
Sample records for dna nucleotide excision

  1. DNA damage and nucleotide excision repair capacity in healthy individuals

    Slyšková, Jana; Naccarati, Alessio; Poláková, Veronika; Pardini, Barbara; Vodičková, Ludmila; Štětina, R.; Schmuczerová, Jana; Šmerhovský, Z.; Lipská, L.; Vodička, Pavel


    Roč. 25, č. 7 (2011), s. 511-517 ISSN 0893-6692 R&D Projects: GA ČR GAP304/10/1286; GA MŠk 7F10069 Grant - others:GA MŠk(CZ) GAUK124710 Institutional research plan: CEZ:AV0Z50390512 Keywords : BPDE-induced DNA repair capacity * comet assay * interindividual variability Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.709, year: 2011

  2. Nucleotide excision repair in yeast

    Eijk, Patrick van


    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  3. DNA-binding polarity of human replication protein A positions nucleases in nucleotide excision repair.

    de Laat, W L; Appeldoorn, E; Sugasawa, K; Weterings, E; Jaspers, N G; Hoeijmakers, J H


    The human single-stranded DNA-binding replication A protein (RPA) is involved in various DNA-processing events. By comparing the affinity of hRPA for artificial DNA hairpin structures with 3'- or 5'-protruding single-stranded arms, we found that hRPA binds ssDNA with a defined polarity; a strong ssDNA interaction domain of hRPA is positioned at the 5' side of its binding region, a weak ssDNA-binding domain resides at the 3' side. Polarity appears crucial for positioning of the excision repair nucleases XPG and ERCC1-XPF on the DNA. With the 3'-oriented side of hRPA facing a duplex ssDNA junction, hRPA interacts with and stimulates ERCC1-XPF, whereas the 5'-oriented side of hRPA at a DNA junction allows stable binding of XPG to hRPA. Our data pinpoint hRPA to the undamaged strand during nucleotide excision repair. Polarity of hRPA on ssDNA is likely to contribute to the directionality of other hRPA-dependent processes as well.

  4. Nucleotide excision repair pathway assessment in DNA exposed to low-intensity red and infrared lasers

    Fonseca, A.S.; Campos, V.M.A.; Magalhaes, L.A.G.; Paoli, F.


    Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T 4 endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T 4 endonuclease V. Low-intensity lasers: i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells, ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, and iv) did not alter the electrophoretic profile of plasmids incubated with T 4 endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers. (author)

  5. Nucleotide excision repair pathway assessment in DNA exposed to low-intensity red and infrared lasers

    Fonseca, A.S.; Campos, V.M.A.; Magalhaes, L.A.G., E-mail: [Instituto de Biologia Roberto Alcantara Gomes, Rio de Janeiro, RJ (Brazil). Departamento de Biofisica e Biometria. Lab. de Ciencias Radiologicas; Paoli, F. [Universidade Federal de Juiz de Fora (UFJF), Juiz de Fora, MG (Brazil). Instituto de Ciencias Biologicas. Departamento de Morfologia


    Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T{sub 4} endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T{sub 4} endonuclease V. Low-intensity lasers: i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells, ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, and iv) did not alter the electrophoretic profile of plasmids incubated with T{sub 4} endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers. (author)

  6. True Lies: The Double Life of the Nucleotide Excision Repair Factors in Transcription and DNA Repair

    Nicolas Le May


    Full Text Available Nucleotide excision repair (NER is a major DNA repair pathway in eukaryotic cells. NER removes structurally diverse lesions such as pyrimidine dimers, arising upon UV irradiation or bulky chemical adducts, arising upon exposure to carcinogens and some chemotherapeutic drugs. NER defects lead to three genetic disorders that result in predisposition to cancers, accelerated aging, neurological and developmental defects. During NER, more than 30 polypeptides cooperate to recognize, incise, and excise a damaged oligonucleotide from the genomic DNA. Recent papers reveal an additional and unexpected role for the NER factors. In the absence of a genotoxic attack, the promoters of RNA polymerases I- and II-dependent genes recruit XPA, XPC, XPG, and XPF to initiate gene expression. A model that includes the growth arrest and DNA damage 45α protein (Gadd45α and the NER factors, in order to maintain the promoter of active genes under a hypomethylated state, has been proposed but remains controversial. This paper focuses on the double life of the NER factors in DNA repair and transcription and describes the possible roles of these factors in the RNA synthesis process.

  7. Nucleotide Excision DNA Repair is Associated with Age-Related Vascular Dysfunction

    Durik, Matej; Kavousi, Maryam; van der Pluijm, Ingrid; Isaacs, Aaron; Cheng, Caroline; Verdonk, Koen; Loot, Annemarieke E.; Oeseburg, Hisko; Musterd-Bhaggoe, Usha; Leijten, Frank; van Veghel, Richard; de Vries, Rene; Rudez, Goran; Brandt, Renata; Ridwan, Yanto R.; van Deel, Elza D.; de Boer, Martine; Tempel, Dennie; Fleming, Ingrid; Mitchell, Gary F.; Verwoert, Germaine C.; Tarasov, Kirill V.; Uitterlinden, Andre G.; Hofman, Albert; Duckers, Henricus J.; van Duijn, Cornelia M.; Oostra, Ben A.; Witteman, Jacqueline C.M.; Duncker, Dirk J.; Danser, A.H. Jan; Hoeijmakers, Jan H.; Roks, Anton J.M.


    Background Vascular dysfunction in atherosclerosis and diabetes, as observed in the aging population of developed societies, is associated with vascular DNA damage and cell senescence. We hypothesized that cumulative DNA damage during aging contributes to vascular dysfunction. Methods and Results In mice with genomic instability due to the defective nucleotide excision repair genes ERCC1 and XPD (Ercc1d/− and XpdTTD mice), we explored age-dependent vascular function as compared to wild-type mice. Ercc1d/− mice showed increased vascular cell senescence, accelerated development of vasodilator dysfunction, increased vascular stiffness and elevated blood pressure at very young age. The vasodilator dysfunction was due to decreased endothelial eNOS levels as well as impaired smooth muscle cell function, which involved phosphodiesterase (PDE) activity. Similar to Ercc1d/− mice, age-related endothelium-dependent vasodilator dysfunction in XpdTTD animals was increased. To investigate the implications for human vascular disease, we explored associations between single nucleotide polymorphisms (SNPs) of selected nucleotide excision repair genes and arterial stiffness within the AortaGen Consortium, and found a significant association of a SNP (rs2029298) in the putative promoter region of DDB2 gene with carotid-femoral pulse wave velocity. Conclusions Mice with genomic instability recapitulate age-dependent vascular dysfunction as observed in animal models and in humans, but with an accelerated progression, as compared to wild type mice. In addition, we found associations between variations in human DNA repair genes and markers for vascular stiffness which is associated with aging. Our study supports the concept that genomic instability contributes importantly to the development of cardiovascular disease. PMID:22705887

  8. The effect of DNA repair defects on reproductive performance in nucleotide excision repair (NER) mouse models: an epidemiological approach

    Tsai, P.S.; Nielen, M.; Horst, G.T.J. van der; Colenbrander, B.; Heesterbeek, J.A.P.; Fentener van Vlissingen, J.M.


    In this study, we used an epidemiological approach to analyze an animal database of DNA repair deficient mice on reproductive performance in five Nucleotide Excision Repair (NER) mutant mouse models on a C57BL/6 genetic background, namely CSA, CSB, XPA, XPC [models for the human DNA repair disorders

  9. Nucleotide-excision repair of DNA in cell-free extracts of the yeast Saccharomyces cerevisiae

    Wang, Z.; Wu, X.; Friedberg, E.C.


    A wide spectrum of DNA lesions are repaired by the nucleotide-excision repair (NER) pathway in both eukaryotic and prokaryotic cells. We have developed a cell-free system in Saccharomyces cerevisiae that supports NER. NER was monitored by measuring repair synthesis in DNA treated with cisplatin or with UV radiation. Repair synthesis in vitro was defective in extracts of rad1, rad2, and rad10 mutant cells, all of which have mutations in genes whose products are known to be required for NER in vivo. Additionally, repair synthesis was complemented by mixing different mutant extracts, or by adding purified Rad1 or Rad10 protein to rad1 or rad10 mutant extracts, respectively. The latter observation demonstrates that the Rad1 and Rad10 proteins directly participate in the biochemical pathway of NER. NER supported by nuclear extracts requires ATP and Mg 2+ and is stimulated by polyethylene glycol and by small amounts of whole cell extract containing overexpressed Rad2 protein. The nuclear extracts also contain base-excision repair activity that is present at wild-type levels in rad mutant extracts. This cell-free system is expected to facilitate studies on the biochemical pathway of NER in S. cerevisiae

  10. Nucleotide excision repair in the test tube.

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)


    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  11. Physical interaction between components of DNA mismatch repair and nucleotide excision repair

    Bertrand, P.; Tishkoff, D.X.; Filosi, N.; Dasgupta, R.; Kolodner, R.D.


    Nucleotide excision repair (NER) and DNA mismatch repair are required for some common processes although the biochemical basis for this requirement is unknown. Saccharomyces cerevisiae RAD14 was identified in a two-hybrid screen using MSH2 as 'bait,' and pairwise interactions between MSH2 and RAD1, RAD2, RAD3, RAD10, RAD14, and RAD25 subsequently were demonstrated by two-hybrid analysis. MSH2 coimmunoprecipitated specifically with epitope-tagged versions of RAD2, RAD10, RAD14, and RAD25. MSH2 and RAD10 were found to interact in msh3 msh6 and mlh1 pms1 double mutants, suggesting a direct interaction with MSH2. Mutations in MSH2 increased the UV sensitivity of NER-deficient yeast strains, and msh2 mutations were epistatic to the mutator phenotype observed in NER-deficient strains. These data suggest that MSH2 and possibly other components of DNA mismatch repair exist in a complex with NER proteins, providing a biochemical and genetical basis for these proteins to function in common processes

  12. The Role of Altered Nucleotide Excision Repair and UVB-Induced DNA Damage in Melanomagenesis

    Timothy Budden


    Full Text Available UVB radiation is the most mutagenic component of the UV spectrum that reaches the earth’s surface and causes the development of DNA damage in the form of cyclobutane pyrimidine dimers and 6-4 photoproducts. UV radiation usually results in cellular death, but if left unchecked, it can affect DNA integrity, cell and tissue homeostasis and cause mutations in oncogenes and tumour-suppressor genes. These mutations, if unrepaired, can lead to abnormal cell growth, increasing the risk of cancer development. Epidemiological data strongly associates UV exposure as a major factor in melanoma development, but the exact biological mechanisms involved in this process are yet to be fully elucidated. The nucleotide excision repair (NER pathway is responsible for the repair of UV-induced lesions. Patients with the genetic disorder Xeroderma Pigmentosum have a mutation in one of eight NER genes associated with the XP complementation groups XP-A to XP-G and XP variant (XP-V. XP is characterized by diminished repair capacity, as well as a 1000-fold increase in the incidence of skin cancers, including melanoma. This has suggested a significant role for NER in melanoma development as a result of UVB exposure. This review discusses the current research surrounding UVB radiation and NER capacity and how further investigation of NER could elucidate the role of NER in avoiding UV-induced cellular death resulting in melanomagenesis.

  13. Nucleotide Excision Repair and Transcription-coupled DNA Repair Abrogate the Impact of DNA Damage on Transcription*

    Nadkarni, Aditi; Burns, John A.; Gandolfi, Alberto; Chowdhury, Moinuddin A.; Cartularo, Laura; Berens, Christian; Geacintov, Nicholas E.; Scicchitano, David A.


    DNA adducts derived from carcinogenic polycyclic aromatic hydrocarbons like benzo[a]pyrene (B[a]P) and benzo[c]phenanthrene (B[c]Ph) impede replication and transcription, resulting in aberrant cell division and gene expression. Global nucleotide excision repair (NER) and transcription-coupled DNA repair (TCR) are among the DNA repair pathways that evolved to maintain genome integrity by removing DNA damage. The interplay between global NER and TCR in repairing the polycyclic aromatic hydrocarbon-derived DNA adducts (+)-trans-anti-B[a]P-N6-dA, which is subject to NER and blocks transcription in vitro, and (+)-trans-anti-B[c]Ph-N6-dA, which is a poor substrate for NER but also blocks transcription in vitro, was tested. The results show that both adducts inhibit transcription in human cells that lack both NER and TCR. The (+)-trans-anti-B[a]P-N6-dA lesion exhibited no detectable effect on transcription in cells proficient in NER but lacking TCR, indicating that NER can remove the lesion in the absence of TCR, which is consistent with in vitro data. In primary human cells lacking NER, (+)-trans-anti-B[a]P-N6-dA exhibited a deleterious effect on transcription that was less severe than in cells lacking both pathways, suggesting that TCR can repair the adduct but not as effectively as global NER. In contrast, (+)-trans-anti-B[c]Ph-N6-dA dramatically reduces transcript production in cells proficient in global NER but lacking TCR, indicating that TCR is necessary for the removal of this adduct, which is consistent with in vitro data showing that it is a poor substrate for NER. Hence, both global NER and TCR enhance the recovery of gene expression following DNA damage, and TCR plays an important role in removing DNA damage that is refractory to NER. PMID:26559971

  14. Homology modeling, molecular docking and DNA binding studies of nucleotide excision repair UvrC protein from M. tuberculosis.

    Parulekar, Rishikesh S; Barage, Sagar H; Jalkute, Chidambar B; Dhanavade, Maruti J; Fandilolu, Prayagraj M; Sonawane, Kailas D


    Mycobacterium tuberculosis is a Gram positive, acid-fast bacteria belonging to genus Mycobacterium, is the leading causative agent of most cases of tuberculosis. The pathogenicity of the bacteria is enhanced by its developed DNA repair mechanism which consists of machineries such as nucleotide excision repair. Nucleotide excision repair consists of excinuclease protein UvrABC endonuclease, multi-enzymatic complex which carries out repair of damaged DNA in sequential manner. UvrC protein is a part of this complex and thus helps to repair the damaged DNA of M. tuberculosis. Hence, structural bioinformatics study of UvrC protein from M. tuberculosis was carried out using homology modeling and molecular docking techniques. Assessment of the reliability of the homology model was carried out by predicting its secondary structure along with its model validation. The predicted structure was docked with the ATP and the interacting amino acid residues of UvrC protein with the ATP were found to be TRP539, PHE89, GLU536, ILE402 and ARG575. The binding of UvrC protein with the DNA showed two different domains. The residues from domain I of the protein VAL526, THR524 and LEU521 interact with the DNA whereas, amino acids interacting from the domain II of the UvrC protein included ARG597, GLU595, GLY594 and GLY592 residues. This predicted model could be useful to design new inhibitors of UvrC enzyme to prevent pathogenesis of Mycobacterium and so the tuberculosis.

  15. NDR1 modulates the UV-induced DNA-damage checkpoint and nucleotide excision repair

    Park, Jeong-Min; Choi, Ji Ye [Department of Biological Science, Dong-A University, Busan (Korea, Republic of); Yi, Joo Mi [Research Center, Dongnam Institute of Radiological & Medical Sciences, Busan (Korea, Republic of); Chung, Jin Woong; Leem, Sun-Hee; Koh, Sang Seok [Department of Biological Science, Dong-A University, Busan (Korea, Republic of); Kang, Tae-Hong, E-mail: [Department of Biological Science, Dong-A University, Busan (Korea, Republic of)


    Nucleotide excision repair (NER) is the sole mechanism of UV-induced DNA lesion repair in mammals. A single round of NER requires multiple components including seven core NER factors, xeroderma pigmentosum A–G (XPA–XPG), and many auxiliary effector proteins including ATR serine/threonine kinase. The XPA protein helps to verify DNA damage and thus plays a rate-limiting role in NER. Hence, the regulation of XPA is important for the entire NER kinetic. We found that NDR1, a novel XPA-interacting protein, modulates NER by modulating the UV-induced DNA-damage checkpoint. In quiescent cells, NDR1 localized mainly in the cytoplasm. After UV irradiation, NDR1 accumulated in the nucleus. The siRNA knockdown of NDR1 delayed the repair of UV-induced cyclobutane pyrimidine dimers in both normal cells and cancer cells. It did not, however, alter the expression levels or the chromatin association levels of the core NER factors following UV irradiation. Instead, the NDR1-depleted cells displayed reduced activity of ATR for some set of its substrates including CHK1 and p53, suggesting that NDR1 modulates NER indirectly via the ATR pathway. - Highlights: • NDR1 is a novel XPA-interacting protein. • NDR1 accumulates in the nucleus in response to UV irradiation. • NDR1 modulates NER (nucleotide excision repair) by modulating the UV-induced DNA-damage checkpoint response.

  16. Nucleotide Excision Repair and Transcription-coupled DNA Repair Abrogate the Impact of DNA Damage on Transcription.

    Nadkarni, Aditi; Burns, John A; Gandolfi, Alberto; Chowdhury, Moinuddin A; Cartularo, Laura; Berens, Christian; Geacintov, Nicholas E; Scicchitano, David A


    DNA adducts derived from carcinogenic polycyclic aromatic hydrocarbons like benzo[a]pyrene (B[a]P) and benzo[c]phenanthrene (B[c]Ph) impede replication and transcription, resulting in aberrant cell division and gene expression. Global nucleotide excision repair (NER) and transcription-coupled DNA repair (TCR) are among the DNA repair pathways that evolved to maintain genome integrity by removing DNA damage. The interplay between global NER and TCR in repairing the polycyclic aromatic hydrocarbon-derived DNA adducts (+)-trans-anti-B[a]P-N(6)-dA, which is subject to NER and blocks transcription in vitro, and (+)-trans-anti-B[c]Ph-N(6)-dA, which is a poor substrate for NER but also blocks transcription in vitro, was tested. The results show that both adducts inhibit transcription in human cells that lack both NER and TCR. The (+)-trans-anti-B[a]P-N(6)-dA lesion exhibited no detectable effect on transcription in cells proficient in NER but lacking TCR, indicating that NER can remove the lesion in the absence of TCR, which is consistent with in vitro data. In primary human cells lacking NER, (+)-trans-anti-B[a]P-N(6)-dA exhibited a deleterious effect on transcription that was less severe than in cells lacking both pathways, suggesting that TCR can repair the adduct but not as effectively as global NER. In contrast, (+)-trans-anti-B[c]Ph-N(6)-dA dramatically reduces transcript production in cells proficient in global NER but lacking TCR, indicating that TCR is necessary for the removal of this adduct, which is consistent with in vitro data showing that it is a poor substrate for NER. Hence, both global NER and TCR enhance the recovery of gene expression following DNA damage, and TCR plays an important role in removing DNA damage that is refractory to NER. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. RPA and XPA interaction with DNA structures mimicking intermediates of the late stages in nucleotide excision repair.

    Krasikova, Yuliya S; Rechkunova, Nadejda I; Maltseva, Ekaterina A; Lavrik, Olga I


    Replication protein A (RPA) and the xeroderma pigmentosum group A (XPA) protein are indispensable for both pathways of nucleotide excision repair (NER). Here we analyze the interaction of RPA and XPA with DNA containing a flap and different size gaps that imitate intermediates of the late NER stages. Using gel mobility shift assays, we found that RPA affinity for DNA decreased when DNA contained both extended gap and similar sized flap in comparison with gapped-DNA structure. Moreover, crosslinking experiments with the flap-gap DNA revealed that RPA interacts mainly with the ssDNA platform within the long gap and contacts flap in DNA with a short gap. XPA exhibits higher affinity for bubble-DNA structures than to flap-gap-containing DNA. Protein titration analysis showed that formation of the RPA-XPA-DNA ternary complex depends on the protein concentration ratio and these proteins can function as independent players or in tandem. Using fluorescently-labelled RPA, direct interaction of this protein with XPA was detected and characterized quantitatively. The data obtained allow us to suggest that XPA can be involved in the post-incision NER stages via its interaction with RPA.

  18. RPA and XPA interaction with DNA structures mimicking intermediates of the late stages in nucleotide excision repair.

    Yuliya S Krasikova

    Full Text Available Replication protein A (RPA and the xeroderma pigmentosum group A (XPA protein are indispensable for both pathways of nucleotide excision repair (NER. Here we analyze the interaction of RPA and XPA with DNA containing a flap and different size gaps that imitate intermediates of the late NER stages. Using gel mobility shift assays, we found that RPA affinity for DNA decreased when DNA contained both extended gap and similar sized flap in comparison with gapped-DNA structure. Moreover, crosslinking experiments with the flap-gap DNA revealed that RPA interacts mainly with the ssDNA platform within the long gap and contacts flap in DNA with a short gap. XPA exhibits higher affinity for bubble-DNA structures than to flap-gap-containing DNA. Protein titration analysis showed that formation of the RPA-XPA-DNA ternary complex depends on the protein concentration ratio and these proteins can function as independent players or in tandem. Using fluorescently-labelled RPA, direct interaction of this protein with XPA was detected and characterized quantitatively. The data obtained allow us to suggest that XPA can be involved in the post-incision NER stages via its interaction with RPA.

  19. Histone displacement during nucleotide excision repair

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.


    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

  20. Bypass of a 5',8-cyclopurine-2'-deoxynucleoside by DNA polymerase β during DNA replication and base excision repair leads to nucleotide misinsertions and DNA strand breaks.

    Jiang, Zhongliang; Xu, Meng; Lai, Yanhao; Laverde, Eduardo E; Terzidis, Michael A; Masi, Annalisa; Chatgilialoglu, Chryssostomos; Liu, Yuan


    5',8-Cyclopurine-2'-deoxynucleosides including 5',8-cyclo-dA (cdA) and 5',8-cyclo-dG (cdG) are induced by hydroxyl radicals resulting from oxidative stress such as ionizing radiation. 5',8-cyclopurine-2'-deoxynucleoside lesions are repaired by nucleotide excision repair with low efficiency, thereby leading to their accumulation in the human genome and lesion bypass by DNA polymerases during DNA replication and base excision repair (BER). In this study, for the first time, we discovered that DNA polymerase β (pol β) efficiently bypassed a 5'R-cdA, but inefficiently bypassed a 5'S-cdA during DNA replication and BER. We found that cell extracts from pol β wild-type mouse embryonic fibroblasts exhibited significant DNA synthesis activity in bypassing a cdA lesion located in replication and BER intermediates. However, pol β knock-out cell extracts exhibited little DNA synthesis to bypass the lesion. This indicates that pol β plays an important role in bypassing a cdA lesion during DNA replication and BER. Furthermore, we demonstrated that pol β inserted both a correct and incorrect nucleotide to bypass a cdA at a low concentration. Nucleotide misinsertion was significantly stimulated by a high concentration of pol β, indicating a mutagenic effect induced by pol β lesion bypass synthesis of a 5',8-cyclopurine-2'-deoxynucleoside. Moreover, we found that bypass of a 5'S-cdA by pol β generated an intermediate that failed to be extended by pol β, resulting in accumulation of single-strand DNA breaks. Our study provides the first evidence that pol β plays an important role in bypassing a 5',8-cyclo-dA during DNA replication and repair, as well as new insight into mutagenic effects and genome instability resulting from pol β bypassing of a cdA lesion. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Poly(ADP-ribose) polymerase 1 escorts XPC to UV-induced DNA lesions during nucleotide excision repair.

    Robu, Mihaela; Shah, Rashmi G; Purohit, Nupur K; Zhou, Pengbo; Naegeli, Hanspeter; Shah, Girish M


    Xeroderma pigmentosum C (XPC) protein initiates the global genomic subpathway of nucleotide excision repair (GG-NER) for removal of UV-induced direct photolesions from genomic DNA. The XPC has an inherent capacity to identify and stabilize at the DNA lesion sites, and this function is facilitated in the genomic context by UV-damaged DNA-binding protein 2 (DDB2), which is part of a multiprotein UV-DDB ubiquitin ligase complex. The nuclear enzyme poly(ADP-ribose) polymerase 1 (PARP1) has been shown to facilitate the lesion recognition step of GG-NER via its interaction with DDB2 at the lesion site. Here, we show that PARP1 plays an additional DDB2-independent direct role in recruitment and stabilization of XPC at the UV-induced DNA lesions to promote GG-NER. It forms a stable complex with XPC in the nucleoplasm under steady-state conditions before irradiation and rapidly escorts it to the damaged DNA after UV irradiation in a DDB2-independent manner. The catalytic activity of PARP1 is not required for the initial complex formation with XPC in the nucleoplasm but it enhances the recruitment of XPC to the DNA lesion site after irradiation. Using purified proteins, we also show that the PARP1-XPC complex facilitates the handover of XPC to the UV-lesion site in the presence of the UV-DDB ligase complex. Thus, the lesion search function of XPC in the genomic context is controlled by XPC itself, DDB2, and PARP1. Our results reveal a paradigm that the known interaction of many proteins with PARP1 under steady-state conditions could have functional significance for these proteins.

  2. Removal of oxygen free-radical-induced 5′,8-purine cyclodeoxynucleosides from DNA by the nucleotide excision-repair pathway in human cells

    Kuraoka, Isao; Bender, Christina; Romieu, Anthony; Cadet, Jean; Wood, Richard D.; Lindahl, Tomas


    Exposure of cellular DNA to reactive oxygen species generates several classes of base lesions, many of which are removed by the base excision-repair pathway. However, the lesions include purine cyclodeoxynucleoside formation by intramolecular crosslinking between the C-8 position of adenine or guanine and the 5′ position of 2-deoxyribose. This distorting form of DNA damage, in which the purine is attached by two covalent bonds to the sugar-phosphate backbone, occurs as distinct diastereoisomers. It was observed here that both diastereoisomers block primer extension by mammalian and microbial replicative DNA polymerases, using DNA with a site-specific purine cyclodeoxynucleoside residue as template, and consequently appear to be cytotoxic lesions. Plasmid DNA containing either the 5′R or 5′S form of 5′,8-cyclo-2-deoxyadenosine was a substrate for the human nucleotide excision-repair enzyme complex. The R diastereoisomer was more efficiently repaired than the S isomer. No correction of the lesion by direct damage reversal or base excision repair was detected. Dual incision around the lesion depended on the core nucleotide excision-repair protein XPA. In contrast to several other types of oxidative DNA damage, purine cyclodeoxynucleosides are chemically stable and would be expected to accumulate at a slow rate over many years in the DNA of nonregenerating cells from xeroderma pigmentosum patients. High levels of this form of DNA damage might explain the progressive neurodegeneration seen in XPA individuals. PMID:10759556

  3. Silymarin protects epidermal keratinocytes from ultraviolet radiation-induced apoptosis and DNA damage by nucleotide excision repair mechanism.

    Santosh K Katiyar

    Full Text Available Solar ultraviolet (UV radiation is a well recognized epidemiologic risk factor for melanoma and non-melanoma skin cancers. This observation has been linked to the accumulation of UVB radiation-induced DNA lesions in cells, and that finally lead to the development of skin cancers. Earlier, we have shown that topical treatment of skin with silymarin, a plant flavanoid from milk thistle (Silybum marianum, inhibits photocarcinogenesis in mice; however it is less understood whether chemopreventive effect of silymarin is mediated through the repair of DNA lesions in skin cells and that protect the cells from apoptosis. Here, we show that treatment of normal human epidermal keratinocytes (NHEK with silymarin blocks UVB-induced apoptosis of NHEK in vitro. Silymarin reduces the amount of UVB radiation-induced DNA damage as demonstrated by reduced amounts of cyclobutane pyrimidine dimers (CPDs and as measured by comet assay, and that ultimately may lead to reduced apoptosis of NHEK. The reduction of UV radiation-induced DNA damage by silymarin appears to be related with induction of nucleotide excision repair (NER genes, because UV radiation-induced apoptosis was not blocked by silymarin in NER-deficient human fibroblasts. Cytostaining and dot-blot analysis revealed that silymarin repaired UV-induced CPDs in NER-proficient fibroblasts from a healthy individual but did not repair UV-induced CPD-positive cells in NER-deficient fibroblasts from patients suffering from xeroderma pigmentosum complementation-A disease. Similarly, immunohistochemical analysis revealed that silymarin did not reduce the number of UVB-induced sunburn/apoptotic cells in the skin of NER-deficient mice, but reduced the number of sunburn cells in their wild-type counterparts. Together, these results suggest that silymarin exert the capacity to reduce UV radiation-induced DNA damage and, thus, prevent the harmful effects of UV radiation on the genomic stability of epidermal cells.

  4. Mobile phone specific electromagnetic fields induce transient DNA damage and nucleotide excision repair in serum-deprived human glioblastoma cells.

    Al-Serori, Halh; Ferk, Franziska; Kundi, Michael; Bileck, Andrea; Gerner, Christopher; Mišík, Miroslav; Nersesyan, Armen; Waldherr, Monika; Murbach, Manuel; Lah, Tamara T; Herold-Mende, Christel; Collins, Andrew R; Knasmüller, Siegfried


    Some epidemiological studies indicate that the use of mobile phones causes cancer in humans (in particular glioblastomas). It is known that DNA damage plays a key role in malignant transformation; therefore, we investigated the impact of the UMTS signal which is widely used in mobile telecommunications, on DNA stability in ten different human cell lines (six brain derived cell lines, lymphocytes, fibroblasts, liver and buccal tissue derived cells) under conditions relevant for users (SAR 0.25 to 1.00 W/kg). We found no evidence for induction of damage in single cell gel electrophoresis assays when the cells were cultivated with serum. However, clear positive effects were seen in a p53 proficient glioblastoma line (U87) when the cells were grown under serum free conditions, while no effects were found in p53 deficient glioblastoma cells (U251). Further experiments showed that the damage disappears rapidly in U87 and that exposure induced nucleotide excision repair (NER) and does not cause double strand breaks (DSBs). The observation of NER induction is supported by results of a proteome analysis indicating that several proteins involved in NER are up-regulated after exposure to UMTS; additionally, we found limited evidence for the activation of the γ-interferon pathway. The present findings show that the signal causes transient genetic instability in glioma derived cells and activates cellular defense systems.

  5. UvrD Participation in Nucleotide Excision Repair Is Required for the Recovery of DNA Synthesis following UV-Induced Damage in Escherichia coli

    Kelley N. Newton


    Full Text Available UvrD is a DNA helicase that participates in nucleotide excision repair and several replication-associated processes, including methyl-directed mismatch repair and recombination. UvrD is capable of displacing oligonucleotides from synthetic forked DNA structures in vitro and is essential for viability in the absence of Rep, a helicase associated with processing replication forks. These observations have led others to propose that UvrD may promote fork regression and facilitate resetting of the replication fork following arrest. However, the molecular activity of UvrD at replication forks in vivo has not been directly examined. In this study, we characterized the role UvrD has in processing and restoring replication forks following arrest by UV-induced DNA damage. We show that UvrD is required for DNA synthesis to recover. However, in the absence of UvrD, the displacement and partial degradation of the nascent DNA at the arrested fork occur normally. In addition, damage-induced replication intermediates persist and accumulate in uvrD mutants in a manner that is similar to that observed in other nucleotide excision repair mutants. These data indicate that, following arrest by DNA damage, UvrD is not required to catalyze fork regression in vivo and suggest that the failure of uvrD mutants to restore DNA synthesis following UV-induced arrest relates to its role in nucleotide excision repair.

  6. Important role of the nucleotide excision repair pathway in Mycobacterium smegmatis in conferring protection against commonly encountered DNA-damaging agents.

    Kurthkoti, Krishna; Kumar, Pradeep; Jain, Ruchi; Varshney, Umesh


    Mycobacteria are an important group of human pathogens. Although the DNA repair mechanisms in mycobacteria are not well understood, these are vital for the pathogen's persistence in the host macrophages. In this study, we generated a null mutation in the uvrB gene of Mycobacterium smegmatis to allow us to compare the significance of the nucleotide excision repair (NER) pathway with two important base excision repair pathways, initiated by uracil DNA glycosylase (Ung) and formamidopyrimidine DNA glycosylase (Fpg or MutM), in an isogenic strain background. The strain deficient in NER was the most sensitive to commonly encountered DNA-damaging agents such as UV, low pH, reactive oxygen species, hypoxia, and was also sensitive to acidified nitrite. Taken together with previous observations on NER-deficient M. tuberculosis, these results suggest that NER is an important DNA repair pathway in mycobacteria.

  7. Effect of point substitutions within the minimal DNA-binding domain of xeroderma pigmentosum group A protein on interaction with DNA intermediates of nucleotide excision repair.

    Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I


    Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.

  8. Regulation of nucleotide excision repair through ubiquitination

    Jia Li; Audesh Bhat; Wei Xiao


    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  9. Nucleotide excision repair II: From yeast to mammals

    J.H.J. Hoeijmakers (Jan)


    textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this

  10. Analysis of DNA binding by human factor xeroderma pigmentosum complementation group A (XPA) provides insight into its interactions with nucleotide excision repair substrates.

    Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J


    Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Measurement of DNA base and nucleotide excision repair activities in mammalian cells and tissues using the comet assay - A methodological overview

    Azqueta, A.; Langie, S. A. S.; Slyšková, Jana; Collins, A. R.


    Roč. 12, č. 11 (2013), s. 1007-1010 ISSN 1568-7864 Grant - others:EU FP6(XE) LSHB-CT-2006-037575 Institutional support: RVO:68378041 Keywords : comet assay * base excision repair * nucleotide excision repair Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.362, year: 2013

  12. Protective Effect of Diphlorethohydroxycarmalol against Ultraviolet B Radiation-Induced DNA Damage by Inducing the Nucleotide Excision Repair System in HaCaT Human Keratinocytes

    Mei Jing Piao


    Full Text Available We investigated the protective properties of diphlorethohydroxycarmalol (DPHC, a phlorotannin, against ultraviolet B (UVB radiation-induced cyclobutane pyrimidine dimers (CPDs in HaCaT human keratinocytes. The nucleotide excision repair (NER system is the pathway by which cells identify and repair bulky, helix-distorting DNA lesions such as ultraviolet (UV radiation-induced CPDs and 6-4 photoproducts. CPDs levels were elevated in UVB-exposed cells; however, this increase was reduced by DPHC. Expression levels of xeroderma pigmentosum complementation group C (XPC and excision repair cross-complementing 1 (ERCC1, which are essential components of the NER pathway, were induced in DPHC-treated cells. Expression of XPC and ERCC1 were reduced following UVB exposure, whereas DPHC treatment partially restored the levels of both proteins. DPHC also increased expression of transcription factor specificity protein 1 (SP1 and sirtuin 1, an up-regulator of XPC, in UVB-exposed cells. DPHC restored binding of the SP1 to the XPC promoter, which is reduced in UVB-exposed cells. These results indicate that DPHC can protect cells against UVB-induced DNA damage by inducing the NER system.

  13. Nucleotide excision repair in differentiated cells

    Wees, Caroline van der [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Jansen, Jacob [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Laarse, Arnoud van der [Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert van [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands)]. E-mail:


    Nucleotide excision repair (NER) is the principal pathway for the removal of a wide range of DNA helix-distorting lesions and operates via two NER subpathways, i.e. global genome repair (GGR) and transcription-coupled repair (TCR). Although detailed information is available on expression and efficiency of NER in established mammalian cell lines, little is known about the expression of NER pathways in (terminally) differentiated cells. The majority of studies in differentiated cells have focused on repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4-photoproducts (6-4PP) because of the high frequency of photolesions at low level of toxicity and availability of sensitive technologies to determine photolesions in defined regions of the genome. The picture that emerges from these studies is blurred and rather complex. Fibroblasts and terminally differentiated myocytes of the rat heart display equally efficient GGR of 6-4PP but poor repair of CPD due to the absence of p48 expression. This repair phenotype is clearly different from human terminal differentiated neurons. Furthermore, both cell types were found to carry out TCR of CPD, thus mimicking the repair phenotype of established rodent cell lines. In contrast, in intact rat spermatogenic cells repair was very inefficient at the genome overall level and in transcriptionally active genes indicating that GGR and TCR are non-functional. Also, non-differentiated mouse embryonic stem (ES) cells exhibit low levels of NER after UV irradiation. However, the mechanisms that lead to low NER activity are clearly different: in differentiated spermatogenic cells differences in chromatin compaction and sequestering of NER proteins may underlie the lack of NER activity in pre-meiotic cells, whereas in non-differentiated ES cells NER is impaired by a strong apoptotic response.

  14. Metabolic modulation of mammalian DNA excision repair

    Schrader, T.J.


    First, ultraviolet light (UVL)- and dimethylsulfate (DMS)-induced excision repair was examined in quiescent and lectin-stimulated bovine lymphocytes. Upon mitogenic stimulation, UVL-induced repair increased by a factor of 2 to 3, and reached this maximum 2 days before the onset of DNA replication. However, DMS-induced repair increased sevenfold in parallel with DNA replication. Repair patch sizes were smaller for DMS-induced damage reflecting patches of 7 nucleotides in quiescent lymphocytes compared to 20 nucleotides induced by UVL. The patch size increased during lymphocyte stimulation until one day prior to the peak of DNA replication when patch sizes of 45 and 35 nucleotides were produced in response to UVL- and DMS-induced damage, respectively. At the peak of DNA replication, the patch sizes were equal for both damaging agents at 34 nucleotides. In the second study, a small amount of repair replication was observed in undamaged quiescent and concanavalin A-stimulated bovine lymphocytes as well as in human T98G glioblastoma cells. Repair incorporation doubled in the presence of hydroxyurea. Thirdly, the enhanced repair replication induced by the poly (ADP-ribose) polymerase inhibitor, 3-aminobenzamide, (3-AB), could not be correlated either with an increased rate of repair in the presence of 3-AB or with the use of hydroxyurea in the repair protocol. Finally, treatment of unstimulated lymphocytes with hyperthermia was accompanied by decreased repair replication while the repair patches remained constant at 20 nucleotides.

  15. Repair of DNA-polypeptide crosslinks by human excision nuclease

    Reardon, Joyce T.; Sancar, Aziz


    DNA-protein crosslinks are relatively common DNA lesions that form during the physiological processing of DNA by replication and recombination proteins, by side reactions of base excision repair enzymes, and by cellular exposure to bifunctional DNA-damaging agents such as platinum compounds. The mechanism by which pathological DNA-protein crosslinks are repaired in humans is not known. In this study, we investigated the mechanism of recognition and repair of protein-DNA and oligopeptide-DNA crosslinks by the human excision nuclease. Under our assay conditions, the human nucleotide excision repair system did not remove a 16-kDa protein crosslinked to DNA at a detectable level. However, 4- and 12-aa-long oligopeptides crosslinked to the DNA backbone were recognized by some of the damage recognition factors of the human excision nuclease with moderate selectivity and were excised from DNA at relatively efficient rates. Our data suggest that, if coupled with proteolytic degradation of the crosslinked protein, the human excision nuclease may be the major enzyme system for eliminating protein-DNA crosslinks from the genome. damage recognition | nucleotide excision repair

  16. Both base excision repair and nucleotide excision repair in humans are influenced by nutritional factors.

    Brevik, Asgeir; Karlsen, Anette; Azqueta, Amaya; Tirado, Anna Estaban; Blomhoff, Rune; Collins, Andrew


    Lack of reliable assays for DNA repair has largely prevented measurements of DNA repair from being included in human biomonitoring studies. Using newly developed modifications of the comet assay we tested whether a fruit- and antioxidant-rich plant-based intervention could affect base excision repair (BER) and nucleotide excision repair (NER) in a group of 102 male volunteers. BER and NER repair capacities were measured in lymphocytes before and after a dietary intervention lasting 8 weeks. The study had one control group, one group consuming three kiwifruits per day and one group consuming a variety of antioxidant-rich fruits and plant products in addition to their normal diet. DNA strand breaks were reduced following consumption of both kiwifruits (13%, p = 0.05) and antioxidant-rich plant products (20%, p = 0.02). Increased BER (55%, p = 0.01) and reduced NER (-39%, p plant products. Reduced NER was also observed in the kiwifruit group (-38%, p = 0.05), but BER was not affected in this group. Here we have demonstrated that DNA repair is affected by diet and that modified versions of the comet assay can be used to assess activity of different DNA repair pathways in human biomonitoring studies. Copyright © 2010 John Wiley & Sons, Ltd.

  17. In vitro Repair of Oxidative DNA Damage by Human Nucleotide Excision Repair System: Possible Explanation for Neurodegeneration in Xeroderma Pigmentosum Patients

    Reardon, Joyce T.; Bessho, Tadayoshi; Kung, Hsiang Chuan; Bolton, Philip H.; Sancar, Aziz


    Xeroderma pigmentosum (XP) patients fail to remove pyrimidine dimers caused by sunlight and, as a consequence, develop multiple cancers in areas exposed to light. The second most common sign, present in 20-30% of XP patients, is a set of neurological abnormalities caused by neuronal death in the central and peripheral nervous systems. Neural tissue is shielded from sunlight-induced DNA damage, so the cause of neurodegeneration in XP patients remains unexplained. In this study, we show that two major oxidative DNA lesions, 8-oxoguanine and thymine glycol, are excised from DNA in vitro by the same enzyme system responsible for removing pyrimidine dimers and other bulky DNA adducts. Our results suggest that XP neurological disease may be caused by defective repair of lesions that are produced in nerve cells by reactive oxygen species generated as by-products of an active oxidative metabolism.

  18. The Fanconi anaemia components UBE2T and FANCM are functionally linked to nucleotide excision repair.

    Ian R Kelsall

    Full Text Available The many proteins that function in the Fanconi anaemia (FA monoubiquitylation pathway initiate replicative DNA crosslink repair. However, it is not clear whether individual FA genes participate in DNA repair pathways other than homologous recombination and translesion bypass. Here we show that avian DT40 cell knockouts of two integral FA genes--UBE2T and FANCM are unexpectedly sensitive to UV-induced DNA damage. Comprehensive genetic dissection experiments indicate that both of these FA genes collaborate to promote nucleotide excision repair rather than translesion bypass to protect cells form UV genotoxicity. Furthermore, UBE2T deficiency impacts on the efficient removal of the UV-induced photolesion cyclobutane pyrimidine dimer. Therefore, this work reveals that the FA pathway shares two components with nucleotide excision repair, intimating not only crosstalk between the two major repair pathways, but also potentially identifying a UBE2T-mediated ubiquitin-signalling response pathway that contributes to nucleotide excision repair.

  19. Implication of Posttranslational Histone Modifications in Nucleotide Excision Repair

    Shisheng Li


    Full Text Available Histones are highly alkaline proteins that package and order the DNA into chromatin in eukaryotic cells. Nucleotide excision repair (NER is a conserved multistep reaction that removes a wide range of generally bulky and/or helix-distorting DNA lesions. Although the core biochemical mechanism of NER is relatively well known, how cells detect and repair lesions in diverse chromatin environments is still under intensive research. As with all DNA-related processes, the NER machinery must deal with the presence of organized chromatin and the physical obstacles it presents. A huge catalogue of posttranslational histone modifications has been documented. Although a comprehensive understanding of most of these modifications is still lacking, they are believed to be important regulatory elements for many biological processes, including DNA replication and repair, transcription and cell cycle control. Some of these modifications, including acetylation, methylation, phosphorylation and ubiquitination on the four core histones (H2A, H2B, H3 and H4 or the histone H2A variant H2AX, have been found to be implicated in different stages of the NER process. This review will summarize our recent understanding in this area.

  20. KIN17, XPC, DNA-PKCS and XRCC4 proteins in the cellular response to DNA damages. Relations between nucleotide excision repair and non-homologous end joining in a human syn-genic model

    Despras, Emmanuelle


    The response to genotoxic stress involves many cellular factors in a complex network of mechanisms that aim to preserve the genetic integrity of the organism. These mechanisms enclose the detection and repair of DNA lesions, the regulation of transcription and replication and, eventually, the setting of cell death. Among the nuclear proteins involved in this response, kin17 proteins are zinc-finger proteins conserved through evolution and activated by ultraviolet (UV) or ionizing radiations (IR). We showed that human kin17 protein (HSAkin17) is found in the cell under a soluble form and a form tightly anchored to nuclear structures. A fraction of HSAkin17 protein is directly associated with chromatin. HSAkin17 protein is recruited to nuclear structures 24 hours after treatment with various agents inducing DNA double-strand breaks (DSB) and/or replication forks blockage. Moreover, the reduction of total HSAkin17 protein level sensitizes RKO cells to IR. We also present evidence for the involvement of HSAkin17 protein in DNA replication. This hypothesis was further confirmed by the biochemical demonstration of its belonging to the replication complex. HSAkin17 protein could link DNA replication and DNA repair, a defect in the HSAkin17 pathway leading to an increased radiosensitivity. In a second part, we studied the interactions between two DNA repair mechanisms: nucleotide excision repair (NER) and non-homologous end joining (NHEJ). NER repairs a wide variety of lesions inducing a distortion of the DNA double helix including UV-induced pyrimidine dimers. NHEJ allows the repair of DSB by direct joining of DNA ends. We used a syn-genic model for DNA repair defects based on RNA interference developed in the laboratory. Epstein-Barr virus-derived vectors (pEBV) allow long-term expression of siRNA and specific extinction of the targeted gene. The reduction of the expression of genes involved in NER (XPA and XPC) or NHEJ (DNA-PKcs and XRCC4) leads to the expected

  1. Nuclear translocation contributes to regulation of DNA excision repair activities

    Knudsen, Nina Østergaard; Andersen, Sofie Dabros; Lützen, Anne


    for regulation of nuclear import that is necessary for proper localization of the repair proteins. This review summarizes the current knowledge on nuclear import mechanisms of DNA excision repair proteins and provides a model that categorizes the import by different mechanisms, including classical nuclear import......DNA mutations are circumvented by dedicated specialized excision repair systems, such as the base excision repair (BER), nucleotide excision repair (NER), and mismatch repair (MMR) pathways. Although the individual repair pathways have distinct roles in suppressing changes in the nuclear DNA......, it is evident that proteins from the different DNA repair pathways interact [Y. Wang, D. Cortez, P. Yazdi, N. Neff, S.J. Elledge, J. Qin, BASC, a super complex of BRCA1-associated proteins involved in the recognition and repair of aberrant DNA structures, Genes Dev. 14 (2000) 927-939; M. Christmann, M...

  2. Effects of nucleotide pool imbalances on the excision repair of ultraviolet-induced damage in the DNA of human diploid fibroblasts

    Snyder, R.D.


    In an attempt to better understand the mechanism of repair inhibition by DNA polymerase inhibitors, and the nature of hydroxyurea enhancement, experiments were initiated in which the effects of a series of ribonucleotide reductase inhibitors on dNTP pools and on the DNA repair process were determined in both quiescent cultures and log-phase cultures of human fibroblasts. It was determined that hydroxyurea, deoxyadenosine, pyridine-2-carboxaldehyde thiosemicarbazone (TSC), pyrozoloimidazole (IMPY), 3,5-diamino-1,2,4-triazole (guanazole), 3,4,5-trihydroxy benzohydroxamic acid (THBA) and 3,4-dihydroxy benzohydroxamic acid (DHBA) are all effective inhibitors of the DNA repair process in confluent cells but not in log-phase cells. Moreover, the effects of these inhibitors can be reversed by the addition of certain combinations of deoxynucleosides. These reversal studies and the direct analysis of dNTP pool modulation by these compounds in log phase and confluent cultures support the notion that specific pool depletions rather than general imbalance of pools gives rise to the inhibition of the DNA excision repair process

  3. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Simon Reed


    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  4. Base Sequence Context Effects on Nucleotide Excision Repair

    Yuqin Cai


    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  5. Nucleotide Excision Repair Lesion-Recognition Protein Rad4 Captures a Pre-Flipped Partner Base in a Benzo[a]pyrene-Derived DNA Lesion: How Structure Impacts the Binding Pathway.

    Mu, Hong; Geacintov, Nicholas E; Min, Jung-Hyun; Zhang, Yingkai; Broyde, Suse


    The xeroderma pigmentosum C protein complex (XPC) recognizes a variety of environmentally induced DNA lesions and is the key in initiating their repair by the nucleotide excision repair (NER) pathway. When bound to a lesion, XPC flips two nucleotide pairs that include the lesion out of the DNA duplex, yielding a productively bound complex that can lead to successful lesion excision. Interestingly, the efficiencies of NER vary greatly among different lesions, influencing their toxicity and mutagenicity in cells. Though differences in XPC binding may influence NER efficiency, it is not understood whether XPC utilizes different mechanisms to achieve productive binding with different lesions. Here, we investigated the well-repaired 10R-(+)-cis-anti-benzo[a]pyrene-N 2 -dG (cis-B[a]P-dG) DNA adduct in a duplex containing normal partner C opposite the lesion. This adduct is derived from the environmental pro-carcinogen benzo[a]pyrene and is likely to be encountered by NER in the cell. We have extensively investigated its binding to the yeast XPC orthologue, Rad4, using umbrella sampling with restrained molecular dynamics simulations and free energy calculations. The NMR solution structure of this lesion in duplex DNA has shown that the dC complementary to the adducted dG is flipped out of the DNA duplex in the absence of XPC. However, it is not known whether the "pre-flipped" base would play a role in its recognition by XPC. Our results show that Rad4 first captures the displaced dC, which is followed by a tightly coupled lesion-extruding pathway for productive binding. This binding path differs significantly from the one deduced for the small cis-syn cyclobutane pyrimidine dimer lesion opposite mismatched thymines [ Mu , H. , ( 2015 ) Biochemistry , 54 ( 34 ), 5263 - 7 ]. The possibility of multiple paths that lead to productive binding to XPC is consistent with the versatile lesion recognition by XPC that is required for successful NER.

  6. Polymerization by DNA polymerase eta is blocked by cis-diamminedichloroplatinum(II) 1,3-d(GpTpG) cross-link: implications for cytotoxic effects in nucleotide excision repair-negative tumor cells.

    Chijiwa, Shotaro; Masutani, Chikahide; Hanaoka, Fumio; Iwai, Shigenori; Kuraoka, Isao


    cis-Diamminedichloroplatinum(II) (cisplatin) forms DNA adducts that interfere with replication and transcription. The most common adducts formed in vivo are 1,2-intrastrand d(GpG) cross-links (Pt-GG) and d(ApG) cross-links (Pt-AG), with minor amounts of 1,3-d(GpNpG) cross-links (Pt-GNG), interstrand cross-links and monoadducts. Although the relative contribution of these different adducts to toxicity is not known, literature implicates that Pt-GG and Pt-AG adducts block replication. Thus, nucleotide excision repair (NER), by which platinum adducts are excised, and translesion DNA synthesis (TLS), which permits adduct bypass, are thought to be associated with cisplatin resistance. Recent studies have reported that the clinical benefit from platinum-based chemotherapy is high if tumor cells express low levels of NER factors. To investigate the role of platinum-DNA adducts in mediating tumor cell survival by TLS, we examined whether 1,3-intrastrand d(GpTpG) platinum cross-links (Pt-GTG), which probably exist in NER-negative tumor cells but not in NER-positive tumor cells, are bypassed by the translesion DNA polymerase eta (pol eta), which is known to bypass Pt-GG. We show that pol eta can incorporate the correct deoxycytidine triphosphate opposite the first 3'-cross-linked G of Pt-GTG but cannot insert any nucleotides opposite the second intact T or the third 5'-cross-linked G of the adducts, thereby suggesting that TLS does not facilitate replication past Pt-GTG adducts. Thus, our findings implicate Pt-GNG adducts as mediating the cytotoxicity of platinum-DNA adducts in NER-negative tumors in vivo.

  7. SUMO and ubiquitin-dependent XPC exchange drives nucleotide excision repair

    Van Cuijk, Loes; Van Belle, Gijsbert J.; Turkyilmaz, Yasemin


    XPC recognizes UV-induced DNA lesions and initiates their removal by nucleotide excision repair (NER). Damage recognition in NER is tightly controlled by ubiquitin and SUMO modifications. Recent studies have shown that the SUMO-targeted ubiquitin ligase RNF111 promotes K63-linked ubiquitylation o...

  8. Differential pathway control in nucleotide excision repair

    G.J.C. van Belle (Gijsbert)


    markdownabstractAbstract The stability and integrity of the genome is crucial for all cellular life on earth. This integrity is continuously challenged by internal and external genotoxic agents. These agents cause DNA damages which interfere with important cellular processes like replication of

  9. Implication of SUMO E3 ligases in nucleotide excision repair.

    Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji


    Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.

  10. A history of the DNA repair and mutagenesis field: The discovery of base excision repair.

    Friedberg, Errol C


    This article reviews the early history of the discovery of an DNA repair pathway designated as base excision repair (BER), since in contrast to the enzyme-catalyzed removal of damaged bases from DNA as nucleotides [called nucleotide excision repair (NER)], BER involves the removal of damaged or inappropriate bases, such as the presence of uracil instead of thymine, from DNA as free bases. Copyright © 2015. Published by Elsevier B.V.

  11. Global-genome Nucleotide Excision Repair Controlled by Ubiquitin/Sumo Modifiers

    Peter eRuethemann


    Full Text Available Global-genome nucleotide excision repair (GG-NER prevents genome instability by excising a wide range of structurally unrelated DNA base adducts and crosslinks induced by chemical carcinogens, ultraviolet (UV radiation or intracellular metabolic by-products. As a versatile damage sensor, xeroderma pigmentosum group C (XPC protein initiates this generic defense reaction by locating the damage and recruiting the subunits of a large lesion demarcation complex that, in turn, triggers the excision of aberrant DNA by endonucleases. In the very special case of a DNA repair response to UV radiation, the function of this XPC initiator is tightly controlled by the dual action of cullin-type CRL4DDB2 and sumo-targeted RNF111 ubiquitin ligases. This twofold protein ubiquitination system promotes GG-NER reactions by spatially and temporally regulating the interaction of XPC protein with damaged DNA across the nucleosome landscape of chromatin. In the absence of either CRL4DDB2 or RNF111, the DNA excision repair of UV lesions is inefficient, indicating that these two ubiquitin ligases play a critical role in mitigating the adverse biological effects of UV light in the exposed skin.

  12. Nucleotide excision repair I: from E.coli to yeast.

    J.H.J. Hoeijmakers (Jan)


    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  13. Molecular cloning and characterization of genes required for nucleotide excision repair in yeast

    Friedberg, E.C.


    Nucleotide excision repair in the yeast S. cerevisiae is a complex process which involves a large number of genes. At least five of these genes (RAD1, RAD2, RAD3, RAD4 and RAD10) are absolutely required for this process and mutations in any of these genes result in no detectable excision repair in vivo. In order to understand the function of these genes in DNA repair, the authors isolated a number of them by screening a yeast genomic library for recombinant plasmids which complement the phentoype of sensitivity to ultraviolet (UV) radiation imparted to mutant strains. A plasmid containing the RAD4 gene was isolated by an alternative strategy which will be discussed. The cloned genes have been extensively characterized. It has been determined that the RAD3 gene is essential for the viability of haploid yeast cells in the absence of DNA damage. The RAD2 gene is inducible by treatment of cells with a variety of DNA-damaging agents, including UV radiation and ionizing radiation. The RAD10 gene shares considerable amino acid sequence homology with a cloned gene involved in nucleotide excision repair in human cells. Yeast is a particularly versatile organism for studying gene function by molecular and genetic approaches and emphasis is placed on many of the techniques used in the present studies

  14. E2F1 and p53 Transcription Factors as Accessory Factors for Nucleotide Excision Repair

    David G. Johnson


    Full Text Available Many of the biochemical details of nucleotide excision repair (NER have been established using purified proteins and DNA substrates. In cells however, DNA is tightly packaged around histones and other chromatin-associated proteins, which can be an obstacle to efficient repair. Several cooperating mechanisms enhance the efficiency of NER by altering chromatin structure. Interestingly, many of the players involved in modifying chromatin at sites of DNA damage were originally identified as regulators of transcription. These include ATP-dependent chromatin remodelers, histone modifying enzymes and several transcription factors. The p53 and E2F1 transcription factors are well known for their abilities to regulate gene expression in response to DNA damage. This review will highlight the underappreciated, transcription-independent functions of p53 and E2F1 in modifying chromatin structure in response to DNA damage to promote global NER.

  15. Nucleotide excision repair- and p53-deficient mouse models in cancer research

    Hoogervorst, Esther M. [Laboratory of Toxicology, Pathology and Genetics, National Institute of Public Health and the Environment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Utrecht University, Department of Pathobiology, Utrecht (Netherlands); Steeg, Harry van [Laboratory of Toxicology, Pathology and Genetics, National Institute of Public Health and the Environment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Vries, Annemieke de [Laboratory of Toxicology, Pathology and Genetics, National Institute of Public Health and the Environment, P.O. Box 1, 3720 BA Bilthoven (Netherlands)]. E-mail:


    Cancer is caused by the loss of controlled cell growth due to mutational (in)activation of critical genes known to be involved in cell cycle regulation. Three main mechanisms are known to be involved in the prevention of cells from becoming cancerous; DNA repair and cell cycle control, important to remove DNA damage before it will be fixed into mutations and apoptosis, resulting in the elimination of cells containing severe DNA damage. Several human syndromes are known to have (partially) deficiencies in these pathways, and are therefore highly cancer prone. Examples are xeroderma pigmentosum (XP) caused by an inborn defect in the nucleotide excision repair (NER) pathway and the Li-Fraumeni syndrome, which is the result of a germ line mutation in the p53 gene. XP patients develop skin cancer on sun exposed areas at a relatively early age, whereas Li-Fraumeni patients spontaneously develop a wide variety of early onset tumors, including sarcomas, leukemia's and mammary gland carcinomas. Several mouse models have been generated to mimic these human syndromes, providing us information about the role of these particular gene defects in the tumorigenesis process. In this review, spontaneous phenotypes of mice deficient for nucleotide excision repair and/or the p53 gene will be described, together with their responses upon exposure to either chemical carcinogens or radiation. Furthermore, possible applications of these and newly generated mouse models for cancer will be given.

  16. Processing closely spaced lesions during Nucleotide Excision Repair triggers mutagenesis in E. coli

    Isogawa, Asako; Fujii, Shingo


    It is generally assumed that most point mutations are fixed when damage containing template DNA undergoes replication, either right at the fork or behind the fork during gap filling. Here we provide genetic evidence for a pathway, dependent on Nucleotide Excision Repair, that induces mutations when processing closely spaced lesions. This pathway, referred to as Nucleotide Excision Repair-induced Mutagenesis (NERiM), exhibits several characteristics distinct from mutations that occur within the course of replication: i) following UV irradiation, NER-induced mutations are fixed much more rapidly (t ½ ≈ 30 min) than replication dependent mutations (t ½ ≈ 80–100 min) ii) NERiM specifically requires DNA Pol IV in addition to Pol V iii) NERiM exhibits a two-hit dose-response curve that suggests processing of closely spaced lesions. A mathematical model let us define the geometry (infer the structure) of the toxic intermediate as being formed when NER incises a lesion that resides in close proximity of another lesion in the complementary strand. This critical NER intermediate requires Pol IV / Pol II for repair, it is either lethal if left unrepaired or mutation-prone when repaired. Finally, NERiM is found to operate in stationary phase cells providing an intriguing possibility for ongoing evolution in the absence of replication. PMID:28686598

  17. Transcriptional and post-transcriptional regulation of nucleotide excision repair genes in human cells

    Lefkofsky, Hailey B. [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Veloso, Artur [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Bioinformatics Program, Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, MI (United States); Ljungman, Mats, E-mail: [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Environmental Health Sciences, School of Public Health, University of Michigan, Ann Arbor, MI (United States)


    Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death.

  18. Removal of misincorporated ribonucleotides from prokaryotic genomes: an unexpected role for nucleotide excision repair.

    Alexandra Vaisman


    Full Text Available Stringent steric exclusion mechanisms limit the misincorporation of ribonucleotides by high-fidelity DNA polymerases into genomic DNA. In contrast, low-fidelity Escherichia coli DNA polymerase V (pol V has relatively poor sugar discrimination and frequently misincorporates ribonucleotides. Substitution of a steric gate tyrosine residue with alanine (umuC_Y11A reduces sugar selectivity further and allows pol V to readily misincorporate ribonucleotides as easily as deoxynucleotides, whilst leaving its poor base-substitution fidelity essentially unchanged. However, the mutability of cells expressing the steric gate pol V mutant is very low due to efficient repair mechanisms that are triggered by the misincorporated rNMPs. Comparison of the mutation frequency between strains expressing wild-type and mutant pol V therefore allows us to identify pathways specifically directed at ribonucleotide excision repair (RER. We previously demonstrated that rNMPs incorporated by umuC_Y11A are efficiently removed from DNA in a repair pathway initiated by RNase HII. Using the same approach, we show here that mismatch repair and base excision repair play minimal back-up roles in RER in vivo. In contrast, in the absence of functional RNase HII, umuC_Y11A-dependent mutagenesis increases significantly in ΔuvrA, uvrB5 and ΔuvrC strains, suggesting that rNMPs misincorporated into DNA are actively repaired by nucleotide excision repair (NER in vivo. Participation of NER in RER was confirmed by reconstituting ribonucleotide-dependent NER in vitro. We show that UvrABC nuclease-catalyzed incisions are readily made on DNA templates containing one, two, or five rNMPs and that the reactions are stimulated by the presence of mispaired bases. Similar to NER of DNA lesions, excision of rNMPs proceeds through dual incisions made at the 8(th phosphodiester bond 5' and 4(th-5(th phosphodiester bonds 3' of the ribonucleotide. Ribonucleotides misinserted into DNA can therefore be

  19. DNA excision repair in permeable human fibroblasts

    Kaufmann, W.K.; Bodell, W.J.; Cleaver, J.E.


    U.v. irradiation of confluent human fibroblasts activated DNA repair, aspects of which were characterized in the cells after they were permeabilized. Incubation of intact cells for 20 min between irradiation and harvesting was necessary to obtain a maximum rate of reparative DNA synthesis. Cells harvested immediately after irradiation before repair was initiated displayed only a small stimulation of DNA synthesis, indicating that permeable cells have a reduced capacity to recognize pyrimidine dimers and activate repair. The distribution of sizes of DNA strands labeled during 10 min of reparative DNA synthesis resembled that of parental DNA. However, during a 60-min incubation of permeable cells at 37 degrees C, parental DNA and DNA labeled by reparative DNA synthesis were both cleaved to smaller sizes. Cleavage also occurred in unirradiated cells, indicating that endogenous nuclease was active during incubation. Repair patches synthesized in permeable cells displayed increased sensitivity to digestion by micrococcal nuclease. However, the change in sensitivity during a chase with unlabeled DNA precursors was small, suggesting that reassembly of nucleosome structure at sites of repair was impaired. To examine whether this deficiency was due to a preponderance of incomplete or unligated repair patches, 3H-labeled (repaired) DNA was purified, then digested with exonuclease III and nuclease S1 to probe for free 3' ends and single-stranded regions. About 85% of the [3H]DNA synthesized during a 10-min pulse resisted digestion, suggesting that a major fraction of the repair patches that were filled were also ligated. U.v. light-activated DNA synthesis in permeable cells, therefore, appears to represent the continuation of reparative gap-filling at sites of excision repair activated within intact cells. Gap-filling and ligation were comparatively efficient processes in permeable cells

  20. Structural and Functional Studies on Nucleotide Excision Repair From Recognition to Incision.

    Caroline Kisker


    Maintenance of the correct genetic information is crucial for all living organisms because mutations are the primary cause of hereditary diseases, as well as cancer and may also be involved in aging. The importance of genomic integrity is underscored by the fact that 80 to 90% of all human cancers are ultimately due to DNA damage. Among the different repair mechanisms that have evolved to protect the genome, nucleotide excision repair (NER) is a universal pathway found in all organisms. NER removes a wide variety of bulky DNA adducts including the carcinogenic cyclobutane pyrimidine dimers induced by UV radiation, benzo(a)pyrene-guanine adducts caused by smoking and the guanine-cisplatin adducts induced by chemotherapy. The importance of this repair mechanism is reflected by three severe inherited diseases in humans, which are due to defects in NER: xeroderma pigmentosum, Cockayne's syndrome and trichothiodystrophy.

  1. PCAF/GCN5-Mediated Acetylation of RPA1 Promotes Nucleotide Excision Repair

    Meimei Zhao


    Full Text Available The RPA complex can integrate multiple stress signals into diverse responses by activating distinct DNA repair pathways. However, it remains unclear how RPA1 elects to activate a specific repair pathway during different types of DNA damage. Here, we report that PCAF/GCN5-mediated K163 acetylation of RPA1 is crucial for nucleotide excision repair (NER but is dispensable for other DNA repair pathways. Mechanistically, we demonstrate that the acetylation of RPA1 is critical for the steady accumulation of XPA at damaged DNA sites and preferentially activates the NER pathway. DNA-PK phosphorylates and activates PCAF upon UV damage and consequently promotes the acetylation of RPA1. Moreover, the acetylation of RPA1 is tightly regulated by HDAC6 and SIRT1. Together, our results demonstrate that the K163 acetylation of RPA1 plays a key role in the repair of UV-induced DNA damage and reveal how the specific RPA1 modification modulates the choice of distinct DNA repair pathways.

  2. Crystal structure of the FeS cluster-containing nucleotide excision repair helicase XPD.

    Stefanie C Wolski


    Full Text Available DNA damage recognition by the nucleotide excision repair pathway requires an initial step identifying helical distortions in the DNA and a proofreading step verifying the presence of a lesion. This proofreading step is accomplished in eukaryotes by the TFIIH complex. The critical damage recognition component of TFIIH is the XPD protein, a DNA helicase that unwinds DNA and identifies the damage. Here, we describe the crystal structure of an archaeal XPD protein with high sequence identity to the human XPD protein that reveals how the structural helicase framework is combined with additional elements for strand separation and DNA scanning. Two RecA-like helicase domains are complemented by a 4Fe4S cluster domain, which has been implicated in damage recognition, and an alpha-helical domain. The first helicase domain together with the helical and 4Fe4S-cluster-containing domains form a central hole with a diameter sufficient in size to allow passage of a single stranded DNA. Based on our results, we suggest a model of how DNA is bound to the XPD protein, and can rationalize several of the mutations in the human XPD gene that lead to one of three severe diseases, xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy.

  3. Nucleotide excision repair is a potential therapeutic target in multiple myeloma

    Szalat, R; Samur, M K; Fulciniti, M; Lopez, M; Nanjappa, P; Cleynen, A; Wen, K; Kumar, S; Perini, T; Calkins, A S; Reznichenko, E; Chauhan, D; Tai, Y-T; Shammas, M A; Anderson, K C; Fermand, J-P; Arnulf, B; Avet-Loiseau, H; Lazaro, J-B; Munshi, N C


    Despite the development of novel drugs, alkylating agents remain an important component of therapy in multiple myeloma (MM). DNA repair processes contribute towards sensitivity to alkylating agents and therefore we here evaluate the role of nucleotide excision repair (NER), which is involved in the removal of bulky adducts and DNA crosslinks in MM. We first evaluated NER activity using a novel functional assay and observed a heterogeneous NER efficiency in MM cell lines and patient samples. Using next-generation sequencing data, we identified that expression of the canonical NER gene, excision repair cross-complementation group 3 (ERCC3), significantly impacted the outcome in newly diagnosed MM patients treated with alkylating agents. Next, using small RNA interference, stable knockdown and overexpression, and small-molecule inhibitors targeting xeroderma pigmentosum complementation group B (XPB), the DNA helicase encoded by ERCC3, we demonstrate that NER inhibition significantly increases sensitivity and overcomes resistance to alkylating agents in MM. Moreover, inhibiting XPB leads to the dual inhibition of NER and transcription and is particularly efficient in myeloma cells. Altogether, we show that NER impacts alkylating agents sensitivity in myeloma cells and identify ERCC3 as a potential therapeutic target in MM. PMID:28588253

  4. A multistep damage recognition mechanism for global genomic nucleotide excision repair.

    Sugasawa, K; Okamoto, T; Shimizu, Y; Masutani, C; Iwai, S; Hanaoka, F


    A mammalian nucleotide excision repair (NER) factor, the XPC-HR23B complex, can specifically bind to certain DNA lesions and initiate the cell-free repair reaction. Here we describe a detailed analysis of its binding specificity using various DNA substrates, each containing a single defined lesion. A highly sensitive gel mobility shift assay revealed that XPC-HR23B specifically binds a small bubble structure with or without damaged bases, whereas dual incision takes place only when damage is present in the bubble. This is evidence that damage recognition for NER is accomplished through at least two steps; XPC-HR23B first binds to a site that has a DNA helix distortion, and then the presence of injured bases is verified prior to dual incision. Cyclobutane pyrimidine dimers (CPDs) were hardly recognized by XPC-HR23B, suggesting that additional factors may be required for CPD recognition. Although the presence of mismatched bases opposite a CPD potentiated XPC-HR23B binding, probably due to enhancement of the helix distortion, cell-free excision of such compound lesions was much more efficient than expected from the observed affinity for XPC-HR23B. This also suggests that additional factors and steps are required for the recognition of some types of lesions. A multistep mechanism of this sort may provide a molecular basis for ensuring the high level of damage discrimination that is required for global genomic NER.

  5. Identification of a chemical that inhibits the mycobacterial UvrABC complex in nucleotide excision repair.

    Mazloum, Nayef; Stegman, Melanie A; Croteau, Deborah L; Van Houten, Bennett; Kwon, Nyoun Soo; Ling, Yan; Dickinson, Caitlyn; Venugopal, Aditya; Towheed, Mohammad Atif; Nathan, Carl


    Bacterial DNA can be damaged by reactive nitrogen and oxygen intermediates (RNI and ROI) generated by host immunity, as well as by antibiotics that trigger bacterial production of ROI. Thus a pathogen's ability to repair its DNA may be important for persistent infection. A prominent role for nucleotide excision repair (NER) in disease caused by Mycobacterium tuberculosis (Mtb) was suggested by attenuation of uvrB-deficient Mtb in mice. However, it was unknown if Mtb's Uvr proteins could execute NER. Here we report that recombinant UvrA, UvrB, and UvrC from Mtb collectively bound and cleaved plasmid DNA exposed to ultraviolet (UV) irradiation or peroxynitrite. We used the DNA incision assay to test the mechanism of action of compounds identified in a high-throughput screen for their ability to delay recovery of M. smegmatis from UV irradiation. 2-(5-Amino-1,3,4-thiadiazol-2-ylbenzo[f]chromen-3-one) (ATBC) but not several closely related compounds inhibited cleavage of damaged DNA by UvrA, UvrB, and UvrC without intercalating in DNA and impaired recovery of M. smegmatis from UV irradiation. ATBC did not affect bacterial growth in the absence of UV exposure, nor did it exacerbate the growth defect of UV-irradiated mycobacteria that lacked uvrB. Thus, ATBC appears to be a cell-penetrant, selective inhibitor of mycobacterial NER. Chemical inhibitors of NER may facilitate studies of the role of NER in prokaryotic pathobiology.

  6. Studies on the molecular mechanism of nucleotide excision repair in human cells

    Friedberg, E.C.


    Studies in this laboratory have focused on attempts to define the mechanism of nucleotide excision repair of DNA in human cells, with a view to understanding the molecular pathogenesis of the disease XP. With the advent of recombinant DNA technology, they directed their efforts to the molecular cloning of human genes defective in XP, with a view to using the cloned genes to overexpress proteins of interest for biochemical investigations. Initial studies exploited the selectable phenotype of marked sensitivity to killing of XP group A cells by UV radiation and by other DNA damaging agents. However, except for a single report in 1982 there has been no reproducible demonstration of complementation of the UV sensitivity of XP cells by DNA-mediated transfection. The apparent difficulties associated with transfection of XP cells have been the subject of several recent studies. In view of the multiple problems associated with stable transfection of XP cells using total genomic DNA, they have embarked on an alternative strategy designed to facilitate the cloning of human XP genes. This strategy involves the transfer of single human chromosomes into XP cells and screening for this relatively high frequency event. The idea is to identify chromosomes on which particular XP genes reside and then to isolate non-complementing derivatives of these chromosomes so that highly enriched DNA pools containing genes of interest can be generated by employing one or more subtractive strategies

  7. Nucleotide sequence preservation of human mitochondrial DNA

    Monnat, R.J. Jr.; Loeb, L.A.


    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  8. Proteins of nucleotide and base excision repair pathways interact in mitochondria to protect from loss of subcutaneous fat, a hallmark of aging

    Y. Kamenisch (York); M.I. Fousteri (Maria); J. Knoch (Jennifer); A.K. Von Thaler (Anna Katherina); B. Fehrenbacher (Birgit); H. Kato (Hiroki); T. Becker (Tim); M.E.T. Dollé (Martijn); R. Kuiper (Ruud); M. Majora (Marc); M. Schaller (Martin); G.T.J. van der Horst (Gijsbertus); H. van Steeg (Harry); M. Röcken (Martin); D. Rapaport (Doron); J. Krutmann (Jean); L.H.F. Mullenders (Leon); M. Berneburg (Mark)


    textabstractDefects in the DNA repair mechanism nucleotide excision repair (NER) may lead to tumors in xeroderma pigmentosum (XP) or to premature aging with loss of subcutaneous fat in Cockayne syndrome (CS). Mutations of mitochondrial (mt)DNA play a role in aging, but a link between the

  9. Transcriptional and Posttranslational Regulation of Nucleotide Excision Repair: The Guardian of the Genome against Ultraviolet Radiation

    Jeong-Min Park


    Full Text Available Ultraviolet (UV radiation from sunlight represents a constant threat to genome stability by generating modified DNA bases such as cyclobutane pyrimidine dimers (CPD and pyrimidine-pyrimidone (6-4 photoproducts (6-4PP. If unrepaired, these lesions can have deleterious effects, including skin cancer. Mammalian cells are able to neutralize UV-induced photolesions through nucleotide excision repair (NER. The NER pathway has multiple components including seven xeroderma pigmentosum (XP proteins (XPA to XPG and numerous auxiliary factors, including ataxia telangiectasia and Rad3-related (ATR protein kinase and RCC1 like domain (RLD and homologous to the E6-AP carboxyl terminus (HECT domain containing E3 ubiquitin protein ligase 2 (HERC2. In this review we highlight recent data on the transcriptional and posttranslational regulation of NER activity.

  10. The role of DNA base excision repair in brain homeostasis and disease

    Akbari, Mansour; Morevati, Marya; Croteau, Deborah


    Chemical modification and spontaneous loss of nucleotide bases from DNA are estimated to occur at the rate of thousands per human cell per day. DNA base excision repair (BER) is a critical mechanism for repairing such lesions in nuclear and mitochondrial DNA. Defective expression or function of p...... energy homeostasis, mitochondrial function and cellular bioenergetics, with especially strong influence on neurological function. Further studies in this area could lead to novel approaches to prevent and treat human neurodegenerative disease....

  11. Oxidative Damage to RPA Limits the Nucleotide Excision Repair Capacity of Human Cells.

    Guven, Melisa; Brem, Reto; Macpherson, Peter; Peacock, Matthew; Karran, Peter


    Nucleotide excision repair (NER) protects against sunlight-induced skin cancer. Defective NER is associated with photosensitivity and a high skin cancer incidence. Some clinical treatments that cause photosensitivity can also increase skin cancer risk. Among these, the immunosuppressant azathioprine and the fluoroquinolone antibiotics ciprofloxacin and ofloxacin interact with UVA radiation to generate reactive oxygen species that diminish NER capacity by causing protein damage. The replication protein A (RPA) DNA-binding protein has a pivotal role in DNA metabolism and is an essential component of NER. The relationship between protein oxidation and NER inhibition was investigated in cultured human cells expressing different levels of RPA. We show here that RPA is limiting for NER and that oxidative damage to RPA compromises NER capability. Our findings reveal that cellular RPA is surprisingly vulnerable to oxidation, and we identify oxidized forms of RPA that are associated with impaired NER. The vulnerability of NER to inhibition by oxidation provides a connection between cutaneous photosensitivity, protein damage, and increased skin cancer risk. Our findings emphasize that damage to DNA repair proteins, as well as to DNA itself, is likely to be an important contributor to skin cancer risk.

  12. Nucleotide Excision Repair and Vitamin D--Relevance for Skin Cancer Therapy.

    Pawlowska, Elzbieta; Wysokinski, Daniel; Blasiak, Janusz


    Ultraviolet (UV) radiation is involved in almost all skin cancer cases, but on the other hand, it stimulates the production of pre-vitamin D3, whose active metabolite, 1,25-dihydroxyvitamin D3 (1,25VD3), plays important physiological functions on binding with its receptor (vitamin D receptor, VDR). UV-induced DNA damages in the form of cyclobutane pyrimidine dimers or (6-4)-pyrimidine-pyrimidone photoproducts are frequently found in skin cancer and its precursors. Therefore, removing these lesions is essential for the prevention of skin cancer. As UV-induced DNA damages are repaired by nucleotide excision repair (NER), the interaction of 1,25VD3 with NER components can be important for skin cancer transformation. Several studies show that 1,25VD3 protects DNA against damage induced by UV, but the exact mechanism of this protection is not completely clear. 1,25VD3 was also shown to affect cell cycle regulation and apoptosis in several signaling pathways, so it can be considered as a potential modulator of the cellular DNA damage response, which is crucial for mutagenesis and cancer transformation. 1,25VD3 was shown to affect DNA repair and potentially NER through decreasing nitrosylation of DNA repair enzymes by NO overproduction by UV, but other mechanisms of the interaction between 1,25VD3 and NER machinery also are suggested. Therefore, the array of NER gene functioning could be analyzed and an appropriate amount of 1.25VD3 could be recommended to decrease UV-induced DNA damage important for skin cancer transformation.

  13. Genetic instability associated with loop or stem–loop structures within transcription units can be independent of nucleotide excision repair

    Burns, John A; Chowdhury, Moinuddin A; Cartularo, Laura; Berens, Christian; Scicchitano, David A


    Abstract Simple sequence repeats (SSRs) are found throughout the genome, and under some conditions can change in length over time. Germline and somatic expansions of trinucleotide repeats are associated with a series of severely disabling illnesses, including Huntington's disease. The underlying mechanisms that effect SSR expansions and contractions have been experimentally elusive, but models suggesting a role for DNA repair have been proposed, in particular the involvement of transcription-coupled nucleotide excision repair (TCNER) that removes transcription-blocking DNA damage from the transcribed strand of actively expressed genes. If the formation of secondary DNA structures that are associated with SSRs were to block RNA polymerase progression, TCNER could be activated, resulting in the removal of the aberrant structure and a concomitant change in the region's length. To test this, TCNER activity in primary human fibroblasts was assessed on defined DNA substrates containing extrahelical DNA loops that lack discernible internal base pairs or DNA stem–loops that contain base pairs within the stem. The results show that both structures impede transcription elongation, but there is no corresponding evidence that nucleotide excision repair (NER) or TCNER operates to remove them. PMID:29474673

  14. Chronic low-dose ultraviolet-induced mutagenesis in nucleotide excision repair-deficient cells.

    Haruta, Nami; Kubota, Yoshino; Hishida, Takashi


    UV radiation induces two major types of DNA lesions, cyclobutane pyrimidine dimers (CPDs) and 6-4 pyrimidine-pyrimidine photoproducts, which are both primarily repaired by nucleotide excision repair (NER). Here, we investigated how chronic low-dose UV (CLUV)-induced mutagenesis occurs in rad14Δ NER-deficient yeast cells, which lack the yeast orthologue of human xeroderma pigmentosum A (XPA). The results show that rad14Δ cells have a marked increase in CLUV-induced mutations, most of which are C→T transitions in the template strand for transcription. Unexpectedly, many of the CLUV-induced C→T mutations in rad14Δ cells are dependent on translesion synthesis (TLS) DNA polymerase η, encoded by RAD30, despite its previously established role in error-free TLS. Furthermore, we demonstrate that deamination of cytosine-containing CPDs contributes to CLUV-induced mutagenesis. Taken together, these results uncover a novel role for Polη in the induction of C→T transitions through deamination of cytosine-containing CPDs in CLUV-exposed NER deficient cells. More generally, our data suggest that Polη can act as both an error-free and a mutagenic DNA polymerase, depending on whether the NER pathway is available to efficiently repair damaged templates.

  15. Exposure of Human Lung Cells to Tobacco Smoke Condensate Inhibits the Nucleotide Excision Repair Pathway.

    Nathaniel Holcomb

    Full Text Available Exposure to tobacco smoke is the number one risk factor for lung cancer. Although the DNA damaging properties of tobacco smoke have been well documented, relatively few studies have examined its effect on DNA repair pathways. This is especially true for the nucleotide excision repair (NER pathway which recognizes and removes many structurally diverse DNA lesions, including those introduced by chemical carcinogens present in tobacco smoke. The aim of the present study was to investigate the effect of tobacco smoke on NER in human lung cells. We studied the effect of cigarette smoke condensate (CSC, a surrogate for tobacco smoke, on the NER pathway in two different human lung cell lines; IMR-90 lung fibroblasts and BEAS-2B bronchial epithelial cells. To measure NER, we employed a slot-blot assay to quantify the introduction and removal of UV light-induced 6-4 photoproducts and cyclobutane pyrimidine dimers. We find a dose-dependent inhibition of 6-4 photoproduct repair in both cell lines treated with CSC. Additionally, the impact of CSC on the abundance of various NER proteins and their respective RNAs was investigated. The abundance of XPC protein, which is required for functional NER, is significantly reduced by treatment with CSC while the abundance of XPA protein, also required for NER, is unaffected. Both XPC and XPA RNA levels are modestly reduced by CSC treatment. Finally, treatment of cells with MG-132 abrogates the reduction in the abundance of XPC protein produced by treatment with CSC, suggesting that CSC enhances proteasome-dependent turnover of the protein that is mediated by ubiquitination. Together, these findings indicate that tobacco smoke can inhibit the same DNA repair pathway that is also essential for the removal of some of the carcinogenic DNA damage introduced by smoke itself, increasing the DNA damage burden of cells exposed to tobacco smoke.

  16. The Mechanism of Nucleotide Excision Repair-Mediated UV-Induced Mutagenesis in Nonproliferating Cells

    Kozmin, Stanislav G.; Jinks-Robertson, Sue


    Following the irradiation of nondividing yeast cells with ultraviolet (UV) light, most induced mutations are inherited by both daughter cells, indicating that complementary changes are introduced into both strands of duplex DNA prior to replication. Early analyses demonstrated that such two-strand mutations depend on functional nucleotide excision repair (NER), but the molecular mechanism of this unique type of mutagenesis has not been further explored. In the experiments reported here, an ade2 adeX colony-color system was used to examine the genetic control of UV-induced mutagenesis in nondividing cultures of Saccharomyces cerevisiae. We confirmed a strong suppression of two-strand mutagenesis in NER-deficient backgrounds and demonstrated that neither mismatch repair nor interstrand crosslink repair affects the production of these mutations. By contrast, proteins involved in the error-prone bypass of DNA damage (Rev3, Rev1, PCNA, Rad18, Pol32, and Rad5) and in the early steps of the DNA-damage checkpoint response (Rad17, Mec3, Ddc1, Mec1, and Rad9) were required for the production of two-strand mutations. There was no involvement, however, for the Pol η translesion synthesis DNA polymerase, the Mms2-Ubc13 postreplication repair complex, downstream DNA-damage checkpoint factors (Rad53, Chk1, and Dun1), or the Exo1 exonuclease. Our data support models in which UV-induced mutagenesis in nondividing cells occurs during the Pol ζ-dependent filling of lesion-containing, NER-generated gaps. The requirement for specific DNA-damage checkpoint proteins suggests roles in recruiting and/or activating factors required to fill such gaps. PMID:23307894

  17. Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time.

    Kong, Muwen; Beckwitt, Emily C; Springall, Luke; Kad, Neil M; Van Houten, Bennett


    Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesions into DNA substrates, these complementary biophysical techniques are well suited for investigating protein-DNA interactions that involve target-specific DNA-binding proteins, such as those engaged in a variety of DNA repair pathways. In this chapter, we demonstrate the utility of the platform by applying these techniques in the studies of proteins participating in nucleotide excision repair. © 2017 Elsevier Inc. All rights reserved.

  18. Nrf1 CNC-bZIP protein promotes cell survival and nucleotide excision repair through maintaining glutathione homeostasis.

    Han, Weinong; Ming, Mei; Zhao, Rui; Pi, Jingbo; Wu, Chunli; He, Yu-Ying


    Skin cancer is the most common cancer in the United States. Its major environmental risk factor is UVB radiation in sunlight. In response to UVB damage, epidermal keratinocytes activate a specific repair pathway, i.e. nucleotide excision repair, to remove UVB-induced DNA lesions. However, the regulation of UVB response is not fully understood. Here we show that the long isoform of the nuclear factor erythroid 2-related factor 1 (Nrf1, also called NFE2L1), a cytoprotective transcription factor critical for the expression of multiple antioxidant response element-dependent genes, plays an important role in the response of keratinocytes to UVB. Nrf1 loss sensitized keratinocytes to UVB-induced apoptosis by up-regulating the expression of the proapoptotic Bcl-2 family member Bik through reducing glutathione levels. Knocking down Bik reduced UVB-induced apoptosis in Nrf1-inhibited cells. In UVB-irradiated surviving cells, however, disruption of Nrf1 impaired nucleotide excision repair through suppressing the transcription of xeroderma pigmentosum C (XPC), a factor essential for initiating the global genome nucleotide excision repair by recognizing the DNA lesion and recruiting downstream factors. Nrf1 enhanced XPC expression by increasing glutathione availability but was independent of the transcription repressor of XPC. Adding XPC or glutathione restored the DNA repair capacity in Nrf1-inhibited cells. Finally, we demonstrate that Nrf1 levels are significantly reduced by UVB radiation in mouse skin and are lower in human skin tumors than in normal skin. These results indicate a novel role of Nrf1 in UVB-induced DNA damage repair and suggest Nrf1 as a tumor suppressor in the skin.

  19. A human homolog of the yeast nucleotide excision repair gene MMS19 interacts with transcription repair factor TFIIH through the XPB and XPD helicases.

    T. Seroz; G.S. Winkler (Sebastiaan); J. Auriol; R.A. Verhage; W. Vermeulen (Wim); B. Smit (Bep); J. Brouwer (Jaap); A.P.M. Eker (André); G. Weeda (Geert); J-M. Egly (Jean-Marc); J.H.J. Hoeijmakers (Jan)


    textabstractNucleotide excision repair (NER) removes UV-induced photoproducts and numerous other DNA lesions in a highly conserved 'cut-and-paste' reaction that involves approximately 25 core components. In addition, several other proteins have been identified which are dispensable for NER in vitro

  20. Decreased nucleotide excision repair in steatotic livers associates with myeloperoxidase-immunoreactivity

    Schults, Marten A.; Nagle, Peter W.; Rensen, Sander S.; Godschalk, Roger W.; Munnia, Armelle; Peluso, Marco; Claessen, Sandra M.; Greve, Jan W.; Driessen, Ann; Verdam, Froukje J.; Buurman, Wim A.; Schooten, Frederik J. van; Chiu, Roland K.


    Chronic inflammation is characterized by the influx of neutrophils and is associated with an increased production of reactive oxygen species that can damage DNA. Oxidative DNA damage is generally thought to be involved in the increased risk of cancer in inflamed tissues. We previously demonstrated that activated neutrophil mediated oxidative stress results in a reduction in nucleotide excision repair (NER) capacity, which could further enhance mutagenesis. Inflammation and oxidative stress are critical factors in the progression of nonalcoholic fatty liver disease that is linked with enhanced liver cancer risk. In this report, we therefore evaluated the role of neutrophils and the associated oxidative stress in damage recognition and DNA repair in steatotic livers of 35 severely obese subjects with either nonalcoholic steatohepatitis (NASH) (n = 17) or steatosis alone (n = 18). The neutrophilic influx in liver was assessed by myeloperoxidase (MPO) staining and the amount of oxidative DNA damage by measuring M 1 dG adducts. No differences in M 1 dG adduct levels were observed between patients with or without NASH and also not between individuals with high or low MPO immunoreactivity. However, we found that high expression of MPO in the liver, irrespective of disease status, reduced the damage recognition capacity as determined by staining for histone 2AX phosphorylation (γH2AX). This reduction in γH2AX formation in individuals with high MPO immunoreactivity was paralleled by a significant decrease in NER capacity as assessed by a functional repair assay, and was not related to cell proliferation. Thus, the observed reduction in NER capacity upon hepatic inflammation is associated with and may be a consequence of reduced damage recognition. These findings suggest a novel mechanism of liver cancer development in patients with nonalcoholic fatty liver disease.

  1. Decreased nucleotide excision repair in steatotic livers associates with myeloperoxidase-immunoreactivity

    Schults, Marten A.; Nagle, Peter W. [Department of Toxicology, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Rensen, Sander S. [Department of Surgery, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Godschalk, Roger W. [Department of Toxicology, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Munnia, Armelle; Peluso, Marco [Cancer Risk Factor Branch, ISPO Cancer Prevention and Research Institute, Via Cosimo il Vecchio 2, 50139 Florence (Italy); Claessen, Sandra M. [Department of Toxicogenomics, GROW-School for Oncology and Developmental Biology, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Greve, Jan W. [Department of Surgery, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Driessen, Ann [Department of Pathology, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Verdam, Froukje J.; Buurman, Wim A. [Department of Surgery, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Schooten, Frederik J. van [Department of Toxicology, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands); Chiu, Roland K., E-mail: [Department of Toxicology, NUTRIM-School for Nutrition, Toxicology and Metabolism, Maastricht University Medical Centre, PO Box 616, 6200 MD Maastricht (Netherlands)


    Chronic inflammation is characterized by the influx of neutrophils and is associated with an increased production of reactive oxygen species that can damage DNA. Oxidative DNA damage is generally thought to be involved in the increased risk of cancer in inflamed tissues. We previously demonstrated that activated neutrophil mediated oxidative stress results in a reduction in nucleotide excision repair (NER) capacity, which could further enhance mutagenesis. Inflammation and oxidative stress are critical factors in the progression of nonalcoholic fatty liver disease that is linked with enhanced liver cancer risk. In this report, we therefore evaluated the role of neutrophils and the associated oxidative stress in damage recognition and DNA repair in steatotic livers of 35 severely obese subjects with either nonalcoholic steatohepatitis (NASH) (n = 17) or steatosis alone (n = 18). The neutrophilic influx in liver was assessed by myeloperoxidase (MPO) staining and the amount of oxidative DNA damage by measuring M{sub 1}dG adducts. No differences in M{sub 1}dG adduct levels were observed between patients with or without NASH and also not between individuals with high or low MPO immunoreactivity. However, we found that high expression of MPO in the liver, irrespective of disease status, reduced the damage recognition capacity as determined by staining for histone 2AX phosphorylation ({gamma}H2AX). This reduction in {gamma}H2AX formation in individuals with high MPO immunoreactivity was paralleled by a significant decrease in NER capacity as assessed by a functional repair assay, and was not related to cell proliferation. Thus, the observed reduction in NER capacity upon hepatic inflammation is associated with and may be a consequence of reduced damage recognition. These findings suggest a novel mechanism of liver cancer development in patients with nonalcoholic fatty liver disease.

  2. Dynamic interaction of TTDA with TFIIH is stabilized by nucleotide excision repair in living cells.

    G. Giglia-Mari (Giuseppina); C. Miquel (Catherine); A.F. Theil (Arjan); P.O. Mari (Pierre-Olivier); D. Hoogstraten (Deborah); J.M.Y. Ng (Jessica); C. Dinant (Christoffel); J.H.J. Hoeijmakers (Jan); W. Vermeulen (Wim)


    textabstractTranscription/repair factor IIH (TFIIH) is essential for RNA polymerase II transcription and nucleotide excision repair (NER). This multi-subunit complex consists of ten polypeptides, including the recently identified small 8-kDa trichothiodystrophy group A (TTDA)/ hTFB5 protein.

  3. Inhibition of nucleotide excision repair by fludarabine in normal lymphocytes in vitro, measured by the alkaline single cell gel electrophoresis (comet) assay

    Yamauchi, Takahiro; Kawai, Yasukazu; Ueda, Takanori [Fukui Medical Univ., Matsuoka (Japan)


    Alkylating agents or platinum analogues initiate several excision repair mechanisms, which involve incision of the DNA strand, excision of the damaged nucleotide, gap filling by DNA resynthesis, and rejoining by ligation. The previous study described that nucleotide excision repair permitted incorporation of fludarabine nucleoside (F-area-A) into the repair patch, thereby inhibiting the DNA resynthesis. In the present study, to clarify the repair kinetics in view of the inhibition by F-ara-A, normal lymphocytes were stimulated to undergo nucleotide excision repair by ultraviolet C (UV) irradiation in the presence or absence of F-ara-A. The repair kinetics were determined as DNA single strand breaks resulting from the incision and the rejoining using the alkaline single cell gel electrophoresis (comet) assay. DNA resynthesis was evaluated in terms of the uptake of tritiated thymidine into DNA. The lymphocytes initiated the incision step maximally at 1 h, and completed the rejoining process within 4 h after UV exposure. UV also initiated thymidine uptake, which increased time-dependently and reached a plateau at 4 h. A 2-h pre-incubation with F-ara-A inhibited the repair in a concentration-dependent manner, with the maximal inhibition by 5 {mu}M. This inhibitory effect was demonstrated by the reduction of the thymidine uptake and by the inhibition of the rejoining. A DNA polymerase inhibitor, aphidicolin, and a ribonucleotide reductase inhibitor, hydroxyurea, were not so inhibitory to the repair process as F-ara-A at equimolar concentrations. The present findings suggest that inhibition of nucleotide excision repair may represent a novel therapeutic strategy against cancer, especially in the context of resistant cells with an increased repair capacity. (author)

  4. The endoperoxide ascaridol shows strong differential cytotoxicity in nucleotide excision repair-deficient cells

    Abbasi, Rashda; Efferth, Thomas; Kuhmann, Christine; Opatz, Till; Hao, Xiaojiang; Popanda, Odilia; Schmezer, Peter


    Targeting synthetic lethality in DNA repair pathways has become a promising anti-cancer strategy. However little is known about such interactions with regard to the nucleotide excision repair (NER) pathway. Therefore, cell lines with a defect in the NER genes ERCC6 or XPC and their normal counterparts were screened with 53 chemically defined phytochemicals isolated from plants used in traditional Chinese medicine for differential cytotoxic effects. The screening revealed 12 drugs that killed NER-deficient cells more efficiently than proficient cells. Five drugs were further analyzed for IC 50 values, effects on cell cycle distribution, and induction of DNA damage. Ascaridol was the most effective compound with a difference of > 1000-fold in resistance between normal and NER-deficient cells (IC 50 values for cells with deficiency in ERCC6: 0.15 μM, XPC: 0.18 μM, and normal cells: > 180 μM). NER-deficiency combined with ascaridol treatment led to G2/M-phase arrest, an increased percentage of subG1 cells, and a substantially higher DNA damage induction. These results were confirmed in a second set of NER-deficient and -proficient cell lines with isogenic background. Finally, ascaridol was characterized for its ability to generate oxidative DNA damage. The drug led to a dose-dependent increase in intracellular levels of reactive oxygen species at cytotoxic concentrations, but only NER-deficient cells showed a strongly induced amount of 8-oxodG sites. In summary, ascaridol is a cytotoxic and DNA-damaging compound which generates intracellular reactive oxidative intermediates and which selectively affects NER-deficient cells. This could provide a new therapeutic option to treat cancer cells with mutations in NER genes. -- Highlights: ► Thousand-fold higher Ascaridol activity in NER-deficient versus proficient cells. ► Impaired repair of Ascaridol-induced oxidative DNA damage in NER-deficient cells. ► Selective activity of Ascaridol opens new therapy options in

  5. Gastroesophageal junction adenocarcinoma displays abnormalities in homologous recombination and nucleotide excision repair

    Dewalt RI


    Full Text Available Robin I Dewalt,1 Kenneth A Kesler,2 Zane T Hammoud,3 LeeAnn Baldridge,4 Eyas M Hattab,4 Shadia I Jalal1,5 1Division of Hematology/Oncology, Department of Medicine, 2Cardiothoracic Division, Department of Surgery, Indiana University School of Medicine, Indianapolis, IN, USA; 3Henry Ford Hospital, Detroit, MI, USA; 4Department of Pathology and Laboratory Medicine, Indiana University School of Medicine, Indianapolis, IN, USA; 5Indiana University Melvin and Bren Simon Cancer Center, Indianapolis, IN, USA Objective: Esophageal adenocarcinoma (EAC continues to be a disease associated with high mortality. Among the factors leading to poor outcomes are innate resistance to currently available therapies, advanced stage at diagnosis, and complex biology. Platinum and ionizing radiation form the backbone of treatment for the majority of patients with EAC. Of the multiple processes involved in response to platinum chemotherapy or ionizing radiation, deoxyribonucleic acid (DNA repair has been a major player in cancer sensitivity to these agents. DNA repair defects have been described in various malignancies. The purpose of this study was to determine whether alterations in DNA repair are present in EAC compared with normal gastroesophageal tissues. Methods: We analyzed the expression of genes involved in homologous recombination (HR, nonhomologous end-joining, and nucleotide excision repair (NER pathways in 12 EAC tumor samples with their matched normal counterparts. These pathways were chosen because they are the main pathways involved in the repair of platinum- or ionizing-radiation-induced damage. In addition, abnormalities in these pathways have not been well characterized in EAC. Results: We identified increased expression of at least one HR gene in eight of the EAC tumor samples. Alterations in the expression of EME1, a structure-specific endonuclease involved in HR, were the most prevalent, with messenger (mRNA overexpression in six of the EAC samples

  6. The endoperoxide ascaridol shows strong differential cytotoxicity in nucleotide excision repair-deficient cells

    Abbasi, Rashda [Division of Epigenomics and Cancer Risk Factors, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Efferth, Thomas [Institute of Pharmacy und Biochemistry, Johannes Gutenberg University, Staudinger Weg 5, 55128 Mainz (Germany); Kuhmann, Christine [Division of Epigenomics and Cancer Risk Factors, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Opatz, Till [Institute of Organic Chemistry, Johannes Gutenberg University, Duesbergweg 10-14, 55128 Mainz (Germany); Hao, Xiaojiang [Kunming Institute of Botany, Chinese Academy of Sciences, Kunming 650204 (China); Popanda, Odilia, E-mail: [Division of Epigenomics and Cancer Risk Factors, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Schmezer, Peter [Division of Epigenomics and Cancer Risk Factors, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)


    Targeting synthetic lethality in DNA repair pathways has become a promising anti-cancer strategy. However little is known about such interactions with regard to the nucleotide excision repair (NER) pathway. Therefore, cell lines with a defect in the NER genes ERCC6 or XPC and their normal counterparts were screened with 53 chemically defined phytochemicals isolated from plants used in traditional Chinese medicine for differential cytotoxic effects. The screening revealed 12 drugs that killed NER-deficient cells more efficiently than proficient cells. Five drugs were further analyzed for IC{sub 50} values, effects on cell cycle distribution, and induction of DNA damage. Ascaridol was the most effective compound with a difference of > 1000-fold in resistance between normal and NER-deficient cells (IC{sub 50} values for cells with deficiency in ERCC6: 0.15 μM, XPC: 0.18 μM, and normal cells: > 180 μM). NER-deficiency combined with ascaridol treatment led to G2/M-phase arrest, an increased percentage of subG1 cells, and a substantially higher DNA damage induction. These results were confirmed in a second set of NER-deficient and -proficient cell lines with isogenic background. Finally, ascaridol was characterized for its ability to generate oxidative DNA damage. The drug led to a dose-dependent increase in intracellular levels of reactive oxygen species at cytotoxic concentrations, but only NER-deficient cells showed a strongly induced amount of 8-oxodG sites. In summary, ascaridol is a cytotoxic and DNA-damaging compound which generates intracellular reactive oxidative intermediates and which selectively affects NER-deficient cells. This could provide a new therapeutic option to treat cancer cells with mutations in NER genes. -- Highlights: ► Thousand-fold higher Ascaridol activity in NER-deficient versus proficient cells. ► Impaired repair of Ascaridol-induced oxidative DNA damage in NER-deficient cells. ► Selective activity of Ascaridol opens new therapy

  7. Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.

    Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent


    Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.

  8. Selective base excision repair of DNA damage by the non-base-flipping DNA glycosylase AlkC

    Shi, Rongxin; Mullins, Elwood A.; Shen, Xing; #8208; Xing; Lay, Kori T.; Yuen, Philip K.; David, Sheila S.; Rokas, Antonis; Eichman, Brandt F. (UCD); (Vanderbilt)


    DNA glycosylases preserve genome integrity and define the specificity of the base excision repair pathway for discreet, detrimental modifications, and thus, the mechanisms by which glycosylases locate DNA damage are of particular interest. Bacterial AlkC and AlkD are specific for cationic alkylated nucleobases and have a distinctive HEAT-like repeat (HLR) fold. AlkD uses a unique non-base-flipping mechanism that enables excision of bulky lesions more commonly associated with nucleotide excision repair. In contrast, AlkC has a much narrower specificity for small lesions, principally N3-methyladenine (3mA). Here, we describe how AlkC selects for and excises 3mA using a non-base-flipping strategy distinct from that of AlkD. A crystal structure resembling a catalytic intermediate complex shows how AlkC uses unique HLR and immunoglobulin-like domains to induce a sharp kink in the DNA, exposing the damaged nucleobase to active site residues that project into the DNA. This active site can accommodate and excise N3-methylcytosine (3mC) and N1-methyladenine (1mA), which are also repaired by AlkB-catalyzed oxidative demethylation, providing a potential alternative mechanism for repair of these lesions in bacteria.

  9. Modulation of DNA base excision repair during neuronal differentiation

    Sykora, Peter; Yang, Jenq-Lin; Ferrarelli, Leslie K


    DNA damage susceptibility and base excision DNA repair (BER) capacity in undifferentiated and differentiated human neural cells. The results show that undifferentiated human SH-SY5Y neuroblastoma cells are less sensitive to oxidative damage than their differentiated counterparts, in part because...

  10. Substrate overlap and functional competition between human nucleotide excision repair and Escherichia coli photolyase and (A)BC excision nuclease

    Sibghat-Ullah; Sancar, Z.


    Human cell free extract prepared by the method of Manley et al. carries out repair synthesis on UV-irradiated DNA. Removal of pyrimidine dimers by photoreactivation with DNA photolyase reduces repair synthesis by about 50%. With excess enzyme in the reaction mixture photolyase reduced the repair signal by the same amount even in the absence of photoreactivating light, presumably by binding to pyrimidine dimers and interfering with the binding of human damage recognition protein. Similarly, the UvrB subunit of Escherichia coli (A)BC excinuclease when loaded onto UV-irradiated or psoralen-adducted DNA inhibited repair synthesis by cell-free extract by 75-80%. The opposite was true also as HeLa cell free extract specifically inhibited the photorepair of a thymine dimer by DNA photolyase and its removal by (A)BC excinuclease. Cell-free extracts from xeroderma pigmentosum (XP) complementation groups A and C were equally effective in blocking the E. coli repair proteins, while extracts from complementation groups D and E were ineffective in blocking the E. coli enzyme. These results suggest that XP-D and XP-E cells are defective in the damage recognition subunits(s) of human excision nuclease

  11. Recombinant methods for screening human DNA excision repair proficiency

    Athas, W.F.


    A method for measuring DNA excision repair in response to ultraviolet radiation (UV)-induced DNA damage has been developed, validated, and field-tested in cultured human lymphocytes. The methodology is amenable to population-based screening and should facilitate future epidemiologic studies seeking to investigate associations between excision repair proficiency and cancer susceptibility. The impetus for such endeavors derives from the belief that the high incidence of skin cancer in the genetic disorder xeroderma pigmentosum (XP) primarily is a result of the reduced capacity of patients cells to repair UV-induced DNA damage. For assay, UV-irradiated non-replicating recombinant plasmid DNA harboring a chloramphenicol acetyltransferase (CAT) indicator gene is introduced into lymphocytes using DEAE-dextran short-term transfection conditions. Exposure to UV induces transcriptionally-inactivating DNA photoproducts in the plasmid DNA which inactivate CAT gene expression. Excision repair of the damaged CAT gene is monitored indirectly as a function of reactivated CAT enzyme activity following a 40 hour repair/expression incubation period

  12. Major Roles for Pyrimidine Dimers, Nucleotide Excision Repair, and ATR in the Alternative Splicing Response to UV Irradiation

    Manuel J. Muñoz


    Full Text Available We have previously found that UV irradiation promotes RNA polymerase II (RNAPII hyperphosphorylation and subsequent changes in alternative splicing (AS. We show now that UV-induced DNA damage is not only necessary but sufficient to trigger the AS response and that photolyase-mediated removal of the most abundant class of pyrimidine dimers (PDs abrogates the global response to UV. We demonstrate that, in keratinocytes, RNAPII is the target, but not a sensor, of the signaling cascade initiated by PDs. The UV effect is enhanced by inhibition of gap-filling DNA synthesis, the last step in the nucleotide excision repair pathway (NER, and reduced by the absence of XPE, the main NER sensor of PDs. The mechanism involves activation of the protein kinase ATR that mediates the UV-induced RNAPII hyperphosphorylation. Our results define the sequence UV-PDs-NER-ATR-RNAPII-AS as a pathway linking DNA damage repair to the control of both RNAPII phosphorylation and AS regulation.

  13. Radicals of DNA and DNA nucleotides generated by ionising radiation

    Przybytniak, G.


    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  14. Relationship between polymorphisms of nucleotide excision repair genes and oral cancer risk in Taiwan: evidence for modification of smoking habit.

    Bau, Da-Tian; Tsai, Ming-Hsui; Huang, Chih-Yang; Lee, Cheng-Chun; Tseng, Hsien-Chang; Lo, Yen-Li; Tsai, Yuhsin; Tsai, Fuu-Jen


    Inherited polymorphisms in DNA repair genes may be associated with differences in the repair capacity and contribute to individual's susceptibility to smoking-related cancers. Both XPA and XPD encode proteins that are part of the nucleotide excision repair (NER) pathway. In a hospital-based case-control study, we have investigated the influence of XPA A-23G and XPD Lys751Gln polymorphisms on oral cancer risk in a Taiwanese population. In total, 154 patients with oral cancer, and 105 age-matched controls recruited from the Chinese Medical Hospital in Central Taiwan were genotyped. No significant association was found between the heterozygous variant allele (AG), the homozygous variant allele (AA) at XPA A-23G, the heterozygous variant allele (AC), the homozygous variant allele (CC) at XPD Lys751Gln, and oral cancer risk. There was no significant joint effect of XPA A-23G and XPD Lys751Gln on oral cancer risk either. Since XPA and XPD are both NER genes, which are very important in removing tobacco-induced DNA adducts, further stratified analyses of both genotype and smoking habit were performed. We found a synergistic effect of variant genotypes of both XPA and XPD, and smoking status on oral cancer risk. Our results suggest that the genetic polymorphisms are modified by environmental carcinogen exposure status, and combined analyses of both genotype and personal habit record are a better access to know the development of oral cancer and useful for primary prevention and early intervention.

  15. New insights in the removal of the hydantoins, oxidation product of pyrimidines, via the base excision and nucleotide incision repair pathways.

    Modesto Redrejo-Rodríguez

    Full Text Available BACKGROUND: Oxidative damage to DNA, if not repaired, can be both miscoding and blocking. These genetic alterations can lead to mutations and/or cell death, which in turn cause cancer and aging. Oxidized DNA bases are substrates for two overlapping repair pathways: base excision (BER and nucleotide incision repair (NIR. Hydantoin derivatives such as 5-hydroxyhydantoin (5OH-Hyd and 5-methyl-5-hydroxyhydantoin (5OH-5Me-Hyd, major products of cytosine and thymine oxidative degradation pathways, respectively, have been detected in cancer cells and ancient DNA. Hydantoins are blocking lesions for DNA polymerases and excised by bacterial and yeast DNA glycosylases in the BER pathway. However little is known about repair of pyrimidine-derived hydantoins in human cells. METHODOLOGY/PRINCIPAL FINDINGS: Here, using both denaturing PAGE and MALDI-TOF MS analyses we report that the bacterial, yeast and human AP endonucleases can incise duplex DNA 5' next to 5OH-Hyd and 5OH-5Me-Hyd thus initiating the NIR pathway. We have fully reconstituted the NIR pathway for these lesions in vitro using purified human proteins. Depletion of Nfo in E. coli and APE1 in HeLa cells abolishes the NIR activity in cell-free extracts. Importantly, a number of redundant DNA glycosylase activities can excise hydantoin residues, including human NTH1, NEIL1 and NEIL2 and the former protein being a major DNA glycosylase activity in HeLa cells extracts. CONCLUSIONS/SIGNIFICANCE: This study demonstrates that both BER and NIR pathways can compete and/or back-up each other to remove hydantoin DNA lesions in vivo.

  16. A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering.

    Nørholm, Morten H H


    The combined use of restriction enzymes with PCR has revolutionized molecular cloning, but is inherently restricted by the content of the manipulated DNA sequences. Uracil-excision based cloning is ligase and sequence independent and allows seamless fusion of multiple DNA sequences in simple one-tube reactions, with higher accuracy than overlapping PCR. Here, the addition of a highly efficient DNA polymerase and a low-background-, large-insertion- compatible site-directed mutagenesis protocol is described, largely expanding the versatility of uracil-excision DNA engineering. The different uracil-excision based molecular tools that have been developed in an open-source fashion, constitute a comprehensive, yet simple and inexpensive toolkit for any need in molecular cloning.

  17. Enhanced base excision repair capacity in carotid atherosclerosis may protect nuclear DNA but not mitochondrial DNA

    Skarpengland, Tonje; B. Dahl, Tuva; Skjelland, Mona


    Lesional and systemic oxidative stress has been implicated in the pathogenesis of atherosclerosis, potentially leading to accumulation of DNA base lesions within atherosclerotic plaques. Although base excision repair (BER) is a major pathway counteracting oxidative DNA damage, our knowledge on BER...

  18. A UV-Induced Genetic Network Links the RSC Complex to Nucleotide Excision Repair and Shows Dose-Dependent Rewiring

    Rohith Srivas


    Full Text Available Efficient repair of UV-induced DNA damage requires the precise coordination of nucleotide excision repair (NER with numerous other biological processes. To map this crosstalk, we generated a differential genetic interaction map centered on quantitative growth measurements of >45,000 double mutants before and after different doses of UV radiation. Integration of genetic data with physical interaction networks identified a global map of 89 UV-induced functional interactions among 62 protein complexes, including a number of links between the RSC complex and several NER factors. We show that RSC is recruited to both silenced and transcribed loci following UV damage where it facilitates efficient repair by promoting nucleosome remodeling. Finally, a comparison of the response to high versus low levels of UV shows that the degree of genetic rewiring correlates with dose of UV and reveals a network of dose-specific interactions. This study makes available a large resource of UV-induced interactions, and it illustrates a methodology for identifying dose-dependent interactions based on quantitative shifts in genetic networks.

  19. Calcium-binding capacity of centrin2 is required for linear POC5 assembly but not for nucleotide excision repair.

    Tiago J Dantas

    Full Text Available Centrosomes, the principal microtubule-organising centres in animal cells, contain centrins, small, conserved calcium-binding proteins unique to eukaryotes. Centrin2 binds to xeroderma pigmentosum group C protein (XPC, stabilising it, and its presence slightly increases nucleotide excision repair (NER activity in vitro. In previous work, we deleted all three centrin isoforms present in chicken DT40 cells and observed delayed repair of UV-induced DNA lesions, but no centrosome abnormalities. Here, we explore how centrin2 controls NER. In the centrin null cells, we expressed centrin2 mutants that cannot bind calcium or that lack sites for phosphorylation by regulatory kinases. Expression of any of these mutants restored the UV sensitivity of centrin null cells to normal as effectively as expression of wild-type centrin. However, calcium-binding-deficient and T118A mutants showed greatly compromised localisation to centrosomes. XPC recruitment to laser-induced UV-like lesions was only slightly slower in centrin-deficient cells than in controls, and levels of XPC and its partner HRAD23B were unaffected by centrin deficiency. Interestingly, we found that overexpression of the centrin interactor POC5 leads to the assembly of linear, centrin-dependent structures that recruit other centrosomal proteins such as PCM-1 and NEDD1. Together, these observations suggest that assembly of centrins into complex structures requires calcium binding capacity, but that such assembly is not required for centrin activity in NER.

  20. Deficiency in nucleotide excision repair family gene activity, especially ERCC3, is associated with non-pigmented hair fiber growth.

    Mei Yu

    Full Text Available We conducted a microarray study to discover gene expression patterns associated with a lack of melanogenesis in non-pigmented hair follicles (HF by microarray. Pigmented and non-pigmented HFs were collected and micro-dissected into the hair bulb (HB and the upper hair sheaths (HS including the bulge region. In comparison to pigmented HS and HBs, nucleotide excision repair (NER family genes ERCC1, ERCC2, ERCC3, ERCC4, ERCC5, ERCC6, XPA, NTPBP, HCNP, DDB2 and POLH exhibited statistically significantly lower expression in non- pigmented HS and HBs. Quantitative PCR verified microarray data and identified ERCC3 as highly differentially expressed. Immunohistochemistry confirmed ERCC3 expression in HF melanocytes. A reduction in ERCC3 by siRNA interference in human melanocytes in vitro reduced their tyrosinase production ability. Our results suggest that loss of NER gene function is associated with a loss of melanin production capacity. This may be due to reduced gene transcription and/or reduced DNA repair in melanocytes which may eventually lead to cell death. These results provide novel information with regard to melanogenesis and its regulation.

  1. Both ATPase sites of Escherichia coli UvrA have functional roles in nucleotide excision repair

    Thiagalingam, S.; Grossman, L.


    The roles of the two tandemly arranged putative ATP binding sites of Escherichia coli UvrA in UvrABC endonuclease-mediated excision repair were analyzed by site-directed mutagenesis and biochemical characterization of the representative mutant proteins. Evidence is presented that UvrA has two functional ATPase sites which coincide with the putative ATP binding motifs predicted from its amino acid sequence. The individual ATPase sites can independently hydrolyze ATP. The C-terminal ATPase site has a higher affinity for ATP than the N-terminal site. The invariable lysine residues at the ends of the glycine-rich loops of the consensus Walker type A motifs are indispensable for ATP hydrolysis. However, the mutations at these lysine residues do not significantly affect ATP binding. UvrA, with bound ATP, forms the most favored conformation for DNA binding. The initial binding of UvrA to DNA is chiefly at the undamaged sites. In contrast to the wild type UvrA, the ATPase site mutants bind equally to damaged and undamaged sites. Dissociation of tightly bound nucleoprotein complexes from the undamaged sites requires hydrolysis of ATP by the C-terminal ATPase site of UvrA. Thus, both ATP binding and hydrolysis are required for the damage recognition step enabling UvrA to discriminate between damaged and undamaged sites on DNA

  2. The Differential Expression of Core Genes in Nucleotide Excision Repair Pathway Indicates Colorectal Carcinogenesis and Prognosis

    Jingwei Liu


    Full Text Available Background. Nucleotide excision repair (NER plays a critical role in maintaining genome integrity. This study aimed to investigate the expression of NER genes and their associations with colorectal cancer (CRC development. Method. Expressions of NER genes in CRC and normal tissues were analysed by ONCOMINE. The Cancer Genome Atlas (TCGA data were downloaded to explore relationship of NER expression with clinicopathological parameters and survival of CRC. Results. ERCC1, ERCC2, ERCC5, and DDB2 were upregulated while ERCC4 was downregulated in CRC. For colon cancer, high ERCC3 expression was related to better T stage; ERCC5 expression indicated deeper T stage and distant metastasis; DDB2 expression suggested earlier TNM stage. For rectal cancer, ERCC2 expression correlated with favourable T stage; XPA expression predicted worse TNM stage. ERCC2 expression was associated with worse overall survival (OS in colon cancer (HR=1.53, P=0.043. Colon cancer patients with high ERCC4 expression showed favorable OS in males (HR=0.54, P=0.035. High XPC expression demonstrated decreased death hazards in rectal cancer (HR=0.40, P=0.026. Conclusion. ERCC1, ERCC2, ERCC4, ERCC5, and DDB2 were differently expressed in CRC and normal tissues; ERCC2, ERCC3, ERCC5, XPA, and DDB2 correlated with clinicopathological parameters of CRC, while ERCC2, ERCC4, and XPC might predict CRC prognosis.

  3. Conservation of the nucleotide excision repair pathway: characterization of hydra Xeroderma Pigmentosum group F homolog.

    Apurva Barve

    Full Text Available Hydra, one of the earliest metazoans with tissue grade organization and nervous system, is an animal with a remarkable regeneration capacity and shows no signs of organismal aging. We have for the first time identified genes of the nucleotide excision repair (NER pathway from hydra. Here we report cloning and characterization of hydra homolog of xeroderma pigmentosum group F (XPF gene that encodes a structure-specific 5' endonuclease which is a crucial component of NER. In silico analysis shows that hydra XPF amino acid sequence is very similar to its counterparts from other animals, especially vertebrates, and shows all features essential for its function. By in situ hybridization, we show that hydra XPF is expressed prominently in the multipotent stem cell niche in the central region of the body column. Ectoderm of the diploblastic hydra was shown to express higher levels of XPF as compared to the endoderm by semi-quantitative RT-PCR. Semi-quantitative RT-PCR analysis also demonstrated that interstitial cells, a multipotent and rapidly cycling stem cell lineage of hydra, express higher levels of XPF mRNA than other cell types. Our data show that XPF and by extension, the NER pathway is highly conserved during evolution. The prominent expression of an NER gene in interstitial cells may have implications for the lack of senescence in hydra.

  4. Reconstitution of nucleotide excision nuclease with UvrA and UvrB proteins from Escherichia coli and UvrC protein from Bacillus subtilis

    Lin, J.J.; Sancar, A.


    Recently, an open reading frame which has a deduced amino acid sequence that shows 38% homology to Escherichia coli UvrC protein was found upstream of the aspartokinase II gene (ask) in Bacillus subtilis. We found that plasmids containing this open reading frame complement the uvrC mutations in E. coli. We joined the open reading frame to a tac promoter to amplify the gene product in E. coli and purified the protein to near homogeneity. The apparent molecular weight of the gene product is 69,000, which is consistent with the calculated molecular weight of 69,378 fro the deduced gene product of the open reading frame. The purified gene product causes the nicking of DNA at the 8th phosphodiester bond 5' and the 5th phosphodiester bond 3' to a thymine dimer when mixed with E. coli UvrA and UvrB proteins and a DNA substrate containing a uniquely located thymine dimer. We conclude that the gene product of the open reading frame is the B. subtilis UvrC protein. Our results suggest that the B. subtilis nucleotide excision repair system is quite similar to that of E. coli. Furthermore, complementation of the UvrA and UvrB proteins from a Gram-negative bacterium with the UvrC protein of Gram-positive B. subtilis indicates a significant evolutionary conservation of the nucleotide excision repair system

  5. DNA Glycosylases Involved in Base Excision Repair May Be Associated with Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

    Osorio, Ana; Milne, Roger L; Kuchenbaecker, Karoline


    Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of th...

  6. DNA Glycosylases Involved in Base Excision Repair May Be Associated with Cancer Risk in BRCA1 and BRCA2 Mutation Carriers

    A. Osorio (Ana); R.L. Milne (Roger); K.B. Kuchenbaecker (Karoline); T. Vaclová (Tereza); G. Pita (Guillermo); R. Alonso (Rosario); P. Peterlongo (Paolo); I. Blanco (Ignacio); M. de La Hoya (Miguel); M. Durán (Mercedes); O. Díez (Orland); T. Ramon Y Cajal; I. Konstantopoulou (I.); C. Martínez-Bouzas (Cristina); R. Andrés Conejero (Raquel); P. Soucy (Penny); L. McGuffog (Lesley); D. Barrowdale (Daniel); A. Lee (Andrew); B. Arver (Brita Wasteson); J. Rantala (Johanna); N. Loman (Niklas); H. Ehrencrona (Hans); O.I. Olopade (Olofunmilayo); M.S. Beattie (Mary); S.M. Domchek (Susan); K.L. Nathanson (Katherine); R. Rebbeck (Timothy); B.K. Arun (Banu); B.Y. Karlan (Beth); C.S. Walsh (Christine); K.J. Lester (Kathryn); E.M. John (Esther); A.S. Whittemore (Alice); M.B. Daly (Mary); M.C. Southey (Melissa); J.L. Hopper (John); M.-B. Terry (Mary-Beth); S.S. Buys (Saundra); R. Janavicius (Ramunas); C.M. Dorfling (Cecilia); E.J. van Rensburg (Elizabeth); L. Steele (Linda); S.L. Neuhausen (Susan); Y.C. Ding (Yuan); T.V.O. Hansen (Thomas); L. Jønson (Lars); B. Ejlertsen (Bent); A-M. Gerdes (Anne-Marie); J. Infante (Jon); B. Herráez (Belén); L.T. Moreno (Leticia Thais); J.N. Weitzel (Jeffrey); J. Herzog (Josef); K. Weeman (Kisa); S. Manoukian (Siranoush); B. Peissel (Bernard); D. Zaffaroni (D.); G. Scuvera (Giulietta); B. Bonnani (Bernardo); F. Mariette (F.); S. Volorio (Sara); A. Viel (Alessandra); L. Varesco (Liliana); L. Papi (Laura); L. Ottini (Laura); M.G. Tibiletti (Maria Grazia); P. Radice (Paolo); D. Yannoukakos (Drakoulis); J. Garber; S.D. Ellis (Steve); D. Frost (Debra); R. Platte (Radka); E. Fineberg (Elena); D.G. Evans (Gareth); F. Lalloo (Fiona); L. Izatt (Louise); R. Eeles (Rosalind); J.W. Adlard (Julian); R. Davidson (Rosemarie); T.J. Cole (Trevor); D. Eccles (Diana); J. Cook (Jackie); S.V. Hodgson (Shirley); C. Brewer (Carole); M. Tischkowitz (Marc); F. Douglas (Fiona); M.E. Porteous (Mary); L. Side (Lucy); L.J. Walker (Lisa); P.J. Morrison (Patrick); A. Donaldson (Alan); J. Kennedy (John); C. Foo (Claire); A.K. Godwin (Andrew); R.K. Schmutzler (Rita); B. Wapenschmidt (Barbara); K. Rhiem (Kerstin); C.W. Engel (Christoph); A. Meindl (Alfons); N. Ditsch (Nina); N. Arnold (Norbert); H. Plendl (Hansjoerg); D. Niederacher (Dieter); C. Sutter (Christian); S. Wang-Gohrke (Shan); D. Steinemann (Doris); S. Preisler-Adams (Sabine); K. Kast (Karin); R. Varon-Mateeva (Raymonda); P.A. Gehrig (Paola A.); D. Stoppa-Lyonnet (Dominique); O. Sinilnikova (Olga); S. Mazoyer (Sylvie); F. Damiola (Francesca); B. Poppe (Bruce); K. Claes (Kathleen); M. Piedmonte (Marion); K. Tucker (Kathryn); F.J. Backes (Floor); P.M. Rodríguez; W. Brewster (Wendy); K. Wakeley (Katie); T. Rutherford (Thomas); T. Caldes (Trinidad); H. Nevanlinna (Heli); K. Aittomäki (Kristiina); M.A. Rookus (Matti); T.A.M. van Os (Theo); L. van der Kolk (Lizet); J.L. de Lange (J.); E.J. Meijers-Heijboer (Hanne); A.H. van der Hout (Annemarie); C.J. van Asperen (Christi); E.B. Gómez García (Encarna); N. Hoogerbrugge (Nicoline); J.M. Collée (Margriet); C.H.M. van Deurzen (Carolien); R.B. van der Luijt (Rob); P. Devilee (Peter); E. Olah (Edith); C. Lazaro (Conxi); A. Teulé (A.); M. Menéndez (Mireia); A. Jakubowska (Anna); C. Cybulski (Cezary); J. Gronwald (Jacek); J. Lubinski (Jan); K. Durda (Katarzyna); K. Jaworska-Bieniek (Katarzyna); O.T. Johannson (Oskar); C. Maugard; M. Montagna (Marco); S. Tognazzo (Silvia); P.J. Teixeira; S. Healey (Sue); C. Olswold (Curtis); L. Guidugli (Lucia); N.M. Lindor (Noralane); S. Slager (Susan); C. Szabo (Csilla); J. Vijai (Joseph); M. Robson (Mark); N. Kauff (Noah); L. Zhang (Lingling); R. Rau-Murthy (Rohini); A. Fink-Retter (Anneliese); C.F. Singer (Christian); C. Rappaport (Christine); D. Geschwantler Kaulich (Daphne); G. Pfeiler (Georg); M.-K. Tea; A. Berger (Annemarie); C. Phelan (Catherine); M.H. Greene (Mark); P.L. Mai (Phuong); F. Lejbkowicz (Flavio); I.L. Andrulis (Irene); A.M. Mulligan (Anna Marie); G. Glendon (Gord); A.E. Toland (Amanda); S.E. Bojesen (Stig); I.S. Pedersen (Inge Sokilde); L. Sunde (Lone); M. Thomassen (Mads); T.A. Kruse (Torben); U.B. Jensen; E. Friedman (Eitan); Y. Laitman (Yael); S.P. Shimon (Shani Paluch); J. Simard (Jacques); D.F. Easton (Douglas); K. Offit (Kenneth); F.J. Couch (Fergus); G. Chenevix-Trench (Georgia); A.C. Antoniou (Antonis); J. Benítez (Javier)


    textabstractSingle Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between

  7. DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers

    Osorio, A.; Milne, R.L.; Kuchenbaecker, K.; Vaclova, T.; Pita, G.; Alonso, R.; Peterlongo, P.; Blanco, I.; Hoya, M. de la; Duran, M.; Diez, O.; Ramon, Y.C.T.; Konstantopoulou, I.; Martinez-Bouzas, C.; Conejero, R. Andres; Soucy, P.; McGuffog, L.; Barrowdale, D.; Lee, A.; Swe, B.; Arver, B.; Rantala, J.; Loman, N.; Ehrencrona, H.; Olopade, O.I.; Beattie, M.S.; Domchek, S.M.; Nathanson, K.; Rebbeck, T.R.; Arun, B.K.; Karlan, B.Y.; Walsh, C.; Lester, J.; John, E.M.; Whittemore, A.S.; Daly, M.B.; Southey, M.; Hopper, J.; Terry, M.B.; Buys, S.S.; Janavicius, R.; Dorfling, C.M.; Rensburg, E.J. van; Steele, L.; Neuhausen, S.L.; Ding, Y.C.; Hansen, T.V.; Jonson, L.; Ejlertsen, B.; Gerdes, A.M.; Infante, M.; Herraez, B.; Moreno, L.T.; Weitzel, J.N.; Herzog, J.; Weeman, K.; Manoukian, S.; Peissel, B.; Zaffaroni, D.; Scuvera, G.; Bonanni, B.; Mariette, F.; Volorio, S.; Viel, A.; Varesco, L.; Papi, L.; Ottini, L.; Tibiletti, M.G.; Radice, P.; Yannoukakos, D.; Garber, J.; Ellis, S.; Frost, D.; Platte, R.; Fineberg, E.; Evans, G.; Lalloo, F.; Izatt, L.; Eeles, R.; Adlard, J.; Davidson, R.; Cole, T.; Eccles, D.; Cook, J; Hodgson, S.; Brewer, C.; Tischkowitz, M.; Douglas, F.; Porteous, M.; Side, L.; Walker, L.; Morrison, P.; Donaldson, A.; Kennedy, J.; Foo, C.; Godwin, A.K.; Schmutzler, R.K.; Wappenschmidt, B.; Rhiem, K.; Engel, C.; Hoogerbrugge-van der Linden, N.; et al.,


    Single Nucleotide Polymorphisms (SNPs) in genes involved in the DNA Base Excision Repair (BER) pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the

  8. Conserved XPB Core Structure and Motifs for DNA Unwinding:Implications for Pathway Selection of Transcription or ExcisionRepair

    Fan, Li; Arval, Andrew S.; Cooper, Priscilla K.; Iwai, Shigenori; Hanaoka, Fumio; Tainer, John A.


    The human xeroderma pigmentosum group B (XPB) helicase is essential for transcription, nucleotide excision repair, and TFIIH functional assembly. Here, we determined crystal structures of an Archaeoglobus fulgidus XPB homolog (AfXPB) that characterize two RecA-like XPB helicase domains and discover a DNA damage recognition domain (DRD), a unique RED motif, a flexible thumb motif (ThM), and implied conformational changes within a conserved functional core. RED motif mutations dramatically reduce helicase activity, and the DRD and ThM, which flank the RED motif, appear structurally as well as functionally analogous to the MutS mismatch recognition and DNA polymerase thumb domains. Substrate specificity is altered by DNA damage, such that AfXPB unwinds dsDNA with 3' extensions, but not blunt-ended dsDNA, unless it contains a lesion, as shown for CPD or (6-4) photoproducts. Together, these results provide an unexpected mechanism of DNA unwinding with Implications for XPB damage verification in nucleotide excision repair.

  9. Substitution of Active Site Tyrosines with Tryptophan Alters the Free Energy for Nucleotide Flipping by Human Alkyladenine DNA Glycosylase†

    Hendershot, Jenna M.; Wolfe, Abigail E.; O'Brien, Patrick J.


    Human alkyladenine DNA glycosylase (AAG) locates and excises a wide variety of structurally diverse alkylated and oxidized purine lesions from DNA to initiate the base excision repair pathway. Recognition of a base lesion requires flipping of the damaged nucleotide into a relatively open active site pocket between two conserved tyrosine residues, Y127 and Y159. We have mutated each of these amino acids to tryptophan and measured the kinetic effects on the nucleotide flipping and base excision steps. The Y127W and Y159W mutant proteins have robust glycosylase activity toward DNA containing 1,N6-ethenoadenine (εA), within 4-fold of that of the wildtype enzyme, raising the possibility that tryptophan fluorescence could be used to probe the DNA binding and nucleotide flipping steps. Stopped-flow fluorescence was used to compare the time-dependent changes in tryptophan fluorescence and εA fluorescence. For both mutants, the tryptophan fluorescence exhibited two-step binding with essentially identical rate constants as were observed for the εA fluorescence changes. These results provide evidence that AAG forms an initial recognition complex in which the active site pocket is perturbed and the stacking of the damaged base is disrupted. Upon complete nucleotide flipping, there is further quenching of the tryptophan fluorescence with coincident quenching of the εA fluorescence. Although these mutations do not have large effects on the rate constant for excision of εA, there are dramatic effects on the rate constants for nucleotide flipping that result in 40 to 100-fold decreases in the flipping equilibrium relative to wildtype. Most of this effect is due to an increased rate of unflipping, but surprisingly the Y159W mutation causes a 5-fold increase in the rate constant for flipping. The large effect on the equilibrium for nucleotide flipping explains the greater deleterious effects that these mutations have on the glycosylase activity toward base lesions that are in

  10. Detection of DNA nucleotides on pretreated boron doped diamond electrodes

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica


    The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

  11. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)


    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA

  12. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.


    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  13. A compromised yeast RNA polymerase II enhances UV sensitivity in the absence of global genome nucleotide excision repair.

    Wong, J M; Ingles, C J


    Nucleotide excision repair is the major pathway responsible for removing UV-induced DNA damage, and is therefore essential for cell survival following exposure to UV radiation. In this report, we have assessed the contributions of some components of the RNA polymerase II (Pol II) transcription machinery to UV resistance in Saccharomyces cerevisiae. Deletion of the gene encoding the Pol II elongation factor TFIIS (SII) resulted in enhanced UV sensitivity, but only in the absence of global genome repair dependent on the RAD7 and RAD16 genes, a result seen previously with deletions of RAD26 and RAD28, yeast homologs of the human Cockayne syndrome genes CSB and CSA, respectively. A RAD7/16-dependent reduction in survival after UV irradiation was also seen in the presence of mutations in RNA Pol II that confer a defect in its response to SII, as well as with other mutations which reside in regions of the largest subunit of Pol II not involved in SII interactions. Indeed, an increase in UV sensitivity was achieved by simply decreasing the steadystate level of RNA Pol II. Truncation of the C-terminal domain and other RNA Pol II mutations conferred sensitivity to the ribonucleotide reductase inhibitor hydroxyurea and induction of RNR1 and RNR2 mRNAs after UV irradiation was attenuated in these mutant cells. That UV sensitivity can be a consequence of mutations in the RNA Pol II machinery in yeast cells suggests that alterations in transcriptional programs could underlie some of the pathophysiological defects seen in the human disease Cockayne syndrome.

  14. Important role for Mycobacterium tuberculosis UvrD1 in pathogenesis and persistence apart from its function in nucleotide excision repair.

    Houghton, Joanna; Townsend, Carolin; Williams, Alan R; Rodgers, Angela; Rand, Lucinda; Walker, K Barry; Böttger, Erik C; Springer, Burkhard; Davis, Elaine O


    Mycobacterium tuberculosis survives and replicates in macrophages, where it is exposed to reactive oxygen and nitrogen species that damage DNA. In this study, we investigated the roles of UvrA and UvrD1, thought to be parts of the nucleotide excision repair pathway of M. tuberculosis. Strains in which uvrD1 was inactivated either alone or in conjunction with uvrA were constructed. Inactivation of uvrD1 resulted in a small colony phenotype, although growth in liquid culture was not significantly affected. The sensitivity of the mutant strains to UV irradiation and to mitomycin C highlighted the importance of the targeted genes for nucleotide excision repair. The mutant strains all exhibited heightened susceptibility to representatives of reactive oxygen intermediates (ROI) and reactive nitrogen intermediates (RNI). The uvrD1 and the uvrA uvrD1 mutants showed decreased intracellular multiplication following infection of macrophages. Most importantly, the uvrA uvrD1 mutant was markedly attenuated following infection of mice by either the aerosol or the intravenous route.

  15. Decreased transcription-coupled nucleotide excision repair capacity is associated with increased p53- and MLH1-independent apoptosis in response to cisplatin

    Stubbert, Lawton J; Smith, Jennifer M; McKay, Bruce C


    One of the most commonly used classes of anti-cancer drugs presently in clinical practice is the platinum-based drugs, including cisplatin. The efficacy of cisplatin therapy is often limited by the emergence of resistant tumours following treatment. Cisplatin resistance is multi-factorial but can be associated with increased DNA repair capacity, mutations in p53 or loss of DNA mismatch repair capacity. RNA interference (RNAi) was used to reduce the transcription-coupled nucleotide excision repair (TC-NER) capacity of several prostate and colorectal carcinoma cell lines with specific defects in p53 and/or DNA mismatch repair. The effect of small inhibitory RNAs designed to target the CSB (Cockayne syndrome group B) transcript on TC-NER and the sensitivity of cells to cisplatin-induced apoptosis was determined. These prostate and colon cancer cell lines were initially TC-NER proficient and RNAi against CSB significantly reduced their DNA repair capacity. Decreased TC-NER capacity was associated with an increase in the sensitivity of tumour cells to cisplatin-induced apoptosis, even in p53 null and DNA mismatch repair-deficient cell lines. The present work indicates that CSB and TC-NER play a prominent role in determining the sensitivity of tumour cells to cisplatin even in the absence of p53 and DNA mismatch repair. These results further suggest that CSB represents a potential target for cancer therapy that may be important to overcome resistance to cisplatin in the clinic

  16. Classifying Coding DNA with Nucleotide Statistics

    Nicolas Carels


    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  17. Statistical properties and fractals of nucleotide clusters in DNA sequences

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting


    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  18. Nucleotide pools dictate the identity and frequency of ribonucleotide incorporation in mitochondrial DNA.

    Anna-Karin Berglund


    Full Text Available Previous work has demonstrated the presence of ribonucleotides in human mitochondrial DNA (mtDNA and in the present study we use a genome-wide approach to precisely map the location of these. We find that ribonucleotides are distributed evenly between the heavy- and light-strand of mtDNA. The relative levels of incorporated ribonucleotides reflect that DNA polymerase γ discriminates the four ribonucleotides differentially during DNA synthesis. The observed pattern is also dependent on the mitochondrial deoxyribonucleotide (dNTP pools and disease-causing mutations that change these pools alter both the absolute and relative levels of incorporated ribonucleotides. Our analyses strongly suggest that DNA polymerase γ-dependent incorporation is the main source of ribonucleotides in mtDNA and argues against the existence of a mitochondrial ribonucleotide excision repair pathway in human cells. Furthermore, we clearly demonstrate that when dNTP pools are limiting, ribonucleotides serve as a source of building blocks to maintain DNA replication. Increased levels of embedded ribonucleotides in patient cells with disturbed nucleotide pools may contribute to a pathogenic mechanism that affects mtDNA stability and impair new rounds of mtDNA replication.

  19. Nucleotide pools dictate the identity and frequency of ribonucleotide incorporation in mitochondrial DNA.

    Berglund, Anna-Karin; Navarrete, Clara; Engqvist, Martin K M; Hoberg, Emily; Szilagyi, Zsolt; Taylor, Robert W; Gustafsson, Claes M; Falkenberg, Maria; Clausen, Anders R


    Previous work has demonstrated the presence of ribonucleotides in human mitochondrial DNA (mtDNA) and in the present study we use a genome-wide approach to precisely map the location of these. We find that ribonucleotides are distributed evenly between the heavy- and light-strand of mtDNA. The relative levels of incorporated ribonucleotides reflect that DNA polymerase γ discriminates the four ribonucleotides differentially during DNA synthesis. The observed pattern is also dependent on the mitochondrial deoxyribonucleotide (dNTP) pools and disease-causing mutations that change these pools alter both the absolute and relative levels of incorporated ribonucleotides. Our analyses strongly suggest that DNA polymerase γ-dependent incorporation is the main source of ribonucleotides in mtDNA and argues against the existence of a mitochondrial ribonucleotide excision repair pathway in human cells. Furthermore, we clearly demonstrate that when dNTP pools are limiting, ribonucleotides serve as a source of building blocks to maintain DNA replication. Increased levels of embedded ribonucleotides in patient cells with disturbed nucleotide pools may contribute to a pathogenic mechanism that affects mtDNA stability and impair new rounds of mtDNA replication.

  20. Accurate DNA assembly and genome engineering with optimized uracil excision cloning

    Cavaleiro, Mafalda; Kim, Se Hyeuk; Seppala, Susanna


    Simple and reliable DNA editing by uracil excision (a.k.a. USER cloning) has been described by several research groups, but the optimal design of cohesive DNA ends for multigene assembly remains elusive. Here, we use two model constructs based on expression of gfp and a four-gene pathway that pro......Simple and reliable DNA editing by uracil excision (a.k.a. USER cloning) has been described by several research groups, but the optimal design of cohesive DNA ends for multigene assembly remains elusive. Here, we use two model constructs based on expression of gfp and a four-gene pathway...... that produces β-carotene to optimize assembly junctions and the uracil excision protocol. By combining uracil excision cloning with a genomic integration technology, we demonstrate that up to six DNA fragments can be assembled in a one-tube reaction for direct genome integration with high accuracy, greatly...... facilitating the advanced engineering of robust cell factories....

  1. DNA Nucleotides Detection via capacitance properties of Graphene

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash


    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  2. Targeted detection of in vivo endogenous DNA base damage reveals preferential base excision repair in the transcribed strand.

    Reis, António M C; Mills, Wilbur K; Ramachandran, Ilangovan; Friedberg, Errol C; Thompson, David; Queimado, Lurdes


    Endogenous DNA damage is removed mainly via base excision repair (BER), however, whether there is preferential strand repair of endogenous DNA damage is still under intense debate. We developed a highly sensitive primer-anchored DNA damage detection assay (PADDA) to map and quantify in vivo endogenous DNA damage. Using PADDA, we documented significantly higher levels of endogenous damage in Saccharomyces cerevisiae cells in stationary phase than in exponential phase. We also documented that yeast BER-defective cells have significantly higher levels of endogenous DNA damage than isogenic wild-type cells at any phase of growth. PADDA provided detailed fingerprint analysis at the single-nucleotide level, documenting for the first time that persistent endogenous nucleotide damage in CAN1 co-localizes with previously reported spontaneous CAN1 mutations. To quickly and reliably quantify endogenous strand-specific DNA damage in the constitutively expressed CAN1 gene, we used PADDA on a real-time PCR setting. We demonstrate that wild-type cells repair endogenous damage preferentially on the CAN1 transcribed strand. In contrast, yeast BER-defective cells accumulate endogenous damage preferentially on the CAN1 transcribed strand. These data provide the first direct evidence for preferential strand repair of endogenous DNA damage and documents the major role of BER in this process.

  3. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet


    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. DNA polymerases beta and lambda mediate overlapping and independent roles in base excision repair in mouse embryonic fibroblasts.

    Elena K Braithwaite


    Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.

  5. Studies on the DNA-excision repair in lymphocytes of patients with recurrent Herpes simplex

    Fanta, D.; Topaloglou, A.; Altmann, H.


    Investigations of the semiconservatrive DNA replication and the excision repair in lymphocytes of patients with recurrent herpes simplex showed defects that could lead to mutations in the DNA with following lower immuncompetence and possibility for activation of already present oncogenic virus formations within the cellular DNA

  6. Affinity purification and partial characterization of a yeast multiprotein complex for nucleotide excision repair using histidine-tagged Rad14 protein

    Rodriguez, K.; Talamantez, J.; Huang, W.; Reed, S.H.; Wang, Z.; Chen, L.; Feaver, W.J.; Friedberg, E.C.; Tomkinson, A.E.


    The nucleotide excision repair (NER) pathway of eukaryotes involves approximately 30 polypeptides. Reconstitution of this pathway with purified components is consistent with the sequential assembly of NER proteins at the DNA lesion. However, recent studies have suggested that NER proteins may be pre-assembled in a high molecular weight complex in the absence of DNA damage. To examine this model further, we have constructed a histidine-tagged version of the yeast DNA damage recognition protein Rad14. Affinity purification of this protein from yeast nuclear extracts resulted in the co-purification of Rad1, Rad7, Rad10, Rad16, Rad23, RPA, RPB1, and TFIIH proteins, whereas none of these proteins bound to the affinity resin in the absence of recombinant Rad14. Furthermore, many of the co-purifying proteins were present in approximately equimolar amounts. Co-elution of these proteins was also observed when the nuclear extract was fractionated by gel filtration, indicating that the NER proteins were associated in a complex with a molecular mass of >1000 kDa prior to affinity chromatography. The affinity purified NER complex catalyzed the incision of UV-irradiated DNA in an ATP-dependent reaction. We conclude that active high molecular weight complexes of NER proteins exist in undamaged yeast cells

  7. DNA excision repair as a component of adaptation to low doses of ionizing radiation Escherichia coli

    Huang, H.; Claycamp, H.G.


    In this study the authors examined whether or not DNA excision repair is a component of adaptation induced by very low-dose ionizing radiation in Escherichia coli, a well-characterized prokaryote, and investigated the relationship between enhanced excision repair and the SOS response. Their data suggest that there seems to be narrow 'windows' of dose-effect for the induction of SOS-independent DNA excision repair. Being similar to mammalian cell studies, the dose range for this effect was about 200-fold less than D 37 for radiation survival. (author)

  8. Nucleotide Excision Repair Is Not Induced in Human Embryonic Lung Fibroblasts Treated with Environmental Pollutants

    Rössner Jr., P.; Mrhálková, A.; Uhlířová, Kateřina; Špátová, M.; Rössnerová, A.; Líbalová, H.; Schmuczerová, J.; Milcová, A.; Topinka, J.; Šrám, R.


    Roč. 8, č. 7 (2013), e69197 E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : environmental pollutants * DNA * expression of DNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  9. Inhibition of excision repair of DNA in u.v.-irradiated Escherichia coli by phenethyl alcohol

    Tachibana, A.; Yonei, S.


    Membrane-specific drugs such as procaine and chlorpromazine have been shown to inhibit excision repair of DNA in u.v.-irradiated E. coli. One possible mechanism is that, if association of DNA with the cell membrane is essential for excision repair, this process may be susceptible to drugs affecting the structure of cell membranes. We examined the effect of phenethyl alcohol, which is a membrane-specific drug and known to dissociate the DNA-membrane complex, on excision repair of DNA in u.v.-irradiated E. coli cells. The cells were irradiated with u.v. light and then held at 30 0 C in buffer (liquid-holding) in the presence or absence of phenethyl alcohol. It was found that phenethyl alcohol inhibits the liquid-holding recovery in both wild-type and recA strains, corresponding to its dissociating action on the DNA-membrane complex. Thus, the association of DNA with cell membrane is an important factor for excision repair in E. coli. Procaine did not show the dissociating effect, suggesting that at least two different mechanisms are responsible for the involvement of cell membrane in excision repair of DNA in E. coli. (author)

  10. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    Steenbergh, P.H.


    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  11. HHR23A, a human homolog of Saccharomyces cerevisiae Rad23, regulates xeroderma pigmentosum C protein and is required for nucleotide excision repair

    Hsieh, Hui-Chuan; Hsieh, Yi-Hsuan; Huang, Yu-Hsin; Shen, Fan-Ching; Tsai, Han-Ni; Tsai, Jui-He; Lai, Yu-Ting; Wang, Yu-Ting; Chuang, Woei-Jer; Huang, Wenya


    HHR23A and hHR23B are the human homologs of Saccharomyces cerevisiae Rad23. hHR23B is associated with the nucleotide excision repair (NER) factor xeroderma pigmentosum C (XPC) protein and is required for global genome repair. The function of hHR23A is not yet clear. In this study, the potential function of the hHR23A protein was investigated using RNA interference techniques. The hHR23A knock-down (KD) construct diminished the RNA level of hHR23A protein by approximately 60%, and it did not interfere with expression of the hHR23B gene. Based on Southwestern immunoblot and host-cell reactivation assays, hHR23A KD cells were found to be deficient in DNA repair activity against the DNA damage caused by UVC irradiation. In these hHR23A KD cells, the XPC gene was not normally induced by UVC irradiation, indicating that the hHR23A protein is involved in NER through regulation of the DNA damage recognition protein XPC. Co-immunoprecipitation experiments revealed that hHR23A was associated with a small portion of hHR23B and the majority of p53 protein, indicating that hHR23A regulates the function of XPC by its association with the NER activator p53

  12. Decreased transcription-coupled nucleotide excision repair capacity is associated with increased p53- and MLH1-independent apoptosis in response to cisplatin

    Smith Jennifer M


    Full Text Available Abstract Background One of the most commonly used classes of anti-cancer drugs presently in clinical practice is the platinum-based drugs, including cisplatin. The efficacy of cisplatin therapy is often limited by the emergence of resistant tumours following treatment. Cisplatin resistance is multi-factorial but can be associated with increased DNA repair capacity, mutations in p53 or loss of DNA mismatch repair capacity. Methods RNA interference (RNAi was used to reduce the transcription-coupled nucleotide excision repair (TC-NER capacity of several prostate and colorectal carcinoma cell lines with specific defects in p53 and/or DNA mismatch repair. The effect of small inhibitory RNAs designed to target the CSB (Cockayne syndrome group B transcript on TC-NER and the sensitivity of cells to cisplatin-induced apoptosis was determined. Results These prostate and colon cancer cell lines were initially TC-NER proficient and RNAi against CSB significantly reduced their DNA repair capacity. Decreased TC-NER capacity was associated with an increase in the sensitivity of tumour cells to cisplatin-induced apoptosis, even in p53 null and DNA mismatch repair-deficient cell lines. Conclusion The present work indicates that CSB and TC-NER play a prominent role in determining the sensitivity of tumour cells to cisplatin even in the absence of p53 and DNA mismatch repair. These results further suggest that CSB represents a potential target for cancer therapy that may be important to overcome resistance to cisplatin in the clinic.

  13. Nucleotide Excision Repair Is Not Induced in Human Embryonic Lung Fibroblasts Treated with Environmental Pollutants

    Rössner ml., Pavel; Mrhálková, Andrea; Uhlířová, Kateřina; Špátová, Milada; Rössnerová, Andrea; Líbalová, Helena; Schmuczerová, Jana; Milcová, Alena; Topinka, Jan; Šrám, Radim


    Roč. 8, č. 7 (2013), e69197 E-ISSN 1932-6203 R&D Projects: GA ČR GAP503/11/0084 Institutional support: RVO:68378041 Keywords : environmental pollutants * DNA * expression of DNA Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 3.534, year: 2013

  14. Nucleotide excision repair : a multi-step mechanism required to maintain genome integrity

    Moser, Jill


    DNA is continuously exposed to exogenous and genotoxic insults including ionizing and ultraviolet radiation as well as chemical agents. DNA damage can compromise the integrity of the genome and have potentially deleterious effects. Ultraviolet light (UV) can induce the formation of helix distorting

  15. Inter-individual variation in nucleotide excision repair pathway is modulated by non-synonymous polymorphisms in ERCC4 and MBD4 genes

    Allione, Alessandra, E-mail: [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Guarrera, Simonetta; Russo, Alessia [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Ricceri, Fulvio [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Department of Medical Sciences, University of Turin, Via Santena 19, 10126 Turin (Italy); Purohit, Rituraj [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Bioinformatics Division, School of Bio Sciences and Technology, Vellore Institute of Technology University, Vellore 632014, Tamil Nadu (India); Pagnani, Andrea; Rosa, Fabio; Polidoro, Silvia; Voglino, Floriana [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Matullo, Giuseppe [Human Genetics Foundation (HuGeF), Via Nizza 52, 10126 Turin (Italy); Department of Medical Sciences, University of Turin, Via Santena 19, 10126 Turin (Italy)


    Highlights: • We reported a large inter-individual variability of NER capacity. • ERCC4 rs1800124 and MBD4 rs10342 nsSNP variants were associated with DNA repair capacity. • DNA–protein interaction analyses showed alteration of binding for ERCC4 and MBD4 variants. • A new possible cross-talk between NER and BER pathways has been reported. - Abstract: Inter-individual differences in DNA repair capacity (DRC) may lead to genome instability and, consequently, modulate individual cancer risk. Among the different DNA repair pathways, nucleotide excision repair (NER) is one of the most versatile, as it can eliminate a wide range of helix-distorting DNA lesions caused by ultraviolet light irradiation and chemical mutagens. We performed a genotype–phenotype correlation study in 122 healthy subjects in order to assess if any associations exist between phenotypic profiles of NER and DNA repair gene single nucleotide polymorphisms (SNPs). Individuals were genotyped for 768 SNPs with a custom Illumina Golden Gate Assay, and peripheral blood mononuclear cells (PBMCs) of the same subjects were tested for a NER comet assay to measure DRC after challenging cells by benzo(a)pyrene diolepoxide (BPDE). We observed a large inter-individual variability of NER capacity, with women showing a statistically significant lower DRC (mean ± SD: 6.68 ± 4.76; p = 0.004) than men (mean ± SD: 8.89 ± 5.20). Moreover, DRC was significantly lower in individuals carrying a variant allele for the ERCC4 rs1800124 non-synonymous SNP (nsSNP) (p = 0.006) and significantly higher in subjects with the variant allele of MBD4 rs2005618 SNP (p = 0.008), in linkage disequilibrium (r{sup 2} = 0.908) with rs10342 nsSNP. Traditional in silico docking approaches on protein–DNA and protein–protein interaction showed that Gly875 variant in ERCC4 (rs1800124) decreases the DNA–protein interaction and that Ser273 and Thr273 variants in MBD4 (rs10342) indicate complete loss of protein–DNA

  16. Loss of Nucleotide Excision Repair as a Source of Genomic Instability in Breast Cancer

    Ford, James M


    .... Our objective is to study DNA repair activity in primary breast epithelial cells and cancer tissues from women at risk for or diagnosed with breast cancer to determine if NER activity can be reliably...

  17. Differences in nucleotide excision repair capacity between newly diagnosed colorectal cancer patients and healthy controls

    Slyšková, Jana; Naccarati, Alessio; Pardini, Barbara; Poláková, Veronika; Vodičková, Ludmila; Šmerhovský, Z.; Levý, M.; Lipská, L.; Liška, V.; Vodička, Pavel (ed.)


    Roč. 27, č. 2 (2012), s. 225-232 ISSN 0267-8357 R&D Projects: GA ČR GAP304/10/1286; GA MZd NS10230 Grant - others:EEA-research fund:(NO) A/CZ0046/2/0012 Institutional research plan: CEZ:AV0Z50390512 Keywords : biomarkers * DNA damage * DNA repair capacity Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.500, year: 2012

  18. Excision repair of 5,6-dihydroxydihydrothymine from the DNA of Micrococcus radiodurans

    Targovnik, H.S.; Hariharan, P.V.


    One of the major ionizing radiation products, 5,6-dihydroxydihydrothymine (thymine glycol), was measured in the DNA of Micrococcus radiodurans following exposure of cells to 6.8-MeV electrons or 254-nm ultraviolet light. Removal of 5,6-dihydroxydihydrothymine was measured in both an ionizing radiation-sensitive strain (262) and a highly radioresistant strain (the wild type W + ) of Micrococcus radiodurans. Within 30 min of incubation (33 0 C) following exposure to ultraviolet light (2400 J/m 2 ) approximately 60% of the thymine glycols were excised, whereas in the case of ionizing radiation (250 krad) only 35% were removed from the cellular DNA of the wild-type strain. In contrast less than 50% of the thymine glycols were excised from the sensitive strain. The amount of DNA degradation induced by radiation was less than 10% in both strains. The results suggest a possible correlation between reduced excision repair of base damage and increased radiation sensitivity

  19. Functional, genetic and epigenetic aspects of base and nucleotide excision repair in colorectal carcinomas

    Slyšková, Jana; Korenková, Vlasta; Collins, A. R.; Procházka, Pavel; Vodičková, Ludmila; Švec, Jiří; Lipská, L.; Levý, M.; Schneiderová, M.; Liška, V.; Holubec, L.; Kumar, R.; Souček, P.; Naccarati, Alessio; Vodička, Pavel


    Roč. 18, č. 21 (2012), s. 5878-5887 ISSN 1078-0432 R&D Projects: GA ČR GAP304/12/1585; GA ČR(CZ) GAP304/10/1286; GA MZd NT12025 Grant - others:UICC(XE) ICR/11/068/2011; EEA-research fund:(NO) B/CZ0046/40031 Institutional research plan: CEZ:AV0Z50390512 Institutional support: RVO:68378041 ; RVO:86652036 Keywords : DNA repair capacity * DNA repair gene expression * methylation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 7.837, year: 2012

  20. Nucleotide excision repair : complexes and complexities : a study of global genome repair in human cells

    Volker, Marcel


    Of all exogenous agents that damage genomic DNA and hence threaten its integrity, the ultraviolet B (UVB) component of sunlight is highly relevant because of its abundance. UVB induces predominantly cyclobutane pyrimidine dimers and 6-4 photoproducts. In humans, these photolesions are repaired by

  1. Excision of thymine dimers from specifically incised DNA by extracts of xeroderma pigmentosum cells

    Cook, K; Friedberg, E C; Slor, H; Cleaver, J E


    DNA repair defects as exhibited in fibroblasts from patients with xeroderma pigmentosa were studied. Five complementation groups for excision-repair defects were examined to test the hypothesis that a defective endonuclease or exonuclease may be the cause. No evidence was found to indicate that the enzyme activity functions in dimer excision. Since ultraviolet irradiated E. coli DNA incised with an endonuclease purified from phage-infected cells were used, it is possible that other factors may be involved in human UV endonuclease action. (JWP)

  2. Polymorphisms in miRNA binding sites of nucleotide excision repair genes and colorectal cancer risk

    Naccarati, Alessio; Pardini, Barbara; Landi, S.; Landi, D.; Slyšková, Jana; Novotný, J.; Levý, M.; Poláková, Veronika; Lipská, L.; Vodička, Pavel


    Roč. 33, č. 7 (2012), s. 1346-1351 ISSN 0143-3334 R&D Projects: GA ČR GAP304/10/1286; GA ČR GP305/09/P194 Institutional research plan: CEZ:AV0Z50390703 Keywords : DNA repair * polymorphisms * miRNA binding sites Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.635, year: 2012

  3. Excision of pyrimidine dimers from epidermal DNA and nonsemiconservative epidermal DNA synthesis following ultraviolet irradiation of mouse skin

    Bowden, G.T.; Trosko, J.E.; Shapas, B.G.; Boutwell, R.K.


    Pyrimidine dimer production and excision in epidermal DNA were studied at five different dose levels of ultraviolet light in the skin of intact mice. Dimer production increased with dose up to 50,400 ergs/sq mm. Approximately 30 percent of the thymine-containing dimers were excised by 24 hr after irradiation at three lower dose levels of ultraviolet light. Nonsemiconservative DNA replication in ultraviolet-irradiated mouse skin was shown to continue for at least 18 hr. The rate of nonsemiconservative replication decreased with time, but did so slowly. The initial rates of nonsemiconservative replication increased with ultraviolet light dose levels up to about 4200 ergs/sq mm, after which the initial rates were decreased. Semiconservative epidermal DNA synthesis was shown to be inhibited by hydroxyurea, but hydroxyurea had no effect on ultraviolet light-induced nonsemiconservative DNA replication. The observed pyrimidine dimer excision and nonsemiconservative DNA replication suggest that in the intact mouse the cells of the epidermis are capable of DNA excision repair after ultraviolet irradiation of mouse skin

  4. Excision and crosslink repair of DNA and sister chromatid exchanges in cultured human fibroblasts with different repair capacities

    Fujiwara, Y; Kano, Y; Paul, P; Goto, K; Yamamoto, K [Kobe Univ. (Japan). School of Medicine


    Xeroderma pigmentosum (XP) groups A to G lacked the initial stage of ultraviolet (UV) excision repair in the order of A = G > C > D > E asymptotically equals F, while the XP variant was weakly defective in the later repair steps. Killing sensitivities were in the orders of A >= G > D > C > E asymptotically equals F asymptotically equals variant > normal to UV, A = G > D > F > C = E > variant > normal to 4-nitroquinoline-1-oxide (4NQO), and A > C > D = E = F = variant > G = normal to decarbamoyl mitomycin-C(DCMC). The induced sister chromatid exchange (SCE) frequency was unrelated to the extent of repair deficiency. The SCE induction rate was consistently 3 - 6 fold higher by these UV-like mutagens in XP group A cells than in normal cells. However, repair-proficient Cockayne's syndrome (CS) cells showed a higher SCE induction by UV, which was normalized by NAD/sup +/, suggesting that chromatin lesions as well as DNA damage contribute to SCE. Two-step crosslink repair involves a first rapid half-excision and a second slow nucleotide-excision repair. Fanconi's anemia (FA) cells had an impaired first half-excision and were supersensitive to MC, but not to UV and DCMC. The SCE frequency induced by MC (1 hr) was higher in FA cells than in normal cells despite their normal response to DCMC, and vice versa in XP cells. FA cells lacked the first rapid decline and showed higher remaining SCEs. Thus, part of the crosslink seems to lead to SCE formation. Caffeine synergistically elevated UV-induced SCEs, but not UV induced mutations in V79 cells, implying that SCE may not necessarily involve mutation.

  5. Excision and crosslink repair of DNA and sister chromatid exchanges in cultured human fibroblasts with different repair capacities

    Fujiwara, Yoshisada; Kano, Yoshio; Paul, P.; Goto, Kaoru; Yamamoto, Kazuo


    Xeroderma pigmentosum (XP) groups A to G lacked the initial stage of ultraviolet (UV) excision repair in the order of A = G > C > D > E asymptotically equals F, while the XP variant was weakly defective in the later repair steps. Killing sensitivities were in the orders of A >= G > D > C > E asymptotically equals F asymptotically equals variant > normal to UV, A = G > D > F > C = E > variant > normal to 4-nitroquinoline-1-oxide (4NQO), and A > C > D = E = F = variant > G = normal to decarbamoyl mitomycin-C(DCMC). The induced sister chromatid exchange (SCE) frequency was unrelated to the extent of repair deficiency. The SCE induction rate was consistently 3 - 6 fold higher by these UV-like mutagens in XP group A cells than in normal cells. However, repair-proficient Cockayne's syndrome (CS) cells showed a higher SCE induction by UV, which was normalized by NAD + , suggesting that chromatin lesions as well as DNA damage contribute to SCE. Two-step crosslink repair involves a first rapid half-excision and a second slow nucleotide-excision repair. Fanconi's anemia (FA) cells had an impaired first half-excision and were supersensitive to MC, but not to UV and DCMC. The SCE frequency induced by MC (1 hr) was higher in FA cells than in normal cells despite their normal response to DCMC, and vice versa in XP cells. FA cells lacked the first rapid decline and showed higher remaining SCEs. Thus, part of the crosslink seems to lead to SCE formation. Caffeine synergistically elevated UV-induced SCEs, but not UV induced mutations in V79 cells, implying that SCE may not necessarily involve mutation. (J.P.N.)

  6. Excision and crosslink repair of DNA and sister chromatid exchanges in cultured human fibroblasts with different repair capacities

    Fujiwara, Y.; Kano, Y.; Paul, P.; Goto, K.; Yamamoto, K. (Kobe Univ. (Japan). School of Medicine)


    Xeroderma pigmentosum (XP) groups A to G lacked the initial stage of ultraviolet (UV) excision repair in the order of A = G > C > D > E asymptotically equals F, while the XP variant was weakly defective in the later repair steps. Killing sensitivities were in the orders of A >= G > D > C > E asymptotically equals F asymptotically equals variant > normal to UV, A = G > D > F > C = E > variant > normal to 4-nitroquinoline-1-oxide (4NQO), and A > C > D = E = F = variant > G = normal to decarbamoyl mitomycin-C(DCMC). The induced sister chromatid exchange (SCE) frequency was unrelated to the extent of repair deficiency. The SCE induction rate was consistently 3 - 6 fold higher by these UV-like mutagens in XP group A cells than in normal cells. However, repair-proficient Cockayne's syndrome (CS) cells showed a higher SCE induction by UV, which was normalized by NAD/sup +/, suggesting that chromatin lesions as well as DNA damage contribute to SCE. Two-step crosslink repair involves a first rapid half-excision and a second slow nucleotide-excision repair. Fanconi's anemia (FA) cells had an impaired first half-excision and were supersensitive to MC, but not to UV and DCMC. The SCE frequency induced by MC (1 hr) was higher in FA cells than in normal cells despite their normal response to DCMC, and vice versa in XP cells. FA cells lacked the first rapid decline and showed higher remaining SCEs. Thus, part of the crosslink seems to lead to SCE formation. Caffeine synergistically elevated UV-induced SCEs, but not UV induced mutations in V79 cells, implying that SCE may not necessarily involve mutation.

  7. Site-specific analysis of UV-induced cyclobutane pyrimidine dimers in nucleotide excision repair-proficient and -deficient hamster cells: Lack of correlation with mutational spectra

    Vreeswijk, Maaike P.G.; Meijers, Caro M.; Giphart-Gassler, Micheline; Vrieling, Harry; Zeeland, Albert A. van; Mullenders, Leon H.F.; Loenen, Wil A.M.


    Irradiation of cells with UVC light induces two types of mutagenic DNA photoproducts, i.e. cyclobutane pyrimidine dimers (CPD) and pyrimidine (6-4) pyrimidone photoproducts (6-4PP). To investigate the relationship between the frequency of UV-induced photolesions at specific sites and their ability to induce mutations, we quantified CPD formation at the nucleotide level along exons 3 and 8 of the hprt gene using ligation-mediated PCR, and determined the mutational spectrum of 132 UV-induced hprt mutants in the AA8 hamster cell line and of 165 mutants in its nucleotide excision repair-defective derivative UV5. In AA8 cells, transversions predominated with a strong strand bias towards thymine-containing photolesions in the non-transcribed strand. As hamster AA8 cells are proficient in global genome repair of 6-4PP but selectively repair CPD from the transcribed strand of active genes, most mutations probably resulted from erroneous bypass of CPD in the non-transcribed strand. However, the relative incidence of CPD and the positions where mutations most frequently arose do not correlate. In fact some major damage sites hardly gave rise to the formation of mutations. In the repair-defective UV5 cells, mutations were almost exclusively C > T transitions caused by photoproducts at PyC sites in the transcribed strand. Even though CPD were formed at high frequencies at some TT sites in UV5, these photoproducts did not contribute to mutation induction at all. We conclude that, even in the absence of repair, large variations in the level of induction of CPD at different sites throughout the two exons do not correspond to frequencies of mutation induction.

  8. Nucleotide excision repair modulates the cytotoxic and mutagenic effects of N-n-butyl-N-nitrosourea in cultured mammalian cells as well as in mouse splenocytes in vivo.

    Bol, S A; van Steeg, H; van Oostrom, C T; Tates, A D; Vrieling, H; de Groot, A J; Mullenders, L H; van Zeeland, A A; Jansen, J G


    The butylating agent N-n-butyl-N-nitrosourea (BNU) was employed to study the role of nucleotide excision repair (NER) in protecting mammalian cells against the genotoxic effects of monofunctional alkylating agents. The direct acting agent BNU was found to be mutagenic in normal and XPA mouse splenocytes after a single i.p. treatment in vivo. After 25 and 35 mg/kg BNU, but not after 75 mg/ kg, 2- to 3-fold more hprt mutants were detected in splenocytes from XPA mice than from normal mice. Using O6-alkylguanine-DNA alkyltransferase (AGT)-deficient hamster cells, it was found that NER-deficient CHO UV5 cells carrying a mutation in the ERCC-2 gene were 40% more mutable towards lesions induced by BNU when compared with parental NER-proficient CHO AA8 cells. UV5 cells were 1.4-fold more sensitive to the cytotoxic effects of BNU compared with AA8 cells. To investigate whether this increased sensitivity of NER-deficient cells is modulated by AGT activity, cell survival studies were performed in human and mouse primary fibroblasts as well. BNU was 2.7-fold more toxic for mouse XPA fibroblasts compared with normal mouse fibroblasts. Comparable results were found for human fibroblasts. Taken together these data indicate that the role of NER in protecting rodent cells against the mutagenic and cytotoxic effects of the alkylating agent BNU depends on AGT.

  9. Modulation of DNA polymerase beta-dependent base excision repair in cultured human cells after low dose exposure to arsenite

    Sykora, Peter; Snow, Elizabeth T.


    Base excision repair (BER) is crucial for development and for the repair of endogenous DNA damage. However, unlike nucleotide excision repair, the regulation of BER is not well understood. Arsenic, a well-established human carcinogen, is known to produce oxidative DNA damage, which is repaired primarily by BER, whilst high doses of arsenic can also inhibit DNA repair. However, the mechanism of repair inhibition by arsenic and the steps inhibited are not well defined. To address this question we have investigated the regulation of DNA polymerase β (Pol β) and AP endonuclease (APE1), in response to low, physiologically relevant doses of arsenic. GM847 lung fibroblasts and HaCaT keratinocytes were exposed to sodium arsenite, As(III), and mRNA, protein levels and BER activity were assessed. Both Pol β and APE1 mRNA exhibited significant dose-dependant down regulation at doses of As(III) above 1 μM. However, at lower doses Pol β mRNA and protein levels, and consequently, BER activity were significantly increased. In contrast, APE1 protein levels were only marginally increased by low doses of As(III) and there was no correlation between APE1 and overall BER activity. Enzyme supplementation of nuclear extracts confirmed that Pol β was rate limiting. These changes in BER correlated with overall protection against sunlight UV-induced toxicity at low doses of As(III) and produced synergistic toxicity at high doses. The results provide evidence that changes in BER due to low doses of arsenic could contribute to a non-linear, threshold dose response for arsenic carcinogenesis

  10. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C


    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  11. DNA Damage and Base Excision Repair in Mitochondria and Their Role in Aging

    Ricardo Gredilla


    Full Text Available During the last decades, our knowledge about the processes involved in the aging process has exponentially increased. However, further investigation will be still required to globally understand the complexity of aging. Aging is a multifactorial phenomenon characterized by increased susceptibility to cellular loss and functional decline, where mitochondrial DNA mutations and mitochondrial DNA damage response are thought to play important roles. Due to the proximity of mitochondrial DNA to the main sites of mitochondrial-free radical generation, oxidative stress is a major source of mitochondrial DNA mutations. Mitochondrial DNA repair mechanisms, in particular the base excision repair pathway, constitute an important mechanism for maintenance of mitochondrial DNA integrity. The results reviewed here support that mitochondrial DNA damage plays an important role in aging.

  12. Single-nucleotide polymorphisms in base excision repair, nucleotide excision repair, and double strand break genes as markers for response to radiotherapy in patients with Stage I to II head-and-neck cancer

    Carles, Joan; Monzo, Mariano; Amat, Marta; Jansa, Sonia; Artells, Rosa; Navarro, Alfons; Foro, Palmira; Alameda, Francesc; Gayete, Angel; Gel, Bernat; Miguel, Maribel; Albanell, Joan; Fabregat, Xavier


    Purpose: Polymorphisms in DNA repair genes can influence response to radiotherapy. We analyzed single-nucleotide polymorphisms (SNP) in nine DNA repair genes in 108 patients with head-and-neck cancer (HNSCC) who had received radiotherapy only. Methods and Materials: From May 1993 to December 2004, patients with Stage I and II histopathologically confirmed HNSCC underwent radiotherapy. DNA was obtained from paraffin-embedded tissue, and SNP analysis was performed using a real-time polymerase chain reaction allelic discrimination TaqMan assay with minor modifications. Results: Patients were 101 men (93.5%) and 7 (6.5%) women, with a median age of 64 years (range, 40 to 89 years). Of the patients, 76 (70.4%) patients were Stage I and 32 (29.6%) were Stage II. The XPF/ERCC1 SNP at codon 259 and XPG/ERCC5 at codon 46 emerged as significant predictors of progression (p 0.00005 and 0.049, respectively) and survival (p = 0.0089 and 0.0066, respectively). Similarly, when variant alleles of XPF/ERCC1, XPG/ERCC5 and XPA were examined in combination, a greater number of variant alleles was associated with shorter time to progression (p = 0.0003) and survival (p 0.0002). Conclusions: Genetic polymorphisms in XPF/ERCC1, XPG/ERCC5, and XPA may significantly influence response to radiotherapy; large studies are warranted to confirm their role in HNSCC

  13. DNA Base Excision Repair (BER) and Cancer Gene Therapy: Use of the Human N-mythlpurien DNA Glycosylase (MPG) to Sensitize Breast Cancer Cells to Low Dose Chemotherapy

    Harvey, Tia


    The DNA Base Excision Repair (PER) pathway is responsible for the repair of alkylation and oxidative DNA damage resulting in protection against the deleterious effects of endogenous and exogenous agents encountered on a daily basis...

  14. Oxidatively-induced DNA damage and base excision repair in euthymic patients with bipolar disorder.

    Ceylan, Deniz; Tuna, Gamze; Kirkali, Güldal; Tunca, Zeliha; Can, Güneş; Arat, Hidayet Ece; Kant, Melis; Dizdaroglu, Miral; Özerdem, Ayşegül


    Oxidatively-induced DNA damage has previously been associated with bipolar disorder. More recently, impairments in DNA repair mechanisms have also been reported. We aimed to investigate oxidatively-induced DNA lesions and expression of DNA glycosylases involved in base excision repair in euthymic patients with bipolar disorder compared to healthy individuals. DNA base lesions including both base and nucleoside modifications were measured using gas chromatography-tandem mass spectrometry and liquid chromatography-tandem mass spectrometry with isotope-dilution in DNA samples isolated from leukocytes of euthymic patients with bipolar disorder (n = 32) and healthy individuals (n = 51). The expression of DNA repair enzymes OGG1 and NEIL1 were measured using quantitative real-time polymerase chain reaction. The levels of malondialdehyde were measured using high performance liquid chromatography. Seven DNA base lesions in DNA of leukocytes of patients and healthy individuals were identified and quantified. Three of them had significantly elevated levels in bipolar patients when compared to healthy individuals. No elevation of lipid peroxidation marker malondialdehyde was observed. The level of OGG1 expression was significantly reduced in bipolar patients compared to healthy individuals, whereas the two groups exhibited similar levels of NEIL1 expression. Our results suggest that oxidatively-induced DNA damage occurs and base excision repair capacity may be decreased in bipolar patients when compared to healthy individuals. Measurement of oxidatively-induced DNA base lesions and the expression of DNA repair enzymes may be of great importance for large scale basic research and clinical studies of bipolar disorder. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V


    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  16. How are base excision DNA repair pathways deployed in vivo? [version 1; referees: 4 approved

    Upasna Thapar


    Full Text Available Since the discovery of the base excision repair (BER system for DNA more than 40 years ago, new branches of the pathway have been revealed at the biochemical level by in vitro studies. Largely for technical reasons, however, the confirmation of these subpathways in vivo has been elusive. We review methods that have been used to explore BER in mammalian cells, indicate where there are important knowledge gaps to fill, and suggest a way to address them.

  17. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah


    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  18. Quantitative characterization of pyrimidine dimer excision from UV-irradiated DNA (excision capacity) by cell-free extracts of the yeast Saccharomyces cerevisiae

    Bekker, M.L.; Kaboev, O.K.; Akhmedov, A.T.; Luchkina, L.A.


    Cell-free extracts from wild-type yeast (RAD + ) and from rad mutants belonging to the RAD3 epistatic group (rad1-1, rad2-1, rad3-1, rad4-1) contain activities catalyzing the excision of pyrimidine dimers (PD) from purified ultraviolet-irradiated DNA which was not pre-treated with exogenous UV-endonuclease. The level of these activities in cell-free extracts from rad mutants did not differ from that in wild-type extract and was close to the in vivo excision capacity of the latter calculated from the LD 37 (about 10 4 PD per haploid genome). (Auth.)

  19. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA

    Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.


    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...

  20. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.


    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  1. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J


    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Base excision DNA repair in the embryonic development of the sea urchin, Strongylocentrotus intermedius.

    Torgasheva, Natalya A; Menzorova, Natalya I; Sibirtsev, Yurii T; Rasskazov, Valery A; Zharkov, Dmitry O; Nevinsky, Georgy A


    In actively proliferating cells, such as the cells of the developing embryo, DNA repair is crucial for preventing the accumulation of mutations and synchronizing cell division. Sea urchin embryo growth was analyzed and extracts were prepared. The relative activity of DNA polymerase, apurinic/apyrimidinic (AP) endonuclease, uracil-DNA glycosylase, 8-oxoguanine-DNA glycosylase, and other glycosylases was analyzed using specific oligonucleotide substrates of these enzymes; the reaction products were resolved by denaturing 20% polyacrylamide gel electrophoresis. We have characterized the profile of several key base excision repair activities in the developing embryos (2 blastomers to mid-pluteus) of the grey sea urchin, Strongylocentrotus intermedius. The uracil-DNA glycosylase specific activity sharply increased after blastula hatching, whereas the specific activity of 8-oxoguanine-DNA glycosylase steadily decreased over the course of the development. The AP-endonuclease activity gradually increased but dropped at the last sampled stage (mid-pluteus 2). The DNA polymerase activity was high at the first cleavage division and then quickly decreased, showing a transient peak at blastula hatching. It seems that the developing sea urchin embryo encounters different DNA-damaging factors early in development within the protective envelope and later as a free-floating larva, with hatching necessitating adaptation to the shift in genotoxic stress conditions. No correlation was observed between the dynamics of the enzyme activities and published gene expression data from developing congeneric species, S. purpuratus. The results suggest that base excision repair enzymes may be regulated in the sea urchin embryos at the level of covalent modification or protein stability.

  3. Evidence that DNA excision-repair in xeroderma pigmentosum group A is limited but biologically significant

    Hull, D.R.; Kantor, G.J.


    The loss of pyrimidine dimers in nondividing populations of an excision-repair deficient xeroderma pigmentosum group. A strain (XP12BE) was measured throughout long periods (up to 5 months) following exposure to low doses of ultraviolet light (UV, 254 nm) using a UV endonuclease-alkaline sedimentation assay. Excision of about 90% of the dimers induced by 1 J/m 2 occurred during the first 50 days. The rate curve has some similarities with that of normal excision-repair proficient cultures that may not be coincidental. Rate curves for both XP12BE and normal cultures are characterized by a fast and slow component, with both rate constants for the XP12BE cultures (0.15 day -1 and 0.025 day -1 ) a factor of 10 smaller than those observed for the respective components of normal cell cultures. The slow components for both XP12BE and normal cultures extrapolate to about 30% of the initial number of dimers. No further excision was detected throughout an additional 90-day period even though the cultures were capable of excision-repair of other newly-introduced pyrimidine dimers. We conclude that nondividing XP12BE cells in addition to having a slower repair rate, cannot repair some of the UV-induced DNA damage. The repair in XP12BE is shown to have biological significance as detected by a cell-survival assay and dose-fractionation techniques. Nondividing XP12BE cells are more resistant to UV when irradiated chronically than when irradiated acutely with the same total dose. (orig.)

  4. The influence of some prostaglandins on DNA synthesis and DNA excision repair in mouse spleen cells ''in vitro''

    Klein, W.; Altmann, H.; Kocsis, F.; Egg, D.; Guenther, R.


    ''In vitro'' experiments were performed on mouse spleen cells to establish possible influences of some naturally occurring prostaglandins on DNA synthesis and DNA excision repair. The prostaglandins A 1 , B 1 , E 1 , E 2 and Fsub(2α) were tested in concentrations of 10 pg, 5 ng and 2,5μg per ml cell suspension. DNA synthesis was significantly increased by PgFsub(2α) in all the three concentrations tested, while the other tested prostaglandins were essentially ineffective. DNA excision repair was significantly inhibited by PgE 1 and PgE 2 at 5 ng/ml and at 2,5 μg/ml but increased by PgFsub(2α) in the two lower concentrations. The rejoining of DNA-strand breaks after gamma-irradiation was slightly reduced by PgE 1 , PgE 2 and PgF 2 at 2,5 μg/ml. (author)

  5. DNA repair capacity and rate of excision repair in UV-irradiated mammalian cells

    Inoue, Masao; Takebe, Hiraku.


    Repair capacities of five mammalian cell strains were measured by colony-forming ability, HCR of UV-irradiated virus, UDS, pyrimidine dimer excision, and semi-conservative DNA replication. Colony-forming ability of UV-irradiated cells was high for human amnion FL cells and mouse L cells, slightly low for African green monkey CV-1 cells, and extremely low for xeroderma pigmentosum cells. HCR of UV-irradiated Herpes simplex virus was high in CV-1 cells, FL and normal human fibroblast cells, low in both XP and L cells. The amount of UDS was high in FL and normal human fibroblast cells, considerably low in CV-1 cells, and essentially no UDS was observed in XP cells. Rate of UDS after UV-irradiation was slower for CV-1 cells than FL and human fibroblast cells. Rate of the excision of thymine-containing dimers from the acid-insoluble fraction during post-irradiation incubation of the cells was rapid in FL and normal human cells and slow in CV-1 cells, and no excision took place in XP cells. Semi-conservative DNA synthesis was reduced after UV-irradiation in all cell lines, but subsequently recovered in FL, normal human and CV-1 cells. The onset of recovery was 4 h after UV-irradiation for FL and normal human cells, but about 6 h for CV-1 cells. The apparent intermediate repair of CV-1 cells except for HCR may be related to the slow rate of excision repair. ''Patch and cut'' model is more favorable than ''cut and patch'' model to elucidate these results. (auth.)

  6. Physico-chemical and biological study of excision-repair of UV-irradiated PHIX 174 RF DNA in vitro

    Heijneker, H.L.


    A study is presented on the excision repair of ultraviolet-irradiated PHIX 174 RFI DNA in vitro with UV-specific endonuclease from micrococcus luteus, DNA polymerase I from E. coli and DNA ligase from phage T 4 infected E. coli. Excision repair was measured by physico-chemical and by biological methods. It is shown that more than 90% of the pyrimidine dimers can be repaired in vitro and that the repaired molecules have regained full biological activity. Endonuclease III was not essential for excision repair in vitro and did not stimulate repair; from this it was concluded that UV-endo generates 3' OH endgroups. The usefulness of the methods with regard to the study of excision repair is discussed

  7. DNA excision repair in cell extracts from human cell lines exhibiting hypersensitivity to DNA-damaging agents

    Hansson, J.; Keyse, S.M.; Lindahl, T.; Wood, R.D.


    Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurements of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links

  8. Condensing the information in DNA with double-headed nucleotides

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte


    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  9. Recovery of DNA synthesis after ultraviolet irradiation of xeroderma pigmentosum cells depends on excision repair and is blocked by caffeine

    Park, S.D.; Cleaver, J.E.


    Normal human and xeroderma pigmentosum (XP, excision-defective group A) cells (both SV40-transformed) pulse-labeled with [ 3 H] thymidine at various times after irradiation with ultraviolet light showed a decline and recovery of both the molecular weights of newly synthesized DNA and the rated of synthesis per cell. At the same ultraviolet dose, both molecular weights and rates of synthesis were inhibited more in XP than in normal cells. This indicates that excision repair plays a role in minimizing the inhibition of chain growth, possibly by excision of dimers ahead of the growing point. The ability to synthesize normal-sized DNA recovered more rapidly than rates of synthesis in normal cells, but both parameters recovered in phase in XP cells. During recovery in normal cells there are therefore fewer actively replicating clusters of replicons because the single-strand breaks involved in the excision of dimers inhibit replicon initiation. XP cells have few excision repair events and therefore fewer breaks to interfere with initiation, but chain growth is blocked by unexcised dimers. In both cell types recovery of the ability to synthesize normal-sized DNA was prevented by growing cells in caffeine after irradiation, possibly because of competition between the DNA binding properties of caffeine and replication proteins. These observations imply that excision repair and semiconservative replication interact strongly in irradiated cells to produce a complex spectrum of changes in DNA replication which may be confused with parts of alternative systems such as post-replication repair. (author)

  10. 1-{beta}-D-arabinofuranosylcytosine is cytotoxic in quiescent normal lymphocytes undergoing DNA excision repair

    Yamauchi, Takahiro; Kawai, Yasukazu; Ueda, Takanori [Fukui Medical Univ., Matsuoka (Japan)


    We have sought to clarify the potential activity of the S-phase-specific antileukemic agent 1-{beta}-D-arabinofuranosylcytosine (ara-C), an inhibitor of DNA synthesis, in quiescent cells that are substantially non-sensitive to nucleoside analogues. It was hypothesized that the combination of ara-C with DNA damaging agents that initiate DNA repair will expand ara-C cytotoxicity to non-cycling cells. The repair kinetics, which included incision of damaged DNA, gap-filling by DNA synthesis and rejoining by ligation, were evaluated using the single cell gel electrophoresis (Comet) assay and the thymidine incorporation assay. When normal lymphocytes were treated with ultraviolet C or with 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU), the processes of DNA excision repair were promptly initiated and rapidly completed. When the cells were incubated with ara-C prior to irradiation or BCNU treatment, the steps of DNA synthesis and rejoining in the repair processes were both inhibited. The ara-C-mediated inhibition of the repair processes was concentration-dependent, with the effect peaking at 10{mu}M. The combination of ara-C with these DNA repair initiators exerted subsequent cytotoxicity, which was proportional to the extent of the repair inhibition in the presence of ara-C. In conclusion, ara-C was cytotoxic in quiescent cells undergoing DNA repair. This might be attributed to unrepaired DNA damage that remained in the cells, thereby inducing lethal cytotoxicity. Alternatively, ara-C might exert its own cytotoxicity by inhibiting DNA synthesis in the repair processes. Such a strategy may be effective against a dormant subpopulation in acute leukemia that survives chemotherapy. (author)

  11. 1-β-D-arabinofuranosylcytosine is cytotoxic in quiescent normal lymphocytes undergoing DNA excision repair

    Yamauchi, Takahiro; Kawai, Yasukazu; Ueda, Takanori


    We have sought to clarify the potential activity of the S-phase-specific antileukemic agent 1-β-D-arabinofuranosylcytosine (ara-C), an inhibitor of DNA synthesis, in quiescent cells that are substantially non-sensitive to nucleoside analogues. It was hypothesized that the combination of ara-C with DNA damaging agents that initiate DNA repair will expand ara-C cytotoxicity to non-cycling cells. The repair kinetics, which included incision of damaged DNA, gap-filling by DNA synthesis and rejoining by ligation, were evaluated using the single cell gel electrophoresis (Comet) assay and the thymidine incorporation assay. When normal lymphocytes were treated with ultraviolet C or with 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU), the processes of DNA excision repair were promptly initiated and rapidly completed. When the cells were incubated with ara-C prior to irradiation or BCNU treatment, the steps of DNA synthesis and rejoining in the repair processes were both inhibited. The ara-C-mediated inhibition of the repair processes was concentration-dependent, with the effect peaking at 10μM. The combination of ara-C with these DNA repair initiators exerted subsequent cytotoxicity, which was proportional to the extent of the repair inhibition in the presence of ara-C. In conclusion, ara-C was cytotoxic in quiescent cells undergoing DNA repair. This might be attributed to unrepaired DNA damage that remained in the cells, thereby inducing lethal cytotoxicity. Alternatively, ara-C might exert its own cytotoxicity by inhibiting DNA synthesis in the repair processes. Such a strategy may be effective against a dormant subpopulation in acute leukemia that survives chemotherapy. (author)

  12. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...



    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  13. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I


    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  14. Base excision repair in Archaea: back to the future in DNA repair.

    Grasso, Stefano; Tell, Gianluca


    Together with Bacteria and Eukarya, Archaea represents one of the three domain of life. In contrast with the morphological difference existing between Archaea and Eukarya, these two domains are closely related. Phylogenetic analyses confirm this evolutionary relationship showing that most of the proteins involved in DNA transcription and replication are highly conserved. On the contrary, information is scanty about DNA repair pathways and their mechanisms. In the present review the most important proteins involved in base excision repair, namely glycosylases, AP lyases, AP endonucleases, polymerases, sliding clamps, flap endonucleases, and ligases, will be discussed and compared with bacterial and eukaryotic ones. Finally, possible applications and future perspectives derived from studies on Archaea and their repair pathways, will be taken into account. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. Assessment of single nucleotide polymorphisms in screening 52 DNA repair and cell cycle control genes in Fanconi anemia patients

    Petrović Sandra


    Full Text Available Fanconi anemia (FA is a rare genetically heterogeneous disorder associated with bone marrow failure, birth defects and cancer susceptibility. Apart from the disease- causing mutations in FANC genes, the identification of specific DNA variations, such as single nucleotide polymorphisms (SNPs, in other candidate genes may lead to a better clinical description of this condition enabling individualized treatment with improvement of the prognosis. In this study, we have assessed 95 SNPs located in 52 key genes involved in base excision repair (BER, nucleotide excision repair (NER, mismatch repair (MMR, double strand break (DSB repair and cell cycle control using a DNA repair chip (Asper Biotech, Estonia which includes most of the common variants for the candidate genes. The SNP genotyping was performed in five FA-D2 patients and in one FA-A patient. The polymorphisms studied were synonymous (n=10, nonsynonymous (missense (n=52 and in non-coding regions of the genome (introns and 5 ‘and 3’ untranslated regions (UTR (n=33. Polymorphisms found at the homozygous state are selected for further analysis. Our results have shown a significant inter-individual variability among patients in the type and the frequency of SNPs and also elucidate the need for further studies of polymorphisms located in ATM, APEX APE 1, XRCC1, ERCC2, MSH3, PARP4, NBS1, BARD1, CDKN1B, TP53 and TP53BP1 which may be of great importance for better clinical description of FA. In addition, the present report recommends the use of SNPs as predictive and prognostic genetic markers to individualize therapy of FA patients. [Projekat Ministarstva nauke Republike Srbije, br. 173046

  16. Role of excision repair in postradiation recovery of biological activity of cellular DNA Bacillus subtilis

    Filippov, V.D.


    DNA extracted from UV-irradiated prototroph cells of Bacillus subtilis uvr + (45 sec. of UV light, 20% survivals) has a lowered transforming activity (TA) of markers purB and metB, and a lowered ratio TA pur/TA met. During the subsequent incubation of uvr + cells in glucose-salt medium free of nitrogen sources the TA of markers and the ratio between them increase. No increase is observed during the postradiation incubation under the same conditions or in a nutrition medium of uvr cells, deficient in escision of pyrimidine dimers. The increment of DNA begins approsimately in 30 min. after the beginning of incubation of irradiated uvr cells in nutrition medium. On the basis of these facts it is concluded that neither the replication of damaged DNA nor the postreplication repair, but only excision repair, can provide the recovery of biological (transforming) activity of cellular DNA in Bac. subtilis. The system given might be a suitable model for testing compounds which affect the activity of this process. The well-known inhibitors of dark repair, caffeine, proflavine to inhibit reversibly the initial steps of the process/ and especially acriflavine, delay the recovery of markers of cellular DNA in irradiated uvr + cells. Caffeine is proved to inhibit reversibly the initial steps of the process

  17. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier, E-mail:


    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL{sup −1} and 50 μg mL{sup −1} of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair

  18. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier


    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL −1 and 50 μg mL −1 of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities

  19. Chromatin associated mechanisms in base excision repair - nucleosome remodeling and DNA transcription, two key players.

    Menoni, Hervé; Di Mascio, Paolo; Cadet, Jean; Dimitrov, Stefan; Angelov, Dimitar


    Genomic DNA is prone to a large number of insults by a myriad of endogenous and exogenous agents. The base excision repair (BER) is the major mechanism used by cells for the removal of various DNA lesions spontaneously or environmentally induced and the maintenance of genome integrity. The presence of persistent DNA damage is not compatible with life, since abrogation of BER leads to early embryonic lethality in mice. There are several lines of evidences showing existence of a link between deficient BER, cancer proneness and ageing, thus illustrating the importance of this DNA repair pathway in human health. Although the enzymology of BER mechanisms has been largely elucidated using chemically defined DNA damage substrates and purified proteins, the complex interplay of BER with another vital process like transcription or when DNA is in its natural state (i.e. wrapped in nucleosome and assembled in chromatin fiber is largely unexplored. Cells use chromatin remodeling factors to overcome the general repression associated with the nucleosomal organization. It is broadly accepted that energy-dependent nucleosome remodeling factors disrupt histones-DNA interactions at the expense of ATP hydrolysis to favor transcription as well as DNA repair. Importantly, unlike transcription, BER is not part of a regulated developmental process but represents a maintenance system that should be efficient anytime and anywhere in the genome. In this review we will discuss how BER can deal with chromatin organization to maintain genetic information. Emphasis will be placed on the following challenging question: how BER is initiated within chromatin? Copyright © 2017 Elsevier Inc. All rights reserved.

  20. The role of the PHP domain associated with DNA polymerase X from Thermus thermophilus HB8 in base excision repair.

    Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji


    Base excision repair (BER) is one of the most commonly used DNA repair pathways involved in genome stability. X-family DNA polymerases (PolXs) play critical roles in BER, especially in filling single-nucleotide gaps. In addition to a polymerase core domain, bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain with phosphoesterase activity which is also required for BER. However, the role of the PHP domain of PolX in bacterial BER remains unresolved. We found that the PHP domain of Thermus thermophilus HB8 PolX (ttPolX) functions as two types of phosphoesterase in BER, including a 3'-phosphatase and an apurinic/apyrimidinic (AP) endonuclease. Experiments using T. thermophilus HB8 cell lysates revealed that the majority of the 3'-phosphatase and AP endonuclease activities are attributable to the another phosphoesterase in T. thermophilus HB8, endonuclease IV (ttEndoIV). However, ttPolX possesses significant 3'-phosphatase activity in ΔttendoIV cell lysate, indicating possible complementation. Our experiments also reveal that there are only two enzymes that display the 3'-phosphatase activity in the T. thermophilus HB8 cell, ttPolX and ttEndoIV. Furthermore, phenotypic analysis of ΔttpolX, ΔttendoIV, and ΔttpolX/ΔttendoIV using hydrogen peroxide and sodium nitrite supports the hypothesis that ttPolX functions as a backup for ttEndoIV in BER. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant


    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  2. Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

    Hendershot, Jenna M.; O'Brien, Patrick J.


    Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

  3. Flexible double-headed cytosine-linked 2'-deoxycytidine nucleotides. Synthesis, polymerase incorporation to DNA and interaction with DNA methyltransferases

    Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal


    Roč. 24, č. 6 (2016), s. 1268-1276 ISSN 0968-0896 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * pyrimidines * DNA methyltransferases * DNA polymerases Subject RIV: CC - Organic Chemistry Impact factor: 2.930, year: 2016

  4. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.


    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  5. Nucleotide excision repair genes are expressed at low levels and are not detectably inducible in Caenorhabditis elegans somatic tissues, but their function is required for normal adult life after UVC exposure

    Boyd, Windy A.; Crocker, Tracey L.; Rodriguez, Ana M.; Leung, Maxwell C.K.; Wade Lehmann, D.; Freedman, Jonathan H.; Van Houten, Ben; Meyer, Joel N.


    We performed experiments to characterize the inducibility of nucleotide excision repair (NER) in Caenorhabditis elegans, and to examine global gene expression in NER-deficient and -proficient strains as well as germline vs. somatic tissues, with and without genotoxic stress. We also carried out experiments to elucidate the importance of NER in the adult life of C. elegans under genotoxin-stressed and control conditions. Adult lifespan was not detectably different between wild-type and NER-deficient xpa-1 nematodes under control conditions. However, exposure to 6 J/m 2 /day of ultraviolet C radiation (UVC) decreased lifespan in xpa-1 nematodes more than a dose of 100 J/m 2 /day in wild-type. Similar differential sensitivities were observed for adult size and feeding. Remarkably, global gene expression was nearly identical in young adult wild-type and xpa-1 nematodes, both in control conditions and 3 h after exposure to 50 J/m 2 UVC. Neither NER genes nor repair activity were detectably inducible in young adults that lacked germ cells and developing embryos (glp-1 strain). However, expression levels of dozens of NER and other DNA damage response genes were much (5-30-fold) lower in adults lacking germ cells and developing embryos, suggesting that somatic and post-mitotic cells have a much lower DNA repair ability. Finally, we describe a refinement of our DNA damage assay that allows damage measurement in single nematodes.

  6. Nucleotide excision repair genes are expressed at low levels and are not detectably inducible in Caenorhabditis elegans somatic tissues, but their function is required for normal adult life after UVC exposure

    Boyd, Windy A. [Biomolecular Screening Branch, National Toxicology Program, National Institute of Environmental Health Sciences, NIH, Research Triangle Park, NC (United States); Crocker, Tracey L. [Nicholas School of the Environment, Duke University, Durham, NC 27708 (United States); Rodriguez, Ana M. [Laboratory of Molecular Genetics, National Institute of Environmental Health Sciences, NIH, Research Triangle Park, NC (United States); Leung, Maxwell C.K. [Nicholas School of the Environment, Duke University, Durham, NC 27708 (United States); Wade Lehmann, D. [Laboratory of Molecular Genetics, National Institute of Environmental Health Sciences, NIH, Research Triangle Park, NC (United States); Freedman, Jonathan H. [Laboratory of Molecular Toxicology, National Institute of Environmental Health Sciences, NIH, Research Triangle Park, NC (United States); Van Houten, Ben [Laboratory of Molecular Genetics, National Institute of Environmental Health Sciences, NIH, Research Triangle Park, NC (United States); Meyer, Joel N., E-mail: [Nicholas School of the Environment, Duke University, Durham, NC 27708 (United States)


    We performed experiments to characterize the inducibility of nucleotide excision repair (NER) in Caenorhabditis elegans, and to examine global gene expression in NER-deficient and -proficient strains as well as germline vs. somatic tissues, with and without genotoxic stress. We also carried out experiments to elucidate the importance of NER in the adult life of C. elegans under genotoxin-stressed and control conditions. Adult lifespan was not detectably different between wild-type and NER-deficient xpa-1 nematodes under control conditions. However, exposure to 6 J/m{sup 2}/day of ultraviolet C radiation (UVC) decreased lifespan in xpa-1 nematodes more than a dose of 100 J/m{sup 2}/day in wild-type. Similar differential sensitivities were observed for adult size and feeding. Remarkably, global gene expression was nearly identical in young adult wild-type and xpa-1 nematodes, both in control conditions and 3 h after exposure to 50 J/m{sup 2} UVC. Neither NER genes nor repair activity were detectably inducible in young adults that lacked germ cells and developing embryos (glp-1 strain). However, expression levels of dozens of NER and other DNA damage response genes were much (5-30-fold) lower in adults lacking germ cells and developing embryos, suggesting that somatic and post-mitotic cells have a much lower DNA repair ability. Finally, we describe a refinement of our DNA damage assay that allows damage measurement in single nematodes.

  7. Excision of HIV-1 proviral DNA by recombinant cell permeable tre-recombinase.

    Lakshmikanth Mariyanna

    Full Text Available Over the previous years, comprehensive studies on antiretroviral drugs resulted in the successful introduction of highly active antiretroviral therapy (HAART into clinical practice for treatment of HIV/AIDS. However, there is still need for new therapeutic approaches, since HAART cannot eradicate HIV-1 from the infected organism and, unfortunately, can be associated with long-term toxicity and the development of drug resistance. In contrast, novel gene therapy strategies may have the potential to reverse the infection by eradicating HIV-1. For example, expression of long terminal repeat (LTR-specific recombinase (Tre-recombinase has been shown to result in chromosomal excision of proviral DNA and, in consequence, in the eradication of HIV-1 from infected cell cultures. However, the delivery of Tre-recombinase currently depends on the genetic manipulation of target cells, a process that is complicating such therapeutic approaches and, thus, might be undesirable in a clinical setting. In this report we demonstrate that E.coli expressed Tre-recombinases, tagged either with the protein transduction domain (PTD from the HIV-1 Tat trans-activator or the translocation motif (TLM of the Hepatitis B virus PreS2 protein, were able to translocate efficiently into cells and showed significant recombination activity on HIV-1 LTR sequences. Tre activity was observed using episomal and stable integrated reporter constructs in transfected HeLa cells. Furthermore, the TLM-tagged enzyme was able to excise the full-length proviral DNA from chromosomal integration sites of HIV-1-infected HeLa and CEM-SS cells. The presented data confirm Tre-recombinase activity on integrated HIV-1 and provide the basis for the non-genetic transient application of engineered recombinases, which may be a valuable component of future HIV eradication strategies.

  8. Methylation of deoxycytidine incorporated by excision-repair synthesis of DNA

    Kastan, M.B.; Gowans, B.J.; Lieberman, M.W.


    Methylation of deoxycytidine incorporated by DNA excision-repair was studied in human diploid fibroblasts following damage with ultraviolet radiation, N-methyl-N-nitrosourea, or N-acetoxy-2-acetylaminofluorene. In confluent, nondividing cells, methylation in repair patches induced by all three agents is slow and incomplete. Whereas after DNA replication in logarithmic-phase cultures a steady state level of 3.4% 5-methylcytosine is reached in less than 2 hr after cells are labeled with 6- 3H-deoxycytidine, following ultraviolet-stimulated repair synthesis in confluent cells it takes about 3 days to reach a level of approximately 2.0% 5-methylcytosine in the repair patch. In cells from cultures in logarithmic-phase growth, 5-methylcytosine formation in ultraviolet-induced repair patches occurs faster and to a greater extent, reaching a level of approximately 2.7% in 10-20 hr. Preexisting hypomethylated repair patches in confluent cells are methylated further when the cells are stimulated to divide; however, the repair patch may still not be fully methylated before cell division occurs. Thus DNA damage and repair may lead to heritable loss of methylation at some sites

  9. DNA template dependent accuracy variation of nucleotide selection in transcription.

    Harriet Mellenius

    Full Text Available It has been commonly assumed that the effect of erroneous transcription of DNA genes into messenger RNAs on peptide sequence errors are masked by much more frequent errors of mRNA translation to protein. We present a theoretical model of transcriptional accuracy. It uses experimentally estimated standard free energies of double-stranded DNA and RNA/DNA hybrids and predicts a DNA template dependent transcriptional accuracy variation spanning several orders of magnitude. The model also identifies high-error as well a high-accuracy transcription motifs. The source of the large accuracy span is the context dependent variation of the stacking free energy of pairs of correct and incorrect base pairs in the ever moving transcription bubble. Our model predictions have direct experimental support from recent single molecule based identifications of transcriptional errors in the C. elegans transcriptome. Our conclusions challenge the general view that amino acid substitution errors in proteins are mainly caused by translational errors. It suggests instead that transcriptional error hotspots are the dominating source of peptide sequence errors in some DNA template contexts, while mRNA translation is the major cause of protein errors in other contexts.

  10. An overview of DNA fingerprinting with 32P nucleotides

    Pappas, G.G.


    The DNA probes radiolabeled with 32 P, a primary tool employed by researchers in the life sciences for > 20 yr, are used by private companies, state-run laboratories, and the FBI to generate autoradiographs displaying the unique banding patterns that constitute the DNA fingerprint. The ability to identify an individual or animal from a biological sample has profound implications. Unidentified bodies, unrecognizable remains, and missing children can be tested and the DNA fingerprint compared to those of family members for positive identification. Paternity can be established before a child's birth. Immigration disputes can easily be resolved. Other uses include pedigree determination and testing for cell-line cross-contamination. Using a DNA fingerprint to determine the guilt or innocence of an individual allegedly involved in a violent crime is very controversial and has great legal and moral implications for society. Forensic laboratories have been challenged to ensure a level of quality control and quality assurance consistent with the weight given to these tests when used as evidence in a court of law

  11. Repair of single-strand breaks induced in the DNA of Proteus mirabilis by excision repair after UV-irradiation

    Stoerl, K.; Mund, C.


    Single-strand breaks have been produced in the DNA of P. mirabilis after UV-irradiation in dependence on the incident UV-doses. It has been found that there exists a discrepancy between the single-strand breaks estimated from sedimentation in alkaline sucrose gradients and the expected single-strand breaks approximated from measurements of dimer excision. The low number in incision breaks observed by sedimentation experiments is an indication that the cells are able to repair the excision-induced breaks as fast as they are formed. Toluenized cells have been used for investigation of the incision step independently of subsequent repair processes. In presence of NMN the appearance of more single-strand breaks in the DNA has been observed. Furthermore, the number of incision breaks in toluenized cells increased in presence of exogenous ATP. The completion of the excision repair process has been investigated by observing the rejoining of incision breaks. After irradiation with UV-doses higher than approximately 240 erg/mm 2 the number of single-strand breaks remaining unrepaired in the DNA increased. Studies of the influence of nutrition conditions on the repair process have shown approximately the same capacity for repair of single-strand breaks in growth medium as well as in buffer. Progress in the excision repair was also followed by investigation of the DNA synthesized at the template-DNA containing the pyrimidine dimers. In comparison with E. coli, P. mirabilis showed a somewhat lower efficiency for the repair of single-strand breaks during the excision repair. (author)

  12. Differential effects of procaine and phenethyl alcohol on excision repair of DNA in u.v.-irradiated Escherichia coli

    Tomiyama, H.; Tachibana, A.; Yonei, S.


    Experiments were performed to investigate the involvement of the cell membrane in the excision DNA repair process in Escherichia coli. Two membrane-binding drugs, procaine and phenethyl alcohol (PEA), inhibited liquid-holding recovery (LBR) in u.v.-irradiated E. coli wild-type and recA strains. In uvrB and polA strains where, after u.v.-irradiation, LHR was absent the two drugs had no effect. Both drugs markedly reduced the removal of u.v.-induced thymine dimers in the DNA of wild-type cells (H/r30). Analysis by alkaline sucrose gradients revealed that PEA inhibited the incision step in excision repair. In contrast, procaine had no effect on incision but apparently inhibited the late steps in excision repair. PEA dissociated DNA from the cell membrane, whereas procaine did not. The results suggest that the two drugs PEA and procaine inhibit LHR and the excision repair process operating on u.v.-induced damage in E. coli by at least two different mechanisms each of which may involve the cell membrane. (author)

  13. Extent of excision repair before DNA synthesis determines the mutagenic but not the lethal effect of UV radiation

    Konze-Thomas, B.; Hazard, R.M.; Maher, V.M.; McCormick, J.J. (Michigan State Univ., East Lansing (USA). Carcinogenesis Lab.)


    Excision repair-proficient diploid fibroblasts from normal persons (NF) and repair-deficient cells from a xeroderma pigmentosum patient (XP12BE, group A) were grown to confluence and allowed to enter the G/sub 0/ state. Autoradiography studies of cells released from G/sub 0/ after 72 h and replated at lower densities (3-9 x 10/sup 3/ cells/cm/sup 2/) in fresh medium showed that semiconservative DNA synthesis (S phase) began approx. equal to 24 h after the replating. The task was to determine whether the time available for DNA excision repair between ultraviolet irradiation (254 nm) and the onset of DNA synthesis was critical in determining the cytotoxic and/or mutagenic effect of UV in human fibroblasts.

  14. Cohort analysis of a single nucleotide polymorphism on DNA chips.

    Schwonbeck, Susanne; Krause-Griep, Andrea; Gajovic-Eichelmann, Nenad; Ehrentreich-Förster, Eva; Meinl, Walter; Glatt, Hansrüdi; Bier, Frank F


    A method has been developed to determine SNPs on DNA chips by applying a flow-through bioscanner. As a practical application we demonstrated the fast and simple SNP analysis of 24 genotypes in an array of 96 spots with a single hybridisation and dissociation experiment. The main advantage of this methodical concept is the parallel and fast analysis without any need of enzymatic digestion. Additionally, the DNA chip format used is appropriate for parallel analysis up to 400 spots. The polymorphism in the gene of the human phenol sulfotransferase SULT1A1 was studied as a model SNP. Biotinylated PCR products containing the SNP (The SNP summary web site: ) (mutant) and those containing no mutation (wild-type) were brought onto the chips coated with NeutrAvidin using non-contact spotting. This was followed by an analysis which was carried out in a flow-through biochip scanner while constantly rinsing with buffer. After removing the non-biotinylated strand a fluorescent probe was hybridised, which is complementary to the wild-type sequence. If this probe binds to a mutant sequence, then one single base is not fully matching. Thereby, the mismatched hybrid (mutant) is less stable than the full-matched hybrid (wild-type). The final step after hybridisation on the chip involves rinsing with a buffer to start dissociation of the fluorescent probe from the immobilised DNA strand. The online measurement of the fluorescence intensity by the biochip scanner provides the possibility to follow the kinetics of the hybridisation and dissociation processes. According to the different stability of the full-match and the mismatch, either visual discrimination or kinetic analysis is possible to distinguish SNP-containing sequence from the wild-type sequence.

  15. Isolation and properties of strains of Micrococcus (Deinococcus) radiodurans unable to excise ultraviolet light-induced pyrimidine dimers from DNA: evidence for two excision pathways

    Moseley, B.E.B.; Evans, D.M.


    A mutant of Deinococcus (formerly Micrococcus) radiodurans sensitive to both the lethal effect of mitomycin C and the mutagenic effect of simple alkylating agents, but having wild-type resistance to UV light, was treated with the mutagen N-methyl-N'-nitro-N-nitrosoguanidine. Three strains were isolated that were UV-sensitive, but had wild-type resistance to the lethal effect of methyl methanesulphonate and all were shown to be unable to excise pyrimidine dimers. The three strains UVS9, UVS25 and UVS78 had, in addition to the mutation in mtcA, mutations in loci designated uvsC, uvsD and uvsE, respectively. When the mutant mtcA gene was replaced by its wild-type allele in all three strains they became UV- and mitomycin C-resistant. On incubating the double mutants UVS9, UVS25 and UVS78 with wild-type DNA about 50% of the transformants selected for UV resistance were mitomycin C-sensitive and about 50% resistant depending on whether the mutant mtcA or the uvsC, D or E genes had been replaced by their wild-type alleles. Although strains mutant singly in uvsC, D or E were UV-resistant the rates of excision of pyrimidine dimers differed between them and was slower in all of them than in the wild-type and strain 302. (author)

  16. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T


    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  17. Single-Molecule Methods for Nucleotide Excision Repair: Building a System to Watch Repair in Real Time

    Kong, Muwen; Beckwitt, Emily C.; Springall, Luke; Kad, Neil M.; Van Houten, Bennett


    Single-molecule approaches to solving biophysical problems are powerful tools that allow static and dynamic real-time observations of specific molecular interactions of interest in the absence of ensemble-averaging effects. Here, we provide detailed protocols for building an experimental system that employs atomic force microscopy and a single-molecule DNA tightrope assay based on oblique angle illumination fluorescence microscopy. Together with approaches for engineering site-specific lesion...

  18. Polymorphisms in RAI and in genes of nucleotide and base excision repair are not associated with risk of testicular cancer.

    Laska, Magdalena J; Nexø, Bjørn A; Vistisen, Kirsten; Poulsen, Henrik Enghusen; Loft, Steffen; Vogel, Ulla


    Testicular cancer has been suggested to be primed in utero and there is familiar occurrence, particularly brothers and sons of men with testicular cancer have increased risk. Although no specific causative genotoxic agents have been identified, variations in DNA repair capacity could be associated with the risk of testicular cancer. A case-control study of 184 testicular cancer cases and 194 population-based controls living in the Copenhagen Greater Area in Denmark was performed. We found that neither polymorphisms in several DNA repair genes nor alleles of several polymorphisms in the chromosomal of region 19q13.2-3, encompassing the genes ASE, ERCC1, RAI and XPD, were associated with risk of testicular cancer in Danish patients. This is in contrast to other cancers, where we reported strong associations between polymorphisms in ERCC1, ASE and RAI and occurrence of basal cell carcinoma, breast cancer and lung. To our knowledge this is the first study of DNA repair gene polymorphisms and risk of testicular cancer.

  19. Synthesis of Hydrazone-Modified Nucleotides and Their Polymerase Incorporation onto DNA for Redox Labeling

    Raindlová, Veronika; Pohl, Radek; Klepetářová, Blanka; Havran, Luděk; Šimková, Eva; Horáková Brázdilová, Petra; Pivoňková, Hana; Fojta, Miroslav; Hocek, Michal


    Roč. 77, č. 8 (2012), s. 652-662 ISSN 2192-6506 R&D Projects: GA AV ČR(CZ) IAA400040901; GA ČR GBP206/12/G151 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040702 Keywords : DNA * oligonucleotides * polymerase * hydrazones * nucleotides Subject RIV: CC - Organic Chemistry

  20. Effects of post mortem interval and gender in DNA base excision repair activities in rat brains

    Soltys, Daniela Tathiana; Pereira, Carolina Parga Martins; Ishibe, Gabriela Naomi; Souza-Pinto, Nadja Cristhina de, E-mail:


    Most human tissues used in research are of post mortem origin. This is the case for all brain samples, and due to the difficulty in obtaining a good number of samples, especially in the case of neurodegenerative diseases, male and female samples are often included in the same experimental group. However, the effects of post mortem interval (PMI) and gender differences in the endpoints being analyzed are not always fully understood, as is the case for DNA repair activities. To investigate these effects, in a controlled genetic background, base excision repair (BER) activities were measured in protein extracts obtained from Wistar rat brains from different genders and defined PMI up to 24 hours, using a novel fluorescent-based in vitro incision assay. Uracil and AP-site incision activity in nuclear and mitochondrial extracts were similar in all groups included in this study. Our results show that gender and PMI up to 24 hours have no influence in the activities of the BER proteins UDG and APE1 in rat brains. These findings demonstrate that these variables do not interfere on the BER activities included in these study, and provide a security window to work with UDG and APE1 proteins in samples of post mortem origin.

  1. Effects of post mortem interval and gender in DNA base excision repair activities in rat brains

    Soltys, Daniela Tathiana; Pereira, Carolina Parga Martins; Ishibe, Gabriela Naomi; Souza-Pinto, Nadja Cristhina de


    Most human tissues used in research are of post mortem origin. This is the case for all brain samples, and due to the difficulty in obtaining a good number of samples, especially in the case of neurodegenerative diseases, male and female samples are often included in the same experimental group. However, the effects of post mortem interval (PMI) and gender differences in the endpoints being analyzed are not always fully understood, as is the case for DNA repair activities. To investigate these effects, in a controlled genetic background, base excision repair (BER) activities were measured in protein extracts obtained from Wistar rat brains from different genders and defined PMI up to 24 hours, using a novel fluorescent-based in vitro incision assay. Uracil and AP-site incision activity in nuclear and mitochondrial extracts were similar in all groups included in this study. Our results show that gender and PMI up to 24 hours have no influence in the activities of the BER proteins UDG and APE1 in rat brains. These findings demonstrate that these variables do not interfere on the BER activities included in these study, and provide a security window to work with UDG and APE1 proteins in samples of post mortem origin

  2. DNA incorporation of 6-thioguanine nucleotides during maintenance therapy of childhood acute lymphoblastic leukaemia and non-Hodgkin lymphoma

    Hedeland, Rikke L; Hvidt, Kristian; Nersting, Jacob


    To explore the DNA incorporation of 6-thioguanine nucleotide levels (DNA-6TGN) during 6-mercaptopurine (6MP) therapy of childhood acute lymphoblastic leukaemia (ALL) and non-Hodgkin lymphoma (NHL) and its relation to erythrocyte levels of their metabolites: 6-thioguanine-nucleotides (E-6TGN...

  3. Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

    Maat, J.


    A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

  4. Aspects of DNA repair and nucleotide pool imbalance

    Holliday, R.


    Evidence that optimum repair depends on adequate pools of deoxynucleotide triphosphates (dNTPs) comes from the study of pyrimidine auxotrophs of Ustilago maydis. These strains are sensitive to UV light and X-rays, and for pyr1-1 it has been shown that the intracellular concentration of dTTP is reduced about 7-fold. The survival curve of pyr1-1 after UV-treatment, and split dose experiments with wild-type cells, provide evidence for an inducible repair mechanism, which probably depends on genetic recombination. Although inducible repair saves cellular resources, it has the disadvantage of becoming ineffective at doses which are high enough to inactivate the repressed structural gene(s) for repair enzymes. It is clear that a wide variety of repair mechanisms have evolved to remove lesions which arise either spontaneously or as a result of damage from external agents. Nevertheless, it would be incorrect to assume that all species require all possible pathways of repair. It is now well established that the accuracy of DNA and protein synthesis depends on proof-reading or editing mechanisms. Optimum accuracy levels will evolve from the balance between error avoidance in macromolecular synthesis and physiological efficiency in growth and propagation.

  5. Classification of DNA nucleotides with transverse tunneling currents

    Nyvold Pedersen, Jonas; Boynton, Paul; Di Ventra, Massimiliano; Jauho, Antti-Pekka; Flyvbjerg, Henrik


    It has been theoretically suggested and experimentally demonstrated that fast and low-cost sequencing of DNA, RNA, and peptide molecules might be achieved by passing such molecules between electrodes embedded in a nanochannel. The experimental realization of this scheme faces major challenges, however. In realistic liquid environments, typical currents in tunneling devices are of the order of picoamps. This corresponds to only six electrons per microsecond, and this number affects the integration time required to do current measurements in real experiments. This limits the speed of sequencing, though current fluctuations due to Brownian motion of the molecule average out during the required integration time. Moreover, data acquisition equipment introduces noise, and electronic filters create correlations in time-series data. We discuss how these effects must be included in the analysis of, e.g., the assignment of specific nucleobases to current signals. As the signals from different molecules overlap, unambiguous classification is impossible with a single measurement. We argue that the assignment of molecules to a signal is a standard pattern classification problem and calculation of the error rates is straightforward. The ideas presented here can be extended to other sequencing approaches of current interest.

  6. Classification of DNA nucleotides with transverse tunneling currents

    Pedersen, Jonas Nyvold; Boynton, Paul; Ventra, Massimiliano Di; Jauho, Antti-Pekka; Flyvbjerg, Henrik


    It has been theoretically suggested and experimentally demonstrated that fast and low-cost sequencing of DNA, RNA, and peptide molecules might be achieved by passing such molecules between electrodes embedded in a nanochannel. The experimental realization of this scheme faces major challenges, however. In realistic liquid environments, typical currents in tunnelling devices are of the order of picoamps. This corresponds to only six electrons per microsecond, and this number affects the integration time required to do current measurements in real experiments. This limits the speed of sequencing, though current fluctuations due to Brownian motion of the molecule average out during the required integration time. Moreover, data acquisition equipment introduces noise, and electronic filters create correlations in time-series data. We discuss how these effects must be included in the analysis of, e.g., the assignment of specific nucleobases to current signals. As the signals from different molecules overlap, unambiguous classification is impossible with a single measurement. We argue that the assignment of molecules to a signal is a standard pattern classification problem and calculation of the error rates is straightforward. The ideas presented here can be extended to other sequencing approaches of current interest. PMID:27897144

  7. Excision repair of bulky lesions in the DNA of mammalian cells

    Setlow, R.B.; Grist, E.


    The report examines the process of excision repair of pyrimidine dimers from uv-irradiated and chemically challenged human cells. It is shown by means of a sensitive endonuclease assay that the amount of excision observed depends upon the isotope used to label cells, and that XP heterozygotes are between normals and XPs

  8. ATR- and ATM-Mediated DNA Damage Response Is Dependent on Excision Repair Assembly during G1 but Not in S Phase of Cell Cycle.

    Ray, Alo; Blevins, Chessica; Wani, Gulzar; Wani, Altaf A


    Cell cycle checkpoint is mediated by ATR and ATM kinases, as a prompt early response to a variety of DNA insults, and culminates in a highly orchestrated signal transduction cascade. Previously, we defined the regulatory role of nucleotide excision repair (NER) factors, DDB2 and XPC, in checkpoint and ATR/ATM-dependent repair pathway via ATR and ATM phosphorylation and recruitment to ultraviolet radiation (UVR)-induced damage sites. Here, we have dissected the molecular mechanisms of DDB2- and XPC- mediated regulation of ATR and ATM recruitment and activation upon UVR exposures. We show that the ATR and ATM activation and accumulation to UVR-induced damage not only depends on DDB2 and XPC, but also on the NER protein XPA, suggesting that the assembly of an active NER complex is essential for ATR and ATM recruitment. ATR and ATM localization and H2AX phosphorylation at the lesion sites occur as early as ten minutes in asynchronous as well as G1 arrested cells, showing that repair and checkpoint-mediated by ATR and ATM starts early upon UV irradiation. Moreover, our results demonstrated that ATR and ATM recruitment and H2AX phosphorylation are dependent on NER proteins in G1 phase, but not in S phase. We reasoned that in G1 the UVR-induced ssDNA gaps or processed ssDNA, and the bound NER complex promote ATR and ATM recruitment. In S phase, when the UV lesions result in stalled replication forks with long single-stranded DNA, ATR and ATM recruitment to these sites is regulated by different sets of proteins. Taken together, these results provide evidence that UVR-induced ATR and ATM recruitment and activation differ in G1 and S phases due to the existence of distinct types of DNA lesions, which promote assembly of different proteins involved in the process of DNA repair and checkpoint activation.

  9. Significant contribution of the 3′→5′ exonuclease activity to the high fidelity of nucleotide incorporation catalyzed by human DNA polymerase ϵ

    Zahurancik, Walter J.; Klein, Seth J.; Suo, Zucai


    Most eukaryotic DNA replication is performed by A- and B-family DNA polymerases which possess a faithful polymerase activity that preferentially incorporates correct over incorrect nucleotides. Additionally, many replicative polymerases have an efficient 3′→5′ exonuclease activity that excises misincorporated nucleotides. Together, these activities contribute to overall low polymerase error frequency (one error per 106–108 incorporations) and support faithful eukaryotic genome replication. Eukaryotic DNA polymerase ϵ (Polϵ) is one of three main replicative DNA polymerases for nuclear genomic replication and is responsible for leading strand synthesis. Here, we employed pre-steady-state kinetic methods and determined the overall fidelity of human Polϵ (hPolϵ) by measuring the individual contributions of its polymerase and 3′→5′ exonuclease activities. The polymerase activity of hPolϵ has a high base substitution fidelity (10−4–10−7) resulting from large decreases in both nucleotide incorporation rate constants and ground-state binding affinities for incorrect relative to correct nucleotides. The 3′→5′ exonuclease activity of hPolϵ further enhances polymerization fidelity by an unprecedented 3.5 × 102 to 1.2 × 104-fold. The resulting overall fidelity of hPolϵ (10−6–10−11) justifies hPolϵ to be a primary enzyme to replicate human nuclear genome (0.1–1.0 error per round). Consistently, somatic mutations in hPolϵ, which decrease its exonuclease activity, are connected with mutator phenotypes and cancer formation. PMID:25414327

  10. The nucleotide sequence of human transition protein 1 cDNA

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)


    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  11. Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica


    Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)

  12. Effects of an extract from the sea squirt Ecteinascidia turbinata on DNA synthesis and excision repair in human fibroblasts

    Dunn, W.C.; Carrier, W.L.; Regan, J.D.


    An aqueous ethanol extract from the marine tunicate species Ecteinascidia turbinata was studied to determine its effect on semiconservative DNA synthesis in human skin fibroblast cultures as measured by (/sup 3/H) thymidine uptake in acid-insoluble cell fractions. In addition, the effect of this extract on DNA excision repair in ultraviolet light (254 nm) irradiated fibroblasts was measured by the bromodeoxyuridine photolysis assay, thymine dimer chromatography, and DNA single-strand break analysis on alkaline sucrose gradients. Repair inhibition was accompanied by an accumulation of single-strand DNA breaks which was enhanced by the addtion of 2 mM hydroxyurea. These results are discussed with respect to a mechanism of action of the marine tunicate extract at the level of DNA polymerases and are contrasted with previously studied inhibitory mechanisms of arabinofuranosyl nucleosides.

  13. Cyclosporin A inhibits nucleotide excision repair via downregulation of the xeroderma pigmentosum group A and G proteins, which is mediated by calcineurin inhibition.

    Kuschal, Christiane; Thoms, Kai-Martin; Boeckmann, Lars; Laspe, Petra; Apel, Antje; Schön, Michael P; Emmert, Steffen


    Cyclosporin A (CsA) inhibits nucleotide excision repair (NER) in human cells, a process that contributes to the skin cancer proneness in organ transplant patients. We investigated the mechanisms of CsA-induced NER reduction by assessing all xeroderma pigmentosum (XP) genes (XPA-XPG). Western blot analyses revealed that XPA and XPG protein expression was reduced in normal human GM00637 fibroblasts exposed to 0.1 and 0.5 μm CsA. Interestingly, the CsA treatment reduced XPG, but not XPA, mRNA expression. Calcineurin knockdown in GM00637 fibroblasts using RNAi led to similar results suggesting that calcineurin-dependent signalling is involved in XPA and XPG protein regulation. CsA-induced reduction in NER could be complemented by the overexpression of either XPA or XPG protein. Likewise, XPA-deficient fibroblasts with stable overexpression of XPA (XP2OS-pCAH19WS) did not show the inhibitory effect of CsA on NER. In contrast, XPC-deficient fibroblasts overexpressing XPC showed CsA-reduced NER. Our data indicate that the CsA-induced inhibition of NER is a result of downregulation of XPA and XPG protein in a calcineurin-dependent manner. © 2011 John Wiley & Sons A/S.

  14. International congress on DNA damage and repair: Book of abstracts


    This document contains the abstracts of 105 papers presented at the Congress. Topics covered include the Escherichia coli nucleotide excision repair system, DNA repair in malignant transformations, defective DNA repair, and gene regulation. (TEM)

  15. International congress on DNA damage and repair: Book of abstracts


    This document contains the abstracts of 105 papers presented at the Congress. Topics covered include the Escherichia coli nucleotide excision repair system, DNA repair in malignant transformations, defective DNA repair, and gene regulation

  16. Modulation of mutagenesis in eukaryotes by DNA replication fork dynamics and quality of nucleotide pools

    Waisertreiger, Irina S.-R.; Liston, Victoria G.; Menezes, Miriam R.; Kim, Hyun-Min; Lobachev, Kirill S.; Stepchenkova, Elena I.; Tahirov, Tahir H.; Rogozin, Igor B.; Pavlov, Youri. I.


    The rate of mutations in eukaryotes depends on a plethora of factors and is not immediately derived from the fidelity of DNA polymerases (Pols). Replication of chromosomes containing the anti-parallel strands of duplex DNA occurs through the copying of leading and lagging strand templates by a trio of Pols α, δ and ε, with the assistance of Pol ζ and Y-family Pols at difficult DNA template structures or sites of DNA damage. The parameters of the synthesis at a given location are dictated by the quality and quantity of nucleotides in the pools, replication fork architecture, transcription status, regulation of Pol switches, and structure of chromatin. The result of these transactions is a subject of survey and editing by DNA repair. PMID:23055184

  17. Defects in maintenance of mitochondrial DNA are associated with intramitochondrial nucleotide imbalances.

    Ashley, Neil; Adams, Susan; Slama, Abdelhamid; Zeviani, Massimo; Suomalainen, Anu; Andreu, Antonio L; Naviaux, Robert K; Poulton, Joanna


    Defects in mtDNA maintenance range from fatal multisystem childhood diseases, such as Alpers syndrome, to milder diseases in adults, including mtDNA depletion syndromes (MDS) and familial progressive external ophthalmoplegia (AdPEO). Most are associated with defects in genes involved in mitochondrial deoxynucleotide metabolism or utilization, such as mutations in thymidine kinase 2 (TK2) as well as the mtDNA replicative helicase, Twinkle and gamma polymerase (POLG). We have developed an in vitro system to measure incorporation of radiolabelled dNTPs into mitochondria of saponin permeabilized cells. We used this to compare the rates of mtDNA synthesis in cells from 12 patients with diseases of mtDNA maintenance. We observed reduced incorporation of exogenous alpha (32)P-dTTP in fibroblasts from a patient with Alpers syndrome associated with the A467T substitution in POLG, a patient with dGK mutations, and a patient with mtDNA depletion of unknown origin compared to controls. However, incorporation of alpha (32)P-dTTP relative to either cell doubling time or alpha (32)P-dCTP incorporation was increased in patients with thymidine kinase deficiency or PEO as the result of TWINKLE mutations compared with controls. The specific activity of newly synthesized mtDNA depends on the size of the endogenous pool diluting the exogenous labelled nucleotide. Our result is consistent with a deficiency in the intramitochondrial pool of dTTP relative to dCTP in cells from patients with TK2 deficiency and TWINKLE mutations. Such DNA precursor asymmetry could cause pausing of the replication complex and hence exacerbate the propensity for age-related mtDNA mutations. Because deviations from the normal concentrations of dNTPs are known to be mutagenic, we suggest that intramitochondrial nucleotide imbalance could underlie the multiple mtDNA mutations observed in these patients.

  18. Metal inhibition of human alkylpurine-DNA-N-glycosylase activityin base excision repair

    Wang, Ping; Guliaev, Anton B.; Hang, Bo


    Cadmium (Cd{sup 2+}), nickel (Ni{sup 2+}) and cobalt (Co{sup 2+}) are human and/or animal carcinogens. Zinc (Zn{sup 2+}) is not categorized as a carcinogen, and rather an essential element to humans. Metals were recently shown to inhibit DNA repair proteins that use metals for their function and/or structure. Here we report that the divalent ions Cd{sup 2+}, Ni{sup 2+}, and Zn{sup 2+} can inhibit the activity of a recombinant human N-methylpurine-DNA glycosylase (MPG) toward a deoxyoligonucleotide with ethenoadenine (var epsilonA). MPG removes a variety of toxic/mutagenic alkylated bases and does not require metal for its catalytic activity or structural integrity. At concentrations starting from 50 to 1000 {micro}M, both Cd{sup 2+} and Zn{sup 2+} showed metal-dependent inhibition of the MPG catalytic activity. Ni{sup 2+} also inhibited MPG, but to a lesser extent. Such an effect can be reversed with EDTA addition. In contrast, Co{sup 2+} and Mg{sup 2+} did not inhibit the MPG activity in the same dose range. Experiments using HeLa cell-free extracts demonstrated similar patterns of inactivation of the var epsilonA excision activity by the same metals. Binding of MPG to the substrate was not significantly affected by Cd{sup 2+}, Zn{sup 2+}, and Ni{sup 2+} at concentrations that show strong inhibition of the catalytic function, suggesting that the reduced catalytic activity is not due to altered MPG binding affinity to the substrate. Molecular dynamics (MD) simulations with Zn{sup 2+} showed that the MPG active site has a potential binding site for Zn{sup 2+}, formed by several catalytically important and conserved residues. Metal binding to such a site is expected to interfere with the catalytic mechanism of this protein. These data suggest that inhibition of MPG activity may contribute to metal genotoxicity and depressed repair of alkylation damage by metals in vivo.

  19. Internucleotide correlations and nucleotide periodicity in Drosophila mtDNA: New evidence for panselective evolution

    Carlos Y Valenzuela


    Full Text Available Analysis for the homogeneity of the distribution of the second base of dinucleotides in relation to the first, whose bases are separated by 0, 1, 2,... 21 nucleotide sites, was performed with the VIH-1 genome (cDNA, the Drosophila mtDNA, the Drosophila Torso gene and the human p-globin gene. These four DNA segments showed highly significant heterogeneities of base distributions that cannot be accounted for by neutral or nearly neutral evolution or by the "neighbor influence" of nucleotides on mutation rates. High correlations are found in the bases of dinucleotides separated by 0, 1 and more number of sites. A periodicity of three consecutive significance values (measured by the x²9 was found only in Drosophila mtDNA. This periodicity may be due to an unknown structure or organization of mtDNA. This non-random distribution of the two bases of dinucleotides widespread throughout these DNA segments is rather compatible with panselective evolution and generalized internucleotide co-adaptation.

  20. The Influence of Hepatitis C Virus Therapy on the DNA Base Excision Repair System of Peripheral Blood Mononuclear Cells.

    Czarny, Piotr; Merecz-Sadowska, Anna; Majchrzak, Kinga; Jabłkowski, Maciej; Szemraj, Janusz; Śliwiński, Tomasz; Karwowski, Bolesław


    Hepatitis C virus (HCV) can infect extrahepatic tissues, including lymphocytes, creating reservoir of the virus. Moreover, HCV proteins can interact with DNA damage response proteins of infected cells. In this article we investigated the influence of the virus infection and a new ombitasvir/paritaprevir/ritonavir ± dasabuvir ± ribavirin (OBV/PTV/r ± DSV ± RBV) anti-HCV therapy on the PBMCs (peripheral blood mononuclear cells, mainly lymphocytes) DNA base excision repair (BER) system. BER protein activity was analyzed in the nuclear and mitochondrial extracts (NE and ME) of PBMC isolated from patients before and after therapy, and from subjects without HCV, using modeled double-strand DNA, with 2'-deoxyuridine substitution as the DNA damage. The NE and ME obtained from patients before therapy demonstrated lower efficacy of 2'-deoxyuridine removal and DNA repair polymerization than those of the control group or patients after therapy. Moreover, the extracts from the patients after therapy had similar activity to those from the control group. However, the efficacy of apurinic/apyrimidinic site excision in NE did not differ between the studied groups. We postulate that infection of lymphocytes by the HCV can lead to a decrease in the activity of BER enzymes. However, the use of novel therapy results in the improvement of glycosylase activity as well as the regeneration of endonuclease and other crucial repair enzymes.

  1. Uracil DNA glycosylase counteracts APOBEC3G-induced hypermutation of hepatitis B viral genomes: excision repair of covalently closed circular DNA.

    Kouichi Kitamura

    Full Text Available The covalently closed circular DNA (cccDNA of the hepatitis B virus (HBV plays an essential role in chronic hepatitis. The cellular repair system is proposed to convert cytoplasmic nucleocapsid (NC DNA (partially double-stranded DNA into cccDNA in the nucleus. Recently, antiviral cytidine deaminases, AID/APOBEC proteins, were shown to generate uracil residues in the NC-DNA through deamination, resulting in cytidine-to-uracil (C-to-U hypermutation of the viral genome. We investigated whether uracil residues in hepadnavirus DNA were excised by uracil-DNA glycosylase (UNG, a host factor for base excision repair (BER. When UNG activity was inhibited by the expression of the UNG inhibitory protein (UGI, hypermutation of NC-DNA induced by either APOBEC3G or interferon treatment was enhanced in a human hepatocyte cell line. To assess the effect of UNG on the cccDNA viral intermediate, we used the duck HBV (DHBV replication model. Sequence analyses of DHBV DNAs showed that cccDNA accumulated G-to-A or C-to-T mutations in APOBEC3G-expressing cells, and this was extensively enhanced by UNG inhibition. The cccDNA hypermutation generated many premature stop codons in the P gene. UNG inhibition also enhanced the APOBEC3G-mediated suppression of viral replication, including reduction of NC-DNA, pre-C mRNA, and secreted viral particle-associated DNA in prolonged culture. Enhancement of APOBEC3G-mediated suppression by UNG inhibition was not observed when the catalytic site of APOBEC3G was mutated. Transfection experiments of recloned cccDNAs revealed that the combination of UNG inhibition and APOBEC3G expression reduced the replication ability of cccDNA. Taken together, these data indicate that UNG excises uracil residues from the viral genome during or after cccDNA formation in the nucleus and imply that BER pathway activities decrease the antiviral effect of APOBEC3-mediated hypermutation.

  2. Production and excision of thymine damage in the DNA of mammalian cells exposed to high-LET radiations

    Mattern, M.R.; Welch, G.P.


    HeLa S3 and Chinese hamster ovary cells were irradiated with high doses of carbon ions having linear energy transfers (LETs) of 170 and 780 keV/μm. The DNA was analyzed for 5,6-dihydroxydihydrothymine (t'-type) radiation products both before and after postirradiation incubation at 37 0 C. In HeLa cells, 2.1 x 10 -5 ring-damaged thymines were produced per kilorad per 10 6 daltons after irradiation with high-LET carbon ions - approximately one-fifth the efficiency of t' formation in HeLa cells exposed to low-LET x rays. t' products were also formed less efficiently in Chinese hamster ovary cells exposed to carbon ions than in those exposed to x rays. In both cell lines, up to 80% of the t' formed initially was excised selectively from the DNA during 60 min of postirradiation incubation at 37 0 C. Product excision was accompanied by small amounts of DNA degradation (less than 1%). Radiation with LET of 170 keV/μm - nearly the most effective LET for cell killing and the generation of unrejoined DNA strand breaks - produced ring-damaged thymines that were removed selectively from the DNA. This result is consistent with the conclusion that t'-type products do not contribute substantially to lethality after high-LET irradiation, although the alternative possibilities remain that t' is not excised as efficiently after biological doses, or that a particular subclass of t' or defective postexcision events contribute to cell killing

  3. Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

    Tess V Clendenen

    Full Text Available Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA.We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison.We observed that 60 of the 81 SNPs (74% had high call frequencies (≥95% using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95% had highly concordant (>98% genotype calls across all three sample types. High purity was not a critical factor to successful genotyping.Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

  4. DNA glycosylases involved in base excision repair may be associated with cancer risk in BRCA1 and BRCA2 mutation carriers.

    Ana Osorio


    Full Text Available Single Nucleotide Polymorphisms (SNPs in genes involved in the DNA Base Excision Repair (BER pathway could be associated with cancer risk in carriers of mutations in the high-penetrance susceptibility genes BRCA1 and BRCA2, given the relation of synthetic lethality that exists between one of the components of the BER pathway, PARP1 (poly ADP ribose polymerase, and both BRCA1 and BRCA2. In the present study, we have performed a comprehensive analysis of 18 genes involved in BER using a tagging SNP approach in a large series of BRCA1 and BRCA2 mutation carriers. 144 SNPs were analyzed in a two stage study involving 23,463 carriers from the CIMBA consortium (the Consortium of Investigators of Modifiers of BRCA1 and BRCA2. Eleven SNPs showed evidence of association with breast and/or ovarian cancer at p<0.05 in the combined analysis. Four of the five genes for which strongest evidence of association was observed were DNA glycosylases. The strongest evidence was for rs1466785 in the NEIL2 (endonuclease VIII-like 2 gene (HR: 1.09, 95% CI (1.03-1.16, p = 2.7 × 10(-3 for association with breast cancer risk in BRCA2 mutation carriers, and rs2304277 in the OGG1 (8-guanine DNA glycosylase gene, with ovarian cancer risk in BRCA1 mutation carriers (HR: 1.12 95%CI: 1.03-1.21, p = 4.8 × 10(-3. DNA glycosylases involved in the first steps of the BER pathway may be associated with cancer risk in BRCA1/2 mutation carriers and should be more comprehensively studied.

  5. Gamma-ray induced inhibition of DNA synthesis in ataxia telangiectasia fibroblasts is a function of excision repair capacity

    Smith, P.J.; Paterson, M.C.


    The extent of the deficiency in γ-ray induced DNA repair synthesis in an ataxia telangiectasia (AT) human fibroblast strain was found to show no oxygen enhancement, consistent with a defect in the repair of base damage. Repair deficiency, but not repair proficiency, in AT cells was accompanied by a lack of inhibition of DNA synthesis by either γ-rays or the radiomimetic drug bleomycin. Experiments with 4-nitroquinoline 1-oxide indicated that lack of inhibition was specific for radiogenic-type damage. Thus excision repair, perhaps by DNA strand incision or chromatin modification, appears to halt replicon initiation in irradiated repair proficient cells whereas in repair defective AT strains this putatively important biological function is inoperative

  6. DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

    Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan


    Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

  7. An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

    Chen, Sherry Xi; Seelig, Georg


    Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

  8. Spontaneous germline excision of Tol1, a DNA-based transposable element naturally occurring in the medaka fish genome.

    Watanabe, Kohei; Koga, Hajime; Nakamura, Kodai; Fujita, Akiko; Hattori, Akimasa; Matsuda, Masaru; Koga, Akihiko


    DNA-based transposable elements are ubiquitous constituents of eukaryotic genomes. Vertebrates are, however, exceptional in that most of their DNA-based elements appear to be inactivated. The Tol1 element of the medaka fish, Oryzias latipes, is one of the few elements for which copies containing an undamaged gene have been found. Spontaneous transposition of this element in somatic cells has previously been demonstrated, but there is only indirect evidence for its germline transposition. Here, we show direct evidence of spontaneous excision in the germline. Tyrosinase is the key enzyme in melanin biosynthesis. In an albino laboratory strain of medaka fish, which is homozygous for a mutant tyrosinase gene in which a Tol1 copy is inserted, we identified de novo reversion mutations related to melanin pigmentation. The gamete-based reversion rate was as high as 0.4%. The revertant fish carried the tyrosinase gene from which the Tol1 copy had been excised. We previously reported the germline transposition of Tol2, another DNA-based element that is thought to be a recent invader of the medaka fish genome. Tol1 is an ancient resident of the genome. Our results indicate that even an old element can contribute to genetic variation in the host genome as a natural mutator.

  9. Structural basis for the binding and incorporation of nucleotide analogs with L-stereochemistry by human DNA polymerase λ

    Vyas, Rajan; Zahurancik, Walter J.; Suo, Zucai


    DNA polymerases are known to select against L-nucleotides, the enantiomers of natural D-nucleotides. However, the structural basis for D-stereoselectivity of a DNA polymerase has not been established, although two L-nucleoside analogs, lamivudine and emtricitabine, have been widely used as anti-HIV and anti-hepatitis B drugs. Here, we report ternary crystal structures of human DNA polymerase λ in complex with DNA and L-deoxycytidine 5′-triphosphate, or its analogs (the triphosphates of lamivu...

  10. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai


    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  11. ssDNA Pairing Accuracy Increases When Abasic Sites Divide Nucleotides into Small Groups.

    Alexandra Peacock-Villada

    Full Text Available Accurate sequence dependent pairing of single-stranded DNA (ssDNA molecules plays an important role in gene chips, DNA origami, and polymerase chain reactions. In many assays accurate pairing depends on mismatched sequences melting at lower temperatures than matched sequences; however, for sequences longer than ~10 nucleotides, single mismatches and correct matches have melting temperature differences of less than 3°C. We demonstrate that appropriately grouping of 35 bases in ssDNA using abasic sites increases the difference between the melting temperature of correct bases and the melting temperature of mismatched base pairings. Importantly, in the presence of appropriately spaced abasic sites mismatches near one end of a long dsDNA destabilize the annealing at the other end much more effectively than in systems without the abasic sites, suggesting that the dsDNA melts more uniformly in the presence of appropriately spaced abasic sites. In sum, the presence of appropriately spaced abasic sites allows temperature to more accurately discriminate correct base pairings from incorrect ones.

  12. Mitochondrial DNA single nucleotide polymorphism associated with weight estimated breeding values in Nelore cattle (Bos indicus

    Fernando Henrique Biase


    Full Text Available We sampled 119 Nelore cattle (Bos indicus, 69 harboring B. indicus mtDNA plus 50 carrying Bos taurus mtDNA, to estimate the frequencies of putative mtDNA single nucleotide polymorphisms (SNPs and investigate their association with Nelore weight and scrotal circumference estimated breeding values (EBVs. The PCR restriction fragment length polymorphism (PCR-RFLP method was used to detect polymorphisms in the mitochondrial asparagine, cysteine, glycine, leucine and proline transporter RNA (tRNA genes (tRNAasn, tRNAcys, tRNAgly, tRNAleu and tRNApro. The 50 cattle carrying B. taurus mtDNA were monomorphic for all the tRNA gene SNPs analyzed, suggesting that they are specific to mtDNA from B. indicus cattle. No tRNAcys or tRNAgly polymorphisms were detected in any of the cattle but we did detect polymorphic SNPs in the tRNAasn, tRNAleu and tRNApro genes in the cattle harboring B. indicus mtDNA, with the same allele observed in the B. taurus sequence being present in the following percentage of cattle harboring B. indicus mtDNA: 72.46% for tRNAasn, 95.23% for tRNAleu and 90.62% for tRNApro. Analyses of variance using the tRNAasn SNP as the independent variable and EBVs as the dependent variable showed that the G -> T SNP was significantly associated (p < 0.05 with maternal EBVs for weight at 120 and 210 days (p < 0.05 and animal's EBVs for weight at 210, 365 and 455 days. There was no association of the tRNAasn SNP with the scrotal circumference EBVs. These results confirm that mtDNA can affect weight and that mtDNA polymorphisms can be a source of genetic variation for quantitative traits.

  13. Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

    Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

    Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

  14. Kinetic Basis of Nucleotide Selection Employed by a Protein Template-Dependent DNA Polymerase†

    Brown, Jessica A.; Fowler, Jason D.; Suo, Zucai


    Rev1, a Y-family DNA polymerase, contributes to spontaneous and DNA damage-induced mutagenic events. In this paper, we have employed pre-steady state kinetic methodology to establish a kinetic basis for nucleotide selection by human Rev1, a unique nucleotidyl transferase that uses a protein template-directed mechanism to preferentially instruct dCTP incorporation. This work demonstrated that the high incorporation efficiency of dCTP is dependent on both substrates: an incoming dCTP and a templating base dG. The extremely low base substitution fidelity of human Rev1 (100 to 10-5) was due to the preferred misincorporation of dCTP with templating bases dA, dT, and dC over correct dNTPs. Using non-natural nucleotide analogs, we showed that hydrogen bonding interactions between residue R357 of human Rev1 and an incoming dNTP are not essential for DNA synthesis. Lastly, human Rev1 discriminates between ribonucleotides and deoxyribonucleotides mainly by reducing the rate of incorporation, and the sugar selectivity of human Rev1 is sensitive to both the size and orientation of the 2′-substituent of a ribonucleotide. PMID:20518555

  15. Effect of cordycepin(3'-deoxyadenosine) on excision repair of 5,6-dihydroxy-dihydrothymine-type products from the DNA of Micrococcus radiodurans

    Patil, M.S.; Tundo, V.J.; Locher, S.E.; Hariharan, P.V.


    Cordycepin(3'-deoxyadenosine), a nucleoside analog, has been shown to enhance radiation-induced cell killing. In an effort to elucidate the possible mechanism for enhancement of cell killing, the effect of cordycepin on the excision repair of radiation-induced 5,6-dihydroxy-dihydrothymine-type (t') products from the DNA of wild type Micrococcus radiodurans was investigated. The capacity of M. radiodurans to excise nondimeric (t') products from its DNA was significantly impaired after cordycepin treatment. The results suggest that the increased radiation sensitivity of cordycepin-treated cells could be due to alterations in cellular processes that repair DNA damage

  16. The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

    Steenbergh, P.H.; Sussenbach, J.S.

    The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

  17. Horizontal gene transfer and nucleotide compositional anomaly in large DNA viruses

    Ogata Hiroyuki


    Full Text Available Abstract Background DNA viruses have a wide range of genome sizes (5 kb up to 1.2 Mb, compared to 0.16 Mb to 1.5 Mb for obligate parasitic bacteria that do not correlate with their virulence or the taxonomic distribution of their hosts. The reasons for such large variation are unclear. According to the traditional view of viruses as gifted "gene pickpockets", large viral genome sizes could originate from numerous gene acquisitions from their hosts. We investigated this hypothesis by studying 67 large DNA viruses with genome sizes larger than 150 kb, including the recently characterized giant mimivirus. Given that horizontally transferred DNA often have anomalous nucleotide compositions differing from the rest of the genome, we conducted a detailed analysis of the inter- and intra-genome compositional properties of these viruses. We then interpreted their compositional heterogeneity in terms of possible causes, including strand asymmetry, gene function/expression, and horizontal transfer. Results We first show that the global nucleotide composition and nucleotide word usage of viral genomes are species-specific and distinct from those of their hosts. Next, we identified compositionally anomalous (cA genes in viral genomes, using a method based on Bayesian inference. The proportion of cA genes is highly variable across viruses and does not exhibit a significant correlation with genome size. The vast majority of the cA genes were of unknown function, lacking homologs in the databases. For genes with known homologs, we found a substantial enrichment of cA genes in specific functional classes for some of the viruses. No significant association was found between cA genes and compositional strand asymmetry. A possible exogenous origin for a small fraction of the cA genes could be confirmed by phylogenetic reconstruction. Conclusion At odds with the traditional dogma, our results argue against frequent genetic transfers to large DNA viruses from their

  18. Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA

    Jukes, T. H.; Kimura, M.


    The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.

  19. APE1, the DNA base excision repair protein, regulates the removal of platinum adducts in sensory neuronal cultures by NER

    Kim, Hyun-Suk; Guo, Chunlu; Thompson, Eric L.; Jiang, Yanlin; Kelley, Mark R.; Vasko, Michael R.; Lee, Suk-Hee


    Peripheral neuropathy is one of the major side effects of treatment with the anticancer drug, cisplatin. One proposed mechanism for this neurotoxicity is the formation of platinum adducts in sensory neurons that could contribute to DNA damage. Although this damage is largely repaired by nuclear excision repair (NER), our previous findings suggest that augmenting the base excision repair pathway (BER) by overexpressing the repair protein APE1 protects sensory neurons from cisplatin-induced neurotoxicity. The question remains whether APE1 contributes to the ability of the NER pathway to repair platinum-damage in neuronal cells. To examine this, we manipulated APE1 expression in sensory neuronal cultures and measured Pt-removal after exposure to cisplatin. When neuronal cultures were treated with increasing concentrations of cisplatin for two or three hours, there was a concentration-dependent increase in Pt-damage that peaked at four hours and returned to near baseline levels after 24 h. In cultures where APE1 expression was reduced by ∼80% using siRNA directed at APE1, there was a significant inhibition of Pt-removal over eight hours which was reversed by overexpressing APE1 using a lentiviral construct for human wtAPE1. Overexpressing a mutant APE1 (C65 APE1), which only has DNA repair activity, but not its other significant redox-signaling function, mimicked the effects of wtAPE1. Overexpressing DNA repair activity mutant APE1 (226 + 177APE1), with only redox activity was ineffective suggesting it is the DNA repair function of APE1 and not its redox-signaling, that restores the Pt-damage removal. Together, these data provide the first evidence that a critical BER enzyme, APE1, helps regulate the NER pathway in the repair of cisplatin damage in sensory neurons

  20. APE1, the DNA base excision repair protein, regulates the removal of platinum adducts in sensory neuronal cultures by NER

    Kim, Hyun-Suk [Department of Biochemistry and Molecular Biology, Indianapolis, IN 46202 (United States); Guo, Chunlu; Thompson, Eric L. [Department of Pharmacology and Toxicology, Indianapolis, IN 46202 (United States); Jiang, Yanlin [Department of Pediatrics and Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Kelley, Mark R. [Department of Biochemistry and Molecular Biology, Indianapolis, IN 46202 (United States); Department of Pharmacology and Toxicology, Indianapolis, IN 46202 (United States); Department of Pediatrics and Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Vasko, Michael R. [Department of Pharmacology and Toxicology, Indianapolis, IN 46202 (United States); Lee, Suk-Hee, E-mail: [Department of Biochemistry and Molecular Biology, Indianapolis, IN 46202 (United States)


    Peripheral neuropathy is one of the major side effects of treatment with the anticancer drug, cisplatin. One proposed mechanism for this neurotoxicity is the formation of platinum adducts in sensory neurons that could contribute to DNA damage. Although this damage is largely repaired by nuclear excision repair (NER), our previous findings suggest that augmenting the base excision repair pathway (BER) by overexpressing the repair protein APE1 protects sensory neurons from cisplatin-induced neurotoxicity. The question remains whether APE1 contributes to the ability of the NER pathway to repair platinum-damage in neuronal cells. To examine this, we manipulated APE1 expression in sensory neuronal cultures and measured Pt-removal after exposure to cisplatin. When neuronal cultures were treated with increasing concentrations of cisplatin for two or three hours, there was a concentration-dependent increase in Pt-damage that peaked at four hours and returned to near baseline levels after 24 h. In cultures where APE1 expression was reduced by ∼80% using siRNA directed at APE1, there was a significant inhibition of Pt-removal over eight hours which was reversed by overexpressing APE1 using a lentiviral construct for human wtAPE1. Overexpressing a mutant APE1 (C65 APE1), which only has DNA repair activity, but not its other significant redox-signaling function, mimicked the effects of wtAPE1. Overexpressing DNA repair activity mutant APE1 (226 + 177APE1), with only redox activity was ineffective suggesting it is the DNA repair function of APE1 and not its redox-signaling, that restores the Pt-damage removal. Together, these data provide the first evidence that a critical BER enzyme, APE1, helps regulate the NER pathway in the repair of cisplatin damage in sensory neurons.

  1. RPA physically interacts with the human DNA glycosylase NEIL1 to regulate excision of oxidative DNA base damage in primer-template structures.

    Theriot, Corey A; Hegde, Muralidhar L; Hazra, Tapas K; Mitra, Sankar


    The human DNA glycosylase NEIL1, activated during the S-phase, has been shown to excise oxidized base lesions in single-strand DNA substrates. Furthermore, our previous work demonstrating functional interaction of NEIL1 with PCNA and flap endonuclease 1 (FEN1) suggested its involvement in replication-associated repair. Here we show interaction of NEIL1 with replication protein A (RPA), the heterotrimeric single-strand DNA binding protein that is essential for replication and other DNA transactions. The NEIL1 immunocomplex isolated from human cells contains RPA, and its abundance in the complex increases after exposure to oxidative stress. NEIL1 directly interacts with the large subunit of RPA (K(d) approximately 20 nM) via the common interacting interface (residues 312-349) in NEIL1's disordered C-terminal region. RPA inhibits the base excision activity of both wild-type NEIL1 (389 residues) and its C-terminal deletion CDelta78 mutant (lacking the interaction domain) for repairing 5-hydroxyuracil (5-OHU) in a primer-template structure mimicking the DNA replication fork. This inhibition is reduced when the damage is located near the primer-template junction. Contrarily, RPA moderately stimulates wild-type NEIL1 but not the CDelta78 mutant when 5-OHU is located within the duplex region. While NEIL1 is inhibited by both RPA and Escherichia coli single-strand DNA binding protein, only inhibition by RPA is relieved by PCNA. These results showing modulation of NEIL1's activity on single-stranded DNA substrate by RPA and PCNA support NEIL1's involvement in repairing the replicating genome. Copyright 2010 Elsevier B.V. All rights reserved.

  2. Modulation of proteostasis counteracts oxidative stress and affects DNA base excision repair capacity in ATM-deficient cells.

    Poletto, Mattia; Yang, Di; Fletcher, Sally C; Vendrell, Iolanda; Fischer, Roman; Legrand, Arnaud J; Dianov, Grigory L


    Ataxia telangiectasia (A-T) is a syndrome associated with loss of ATM protein function. Neurodegeneration and cancer predisposition, both hallmarks of A-T, are likely to emerge as a consequence of the persistent oxidative stress and DNA damage observed in this disease. Surprisingly however, despite these severe features, a lack of functional ATM is still compatible with early life, suggesting that adaptation mechanisms contributing to cell survival must be in place. Here we address this gap in our knowledge by analysing the process of human fibroblast adaptation to the lack of ATM. We identify profound rearrangement in cellular proteostasis occurring very early on after loss of ATM in order to counter protein damage originating from oxidative stress. Change in proteostasis, however, is not without repercussions. Modulating protein turnover in ATM-depleted cells also has an adverse effect on the DNA base excision repair pathway, the major DNA repair system that deals with oxidative DNA damage. As a consequence, the burden of unrepaired endogenous DNA lesions intensifies, progressively leading to genomic instability. Our study provides a glimpse at the cellular consequences of loss of ATM and highlights a previously overlooked role for proteostasis in maintaining cell survival in the absence of ATM function. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

    Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M


    There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

  4. Acetylation regulates WRN catalytic activities and affects base excision DNA repair

    Muftuoglu, Meltem; Kusumoto, Rika; Speina, Elzbieta


    The Werner protein (WRN), defective in the premature aging disorder Werner syndrome, participates in a number of DNA metabolic processes, and we have been interested in the possible regulation of its function in DNA repair by post-translational modifications. Acetylation mediated by histone...... acetyltransferases is of key interest because of its potential importance in aging, DNA repair and transcription....

  5. Engineered split in Pfu DNA polymerase fingers domain improves incorporation of nucleotide γ-phosphate derivative

    Hansen, Connie J.; Wu, Lydia; Fox, Jeffrey D.; Arezi, Bahram; Hogrefe, Holly H.


    Using compartmentalized self-replication (CSR), we evolved a version of Pyrococcus furiosus (Pfu) DNA polymerase that tolerates modification of the γ-phosphate of an incoming nucleotide. A Q484R mutation in α-helix P of the fingers domain, coupled with an unintended translational termination-reinitiation (split) near the finger tip, dramatically improve incorporation of a bulky γ-phosphate-O-linker-dabcyl substituent. Whether synthesized by coupled translation from a bicistronic (−1 frameshift) clone, or reconstituted from separately expressed and purified fragments, split Pfu mutant behaves identically to wild-type DNA polymerase with respect to chromatographic behavior, steady-state kinetic parameters (for dCTP), and PCR performance. Although naturally-occurring splits have been identified previously in the finger tip region of T4 gp43 variants, this is the first time a split (in combination with a point mutation) has been shown to broaden substrate utilization. Moreover, this latest example of a split hyperthermophilic archaeal DNA polymerase further illustrates the modular nature of the Family B DNA polymerase structure. PMID:21062827

  6. Engineered split in Pfu DNA polymerase fingers domain improves incorporation of nucleotide gamma-phosphate derivative.

    Hansen, Connie J; Wu, Lydia; Fox, Jeffrey D; Arezi, Bahram; Hogrefe, Holly H


    Using compartmentalized self-replication (CSR), we evolved a version of Pyrococcus furiosus (Pfu) DNA polymerase that tolerates modification of the γ-phosphate of an incoming nucleotide. A Q484R mutation in α-helix P of the fingers domain, coupled with an unintended translational termination-reinitiation (split) near the finger tip, dramatically improve incorporation of a bulky γ-phosphate-O-linker-dabcyl substituent. Whether synthesized by coupled translation from a bicistronic (-1 frameshift) clone, or reconstituted from separately expressed and purified fragments, split Pfu mutant behaves identically to wild-type DNA polymerase with respect to chromatographic behavior, steady-state kinetic parameters (for dCTP), and PCR performance. Although naturally-occurring splits have been identified previously in the finger tip region of T4 gp43 variants, this is the first time a split (in combination with a point mutation) has been shown to broaden substrate utilization. Moreover, this latest example of a split hyperthermophilic archaeal DNA polymerase further illustrates the modular nature of the Family B DNA polymerase structure.

  7. Repair of UV-irradiated plasmid DNA in excision repair deficient mutants of Saccharomyces cerevisiae

    Ikai, K.; Tano, K.; Ohnishi, T.; Nozu, K.


    The repair of UV-irradiated DNA of plasmid YEp13 was studied in the incision defective strains by measurement of cell transformation frequency. In Saccharomyces cerevisiae, rad1,2,3 and 4 mutants could repair UV-damaged plasmid DNA. In Escherichia coli, uvrA mutant was unable to repair UV-damaged plasmid DNA; however, pretreatment of the plasmid with Micrococcus luteus endonuclease increased repair. It was concluded that all the mutations of yeast were probably limited only to the nuclear DNA. (author)

  8. Dideoxynucleoside triphosphate-sensitive DNA polymerase from rice is involved in base excision repair and immunologically similar to mammalian DNA pol beta.

    Sarkar, Sailendra Nath; Bakshi, Sankar; Mokkapati, Sanath K; Roy, Sujit; Sengupta, Dibyendu N


    A single polypeptide with ddNTP-sensitive DNA polymerase activity was purified to near homogeneity from the shoot tips of rice seedlings and analysis of the preparations by SDS-PAGE followed by silver staining showed a polypeptide of 67 kDa size. The DNA polymerase activity was found to be inhibitory by ddNTP in both in vitro DNA polymerase activity assay and activity gel analysis. Aphidicolin, an inhibitor of other types of DNA polymerases, had no effect on plant enzyme. The 67 kDa rice DNA polymerase was found to be recognized by the polyclonal antibody (purified IgG) made against rat DNA polymerase beta (pol beta) both in solution and also on Western blot. The recognition was found to be very specific as the activity of Klenow enzyme was unaffected by the antibody. The ability of rice nuclear extract to correct G:U mismatch of oligo-duplex was observed when oligo-duplex with 32P-labeled lower strand containing U (at 22nd position) was used as substrate. Differential appearance of bands at 21-mer, 22-mer, and 51-mer position in presence of dCTP was visible only with G:U mismatch oligo-duplex, but not with G:C oligo-duplex. While ddCTP or polyclonal antibody against rat-DNA pol beta inhibits base excision repair (BER), aphidicolin had no effect. These results for the first time clearly demonstrate the ability of rice nuclear extract to run BER and the involvement of ddNTP-sensitive pol beta type DNA polymerase. Immunological similarity of the ddNTP-sensitive DNA polymerase beta of rice and rat and its involvement in BER revealed the conservation of structure and function of ddNTP-sensitive DNA pol beta in plant and animal.

  9. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K


    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  10. Zinc finger nuclease: a new approach for excising HIV-1 proviral DNA from infected human T cells.

    Qu, Xiying; Wang, Pengfei; Ding, Donglin; Wang, Xiaohui; Zhang, Gongmin; Zhou, Xin; Liu, Lin; Zhu, Xiaoli; Zeng, Hanxian; Zhu, Huanzhang


    A major reason that Acquired Immune Deficiency Syndrome (AIDS) cannot be completely cured is the human immunodeficiency virus 1 (HIV-1) provirus integrated into the human genome. Though existing therapies can inhibit replication of HIV-1, they cannot eradicate it. A molecular therapy gains popularity due to its specifically targeting to HIV-1 infected cells and effectively removing the HIV-1, regardless of viral genes being active or dormant. Now, we propose a new method which can excellently delete the HIV provirus from the infected human T cell genome. First, we designed zinc-finger nucleases (ZFNs) that target a sequence within the long terminal repeat (LTR) U3 region that is highly conserved in whole clade. Then, we screened out one pair of ZFN and named it as ZFN-U3. We discovered that ZFN-U3 can exactly target and eliminate the full-length HIV-1 proviral DNA after the infected human cell lines treated with it, and the frequency of its excision was about 30 % without cytotoxicity. These results prove that ZFN-U3 can efficiently excise integrated HIV-1 from the human genome in infected cells. This method to delete full length HIV-1 in human genome can therefore provide a novel approach to cure HIV-infected individuals in the future.

  11. Use of capillary GC-MS for identification of radiation-induced DNA base damage: Implications for base-excision repair of DNA

    Dizdaroglu, M.


    Application of GC-MS to characterization of radiation-induced base products of DNA and DNa base-amino acid crosslinks is presented. Samples of γ-irradiated DNa were hydrolyzed with formic acid, trimethylsilylated and subjected to GC-MS analysis using a fused silica capillary column. Hydrolysis conditions suitable for the simultaneous analysis of the radiation-induced products of all four DNA bases in a single run were determined. The trimethylsilyl derivatives of these products had excellent GC-properties and easily interpretable mass spectra. The complementary use of t-butyldimetylsilyl derivatives was also demonstrated. Moreover, the usefulness of this method for identification of radiation-induced DNA base-amino acid crosslinks was shown using γ-irradiated mixtures of thymine and tyrosine or phenylalanine. Because of the excellent resolving power of capillary GC and the instant and highly sensitive identification by MS, GC-MS is suggested as a suitable technique for identification of altered bases removed from DNA by base-excision repair enzymes

  12. Studies on the DNA excision repair in lymphocytes of patients with recurrent herpes simplex

    Fanta, D.; Topaloglou, A.; Altmann, H.


    DNA repair was investigated in lymphocytes from patients with recurrent herpes simplex and from healthy controls. From the results - depressed UV type repair, depressed gamma type repair, reduced RF - it may be concluded that mutations can be expected due to the faults remaining in the DNA. This may not only lower cellular immunocompetence, but also activate already present oncogenic virus informations within the cellular DNA. Thus, irrespective of the possible oncogenic potential of HSV, there seems to be an increased risk of late effects in patients with recurrent herpetic manifestations. (Auth.)

  13. Investigations on the mechanism of DNA excision repair in tissue culture cells

    Wawra, E.; Dolejs, I.; Ott, E.


    Semiconservative DNA- synthesis and repair- synthesis was measured in HeLa cells and spleen cells under different conditions (i.e. different temperatures, addition of p-chloromercuribenzoate or cytosine-arabinoside). In order to obtain more information about the enzymatic background of these steps of DNA metabolism, parallel in vitro experiments were done with two different types of DNA polymerase, which had been isolated from pig spleen. At least the experiments at different temperatures are showing some correlations of α-polymerase with semiconservative synthesis and of β-polymerase with repair synthesis. (author)

  14. Excised radicle tips as a source of genomic DNA for PCR-based ...


    Dec 13, 2012 ... Cotton; cry1Ac; genomic DNA isolation; high-resolution melting curve analysis; radicle tip; seed purity testing .... cooled to 40°C. Fluorescence data for melting curves were ... greatly increased by introducing automation.

  15. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.


    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  16. An inverse switch in DNA base excision and strand break repair contributes to melphalan resistance in multiple myeloma cells.

    Mirta M L Sousa

    Full Text Available Alterations in checkpoint and DNA repair pathways may provide adaptive mechanisms contributing to acquired drug resistance. Here, we investigated the levels of proteins mediating DNA damage signaling and -repair in RPMI8226 multiple myeloma cells and its Melphalan-resistant derivative 8226-LR5. We observed markedly reduced steady-state levels of DNA glycosylases UNG2, NEIL1 and MPG in the resistant cells and cross-resistance to agents inducing their respective DNA base lesions. Conversely, repair of alkali-labile sites was apparently enhanced in the resistant cells, as substantiated by alkaline comet assay, autoribosylation of PARP-1, and increased sensitivity to PARP-1 inhibition by 4-AN or KU58684. Reduced base-excision and enhanced single-strand break repair would both contribute to the observed reduction in genomic alkali-labile sites, which could jeopardize productive processing of the more cytotoxic Melphalan-induced interstrand DNA crosslinks (ICLs. Furthermore, we found a marked upregulation of proteins in the non-homologous end-joining (NHEJ pathway of double-strand break (DSB repair, likely contributing to the observed increase in DSB repair kinetics in the resistant cells. Finally, we observed apparent upregulation of ATR-signaling and downregulation of ATM-signaling in the resistant cells. This was accompanied by markedly increased sensitivity towards Melphalan in the presence of ATR-, DNA-PK, or CHK1/2 inhibitors whereas no sensitizing effect was observed subsequent to ATM inhibition, suggesting that replication blocking lesions are primary triggers of the DNA damage response in the Melphalan resistant cells. In conclusion, Melphalan resistance is apparently contributed by modulation of the DNA damage response at multiple levels, including downregulation of specific repair pathways to avoid repair intermediates that could impair efficient processing of cytotoxic ICLs and ICL-induced DSBs. This study has revealed several novel

  17. PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma.

    Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li


    The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.

  18. Structural and kinetic insights into binding and incorporation of L-nucleotide analogs by a Y-family DNA polymerase

    Gaur, Vineet; Vyas, Rajan; Fowler, Jason D.; Efthimiopoulos, Georgia; Feng, Joy Y.; Suo, Zucai


    Considering that all natural nucleotides (D-dNTPs) and the building blocks (D-dNMPs) of DNA chains possess D-stereochemistry, DNA polymerases and reverse transcriptases (RTs) likely possess strongD-stereoselectivity by preferably binding and incorporating D-dNTPs over unnatural L-dNTPs during DNA synthesis. Surprisingly, a structural basis for the discrimination against L-dNTPs by DNA polymerases or RTs has not been established although L-deoxycytidine analogs (lamivudine and emtricitabine) a...

  19. Base excision repair of oxidative DNA damage and association with cancer and aging

    Maynard, Scott; Schurman, Shepherd H; Harboe, Charlotte


    Aging has been associated with damage accumulation in the genome and with increased cancer incidence. Reactive oxygen species (ROS) are produced from endogenous sources, most notably the oxidative metabolism in the mitochondria, and from exogenous sources, such as ionizing radiation. ROS attack DNA...

  20. Distinctive features of single nucleotide alterations in induced pluripotent stem cells with different types of DNA repair deficiency disorders

    Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro


    Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874

  1. Inroads into base excision repair I. The discovery of apurinic/apyrimidinic (AP) endonuclease. "An endonuclease for depurinated DNA in Escherichia coli B," Canadian Journal of Biochemistry, 1972.

    Lindahl, Tomas; Verly, W G; Paquette Y


    DNA treated with alkylating agents is incised at sites of damage by cell extracts. A key component of this DNA repair function was shown by Verly and co-workers to be an endonuclease acting at secondary lesions, apurinic sites, rather than directly at alkylated nucleotide residues.

  2. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun


    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at

  3. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    Dong, Min; Graham, Mitchell; Yadav, Nehul


    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at PMID:28582416

  4. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Jieming Shi

    Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at

  5. Ultraviolet-induced DNA excision repair in human B and T lymphocytes. II

    Yew, F.F.-H.; Johnson, R.T.


    Despite their great sensitivity to ultraviolet light purified human B and T lymphocytes are capable of complete repair provided that the ultraviolet dose does not exceed 0.5 Jm -2 . Their capacity to repair, as measured by the restoration of DNA supercoiling in preparations of nucleoids, and their survival are significantly increased in the presence of deoxyribonucleosides. Certain agents which inhibit semi-conservative DNA synthesis (hydroxyurea, 1-β-D-arabino-furanosylcytosine (arafCyt) either stop or delay the repair process in lymphocytes. The effect of hydroxyurea is eventually overcome spontaneously, but changes in the sedimentation behaviour of ultraviolet-irradiated nucleoids caused by arafCyt can only be neutralized by addition of deoxycytidine. The effective inhibition of repair by arafCyt permits the detection of extremely small amounts of ultraviolet damage and also the estimation of when repair is complete. (Auth.)

  6. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    Siebert, P.D.; Fukuda, M.


    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  7. Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates

    Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla


    Roč. 26, č. 2 (2016), s. 288-291 ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.454, year: 2016

  8. Synthesis of Aldehyde-Linked Nucleotides and DNA and Their Bioconjugations with Lysine and Peptides through Reductive Amination

    Raindlová, Veronika; Pohl, Radek; Hocek, Michal


    Roč. 18, č. 13 (2012), s. 4080-4087 ISSN 0947-6539 R&D Projects: GA ČR GA203/09/0317 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleotides * aldehydes * DNA * reductive amination * bioconjugations Subject RIV: CC - Organic Chemistry Impact factor: 5.831, year: 2012

  9. Overexpression of DNA ligase III in mitochondria protects cells against oxidative stress and improves mitochondrial DNA base excision repair

    Akbari, Mansour; Keijzers, Guido; Maynard, Scott


    slower than the preceding mitochondrial BER steps. Overexpression of DNA ligase III in mitochondria improved the rate of overall BER, increased cell survival after menadione induced oxidative stress and reduced autophagy following the inhibition of the mitochondrial electron transport chain complex I...

  10. Excision without excision

    Brown, David; Sarbach, Olivier; Schnetter, Erik; Diener, Peter; Tiglio, Manuel; Hawke, Ian; Pollney, Denis


    to turducken (turduckens, turduckening, turduckened, turduckened) [math.]: To stuff a black hole. We analyze and apply an alternative to black hole excision based on smoothing the interior of black holes with arbitrary initial data, and solving the vacuum Einstein evolution equations everywhere. By deriving the constraint propagation system for our hyperbolic formulation of the BSSN evolution system we rigorously prove that the constraints propagate causally and so any constraint violations introduced inside the black holes cannot affect the exterior spacetime. We present evolutions of Cook-Pfeiffer binary black hole initial configurations showing that these techniques appear to work robustly for generic data. We also present evidence from spherically symmetric evolutions that for the gauge conditions used the same stationary end-state is approached irrespective of the choice of initial data and smoothing procedure

  11. Dependence of u.v.-induced DNA excision repair on deoxyribonucleoside triphosphate concentrations in permeable human fibroblasts: a model for the inhibition of repair by hydroxyurea

    Hunting, D.J.; Dresler, S.L.


    We have tested the hypothesis that the inhibition by hydroxyurea of repair patch ligation and chromatin rearrangement during u.v.-induced DNA excision repair results from a reduction in cellular deoxyribonucleotide concentrations and not from a direct effect of hydroxyurea on the repair process. Using permeable human fibroblasts, we have shown that hydroxyurea has no direct effect on either repair synthesis or repair patch ligation. We also have shown that by reducing the deoxyribonucleoside triphosphate concentrations in the permeable cell reaction mixture, we can mimic the inhibition of repair patch ligation and chromatin rearrangement seen when u.v.-damaged intact confluent fibroblasts are treated with hydroxyurea. Our results are consistent with the concept that hydroxyurea inhibits DNA repair in intact cells by inhibiting deoxyribonucleotide synthesis through its effect on ribonucleotide reductase and, conversely, that continued deoxyribonucleotide synthesis is required for the excision repair of u.v.-induced DNA damage even in resting cells

  12. Analysis of mutagenic DNA repair in a thermoconditional mutant of Saccharomyces cerevisiae. IV. Influence of DNA replication and excision repair on REV2 dependent UV-mutagenesis and repair

    Siede, W.; Eckardt, F.


    A double mutant being thermoconditionally defective in mutation induction as well as in repair of pre-lethal UV-induced DNA damage (rev2ts) and deficient in excision repair (rad3-2) was studied in temperature-shift experiments. The influence of inhibitors of DNA replication (hydroxyurea, aphidicolin) was determined. Additionally, an analysis of the dose-response pattern of mutation induction (mutation kinetics) at several ochre alleles was carried out. It was concluded that the UV-inducible REV2 dependent mutagenic repair process is not induced in excision-deficient cells. In excision-deficient cells, REV2 dependent mutation fixation is slow and mostly post-replicative though not dependent on DNA replication. The REV2 mediated mutagenic process could be separated from the repair function.

  13. In vivo excision of pyrimidine dimers is mediated by a DNA N-glycosylase in Micrococcus luteus but not in human fibroblasts

    La Belle, M.; Linn, S.


    It has been previously shown that Micrococcus luteus possesses a pyrimidine dimer-specific endonuclease which in vitro, functions as both an endonuclease and DNA-glycosylase. To determine if these combined activities function in vivo, the excision products of UV-irradiated M. luteus were isolated and examined. In addition, a procedure was devised to isolate and examine the excision products from UV-irradiated human fibroblasts to determine if an endonuclease/glycosylase activity functions in the excision of UV-induced pyrimidine dimers in human fibroblasts. It was shown that, in vivo, an endonuclease/glycosylase mechanism is utilized extensively in the repair of pyrimidine dimers by M. luteus, but that human fibroblasts do not appear to use this mechanism. (author)

  14. In vivo excision of pyrimidine dimers is mediated by a DNA N-glycosylase in Micrococcus luteus but not in human fibroblasts

    La Belle, M; Linn, S [California Univ., Berkeley (USA). Dept. of Biochemistry


    It has been previously shown that Micrococcus luteus possesses a pyrimidine dimer-specific endonuclease which in vitro, functions as both an endonuclease and DNA-glycosylase. To determine if these combined activities function in vivo, the excision products of UV-irradiated M. luteus were isolated and examined. In addition, a procedure was devised to isolate and examine the excision products from UV-irradiated human fibroblasts to determine if an endonuclease/glycosylase activity functions in the excision of UV-induced pyrimidine dimers in human fibroblasts. It was shown that, in vivo, an endonuclease/glycosylase mechanism is utilized extensively in the repair of pyrimidine dimers by M. luteus, but that human fibroblasts do not appear to use this mechanism.

  15. Deficiency of UV-induced excision repair in human thymocytes

    Gensler, H.L.; Lindberg, R.E.; Pinnas, J.L.; Jones, J.F.


    The capacity of human thymocytes and of differentiated lymphocytes circulating in peripheral blood to perform unscheduled DNA synthesis (a measure of nucleotide excision repair) after UV irradiation was measured by radioautographic analysis. Only 4% of immature T lymphocytes, but 68% of circulating lymphocytes exhibited unscheduled DNA synthesis. When UV sensitivity of peripheral blood lymphocytes and thymocytes from the same donor were compared, the thymocytes, in each case, were significantly more UV sensitive than were the circulating lymphocytes. Peripheral blood lymphocytes from subjects undergoing halothane and morphine anesthesia during surgery showed 56% less excision repair capacity than those from unanesthetized donors. The difference occurred in the number of cells capable of repair rather than in the extent of repair synthesis per cell. Ultraviolet-induced unscheduled DNA synthesis occurred in only 3% of the thymocytes removed from rats killed by cervical dislocation. Therefore, the deficiency of excision repair was observed in rat thymocytes which had not been affected by anesthesia or surgical trauma. The results indicate that immature T-cells are deficient in nucleotide excision repair whereas the majority of mature peripheral blood lymphocytes exhibit such repair. (author)

  16. DNA Three-Way Junction for Differentiation of Single-Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles.

    Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin


    A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Excision-repair in mutants of Escherichia coli deficient in DNA polymerase I and/or its associated 5'. -->. 3' exonuclease

    Cooper, P [Stanford Univ., Calif. (USA). Dept. of Biological Sciences


    The UV sensitivity of E.coli mutants deficient in the 5'..-->..3' exonuclease activity of DNA polymerase I is intermediate between that of pol/sup +/ strains and mutants which are deficient in the polymerizing activity of pol I (polA1). Like polA1 mutants, the 5'-econuclease deficient mutants exhibit increased UV-induced DNA degradation and increased repair synthesis compared to a pol/sup +/ strain, although the increase is not as great as in polA1 or in the conditionally lethal mutant BT4113ts deficient in both polymerase I activities. When dimer excision was measured at UV doses low enough to avoid interference from extensive DNA degradation, all three classes of polymerase I deficient mutants were found to remove dimers efficiently from their DNA. We conclude that enzymes alternative to polymerase I can operate in both the excision and resynthesis steps of excision repair and that substitution for either of the polymerase I functions results in longer patches of repair. A model is proposed detailing the possible events in the alternative pathways.

  18. RNF111/Arkadia is a SUMO-targeted ubiquitin ligase that facilitates the DNA damage response

    Poulsen, Sara L; Hansen, Rebecca K; Wagner, Sebastian A


    nonproteolytic, K63-linked ubiquitylation of SUMOylated target proteins. We demonstrate that RNF111 promoted ubiquitylation of SUMOylated XPC (xeroderma pigmentosum C) protein, a central DNA damage recognition factor in nucleotide excision repair (NER) extensively regulated by ultraviolet (UV...

  19. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey


    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  20. A nucleotide-analogue-induced gain of function corrects the error-prone nature of human DNA polymerase iota.

    Ketkar, Amit; Zafar, Maroof K; Banerjee, Surajit; Marquez, Victor E; Egli, Martin; Eoff, Robert L


    Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2'-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2'-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle, which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base-stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase.

  1. A nucleotide analogue induced gain of function corrects the error-prone nature of human DNA polymerase iota

    Ketkar, Amit; Zafar, Maroof K.; Banerjee, Surajit; Marquez, Victor E.; Egli, Martin; Eoff, Robert L


    Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2′-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2′-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle (χ), which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase. PMID:22632140

  2. Helicase and Polymerase Move Together Close to the Fork Junction and Copy DNA in One-Nucleotide Steps

    Manjula Pandey


    Full Text Available By simultaneously measuring DNA synthesis and dNTP hydrolysis, we show that T7 DNA polymerase and T7 gp4 helicase move in sync during leading-strand synthesis, taking one-nucleotide steps and hydrolyzing one dNTP per base-pair unwound/copied. The cooperative catalysis enables the helicase and polymerase to move at a uniformly fast rate without guanine:cytosine (GC dependency or idling with futile NTP hydrolysis. We show that the helicase and polymerase are located close to the replication fork junction. This architecture enables the polymerase to use its strand-displacement synthesis to increase the unwinding rate, whereas the helicase aids this process by translocating along single-stranded DNA and trapping the unwound bases. Thus, in contrast to the helicase-only unwinding model, our results suggest a model in which the helicase and polymerase are moving in one-nucleotide steps, DNA synthesis drives fork unwinding, and a role of the helicase is to trap the unwound bases and prevent DNA reannealing.

  3. Whole Blood PCR Amplification with Pfu DNA Polymerase and Its Application in Single-Nucleotide Polymorphism Analysis.

    Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping


    Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.

  4. denV gene of bacteriophage T4 restores DNA excision repair to mei-9 and mus201 mutants of Drosophila melanogaster

    Banga, S.S.; Boyd, J.B.; Valerie, K.; Harris, P.V.; Kurz, E.M.; de Riel, J.K.


    The denV gene of bacteriophage T4 was fused to a Drosophila hsp70 (70-kDa heat shock protein) promoter and introduced into the germ line of Drosophila by P-element-mediated transformation. The protein product of that gene (endonuclease V) was detected in extracts of heat-shocked transformants with both enzymological and immunoblotting procedures. That protein restores both excision repair and UV resistance to mei-9 and mus201 mutants of this organism. These results reveal that the denV gene can compensate for excision-repair defects in two very different eukayotic mutants, in that the mus201 mutants are typical of excision-deficient mutants in other organisms, whereas the mei-9 mutants exhibit a broad pleiotropism that includes a strong meiotic deficiency. This study permits an extension of the molecular analysis of DNA repair to the germ line of higher eukaryotes. It also provides a model system for future investigations of other well-characterized microbial repair genes on DNA damage in the germ line of this metazoan organism

  5. Synthesis of aldehyde-linked nucleotides and DNA and their bioconjugations with lysine and peptides through reductive amination.

    Raindlová, Veronika; Pohl, Radek; Hocek, Michal


    5-(5-Formylthienyl)-, 5-(4-formylphenyl)- and 5-(2-fluoro-5-formylphenyl)cytosine 2'-deoxyribonucleoside mono- (dC(R)MP) and triphosphates (dC(R)TP) were prepared by aqueous Suzuki-Miyaura cross-coupling of 5-iodocytosine nucleotides with the corresponding formylarylboronic acids. The dC(R)TPs were excellent substrates for DNA polymerases and were incorporated into DNA by primer extension or PCR. Reductive aminations of the model dC(R)MPs with lysine or lysine-containing tripeptide were studied and optimized. In aqueous phosphate buffer (pH 6.7) the yields of the reductive aminations with tripeptide III were up to 25 %. Bioconjugation of an aldehyde-containing DNA with a lysine-containing tripeptide was achieved through reductive amination in yields of up to 90 % in aqueous phosphate buffer. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Technical reproducibility of single-nucleotide and size-based DNA biomarker assessment using DNA extracted from formalin-fixed, paraffin-embedded tissues.

    Zhang, Shenli; Tan, Iain B; Sapari, Nur S; Grabsch, Heike I; Okines, Alicia; Smyth, Elizabeth C; Aoyama, Toru; Hewitt, Lindsay C; Inam, Imran; Bottomley, Dan; Nankivell, Matthew; Stenning, Sally P; Cunningham, David; Wotherspoon, Andrew; Tsuburaya, Akira; Yoshikawa, Takaki; Soong, Richie; Tan, Patrick


    DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissues has been used in the past to analyze genetic polymorphisms. We evaluated the technical reproducibility of different types of assays for gene polymorphisms using DNA extracted from FFPE material. By using the MassARRAY iPLEX system, we investigated polymorphisms in DPYD (rs1801159 and rs3918290), UMPS (rs1801019), ERCC1 (rs11615), ERCC1 (rs3212986), and ERCC2 (rs13181) in 56 FFPE DNA samples. By using PCR, followed by size-based gel electrophoresis, we also examined TYMS 5' untranslated region 2R/3R repeats and GSTT1 deletions in 50 FFPE DNA samples and 34 DNAs extracted from fresh-frozen tissues and cell lines. Each polymorphism was analyzed by two independent runs. We found that iPLEX biomarker assays measuring single-nucleotide polymorphisms provided consistent concordant results. However, by using FFPE DNA, size-based PCR biomarkers (GSTT1 and TYMS 5' untranslated region) were discrepant in 32.7% (16/49, with exact 95% CI, 19.9%-47.5%; exact binomial confidence limit test) and 4.2% (2/48, with exact 95% CI, 0.5%-14.3%) of cases, respectively, whereas no discrepancies were observed using intact genomic DNA. Our findings suggest that DNA from FFPE material can be used to reliably test single-nucleotide polymorphisms. However, results based on size-based PCR biomarkers, and particularly GSTT1 deletions, using FFPE DNA need to be interpreted with caution. Independent repeated assays should be performed on all cases to assess potential discrepancies. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  7. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki


    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  8. Excision repair of gamma-ray-induced alkali-stable DNA lesions with the help of γ-endonuclease from Micrococcus luteus

    Tomilin, N.V.; Barenfeld, L.S.


    γ-endonuclease Y, an enzyme that hydrolyses phosphodiester bonds at alkali-stable lesions in γ-irradiated (N 2 , tris buffer) DNA, has been partially purified from Micrococcus luteus. The enzyme has a molecular weight of about 19 000, induces single-strand breaks with 3'OH-5'PO 4 termini and contains endonuclease activity towards DNA treated with 7-bromomethylbenz(a)anthracene. γ-endonuclease Y induces breaks in OsO 4 -treated poly(dA-dT) and apparently is specific towards γ-ray-induced base lesions of the t' type. The complete excision repair of γ-endonuclease Y substrate sites has been performed in vitro by γ-endonuclease Y, DNA polymerase and ligase. (author)

  9. Excision repair of gamma-ray-induced alkali-stable DNA lesions with the help of. gamma. -endonuclease from Micrococcus luteus

    Tomilin, N V; Barenfeld, L S [AN SSSR, Leningrad. Inst. Tsitologii


    ..gamma..-endonuclease Y, an enzyme that hydrolyses phosphodiester bonds at alkali-stable lesions in ..gamma..-irradiated (N/sub 2/, tris buffer) DNA, has been partially purified from Micrococcus luteus. The enzyme has a molecular weight of about 19 000, induces single-strand breaks with 3'OH-5'PO/sub 4/ termini and contains endonuclease activity towards DNA treated with 7-bromomethylbenz(a)anthracene. ..gamma..-endonuclease Y induces breaks in OsO/sub 4/-treated poly(dA-dT) and apparently is specific towards ..gamma..-ray-induced base lesions of the t' type. The complete excision repair of ..gamma..-endonuclease Y substrate sites has been performed in vitro by ..gamma..-endonuclease Y, DNA polymerase and ligase.

  10. Small serine recombination systems ParA-MRS and CinH-RS2 perform precise excision of plastid DNA

    Selectable marker genes (SMGs) are necessary for selection of transgenic plants. However, once stable transformants have been identified, the marker gene is no longer needed. In this study, we demonstrate the use of the small serine recombination systems, ParA-MRS and CinH-RS2, to precisely excise ...

  11. Alkylsulfanylphenyl derivatives of cytosine and 7-deazaadenine nucleosides, nucleotides and nucleoside triphosphates. Synthesis, polymerase incorporation to DNA and electrochemical study

    Macíčková-Cahová, Hana; Pohl, Radek; Horáková Brázdilová, Petra; Havran, Luděk; Špaček, Jan; Fojta, Miroslav; Hocek, Michal


    Roč. 17, č. 21 (2011), s. 5833-5841 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06035; GA MŠk LC512; GA ČR GA203/09/0317; GA AV ČR(CZ) IAA400040901 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA polymerases * electrochemistry * nucleosides * nucleotides * organosulfur compounds Subject RIV: CC - Organic Chemistry Impact factor: 5.925, year: 2011

  12. 2′-O-methyl nucleotide modified DNA substrates influence the ...


    Jul 18, 2014 ... 1. Introduction. Due to the development of novel nucleotide derivatives, ..... which is located in a spiral ring made of 152-157 bases before α6. ..... 8 126–. 130. Majlessi M, Nelson NC and Becker MM 1998 Advantages of 2'-O-.

  13. DNA-thioguanine nucleotide concentration and relapse-free survival during maintenance therapy of childhood acute lymphoblastic leukaemia (NOPHO ALL2008)

    Nielsen, Stine Nygaard; Grell, Kathrine; Nersting, Jacob


    BACKGROUND: Adjustment of mercaptopurine and methotrexate maintenance therapy of acute lymphoblastic leukaemia by leucocyte count is confounded by natural variations. Cytotoxicity is primarily mediated by DNA-incorporated thioguanine nucleotides (DNA-TGN). The aim of this study was to establish w...

  14. Anchoring cationic amphiphiles for nucleotide delivery: significance of DNA release from cationic liposomes for transfection.

    Hirashima, Naohide; Minatani, Kazuhiro; Hattori, Yoshifumi; Ohwada, Tomohiko; Nakanishi, Mamoru


    We have designed and synthesized lithocholic acid-based cationic amphiphile molecules as components of cationic liposomes for gene transfection (lipofection). To study the relationship between the molecular structures of those amphiphilic molecules, particularly the extended hydrophobic appendant (anchor) at the 3-hydroxyl group, and transfection efficiency, we synthesized several lithocholic and isolithocholic acid derivatives, and examined their transfection efficiency. We also compared the physico-chemical properties of cationic liposomes prepared from these derivatives. We found that isolithocholic acid derivatives exhibit higher transfection efficiency than the corresponding lithocholic acid derivatives. This result indicates that the orientation and extension of hydrophobic regions influence the gene transfection process. Isolithocholic acid derivatives showed a high ability to encapsulate DNA in a compact liposome-DNA complex and to protect it from enzymatic degradation. Isolithocholic acid derivatives also facilitated the release of DNA from the liposome-DNA complex, which is a crucial step for DNA entry into the nucleus. Our results show that the transfection efficiency is directly influenced by the ability of the liposome complex to release DNA, rather than by the DNA-encapsulating ability. Molecular modeling revealed that isolithocholic acid derivatives take relatively extended conformations, while the lithocholic acid derivatives take folded structures. Thus, the efficiency of release of DNA from cationic liposomes in the cytoplasm, which contributes to high transfection efficiency, appears to be dependent upon the molecular shape of the cationic amphiphiles.

  15. Inducible nucleotide excision repair (NER) of UV-induced cyclobutane pyrimidine dimers in the cell cycle of the budding yeast Saccharomyces cerevisiae: evidence that inducible NER is confined to the G1 phase of the mitotic cell cycle

    Scott, A.D.; Waters, R.


    We previously reported on an inducible component of nucleotide excision repair in Saccharomyces cerevisiae that is controlled by the RAD16 gene. Here we describe a study of this event at the MAT alpha and HML alpha mating-type loci and on the transcribed (TS) and nontranscribed (NTS) strands of the RAD16 gene. Events were examined at various stages of the mitotic cycle in cells synchronised by centrifugal elutriation. Repair of cyclobutane pyrimidine dimers (CPDs) following a single UV dose does not vary significantly in different stages of the mitotic cell cycle. CPDs are removed more rapidly from the transcriptionally active MAT alpha locus than from the silent HML alpha locus, and the TS of RAD16 is repaired faster than the NTS in all stages of the cycle following a single UV irradiation. Enhanced excision of CPDs at MAT alpha and HML alpha can be induced only in the G1 and early S stages of the cell cycle. Here prior irradiation of cells with 25 J/m 2 enhances the removal of CPDs following a second UV dose of 70 J/m 2 . The level of enhancement of repair does not differ significantly between MAT alpha and HML alpha in G1. Enhanced removal of CPDs is absent when cells receive the inducing dose in late S or G2/M. Repair of CPDs in both strands of RAD16 is similarly enhanced only if cells receive the initial irradiation in G1 and early S. The level of enhanced removal of CPDs is not significantly different in the TS and NTS of RAD16 either in asynchronous cells or in cells preirradiated in G1 and early S. It has been shown by others that UV-induced expression of RAD16 remains at high levels if cells are held in G1 by treatment with alpha factor. Therefore the increase in RAD16 transcript levels in G1 may be responsible for the ability to enhance NER solely in this stage of the cell cycle

  16. DNA Damage Induced by Alkylating Agents and Repair Pathways

    Natsuko Kondo; Akihisa Takahashi; Koji Ono; Takeo Ohnishi


    The cytotoxic effects of alkylating agents are strongly attenuated by cellular DNA repair processes, necessitating a clear understanding of the repair mechanisms. Simple methylating agents form adducts at N- and O-atoms. N-methylations are removed by base excision repair, AlkB homologues, or nucleotide excision repair (NER). O 6-methylguanine (MeG), which can eventually become cytotoxic and mutagenic, is repaired by O 6-methylguanine-DNA methyltransferase, and O 6MeG:T mispairs are recognized...

  17. Damages to DNA that result in neoplastic transformation

    Setlow, R.B.


    Some topics discussed are: correlation between carcinogens and mutagens; defective DNA repair in uv-damaged xeroderma pigmentosum cells; analysis of nucleotide damage to DNA following exposure to chemicals or radiations; photoreactivation in uv-irradiated Escherichia coli; tumor development in fish; excision repair as an aid in identifying damage; detection of excision repair; role of endonucleases in repair of uv damage; and alkylation products and tumors

  18. Is the Oxidative DNA Damage Level of Human Lymphocyte Correlated with the Antioxidant Capacity of Serum or the Base Excision Repair Activity of Lymphocyte?

    Yi-Chih Tsai


    Full Text Available A random screening of human blood samples from 24 individuals of nonsmoker was conducted to examine the correlation between the oxidative DNA damage level of lymphocytes and the antioxidant capacity of serum or the base excision repair (BER activity of lymphocytes. The oxidative DNA damage level was measured with comet assay containing Fpg/Endo III cleavage, and the BER activity was estimated with a modified comet assay including nuclear extract of lymphocytes for enzymatic cleavage. Antioxidant capacity was determined with trolox equivalent antioxidant capacity assay. We found that though the endogenous DNA oxidation levels varied among the individuals, each individual level appeared to be steady for at least 1 month. Our results indicate that the oxidative DNA damage level is insignificantly or weakly correlated with antioxidant capacity or BER activity, respectively. However, lymphocytes from carriers of Helicobacter pylori (HP or Hepatitis B virus (HBV tend to give higher levels of oxidative DNA damage (P<0.05. Though sera of this group of individuals show no particular tendency with reduced antioxidant capacity, the respective BER activities of lymphocytes are lower in average (P<0.05. Thus, reduction of repair activity may be associated with the genotoxic effect of HP or HBV infection.

  19. Quantitative strategies to determine cisplatin adducts with DNA nucleotides in drosofila larvae and tumoral cell cultures

    Garcia Sar, D.; Montes-Bayon, M.; Hann, S.; Koellensperger, G.; Blanco-Gonzalez, E.; Sanz-Medel, A.


    Full text: The antitumoral effect of cisplatin [cis-diamminodichloroplatinum(II)] in mammals is related to its binding to DNA components. A novel sensitive and selective method is proposed to quantify cisplatin-DNA adducts induced in vivo in somatic cells of Drosophila melanogaster at biologically relevant concentrations. The method uses HPLC-ICPMS in combination with species-specific isotope dilution analysis (cisplatin enriched in 194 Pt). For the first time, a cisplatin-DNA adduct is quantified by this approach. The obtained results show the great potential of this system to advance our molecular understanding of the biological effects of cisplatin. (author)

  20. A child with xeroderma pigmentosum for excision of basal cell carcinoma

    Sridevi M Mulimani


    Full Text Available Xeroderma pigmentosum (XP is characterized by hypersensitivity to sunlight, ocular involvement, and progressive neurological complications. These manifestations are due to a cellular hypersensitivity to ultraviolet radiation leading to a defect in repair of DNA by the process of nucleotide excision repair. Basal cell carcinoma which is rare in children can occur with XP. Though the XP induced changes are predominately dermatologic, pose several challenges in anaesthetic management. Hence, we are reporting a 9-year-old child with XP scheduled for excision of basal cell carcinoma under general anaesthesia.

  1. Pre-Steady State Kinetic Investigation of the Incorporation of Anti-Hepatitis B Nucleotide Analogs Catalyzed by Non-Canonical Human DNA Polymerases

    Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai


    Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702

  2. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.


    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  3. Base excision repair of chemotherapeutically-induced alkylated DNA damage predominantly causes contractions of expanded GAA repeats associated with Friedreich's ataxia.

    Yanhao Lai

    Full Text Available Expansion of GAA·TTC repeats within the first intron of the frataxin gene is the cause of Friedreich's ataxia (FRDA, an autosomal recessive neurodegenerative disorder. However, no effective treatment for the disease has been developed as yet. In this study, we explored a possibility of shortening expanded GAA repeats associated with FRDA through chemotherapeutically-induced DNA base lesions and subsequent base excision repair (BER. We provide the first evidence that alkylated DNA damage induced by temozolomide, a chemotherapeutic DNA damaging agent can induce massive GAA repeat contractions/deletions, but only limited expansions in FRDA patient lymphoblasts. We showed that temozolomide-induced GAA repeat instability was mediated by BER. Further characterization of BER of an abasic site in the context of (GAA20 repeats indicates that the lesion mainly resulted in a large deletion of 8 repeats along with small expansions. This was because temozolomide-induced single-stranded breaks initially led to DNA slippage and the formation of a small GAA repeat loop in the upstream region of the damaged strand and a small TTC loop on the template strand. This allowed limited pol β DNA synthesis and the formation of a short 5'-GAA repeat flap that was cleaved by FEN1, thereby leading to small repeat expansions. At a later stage of BER, the small template loop expanded into a large template loop that resulted in the formation of a long 5'-GAA repeat flap. Pol β then performed limited DNA synthesis to bypass the loop, and FEN1 removed the long repeat flap ultimately causing a large repeat deletion. Our study indicates that chemotherapeutically-induced alkylated DNA damage can induce large contractions/deletions of expanded GAA repeats through BER in FRDA patient cells. This further suggests the potential of developing chemotherapeutic alkylating agents to shorten expanded GAA repeats for treatment of FRDA.

  4. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.


    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  5. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.


    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  6. The Potato Nucleotide-binding Leucine-rich Repeat (NLR) Immune Receptor Rx1 Is a Pathogen-dependent DNA-deforming Protein.

    Fenyk, Stepan; Townsend, Philip D; Dixon, Christopher H; Spies, Gerhard B; de San Eustaquio Campillo, Alba; Slootweg, Erik J; Westerhof, Lotte B; Gawehns, Fleur K K; Knight, Marc R; Sharples, Gary J; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J


    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. The Potato Nucleotide-binding Leucine-rich Repeat (NLR) Immune Receptor Rx1 Is a Pathogen-dependent DNA-deforming Protein*

    Fenyk, Stepan; Townsend, Philip D.; Dixon, Christopher H.; Spies, Gerhard B.; de San Eustaquio Campillo, Alba; Slootweg, Erik J.; Westerhof, Lotte B.; Gawehns, Fleur K. K.; Knight, Marc R.; Sharples, Gary J.; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.


    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. PMID:26306038

  8. Single nucleotide editing without DNA cleavage using CRISPR/Cas9-deaminase in the sea urchin embryo.

    Shevidi, Saba; Uchida, Alicia; Schudrowitz, Natalie; Wessel, Gary M; Yajima, Mamiko


    A single base pair mutation in the genome can result in many congenital disorders in humans. The recent gene editing approach using CRISPR/Cas9 has rapidly become a powerful tool to replicate or repair such mutations in the genome. These approaches rely on cleaving DNA, while presenting unexpected risks. In this study, we demonstrate a modified CRISPR/Cas9 system fused to cytosine deaminase (Cas9-DA), which induces a single nucleotide conversion in the genome. Cas9-DA was introduced into sea urchin eggs with sgRNAs targeted for SpAlx1, SpDsh, or SpPks, each of which is critical for skeletogenesis, embryonic axis formation, or pigment formation, respectively. We found that both Cas9 and Cas9-DA edit the genome, and cause predicted phenotypic changes at a similar efficiency. Cas9, however, resulted in significant deletions in the genome centered on the gRNA target sequence, whereas Cas9-DA resulted in single or double nucleotide editing of C to T conversions within the gRNA target sequence. These results suggest that the Cas9-DA approach may be useful for manipulating gene activity with decreased risks of genomic aberrations. Developmental Dynamics 246:1036-1046, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  9. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G


    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  10. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard


    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  11. Repetitive DNA Reeling by the Cascade-Cas3 Complex in Nucleotide Unwinding Steps

    Loeff, Luuk; Brouns, Stan J.J.; Joo, Chirlmin


    CRISPR-Cas provides RNA-guided adaptive immunity against invading genetic elements. Interference in type I systems relies on the RNA-guided Cascade complex for target DNA recognition and the Cas3 helicase/nuclease protein for target degradation. Even though the biochemistry of CRISPR interference

  12. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin


    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  13. Nucleotide-mimetic synthetic ligands for DNA-recognizing enzymes One-step purification of Pfu DNA polymerase.

    Melissis, S; Labrou, N E; Clonis, Y D


    The commercial availability of DNA polymerases has revolutionized molecular biotechnology and certain sectors of the bio-industry. Therefore, the development of affinity adsorbents for purification of DNA polymerases is of academic interest and practical importance. In the present study we describe the design, synthesis and evaluation of a combinatorial library of novel affinity ligands for the purification of DNA polymerases (Pols). Pyrococcus furiosus DNA polymerase (Pfu Pol) was employed as a proof-of-principle example. Affinity ligand design was based on mimicking the natural interactions between deoxynucleoside-triphosphates (dNTPs) and the B-motif, a conserved structural moiety found in Pol-I and Pol-II family of enzymes. Solid-phase 'structure-guided' combinatorial chemistry was used to construct a library of 26 variants of the B-motif-binding 'lead' ligand X-Trz-Y (X is a purine derivative and Y is an aliphatic/aromatic sulphonate or phosphonate derivative) using 1,3,5-triazine (Trz) as the scaffold for assembly. The 'lead' ligand showed complementarity against a Lys and a Tyr residue of the polymerase B-motif. The ligand library was screened for its ability to bind and purify Pfu Pol from Escherichia coli extract. One immobilized ligand (oABSAd), bearing 9-aminoethyladenine (AEAd) and sulfanilic acid (oABS) linked on the triazine scaffold, displayed the highest purifying ability and binding capacity (0,55 mg Pfu Pol/g wet gel). Adsorption equilibrium studies with this affinity ligand and Pfu Pol determined a dissociation constant (K(D)) of 83 nM for the respective complex. The oABSAd affinity adsorbent was exploited in the development of a facile Pfu Pol purification protocol, affording homogeneous enzyme (>99% purity) in a single chromatography step. Quality control tests showed that Pfu Pol purified on the B-motif-complementing ligand is free of nucleic acids and contaminating nuclease activities, therefore, suitable for experimental use.

  14. Anthraquinone as a Redox Label for DNA: Synthesis, Enzymatic Incorporation, and Electrochemistry of Anthraquinone-Modified Nucleosides, Nucleotides, and DNA

    Balintová, Jana; Pohl, Radek; Horáková Brázdilová, Petra; Vidláková, Pavlína; Havran, Luděk; Fojta, Miroslav; Hocek, Michal


    Roč. 17, č. 50 (2011), s. 14063-14073 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06035; GA MŠk LC512; GA AV ČR(CZ) IAA400040901 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : anthraquinone * DNA * electrochemistry * nucleosides * oligonucleotides Subject RIV: CC - Organic Chemistry Impact factor: 5.925, year: 2011

  15. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa


    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  16. Concordance of DNA methylation profiles between breast core biopsy and surgical excision specimens containing ductal carcinoma in situ (DCIS).

    Chen, Youdinghuan; Marotti, Jonathan D; Jenson, Erik G; Onega, Tracy L; Johnson, Kevin C; Christensen, Brock C


    The utility and reliability of assessing molecular biomarkers for translational applications on pre-operative core biopsy specimens assume consistency of molecular profiles with larger surgical specimens. Whether DNA methylation in ductal carcinoma in situ (DCIS), measured in core biopsy and surgical specimens are similar, remains unclear. Here, we compared genome-scale DNA methylation measured in matched core biopsy and surgical specimens from DCIS, including specific DNA methylation biomarkers of subsequent invasive cancer. DNA was extracted from guided 2mm cores of formalin fixed paraffin embedded (FFPE) specimens, bisulfite-modified, and measured on the Illumina HumanMethylation450 BeadChip. DNA methylation profiles of core biopsies exhibited high concordance with matched surgical specimens. Within-subject variability in DNA methylation was significantly lower than between-subject variability (all Pcore biopsy and surgical specimens, 15%, and a pathway analysis of these CpGs indicated enrichment for genes related with wound healing. Our results indicate that DNA methylation measured in core biopsies are representative of the matched surgical specimens and suggest that DCIS biomarkers measured in core biopsies can inform clinical decision-making. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Accurate Dna Assembly And Direct Genome Integration With Optimized Uracil Excision Cloning To Facilitate Engineering Of Escherichia Coli As A Cell Factory

    Cavaleiro, Mafalda; Kim, Se Hyeuk; Nørholm, Morten


    Plants produce a vast diversity of valuable compounds with medical properties, but these are often difficult to purify from the natural source or produce by organic synthesis. An alternative is to transfer the biosynthetic pathways to an efficient production host like the bacterium Escherichia co......-excision-based cloning and combining it with a genome-engineering approach to allow direct integration of whole metabolic pathways into the genome of E. coli, to facilitate the advanced engineering of cell factories........ Cloning and heterologous gene expression are major bottlenecks in the metabolic engineering field. We are working on standardizing DNA vector design processes to promote automation and collaborations in early phase metabolic engineering projects. Here, we focus on optimizing the already established uracil...

  18. Identification of Diagnostic Mitochondrial DNA Single Nucleotide Polymorphisms Specific to Sumatran Orangutan (Pongo abelii Populations

    Puji Rianti


    Full Text Available The hypervariable region I of mitochondrial DNA has frequently been used to distinguish among populations, in particular in species with strong female philopatry. In such cases, populations are expected to diverge rapidly for hypervariable region I markers because of the smaller effective population size and thus increased genetic drift. This rapid divergence leads to the accumulation of mutations exclusively found in one population, which may serve as diagnostic single nucleotide polymorphisms (SNPs. To date, diagnostic SNPs distinctive to Sumatran orangutan populations have not yet been described. However, given the continuously declining numbers of Sumatran orangutans, this information can be vital for effective conservation measures, especially regarding reintroductions of orangutans in rehabilitation centers. Phylogenetic analyses of 54 samples of Sumatran orangutans from nine sampling sites with good provenance, we found five major clades and a total of 20 haplotypes. We propose a total of 52 diagnostic SNPs that are specific to Sumatran orangutan populations. Data can be used to develop restriction fragment length polymorphism assays to carry out genetic assignments using basic laboratory equipment to assign Sumatran orangutan to their population of origin.

  19. Sensing of nucleosides, nucleotides and DNA using luminescent Eu complex by normal and time resolved fluorescence techniques

    Azab, Hassan A.; Anwar, Zeinab M. [Chemistry Department, Faculty of Science, Suez Canal University, 41522 Ismailia (Egypt); Kamel, Rasha M., E-mail: [Chemistry Department, Faculty of Science, Suez University, 43518 Suez (Egypt); Rashwan, Mai S. [Chemistry Department, Faculty of Science, Suez Canal University, 41522 Ismailia (Egypt)


    The interaction of Eu-1,4,7,10-tetraazacyclododecane (Cyclen) complex by using 4,4,4 trifluoro-1-(2-naphthyl)1,3-butanedione (TNB) as antenna with some nucleosides (guanosine, adenosine, cytidine and inosine), nucleotides (AMP, GMP, CMP, ATP and IMP) and DNA is studied using fluorescence technique. Two detection modes are employed one is the time-resolved mode, and the other is the normal luminescence mode. The time-resolved mode is more sensing than the normal luminescence mode in the present study. By using Benesi–Hildebrand equation binding constants were determined at various temperatures. Thermodynamic parameters showed that the reaction is spontaneous through the obtained negative values of free energy change ΔG. The enthalpy ΔH and the entropy ΔS of reactions were all determined. - Highlights: • This is an application for the detection of biologically important ligands. • The detection limits, binding constants and thermodynamic parameters were evaluated. • Effect of some interferents on the detection of DNA has been investigated.

  20. Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

    Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.


    Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

  1. Sensing of nucleosides, nucleotides and DNA using luminescent Eu complex by normal and time resolved fluorescence techniques

    Azab, Hassan A.; Anwar, Zeinab M.; Kamel, Rasha M.; Rashwan, Mai S.


    The interaction of Eu-1,4,7,10-tetraazacyclododecane (Cyclen) complex by using 4,4,4 trifluoro-1-(2-naphthyl)1,3-butanedione (TNB) as antenna with some nucleosides (guanosine, adenosine, cytidine and inosine), nucleotides (AMP, GMP, CMP, ATP and IMP) and DNA is studied using fluorescence technique. Two detection modes are employed one is the time-resolved mode, and the other is the normal luminescence mode. The time-resolved mode is more sensing than the normal luminescence mode in the present study. By using Benesi–Hildebrand equation binding constants were determined at various temperatures. Thermodynamic parameters showed that the reaction is spontaneous through the obtained negative values of free energy change ΔG. The enthalpy ΔH and the entropy ΔS of reactions were all determined. - Highlights: • This is an application for the detection of biologically important ligands. • The detection limits, binding constants and thermodynamic parameters were evaluated. • Effect of some interferents on the detection of DNA has been investigated.

  2. Excision of deaminated cytosine from the vertebrate genome: role of the SMUG1 uracil–DNA glycosylase

    Nilsen, Hilde; Haushalter, Karl A.; Robins, Peter; Barnes, Deborah E.; Verdine, Gregory L.; Lindahl, Tomas


    Gene-targeted mice deficient in the evolutionarily conserved uracil–DNA glycosylase encoded by the UNG gene surprisingly lack the mutator phenotype characteristic of bacterial and yeast ung– mutants. A complementary uracil–DNA glycosylase activity detected in ung–/– murine cells and tissues may be responsible for the repair of deaminated cytosine residues in vivo. Here, specific neutralizing antibodies were used to identify the SMUG1 enzyme as the major uracil–DNA glycosylase in UNG-deficient mice. SMUG1 is present at similar levels in cell nuclei of non-proliferating and proliferating tissues, indicating a replication- independent role in DNA repair. The SMUG1 enzyme is found in vertebrates and insects, whereas it is absent in nematodes, plants and fungi. We propose a model in which SMUG1 has evolved in higher eukaryotes as an anti-mutator distinct from the UNG enzyme, the latter being largely localized to replication foci in mammalian cells to counteract de novo dUMP incorporation into DNA. PMID:11483530

  3. DNA repair and its coupling to DNA replication in eukaryotic cells. [UV, x ray

    Cleaver, J.E.


    This review article with 184 references presents the view that mammalian cells have one major repair system, excision repair, with many branches (nucleotide excision repair, base excision repair, crosslink repair, etc.) and a multiplicity of enzymes. Any particular carcinogen makes a spectrum of damaged sites and each kind of damage may be repaired by one or more branches of excision repair. Excision repair is rarely complete, except at very low doses, and eukaryotic cells survive and replicate DNA despite the presence of unrepaired damage. An alteration in a specific biochemical pathway seen in damaged or mutant cells will not always be the primary consequence of damage or of the biochemical defect of the cells. Detailed kinetic data are required to understand comprehensively the various facets of excision repair and replication. Correlation between molecular events of repair and cytological and cellular changes such as chromosomal damage, mutagenesis, transformation, and carcinogenesis are also rudimentary.

  4. Origin of Oryza sativa in China inferred by nucleotide polymorphisms of organelle DNA.

    Xin Wei

    Full Text Available China is rich of germplasm resources of common wild rice (Oryza rufipogon Griff. and Asian cultivated rice (O. sativa L. which consists of two subspecies, indica and japonica. Previous studies have shown that China is one of the domestication centers of O. sativa. However, the geographic origin and the domestication times of O. sativa in China are still under debate. To settle these disputes, six chloroplast loci and four mitochondrial loci were selected to examine the relationships between 50 accessions of Asian cultivated rice and 119 accessions of common wild rice from China based on DNA sequence analysis in the present study. The results indicated that Southern China is the genetic diversity center of O. rufipogon and it might be the primary domestication region of O. sativa. Molecular dating suggested that the two subspecies had diverged 0.1 million years ago, much earlier than the beginning of rice domestication. Genetic differentiations and phylogeography analyses indicated that indica was domesticated from tropical O. rufipogon while japonica was domesticated from O. rufipogon which located in higher latitude. These results provided molecular evidences for the hypotheses of (i Southern China is the origin center of O. sativa in China and (ii the two subspecies of O. sativa were domesticated multiple times.

  5. Detecting deletions, insertions, and single nucleotide substitutions in cloned β-globin genes and new polymorphic nucleotide substitutions in β-globin genes in a Japanese population using ribonuclease cleavage at mismatches in RNA: DNA duplexes

    Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.


    The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)

  6. Correlation between base-excision repair gene polymorphisms and levels of in-vitro BPDE-induced DNA adducts in cultured peripheral blood lymphocytes.

    Hongping Yu

    Full Text Available In vitro benzo[a]pyrene diol epoxide (BPDE-induced DNA adducts in cultured peripheral lymphocytes have been shown to be a phenotypic biomarker of individual's DNA repair phenotype that is associated with cancer risk. In this study, we explored associations between genotypes of base-excision repair genes (PARP1 Val762Ala, APEX1 Asp148Glu, and XRCC1 Arg399Gln and in vitro BPDE-induced DNA adducts in cultured peripheral blood lymphocytes in 706 cancer-free non-Hispanic white subjects. We found that levels of BPDE-induced DNA adducts were significantly higher in ever smokers than in never smokers and that individuals with the Glu variant genotypes (i.e., Asp/Glu and Glu/Glu exhibited lower levels of BPDE-induced DNA adducts than did individuals with the common Asp/Asp homozygous genotype (median RAL levels: 32.0 for Asp/Asp, 27.0 for Asp/Glu, and 17.0 for Glu/Glu, respectively; P(trend = 0.030. Further stratified analysis showed that compared with individuals with the common APEX1-148 homozygous Asp/Asp genotype, individuals with the APEX1-148Asp/Glu genotype or the Glu/Glu genotype had a lower risk of having higher-level adducts (adjusted OR = 0.60, 95% CI: 0.36-0.98 and adjusted OR = 0.47, 95% CI: 0.26-0.86, respectively; P(trend = 0.012 among smokers. Such an effect was not observed in non-smokers. However, there was no significant interaction between the APEX1 Asp148Glu polymorphism and smoking exposure in this study population (P = 0.512. Additional genotype-phenotype analysis found that the APEX1-148Glu allele had significantly increased expression of APEX1 mRNA in 270 Epstein-Barr virus-transformed lymphoblastoid cell lines, which is likely associated with more active repair activity. Our findings suggest that the functional APEX1-148Glu allele is associated with reduced risk of having high levels of BPDE-induced DNA adducts mediated with high levels of mRNA expression.

  7. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.


    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  8. Single nucleotide polymorphisms of DNA mismatch repair genes MSH2 and MLH1 confer susceptibility to esophageal cancer.

    Sun, Ming-Zhong; Ju, Hui-Xiang; Zhou, Zhong-Wei; Jin, Hao; Zhu, Rong


    Defects in DNA mismatch repair genes like MSH2 and MLH1 confer increased risk of cancers. Here, single nucleotide polymorphisms (SNPs) in MSH2 and MLH1 were investigated for their potential contribution to the risk of esophageal cancer. This study recruited 614 participants from Affiliated Yancheng Hospital, School of Medicine, Southeast University, of which 289 were patients with esophageal cancer, and the remainder was healthy individuals who served as a control group. Two SNPs, MSH2 c.2063T>G and MLH1 IVS14-19A>G, were genotyped using PCR-RFLP. Statistical analysis was performed using chi-square test and logistic regression analysis. Carriers of the MSH2 c.2063G allele were at significantly higher risk for esophageal cancer compared to individuals with the TT genotype [OR = 3.36, 95% confidence interval (CI): 1.18-11.03]. The MLH1 IVS14-19A>G allele also conferred significantly increased (1.70-fold) for esophageal cancer compared to the AA genotype (OR = 1.70, 95% CI: 1.13-5.06). Further, the variant alleles interacted such that individuals with the susceptible genotypes at both MSH2 and MLH1 had a significantly exacerbated risk for esophageal cancer (OR = 12.38, 95% CI: 3.09-63.11). In brief, SNPs in the DNA mismatch repair genes MSH2 and MLH1 increase the risk of esophageal cancer. Molecular investigations are needed to uncover the mechanism behind their interaction effect.

  9. TFIIH with inactive XPD helicase functions in transcription initiation but is defective in DNA repair

    G.S. Winkler (Sebastiaan); U. Fiedler; W. Vermeulen (Wim); F. Coin (Frédéric); R.D. Wood (Richard); H.T.M. Timmers (Marc); G. Weeda (Geert); J.H.J. Hoeijmakers (Jan); S.J. Araú jo; J-M. Egly (Jean-Marc)


    textabstractTFIIH is a multisubunit protein complex involved in RNA polymerase II transcription and nucleotide excision repair, which removes a wide variety of DNA lesions including UV-induced photoproducts. Mutations in the DNA-dependent ATPase/helicase subunits of TFIIH, XPB and

  10. DNA excision repair in human cells treated with ultraviolet radiation and 7,12-dimethylbenz(a)anthracene 5,6-oxide

    Ahmed, F.E.; Gentil, A.; Renstein, B.S.; Setlow, R.B.


    Excision repair was measured in normal human and xeroderma pigmentosum group C cells treated with 7,12-dimethylbenz(a)anthracene 5,6-oxide and with ultraviolet radiation by the techniques of unscheduled DNA synthesis, repair replication, a modification and bromodeoxyuridine photolysis and endonuclease-sensitive sites assay. Radiautography and repair replication showed that in normal cells the magnitude of repair after a saturation dose of the epoxide to be 0.1 to 0.2, that after a saturating ultraviolet dose, though survival data showed that both doses gave nearly similar killings. Repair was of the long-patch type and repair kinetics after the epoxide treatment were similar to ultraviolet. After a combined treatment with both agents, unscheduled synthesis in normal cells was more than additive. The data indicate that there are different rate-limiting steps in the removal of the ultraviolet and the epoxide damages, and that the residual repair activity in xeroderma pigmentosum cells is accomplished by different, not just fewer, enzymes than in normal cells.

  11. Mitochondrial base excision repair assays

    Maynard, Scott; de Souza-Pinto, Nadja C; Scheibye-Knudsen, Morten


    The main source of mitochondrial DNA (mtDNA) damage is reactive oxygen species (ROS) generated during normal cellular metabolism. The main mtDNA lesions generated by ROS are base modifications, such as the ubiquitous 8-oxoguanine (8-oxoG) lesion; however, base loss and strand breaks may also occur....... Many human diseases are associated with mtDNA mutations and thus maintaining mtDNA integrity is critical. All of these lesions are repaired primarily by the base excision repair (BER) pathway. It is now known that mammalian mitochondria have BER, which, similarly to nuclear BER, is catalyzed by DNA...... glycosylases, AP endonuclease, DNA polymerase (POLgamma in mitochondria) and DNA ligase. This article outlines procedures for measuring oxidative damage formation and BER in mitochondria, including isolation of mitochondria from tissues and cells, protocols for measuring BER enzyme activities, gene...

  12. Niacin deficiency delays DNA excision repair and increases spontaneous and nitrosourea-induced chromosomal instability in rat bone marrow.

    Kostecki, Lisa M; Thomas, Megan; Linford, Geordie; Lizotte, Matthew; Toxopeus, Lori; Bartleman, Anne-Pascale; Kirkland, James B


    We have shown that niacin deficiency impairs poly(ADP-ribose) formation and enhances sister chromatid exchanges and micronuclei formation in rat bone marrow. We designed the current study to investigate the effects of niacin deficiency on the kinetics of DNA repair following ethylation, and the accumulation of double strand breaks, micronuclei (MN) and chromosomal aberrations (CA). Weanling male Long-Evans rats were fed niacin deficient (ND), or pair fed (PF) control diets for 3 weeks. We examined repair kinetics by comet assay in the 36h following a single dose of ethylnitrosourea (ENU) (30mg/kg bw). There was no effect of ND on mean tail moment (MTM) before ENU treatment, or on the development of strand breaks between 0 and 8h after ENU. Repair kinetics between 12 and 30h were significantly delayed by ND, with a doubling of area under the MTM curve during this period. O(6)-ethylation of guanine peaked by 1.5h, was largely repaired by 15h, and was also delayed in bone marrow cells from ND rats. ND significantly enhanced double strand break accumulation at 24h after ENU. ND alone increased chromosome and chromatid breaks (four- and two-fold). ND alone caused a large increase in MN, and this was amplified by ENU treatment. While repair kinetics suggest that ND may be acting by creating catalytically inactive PARP molecules with a dominant-negative effect on repair processes, the effect of ND alone on O(6)-ethylation, MN and CA, in the absence of altered comet results, suggests additional mechanisms are also leading to chromosomal instability. These data support the idea that the bone marrow cells of niacin deficient cancer patients may be more sensitive to the side effects of genotoxic chemotherapy, resulting in acute bone marrow suppression and chronic development of secondary leukemias.

  13. Distinct energetics and closing pathways for DNA polymerase β with 8-oxoG template and different incoming nucleotides

    Wang Yanli


    Full Text Available Abstract Background 8-Oxoguanine (8-oxoG is a common oxidative lesion frequently encountered by DNA polymerases such as the repair enzyme DNA polymerase β (pol β. To interpret in atomic and energetic detail how pol β processes 8-oxoG, we apply transition path sampling to delineate closing pathways of pol β 8-oxoG complexes with dCTP and dATP incoming nucleotides and compare the results to those of the nonlesioned G:dCTP and G:dATPanalogues. Results Our analyses show that the closing pathways of the 8-oxoG complexes are different from one another and from the nonlesioned analogues in terms of the individual transition states along each pathway, associated energies, and the stability of each pathway's closed state relative to the corresponding open state. In particular, the closed-to-open state stability difference in each system establishes a hierarchy of stability (from high to low as G:C > 8-oxoG:C > 8-oxoG:A > G:A, corresponding to -3, -2, 2, 9 kBT, respectively. This hierarchy of closed state stability parallels the experimentally observed processing efficiencies for the four pairs. Network models based on the calculated rate constants in each pathway indicate that the closed species are more populated than the open species for 8-oxoG:dCTP, whereas the opposite is true for 8-oxoG:dATP. Conclusion These results suggest that the lower insertion efficiency (larger Km for dATP compared to dCTP opposite 8-oxoG is caused by a less stable closed-form of pol β, destabilized by unfavorable interactions between Tyr271 and the mispair. This stability of the closed vs. open form can also explain the higher insertion efficiency for 8-oxoG:dATP compared to the nonlesioned G:dATP pair, which also has a higher overall conformational barrier. Our study offers atomic details of the complexes at different states, in addition to helping interpret the different insertion efficiencies of dATP and dCTP opposite 8-oxoG and G.

  14. Archaeal DNA Polymerase-B as a DNA Template Guardian: Links between Polymerases and Base/Alternative Excision Repair Enzymes in Handling the Deaminated Bases Uracil and Hypoxanthine

    Javier Abellón-Ruiz


    Full Text Available In Archaea repair of uracil and hypoxanthine, which arise by deamination of cytosine and adenine, respectively, is initiated by three enzymes: Uracil-DNA-glycosylase (UDG, which recognises uracil; Endonuclease V (EndoV, which recognises hypoxanthine; and Endonuclease Q (EndoQ, (which recognises both uracil and hypoxanthine. Two archaeal DNA polymerases, Pol-B and Pol-D, are inhibited by deaminated bases in template strands, a feature unique to this domain. Thus the three repair enzymes and the two polymerases show overlapping specificity for uracil and hypoxanthine. Here it is demonstrated that binding of Pol-D to primer-templates containing deaminated bases inhibits the activity of UDG, EndoV, and EndoQ. Similarly Pol-B almost completely turns off EndoQ, extending earlier work that demonstrated that Pol-B reduces catalysis by UDG and EndoV. Pol-B was observed to be a more potent inhibitor of the enzymes compared to Pol-D. Although Pol-D is directly inhibited by template strand uracil, the presence of Pol-B further suppresses any residual activity of Pol-D, to near-zero levels. The results are compatible with Pol-D acting as the replicative polymerase and Pol-B functioning primarily as a guardian preventing deaminated base-induced DNA mutations.

  15. Uracil Excision for Assembly of Complex Pathways

    Cavaleiro, Mafalda; Nielsen, Morten Thrane; Kim, Se Hyeuk


    Despite decreasing prices on synthetic DNA constructs, higher-order assembly of PCR-generated DNA continues to be an important exercise in molecular and synthetic biology. Simplicity and robustness are attractive features met by the uracil excision DNA assembly method, which is one of the most in...

  16. Human inherited diseases with altered mechanisms for DNA repair and mutagenesis

    Cleaver, J.E.


    A variety of human diseases involving clinical symptoms of increased cancer risk, and disorders of the central nervous system, and of hematopoietic, immunological, ocular, and cutaneous tissues and embryological development have defects in biochemical pathways for excision repair of damaged DNA. Excision repair has multiple branches by which damaged nucleotides, bases, and cross-links are excised and requires cofactors that control the access of repair enzymes to damage in DNA in chromatin. Diseases in which repair defects are a consistent feature of their biochemistry include xeroderma pigmentosum, ataxia telangiectasia and Fanconi's anemia.

  17. Alkyltransferase-like proteins: brokers dealing with alkylated DNA bases.

    Schärer, Orlando D


    A new pathway for the repair of DNA alkylation damage is described in this issue of Molecular Cell (Latypov et al., 2012). Alkyltransferase-like enzymes mark O(6)-alkylguanine lesions and, depending on adduct size, channel them into global genome or transcription-coupled nucleotide excision repair pathways. Copyright © 2012 Elsevier Inc. All rights reserved.

  18. A TetR family transcriptional factor directly regulates the expression of a 3-methyladenine DNA glycosylase and physically interacts with the enzyme to stimulate its base excision activity in Mycobacterium bovis BCG.

    Liu, Lei; Huang, Cheng; He, Zheng-Guo


    3-Methyladenine DNA glycosylase recognizes and excises a wide range of damaged bases and thus plays a critical role in base excision repair. However, knowledge on the regulation of DNA glycosylase in prokaryotes and eukaryotes is limited. In this study, we successfully characterized a TetR family transcriptional factor from Mycobacterium bovis bacillus Calmette-Guerin (BCG), namely BCG0878c, which directly regulates the expression of 3-methyladenine DNA glycosylase (designated as MbAAG) and influences the base excision activity of this glycosylase at the post-translational level. Using electrophoretic mobility shift assay and DNase I footprinting experiments, we identified two conserved motifs within the upstream region of mbaag specifically recognized by BCG0878c. Significant down-regulation of mbaag was observed in BCG0878c-overexpressed M. bovis BCG strains. By contrast, about 12-fold up-regulation of mbaag expression was found in bcg0878c-deleted mutant M. bovis BCG strains. β-Galactosidase activity assays also confirmed these results. Thus, BCG0878c can function as a negative regulator of mbaag expression. In addition, the regulator was shown to physically interact with MbAAG to enhance the ability of the glycosylase to bind damaged DNA. Interaction between the two proteins was further found to facilitate AAG-catalyzed removal of hypoxanthine from DNA. These results indicate that a TetR family protein can dually regulate the function of 3-methyladenine DNA glycosylase in M. bovis BCG both at the transcriptional and post-translational levels. These findings enhance our understanding of the expression and regulation of AAG in mycobacteria.

  19. Use of reiterative primer extension methodology to map UV-induced photoproducts at the nucleotide level in the laci gene from genomic DNA

    Chandrasekhar, D.; Houten, B. Van


    A newly developed reiterative primer extension assay has been employed to examine photoproduct formation and repair at the nucleotide level. Analysis of UV-induced DNA photoproduct hotspots in the first 184 base pairs of the laci genes of genomic E. coli DNA has revealed that photoproducts are formed linearly with dose and display a sequence-dependent increase. Generally, pyrimdine dimers were twice as frequent as all other UV-induced photoproducts. However, specific sites showed differing distributions. A post-irradiation recovery period revealed differences in the repair efficiency at individual nucleotides. Repair of photoproducts on the transcribed strand was generally twice as efficient as repair of photoproducts on the nontranscribed strand, indicating that strand-specific DNA repair occurs in the constitutively transcribed laci gene of E. coli. The UV-induced DNA photoproduct distribution following repair was well correlated with an established UV-induced mutation spectrum for wild-type E. coli cells. This analysis revealed that photoproduct hotspots on the efficiently repaired transcribed strand did not correlate with mutagenic hotspots. These data strongly support the hypothesis that mutations arise at inefficiently repaired sites on the nontranscribed strand

  20. Carcinogen-induced damage to DNA

    Strauss, B.; Altamirano, M.; Bose, K.; Sklar, R.; Tatsumi, K.


    Human cells respond to carcinogen-induced damage in their DNA in at least two ways. The first response, excision repair, proceeds by at least three variations, depending on the nature of the damage. Nucleotide excision results in relatively large repair patches but few free DNA breaks, since the endonuclease step is limiting. Apurinic repair is characterized by the appearance of numerous breaks in the DNA and by short repair patches. The pathways behave as though they function independently. Lymphoic cells derived from a xeroderma pigmentosum complementation group C patient are deficient in their ability to perform nucleotide excision and also to excise 6 methoxyguanine adducts, but they are apurinic repair competent. Organisms may bypass damage in their DNA. Lymphoblastoid cells, including those derived from xeroderma pigmentosum treated with 3 H-anti-BPDE, can replicate their DNA at low doses of carcinogen. Unexcised 3 H is found in the light or parental strand of the resulting hybrid DNA when replication occurs in medium with BrdUrd. This observation indicates a bypass reaction occurring by a mechanism involving branch migration at DNA growing points. Branch migration in DNA preparations have been observed, but the evidence is that most occurs in BrdUrd-containing DNA during cell lysis. The measurement of the bifilarly substituted DNA resulting from branch migration is a convenient method of estimating the proportion of new synthesis remaining in the vicinity of the DNA growing point. Treatment with carcinogens or caffeine results in accumulation of DNA growing points accompanied by the synthesis of shortened pieces of daughter DNA

  1. Absence of zero-temperature transmission rate of a double-chain tight-binding model for DNA with random sequence of nucleotides in thermodynamic limit

    Xiong Gang; Wang, X.R.


    The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor

  2. Curcumin stably interacts with DNA hairpin through minor groove binding and demonstrates enhanced cytotoxicity in combination with FdU nucleotides.

    Ghosh, Supratim; Mallick, Sumana; Das, Upasana; Verma, Ajay; Pal, Uttam; Chatterjee, Sabyasachi; Nandy, Abhishek; Saha, Krishna D; Maiti, Nakul Chandra; Baishya, Bikash; Suresh Kumar, G; Gmeiner, William H


    We report, based on biophysical studies and molecular mechanical calculations that curcumin binds DNA hairpin in the minor groove adjacent to the loop region forming a stable complex. UV-Vis and fluorescence spectroscopy indicated interaction of curcumin with DNA hairpin. In this novel binding motif, two ɣ H of curcumin heptadiene chain are closely positioned to the A 16 -H8 and A 17 -H8, while G 12 -H8 is located in the close proximity of curcumin α H. Molecular dynamics (MD) simulations suggest, the complex is stabilized by noncovalent forces including; π-π stacking, H-bonding and hydrophobic interactions. Nuclear magnetic resonance (NMR) spectroscopy in combination with molecular dynamics simulations indicated curcumin is bound in the minor groove, while circular dichroism (CD) spectra suggested minute enhancement in base stacking and a little change in DNA helicity, without significant conformational change of DNA hairpin structure. The DNA:curcumin complex formed with FdU nucleotides rather than Thymidine, demonstrated enhanced cytotoxicity towards oral cancer cells relative to the only FdU substituted hairpin. Fluorescence co-localization demonstrated stability of the complex in biologically relevant conditions, including its cellular uptake. Acridine orange/EtBr staining further confirmed the enhanced cytotoxic effects of the complex, suggesting apoptosis as mode of cell death. Thus, curcumin can be noncovalently complexed to small DNA hairpin for cellular delivery and the complex showed increased cytotoxicity in combination with FdU nucleotides, demonstrating its potential for advanced cancer therapy. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. DNA repair deficiency in neurodegeneration

    Jeppesen, Dennis Kjølhede; Bohr, Vilhelm A; Stevnsner, Tinna V.


    Deficiency in repair of nuclear and mitochondrial DNA damage has been linked to several neurodegenerative disorders. Many recent experimental results indicate that the post-mitotic neurons are particularly prone to accumulation of unrepaired DNA lesions potentially leading to progressive...... neurodegeneration. Nucleotide excision repair is the cellular pathway responsible for removing helix-distorting DNA damage and deficiency in such repair is found in a number of diseases with neurodegenerative phenotypes, including Xeroderma Pigmentosum and Cockayne syndrome. The main pathway for repairing oxidative...... base lesions is base excision repair, and such repair is crucial for neurons given their high rates of oxygen metabolism. Mismatch repair corrects base mispairs generated during replication and evidence indicates that oxidative DNA damage can cause this pathway to expand trinucleotide repeats, thereby...

  4. Heat-transfer resistance at solid-liquid interfaces: a tool for the detection of single-nucleotide polymorphisms in DNA.

    van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick


    In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society

  5. Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides AT+CG in the mitogenome of Kamimuria wangi.

    Seligmann, Hervé


    Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (XY, i.e. AC) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the AT+CG exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA.

  6. Development of laser-induced fluorescence detection to assay DNA damage

    Sharma, M.; Freund, H.G.


    A precolumn derivation method has been developed for high performance liquid chromatographic (HPLC) analysis of DNA damage using fluorescence detection. The modified nucleotide, having excised enzymatically from the exposed DNA, is enriched from the normal nucleotides and labeled with a fluorescent reagent. The labeling procedure involves phosphoramidation of the nucleotide with ethylenediamine (EDA) followed by conjugation of the free amino end of the phosphoramidate with 5-dimethylaminonaphthalene 1-sulfonyl chloride, commonly known as Dansyl chloride. The dansylated nucleotide can be analyzed with a sub-picomole limit of detection (LOD) by conventional HPLC using a conventional fluorescence detector. By combining microbore HPLC with laser-induced fluorescence (LIF) detection, the authors present the development of an analytical system that has sub-femtomole LOD for real-time analysis of the dansylated nucleotide. In this paper the application of the developed system in fluorescence postlabeling assay of a small alkyl-modified nucleotide (5-methyl CMP) in calf-thymus DNA is discussed

  7. Synthesis and biological properties of 5-azido-2'-deoxyuridine 5'-triphosphate, a photoactive nucleotide suitable for making light-sensitive DNA

    Evans, R.K.; Haley, B.E.


    A photoactive nucleotide analogue of dUTP, 5-azido-2'-deoxyuridine 5'-triphosphate (5-N 3 dUTP), was synthesized from dUMP in five steps. The key reaction in the synthesis of 5-N 3 dUTP is the nitration of dUMP in 98% yield in 5 min at 25 0 C using an excess of nitrosonium tetrafluoroborate in anhydrous dimethylformamide. Reduction of the resulting 5-nitro compound with zinc and 20 mM HCl gave 5-aminodeoxyuridine monophosphate (5-NH 2 dUMP). Diazotization of 5-NH 2 dUMP with HNO 2 followed by the addition NaN 3 to the acidic diazonium salt solution gave a photoactive nucleotide derivative in 80-90% yield. The monophosphate product was identified as 5-N 3 dUMP by proton NMR, UV, IR, and chromatographic analysis as well as by the mode of synthesis and its photosensitivity. After formation of 5-N 3 dUTP through a chemical coupling of pyrophosphate to 5-N 3 dUMP, the triphosphate form of the nucleotide was found to support DNA synthesis by Escherichia coli DNA polymerase I at a rate indistinguishable from that supported by dTTP. When UMP was used as the starting compound, 5-N 3 UTP was formed in an analogous fashion with similar yields and produced a photoactive nucleotide which is a substrate for E. coli RNA polymerase. To prepare [γ- 32 P]-5-N 3 dUTP for use as an active-site-directed photoaffinity labeling reagent, a simple method of preparing γ- 32 P-labeled pyrimidine nucleotides was developed. [γ- 32 P]-5-N 3 dUTP is an effective photoaffinity labeling reagent for DNA polymerase I and was found to bind to the active site with a 2-fold higher affinity than dTTP. The photoactivity of 5-N 3 dUMP is stable to extremes of pH, and [γ- 32 P]-5-N 3 dUTP was an effective photolabeling reagent even in the presence of 10 mM dithiothreitol

  8. Arabidopsis RNASE THREE LIKE2 Modulates the Expression of Protein-Coding Genes via 24-Nucleotide Small Interfering RNA-Directed DNA Methylation.

    Elvira-Matelot, Emilie; Hachet, Mélanie; Shamandi, Nahid; Comella, Pascale; Sáez-Vásquez, Julio; Zytnicki, Matthias; Vaucheret, Hervé


    RNaseIII enzymes catalyze the cleavage of double-stranded RNA (dsRNA) and have diverse functions in RNA maturation. Arabidopsis thaliana RNASE THREE LIKE2 (RTL2), which carries one RNaseIII and two dsRNA binding (DRB) domains, is a unique Arabidopsis RNaseIII enzyme resembling the budding yeast small interfering RNA (siRNA)-producing Dcr1 enzyme. Here, we show that RTL2 modulates the production of a subset of small RNAs and that this activity depends on both its RNaseIII and DRB domains. However, the mode of action of RTL2 differs from that of Dcr1. Whereas Dcr1 directly cleaves dsRNAs into 23-nucleotide siRNAs, RTL2 likely cleaves dsRNAs into longer molecules, which are subsequently processed into small RNAs by the DICER-LIKE enzymes. Depending on the dsRNA considered, RTL2-mediated maturation either improves (RTL2-dependent loci) or reduces (RTL2-sensitive loci) the production of small RNAs. Because the vast majority of RTL2-regulated loci correspond to transposons and intergenic regions producing 24-nucleotide siRNAs that guide DNA methylation, RTL2 depletion modifies DNA methylation in these regions. Nevertheless, 13% of RTL2-regulated loci correspond to protein-coding genes. We show that changes in 24-nucleotide siRNA levels also affect DNA methylation levels at such loci and inversely correlate with mRNA steady state levels, thus implicating RTL2 in the regulation of protein-coding gene expression. © 2016 American Society of Plant Biologists. All rights reserved.

  9. Rad10 exhibits lesion-dependent genetic requirements for recruitment to DNA double-strand breaks in Saccharomyces cerevisiae

    Moore, Destaye M; Karlin, Justin; González-Barrera, Sergio


    In the yeast Saccharomyces cerevisiae, the Rad1-Rad10 protein complex participates in nucleotide excision repair (NER) and homologous recombination (HR). During HR, the Rad1-Rad10 endonuclease cleaves 3' branches of DNA and aberrant 3' DNA ends that are refractory to other 3' processing enzymes. ...

  10. Structural changes in the nucleotide DNA of blood and the development of the late consequences of irradiation in rats

    Ivanov, S.D.; Remizova, I.V.; Kovan'ko, E.G.; Gubareva, A.V.; Komar, V.E.


    Fluorescent analysis of structural changes of nucleotide in the blood associated with AT-fragments has been studied in rats, γ-irradiated with doses of 2 and 4 Gy. It was demonstrated that the haematological, gerontological and cancerogenic late consequences were preceded by the structural genomic disturbances determined by 30 day after irradiation

  11. Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

    Siebert, P.D.; Fukuda, M.


    In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

  12. Differences in substrate specificity of C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides by DNA polymerases from thermophilic bacteria, archaea, and phages.

    Sawai, Hiroaki; Nagashima, Junichi; Kuwahara, Msayasu; Kitagata, Rina; Tamura, Takehiro; Matsui, Ikuo


    The pyrimidine bases of RNA are uracil (U) and cytosine (C), while thymine (T) and C are used for DNA. The C(5) position of C and U is unsubstituted, whereas the C(5) of T is substituted with a Me group. Miller et al. hypothesized that various C(5)-substituted uracil derivatives were formed during chemical evolution, and that C(5)-substituted U derivatives may have played important roles in the transition from an 'RNA world' to a 'DNA-RNA-protein world'. Hyperthermophilic bacteria and archaea are considered to be primitive organisms that are evolutionarily close to the universal ancestor of all life on earth. Thus, we examined the substrate specificity of several C(5)-substituted or C(5)-unsubstituted dUTP and dCTP analogs for several DNA polymerases from hyperthermophilic bacteria, hyperthermophilic archaea, and viruses during PCR or primer extension reaction. The substrate specificity of the C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides varied greatly depending on the type of DNA polymerase. The significance of this difference in substrate specificity in terms of the origin and evolution of the DNA replication system is discussed briefly.

  13. My journey to DNA repair.

    Lindahl, Tomas


    I completed my medical studies at the Karolinska Institute in Stockholm but have always been devoted to basic research. My longstanding interest is to understand fundamental DNA repair mechanisms in the fields of cancer therapy, inherited human genetic disorders and ancient DNA. I initially measured DNA decay, including rates of base loss and cytosine deamination. I have discovered several important DNA repair proteins and determined their mechanisms of action. The discovery of uracil-DNA glycosylase defined a new category of repair enzymes with each specialized for different types of DNA damage. The base excision repair pathway was first reconstituted with human proteins in my group. Cell-free analysis for mammalian nucleotide excision repair of DNA was also developed in my laboratory. I found multiple distinct DNA ligases in mammalian cells, and led the first genetic and biochemical work on DNA ligases I, III and IV. I discovered the mammalian exonucleases DNase III (TREX1) and IV (FEN1). Interestingly, expression of TREX1 was altered in some human autoimmune diseases. I also showed that the mutagenic DNA adduct O(6)-methylguanine (O(6)mG) is repaired without removing the guanine from DNA, identifying a surprising mechanism by which the methyl group is transferred to a residue in the repair protein itself. A further novel process of DNA repair discovered by my research group is the action of AlkB as an iron-dependent enzyme carrying out oxidative demethylation. Copyright © 2013. Production and hosting by Elsevier Ltd.

  14. Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis

    Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai


    The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

  15. Molecular mechanisms of DNA repair inhibition by caffeine

    Selby, C.P.; Sancar, A. (Univ. of North Carolina School of Medicine, Chapel Hill (USA))


    Caffeine potentiates the mutagenic and lethal effects of genotoxic agents. It is thought that this is due, at least in some organisms, to inhibition of DNA repair. However, direct evidence for inhibition of repair enzymes has been lacking. Using purified Escherichia coli DNA photolyase and (A)BC excinuclease, we show that the drug inhibits photoreactivation and nucleotide excision repair by two different mechanisms. Caffeine inhibits photoreactivation by interfering with the specific binding of photolyase to damaged DNA, and it inhibits nucleotide excision repair by promoting nonspecific binding of the damage-recognition subunit, UvrA, of (A)BC excinuclease. A number of other intercalators, including acriflavin and ethidium bromide, appear to inhibit the excinuclease by a similar mechanism--that is, by trapping the UvrA subunit in nonproductive complexes on undamaged DNA.

  16. DnaC inactivation in Escherichia coli K-12 induces the SOS response and expression of nucleotide biosynthesis genes

    Løbner-Olesen, Anders; Slominska-Wojewodzka, Monika; Hansen, Flemming G.


    Background: Initiation of chromosome replication in E. coli requires the DnaA and DnaC proteins and conditionally-lethal dnaA and dnaC mutants are often used to synchronize cell populations. Methodology/Principal Findings: DNA microarrays were used to measure mRNA steady-state levels in initiatio......C genes was increased at the non-permissive temperature in the respective mutant strains indicating auto-regulation of both genes. Induction of the SOS regulon was observed in dnaC2 cells at 38 degrees C and 42 degrees C. Flow cytometric analysis revealed that dnaC2 mutant cells at non......-permissive temperature had completed the early stages of chromosome replication initiation. Conclusion/Significance: We suggest that in dnaC2 cells the SOS response is triggered by persistent open-complex formation at oriC and/or by arrested forks that require DnaC for replication restart....

  17. Reversible thermal transition in GrpE, the nucleotide exchange factor of the DnaK heat-shock system.

    Grimshaw, J P; Jelesarov, I; Schönfeld, H J; Christen, P


    DnaK, a Hsp70 acting in concert with its co-chaperones DnaJ and GrpE, is essential for Escherichia coli to survive environmental stress, including exposure to elevated temperatures. Here we explored the influence of temperature on the structure of the individual components and the functional properties of the chaperone system. GrpE undergoes extensive but fully reversible conformational changes in the physiologically relevant temperature range (transition midpoint at approximately 48 degrees C), as observed with both circular dichroism measurements and differential scanning calorimetry, whereas no thermal transitions occur in DnaK and DnaJ between 15 degrees C and 48 degrees C. The conformational changes in GrpE appear to be important in controlling the interconversion of T-state DnaK (ATP-liganded, low affinity for polypeptide substrates) and R-state DnaK (ADP-liganded, high affinity for polypeptide substrates). The rate of the T --> R conversion of DnaK due to DnaJ-triggered ATP hydrolysis follows an Arrhenius temperature dependence. In contrast, the rate of the R --> T conversion due to GrpE-catalyzed ADP/ATP exchange increases progressively less with increasing temperature and even decreases at temperatures above approximately 40 degrees C, indicating a temperature-dependent reversible inactivation of GrpE. At heat-shock temperatures, the reversible structural changes of GrpE thus shift DnaK toward its high-affinity R state.

  18. DNA Repair Mechanisms and the Bypass of DNA Damage in Saccharomyces cerevisiae

    Boiteux, Serge; Jinks-Robertson, Sue


    DNA repair mechanisms are critical for maintaining the integrity of genomic DNA, and their loss is associated with cancer predisposition syndromes. Studies in Saccharomyces cerevisiae have played a central role in elucidating the highly conserved mechanisms that promote eukaryotic genome stability. This review will focus on repair mechanisms that involve excision of a single strand from duplex DNA with the intact, complementary strand serving as a template to fill the resulting gap. These mechanisms are of two general types: those that remove damage from DNA and those that repair errors made during DNA synthesis. The major DNA-damage repair pathways are base excision repair and nucleotide excision repair, which, in the most simple terms, are distinguished by the extent of single-strand DNA removed together with the lesion. Mistakes made by DNA polymerases are corrected by the mismatch repair pathway, which also corrects mismatches generated when single strands of non-identical duplexes are exchanged during homologous recombination. In addition to the true repair pathways, the postreplication repair pathway allows lesions or structural aberrations that block replicative DNA polymerases to be tolerated. There are two bypass mechanisms: an error-free mechanism that involves a switch to an undamaged template for synthesis past the lesion and an error-prone mechanism that utilizes specialized translesion synthesis DNA polymerases to directly synthesize DNA across the lesion. A high level of functional redundancy exists among the pathways that deal with lesions, which minimizes the detrimental effects of endogenous and exogenous DNA damage. PMID:23547164

  19. Triple negative breast cancers have a reduced expression of DNA repair genes.

    Enilze Ribeiro

    Full Text Available DNA repair is a key determinant in the cellular response to therapy and tumor repair status could play an important role in tailoring patient therapy. Our goal was to evaluate the mRNA of 13 genes involved in different DNA repair pathways (base excision, nucleotide excision, homologous recombination, and Fanconi anemia in paraffin embedded samples of triple negative breast cancer (TNBC compared to luminal A breast cancer (LABC. Most of the genes involved in nucleotide excision repair and Fanconi Anemia pathways, and CHK1 gene were significantly less expressed in TNBC than in LABC. PARP1 levels were higher in TNBC than in LABC. In univariate analysis high level of FANCA correlated with an increased overall survival and event free survival in TNBC; however multivariate analyses using Cox regression did not confirm FANCA as independent prognostic factor. These data support the evidence that TNBCs compared to LABCs harbour DNA repair defects.

  20. Direct Detection of Unnatural DNA Nucleotides dNaM and d5SICS using the MspA Nanopore.

    Jonathan M Craig

    Full Text Available Malyshev et al. showed that the four-letter genetic code within a living organism could be expanded to include the unnatural DNA bases dNaM and d5SICS. However, verification and detection of these unnatural bases in DNA requires new sequencing techniques. Here we provide proof of concept detection of dNaM and d5SICS in DNA oligomers via nanopore sequencing using the nanopore MspA. We find that both phi29 DNA polymerase and Hel308 helicase are capable of controlling the motion of DNA containing dNaM and d5SICS through the pore and that single reads are sufficient to detect the presence and location of dNaM and d5SICS within single molecules.

  1. DNA dynamics is likely to be a factor in the genomic nucleotide repeats expansions related to diseases.

    Boian S Alexandrov

    Full Text Available Trinucleotide repeats sequences (TRS represent a common type of genomic DNA motif whose expansion is associated with a large number of human diseases. The driving molecular mechanisms of the TRS ongoing dynamic expansion across generations and within tissues and its influence on genomic DNA functions are not well understood. Here we report results for a novel and notable collective breathing behavior of genomic DNA of tandem TRS, leading to propensity for large local DNA transient openings at physiological temperature. Our Langevin molecular dynamics (LMD and Markov Chain Monte Carlo (MCMC simulations demonstrate that the patterns of openings of various TRSs depend specifically on their length. The collective propensity for DNA strand separation of repeated sequences serves as a precursor for outsized intermediate bubble states independently of the G/C-content. We report that repeats have the potential to interfere with the binding of transcription factors to their consensus sequence by altered DNA breathing dynamics in proximity of the binding sites. These observations might influence ongoing attempts to use LMD and MCMC simulations for TRS-related modeling of genomic DNA functionality in elucidating the common denominators of the dynamic TRS expansion mutation with potential therapeutic applications.

  2. High-Quality and -Quantity DNA Extraction from Frozen Archival Blood Clots for Genotyping of Single-Nucleotide Polymorphisms

    Bank, Steffen; Nexø, Bjørn Andersen; Andersen, Vibeke


    the efficiency of commercial purification kits for extracting DNA from long-term frozen clotted blood. Methods: Serum tubes with clotted blood were stored at −20°C for 1 to 2.5 years before DNA extraction. DNA was extracted from 10 blood clot samples using PureGene (Qiagen) with and without glycogen, the QIAamp...... with a median of 0.65 μg (range 0.5–2.6 μg) pr 300 μL total blood. Conclusion: The yield obtained by the different commercial kits varied considerably. Our work demonstrates that high-quality and -quantity DNA can be extracted with the Maxwell 16 Blood purification kit (Promega) from cryopreserved blood clots...

  3. Glucose-nucleobase pairs within DNA: impact of hydrophobicity, alternative linking unit and DNA polymerase nucleotide insertion studies† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc04850e

    Vengut-Climent, Empar; Peñalver, Pablo; Lucas, Ricardo; Gómez-Pinto, Irene; Aviñó, Anna; Muro-Pastor, Alicia M.; Galbis, Elsa; de Paz, M. Violante; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias; Eritja, Ramón; González, Carlos


    Recently, we studied glucose-nucleobase pairs, a binding motif found in aminoglycoside–RNA recognition. DNA duplexes with glucose as a nucleobase were able to hybridize and were selective for purines. They were less stable than natural DNA but still fit well on regular B-DNA. These results opened up the possible use of glucose as a non-aromatic DNA base mimic. Here, we have studied the incorporation and thermal stability of glucose with different types of anchoring units and alternative apolar sugar-nucleobase pairs. When we explored butanetriol instead of glycerol as a wider anchoring unit, we did not gain duplex thermal stability. This result confirmed the necessity of a more conformationally restricted linker to increase the overall duplex stability. Permethylated glucose-nucleobase pairs showed similar stability to glucoside-nucleobase pairs but no selectivity for a specific nucleobase, possibly due to the absence of hydrogen bonds between them. The three-dimensional structure of the duplex solved by NMR located both, the hydrophobic permethylated glucose and the nucleobase, inside the DNA helix as in the case of glucose-nucleobase pairs. Quantum chemical calculations on glucose-nucleobase pairs indicate that the attachment of the sugar to the DNA skeleton through the OH1 or OH4 positions yields the highest binding energies. Moreover, glucose was very selective for guanine when attached through OH1 or OH4 to the DNA. Finally, we examined DNA polymerase insertion of nucleotides in front of the saccharide unit. KF– polymerase from E. coli inserted A and G opposite glc and 6dglc with low efficiency but notable selectivity. It is even capable of extending the new pair although its efficiency depended on the DNA sequence. In contrast, Bst 2.0, SIII and BIOTAQ™ DNA polymerases seem to display a loop-out mechanism possibly due to the flexible glycerol linker used instead of deoxyribose. PMID:29780486

  4. DNA Mismatch Repair and Oxidative DNA Damage: Implications for Cancer Biology and Treatment

    Bridge, Gemma; Rashid, Sukaina; Martin, Sarah A.


    Many components of the cell, including lipids, proteins and both nuclear and mitochondrial DNA, are vulnerable to deleterious modifications caused by reactive oxygen species. If not repaired, oxidative DNA damage can lead to disease-causing mutations, such as in cancer. Base excision repair and nucleotide excision repair are the two DNA repair pathways believed to orchestrate the removal of oxidative lesions. However, recent findings suggest that the mismatch repair pathway may also be important for the response to oxidative DNA damage. This is particularly relevant in cancer where mismatch repair genes are frequently mutated or epigenetically silenced. In this review we explore how the regulation of oxidative DNA damage by mismatch repair proteins may impact on carcinogenesis. We discuss recent studies that identify potential new treatments for mismatch repair deficient tumours, which exploit this non-canonical role of mismatch repair using synthetic lethal targeting

  5. DNA Mismatch Repair and Oxidative DNA Damage: Implications for Cancer Biology and Treatment

    Bridge, Gemma; Rashid, Sukaina; Martin, Sarah A., E-mail: [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ (United Kingdom)


    Many components of the cell, including lipids, proteins and both nuclear and mitochondrial DNA, are vulnerable to deleterious modifications caused by reactive oxygen species. If not repaired, oxidative DNA damage can lead to disease-causing mutations, such as in cancer. Base excision repair and nucleotide excision repair are the two DNA repair pathways believed to orchestrate the removal of oxidative lesions. However, recent findings suggest that the mismatch repair pathway may also be important for the response to oxidative DNA damage. This is particularly relevant in cancer where mismatch repair genes are frequently mutated or epigenetically silenced. In this review we explore how the regulation of oxidative DNA damage by mismatch repair proteins may impact on carcinogenesis. We discuss recent studies that identify potential new treatments for mismatch repair deficient tumours, which exploit this non-canonical role of mismatch repair using synthetic lethal targeting.

  6. Nucleotide Metabolism

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens


    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  7. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Zhang, Xueru; McGown, Linda B


    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Trabectedin – the DNA minor groove binder

    G. A. Belitsky


    Full Text Available Trabectedin (ET-743, Yondelis is an alkaloid that was originally isolated from the Caribbean Sea squirt, Ecteinascidia turbinata and is now produced synthetically. Its chemical structure consists in three fused tetrahydroisoquinoline rings. Two of them, A and B, binds covalently to guanine residues in the minor groove of the DNA double helix to bend the molecule toward the major groove and the third ring C protrudes from the DNA duplex, apparently allowing interactions with several nuclear proteins. Binding to the minor groove of DNA, trabectedin trigger a cascade of events that interfere with several transcription factors, DNA binding proteins, and DNA repair pathways in particular nucleotide excision repair. It acts both as a DNA-alkylating drug and topoisomerase poison. Trabectedin-DNA adduct traps the nucleotide excision repair proteins repairing the DNA damage in transcribing genes and induces DNA strand breaks. Cells deficient in homologous recombination pathway which repairs these double-strand breaks show increased sensitivity to trabectedin. The most sensitive of them were myxoid liposarcomas. Trabectedin is also effective in chemotherapy-experienced patients with advanced, recurrent liposarcoma or leiomyosarcoma as well as in women with ovarian cancer and breast cancer with BRCAness phenotype. Besides of tumor cells Trabectedin inhibits inflammatory cells by affecting directly monocytes and tumorassociated macrophages and indirectly by inhibiting production of inflammatory mediators, the cytokines and chemokines. It inhibits also the MDR-1 gene, which is responsible for the resistance of cancer cells to chemotherapeutic agents and strikes tumor angiogenesis.

  9. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    Dunham, S P; Onions, D E


    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  10. 16S-23S rDNA intergenic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis.

    Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo


    The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.

  11. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E


    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  12. Molecular architecture of the recombinant human MCM2-7 helicase in complex with nucleotides and DNA

    Boskovic, Jasminka; Bragado-Nilsson, Elisabeth; Saligram Prabhakar, Bhargav


    DNA replication is a key biological process that involves different protein complexes whose assembly is rigorously regulated in a successive order. One of these complexes is a replicative hexameric helicase, the MCM complex, which is essential for the initiation and elongation phases of replicati...

  13. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.


    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  14. Unique structural properties of DNA interstrand cross-links formed by a new antitumor dinuclear Pt(II) complex

    Hrabina, O.; Kašpárková, J.; Suchánková, Tereza; Novohradský, Vojtěch; Guo, Z.; Brabec, Viktor


    Roč. 9, č. 5 (2017), s. 494-500 ISSN 1756-5901 Institutional support: RVO:68081707 Keywords : cisplatin-modified dna * nucleotide excision-repair * hmg domain proteins Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 3.975, year: 2016

  15. Conformation and dynamics of nucleotides in bulges and symmetric internal loops in duplex DNA studied by EPR and fluorescence spectroscopies

    Cekan, Pavol; Sigurdsson, Snorri Th.


    Highlights: ► Bulges and loops were studied by both EPR and fluorescence spectroscopies using the probe Ç/Ç f . ► One-base bulge was in a temperature-dependent equilibrium between looped-out and stacked states. ► Bases in two- and three-base bulges were stacked at all temperatures, resulting in DNA bending. ► Bases were stacked in symmetrical two- to five-base internal loops, according to EPR data. ► Unexpectedly high fluorescence for the smaller loops indicated local structural perturbations. -- Abstract: The dynamics and conformation of base bulges and internal loops in duplex DNA were studied using the bifunctional spectroscopic probe Ç, which becomes fluorescent (Ç f ) upon reduction of the nitroxide functional group, along with EPR and fluorescence spectroscopies. A one-base bulge was in a conformational equilibrium between looped-out and stacked states, the former favored at higher temperature and the latter at lower temperature. Stacking of bulge bases was favored in two- and three-base bulges, independent of temperature, resulting in DNA bending as evidenced by increased fluorescence of Ç f . EPR spectra of Ç-labeled three-, four- and five-base symmetrical interior DNA bulges at 20 °C showed low mobility, indicating that the spin-label was stacked within the loop. The spin-label mobility at 37 °C increased as the loops became larger. A considerable variation in fluorescence between different loops was observed, as well as a temperature-dependence within constructs. Fluorescence unexpectedly increased as the size of the loop decreased at 2 °C. Fluorescence of the smallest loops, where a single T·T mismatch was located between the stem region and the probe, was even larger than for the single strand, indicating a considerable local structural deformation of these loops from regular B-DNA. These results show the value of combining EPR and fluorescence spectroscopy to study non-helical regions of nucleic acids.

  16. Structure of a DNA glycosylase that unhooks interstrand cross-links

    Mullins, Elwood A.; Warren, Garrett M.; Bradley, Noah P.; Eichman, Brandt F. (Vanderbilt)


    DNA glycosylases are important editing enzymes that protect genomic stability by excising chemically modified nucleobases that alter normal DNA metabolism. These enzymes have been known only to initiate base excision repair of small adducts by extrusion from the DNA helix. However, recent reports have described both vertebrate and microbial DNA glycosylases capable of unhooking highly toxic interstrand cross-links (ICLs) and bulky minor groove adducts normally recognized by Fanconi anemia and nucleotide excision repair machinery, although the mechanisms of these activities are unknown. Here we report the crystal structure of Streptomyces sahachiroi AlkZ (previously Orf1), a bacterial DNA glycosylase that protects its host by excising ICLs derived from azinomycin B (AZB), a potent antimicrobial and antitumor genotoxin. AlkZ adopts a unique fold in which three tandem winged helix-turn-helix motifs scaffold a positively charged concave surface perfectly shaped for duplex DNA. Through mutational analysis, we identified two glutamine residues and a β-hairpin within this putative DNA-binding cleft that are essential for catalytic activity. Additionally, we present a molecular docking model for how this active site can unhook either or both sides of an AZB ICL, providing a basis for understanding the mechanisms of base excision repair of ICLs. Given the prevalence of this protein fold in pathogenic bacteria, this work also lays the foundation for an emerging role of DNA repair in bacteria-host pathogenesis.

  17. Role of DNA lesions and DNA repair in mutagenesis by carcinogens in diploid human fibroblasts

    Maher, V.M.; McCormick, J.J.


    The authors investigated the cytotoxicity, mutagenicity, and transforming activity of carcinogens and radiation in diploid human fibroblasts, using cells which differ in their DNA repair capacity. The results indicate that cell killing and induction of mutations are correlated with the number of specific lesions remaining unrepaired in the cells at a particular time posttreatment. DNA excision repair acts to eliminate potentially cytotoxic and mutagenic (and transforming) damage from DNA before these can be converted into permanent cellular effects. Normal human fibroblasts were derived from skin biopsies or circumcision material. Skin fibroblasts from xeroderma pigmentosum (XP) patients provided cells deficient in nucleotide excision repair of pyrimidine dimers or DNA adducts formed by bulky ring structures. Cytotoxicity was determined from loss of ability to form a colony. The genetic marker used was resistance to 6-thioguanine (TG). Transformation was measured by determining the frequency of anchorage-independent cells

  18. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)


    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  19. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J


    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  20. Hydrogen-Bonding Capability of a Templating Difluorotoluene Nucleotide Residue in an RB69 DNA Polymerase Ternary Complex

    Xia, Shuangluo; Konigsberg, William H.; Wang, Jimin (Yale)


    Results obtained using 2,4-difluorotoluene nucleobase (dF) as a nonpolar thymine isostere by Kool and colleagues challenged the Watson-Crick dogma that hydrogen bonds between complementary bases are an absolute requirement for accurate DNA replication. Here, we report crystal structure of an RB69 DNA polymerase L561A/S565G/Y567A triple mutant ternary complex with a templating dF opposite dTTP at 1.8 {angstrom}-resolution. In this structure, direct hydrogen bonds were observed between: (i) dF and the incoming dTTP, (ii) dF and residue G568 of the polymerase, and (iii) dF and ordered water molecules surrounding the nascent base pair. Therefore, this structure provides evidence that a templating dF can form novel hydrogen bonds with the incoming dTTP and with the enzyme that differ from those formed with a templating dT.

  1. From nucleotides to DNA analysis by a SERS substrate of a self similar chain of silver nanospheres

    Coluccio, M L


    In this work we realized a device of silver nanostructures designed so that they have a great ability to sustain the surface-enhanced Raman scattering effect. The nanostructures were silver self-similar chains of three nanospheres, having constant ratios between their diameters and between their reciprocal distances. They were realized by electron beam lithography, to write the pattern, and by silver electroless deposition technique, to fill it with the metal. The obtained device showed the capability to increase the Raman signal coming from the gap between the two smallest nanospheres (whose size is around 10 nm) and so it allows the detection of biomolecules fallen into this hot spot. In particular, oligonucleotides with 6 DNA bases, deposited on these devices with a drop coating method, gave a Raman spectrum characterized by a clear fingerprint coming from the hot spot and, with the help of a fitting method, also oligonucleotides of 9 bases, which are less than 3 nm long, were resolved. In conclusion the silver nanolens results in a SERS device able to measure all the molecules, or part of them, held into the hot spot of the nanolenses, and thus it could be a future instrument with which to analyze DNA portions.

  2. Base excision repair, aging and health span

    Xu, G.; Herzig, M.; Rotrekl, Vladimír; Walter, Ch. A.


    Roč. 129, 7-8 (2008), s. 366-382 ISSN 0047-6374 Institutional research plan: CEZ:AV0Z50390512 Keywords : base excision repair * aging * DNA damage Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.915, year: 2008

  3. Single Nucleotide Polymorphism

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg


    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  4. Human longevity and variation in DNA damage response and repair

    Debrabant, Birgit; Soerensen, Mette; Flachsbart, Friederike


    others. Data were applied on 592 SNPs from 77 genes involved in nine sub-processes: DNA-damage response, base excision repair (BER), nucleotide excision repair, mismatch repair, non-homologous end-joining, homologous recombinational repair (HRR), RecQ helicase activities (RECQ), telomere functioning...... in genotyping procedures and investigated SNPs, potentially inducing differences in the coverage of gene regions. Specifically, five genes were not covered at all in the German data. Therefore, investigations in additional study populations are needed before final conclusion can be drawn....

  5. Pyrrolo-dC modified duplex DNA as a novel probe for the sensitive assay of base excision repair enzyme activity.

    Lee, Chang Yeol; Park, Ki Soo; Park, Hyun Gyu


    We develop a novel approach to determine formamidopyrimidine DNA glycosylase (Fpg) activity by taking advantage of the unique fluorescence property of pyrrolo-dC (PdC) positioned opposite to 8-oxoguanine (8-oxoG) in duplex DNA. In its initial state, PdC in duplex DNA undergoes the efficient stacking and collisional quenching interactions, showing the low fluorescence signal. In contrast, the presence of Fpg, which specifically removes 8-oxoG and incises resulting apurinic (AP) site, transforms duplex DNA into single-stranded (ss) DNAs. As a result, the intrinsic fluorescence signal of PdC in ssDNA is recovered to exhibit the significantly enhanced fluorescence signal. Based on this Fpg-dependent fluorescence response of PdC, we could reliably determine Fpg activity down to 1.25U/ml with a linear response from 0 to 50U/ml. In addition, the diagnostic capability of this strategy was successfully demonstrated by reliably assaying Fpg activity in human blood serum, showing its great potential in the practical applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Novel tetra-nucleotide microsatellite DNA markers for assessing the evolutionary genetics and demographics of Northern Snakehead (Channa argus) invading North America

    King, Timothy L.; Johnson, Robin L.


    We document the isolation and characterization of 19 tetra-nucleotide microsatellite DNA markers in northern snakehead (Channa argus) fish that recently colonized Meadow Lake, New York City, New York. These markers displayed moderate levels of allelic diversity (averaging 6.8 alleles/locus) and heterozygosity (averaging 74.2%). Demographic analyses suggested that the Meadow Lake collection has not achieved mutation-drift equilibrium. These results were consistent with instances of deviations from Hardy–Weinberg equilibrium and the presence of some linkage disequilibrium. A comparison of individual pair-wise distances suggested the presence of multiple differentiated groups of related individuals. Results of all analyses are consistent with a pattern of multiple, recent introductions. The microsatellite markers developed for C. argus yielded sufficient genetic diversity to potentially: (1) delineate kinship; (2) elucidate fine-scale population structure; (3) define management (eradication) units; (4) estimate dispersal rates; (5) estimate population sizes; and (6) provide unique demographic perspectives of control or eradication effectiveness.

  7. Safety and efficacy of a xenogeneic DNA vaccine encoding for human tyrosinase as adjunctive treatment for oral malignant melanoma in dogs following surgical excision of the primary tumor.

    Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D


    To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.

  8. Exonuclease of human DNA polymerase gamma disengages its strand displacement function.

    He, Quan; Shumate, Christie K; White, Mark A; Molineux, Ian J; Yin, Y Whitney


    Pol γ, the only DNA polymerase found in human mitochondria, functions in both mtDNA repair and replication. During mtDNA base-excision repair, gaps are created after damaged base excision. Here we show that Pol γ efficiently gap-fills except when the gap is only a single nucleotide. Although wild-type Pol γ has very limited ability for strand displacement DNA synthesis, exo(-) (3'-5' exonuclease-deficient) Pol γ has significantly high activity and rapidly unwinds downstream DNA, synthesizing DNA at a rate comparable to that of the wild-type enzyme on a primer-template. The catalytic subunit Pol γA alone, even when exo(-), is unable to synthesize by strand displacement, making this the only known reaction of Pol γ holoenzyme that has an absolute requirement for the accessory subunit Pol γB. © 2013. Published by Elsevier B.V.

  9. Effects of coordination of diammineplatinum(II) with DNA on the activities of Escherichia coli DNA polymerase I

    Bernges, F.; Holler, E.


    The effects of the reaction of cis- and trans-diamminedichloroplatinum(II) with DNA have been measured with regard to DNA synthesis, 3'-5' exonuclease (proofreading), and 5'-3' exonuclease (repair) activities of Escherichia coli DNA polymerase I. Both isomers inhibit DNA synthetic activity of the polymerase through an increase in K/sub m/ values and a decrease in V/sub max/ values for platinated DNA but not for the nucleoside 5'-triphosphates as the varied substrates. The inhibition is a consequence of lowered binding affinity between platinated DNA and DNA polymerase, and of a platination-induced separation of template and primer strands. Strand separation enhances initial rates of 3'-5' excision of [ 3 H]dCMP from platinated DNA (proofreading), while total excision levels of nucleotides are decreased. In contrast to proofreading activity, the 5'-3' exonuclease activity (repair) discriminates between DNA which had reacted with cis- and with trans-diamminedichloroplatinum(II). While both initial rates and total excision are inhibited for the cis isomer, they are almost not affected for the trans isomer. This differential effect could explain why bacterial growth inhibition requires much higher concentrations of trans- than cis-diamminedichloroplatinum(II)

  10. The replicative DNA polymerase of herpes simplex virus 1 exhibits apurinic/apyrimidinic and 5′-deoxyribose phosphate lyase activities

    Bogani, Federica; Boehmer, Paul E.


    Base excision repair (BER) is essential for maintaining genome stability both to counter the accumulation of unusual bases and to protect from base loss in the DNA. Herpes simplex virus 1 (HSV-1) is a large dsDNA virus that encodes its own DNA replication machinery, including enzymes involved in nucleotide metabolism. We report on a replicative family B and a herpesvirus-encoded DNA Pol that possesses DNA lyase activity. We have discovered that the catalytic subunit of the HSV-1 DNA polymeras...

  11. Excision of x-ray-induced thymine damage in chromatin from heated cells

    Warters, R.L.; Roti Roti, J.L.


    Experiments were performed to distinguish between two possible modes of hyperthermia-induced inhibition of thymine base damage excision from the DNA of CHO cells: (1) heat denaturation of excision enzyme(s) or (2) heat-induced alteration of the substrate for damage excision (chromatin). While hyperthermia (45 0 C, 15 min) had no apparent effect on the capacity of the excision enzymes to excise damage from DNA it had a dramatic effect (ca. 80% inhibition) on the ability of chromatin to serve as a substrate for unheated enzymes. These results suggest that hyperthermia-induced radiosensitization of CHO cells may be due primarily to lesions in the cellular chromatin

  12. Energy and Technology Review: Unlocking the mysteries of DNA repair

    Quirk, W.A.


    DNA, the genetic blueprint, has the remarkable property of encoding its own repair following diverse types of structural damage induced by external agents or normal metabolism. We are studying the interplay of DNA damaging agents, repair genes, and their protein products to decipher the complex biochemical pathways that mediate such repair. Our research focuses on repair processes that correct DNA damage produced by chemical mutagens and radiation, both ionizing and ultraviolet. The most important type of DNA repair in human cells is called excision repair. This multistep process removes damaged or inappropriate pieces of DNA -- often as a string of 29 nucleotides containing the damage -- and replaces them with intact ones. We have isolated, cloned, and mapped several human repair genes associated with the nucleotide excision repair pathway and involved in the repair of DNA damage after exposure to ultraviolet light or mutagens in cooked food. We have shown that a defect in one of these repair genes, ERCC2, is responsible for the repair deficiency in one of the groups of patients with the recessive genetic disorder xeroderma pigmentosum (XP group D). We are exploring ways to purify sufficient quantities (milligrams) of the protein products of these and other repair genes so that we can understand their functions. Our long-term goals are to link defective repair proteins to human DNA repair disorders that predispose to cancer, and to produce DNA-repair-deficient mice that can serve as models for the human disorders.

  13. Uracil excision repair in Mycobacterium tuberculosis cell-free extracts.

    Kumar, Pradeep; Bharti, Sanjay Kumar; Varshney, Umesh


    Uracil excision repair is ubiquitous in all domains of life and initiated by uracil DNA glycosylases (UDGs) which excise the promutagenic base, uracil, from DNA to leave behind an abasic site (AP-site). Repair of the resulting AP-sites requires an AP-endonuclease, a DNA polymerase, and a DNA ligase whose combined activities result in either short-patch or long-patch repair. Mycobacterium tuberculosis, the causative agent of tuberculosis, has an increased risk of accumulating uracils because of its G + C-rich genome, and its niche inside host macrophages where it is exposed to reactive nitrogen and oxygen species, two major causes of cytosine deamination (to uracil) in DNA. In vitro assays to study DNA repair in this important human pathogen are limited. To study uracil excision repair in mycobacteria, we have established assay conditions using cell-free extracts of M. tuberculosis and M. smegmatis (a fast-growing mycobacterium) and oligomer or plasmid DNA substrates. We show that in mycobacteria, uracil excision repair is completed primarily via long-patch repair. In addition, we show that M. tuberculosis UdgB, a newly characterized family 5 UDG, substitutes for the highly conserved family 1 UDG, Ung, thereby suggesting that UdgB might function as backup enzyme for uracil excision repair in mycobacteria. Copyright © 2011 Elsevier Ltd. All rights reserved.

  14. Drosophila mutations at the mei-9 and mus(2)201 loci which block excision of thymine dimers also block induction of unscheluded DNA synthesis by methyl methanesulfonate, ethyl methanesulfonate, N-methyl-N-nitrosourea, UV light and X-rays

    Dusenbery, R.L.; McCormick, S.C.; Smith, P.D.


    The mei-9 and mus(2)201 mutants of Drosophila melanogaster were identified as mutagen-sensitive mutants on the basis of larval hypersensitivity to methyl methanesulfonate and characterized as excision repair-deficient on the basis of a greatly reduced capacity to excise thymine dimers from cellular DNA. The high degree of larval cytotoxicity observed with a variety of other chemical and physical agents indicated that these mutants may be unable to excise other important classes of DNA adducts. We have measured the ability of the single mutants and the double mutant combination mei-9;mus(2)201 to perform the resynthesis step in excision repair by means of an autoradiographic analysis of unscheduled DNA synthesis (UDS) induced in a mixed population of primary cells in culture. The 3 strains exhibit no detectable UDS activity in response to applied doses of 1.5-6.0 mM methyl methanesulfonate, 1.0-4.5 nM N-methyl-N-nitrosourea or 10-40 J/m 2 254-nm UV light, dose ranges in which control cells exhibit a strong dose-dependent UDS response. The mei-9 and mei-9;mus(2)201 mutants also have no detectable UDS response to X-ray doses of 300-1.800 rad, whereas the mus(2)201 mutant exhibits a reduced, but dose-dependent, response over this range. These data correlate well with the degree of larval hypersensitivity of the strains and suggest that mutations at both loci block the excision repair of a wide variety of DNA damage prior to the resynthesis step. (orig.)

  15. Differential role of base excision repair proteins in mediating cisplatin cytotoxicity.

    Sawant, Akshada; Floyd, Ashley M; Dangeti, Mohan; Lei, Wen; Sobol, Robert W; Patrick, Steve M


    Interstrand crosslinks (ICLs) are covalent lesions formed by cisplatin. The mechanism for the processing and removal of ICLs by DNA repair proteins involves nucleotide excision repair (NER), homologous recombination (HR) and fanconi anemia (FA) pathways. In this report, we monitored the processing of a flanking uracil adjacent to a cisplatin ICL by the proteins involved in the base excision repair (BER) pathway. Using a combination of extracts, purified proteins, inhibitors, functional assays and cell culture studies, we determined the specific BER proteins required for processing a DNA substrate with a uracil adjacent to a cisplatin ICL. Uracil DNA glycosylase (UNG) is the primary glycosylase responsible for the removal of uracils adjacent to cisplatin ICLs, whereas other uracil glycosylases can process uracils in the context of undamaged DNA. Repair of the uracil adjacent to cisplatin ICLs proceeds through the classical BER pathway, highlighting the importance of specific proteins in this redundant pathway. Removal of uracil is followed by the generation of an abasic site and subsequent cleavage by AP endonuclease 1 (APE1). Inhibition of either the repair or redox domain of APE1 gives rise to cisplatin resistance. Inhibition of the lyase domain of Polymerase β (Polβ) does not influence cisplatin cytotoxicity. In addition, lack of XRCC1 leads to increased DNA damage and results in increased cisplatin cytotoxicity. Our results indicate that BER activation at cisplatin ICLs influences crosslink repair and modulates cisplatin cytotoxicity via specific UNG, APE1 and Polβ polymerase functions. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Expression of DNA repair genes in burned skin exposed to low-level red laser.

    Trajano, Eduardo Tavares Lima; Mencalha, Andre Luiz; Monte-Alto-Costa, Andréa; Pôrto, Luís Cristóvão; de Souza da Fonseca, Adenilson


    Although red laser lights lie in the region of non-ionizing radiations in the electromagnetic spectrum, there are doubts whether absorption of these radiations causes lesions in the DNA molecule. Our aim was to investigate the expression of the genes involved with base excision and nucleotide excision repair pathways in skin tissue submitted to burn injury and exposed to low-level red laser. Wistar rats were divided as follows: control group-rats burned and not irradiated, laser group-rats burned and irradiated 1 day after injury for five consecutive days, and later laser group-rats injured and treated 4 days after injury for five consecutive days. Irradiation was performed according to a clinical protocol (20 J/cm(2), 100 mW, continuous wave emission mode). The animals were sacrificed on day 10, and scarred tissue samples were withdrawn for total RNA extraction, complementary DNA (cDNA) synthesis, and evaluation of gene expression by quantitative polymerase chain reaction. Low-level red laser exposure (1) reduces the expression of APE1 messenger (mRNA), (2) increases the expression of OGG1 mRNA, (3) reduces the expression of XPC mRNA, and (4) increases the expression of XPA mRNA both in laser and later laser groups. Red laser exposure at therapeutic fluences alters the expression of genes related to base excision and nucleotide excision pathways of DNA repair during wound healing of burned skin.

  17. DNA polymerase beta participates in mitochondrial DNA repair

    Sykora, P; Kanno, S; Akbari, M


    We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments, mitocho......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...... in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation...

  18. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα-encoding (GNAS genomic imprinting domain are associated with performance traits

    Mullen Michael P


    Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs

  19. Arthroscopic excision of ganglion cysts.

    Bontempo, Nicholas A; Weiss, Arnold-Peter C


    Arthroscopy is an advancing field in orthopedics, the applications of which have been expanding over time. Traditionally, excision of ganglion cysts has been done in an open fashion. However, more recently, studies show outcomes following arthroscopic excision to be as good as open excision. Cosmetically, the incisions are smaller and heal faster following arthroscopy. In addition, there is the suggested benefit that patients will regain function and return to work faster following arthroscopic excision. More prospective studies comparing open and arthroscopic excision of ganglion cysts need to be done in order to delineate if there is a true functional benefit. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Molecular cloning and biological characterization of the human excision repair gene ERCC-3

    Weeda, G.; van Ham, R.C.; Masurel, R.; Westerveld, A.; Odijk, H.; de Wit, J.; Bootsma, D.; van der Eb, A.J.; Hoeijmakers, J.H.


    In this report we present the cloning, partial characterization, and preliminary studies of the biological activity of a human gene, designated ERCC-3, involved in early steps of the nucleotide excision repair pathway. The gene was cloned after genomic DNA transfection of human (HeLa) chromosomal DNA together with dominant marker pSV3gptH to the UV-sensitive, incision-defective Chinese hamster ovary (CHO) mutant 27-1. This mutant belongs to complementation group 3 of repair-deficient rodent mutants. After selection of UV-resistant primary and secondary 27-1 transformants, human sequences associated with the induced UV resistance were rescued in cosmids from the DNA of a secondary transformant by using a linked dominant marker copy and human repetitive DNA as probes. From coinheritance analysis of the ERCC-3 region in independent transformants, we deduce that the gene has a size of 35 to 45 kilobases, of which one essential segment has so far been refractory to cloning. Conserved unique human sequences hybridizing to a 3.0-kilobase mRNA were used to isolate apparently full-length cDNA clones. Upon transfection to 27-1 cells, the ERCC-3 cDNA, inserted in a mammalian expression vector, induced specific and (virtually) complete correction of the UV sensitivity and unscheduled DNA synthesis of mutants of complementation group 3 with very high efficiency. Mutant 27-1 is, unlike other mutants of complementation group 3, also very sensitive toward small alkylating agents. This unique property of the mutant is not corrected by introduction of the ERCC-3 cDNA, indicating that it may be caused by an independent second mutation in another repair function. By hybridization to DNA of a human x rodent hybrid cell panel, the ERCC-3 gene was assigned to chromosome 2, in agreement with data based on cell fusion

  1. Modeling base excision repair in Escherichia coli bacterial cells

    Belov, O.V.


    A model describing the key processes in Escherichia coli bacterial cells during base excision repair is developed. The mechanism is modeled of damaged base elimination involving formamidopyrimidine DNA glycosylase (the Fpg protein), which possesses several types of activities. The modeling of the transitions between DNA states is based on a stochastic approach to the chemical reaction description

  2. Time-resolved fluorescence sensing of N-acetyl amino acids, nucleobases, nucleotides and DNA by the luminescent Tb (III) - 8-alkyl-2-oxo-2H-chromene-3-carbaldehyde probe

    Azab, Hassan A. [Chemistry Department, Faculty of Science, Suez Canal University, 41522 Ismailia (Egypt); Khairy, Gasser M., E-mail: [Chemistry Department, Faculty of Science and Arts, Aljouf University, P.O. Box # 2014, Skaka 41421 (Saudi Arabia); Chemistry Department, Faculty of Science, Suez Canal University, 41522 Ismailia (Egypt); Abd El-Ghany, N.; Ahmed, Marwa A. [Chemistry Department, Faculty of Science, Suez Canal University, El-Arish (Egypt)


    A time-resolved (gated) luminescence-based method for the detection of some of N-acetyl amino acids, nucleobases, nucleotides, and DNA using terbium- 8-alkyl-2-oxo-2H-chromene-3-carbaldehyde (AOCC) complex in 1:2 metal: ligand ratio in microtiterplate format has been evolved. The linear range for determination of the selected biomolecules is 0.1–1.0 µM. The detection limit was in the range of 0.0371–0.106 µM. The thermodynamic parameters, and binding constants (K) of N-acetyl amino acids, nucleobases, nucleotides with Tb (III) –(AOCC) {sub 2} complex were calculated. Positive and negative values of entropy (ΔS) and enthalpy (ΔH) changes for Tb (III) –(AOCC){sub 2}– N-acetyl amino acids, nucleobases or nucleotides ternary complexes were evaluated. Selectivity of Tb (III) -complex towards different biomolecules has been studied using ratiometric methods of analysis by comparison of biomolecules binding affinities for Tb (III) -complex. Interaction of Tb (III) complex with DNA has been studied.

  3. Time-resolved fluorescence sensing of N-acetyl amino acids, nucleobases, nucleotides and DNA by the luminescent Tb (III) - 8-alkyl-2-oxo-2H-chromene-3-carbaldehyde probe

    Azab, Hassan A.; Khairy, Gasser M.; Abd El-Ghany, N.; Ahmed, Marwa A.


    A time-resolved (gated) luminescence-based method for the detection of some of N-acetyl amino acids, nucleobases, nucleotides, and DNA using terbium- 8-alkyl-2-oxo-2H-chromene-3-carbaldehyde (AOCC) complex in 1:2 metal: ligand ratio in microtiterplate format has been evolved. The linear range for determination of the selected biomolecules is 0.1–1.0 µM. The detection limit was in the range of 0.0371–0.106 µM. The thermodynamic parameters, and binding constants (K) of N-acetyl amino acids, nucleobases, nucleotides with Tb (III) –(AOCC) 2 complex were calculated. Positive and negative values of entropy (ΔS) and enthalpy (ΔH) changes for Tb (III) –(AOCC) 2 – N-acetyl amino acids, nucleobases or nucleotides ternary complexes were evaluated. Selectivity of Tb (III) -complex towards different biomolecules has been studied using ratiometric methods of analysis by comparison of biomolecules binding affinities for Tb (III) -complex. Interaction of Tb (III) complex with DNA has been studied.

  4. Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

    Hwang, Hanshin; Taylor, John-Stephen


    We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the

  5. DNA-thioguanine nucleotide concentration and relapse-free survival during maintenance therapy of childhood acute lymphoblastic leukaemia (NOPHO ALL2008): a prospective substudy of a phase 3 trial.

    Nielsen, Stine Nygaard; Grell, Kathrine; Nersting, Jacob; Abrahamsson, Jonas; Lund, Bendik; Kanerva, Jukka; Jónsson, Ólafur Gísli; Vaitkeviciene, Goda; Pruunsild, Kaie; Hjalgrim, Lisa Lyngsie; Schmiegelow, Kjeld


    Adjustment of mercaptopurine and methotrexate maintenance therapy of acute lymphoblastic leukaemia by leucocyte count is confounded by natural variations. Cytotoxicity is primarily mediated by DNA-incorporated thioguanine nucleotides (DNA-TGN). The aim of this study was to establish whether DNA-TGN concentrations in blood leucocytes during maintenance therapy are associated with relapse-free survival. In this substudy of the NOPHO ALL2008 phase 3 trial done in 23 hospitals in seven European countries (Denmark, Estonia, Finland, Iceland, Lithuania, Norway, and Sweden), we analysed data from centralised and blinded analyses of 6-mercaptopurine and methotrexate metabolites in blood samples from patients with non-high-risk childhood acute lymphoblastic leukaemia. Eligible patients were aged 1·0-17·9 years; had been diagnosed with non-high-risk precursor B-cell or T-cell leukaemia; had been treated according to the Nordic Society of Pediatric Hematology and Oncology ALL2008 protocol; and had reached maintenance therapy in first remission. Maintenance therapy was (mercaptopurine 75 mg/m 2 once per day and methotrexate 20 mg/m 2 once per week, targeted to a leucocyte count of 1·5-3·0 × 10 9 cells per L). We measured DNA-TGN and erythrocyte concentrations of TGN nucleotides, methylated mercaptopurine metabolites, and methotrexate polyglutamates. The primary objective was the association of DNA-TGN concentrations and 6-mercaptopurine and methotrexate metabolites with relapse-free survival. The secondary endpoint was the assessment of DNA-TGN concentration and 6-mercaptopurine and methotrexate metabolites during maintenance therapy phase 2. Between Nov 26, 2008 and June 14, 2016, 1509 patients from the NOPHO ALL2008 study were assessed for eligibility in the DNA-TGN substudy, of which 918 (89%) of 1026 eligible patients had at least one DNA-TGN measurement and were included in the analyses. Median follow-up was 4·6 years (IQR 3·1-6·1). Relapse-free survival was

  6. Coupling of the nucleotide incision and 3' {yields} 5' exonuclease activities in Escherichia coli endonuclease IV: Structural and genetic evidences

    Golan, Gali [Hebrew University of Jerusalem, Jerusalem 91904 (Israel); Ishchenko, Alexander A. [Groupe Reparation de l' ADN, CNRS UMR 8126, Univ. Paris-Sud, Institut de Cancerologie Gustave Roussy, 39, rue Camille Desmoulins, F-94805 Villejuif Cedex (France); Khassenov, Bekbolat [National Center for Biotechnology, Astana (Kazakhstan); Shoham, Gil, E-mail: [Hebrew University of Jerusalem, Jerusalem 91904 (Israel); Saparbaev, Murat K., E-mail: [Groupe Reparation de l' ADN, CNRS UMR 8126, Univ. Paris-Sud, Institut de Cancerologie Gustave Roussy, 39, rue Camille Desmoulins, F-94805 Villejuif Cedex (France)


    Aerobic respiration generates reactive oxygen species (ROS) as a by-product of cellular metabolism which can damage DNA. The complex nature of oxidative DNA damage requires actions of several repair pathways. Oxidized DNA bases are substrates for two overlapping pathways: base excision repair (BER) and nucleotide incision repair (NIR). In the BER pathway a DNA glycosylase cleaves the N-glycosylic bond between the abnormal base and deoxyribose, leaving either an abasic site or single-stranded DNA break. Alternatively, in the NIR pathway, an apurinic/apyrimidinic (AP) endonuclease incises duplex DNA 5' next to oxidatively damaged nucleotide. The multifunctional Escherichia coli endonuclease IV (Nfo) is involved in both BER and NIR pathways. Nfo incises duplex DNA 5' of a damaged residue but also possesses an intrinsic 3' {yields} 5' exonuclease activity. Herein, we demonstrate that Nfo-catalyzed NIR and exonuclease activities can generate a single-strand gap at the 5' side of 5,6-dihydrouracil residue. Furthermore, we show that Nfo mutants carrying amino acid substitutions H69A and G149D are deficient in both NIR and exonuclease activities, suggesting that these two functions are genetically linked and governed by the same amino acid residues. The crystal structure of Nfo-H69A mutant reveals the loss of one of the active site zinc atoms (Zn1) and rearrangements of the catalytic site, but no gross changes in the overall enzyme conformation. We hypothesize that these minor changes strongly affect the DNA binding of Nfo. Decreased affinity may lead to a different kinking angle of the DNA helix and this in turn thwart nucleotide incision and exonuclease activities of Nfo mutants but to lesser extent of their AP endonuclease function. Based on the biochemical and genetic data we propose a model where nucleotide incision coupled to 3' {yields} 5' exonuclease activity prevents formation of lethal double-strand breaks when repairing bi

  7. Alkylation damage in DNA and RNA--repair mechanisms and medical significance

    Drabløs, Finn; Feyzi, Emadoldin; Aas, Per Arne


    Alkylation lesions in DNA and RNA result from endogenous compounds, environmental agents and alkylating drugs. Simple methylating agents, e.g. methylnitrosourea, tobacco-specific nitrosamines and drugs like temozolomide or streptozotocin, form adducts at N- and O-atoms in DNA bases. These lesions...... are mainly repaired by direct base repair, base excision repair, and to some extent by nucleotide excision repair (NER). The identified carcinogenicity of O(6)-methylguanine (O(6)-meG) is largely caused by its miscoding properties. Mutations from this lesion are prevented by O(6)-alkylG-DNA alkyltransferase......, inactivation of the MMR system in an AGT-defective background causes resistance to the killing effects of O(6)-alkylating agents, but not to the mutagenic effect. Bifunctional alkylating agents, such as chlorambucil or carmustine (BCNU), are commonly used anti-cancer drugs. DNA lesions caused by these agents...

  8. The 2015 Nobel Prize in Chemistry The Discovery of Essential Mechanisms that Repair DNA Damage.

    Lindahl, Tomas; Modrich, Paul; Sancar, Aziz


    The Royal Swedish Academy awarded the Nobel Prize in Chemistry for 2015 to Tomas Lindahl, Paul Modrich and Aziz Sancar for their discoveries in fundamental mechanisms of DNA repair. This pioneering research described three different essential pathways that correct DNA damage, safeguard the integrity of the genetic code to ensure its accurate replication through generations, and allow proper cell division. Working independently of each other, Tomas Lindahl, Paul Modrich and Aziz Sancar delineated the mechanisms of base excision repair, mismatch repair and nucleotide excision repair, respectively. These breakthroughs challenged and dismissed the early view that the DNA molecule was very stable, paving the way for the discovery of human hereditary diseases associated with distinct DNA repair deficiencies and a susceptibility to cancer. It also brought a deeper understanding of cancer as well as neurodegenerative or neurological diseases, and let to novel strategies to treat cancer.

  9. Effect of oxygen on inactivation of biologically active DNA by γ rays in vitro: influence of metalloporphyrins and enzymatic DNA repair

    van Hemmen, J.J.; Meuling, W.J.A.; Bleichrodt, J.F.


    Biologically active DNA dissolved in a bacterial extract shows a higher sensitivity to γ rays under oxygen than under anoxic conditions. This oxygen effect depends on the presence of dialyzable, probably organometallic, compounds in the extract. Metalloporphyrins mimic these cellular components with regard to the effect of oxygen on DNA irradiated in vitro. Anoxic irradiation leads to less double-strand breaks in the DNA than irradiation under oxygen, but the oxygen effect in vitro is mainly due to nucleotide damage. No oxygen effect is observed when the biological activity of the irradiated DNA is assayed on spheroplasts of a bacterial strain carrying a uvrA mutation, i.e., a deficiency in the excision repair system, and the sensitivity of the DNA is almost equal to that found for irradiation under oxygen and assay on a repair-proficient strain. It may be concluded, therefore, that the oxygen effect observed with DNA in cellular extracts or in the presence of metalloporphyrins results from more efficient cellular repair of the otherwise lethal nucleotide damage inflicted under anoxic conditions. Comparison of the oxygen effect on DNA in vitro with the radiosensitization of bacterial cells by oxygen shows that in bacteria part of the radiation damage may be similar to that induced in DNA in vitro, but, in addition, the cells sustain another type of damage which is subjected to an oxygen effect but not to excision repair

  10. Systematic analysis of DNA damage induction and DNA repair pathway activation by continuous wave visible light laser micro-irradiation

    Britta Muster


    Full Text Available Laser micro-irradiation can be used to induce DNA damage with high spatial and temporal resolution, representing a powerful tool to analyze DNA repair in vivo in the context of chromatin. However, most lasers induce a mixture of DNA damage leading to the activation of multiple DNA repair pathways and making it impossible to study individual repair processes. Hence, we aimed to establish and validate micro-irradiation conditions together with inhibition of several key proteins to discriminate different types of DNA damage and repair pathways using lasers commonly available in confocal microscopes. Using time-lapse analysis of cells expressing fluorescently tagged repair proteins and also validation of the DNA damage generated by micro-irradiation using several key damage markers, we show that irradiation with a 405 nm continuous wave laser lead to the activation of all repair pathways even in the absence of exogenous sensitization. In contrast, we found that irradiation with 488 nm laser lead to the selective activation of non-processive short-patch base excision and single strand break repair, which were further validated by PARP inhibition and metoxyamine treatment. We conclude that these low energy conditions discriminated against processive long-patch base excision repair, nucleotide excision repair as well as double strand break repair pathways.

  11. Ubiquitin ligase activity of TFIIH and the transcriptional response to DNA damage.

    Takagi, Yuichiro; Masuda, Claudio A; Chang, Wei-Hau; Komori, Hirofumi; Wang, Dong; Hunter, Tony; Joazeiro, Claudio A P; Kornberg, Roger D


    Core transcription factor (TF) IIH purified from yeast possesses an E3 ubiquitin (Ub) ligase activity, which resides, at least in part, in a RING finger (RNF) domain of the Ssl1 subunit. Yeast strains mutated in the Ssl1 RNF domain are sensitive to ultraviolet (UV) light and to methyl methanesulfonate (MMS). This increased sensitivity to DNA-damaging agents does not reflect a deficiency in nucleotide excision repair. Rather, it correlates with reduced transcriptional induction of genes involved in DNA repair, suggesting that the E3 Ub ligase activity of TFIIH mediates the transcriptional response to DNA damage.

  12. Detection of UVR-induced DNA damage in mouse epidermis in vivo using alkaline elution

    Kinley, J.S.; Moan, J.; Brunborg, G.


    Alkaline elution has been used to detect ultraviolet radiation (UVR)-induced DNA damage in the epidermis of C3H/Tif hr/hr mice. This technique detects DNA damage in the form of single-strand breaks and alkali-labile sites (SSB) formed directly by UVA (320-400 nm) or indirectly by UVB (280-320 nm). The latter induces DNA damage such as cyclobutane pyrimidine dimers and pyrimidine-pyrimidone (6-4)-photoproducts, which are then converted into transient SSB by cellular endonucleases, during nucleotide excision repair (NER). (Author)

  13. Metal-ion binding properties of (S)-1-[3-hydroxy-2-(phosphonomethoxy)propyl]cytosine (HPMPC, Cidofovir). A nucleotide analogue with activity against DNA viruses

    Blindauer, C. A.; Sigel, A.; Operschall, B. P.; Holý, Antonín; Sigel, H.


    Roč. 472, Mar 1 (2018), s. 283-294 ISSN 0020-1693 Institutional support: RVO:61388963 Keywords : acyclic nucleoside phosphonates * antivirals * chelates * isomeric equilibria * metal ion complexes * nucleotide analogues Subject RIV: CC - Organic Chemistry OBOR OECD: Organic chemistry Impact factor: 2.002, year: 2016

  14. Excision repair in MUT-mutants of Proteus mirabilis after UV-irradiation

    Stoerl, K.; Mund, C.


    The behaviour of MUT-mutants of P.mirabilis to perform certain steps of excision repair after U.V.-irradiation is described. MUT-mutants introduce single-strand breaks in the DNA immediately after U.V.-irradiation, but their ability to excise pyrimidine dimers from the DNA is very diminished. Moreover, they are not able to accomplish the excision repair by rejoining of the single-strand breaks. The connection between the incomplete excision repair and the mutator phenotype of these mutants is discussed. (author)

  15. DNA repair in Mycobacterium tuberculosis revisited.

    Dos Vultos, Tiago; Mestre, Olga; Tonjum, Tone; Gicquel, Brigitte


    Our understanding of Mycobacterium tuberculosis DNA repair mechanisms is still poor compared with that of other bacterial organisms. However, the publication of the first complete M. tuberculosis genome sequence 10 years ago boosted the study of DNA repair systems in this organism. A first step in the elucidation of M. tuberculosis DNA repair mechanisms was taken by Mizrahi and Andersen, who identified homologs of genes involved in the reversal or repair of DNA damage in Escherichia coli and related organisms. Genes required for nucleotide excision repair, base excision repair, recombination, and SOS repair and mutagenesis were identified. Notably, no homologs of genes involved in mismatch repair were identified. Novel characteristics of the M. tuberculosis DNA repair machinery have been found over the last decade, such as nonhomologous end joining, the presence of Mpg, ERCC3 and Hlr - proteins previously presumed to be produced exclusively in mammalian cells - and the recently discovered bifunctional dCTP deaminase:dUTPase. The study of these systems is important to develop therapeutic agents that can counteract M. tuberculosis evolutionary changes and to prevent adaptive events resulting in antibiotic resistance. This review summarizes our current understanding of the M. tuberculosis DNA repair system.

  16. Characterization of DNA repair phenotypes of Xeroderma pigmentosum cell lines by a paralleled in vitro test

    Raffin, A.L.


    DNA is constantly damaged modifying the genetic information for which it encodes. Several cellular mechanisms as the Base Excision Repair (BER) and the Nucleotide Excision Repair (NER) allow recovering the right DNA sequence. The Xeroderma pigmentosum is a disease characterised by a deficiency in the NER pathway. The aim of this study was to propose an efficient and fast test for the diagnosis of this disease as an alternative to the currently available UDS test. DNA repair activities of XP cell lines were quantified using in vitro miniaturized and paralleled tests in order to establish DNA repair phenotypes of XPA and XPC deficient cells. The main advantage of the tests used in this study is the simultaneous measurement of excision or excision synthesis (ES) of several lesions by only one cellular extract. We showed on one hand that the relative ES of the different lesions depend strongly on the protein concentration of the nuclear extract tested. Working at high protein concentration allowed discriminating the XP phenotype versus the control one, whereas it was impossible under a certain concentration's threshold. On the other hand, while the UVB irradiation of control cells stimulated their repair activities, this effect was not observed in XP cells. This study brings new information on the XPA and XPC protein roles during BER and NER and underlines the complexity of the regulations of DNA repair processes. (author)

  17. The proviral genome of radiation leukemia virus: Molecular cloning, nucleotide sequence of its long terminal repeat and integration in lymphoma cell DNA

    Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.


    The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy

  18. A Cross-Cancer Genetic Association Analysis of the DNA Repair and DNA Damage Signaling Pathways for Lung, Ovary, Prostate, Breast, and Colorectal Cancer.

    Scarbrough, Peter M; Weber, Rachel Palmieri; Iversen, Edwin S; Brhane, Yonathan; Amos, Christopher I; Kraft, Peter; Hung, Rayjean J; Sellers, Thomas A; Witte, John S; Pharoah, Paul; Henderson, Brian E; Gruber, Stephen B; Hunter, David J; Garber, Judy E; Joshi, Amit D; McDonnell, Kevin; Easton, Doug F; Eeles, Ros; Kote-Jarai, Zsofia; Muir, Kenneth; Doherty, Jennifer A; Schildkraut, Joellen M


    DNA damage is an established mediator of carcinogenesis, although genome-wide association studies (GWAS) have identified few significant loci. This cross-cancer site, pooled analysis was performed to increase the power to detect common variants of DNA repair genes associated with cancer susceptibility. We conducted a cross-cancer analysis of 60,297 single nucleotide polymorphisms, at 229 DNA repair gene regions, using data from the NCI Genetic Associations and Mechanisms in Oncology (GAME-ON) Network. Our analysis included data from 32 GWAS and 48,734 controls and 51,537 cases across five cancer sites (breast, colon, lung, ovary, and prostate). Because of the unavailability of individual data, data were analyzed at the aggregate level. Meta-analysis was performed using the Association analysis for SubSETs (ASSET) software. To test for genetic associations that might escape individual variant testing due to small effect sizes, pathway analysis of eight DNA repair pathways was performed using hierarchical modeling. We identified three susceptibility DNA repair genes, RAD51B (P cancer risk in the base excision repair, nucleotide excision repair, mismatch repair, and homologous recombination pathways. Only three susceptibility loci were identified, which had all been previously reported. In contrast, hierarchical modeling identified several pleiotropic cancer risk associations in key DNA repair pathways. Results suggest that many common variants in DNA repair genes are likely associated with cancer susceptibility through small effect sizes that do not meet stringent significance testing criteria. ©2015 American Association for Cancer Research.


    L.G. Mamonova


    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  20. Analysis of DNA repair in XP-HeLa hybrids; lack of correlation between excision repair of u.v. damage and adenovirus reactivation in an XP(D)-like cell line

    Johnson, R.Y.; Squires, S.; Elliott, G.C.


    Hybrids formed between HeLa cells and fibroblasts from xeroderma pigmentosum group D show either HeLa sensitivity or XPD-like hypersensitivity to u.v. radiation and corresponding high or low excision repair capability. Hybrids with low repair are presumed to have lost, via chromosome segregation, the HeLa wild type D alleles. The u.v. sensitivity and excision repair capability of another hybrid, HD1A, derived spontaneously from the normally sensitive hybrid HD1 are analyzed. While HD1A closely resembles the XPD phenotype in terms of u.v. sensitivity and excision repair it differs from XPD because of its ability to reactivate u.v.-irradiated adenovirus 2 to an extent similar to that of its HeLa parent. This capacity functionally dissociates excision repair of chromatin-based damage from damage in a viral environment. Moreover, on the basis of complementation studies the excision repair of genomic damage by HD1A is subtly different from that of a true XPD-like hybrid, HD2. The data are discussed in terms of a second change in the defective D allele of the HD1A cell. (author)

  1. Frequency of intrachromosomal homologous recombination induced by UV radiation in normally repairing and excision repair-deficient human cells

    Tsujimura, T.; Maher, V.M.; McCormick, J.J.; Godwin, A.R.; Liskay, R.M.


    To investigate the role of DNA damage and nucleotide excision repair in intrachromosomal homologous recombination, a plasmid containing duplicated copies of the gene coding for hygromycin resistance was introduced into the genome of a repair-proficient human cell line, KMST-6, and two repair-deficient lines, XP2OS(SV) from xeroderma pigmentosum complementation group A and XP2YO(SV) from complementation group F. Neither hygromycin-resistance gene codes for a functional enzyme because each contains an insertion/deletion mutation at a unique site, but recombination between the two defective genes can yield hygromycin-resistant cells. The rates of spontaneous recombination in normal and xeroderma pigmentosum cell strains containing the recombination substrate were found to be similar. The frequency of UV-induced recombination was determined for three of these cell strains. At low doses, the group A cell strain and the group F cell strain showed a significant increase in frequency of recombinants. The repair-proficient cell strain required 10-to 20-fold higher doses of UV to exhibit comparable increases in frequency of recombinants. These results suggest that unexcised DNA damage, rather than the excision repair process per se, stimulates such recombination

  2. Kinetics and mechanism of DNA repair

    Meldrum, R.A.; Wharton, C.W.; Shall, S.


    Experiments are described in which the feasibility of using caged dideoxy and other nucleoside triphosphate analogues for trapping breaks induced by u.v. radiation damage to mammalian cell DNA is evaluated. These nucleotide analogues that have a photolabile 1-(2-nitrophenyl)ethyl-protecting group attached to the γ-phosphate are placed in situ by permeabilizing cells by exposure to hypo-osmotic medium. The nucleoside triphosphate is released by a 351 nm u.v. laser pulse whence it may incorporate in the growing chain of DNA induced by the excision-repair process and terminate chain elongation. If the photoreleased dideoxynucleoside trisphosphate is isotopically labelled in the α-phosphate position the break is trapped and labelled. Incorporation of radioactivity into trichloroacetic acid insoluble material in these experiments confirms their potential for use in studies of the kinetics of mammalian cell DNA repair. (author)

  3. Enzymatic activities and DNA substrate specificity of Mycobacterium tuberculosis DNA helicase XPB.

    Balasingham, Seetha V; Zegeye, Ephrem Debebe; Homberset, Håvard; Rossi, Marie L; Laerdahl, Jon K; Bohr, Vilhelm A; Tønjum, Tone


    XPB, also known as ERCC3 and RAD25, is a 3' → 5' DNA repair helicase belonging to the superfamily 2 of helicases. XPB is an essential core subunit of the eukaryotic basal transcription factor complex TFIIH. It has two well-established functions: in the context of damaged DNA, XPB facilitates nucleotide excision repair by unwinding double stranded DNA (dsDNA) surrounding a DNA lesion; while in the context of actively transcribing genes, XPB facilitates initiation of RNA polymerase II transcription at gene promoters. Human and other eukaryotic XPB homologs are relatively well characterized compared to conserved homologs found in mycobacteria and archaea. However, more insight into the function of bacterial helicases is central to understanding the mechanism of DNA metabolism and pathogenesis in general. Here, we characterized Mycobacterium tuberculosis XPB (Mtb XPB), a 3'→5' DNA helicase with DNA-dependent ATPase activity. Mtb XPB efficiently catalyzed DNA unwinding in the presence of significant excess of enzyme. The unwinding activity was fueled by ATP or dATP in the presence of Mg(2+)/Mn(2+). Consistent with the 3'→5' polarity of this bacterial XPB helicase, the enzyme required a DNA substrate with a 3' overhang of 15 nucleotides or more. Although Mtb XPB efficiently unwound DNA model substrates with a 3' DNA tail, it was not active on substrates containing a 3' RNA tail. We also found that Mtb XPB efficiently catalyzed ATP-independent annealing of complementary DNA strands. These observations significantly enhance our understanding of the biological roles of Mtb XPB.

  4. Enzymatic activities and DNA substrate specificity of Mycobacterium tuberculosis DNA helicase XPB.

    Seetha V Balasingham

    Full Text Available XPB, also known as ERCC3 and RAD25, is a 3' → 5' DNA repair helicase belonging to the superfamily 2 of helicases. XPB is an essential core subunit of the eukaryotic basal transcription factor complex TFIIH. It has two well-established functions: in the context of damaged DNA, XPB facilitates nucleotide excision repair by unwinding double stranded DNA (dsDNA surrounding a DNA lesion; while in the context of actively transcribing genes, XPB facilitates initiation of RNA polymerase II transcription at gene promoters. Human and other eukaryotic XPB homologs are relatively well characterized compared to conserved homologs found in mycobacteria and archaea. However, more insight into the function of bacterial helicases is central to understanding the mechanism of DNA metabolism and pathogenesis in general. Here, we characterized Mycobacterium tuberculosis XPB (Mtb XPB, a 3'→5' DNA helicase with DNA-dependent ATPase activity. Mtb XPB efficiently catalyzed DNA unwinding in the presence of significant excess of enzyme. The unwinding activity was fueled by ATP or dATP in the presence of Mg(2+/Mn(2+. Consistent with the 3'→5' polarity of this bacterial XPB helicase, the enzyme required a DNA substrate with a 3' overhang of 15 nucleotides or more. Although Mtb XPB efficiently unwound DNA model substrates with a 3' DNA tail, it was not active on substrates containing a 3' RNA tail. We also found that Mtb XPB efficiently catalyzed ATP-independent annealing of complementary DNA strands. These observations significantly enhance our understanding of the biological roles of Mtb XPB.

  5. Faulty DNA-polymerase δ/ε-mediated excision-repair in response to gamma-radiation or ultraviolet-light in P53-deficient fibroblast strains from affected members of a cancer-prone family with Li-Fraumeni syndrome

    Mirzayans, R.; Enns, L.; Dietrich, K.; Barley, R.D.C.; Paterson, M.C.; Alberta Univ., Edmonton, AB; Alberta Univ., Edmonton, AB


    Dermal fibroblast strains cultured from affected members of a cancer-prone family with Li-Fraumeni syndrome (LFS) harbor a point mutation in one allele of the p53 tumor suppressor gene, resulting in loss of normal p53-deficient strains to carry out the long-patch mode of excision repair, mediated by DNA polymerases delta and epsilon, after exposure to Co-60 gamma radiation or far ultraviolet (UV) (chiefly 254 mm) light. Repair was monitored by incubation of the irradiated cultures in the presence of aphidicolin (ape) or 1-beta-D-arabinofuranosylcytosine (araC), each a specific inhibitor of long-patch repair, followed by measurement of drug-induced DNA strand breaks (reflecting non-ligated strand incision events) by alkaline surcrose velocity sedimentation. The LFS strains displayed deficient repair capacity in response to both gamma rays and UV light. The repair anomaly in UV-irradiated LFS cultures was manifested not only in the overall genome, but also in the transcriptionally active, preferentially repaired c-myc gene. Using autoradiography we also assessed unscheduled DNA synthesis (UDS) after UV irradiation and found this conventional measure of repair replication to be deficient in LFS strains. Moreover, both ape and araC decreased the level of UV-induced UDS by similar to 75% in normal cells, but each had only a marginal effect on LFS cells. We further demonstrated that the LFS strains are impaired in the recovery of both RNA and replicative DNA syntheses after UV treatment, two molecular anomalies of the DNA repair deficiency disorders xeroderma pigmentosum and Cockayne's syndrome. Together these results imply a critical role for wild-type p53 protein in DNA polymerase delta/epsilon-mediated excision repair, both the mechanism operating on the entire genome and that acting on expressed genes. (Author)

  6. DNA repair

    Setlow, R.


    Some topics discussed are as follows: difficulty in extrapolating data from E. coli to mammalian systems; mutations caused by UV-induced changes in DNA; mutants deficient in excision repair; other postreplication mechanisms; kinds of excision repair systems; detection of repair by biochemical or biophysical means; human mutants deficient in repair; mutagenic effects of UV on XP cells; and detection of UV-repair defects among XP individuals

  7. Base excision repair mechanisms and relevance to cancer susceptibility

    Dogliotti, E.; Wilson, S.H.


    The base excision repair (BER) pathway is considered the predominant DNA repair system in mammalian cells for eliminating small DNA lesions generated at DNA bases either exogenously by environmental agents or endogenously by normal cellular metabolic processes (e.g. production of oxyradical species, alkylating agents, etc). The main goal of this project is the understanding of the involvement of BER in genome stability and in particular in sporadic cancer development associated with inflammation such as gastric cancer (GC). A major risk factor of GC is the infection by Helicobacter pylori, which causes oxidative stress. Oxidative DNA damage is mainly repaired by BER

  8. Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

    Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)


    Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

  9. Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

    Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.


    The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

  10. Insulin: its binding to specific receptors and its stimulation of DNA synthesis and 2',3'-cyclic nucleotide phosphohydrolase in embryonic mouse brain cell cultures

    Shanker, G.; Pieringer, R.A.


    Previously, the authors demonstrated that ornithine decarboxylase was stimulated by insulin in cultures of embryonic mouse brain cells. In the present work, they have investigated the presence and specificity of insulin receptors in these cultures. A time study showed that maximum binding of 125 [I] labelled insulin was around 75 min. Other studies measured the influence of concentration and age on insulin binding. A displacement study using increasing concentrations of cold insulin, glucagon or growth hormone demonstrated that the specificity of the receptors for insulin was rather high. It was also found that insulin displayed a clear dose-dependent stimulation of thymidine incorporation into the brain cells. Insulin also stimulated the glial enzyme 2':3'-cyclic nucleotide phosphohydrolase (CNP-ase). The results suggest a dual role for insulin; it regulates both cell proliferation as well as differentiation

  11. The GC-Rich Mitochondrial and Plastid Genomes of the Green Alga Coccomyxa Give Insight into the Evolution of Organelle DNA Nucleotide Landscape

    Smith, David Roy; Burki, Fabien; Yamada, Takashi; Grimwood, Jane; Grigoriev, Igor V.; Van Etten, James L.; Keeling, Patrick J.


    Most of the available mitochondrial and plastid genome sequences are biased towards adenine and thymine (AT) over guanine and cytosine (GC). Examples of GC-rich organelle DNAs are limited to a small but eclectic list of species, including certain green algae. Here, to gain insight in the evolution of organelle nucleotide landscape, we present the GC-rich mitochondrial and plastid DNAs from the trebouxiophyte green alga Coccomyxa sp. C-169. We compare these sequences with other GC-rich organelle DNAs and argue that the forces biasing them towards G and C are nonadaptive and linked to the metabolic and/or life history features of this species. The Coccomyxa organelle genomes are also used for phylogenetic analyses, which highlight the complexities in trying to resolve the interrelationships among the core chlorophyte green algae, but ultimately favour a sister relationship between the Ulvophyceae and Chlorophyceae, with the Trebouxiophyceae branching at the base of the chlorophyte crown.

  12. DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair

    Elisa Mentegari


    Full Text Available DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell’s genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.

  13. DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair.

    Mentegari, Elisa; Kissova, Miroslava; Bavagnoli, Laura; Maga, Giovanni; Crespan, Emmanuele


    DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell's genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.

  14. The Potato Nucleotide-Binding Leucine-Rich Repeat (NLR) Immune Receptor Rx1 is a Pathogen Dependent DNA-Deforming Protein

    Fenyk, S.; Townsend, P.D.; Dixon, C.H.; Spies, G.B.; Campillo, A.S.E.; Slootweg, E.J.; Westerhof, L.B.; Gawehns, F.K.K.; Knight, M.R.; Sharples, G.J.; Goverse, A.; Palsson, L.O.; Takken, F.L.W.; Cann, M.J.


    Plant NLR proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus, however, conserved nuclear targets that support their role in immunity are unknown. Previously we noted a structural homology between the NB domain of NLRs and DNA replication origin-binding Cdc6/Orc1

  15. Aqueous Heck Cross-Coupling Preparation of Acrylate-Modified Nucleotides and Nucleoside Triphosphates for Polymerase Synthesis of Acrylate-Labeled DNA

    Daďová, Jitka; Vidláková, Pavlína; Pohl, Radek; Havran, Luděk; Fojta, Miroslav; Hocek, Michal


    Roč. 78, č. 19 (2013), s. 9627-9637 ISSN 0022-3263 R&D Projects: GA AV ČR(CZ) IAA400040901 Institutional support: RVO:61388963 ; RVO:68081707 Keywords : nucleic-acids * enzymatic incorporation * protein interactions * functionalized DNA Subject RIV: CC - Organic Chemistry Impact factor: 4.638, year: 2013

  16. Isolation of the functional human excision repair gene ERCC5 by intercosmid recombination

    Mudgett, J.S.; MacInnes, M.A.


    The complete human nucleotide exicision repair gene ERCC5 was isolated as a functional gene on overlapping cosmids. ERCC5 corrects the excision repair deficiency of Chinese hamster ovary cell line UV135, of complementation group 5. Cosmids that contained human sequences were obtained from a UV-resistant cell line derived from UV135 cells transformed with human genomic DNA. Individually, none of the cosmids complemented the UV135 repair defect; cosmid groups were formed to represent putative human genomic regions, and specific pairs of cosmids that effectively transformed UV135 cells to UV resistance were identified. Analysis of transformants derived from the active cosmid pairs showed that the functional 32-kbp ERCC5 gene was reconstructed by homologous intercosmid recombination. The cloned human sequences exhibited 100% concordance with the locus designated genetically as ERCC5 located on human chromosome 13q. Cosmid-transformed UV135 host cells repaired cytotoxic damage to levels about 70% of normal and repaired UV-irradiated shuttle vector DNA to levels about 82% of normal

  17. A seventh complementation group in excision-deficient xeroderma pigmentosum

    Keijzer, W.; Jaspers, N.G.J.; Bootsma, D.; Abrahams, P.J.; Taylor, A.M.R.; Arlett, C.F.; Zelle, B.; Kinmont, P.D.S.


    Cells from a xeroderma pigmentosum patient XP2B1 who has reached 17 years of age with no keratoses or skin tumours constitute a new, 7th complementation group G. These cells exhibit a low residual level of excision repair, 2% of normal after a UV dose of 5 J/m 2 and an impairment of post-replication repair characteristic of excision-defective XPs. They are also sensitive to the lethal effects of UV and defective in host-cell reactivation of UV-irradiated SV40 DNA. (Auth.)

  18. Solar ultraviolet radiation-induced DNA damage in aquatic organisms: potential environmental impact

    Haeder, Donat-P.; Sinha, Rajeshwar P.


    Continuing depletion of stratospheric ozone and subsequent increases in deleterious ultraviolet (UV) radiation at the Earth's surface have fueled the interest in its ecological consequences for aquatic ecosystems. The DNA is certainly one of the key targets for UV-induced damage in a variety of aquatic organisms. UV radiation induces two of the most abundant mutagenic and cytotoxic DNA lesions, cyclobutane pyrimidine dimers (CPDs) and pyrimidine pyrimidone photoproducts (6-4PPs) and their Dewar valence isomers. However, aquatic organisms have developed a number of repair and tolerance mechanisms to counteract the damaging effects of UV on DNA. Photoreactivation with the help of the enzyme photolyase is one of the most important and frequently occurring repair mechanisms in a variety of organisms. Excision repair, which can be distinguished into base excision repair (BER) and nucleotide excision repair (NER), also play an important role in DNA repair in several organisms with the help of a number of glycosylases and polymerases, respectively. In addition, mechanisms such as mutagenic repair or dimer bypass, recombinational repair, cell-cycle checkpoints, apoptosis and certain alternative repair pathways are also operative in various organisms. This review deals with the UV-induced DNA damage and repair in a number of aquatic organisms as well as methods of detecting DNA damage

  19. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    Rasmussen, Søren Kjærsgård; Johansson, A.


    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  20. Single nucleotide polymorphisms in the D-loop region of mitochondrial DNA is associated with the kidney survival time in chronic kidney disease patients.

    Xu, Jinsheng; Guo, Zhanjun; Bai, Yaling; Zhang, Junxia; Cui, Liwen; Zhang, Huiran; Zhang, Shenglei; Ai, Xiaolu


    The mitochondrial displacement loop (D-loop) is known to accumulate mutations and SNPs at a higher frequency than other regions of mitochondrial DNA (mtDNA). We had identified chronic kidney disease (CKD) risk-associated SNPs in the D-loop of CKD patients previously. In this study, we investigated the association of SNPs in the D-loop of mtDNA with the kidney survival of CKD. The D-loop region of mtDNA was sequenced for 119 CKD patients from the inpatient of the Fourth Hospital of Hebei Medical University. The Kaplan-Meier method was used to identify disease outcome-associated SNPs in the D-loop of CKD patients. The Cox proportional hazards model was used to identify risk factors for the kidney survival of CKD. In the present study, we identified 20 SNPs with a frequency higher than 5% and assessed the relationship of these SNPs with kidney survival time in CKD patients, a SNP of 146 was identified by log-rank test for statistically significant prediction of the kidney survival time. In an overall multivariate analysis, allele 146 was identified as an independent predictor of kidney survival time in CKD patients. The survival time of kidney in the CKD patients with 146C was significantly shorter than that of kidney in CKD patients with 146T (relative risk, 2.336; 95% CI, 1.319-3.923; p = 0.001). SNPs in the D-loop can predict the kidney survival of CKD patients. Analysis of genetic polymorphisms in the mitochondrial D-loop can help to identify CKD patient subgroup at high risk of a poor disease outcome.

  1. A Rotational BODIPY Nucleotide: An Environment-Sensitive Fluorescence-Lifetime Probe for DNA Interactions and Applications in Live-Cell Microscopy

    Dziuba, Dmytro; Jurkiewicz, Piotr; Cebecauer, Marek; Hof, Martin; Hocek, Michal


    Roč. 55, č. 1 (2016), s. 174-178 ISSN 1433-7851 R&D Projects: GA ČR GBP206/12/G151; GA ČR(CZ) GC14-03141J Institutional support: RVO:61388963 ; RVO:61388955 Keywords : DNA * fluorescence spectroscopy * fluorescent probes * nucleosides * time-resolved spectroscopy Subject RIV: CC - Organic Chemistry ; BO - Biophysics (UFCH-W) Impact factor: 11.994, year: 2016

  2. Comparison of the effect of nalidixic acid and thymine deprivation on excision repair in Escherichia coli

    Masek, F.; Slezarikova, V.; Sedliakova, M.


    A difference was found in the extent of inhibition of thymine dimers (TT) excision in ultraviolet (UV) irradiated cells of E. coli after preirradiation depression of protein and DNA syntheses induced by a simultaneous removal of essential amino acids (AA - ) and thymine (T - ) or by the removal of essential amino acids and the addition of nalidixic acid (NAL + ). The difference was observed in both E. coli B/r Hcr + and E. coli K12 SR20 uvr + cells. The depression of DNA synthesis by nalidixic acid as an exogenous agent inhibited TT excision to a lower degree than the depression of DNA synthesis by thymine starvation. The extent of TT excision had no appreciable effect on the restoration of the sedimentation profile of a newly synthesized DNA nor on UV resistance of cells during dark repair. A DNA molecule having the size of a molecule of nonirradiated cells became synthesized while TT were still present in the DNA. (author)

  3. The mitochondrial transcription factor A functions in mitochondrial base excision repair

    Canugovi, Chandrika; Maynard, Scott; Bayne, Anne-Cécile V


    Mitochondrial transcription factor A (TFAM) is an essential component of mitochondrial nucleoids. TFAM plays an important role in mitochondrial transcription and replication. TFAM has been previously reported to inhibit nucleotide excision repair (NER) in vitro but NER has not yet been detected i...

  4. DNA repair inhibition by UVA photoactivated fluoroquinolones and vemurafenib

    Peacock, Matthew; Brem, Reto; Macpherson, Peter; Karran, Peter


    Cutaneous photosensitization is a common side effect of drug treatment and can be associated with an increased skin cancer risk. The immunosuppressant azathioprine, the fluoroquinolone antibiotics and vemurafenib—a BRAF inhibitor used to treat metastatic melanoma—are all recognized clinical photosensitizers. We have compared the effects of UVA radiation on cultured human cells treated with 6-thioguanine (6-TG, a DNA-embedded azathioprine surrogate), the fluoroquinolones ciprofloxacin and ofloxacin and vemurafenib. Despite widely different structures and modes of action, each of these drugs potentiated UVA cytotoxicity. UVA photoactivation of 6-TG, ciprofloxacin and ofloxacin was associated with the generation of singlet oxygen that caused extensive protein oxidation. In particular, these treatments were associated with damage to DNA repair proteins that reduced the efficiency of nucleotide excision repair. Although vemurafenib was also highly phototoxic to cultured cells, its effects were less dependent on singlet oxygen. Highly toxic combinations of vemurafenib and UVA caused little protein carbonylation but were nevertheless inhibitory to nucleotide excision repair. Thus, for three different classes of drugs, photosensitization by at least two distinct mechanisms is associated with reduced protection against potentially mutagenic and carcinogenic DNA damage. PMID:25414333

  5. DNA Damage Induced by Alkylating Agents and Repair Pathways

    Kondo, Natsuko; Takahashi, Akihisa; Ono, Koji; Ohnishi, Takeo


    The cytotoxic effects of alkylating agents are strongly attenuated by cellular DNA repair processes, necessitating a clear understanding of the repair mechanisms. Simple methylating agents form adducts at N- and O-atoms. N-methylations are removed by base excision repair, AlkB homologues, or nucleotide excision repair (NER). O6-methylguanine (MeG), which can eventually become cytotoxic and mutagenic, is repaired by O6-methylguanine-DNA methyltransferase, and O6MeG:T mispairs are recognized by the mismatch repair system (MMR). MMR cannot repair the O6MeG/T mispairs, which eventually lead to double-strand breaks. Bifunctional alkylating agents form interstrand cross-links (ICLs) which are more complex and highly cytotoxic. ICLs are repaired by complex of NER factors (e.g., endnuclease xeroderma pigmentosum complementation group F-excision repair cross-complementing rodent repair deficiency complementation group 1), Fanconi anemia repair, and homologous recombination. A detailed understanding of how cells cope with DNA damage caused by alkylating agents is therefore potentially useful in clinical medicine. PMID:21113301

  6. Incomplete excision repair process after UV-irradiation in MUT-mutants of Proteus mirabillis

    Stoerl, K.


    MUT-mutants of P. mirabilis seem to be able to perform the incision step in the course of excision repair. In contrast to the corresponding wildtype strains with MUT-mutants the number of single-strand breaks formed after UV-irradiation is independent of the UV-dose up to about 720 erg/mm 2 . Incubation in minimal medium over a longer time does not result in completion of excision repair; about 3-6 single-strand breaks in the DNA of these mutants remain open. Likewise, the low molecular weight of the newly synthesized daughter DNA confirms an incompletely proceeding or delayed repair process. As a possible reason for the mutator phenotype an alteration of the DNA-polymerase playing a role in excision and resynthesis steps of excision repair is discussed. (author)

  7. First-passage problems in DNA replication: effects of template tension on stepping and exonuclease activities of a DNA polymerase motor

    Sharma, Ajeet K; Chowdhury, Debashish


    A DNA polymerase (DNAP) replicates a template DNA strand. It also exploits the template as the track for its own motor-like mechanical movement. In the polymerase mode it elongates the nascent DNA by one nucleotide in each step. However, whenever it commits an error by misincorporating an incorrect nucleotide, it can switch to an exonuclease mode. In the latter mode it excises the wrong nucleotide before switching back to its polymerase mode. We develop a stochastic kinetic model of DNA replication that mimics an in vitro experiment where single-stranded DNA, subjected to a mechanical tension F, is converted to double-stranded DNA by a single DNAP. The F-dependence of the average rate of replication, which depends on the rates of both polymerase and exonuclease activities of the DNAP, is in good qualitative agreement with the corresponding experimental results. We introduce nine novel distinct conditional dwell times of a DNAP. Using the method of first-passage times, we also derive the exact analytical expressions for the probability distributions of these conditional dwell times. The predicted F-dependences of these distributions are, in principle, accessible to single-molecule experiments. (paper)

  8. Influence of XRCC1 Genetic Polymorphisms on Ionizing Radiation-Induced DNA Damage and Repair

    Silvia Sterpone


    Full Text Available It is well known that ionizing radiation (IR can damage DNA through a direct action, producing single- and double-strand breaks on DNA double helix, as well as an indirect effect by generating oxygen reactive species in the cells. Mammals have evolved several and distinct DNA repair pathways in order to maintain genomic stability and avoid tumour cell transformation. This review reports important data showing a huge interindividual variability on sensitivity to IR and in susceptibility to developing cancer; this variability is principally represented by genetic polymorphisms, that is, DNA repair gene polymorphisms. In particular we have focussed on single nucleotide polymorphisms (SNPs of XRCC1, a gene that encodes for a scaffold protein involved basically in Base Excision Repair (BER. In this paper we have reported and presented recent studies that show an influence of XRCC1 variants on DNA repair capacity and susceptibility to breast cancer.

  9. Influence of XRCC1 Genetic Polymorphisms on Ionizing Radiation-Induced DNA Damage and Repair.

    Sterpone, Silvia; Cozzi, Renata


    It is well known that ionizing radiation (IR) can damage DNA through a direct action, producing single- and double-strand breaks on DNA double helix, as well as an indirect effect by generating oxygen reactive species in the cells. Mammals have evolved several and distinct DNA repair pathways in order to maintain genomic stability and avoid tumour cell transformation. This review reports important data showing a huge interindividual variability on sensitivity to IR and in susceptibility to developing cancer; this variability is principally represented by genetic polymorphisms, that is, DNA repair gene polymorphisms. In particular we have focussed on single nucleotide polymorphisms (SNPs) of XRCC1, a gene that encodes for a scaffold protein involved basically in Base Excision Repair (BER). In this paper we have reported and presented recent studies that show an influence of XRCC1 variants on DNA repair capacity and susceptibility to breast cancer.

  10. Recognition of damaged DNA by Escherichia coli Fpg protein: insights from structural and kinetic data

    Zharkov, Dmitry O.; Ishchenko, Alexander A.; Douglas, Kenneth T.; Nevinsky, Georgy A.


    Formamidopyrimidine-DNA glycosylase (Fpg) excises oxidized purines from damaged DNA. The recent determination of the three-dimensional structure of the covalent complex of DNA with Escherichia coli Fpg, obtained by reducing the Schiff base intermediate formed during the reaction [Gilboa et al., J. Biol. Chem. 277 (2002) 19811] has revealed a number of potential specific and non-specific interactions between Fpg and DNA. We analyze the structural data for Fpg in the light of the kinetic and thermodynamic data obtained by the method of stepwise increase in ligand complexity to estimate relative contributions of individual nucleotide units of lesion-containing DNA to its total affinity for this enzyme [Ishchenko et al., Biochemistry 41 (2002) 7540]. Stopped-flow kinetic analysis that has allowed the dissection of Fpg catalysis in time [Fedorova et al., Biochemistry 41 (2002) 1520] is also correlated with the structural data

  11. Structural dynamics and interactions of Xeroderma pigmentosum complementation group A (XPA98-210) with damaged DNA.

    Pradhan, Sushmita; Mattaparthi, Venkata Satish Kumar


    Nucleotide excision repair (NER) in higher organisms repair massive DNA abrasions caused by ultraviolet rays, and various mutagens, where Xeroderma pigmentosum group A (XPA) protein is known to be involved in damage recognition step. Any mutations in XPA cause classical Xeroderma pigmentosum disease. The extent to which XPA is required in the NER is still unclear. Here, we present the comparative study on the structural and conformational changes in globular DNA binding domain of XPA 98-210 in DNA bound and DNA free state. Atomistic molecular dynamics simulation was carried out for both XPA 98-210 systems using AMBER force fields. We observed that XPA 98-210 in presence of damaged DNA exhibited more structural changes compared to XPA 98-210 in its free form. When XPA is in contact with DNA, we found marked stability of the complex due to the formation of characteristic longer antiparallel β-sheets consisting mainly lysine residues.

  12. Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

    Maíra C. M. Freire


    Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

  13. Probing the DNA Structural Requirements for Facilitated Diffusion


    DNA glycosylases perform a genome-wide search to locate damaged nucleotides among a great excess of undamaged nucleotides. Many glycosylases are capable of facilitated diffusion, whereby multiple sites along the DNA are sampled during a single binding encounter. Electrostatic interactions between positively charged amino acids and the negatively charged phosphate backbone are crucial for facilitated diffusion, but the extent to which diffusing proteins rely on the double-helical structure DNA is not known. Kinetic assays were used to probe the DNA searching mechanism of human alkyladenine DNA glycosylase (AAG) and to test the extent to which diffusion requires B-form duplex DNA. Although AAG excises εA lesions from single-stranded DNA, it is not processive on single-stranded DNA because dissociation is faster than N-glycosidic bond cleavage. However, the AAG complex with single-stranded DNA is sufficiently stable to allow for DNA annealing when a complementary strand is added. This observation provides evidence of nonspecific association of AAG with single-stranded DNA. Single-strand gaps, bubbles, and bent structures do not impede the search by AAG. Instead, these flexible or bent structures lead to the capture of a nearby site of damage that is more efficient than that of a continuous B-form duplex. The ability of AAG to negotiate these helix discontinuities is inconsistent with a sliding mode of diffusion but can be readily explained by a hopping mode that involves microscopic dissociation and reassociation. These experiments provide evidence of relatively long-range hops that allow a searching protein to navigate around DNA binding proteins that would serve as obstacles to a sliding protein. PMID:25495964

  14. Stress and DNA repair biology of the Fanconi anemia pathway

    Longerich, Simonne; Li, Jian; Xiong, Yong; Sung, Patrick


    Fanconi anemia (FA) represents a paradigm of rare genetic diseases, where the quest for cause and cure has led to seminal discoveries in cancer biology. Although a total of 16 FA genes have been identified thus far, the biochemical function of many of the FA proteins remains to be elucidated. FA is rare, yet the fact that 5 FA genes are in fact familial breast cancer genes and FA gene mutations are found frequently in sporadic cancers suggest wider applicability in hematopoiesis and oncology. Establishing the interaction network involving the FA proteins and their associated partners has revealed an intersection of FA with several DNA repair pathways, including homologous recombination, DNA mismatch repair, nucleotide excision repair, and translesion DNA synthesis. Importantly, recent studies have shown a major involvement of the FA pathway in the tolerance of reactive aldehydes. Moreover, despite improved outcomes in stem cell transplantation in the treatment of FA, many challenges remain in patient care. PMID:25237197

  15. Interplay of DNA repair with transcription: from structures to mechanisms.

    Deaconescu, Alexandra M; Artsimovitch, Irina; Grigorieff, Nikolaus


    Many DNA transactions are crucial for maintaining genomic integrity and faithful transfer of genetic information but remain poorly understood. An example is the interplay between nucleotide excision repair (NER) and transcription, also known as transcription-coupled DNA repair (TCR). Discovered decades ago, the mechanisms for TCR have remained elusive, not in small part due to the scarcity of structural studies of key players. Here we summarize recent structural information on NER/TCR factors, focusing on bacterial systems, and integrate it with existing genetic, biochemical, and biophysical data to delineate the mechanisms at play. We also review emerging, alternative modalities for recruitment of NER proteins to DNA lesions. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Kinetics and mechanism of DNA repair; Evaluation of caged compounds for use in studies of u. v. -induced DNA repair

    Meldrum, R.A.; Wharton, C.W. (Birmingham Univ. (UK). Dept. of Biochemistry); Shall, S. (Sussex Univ., Brighton (UK). School of Biological Sciences)


    Experiments are described in which the feasibility of using caged dideoxy and other nucleoside triphosphate analogues for trapping breaks induced by u.v. radiation damage to mammalian cell DNA is evaluated. These nucleotide analogues that have a photolabile 1-(2-nitrophenyl)ethyl-protecting group attached to the {gamma}-phosphate are placed in situ by permeabilizing cells by exposure to hypo-osmotic medium. The nucleoside triphosphate is released by a 351 nm u.v. laser pulse whence it may incorporate in the growing chain of DNA induced by the excision-repair process and terminate chain elongation. If the photoreleased dideoxynucleoside trisphosphate is isotopically labelled in the {alpha}-phosphate position the break is trapped and labelled. Incorporation of radioactivity into trichloroacetic acid insoluble material in these experiments confirms their potential for use in studies of the kinetics of mammalian cell DNA repair. (author).

  17. ATP-dependent chromatin remodeling in the DNA-damage response

    Lans Hannes


    Full Text Available Abstract The integrity of DNA is continuously challenged by metabolism-derived and environmental genotoxic agents that cause a variety of DNA lesions, including base alterations and breaks. DNA damage interferes with vital processes such as transcription and replication, and if not repaired properly, can ultimately lead to premature aging and cancer. Multiple DNA pathways signaling for DNA repair and DNA damage collectively safeguard the integrity of DNA. Chromatin plays a pivotal role in regulating DNA-associated processes, and is itself subject to regulation by the DNA-damage response. Chromatin influences access to DNA, and often serves as a docking or signaling site for repair and signaling proteins. Its structure can be adapted by post-translational histone modifications and nucleosome remodeling, catalyzed by the activity of ATP-dependent chromatin-remodeling complexes. In recent years, accumulating evidence has suggested that ATP-dependent chromatin-remodeling complexes play important, although poorly characterized, roles in facilitating the effectiveness of the DNA-damage response. In this review, we summarize the current knowledge on the involvement of ATP-dependent chromatin remodeling in three major DNA repair pathways: nucleotide excision repair, homologous recombination, and non-homologous end-joining. This shows that a surprisingly large number of different remodeling complexes display pleiotropic functions during different stages of the DNA-damage response. Moreover, several complexes seem to have multiple functions, and are implicated in various mechanistically distinct repair pathways.

  18. Lumbar disc excision through fenestration

    Sangwan S


    Full Text Available Background : Lumbar disc herniation often causes sciatica. Many different techniques have been advocated with the aim of least possible damage to other structures while dealing with prolapsed disc surgically in the properly selected and indicated cases. Methods : Twenty six patients with clinical symptoms and signs of prolapsed lumbar intervertebral disc having radiological correlation by MRI study were subjected to disc excision by interlaminar fenestration method. Results : The assessment at follow-up showed excellent results in 17 patients, good in 6 patients, fair in 2 patients and poor in 1 patient. The mean preoperative and postoperative Visual Analogue Scores were 9.34 ±0.84 and 2.19 ±0.84 on scale of 0-10 respectively. These were statistically significant (p value< 0.001, paired t test. No significant complications were recorded. Conclusion : Procedures of interlaminar fenestration and open disc excision under direct vision offers sufficient adequate exposure for lumbar disc excision with a smaller incision, lesser morbidity, shorter convalescence, early return to work and comparable overall results in the centers where recent laser and endoscopy facilities are not available.

  19. Gene therapy for the circumvention of inborn errors of metabolism (IEM) caused by single-nucleotide-polymorphisms (SNPs).

    Wiseman, Alan


    Single nucleotide polymorphisms (SNPs) are the result of point mutations in nuclear (and mitochondrial) DNA. Such localised damage to DNA (and its replicative mechanisms) may not be excised fully by the DNA repair mechanism in the genome: and therefore can become inheritable; subsequently to manifest later as an inborn error of metabolism (IEM). Causes of mutagenic damage to the DNA can include background radiation (such as emitted by radon gas), and by reactive oxygen species (ROS): and also by mutagenic chemicals that occur naturally (inter alia in the diet). Other causes of DNA damage are variable environmental hazards such as solar-derived short wave ultraviolet light A. Gene therapy involves the placement of missing genes into particular tissues by the harnessing of suitable vectors (originally these were animal viruses such as SV40). For example, gene therapy in the rat for diabetes has succeeded by liver-production of insulin (using genes obtained from pancreatic Islets of Langerhans cells). Many inborn errors of metabolism could be treated in this way: examples may include 100 haemoglobinopathies (such as sickle cell anaemia), phenylketonuria; and other diseases caused by lack of tissue-production of a particular enzyme (in its catalytically-active conformation).

  20. Impact of DNA repair on the dose-response of colorectal cancer formation induced by dietary carcinogens.

    Fahrer, Jörg; Kaina, Bernd


    Colorectal cancer (CRC) is one of the most frequently diagnosed cancers, which is causally linked to dietary habits, notably the intake of processed and red meat. Processed and red meat contain dietary carcinogens, including heterocyclic aromatic amines (HCAs) and N-nitroso compounds (NOC). NOC are agents that induce various N-methylated DNA adducts and O 6 -methylguanine (O 6 -MeG), which are removed by base excision repair (BER) and O 6 -methylguanine-DNA methyltransferase (MGMT), respectively. HCAs such as the highly mutagenic 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) cause bulky DNA adducts, which are removed from DNA by nucleotide excision repair (NER). Both O 6 -MeG and HCA-induced DNA adducts are linked to the occurrence of KRAS and APC mutations in colorectal tumors of rodents and humans, thereby driving CRC initiation and progression. In this review, we focus on DNA repair pathways removing DNA lesions induced by NOC and HCA and assess their role in protecting against mutagenicity and carcinogenicity in the large intestine. We further discuss the impact of DNA repair on the dose-response relationship in colorectal carcinogenesis in view of recent studies, demonstrating the existence of 'no effect' point of departures (PoDs), i.e. thresholds for genotoxicity and carcinogenicity. The available data support the threshold concept for NOC with DNA repair being causally involved. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  2. Repair of UVC induced DNA lesions in erythrocytes from Carassius auratus gibelio

    Bagdonas, E.; Zukas, K.


    The kinetics of UVC (254 nm) irradiation induced DNA single-strand breaks generated during the excision repair of UV induced DNA damage in erythrocytes from Carassius auratus gibelio were studied using alkaline comet assay. Nucleotide excision repair recognised DNA lesions such as UVC induced cyclobutane pyrimidine dimers and 6-4 pyrimidine-pyrimidone photoproducts and produced DNA single-stranded breaks that were easily detected by comet assay. After irradiation of erythrocytes with 58 j/m 2 UVC dose, there was an increase in comet tail moment (CTM) at 2 hours post-radiation, whereas at 4 hours post-radiation CTM decreased and did not differ significantly from the control level (P=0,127). When erythrocytes were exposed to 173 J/m 2 UVC dose, the excision repair delayed in the beginning (0 hours), reached maximum level at 2 hours post-radiation (CTM-54,8) and showed slightly decreased level at 4 hours post-radiation (CTM=18,5). (author)

  3. Characterization of DNA repair phenotypes of Xeroderma pigmentosum cell lines by a paralleled in vitro test; Phenotypage de la reparation de l'ADN de lignees Xeroderma pigmentosum, par un test in vitro multiparametrique

    Raffin, A.L.


    DNA is constantly damaged modifying the genetic information for which it encodes. Several cellular mechanisms as the Base Excision Repair (BER) and the Nucleotide Excision Repair (NER) allow recovering the right DNA sequence. The Xeroderma pigmentosum is a disease characterised by a deficiency in the NER pathway. The aim of this study was to propose an efficient and fast test for the diagnosis of this disease as an alternative to the currently available UDS test. DNA repair activities of XP cell lines were quantified using in vitro miniaturized and paralleled tests in order to establish DNA repair phenotypes of XPA and XPC deficient cells. The main advantage of the tests used in this study is the simultaneous measurement of excision or excision synthesis (ES) of several lesions by only one cellular extract. We showed on one hand that the relative ES of the different lesions depend strongly on the protein concentration of the nuclear extract tested. Working at high protein concentration allowed discriminating the XP phenotype versus the control one, whereas it was impossible under a certain concentration's threshold. On the other hand, while the UVB irradiation of control cells stimulated their repair activities, this effect was not observed in XP cells. This study brings new information on the XPA and XPC protein roles during BER and NER and underlines the complexity of the regulations of DNA repair processes. (author)

  4. Detecção do DNA do papilomavírus humano após excisão da zona de transformação com alça diatérmica para tratamento de neoplasia intra-epitelial cervical Human papillomavirus DNA detection after large loop excision of the transformation zone for the treatment of cervical intraepithelial neoplasia

    Priscila Garcia Figueirêdo


    Full Text Available OBJETIVO: avaliar a presença do DNA do papilomavírus humano (HPV de alto risco oncológico antes e quatro meses após excisão da zona de transformação com alça diatérmica em mulheres com neoplasia intra-epitelial cervical (NIC. MÉTODOS: neste estudo clínico prospectivo foram incluídas 78 mulheres submetidas à excisão da zona de transformação tratadas no período de fevereiro a dezembro de 2001. Todas foram submetidas a colposcopia, citologia oncológica e captura híbrida II (CH II antes da cirurgia e após 4±1,25 meses. Para análise estatística utilizou-se o cálculo do odds ratio (OR com intervalo de confiança de 95% (IC 95%. RESULTADOS: antes da excisão, 67 (86% mulheres apresentavam CH II positiva para DNA-HPV de alto risco oncológico e destas, apenas 22 (33% mantiveram a CH II positiva quatro meses após. A detecção do DNA-HPV após o tratamento não se relacionou com a carga viral prévia, presença de doença nas margens da peça cirúrgica ou idade da mulher. Após quatro meses, a detecção do DNA-HPV associou-se significativamente com a presença de alterações citológicas (OR = 4,8; IC 95% = 1,7-13,7, porém não se relacionou com doença residual ou recidiva histológica (OR = 6,0; IC 95% = 0,8-52,3. CONCLUSÃO: após o tratamento da NIC, a detecção do DNA-HPV diminuiu significativamente porém não se observou relação com a presença de doença residual ou recidiva histológica.PURPOSE: to evaluate the detection of high oncogenic risk human papillomavirus DNA (HPV-DNA immediately before and 4±1.25 months after large loop excision of the transformation zone (LLETZ in the treatment of cervical intraepithelial neoplasia (CIN. METHODS: in this clinical prospective study, 78 patients submitted to LLETZ from February to December 2001 were enrolled. All patients were submitted to colposcopic evaluation and had Pap smear and hybrid capture II (HC II specimens collected immediately before LLETZ and four months

  5. Main: Nucleotide Analysis [KOME

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result ...

  6. DNA repair: Dynamic defenders against cancer and aging

    Fuss, Jill O.; Cooper, Priscilla K.


    You probably weren't thinking about your body's cellular DNA repair systems the last time you sat on the beach in the bright sunshine. Fortunately, however, while you were subjecting your DNA to the harmful effects of ultraviolet light, your cells were busy repairing the damage. The idea that our genetic material could be damaged by the sun was not appreciated in the early days of molecular biology. When Watson and Crick discovered the structure of DNA in 1953 [1], it was assumed that DNA is fundamentally stable since it carries the blueprint of life. However, over 50 years of research have revealed that our DNA is under constant assault by sunlight, oxygen, radiation, various chemicals, and even our own cellular processes. Cleverly, evolution has provided our cells with a diverse set of tools to repair the damage that Mother Nature causes. DNA repair processes restore the normal nucleotide sequence and DNA structure of the genome after damage [2]. These responses are highly varied and exquisitely regulated. DNA repair mechanisms are traditionally characterized by the type of damage repaired. A large variety of chemical modifications can alter normal DNA bases and either lead to mutations or block transcription if not repaired, and three distinct pathways exist to remove base damage. Base excision repair (BER) corrects DNA base alterations that do not distort the overall structure of the DNA helix such as bases damaged by oxidation resulting from normal cellular metabolism. While BER removes single damaged bases, nucleotide excision repair (NER) removes short segments of nucleotides (called oligonucleotides) containing damaged bases. NER responds to any alteration that distorts the DNA helix and is the mechanism responsible for repairing bulky base damage caused by carcinogenic chemicals such as benzo [a]pyrene (found in cigarette smoke and automobile exhaust) as well as covalent linkages between adjacent pyrimidine bases resulting from the ultraviolet

  7. Human DNA repair and recombination genes

    Thompson, L.H.; Weber, C.A.; Jones, N.J.


    Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs

  8. Deficiency of gamma-ray excision repair in skin fibroblasts from patients with Fanconi's anemia

    Remsen, J.F.; Cerutti, P.A.


    The capacity of preparations of skin fibroblasts from normal individuals and patients with Fanconi's anemia to excise gamma-ray products of the 5,6-dihydroxydihydrothymine type from exogenous DNA was investigated. The excision capacity of whole-cell homogenates of fibroblasts from two of four patients with Fanconi's anemia was substantially below normal. This repair deficiency was further pronounced in nuclear preparations from cells of the same two patients

  9. Stripped-down DNA repair in a highly reduced parasite

    Fast Naomi M


    Full Text Available Abstract Background Encephalitozoon cuniculi is a member of a distinctive group of single-celled parasitic eukaryotes called microsporidia, which are closely related to fungi. Some of these organisms, including E. cuniculi, also have uniquely small genomes that are within the prokaryotic range. Thus, E. cuniculi has undergone a massive genome reduction which has resulted in a loss of genes from diverse biological pathways, including those that act in DNA repair. DNA repair is essential to any living cell. A loss of these mechanisms invariably results in accumulation of mutations and/or cell death. Six major pathways of DNA repair in eukaryotes include: non-homologous end joining (NHEJ, homologous recombination repair (HRR, mismatch repair (MMR, nucleotide excision repair (NER, base excision repair (BER and methyltransferase repair. DNA polymerases are also critical players in DNA repair processes. Given the close relationship between microsporidia and fungi, the repair mechanisms present in E. cuniculi were compared to those of the yeast Saccharomyces cerevisiae to ascertain how the process of genome reduction has affected the DNA repair pathways. Results E. cuniculi lacks 16 (plus another 6 potential absences of the 56 DNA repair genes sought via BLASTP and PSI-BLAST searches. Six of 14 DNA polymerases or polymerase subunits are also absent in E. cuniculi. All of these genes are relatively well conserved within eukaryotes. The absence of genes is not distributed equally among the different repair pathways; some pathways lack only one protein, while there is a striking absence of many proteins that are components of both double strand break repair pathways. All specialized repair polymerases are also absent. Conclusion Given the large number of DNA repair genes that are absent from the double strand break repair pathways, E. cuniculi is a prime candidate for the study of double strand break repair with minimal machinery. Strikingly, all of the

  10. Characterization of RAD4 gene required for ultraviolet-induced excision repair of Saccharomyces cerevisiae propagated in Escherichia coli without inactivation

    Choi, I.S.; Kim, J.B.; Lee, K.N.; Park, S.D.


    The previously isolated RAD4 gene designated as pPC1 from the genomic library of Saccharomyces cerevisiae appeared to propagate in Escherichia coli and yet retained its complementing activity of rad4 mutants without inactivation. The subcloned RAD4 gene was found to be localized within a 2.5 kb DNA fragment flanking Bg/II and BamHI sites in the insert DNA, and was shown to have the same restriction map as a yeast chromosomal DNA, as determined by Southern hybridization. Tetrad analysis and pulse-field chromosome mapping have revealed that the cloned RAD4 gene can be mapped and integrated into the yeast chromosome V, the actual site of this gene. DNA-tRNA hybridization has shown that the isolated RAD4 gene did not contain a suppressor tRNA gene. These results have indicated that the pPC1 is a functional RAD4 gene playing a unique role involved in the nucleotide excision repair of yeast without any genetic change during amplification in E. coli. (author)

  11. DNA homoduplexes containing no pyrimidine nucleotide

    Kypr, Jaroslav; Kejnovská, Iva; Vorlíčková, Michaela


    Roč. 32, č. 2 (2003), s. 154-158 ISSN 0175-7571 R&D Projects: GA ČR GA301/01/0590; GA AV ČR IAA4004201 Institutional research plan: CEZ:AV0Z5004920 Keywords : adenine * base pairing * circular dichroism spectroscopy Subject RIV: BO - Biophysics Impact factor: 1.769, year: 2003

  12. DNA damage mediated transcription arrest: Step back to go forward.

    Mullenders, Leon


    The disturbance of DNA helix conformation by bulky DNA damage poses hindrance to transcription elongating due to stalling of RNA polymerase at transcription blocking lesions. Stalling of RNA polymerase provokes the formation of R-loops, i.e. the formation of a DNA-RNA hybrid and a displaced single stranded DNA strand as well as displacement of spliceosomes. R-loops are processed into DNA single and double strand breaks by NER factors depending on TC-NER factors leading to genome instability. Moreover, stalling of RNA polymerase induces a strong signal for cell cycle arrest and apoptosis. These toxic and mutagenic effects are counteracted by a rapid recruitment of DNA repair proteins to perform transcription coupled nucleotide excision repair (TC-NER) to remove the blocking DNA lesions and to restore transcription. Recent studies have highlighted the role of backtracking of RNA polymerase to facilitate TC-NER and identified novel factors that play key roles in TC-NER and in restoration of transcription. On the molecular level these factors facilitate stability of the repair complex by promotion and regulation of various post-translational modifications of NER factors and chromatin substrate. In addition, the continuous flow of new factors that emerge from screening assays hints to several regulatory levels to safeguard the integrity of transcription elongation after disturbance by DNA damage that have yet to be explored. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Cloning human DNA repair genes

    Jeggo, P.A.; Carr, A.M.; Lehmann, A.R.


    Many human genes involved in the repair of UV damage have been cloned using different procedures and they have been of great value in assisting the understanding of the mechanism of nucleotide excision-repair. Genes involved in repair of ionizing radiation damage have proved more difficult to isolate. Positional cloning has localized the XRCC5 gene to a small region of chromosome 2q33-35, and a series of yeast artificial chromosomes covering this region have been isolated. Very recent work has shown that the XRCC5 gene encodes the 80 kDa subunit of the Ku DNA-binding protein. The Ku80 gene also maps to this region. Studies with fission yeast have shown that radiation sensitivity can result not only from defective DNA repair but also from abnormal cell cycle control following DNA damage. Several genes involved in this 'check-point' control in fission yeast have been isolated and characterized in detail. It is likely that a similar checkpoint control mechanism exists in human cells. (author)

  14. Cyclic nucleotides and radioresistnace

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.


    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  15. The cutting edges in DNA repair, licensing, and fidelity: DNA and RNA repair nucleases sculpt DNA to measure twice, cut once.

    Tsutakawa, Susan E; Lafrance-Vanasse, Julien; Tainer, John A


    To avoid genome instability, DNA repair nucleases must precisely target the correct damaged substrate before they are licensed to incise. Damage identification is a challenge for all DNA damage response proteins, but especially for nucleases that cut the DNA and necessarily create a cleaved DNA repair intermediate, likely more toxic than the initial damage. How do these enzymes achieve exquisite specificity without specific sequence recognition or, in some cases, without a non-canonical DNA nucleotide? Combined structural, biochemical, and biological analyses of repair nucleases are revealing their molecular tools for damage verification and safeguarding against inadvertent incision. Surprisingly, these enzymes also often act on RNA, which deserves more attention. Here, we review protein-DNA structures for nucleases involved in replication, base excision repair, mismatch repair, double strand break repair (DSBR), and telomere maintenance: apurinic/apyrimidinic endonuclease 1 (APE1), Endonuclease IV (Nfo), tyrosyl DNA phosphodiesterase (TDP2), UV Damage endonuclease (UVDE), very short patch repair endonuclease (Vsr), Endonuclease V (Nfi), Flap endonuclease 1 (FEN1), exonuclease 1 (Exo1), RNase T and Meiotic recombination 11 (Mre11). DNA and RNA structure-sensing nucleases are essential to life with roles in DNA replication, repair, and transcription. Increasingly these enzymes are employed as advanced tools for synthetic biology and as targets for cancer prognosis and interventions. Currently their structural biology is most fully illuminated for DNA repair, which is also essential to life. How DNA repair enzymes maintain genome fidelity is one of the DNA double helix secrets missed by James Watson and Francis Crick, that is only now being illuminated though structural biology and mutational analyses. Structures reveal motifs for repair nucleases and mechanisms whereby these enzymes follow the old carpenter adage: measure twice, cut once. Furthermore, to measure

  16. Guardians of the mycobacterial genome: A review on DNA repair systems in Mycobacterium tuberculosis.

    Singh, Amandeep


    The genomic integrity of Mycobacterium tuberculosis is continuously threatened by the harsh survival conditions inside host macrophages, due to immune and antibiotic stresses. Faithful genome maintenance and repair must be accomplished under stress for the bacillus to survive in the host, necessitating a robust DNA repair system. The importance of DNA repair systems in pathogenesis is well established. Previous examination of the M. tuberculosis genome revealed homologues of almost all the major DNA repair systems, i.e. nucleotide excision repair (NER), base excision repair (BER), homologous recombination (HR) and non-homologous end joining (NHEJ). However, recent developments in the field have pointed to the presence of novel proteins and pathways in mycobacteria. Homologues of archeal mismatch repair proteins were recently reported in mycobacteria, a pathway previously thought to be absent. RecBCD, the major nuclease-helicase enzymes involved in HR in E. coli, were implicated in the single-strand annealing (SSA) pathway. Novel roles of archeo-eukaryotic primase (AEP) polymerases, previously thought to be exclusive to NHEJ, have been reported in BER. Many new proteins with a probable role in DNA repair have also been discovered. It is now realized that the DNA repair systems in M. tuberculosis are highly evolved and have redundant backup mechanisms to mend the damage. This review is an attempt to summarize our current understanding of the DNA repair systems in M. tuberculosis.

  17. DNA repair systems and the pathogenesis of Mycobacterium tuberculosis: varying activities at different stages of infection.

    Gorna, Alina E; Bowater, Richard P; Dziadek, Jaroslaw


    Mycobacteria, including most of all MTB (Mycobacterium tuberculosis), cause pathogenic infections in humans and, during the infectious process, are exposed to a range of environmental insults, including the host's immune response. From the moment MTB is exhaled by infected individuals, through an active and latent phase in the body of the new host, until the time they reach the reactivation stage, MTB is exposed to many types of DNA-damaging agents. Like all cellular organisms, MTB has efficient DNA repair systems, and these are believed to play essential roles in mycobacterial pathogenesis. As different stages of infection have great variation in the conditions in which mycobacteria reside, it is possible that different repair systems are essential for progression to specific phases of infection. MTB possesses homologues of DNA repair systems that are found widely in other species of bacteria, such as nucleotide excision repair, base excision repair and repair by homologous recombination. MTB also possesses a system for non-homologous end-joining of DNA breaks, which appears to be widespread in prokaryotes, although its presence is sporadic within different species within a genus. However, MTB does not possess homologues of the typical mismatch repair system that is found in most bacteria. Recent studies have demonstrated that DNA repair genes are expressed differentially at each stage of infection. In the present review, we focus on different DNA repair systems from mycobacteria and identify questions that remain in our understanding of how these systems have an impact upon the infection processes of these important pathogens.

  18. The Impact of Hedgehog Signaling Pathway on DNA Repair Mechanisms in Human Cancer

    Meng, Erhong; Hanna, Ann; Samant, Rajeev S.; Shevde, Lalita A.


    Defined cellular mechanisms have evolved that recognize and repair DNA to protect the integrity of its structure and sequence when encountering assaults from endogenous and exogenous sources. There are five major DNA repair pathways: mismatch repair, nucleotide excision repair, direct repair, base excision repair and DNA double strand break repair (including non-homologous end joining and homologous recombination repair). Aberrant activation of the Hedgehog (Hh) signaling pathway is a feature of many cancer types. The Hh pathway has been documented to be indispensable for epithelial-mesenchymal transition, invasion and metastasis, cancer stemness, and chemoresistance. The functional transcription activators of the Hh pathway include the GLI proteins. Inhibition of the activity of GLI can interfere with almost all DNA repair types in human cancer, indicating that Hh/GLI functions may play an important role in enabling tumor cells to survive lethal types of DNA damage induced by chemotherapy and radiotherapy. Thus, Hh signaling presents an important therapeutic target to overcome DNA repair-enabled multi-drug resistance and consequently increase chemotherapeutic response in the treatment of cancer

  19. DNA Repair and Photoprotection: Mechanisms of Overcoming Environmental Ultraviolet Radiation Exposure in Halophilic Archaea.

    Jones, Daniel L; Baxter, Bonnie K


    Halophilic archaea push the limits of life at several extremes. In particular, they are noted for their biochemical strategies in dealing with osmotic stress, low water activity and cycles of desiccation in their hypersaline environments. Another feature common to their habitats is intense ultraviolet (UV) radiation, which is a challenge that microorganisms must overcome. The consequences of high UV exposure include DNA lesions arising directly from bond rearrangement of adjacent bipyrimidines, or indirectly from oxidative damage, which may ultimately result in mutation and cell death. As such, these microorganisms have evolved a number of strategies to navigate the threat of DNA damage, which we differentiate into two categories: DNA repair and photoprotection. Photoprotection encompasses damage avoidance strategies that serve as a "first line of defense," and in halophilic archaea include pigmentation by carotenoids, mechanisms of oxidative damage avoidance, polyploidy, and genomic signatures that make DNA less susceptible to photodamage. Photolesions that do arise are addressed by a number of DNA repair mechanisms that halophilic archaea efficiently utilize, which include photoreactivation, nucleotide excision repair, base excision repair, and homologous recombination. This review seeks to place DNA damage, repair, and photoprotection in the context of halophilic archaea and the solar radiation of their hypersaline environments. We also provide new insight into the breadth of strategies and how they may work together to produce remarkable UV-resistance for these microorganisms.

  20. The Impact of Hedgehog Signaling Pathway on DNA Repair Mechanisms in Human Cancer

    Meng, Erhong; Hanna, Ann; Samant, Rajeev S.; Shevde, Lalita A., E-mail: [Department of Pathology, Comprehensive Cancer Center, University of Alabama at Birmingham, WTI320D, 1824 6th Avenue South, Birmingham, AL 35233 (United States)


    Defined cellular mechanisms have evolved that recognize and repair DNA to protect the integrity of its structure and sequence when encountering assaults from endogenous and exogenous sources. There are five major DNA repair pathways: mismatch repair, nucleotide excision repair, direct repair, base excision repair and DNA double strand break repair (including non-homologous end joining and homologous recombination repair). Aberrant activation of the Hedgehog (Hh) signaling pathway is a feature of many cancer types. The Hh pathway has been documented to be indispensable for epithelial-mesenchymal transition, invasion and metastasis, cancer stemness, and chemoresistance. The functional transcription activators of the Hh pathway include the GLI proteins. Inhibition of the activity of GLI can interfere with almost all DNA repair types in human cancer, indicating that Hh/GLI functions may play an important role in enabling tumor cells to survive lethal types of DNA damage induced by chemotherapy and radiotherapy. Thus, Hh signaling presents an important therapeutic target to overcome DNA repair-enabled multi-drug resistance and consequently increase chemotherapeutic response in the treatment of cancer.

  1. DNA Repair and Photoprotection: Mechanisms of Overcoming Environmental Ultraviolet Radiation Exposure in Halophilic Archaea

    Daniel L. Jones


    Full Text Available Halophilic archaea push the limits of life at several extremes. In particular, they are noted for their biochemical strategies in dealing with osmotic stress, low water activity and cycles of desiccation in their hypersaline environments. Another feature common to their habitats is intense ultraviolet (UV radiation, which is a challenge that microorganisms must overcome. The consequences of high UV exposure include DNA lesions arising directly from bond rearrangement of adjacent bipyrimidines, or indirectly from oxidative damage, which may ultimately result in mutation and cell death. As such, these microorganisms have evolved a number of strategies to navigate the threat of DNA damage, which we differentiate into two categories: DNA repair and photoprotection. Photoprotection encompasses damage avoidance strategies that serve as a “first line of defense,” and in halophilic archaea include pigmentation by carotenoids, mechanisms of oxidative damage avoidance, polyploidy, and genomic signatures that make DNA less susceptible to photodamage. Photolesions that do arise are addressed by a number of DNA repair mechanisms that halophilic archaea efficiently utilize, which include photoreactivation, nucleotide excision repair, base excision repair, and homologous recombination. This review seeks to place DNA damage, repair, and photoprotection in the context of halophilic archaea and the solar radiation of their hypersaline environments. We also provide new insight into the breadth of strategies and how they may work together to produce remarkable UV-resistance for these microorganisms.

  2. Xeroderma pigmentosum and other diseases of human premature aging and DNA repair: Molecules to patients

    Niedernhofer, Laura J.; Bohr, Vilhelm A.; Sander, Miriam; Kraemer, Kenneth H.


    A workshop1 to share, consider and discuss the latest developments in understanding xeroderma pigmentosum and other human diseases caused by defects in nucleotide excision repair (NER) of DNA damage was held on September 21–24, 2010 in Virginia. It was attended by approximately 100 researchers and clinicians, as well as several patients and representatives of patient support groups. This was the third in a series of workshops with similar design and goals: to emphasize discussion and interaction among participants as well as open exchange of information and ideas. The participation of patients, their parents and physicians was an important feature of this and the preceding two workshops. Topics discussed included the natural history and clinical features of the diseases, clinical and laboratory diagnosis of these rare diseases, therapeutic strategies, mouse models of neurodegeneration, molecular analysis of accelerated aging, impact of transcriptional defects and mitochondrial dysfunction on neurodegeneration, and biochemical insights into mechanisms of NER and base excision repair. PMID:21708183

  3. Nucleotide Manipulatives to Illustrate the Central Dogma

    Sonja B. Yung; Todd P. Primm


    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  4. Nucleotide Manipulatives to Illustrate the Central Dogma

    Sonja B. Yung


    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  5. Feasibility study of transanal total mesorectal excision

    Velthuis, S.; Boezem, P.B. van den; Peet, D.L. van der; Cuesta, M.A.; Sietses, C.


    BACKGROUND: Laparoscopic resection of colorectal cancers is a safe alternative to open surgery. The conversion rate to open surgery remains fairly constant but is associated with increased morbidity. A new approach to the surgical excision of rectal cancer is transanal total mesorectal excision

  6. Repair of DNA damage induced by anthanthrene, a polycyclic aromatic hydrocarbon (PAH) without bay or fjord regions

    Madsen, Claus Desler; Johannessen, Christian; Rasmussen, Lene Juel


    Polycyclic aromatic hydrocarbons (PAHs) are environmental pollutants, formed during incomplete burning of coal, oil and gas. Several PAHs have carcinogenic and mutagenic potencies, but these compounds must be activated in order to exert their mutagenic effects. One of the principal pathways...... proposed for metabolic activation of PAHs involves the cytochrome P450 enzymes. The DNA damaging potential of cytochrome P450-activated PAHs is generally associated with their bay and fjord regions, and the DNA repair response of PAHs containing such regions has been thoroughly studied. However, little...... in response to DNA damage induced by cytochrome P450-activated anthanthrene. In cell extracts, functional nucleotide excision repair (NER) and mismatch repair (MMR) activities were necessary to trigger a response to anthanthrene metabolite-induced DNA damage. In cell cultures, NER was responsible...

  7. Single Nucleotide Polymorphisms in Noncoding Regions of Rad51C Do Not Change the Risk of Unselected Breast Cancer but They Modulate the Level of Oxidative Stress and the DNA Damage Characteristics

    Gresner, Peter; Gromadzinska, Jolanta; Jablonska, Ewa


    affect the unselected BrC risk. Contrary to this, carriers of rs12946522, rs16943176, rs12946397 and rs17222691 rare-alleles were found to present significantly increased level of blood plasma TBARS compared to respective wild-type homozygotes (p... decreased fraction of oxidatively generated DNA damage (34% of total damaged DNA) in favor of DNA strand breakage, with no effect on total DNA damage, unlike respective wild-types, among which more evenly distributed proportions between oxidatively damaged DNA (48% of total DNA damage) and DNA strand...

  8. Pyrimidine dimer excision in human cells and skin cancer

    Regan, J.D.; Carrier, W.L.; Smith, D.P.; Waters, R.


    We have compared three different methods for estimating the induction and removal of uv induced pyrimidine dimers from the DNA of human fibroblasts. Results indicate that after uv doses of 5-20 J/m 2 50% of the dimers are removed by 24 hours after irradiation. Almost complete excision can be observed if the cells are incubated for periods not less than 72 hours after 5 J/m 2 . After higher doses it probably takes even longer fr such complete removal to be seen

  9. Repair Mechanism of UV-damaged DNA in Xeroderma Pigmentosum | Center for Cancer Research

    Xeroderma pigmentosum (XP) is a rare, inherited disorder characterized by extreme skin sensitivity to ultraviolet (UV) rays from sunlight. XP is caused by mutations in genes involved in nucleotide excision repair (NER) of damaged DNA. Normal cells are usually able to fix this damage before it leads to problems; however, the DNA damage is not repaired normally in patients with XP. As more abnormalities form in DNA, cells malfunction and eventually become cancerous or die. XP patients have more than a 10,000-fold increased risk of developing skin cancer. Kenneth Kraemer, M.D., in CCR’s Dermatology Branch, has been studying XP patients at the Clinical Center for more than 40 years.

  10. The arabidopsis cyclic nucleotide interactome

    Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A


    Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

  11. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A


    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  12. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  13. An Analysis of Enzyme Kinetics Data for Mitochondrial DNA Strand Termination by Nucleoside Reverse Transcription Inhibitors

    Wendelsdorf, Katherine V.; Song, Zhuo; Cao, Yang; Samuels, David C.


    Nucleoside analogs used in antiretroviral treatment have been associated with mitochondrial toxicity. The polymerase-γ hypothesis states that this toxicity stems from the analogs' inhibition of the mitochondrial DNA polymerase (polymerase-γ) leading to mitochondrial DNA (mtDNA) depletion. We have constructed a computational model of the interaction of polymerase-γ with activated nucleoside and nucleotide analog drugs, based on experimentally measured reaction rates and base excision rates, together with the mtDNA genome size, the human mtDNA sequence, and mitochondrial dNTP concentrations. The model predicts an approximately 1000-fold difference in the activated drug concentration required for a 50% probability of mtDNA strand termination between the activated di-deoxy analogs d4T, ddC, and ddI (activated to ddA) and the activated forms of the analogs 3TC, TDF, AZT, FTC, and ABC. These predictions are supported by experimental and clinical data showing significantly greater mtDNA depletion in cell culture and patient samples caused by the di-deoxy analog drugs. For zidovudine (AZT) we calculated a very low mtDNA replication termination probability, in contrast to its reported mitochondrial toxicity in vitro and clinically. Therefore AZT mitochondrial toxicity is likely due to a mechanism that does not involve strand termination of mtDNA replication. PMID:19132079

  14. DNA repair in neurons: So if they don't divide what's to repair?

    Fishel, Melissa L.; Vasko, Michael R.; Kelley, Mark R.


    Neuronal DNA repair remains one of the most exciting areas for investigation, particularly as a means to compare the DNA repair response in mitotic (cancer) vs. post-mitotic (neuronal) cells. In addition, the role of DNA repair in neuronal cell survival and response to aging and environmental insults is of particular interest. DNA damage caused by reactive oxygen species (ROS) such as generated by mitochondrial respiration includes altered bases, abasic sites, and single- and double-strand breaks which can be prevented by the DNA base excision repair (BER) pathway. Oxidative stress accumulates in the DNA of the human brain over time especially in the mitochondrial DNA (mtDNA) and is proposed to play a critical role in aging and in the pathogenesis of several neurological disorders including Parkinson's disease, ALS, and Alzheimer's diseases. Because DNA damage accumulates in the mtDNA more than nuclear DNA, there is increased interest in DNA repair pathways and the consequence of DNA damage in the mitochondria of neurons. The type of damage that is most likely to occur in neuronal cells is oxidative DNA damage which is primarily removed by the BER pathway. Following the notion that the bulk of neuronal DNA damage is acquired by oxidative DNA damage and ROS, the BER pathway is a likely area of focus for neuronal studies of DNA repair. BER variations in brain aging and pathology in various brain regions and tissues are presented. Therefore, the BER pathway is discussed in greater detail in this review than other repair pathways. Other repair pathways including direct reversal, nucleotide excision repair (NER), mismatch repair (MMR), homologous recombination and non-homologous end joining are also discussed. Finally, there is a growing interest in the role that DNA repair pathways play in the clinical arena as they relate to the neurotoxicity and neuropathy associated with cancer treatments. Among the numerous side effects of cancer treatments, major clinical effects

  15. Coordinating repair of oxidative DNA damage with transcription and replication

    Cooper, P.K.


    Transcription-coupled repair (TCR) preferentially removes DNA lesions from template strands of active genes. Defects in TCR, which acts both on lesions removed by nucleotide excision repair (NER) and on oxidative lesions removed by base excision repair (BER), underlie the fatal developmental disorder Cockayne syndrome. Although its detailed mechanism remains unknown, TCR involves recognition of a stalled RNA polymerase (RNAP), removal or remodeling of RNAP to allow access to the lesion, and recruitment of repair enzymes. At a minimum, these early steps require a non-enzymatic function of the multifunctional repair protein XPG, the CSB protein with ATP-dependent chromatin remodeling activity, and the TFIIH complex (including the XPB and XPD helicases) that is also required for basal transcription initiation and NER. XPG exists in the cell in a complex with TFIIH, and in vitro evidence has suggested that it interacts with CSB. To address the mechanism of TCR, we are characterizing protein-DNA and protein-protein interactions of XPG. We show that XPG preferentially binds to double-stranded DNA containing bubbles resembling in size the unpaired regions associated with transcription. Two distinct domains of XPG are required for the observed strong binding specificity and stability. XPG both interacts directly with CSB and synergistically binds with it to bubble DNA, and it strongly stimulates the bubble DNA-dependent ATPase activity of CSB. Significantly for TCR, XPG also interacts directly with RNAP II, binds both the protein and nucleic acid components (the R-loop) of a stalled RNA polymerase, and forms a ternary complex with CSB and the stalled RNAP. These results are consistent with the model that XPG and CSB jointly interact with the DNA/chromatin structure in the vicinity of the stalled transcriptional apparatus and with the transcriptional machinery itself to remodel the chromatin and either move or remodel the blocked RNA polymerase to expose the lesion

  16. Decreased cell survival and DNA repair capacity after UVC irradiation in association with down-regulation of GRP78/BiP in human RSa cells

    Zhai Ling; Kita, Kazuko; Wano, Chieko; Wu Yuping; Sugaya, Shigeru; Suzuki, Nobuo


    In contrast to extensive studies on the roles of molecular chaperones, such as heat shock proteins, there are only a few reports about the roles of GRP78/BiP, an endoplasmic reticulum (ER) stress-induced molecular chaperone, in mammalian cell responses to DNA-damaging stresses. To investigate whether GRP78/BiP is involved in resistance to a DNA-damaging agent, UVC (principally 254 nm in wavelength), we established human cells with down-regulation of GRP78/BiP by transfection of human RSa cells with antisense cDNA for GRP78/BiP. We found that the transfected cells showed higher sensitivity to UVC-induced cell death than control cells transfected with the vector alone. In the antisense-cDNA transfected cells, the removal capacities of the two major types of UVC-damaged DNA (thymine dimers and (6-4) photoproducts) in vivo and DNA synthesis activity of whole cell extracts to repair UVC-irradiated plasmids in vitro were remarkably decreased compared with those in the control cells. Furthermore, the antisense-cDNA transfected cells also showed slightly higher sensitivity to cisplatin-induced cell death than the control cells. Cisplatin-induced DNA damage is primarily repaired by nucleotide excision repair, like UVC-induced DNA damage. The present results suggest that GRP78/BiP plays a protective role against UVC-induced cell death possibly via nucleotide excision repair, at least in the human RSa cells tested

  17. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Le Gall, O; Candresse, T; Brault, V; Dunez, J


    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  18. X-ray repair cross complementing protein 1 in base excision repair

    Hanssen-Bauer, Audun; Solvang-Garten, Karin; Akbari, Mansour


    X-ray Repair Cross Complementing protein 1 (XRCC1) acts as a scaffolding protein in the converging base excision repair (BER) and single strand break repair (SSBR) pathways. XRCC1 also interacts with itself and rapidly accumulates at sites of DNA damage. XRCC1 can thus mediate the assembly of large...

  19. Structure determination of uracil-DNA N-glycosylase from Deinococcus radiodurans in complex with DNA.

    Pedersen, Hege Lynum; Johnson, Kenneth A; McVey, Colin E; Leiros, Ingar; Moe, Elin


    Uracil-DNA N-glycosylase (UNG) is a DNA-repair enzyme in the base-excision repair (BER) pathway which removes uracil from DNA. Here, the crystal structure of UNG from the extremophilic bacterium Deinococcus radiodurans (DrUNG) in complex with DNA is reported at a resolution of 1.35 Å. Prior to the crystallization experiments, the affinity between DrUNG and different DNA oligonucleotides was tested by electrophoretic mobility shift assays (EMSAs). As a result of this analysis, two 16 nt double-stranded DNAs were chosen for the co-crystallization experiments, one of which (16 nt AU) resulted in well diffracting crystals. The DNA in the co-crystal structure contained an abasic site (substrate product) flipped into the active site of the enzyme, with no uracil in the active-site pocket. Despite the high resolution, it was not possible to fit all of the terminal nucleotides of the DNA complex into electron density owing to disorder caused by a lack of stabilizing interactions. However, the DNA which was in contact with the enzyme, close to the active site, was well ordered and allowed detailed analysis of the enzyme-DNA interaction. The complex revealed that the interaction between DrUNG and DNA is similar to that in the previously determined crystal structure of human UNG (hUNG) in complex with DNA [Slupphaug et al. (1996). Nature (London), 384, 87-92]. Substitutions in a (here defined) variable part of the leucine loop result in a shorter loop (eight residues instead of nine) in DrUNG compared with hUNG; regardless of this, it seems to fulfil its role and generate a stabilizing force with the minor groove upon flipping out of the damaged base into the active site. The structure also provides a rationale for the previously observed high catalytic efficiency of DrUNG caused by high substrate affinity by demonstrating an increased number of long-range electrostatic interactions between the enzyme and the DNA. Interestingly, specific interactions between residues

  20. A novel role for Gadd45α in base excision repair: Modulation of APE1 activity by the direct interaction of Gadd45α with PCNA

    Kim, Hye Lim; Kim, Sang Uk; Seo, Young Rok


    Highlights: ► Emerging critical role for Gadd45α in modulating BER activity. ► Identifying specific PCNA binding site on Gadd45α protein. ► Regulating APE1 activity through interaction between Gadd45α and PCNA. ► Suggesting potential role of Gadd45α–PCNA binding in pancreatic carcinogenesis. -- Abstract: The growth arrest and DNA damage inducible, alpha (Gadd45α) protein regulates DNA repair by interacting with proliferating cell nuclear antigen (PCNA). Our previous study suggested a potential role for Gadd45α in the base excision repair (BER) pathway by affecting apurinic/apyrimidinic endonuclease 1 (APE1) protein in addition to its accepted role in nucleotide excision repair (NER). Here, we investigated whether the interaction of Gadd45α with PCNA affects APE1 activity. To address this issue, we used a siRNA directed to Gadd45α and a form of Gadd45α with a mutation to the predicted site of PCNA binding. There was a reduction of APE1 activity in cells transfected with the Gadd45α siRNA. Furthermore, the interaction of Gadd45α with PCNA and APE1 was lower in cells transfected with mutant Gadd45α compared with cells transfected with wild-type Gadd45α. Indeed, we observed that the APE1 activity in the Gadd45α-interacting complex was significantly lower in cells that overexpress mutant Gadd45α compared with cells that overexpress wild-type Gadd45α. We conclude that the PCNA binding site on Gadd45α plays a critical role in modulating the interaction with PCNA and APE1, affecting BER activity. These results provide novel insights into the mechanisms by which BER activity is modulated, although the interaction of Gadd45α with APE1 needs to be clarified