WorldWideScience

Sample records for dna minor groove

  1. DNA minor groove alkylating agents.

    Science.gov (United States)

    Denny, W A

    2001-04-01

    Recent work on a number of different classes of anticancer agents that alkylate DNA in the minor groove is reviewed. There has been much work with nitrogen mustards, where attachment of the mustard unit to carrier molecules can change the normal patterns of both regio- and sequence-selectivity, from reaction primarily at most guanine N7 sites in the major groove to a few adenine N3 sites at the 3'-end of poly(A/T) sequences in the minor groove. Carrier molecules discussed for mustards are intercalators, polypyrroles, polyimidazoles, bis(benzimidazoles), polybenzamides and anilinoquinolinium salts. In contrast, similar targeting of pyrrolizidine alkylators by a variety of carriers has little effect of their patterns of alkylation (at the 2-amino group of guanine). Recent work on the pyrrolobenzodiazepine and cyclopropaindolone classes of natural product minor groove binders is also reviewed.

  2. Trabectedin – the DNA minor groove binder

    Directory of Open Access Journals (Sweden)

    G. A. Belitsky

    2015-01-01

    Full Text Available Trabectedin (ET-743, Yondelis is an alkaloid that was originally isolated from the Caribbean Sea squirt, Ecteinascidia turbinata and is now produced synthetically. Its chemical structure consists in three fused tetrahydroisoquinoline rings. Two of them, A and B, binds covalently to guanine residues in the minor groove of the DNA double helix to bend the molecule toward the major groove and the third ring C protrudes from the DNA duplex, apparently allowing interactions with several nuclear proteins. Binding to the minor groove of DNA, trabectedin trigger a cascade of events that interfere with several transcription factors, DNA binding proteins, and DNA repair pathways in particular nucleotide excision repair. It acts both as a DNA-alkylating drug and topoisomerase poison. Trabectedin-DNA adduct traps the nucleotide excision repair proteins repairing the DNA damage in transcribing genes and induces DNA strand breaks. Cells deficient in homologous recombination pathway which repairs these double-strand breaks show increased sensitivity to trabectedin. The most sensitive of them were myxoid liposarcomas. Trabectedin is also effective in chemotherapy-experienced patients with advanced, recurrent liposarcoma or leiomyosarcoma as well as in women with ovarian cancer and breast cancer with BRCAness phenotype. Besides of tumor cells Trabectedin inhibits inflammatory cells by affecting directly monocytes and tumorassociated macrophages and indirectly by inhibiting production of inflammatory mediators, the cytokines and chemokines. It inhibits also the MDR-1 gene, which is responsible for the resistance of cancer cells to chemotherapeutic agents and strikes tumor angiogenesis.

  3. Synthesis and characterization of DNA minor groove binding alkylating agents.

    Science.gov (United States)

    Iyer, Prema; Srinivasan, Ajay; Singh, Sreelekha K; Mascara, Gerard P; Zayitova, Sevara; Sidone, Brian; Fouquerel, Elise; Svilar, David; Sobol, Robert W; Bobola, Michael S; Silber, John R; Gold, Barry

    2013-01-18

    Derivatives of methyl 3-(1-methyl-5-(1-methyl-5-(propylcarbamoyl)-1H-pyrrol-3-ylcarbamoyl)-1H-pyrrol-3-ylamino)-3-oxopropane-1-sulfonate (1), a peptide-based DNA minor groove binding methylating agent, were synthesized and characterized. In all cases, the N-terminus was appended with an O-methyl sulfonate ester, while the C-terminus group was varied with nonpolar and polar side chains. In addition, the number of pyrrole rings was varied from 2 (dipeptide) to 3 (tripeptide). The ability of the different analogues to efficiently generate N3-methyladenine was demonstrated as was their selectivity for minor groove (N3-methyladenine) versus major groove (N7-methylguanine) methylation. Induced circular dichroism studies were used to measure the DNA equilibrium binding properties of the stable sulfone analogues; the tripeptide binds with affinity that is >10-fold higher than that of the dipeptide. The toxicities of the compounds were evaluated in alkA/tag glycosylase mutant E. coli and in human WT glioma cells and in cells overexpressing and under-expressing N-methylpurine-DNA glycosylase, which excises N3-methyladenine from DNA. The results show that equilibrium binding correlates with the levels of N3-methyladenine produced and cellular toxicity. The toxicity of 1 was inversely related to the expression of MPG in both the bacterial and mammalian cell lines. The enhanced toxicity parallels the reduced activation of PARP and the diminished rate of formation of aldehyde reactive sites observed in the MPG knockdown cells. It is proposed that unrepaired N3-methyladenine is toxic due to its ability to directly block DNA polymerization.

  4. Sequence specificity and biological consequences of drugs that bind covalently in the minor groove of DNA

    International Nuclear Information System (INIS)

    Hurley, L.H.; Needham-VanDevanter, D.R.

    1986-01-01

    DNA ligands which bind within the minor groove of DNA exhibit varying degrees of sequence selectivity. Factors which contribute to nucleotide sequence recognition by minor groove ligands have been extensively investigated. Electrostatic interactions, ligand and DNA dehydration energies, hydrophobic interactions and steric factors all play significant roles in sequence selectivity in the minor groove. Interestingly, ligand recognition of nucleotide sequence in the minor groove does not involve significant hydrogen bonding. This is in sharp contrast to cellular enzyme and protein recognition of nucleotide sequence, which is achieved in the major groove via specific hydrogen bond formation between individual bases and the ligand. The ability to read nucleotide sequence via hydrogen bonding allows precise binding of proteins to specific DNA sequences. Minor groove ligands examined to date exhibit a much lower sequence specificity, generally binding to a subset of possible sequences, rather than a single sequence. 19 refs., 7 figs

  5. NMR studies of DNA oligomers and their interactions with minor groove binding ligands

    Energy Technology Data Exchange (ETDEWEB)

    Fagan, Patricia A. [Univ. of California, Berkeley, CA (United States). Dept. of Chemistry

    1996-05-01

    The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1 ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.

  6. DNA minor groove binding of small molecules: Experimental and ...

    Indian Academy of Sciences (India)

    Administrator

    Abstract. Eight indole derivatives were studied for their DNA binding ability using fluorescence quenching and molecular docking methods. These indole compounds have structural moieties similar as in few indole alkaloids. Experimental and theoretical studies have suggested that indole derivatives bind in the minor ...

  7. Role of minor groove width and hydration pattern on amsacrine interaction with DNA.

    Directory of Open Access Journals (Sweden)

    Deepak K Jangir

    Full Text Available Amsacrine is an anilinoacridine derivative anticancer drug, used to treat a wide variety of malignancies. In cells, amsacrine poisons topoisomerase 2 by stabilizing DNA-drug-enzyme ternary complex. Presence of amsacrine increases the steady-state concentration of these ternary complexes which in turn hampers DNA replication and results in subsequent cell death. Due to reversible binding and rapid slip-out of amsacrine from DNA duplex, structural data is not available on amsacrine-DNA complexes. In the present work, we designed five oligonucleotide duplexes, differing in their minor groove widths and hydration pattern, and examined their binding with amsacrine using attenuated total reflection Fourier transform infrared (ATR-FTIR spectroscopy. Complexes of amsacrine with calf thymus DNA were also evaluated for a comparison. Our results demonstrate for the first time that amsacrine is not a simple intercalator; rather mixed type of DNA binding (intercalation and minor groove takes place between amsacrine and DNA. Further, this binding is highly sensitive towards the geometries and hydration patterns of different minor grooves present in the DNA. This study shows that ligand binding to DNA could be very sensitive to DNA base composition and DNA groove structures. Results demonstrated here could have implication for understanding cytotoxic mechanism of aminoacridine based anticancer drugs and provide directions to modify these drugs for better efficacy and few side-effects.

  8. DNA minor groove electrostatic potential: influence of sequence-specific transitions of the torsion angle gamma and deoxyribose conformations.

    Science.gov (United States)

    Zhitnikova, M Y; Shestopalova, A V

    2017-11-01

    The structural adjustments of the sugar-phosphate DNA backbone (switching of the γ angle (O5'-C5'-C4'-C3') from canonical to alternative conformations and/or C2'-endo → C3'-endo transition of deoxyribose) lead to the sequence-specific changes in accessible surface area of both polar and non-polar atoms of the grooves and the polar/hydrophobic profile of the latter ones. The distribution of the minor groove electrostatic potential is likely to be changing as a result of such conformational rearrangements in sugar-phosphate DNA backbone. Our analysis of the crystal structures of the short free DNA fragments and calculation of their electrostatic potentials allowed us to determine: (1) the number of classical and alternative γ angle conformations in the free B-DNA; (2) changes in the minor groove electrostatic potential, depending on the conformation of the sugar-phosphate DNA backbone; (3) the effect of the DNA sequence on the minor groove electrostatic potential. We have demonstrated that the structural adjustments of the DNA double helix (the conformations of the sugar-phosphate backbone and the minor groove dimensions) induce changes in the distribution of the minor groove electrostatic potential and are sequence-specific. Therefore, these features of the minor groove sizes and distribution of minor groove electrostatic potential can be used as a signal for recognition of the target DNA sequence by protein in the implementation of the indirect readout mechanism.

  9. Protein and Drug Interactions in the Minor Groove of DNA

    Czech Academy of Sciences Publication Activity Database

    Morávek, Z.; Neidle, S.; Schneider, Bohdan

    2002-01-01

    Roč. 30, č. 5 (2002), s. 1182-1191 ISSN 0305-1048 R&D Projects: GA MŠk LN00A032 Institutional research plan: CEZ:AV0Z4040901 Keywords : protein * DNA * interactions Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 7.051, year: 2002

  10. Binding to the DNA Minor Groove by Heterocyclic Dications: From AT Specific Monomers to GC Recognition with Dimers

    Science.gov (United States)

    Nanjunda, Rupesh; Wilson, W. David

    2012-01-01

    Compounds that bind in the DNA minor groove have provided critical information on DNA molecular recognition, they have found extensive uses in biotechnology and they are providing clinically useful drugs against diseases as diverse as cancer and sleeping sickness. This review focuses on the development of clinically useful heterocyclic diamidine minor groove binders. These compounds have shown us that the classical model for minor groove binding in AT DNA sequences must be expanded in several ways: compounds with nonstandard shapes can bind strongly to the groove, water can be directly incorporated into the minor groove complex in an interfacial interaction, and the compounds can form cooperative stacked dimers to recognize GC and mixed AT/GC base pair sequences. PMID:23255206

  11. In and out of the minor groove: interaction of an AT-rich DNA with the drug CD27

    Energy Technology Data Exchange (ETDEWEB)

    Acosta-Reyes, Francisco J. [Universitat Politécnica de Catalunya, Diagonal 647, 08028 Barcelona (Spain); Dardonville, Christophe [Instituto de Química Médica, IQM–CSIC, Juan de la Cierva 3, 28006 Madrid (Spain); Koning, Harry P. de; Natto, Manal [University of Glasgow, 120 University Place, Glasgow G12 8TA, Scotland (United Kingdom); Subirana, Juan A.; Campos, J. Lourdes, E-mail: lourdes.campos@upc.edu [Universitat Politécnica de Catalunya, Diagonal 647, 08028 Barcelona (Spain)

    2014-06-01

    New features of an antiprotozoal DNA minor-groove binding drug, which acts as a cross-linking agent, are presented. It also fills the minor groove of DNA completely and prevents the access of proteins. These features are also expected for other minor-groove binding drugs when associated with suitable DNA targets. The DNA of several pathogens is very rich in AT base pairs. Typical examples include the malaria parasite Plasmodium falciparum and the causative agents of trichomoniasis and trypanosomiases. This fact has prompted studies of drugs which interact with the minor groove of DNA, some of which are used in medical practice. Previous studies have been performed almost exclusively with the AATT sequence. New features should be uncovered through the study of different DNA sequences. In this paper, the crystal structure of the complex of the DNA duplex d(AAAATTTT){sub 2} with the dicationic drug 4, 4′-bis(imidazolinylamino)diphenylamine (CD27) is presented. The drug binds to the minor groove of DNA as expected, but it shows two new features that have not previously been described: (i) the drugs protrude from the DNA and interact with neighbouring molecules, so that they may act as cross-linking agents, and (ii) the drugs completely cover the whole minor groove of DNA and displace bound water. Thus, they may prevent the access to DNA of proteins such as AT-hook proteins. These features are also expected for other minor-groove binding drugs when associated with all-AT DNA. These findings allow a better understanding of this family of compounds and will help in the development of new, more effective drugs. New data on the biological interaction of CD27 with the causative agent of trichomoniasis, Trichomonas vaginalis, are also reported.

  12. In and out of the minor groove: interaction of an AT-rich DNA with the drug CD27

    International Nuclear Information System (INIS)

    Acosta-Reyes, Francisco J.; Dardonville, Christophe; Koning, Harry P. de; Natto, Manal; Subirana, Juan A.; Campos, J. Lourdes

    2014-01-01

    New features of an antiprotozoal DNA minor-groove binding drug, which acts as a cross-linking agent, are presented. It also fills the minor groove of DNA completely and prevents the access of proteins. These features are also expected for other minor-groove binding drugs when associated with suitable DNA targets. The DNA of several pathogens is very rich in AT base pairs. Typical examples include the malaria parasite Plasmodium falciparum and the causative agents of trichomoniasis and trypanosomiases. This fact has prompted studies of drugs which interact with the minor groove of DNA, some of which are used in medical practice. Previous studies have been performed almost exclusively with the AATT sequence. New features should be uncovered through the study of different DNA sequences. In this paper, the crystal structure of the complex of the DNA duplex d(AAAATTTT) 2 with the dicationic drug 4, 4′-bis(imidazolinylamino)diphenylamine (CD27) is presented. The drug binds to the minor groove of DNA as expected, but it shows two new features that have not previously been described: (i) the drugs protrude from the DNA and interact with neighbouring molecules, so that they may act as cross-linking agents, and (ii) the drugs completely cover the whole minor groove of DNA and displace bound water. Thus, they may prevent the access to DNA of proteins such as AT-hook proteins. These features are also expected for other minor-groove binding drugs when associated with all-AT DNA. These findings allow a better understanding of this family of compounds and will help in the development of new, more effective drugs. New data on the biological interaction of CD27 with the causative agent of trichomoniasis, Trichomonas vaginalis, are also reported

  13. Unexpected DNA affinity and sequence selectivity through core rigidity in guanidinium-based minor groove binders.

    Science.gov (United States)

    Nagle, Padraic S; McKeever, Caitriona; Rodriguez, Fernando; Nguyen, Binh; Wilson, W David; Rozas, Isabel

    2014-09-25

    In this paper we report the design and biophysical evaluation of novel rigid-core symmetric and asymmetric dicationic DNA binders containing 9H-fluorene and 9,10-dihydroanthracene cores as well as the synthesis of one of these fluorene derivatives. First, the affinity toward particular DNA sequences of these compounds and flexible core derivatives was evaluated by means of surface plasmon resonance and thermal denaturation experiments finding that the position of the cations significantly influence the binding strength. Then their affinity and mode of binding were further studied by performing circular dichroism and UV studies and the results obtained were rationalized by means of DFT calculations. We found that the fluorene derivatives prepared have the ability to bind to the minor groove of certain DNA sequences and intercalate to others, whereas the dihydroanthracene compounds bind via intercalation to all the DNA sequences studied here.

  14. Configurational entropy change of netropsin and distamycin upon DNA minor-groove binding.

    Science.gov (United States)

    Dolenc, Jozica; Baron, Riccardo; Oostenbrink, Chris; Koller, Joze; van Gunsteren, Wilfred F

    2006-08-15

    Binding of a small molecule to a macromolecular target reduces its conformational freedom, resulting in a negative entropy change that opposes the binding. The goal of this study is to estimate the configurational entropy change of two minor-groove-binding ligands, netropsin and distamycin, upon binding to the DNA duplex d(CGCGAAAAACGCG).d(CGCGTTTTTCGCG). Configurational entropy upper bounds based on 10-ns molecular dynamics simulations of netropsin and distamycin in solution and in complex with DNA in solution were estimated using the covariance matrix of atom-positional fluctuations. The results suggest that netropsin and distamycin lose a significant amount of configurational entropy upon binding to the DNA minor groove. The estimated changes in configurational entropy for netropsin and distamycin are -127 J K(-1) mol(-1) and -104 J K(-1) mol(-1), respectively. Estimates of the configurational entropy contributions of parts of the ligands are presented, showing that the loss of configurational entropy is comparatively more pronounced for the flexible tails than for the relatively rigid central body.

  15. Origin of DNA-Induced Circular Dichroism in a Minor-Groove Binder.

    Science.gov (United States)

    Holmgaard List, Nanna; Knoops, Jérémie; Rubio-Magnieto, Jenifer; Idé, Julien; Beljonne, David; Norman, Patrick; Surin, Mathieu; Linares, Mathieu

    2017-10-25

    Induced circular dichroism (ICD) of DNA-binding ligands is well known to be strongly influenced by the specific mode of binding, but the relative importance of the possible mechanisms has remained undetermined. With a combination of molecular dynamics simulations, CD response calculations, and experiments on an AT-sequence, we show that the ICD of minor-groove-bound 4',6-diamidino-2-phenylindole (DAPI) originates from an intricate interplay between the chiral imprint of DNA, off-resonant excitonic coupling to nucleobases, charge-transfer, and resonant excitonic coupling between DAPIs. The significant contributions from charge-transfer and the chiral imprint to the ICD demonstrate the inadequacy of a standard Frenkel exciton theory of the DAPI-DNA interactions.

  16. Imidazopyridine/Pyrrole and hydroxybenzimidazole/pyrrole pairs for DNA minor groove recognition.

    Science.gov (United States)

    Renneberg, Dorte; Dervan, Peter B

    2003-05-14

    The DNA binding properties of fused heterocycles imidazo[4,5-b]pyridine (Ip) and hydroxybenzimidazole (Hz) paired with pyrrole (Py) in eight-ring hairpin polyamides are reported. The recognition profile of Ip/Py and Hz/Py pairs were compared to the five-membered ring pairs Im/Py and Hp/Py on a DNA restriction fragment at four 6-base pair recognition sites which vary at a single position 5'-TGTNTA-3', where N = G, C, T, A. The Ip/Py pair distinguishes G.C from C.G, T.A, and A.T, and the Hz/Py pair distinguishes T.A from A.T, G.C, and C.G, affording a new set of heterocycle pairs to target the four Watson-Crick base pairs in the minor groove of DNA.

  17. Binding to the minor groove of the double-strand, tau protein prevents DNA from damage by peroxidation.

    Science.gov (United States)

    Wei, Yan; Qu, Mei-Hua; Wang, Xing-Sheng; Chen, Lan; Wang, Dong-Liang; Liu, Ying; Hua, Qian; He, Rong-Qiao

    2008-07-02

    Tau, an important microtubule associated protein, has been found to bind to DNA, and to be localized in the nuclei of both neurons and some non-neuronal cells. Here, using electrophoretic mobility shifting assay (EMSA) in the presence of DNA with different chain-lengths, we observed that tau protein favored binding to a 13 bp or a longer polynucleotide. The results from atomic force microscopy also showed that tau protein preferred a 13 bp polynucleotide to a 12 bp or shorter polynucleotide. In a competitive assay, a minor groove binder distamycin A was able to replace the bound tau from the DNA double helix, indicating that tau protein binds to the minor groove. Tau protein was able to protect the double-strand from digestion in the presence of DNase I that was bound to the minor groove. On the other hand, a major groove binder methyl green as a negative competitor exhibited little effect on the retardation of tau-DNA complex in EMSA. This further indicates the DNA minor groove as the binding site for tau protein. EMSA with truncated tau proteins showed that both the proline-rich domain (PRD) and the microtubule-binding domain (MTBD) contributed to the interaction with DNA; that is to say, both PRD and MTBD bound to the minor groove of DNA and bent the double-strand, as observed by electron microscopy. To investigate whether tau protein is able to prevent DNA from the impairment by hydroxyl free radical, the chemiluminescence emitted by the phen-Cu/H(2)O(2)/ascorbate was measured. The emission intensity of the luminescence was markedly decreased when tau protein was present, suggesting a significant protection of DNA from the damage in the presence of hydroxyl free radical.

  18. A monofunctional platinum complex coordinated to a rhodium metalloinsertor selectively binds mismatched DNA in the minor groove.

    Science.gov (United States)

    Weidmann, Alyson G; Barton, Jacqueline K

    2015-10-05

    We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh-O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA nonclassically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and it triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors.

  19. Resistance to minor groove binders.

    Science.gov (United States)

    Colmegna, Benedetta; Uboldi, Sarah; Erba, Eugenio; D'Incalci, Maurizio

    2014-03-01

    In this paper multiple resistance mechanisms to minor groove binders (MGBs) are overviewed. MGBs with antitumor properties are natural products or their derivatives and, as expected, they are all substrates of P-glycoprotein (P-gp). However, a moderate expression of P-gp does not appear to reduce the sensitivity to trabectedin, the only MGB so far approved for clinical use. Resistance to this drug is often related to transcriptional mechanisms and to DNA repair pathways, particularly defects in transcription-coupled nucleotide excision repair (TC-NER). Therefore tumors resistant to trabectedin may become hypersensitive to UV rays and other DNA damaging agents acting in the major groove, such as Platinum (Pt) complexes. If this is confirmed in clinic, that will provide the rationale to combine trabectedin sequentially with Pt derivates.

  20. Influence of Divalent Counterions on the Dynamics in DNA as Probed by Using a Minor-Groove Binder.

    Science.gov (United States)

    Paul, Sneha; Ahmed, Tasnim; Samanta, Anunay

    2017-08-05

    DNA dynamics, to which water, counterions, and DNA motions contribute, is a topic of considerable interest because it is closely related to the efficiency of biological functions performed by it. Simulation studies and experiments suggest that the counterion dynamics in DNA probed by a minor-groove binder are similar for various monovalent counterions. To date, the influence on DNA dynamics of higher-valence counterions, which are also present around DNA and are known to bind more strongly to it than monovalent ions, has not been studied. Herein we investigated DNA dynamics in the presence of Mg 2+ and Ca 2+ , chosen for their relative abundance in cells, by using minor-groove binder 4',6-diamidino-2-phenylindole (DAPI) as a fluorescence probe. The dynamics, as measured from the time-resolved fluorescence Stokes shifts of DAPI bound to calf thymus DNA on a subpicosecond-to-nanosecond timescale, were found to be very similar in the presence of both the divalent ions and Na + ions. The observation is explained by considering the screening of the electric field of the divalent ion by its hydration shell, preferential binding of the ions to the phosphate groups, and displacement of ions from the minor groove by DAPI due to the stronger binding interaction of the latter. Furthermore, the similarity of our results in the presence of Na + to those reported for smaller oligonucleotides suggests that the chain length of DNA does not influence the DNA dynamics. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Translesion synthesis DNA polymerases promote error-free replication through the minor-groove DNA adduct 3-deaza-3-methyladenine.

    Science.gov (United States)

    Yoon, Jung-Hoon; Roy Choudhury, Jayati; Park, Jeseong; Prakash, Satya; Prakash, Louise

    2017-11-10

    N3-Methyladenine (3-MeA) is formed in DNA by reaction with S -adenosylmethionine, the reactive methyl donor, and by reaction with alkylating agents. 3-MeA protrudes into the DNA minor groove and strongly blocks synthesis by replicative DNA polymerases (Pols). However, the mechanisms for replicating through this lesion in human cells remain unidentified. Here we analyzed the roles of translesion synthesis (TLS) Pols in the replication of 3-MeA-damaged DNA in human cells. Because 3-MeA has a short half-life in vitro , we used the stable 3-deaza analog, 3-deaza-3-methyladenine (3-dMeA), which blocks the DNA minor groove similarly to 3-MeA. We found that replication through the 3-dMeA adduct is mediated via three different pathways, dependent upon Polι/Polκ, Polθ, and Polζ. As inferred from biochemical studies, in the Polι/Polκ pathway, Polι inserts a nucleotide (nt) opposite 3-dMeA and Polκ extends synthesis from the inserted nt. In the Polθ pathway, Polθ carries out both the insertion and extension steps of TLS opposite 3-dMeA, and in the Polζ pathway, Polζ extends synthesis following nt insertion by an as yet unidentified Pol. Steady-state kinetic analyses indicated that Polι and Polθ insert the correct nt T opposite 3-dMeA with a much reduced catalytic efficiency and that both Pols exhibit a high propensity for inserting a wrong nt opposite this adduct. However, despite their low fidelity of synthesis opposite 3-dMeA, TLS opposite this lesion replicates DNA in a highly error-free manner in human cells. We discuss the implications of these observations for TLS mechanisms in human cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. Protein Recognition in Drug-Induced DNA Alkylation: When the Moonlight Protein GAPDH Meets S23906-1/DNA Minor Groove Adducts.

    Science.gov (United States)

    Savreux-Lenglet, Gaëlle; Depauw, Sabine; David-Cordonnier, Marie-Hélène

    2015-11-05

    DNA alkylating drugs have been used in clinics for more than seventy years. The diversity of their mechanism of action (major/minor groove; mono-/bis-alkylation; intra-/inter-strand crosslinks; DNA stabilization/destabilization, etc.) has undoubtedly major consequences on the cellular response to treatment. The aim of this review is to highlight the variety of established protein recognition of DNA adducts to then particularly focus on glyceraldehyde-3-phosphate dehydrogenase (GAPDH) function in DNA adduct interaction with illustration using original experiments performed with S23906-1/DNA adduct. The introduction of this review is a state of the art of protein/DNA adducts recognition, depending on the major or minor groove orientation of the DNA bonding as well as on the molecular consequences in terms of double-stranded DNA maintenance. It reviews the implication of proteins from both DNA repair, transcription, replication and chromatin maintenance in selective DNA adduct recognition. The main section of the manuscript is focusing on the implication of the moonlighting protein GAPDH in DNA adduct recognition with the model of the peculiar DNA minor groove alkylating and destabilizing drug S23906-1. The mechanism of action of S23906-1 alkylating drug and the large variety of GAPDH cellular functions are presented prior to focus on GAPDH direct binding to S23906-1 adducts.

  3. Photosensitization by iodinated DNA minor groove binding ligands: Evaluation of DNA double-strand break induction and repair.

    Science.gov (United States)

    Briggs, Benjamin; Ververis, Katherine; Rodd, Annabelle L; Foong, Laura J L; Silva, Fernando M Da; Karagiannis, Tom C

    2011-05-03

    Iodinated DNA minor groove binding bibenzimidazoles represent a unique class of UVA photosensitizer and their extreme photopotency has been previously characterized. Earlier studies have included a comparison of three isomers, referred to as ortho-, meta- and para-iodoHoechst, which differ only in the location of the iodine substituent in the phenyl ring of the bibenzimidazole. DNA breakage and clonogenic survival studies in human erythroleukemic K562 cells have highlighted the higher photo-efficiency of the ortho-isomer (subsequently designated UV(A)Sens) compared to the meta- and para-isomers. In this study, the aim was to compare the induction and repair of DNA double-strand breaks induced by the three isomers in K562 cells. Further, we examined the effects of the prototypical broad-spectrum histone deacetylase inhibitor, Trichostatin A, on ortho-iodoHoechst/UVA-induced double-strand breaks in K562 cells. Using γH2AX as a molecular marker of the DNA lesions, our findings indicate a disparity in the induction and particularly, in the repair kinetics of double-strand breaks for the three isomers. The accumulation of γH2AX foci induced by the meta- and para-isomers returned to background levels within 24 and 48 h, respectively; the number of γH2AX foci induced by ortho-iodoHoechst remained elevated even after incubation for 96 h post-irradiation. These findings provide further evidence that the extreme photopotency of ortho-iodoHoechst is due to not only to the high quantum yield of dehalogenation, but also to the severity of the DNA lesions which are not readily repaired. Finally, our findings which indicate that Trichostatin A has a remarkable potentiating effect on ortho-iodoHoechst/UVA-induced DNA lesions are encouraging, particularly in the context of cutaneous T-cell lymphoma, for which a histone deacetylase inhibitor is already approved for therapy. This finding prompts further evaluation of the potential of combination therapies. Copyright © 2011

  4. Impact of pyrrolidine-bispyrrole DNA minor groove binding agents and chirality on global proteomic profile in Escherichia Coli.

    Science.gov (United States)

    Yang, Ya-Ting; Lin, Chun-Yu; Jeng, Jingyueh; Ong, Chi-Wi

    2013-05-23

    There is great interest in the design of small molecules that selectively target minor grooves of duplex DNA for controlling specific gene expression implicated in a disease. The design of chiral small molecules for rational drug design has attracted increasing attention due to the chirality of DNA. Yet, there is limited research on the chirality effect of minor groove binders on DNA interaction, especially at the protein expression level. This paper is an attempt to illustrate that DNA binding affinity might not provide a full picture on the biological activities. Drug interacting at the genomic level can be translated to the proteomic level. Here we have illustrated that although the chiral bispyrrole-pyrrolidine-oligoamides, PySSPy and PyRSPy, showed low binding affinity to DNA, their influence at the proteomic level is significant. More importantly, the chirality also plays a role. Two-dimensional proteomic profile to identify the differentially expressed protein in Escherichia coli DH5α (E coli DH5α) were investigated. E coli DH5α incubated with the chiral PySSPy and PyRSPy, diastereomeric at the pyrrolidine ring, showed differential expression of eighteen proteins as observed through two dimensional proteomic profiling. These eighteen proteins identified by MALDI_TOF/TOF MS include antioxidant defense, DNA protection, protein synthesis, chaperone, and stress response proteins. No statistically significant toxicity was observed at the tested drug concentrations as measured via MTT assay. The current results showed that the chiral PySSPy and PyRSPy impact on the proteomic profiling of E coli DH5α, implicating the importance of drug chirality on biological activities at the molecular level.

  5. Methylene blue binding to DNA with alternating AT base sequence: minor groove binding is favored over intercalation.

    Science.gov (United States)

    Rohs, Remo; Sklenar, Heinz

    2004-04-01

    The results presented in this paper on methylene blue (MB) binding to DNA with AT alternating base sequence complement the data obtained in two former modeling studies of MB binding to GC alternating DNA. In the light of the large amount of experimental data for both systems, this theoretical study is focused on a detailed energetic analysis and comparison in order to understand their different behavior. Since experimental high-resolution structures of the complexes are not available, the analysis is based on energy minimized structural models of the complexes in different binding modes. For both sequences, four different intercalation structures and two models for MB binding in the minor and major groove have been proposed. Solvent electrostatic effects were included in the energetic analysis by using electrostatic continuum theory, and the dependence of MB binding on salt concentration was investigated by solving the non-linear Poisson-Boltzmann equation. We find that the relative stability of the different complexes is similar for the two sequences, in agreement with the interpretation of spectroscopic data. Subtle differences, however, are seen in energy decompositions and can be attributed to the change from symmetric 5'-YpR-3' intercalation to minor groove binding with increasing salt concentration, which is experimentally observed for the AT sequence at lower salt concentration than for the GC sequence. According to our results, this difference is due to the significantly lower non-electrostatic energy for the minor groove complex with AT alternating DNA, whereas the slightly lower binding energy to this sequence is caused by a higher deformation energy of DNA. The energetic data are in agreement with the conclusions derived from different spectroscopic studies and can also be structurally interpreted on the basis of the modeled complexes. The simple static modeling technique and the neglect of entropy terms and of non-electrostatic solute

  6. Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.

    Science.gov (United States)

    Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J

    2015-05-26

    DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. DNA minor groove targeted alkylating agents based on bisbenzimidazole carriers: synthesis, cytotoxicity and sequence-specificity of DNA alkylation.

    Science.gov (United States)

    Smaill, J B; Fan, J Y; Denny, W A

    1998-12-01

    A series of bisbenzimidazoles bearing a variety of alkylating agents [ortho- and meta-mustards, imidazolebis(hydroxymethyl), imidazolebis(methylcarbamate) and pyrrolebis(hydroxymethyl)], appended by a propyl linker chain, were prepared and investigated for sequence-specificity of DNA alkylation and their cytotoxicity. Previous work has shown that, for para-aniline mustards, a propyl linker is optimal for cytotoxicity. Alkaline cleavage assays using a variety of different labelled oligonucleotides showed that the preferred sequences for adenine alkylation were 5'-TTTANANAANN and 5'-ATTANANAANN (underlined bases show the drug alkylation sites), with AT-rich sequences required on both the 5' and 3' sides of the alkylated adenine. The different aniline mustards showed little variation in alkylation pattern and similar efficiencies of DNA cross-link formation despite the changes in orientation and positioning of the mustard, suggesting that the propyl linker has some flexibility. The imidazole- and pyrrolebis(hydroxymethyl) alkylators showed no DNA strand cleavage following base treatment, indicating that no guanine or adenine N3 or N7 adducts were formed. Using the PCR-based polymerase stop assay, these alkylators showed PCR blocks at 5'-C*G sites (the * nucleotide indicates the blocked site), particularly at 5'-TAC*GA 5'-AGC*GGA, and 5'-AGCC*GGT sequences, caused by guanine 2-NH2 lesions on the opposite strand. Only the (more reactive) imidazolebis(methylcarbamoyl) and pyrrolebis(hydroxymethyl) alkylators demonstrated interstrand cross-linking ability. All of the bifunctional mustards showed large (approximately 100-fold) increases in cytotoxicity over chlorambucil, with the corresponding monofunctional mustards being 20- to 60-fold less cytotoxic. These results suggest that in the mustards the propyl linker provides sufficient flexibility to achieve delivery of the alkylator to favoured (adenine N3) sites in the minor groove, regardless of its exact geometry with

  8. A DNA minor groove electronegative potential genome map based on photo-chemical probing

    DEFF Research Database (Denmark)

    Lindemose, Søren; Nielsen, Peter Eigil; Hansen, Morten

    2011-01-01

    The double-stranded DNA of the genome contains both sequence information directly relating to the protein and RNA coding as well as functional and structural information relating to protein recognition. Only recently is the importance of DNA shape in this recognition process being fully appreciat...

  9. Direction of Intercalation of a bis-Ru(II) Complex to DNA Probed by a Minor Groove Binding Molecule 4',6-Diamidino-2-phenylindole

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Yoon Jung; Kim, Raeyeong; Chitrapriya, Nataraj; Kim, Seog K.; Bae, Inho [Yeungnam Univ., Gyeongsan (Korea, Republic of)

    2013-10-15

    Direction of intercalation to DNA of the planar dipyrido[3,2-a:2',3'-c]phenazine ligands (dppz) of a bis-Ru(II) complex namely, [Ru(1,10-phenanthroline){sub 2}dipyrido[3,2-a:2',3'-c]phenazine]{sup 2+} linkered by a 1,3-bis(4-pyridyl)propane, was investigated by probing the behavior of 4',6-diamidino-2-phenylindole (DAPI) that bound deep in the minor groove. Bis-intercalation of DPPZ resulted in a little blue shift and hyperchromism in DAPI absorption band, and a large decrease in DAPI fluorescence intensity which accompanied by an increase in the dppz emission intensity. Diminishing the intensity of the positive induced circular dichroism (CD) and linear dichroism (LD) were also observed. These spectral changes indicated that insertion of dppz ligand caused the change of the binding mode of DAPI, which probably moved to the exterior of DNA from the minor groove and interacted with the phospghate groups of DNA by electrostatic interaction. At the surface of DNA, DAPI binds at the phosphate groups of DNA by electrostatic attraction. Consequently, this observation indicated that the dppz ligand intercalated from the minor groove.

  10. Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove

    Science.gov (United States)

    Yonetani, Yoshiteru; Kono, Hidetoshi

    2009-01-01

    Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662

  11. Elucidation of the sequence selective binding mode of the DNA minor groove binder adozelesin, by high-field 1H NMR and restrained molecular dynamics

    International Nuclear Information System (INIS)

    Cameron, L.

    1999-01-01

    Adozelesin (formerly U73-975, The Upjohn Co.) is a covalent, minor-groove binding analogue of the antitumour antibiotic (+)CC-1065. Adozelesin consists of a cyclopropapyrroloindole alkylating sub-unit identical to (+)CC-1065, plus indole and benzofuran sub-units which replace the more complex pyrroloindole B and C sub-units, respectively, of (+)CC-1065. Adozelesin is a clinically important drug candidate, since it does not contain the ethylene bridge moieties on the B and C sub-units which are thought to be responsible for the unusual delayed hepatotoxicity exhibited by (+)CC-1065. Sequencing techniques identified two consensus sequences for adozelesin binding as p(dA) and 5'(T/A)(T/A)T-A*(C/G)G. This suggests that adozelesin spans a total of five base-pairs and shows a preference for A=T base-pair rich sequences, thus avoiding steric crowding around the exocyclic NH 2 of guanine and a wide minor groove. In this project, the covalent modification of two DNA sequences, i.e. 5'd(CGTAAGCGCTTA*CG) 2 and 5'-d(CGAAAAA*CGG)· 5'-d(CCGTTTTTCG), by adozelesin was examined by high-field NMR and restrained molecular mechanics and dynamics. Previous studies of minor groove binding drugs, using techniques as diverse as NMR, X-ray crystallography and molecular modelling, indicate that the incorporation of a guanine into the consensus sequence sterically hinders binding and, more importantly, produces a wider minor groove which is a 'slack' fit for the ligand. The aim of this investigation was to provide an insight into the sequence selective binding of adozelesin to 5'-AAAAA*CG and 5'-GCTTA*CG. The 1 H NMR data revealed that, in both cases, β-helical structure and Watson-Crick base-pairing was maintained on adduct formation. The 5'-GCTTA*CG adduct displayed significant distortion of the guanine base on the non-covalently modified strand. This distortion resulted from an amalgamation of two factors. Firstly, the presence of a strong hydrogen-bond between the amide linker of the

  12. Curcumin stably interacts with DNA hairpin through minor groove binding and demonstrates enhanced cytotoxicity in combination with FdU nucleotides.

    Science.gov (United States)

    Ghosh, Supratim; Mallick, Sumana; Das, Upasana; Verma, Ajay; Pal, Uttam; Chatterjee, Sabyasachi; Nandy, Abhishek; Saha, Krishna D; Maiti, Nakul Chandra; Baishya, Bikash; Suresh Kumar, G; Gmeiner, William H

    2018-03-01

    We report, based on biophysical studies and molecular mechanical calculations that curcumin binds DNA hairpin in the minor groove adjacent to the loop region forming a stable complex. UV-Vis and fluorescence spectroscopy indicated interaction of curcumin with DNA hairpin. In this novel binding motif, two ɣ H of curcumin heptadiene chain are closely positioned to the A 16 -H8 and A 17 -H8, while G 12 -H8 is located in the close proximity of curcumin α H. Molecular dynamics (MD) simulations suggest, the complex is stabilized by noncovalent forces including; π-π stacking, H-bonding and hydrophobic interactions. Nuclear magnetic resonance (NMR) spectroscopy in combination with molecular dynamics simulations indicated curcumin is bound in the minor groove, while circular dichroism (CD) spectra suggested minute enhancement in base stacking and a little change in DNA helicity, without significant conformational change of DNA hairpin structure. The DNA:curcumin complex formed with FdU nucleotides rather than Thymidine, demonstrated enhanced cytotoxicity towards oral cancer cells relative to the only FdU substituted hairpin. Fluorescence co-localization demonstrated stability of the complex in biologically relevant conditions, including its cellular uptake. Acridine orange/EtBr staining further confirmed the enhanced cytotoxic effects of the complex, suggesting apoptosis as mode of cell death. Thus, curcumin can be noncovalently complexed to small DNA hairpin for cellular delivery and the complex showed increased cytotoxicity in combination with FdU nucleotides, demonstrating its potential for advanced cancer therapy. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Quantitative structure of a complex between a minor-groove-specific drug and a bent DNA decamer duplex: Use of 2D NMR data and NOESY constrained energy minimization

    International Nuclear Information System (INIS)

    Sarma, M.H.; Gupta, G.; Garcia, A.E.; Umemoto, K.; Sarma, R.H.

    1990-01-01

    Two-dimensional nuclear magnetic resonance (2D NMR) studies on d(GA4T4C)2 and d(GT4A4C)2 showed that A.T pairs are propeller twisted. As a result, A/T tracts form a straight rigid structural block with an array of bifurcated inter base pair H bonds in the major groove. It was demonstrated (previous paper) that replacement of methyl group by hydrogen (changing from T to U) in the major groove does not disrupt the array of bifurcated H bonds in the major groove. In this article, we summarize results of 2D NMR and molecular mechanic studies on the effect of a minor-groove-binding A.T-specific drug on the structure d(GA4T4C)2. A distamycin analogue (Dst2) was used for this study. It is shown that Dst2 binds to the minor groove of d(GA4T4C)2 mainly driven by van der Waals interaction between A.T pairs and the drug; as a consequence, an array of bifurcated H bonds can be formed in the minor groove between amide/amino protons of Dst2 and A.T pairs of DNA. NOESY data suggest that Dst2 predominantly binds at the central 5 A.T pairs. NOESY data also reveal that, upon drug binding, d(GA4T4C)2 does not undergo any significant change in conformation from the free state; i.e., propeller-twisted A.T pairs are still present in DNA and hence the array of bifurcated H bonds must be preserved in the major groove. NOESY data for the A5-T6 sequence also indicate that there is little change in junction stereochemistry upon drug binding

  14. Differential Deformability of the DNA Minor Groove and Altered BI/BII Backbone Conformational Equilibrium by the Monovalent Ions Li+, Na+, K+ and Rb+ via Water-Mediated Hydrogen Bonding

    Science.gov (United States)

    Savelyev, Alexey; MacKerell, Alexander D.

    2015-01-01

    Recently, we reported the differential impact of the monovalent cations Li+, Na+, K+ and Rb+ on DNA conformational properties. These were identified from variations in the calculated solution-state X-ray DNA spectra as a function of the ion type in the solvation buffer in MD simulations using our recently developed polarizable force field based on the classical Drude oscillator. Changes in the DNA structure were found to mainly involve variations in the minor groove width. Because minor groove dimensions vary significantly in protein-DNA complexes and have been shown to play a critical role in both specific and nonspecific DNA readout, understanding the origins of the observed differential DNA modulation by the first-group monovalent ions is of great biological importance. In the present study we show that the primary microscopic mechanism for the phenomenon is the formation of the water-mediated hydrogen bonds between solvated cations located inside the minor groove and simultaneously to two DNA strands, a process whose intensity and impact on DNA structure depends on both the type of the ion and DNA sequence. Additionally, it is shown that formation of such ion-DNA hydrogen bond complexes appreciably modulates the conformation of the backbone by increasing the population of the BII substate. Notably, the differential impact of the ions on DNA conformational behavior is only predicted by the Drude polarizable model for DNA, with virtually no effect observed from MD simulations utilizing the additive CHARMM36 model. Analysis of dipole moments of the water shows the Drude SWM4 model to possess high sensitivity to changes in the local environment, which indicates the important role of electronic polarization in the salt-dependent conformational properties. This also suggests that inclusion of polarization effects is required to model even relatively simple biological systems such as DNA in various ionic solutions. PMID:26575937

  15. Recognition by nonaromatic and stereochemical subunit-containing polyamides of the four Watson-Crick base pairs in the DNA minor groove.

    Science.gov (United States)

    Zhang, Hong-Fei; Wu, Yan-Ling; Jiang, Shi-Kun; Wang, Pu; Sugiyama, Hiroshi; Chen, Xing-Lai; Zhang, Wen; Ji, Yan-Juan; Guo, Chuan-Xin

    2012-06-18

    In order to develop an optimal subunit as a T-recognition element in hairpin polyamides, 15 novel chirality-modified polyamides containing (R)-α,β-diaminopropionic acid ((R) β α-NH 2), (S)-α,β-diaminopropionic acid ((S) β α-NH 2), (1R,3S)-3-aminocyclopentanecarboxylic acid ((RS) Cp), (1S,3R)-3-amino-cyclopentanecarboxylic acid ((RS) Cp), (1R,3R)-3-aminocyclopentanecarboxylic acid ((RR) Cp) and (1S,3S)-3-amino-cyclopentanecarboxylic acid ((SS) Cp) residues were synthesized. Their binding characteristics to DNA sequences 5'-TGCNCAT-3'/3'-ACGN'GTA-5' (N⋅N'=A⋅T, T⋅A, G⋅C and C⋅G) were systemically studied by surface plasmon resonance (SPR) and molecular simulation (MSim) techniques. SPR showed that polyamide 4, AcIm-(S) β α-NH 2-ImPy-γ-ImPy-β-Py-βDp (β/(S) β α-NH 2 pair), bound to a DNA sequence containing a core binding site of 5'-TGCACAT-3' with a dissociation equilibrium constant (K(D) ) of 4.5×10(-8)  m. This was a tenfold improvement in specificity over 5'-TGCTCAT-3' (K(D) =4.5×10(-7)  M). MSim studies supported the SPR results. More importantly, for the first time, we found that chiral 3-aminocyclopentanecarboxylic acids in polyamides can be employed as base readers with only a small decrease in binding affinity to DNA. In particular, SPR showed that polyamide 9 ((RR) Cp/β pair) had a 15-fold binding preference for 5'-TGCTCAT-3' over 5'-TGCACAT-3'. A large difference in standard free energy change for A⋅T over T⋅A was determined (ΔΔG(o) =5.9 kJ mol(-1) ), as was a twofold decrease in interaction energy by MSim. Moreover, a 1:1 stoichiometry (9 to 5'-TGCTCAT-3'/3'-ACGAGTA-5') was shown by MSim to be optimal for the chiral five-membered cycle to fit the minor groove. Collectively, the study suggests that the (S)-α-amino-β-aminopropionic acid and (1R,3R)-3-aminocyclopentanecarboxylic acid can serve as a T-recognition element, and the stereochemistry and the nature of these subunits significantly influence

  16. From old alkylating agents to new minor groove binders.

    Science.gov (United States)

    Puyo, Stéphane; Montaudon, Danièle; Pourquier, Philippe

    2014-01-01

    Alkylating agents represent the oldest class of anticancer agents with the approval of mechloretamine by the FDA in 1949. Even though their clinical use is far beyond the use of new targeted therapies, they still occupy a major place in the treatment of specific malignancies, sometimes representing the unique option for the treatment of refractory tumors. Here, we are reviewing the major classes of alkylating agents, with a particular focus on the latest generations of compounds that specifically target the minor groove of the DNA. These naturally occurring derivatives have a unique mechanism of action that explains the recent regain of interest in developing new classes of alkylating agents that could be used in combination with other anticancer drugs to enhance tumor response in the clinic. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  17. Cellular uptake, nuclear localization and cytotoxicity of 125I-labelled DNA minor groove binding ligands in K562, human erythroleukaemia cells

    International Nuclear Information System (INIS)

    Karagiannis, T.C.; Lobachevsky, P.N.; Martin, R.F.

    2000-01-01

    Full text: Iodine-125 decays by orbital electron capture and internal conversion resulting in the emission of numerous Auger electrons which produce a highly localised radiochemical damage in the immediate vicinity of the site of decay. Given the requirement to deliver 125 I to the nuclear DNA, a minor groove binding bibenzimidazole, 125 I-iodoHoechst 33258 was investigated. It has been noted that this analogue may be prone to de-iodination in vitro and in vivo, given the presence of an orthoiodophenol moiety which is analogous to that in thyroxins. Therefore, an 125 I -iodoHoechst analogue without the hydroxyl group was also studied. The 125 I -iodoHoechst 33258 analogue was prepared by direct iodination of Hoechst 33258 and 125 I iodoHoechst was prepared by demetallation of a trimethylstannyl precursor. DNA binding studies indicated that both iodo-analogues bind to calf thymus DNA, K D = 89 ± 30nM, n = 0.018 bp - 1 for iodoHoechst 33258 and K D = 121 ± 31nM, n = 0.024 bp -1 for iodoHoechst. Similarly, nuclear localization following incubation with 5μM of either ligand at 37 deg C was observed in K562 cells by fluorescence microscopy. Flow cytometry was used to investigate the kinetics of drug uptake and efflux in K562 cells. The results indicated that when 10 6 cells were incubated with 5μM ligand at 37 deg C, the uptake reached a plateau at approximately 43 minutes for iodoHoechst 33258 and approximately 52 minutes for iodoHoechst. Ligand efflux results indicated two-phase kinetics. The initial phase which involves 50-60% of drug was characterised by a half-life time (t 1/2 ) of 55.4 minutes for efflux of iodoHoechst 33258 and a t 1/2 of 10.3 minutes for efflux of iodoHoechst, at 37 deg C. Furthermore, the results suggested that the DNA binding sites in a 10 6 cell/ml suspension were saturated by incubation with 3μM iodoHoechst 33258 and 5μM iodoHoechst. In the initial cytotoxicity experiments using 125 I-iodoHoechst 33258, K562 cells were incubated for 1

  18. Two 1 : 1 binding modes for distamycin in the minor groove of d(GGCCAATTGG)

    Czech Academy of Sciences Publication Activity Database

    Uytterhoeven, K.; Šponer, Jiří; Van Meervelt, L.

    2002-01-01

    Roč. 269, č. 12 (2002), s. 2868-2877 ISSN 0014-2956 R&D Projects: GA MŠk LN00A016 Keywords : distamycin * drug-DNA complex * minor groove binder Subject RIV: BO - Biophysics Impact factor: 2.999, year: 2002

  19. NMR solution structure of an N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: Intercalation from the minor groove with ruptured Watson-Crick base pairing

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.

    2012-01-01

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427

  20. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  1. Aptamer sensor for cocaine using minor groove binder based energy transfer.

    Science.gov (United States)

    Zhou, Jinwen; Ellis, Amanda V; Kobus, Hilton; Voelcker, Nicolas H

    2012-03-16

    We report on an optical aptamer sensor for cocaine detection. The cocaine sensitive fluorescein isothiocyanate (FITC)-labeled aptamer underwent a conformational change from a partial single-stranded DNA with a short hairpin to a double-stranded T-junction in the presence of the target. The DNA minor groove binder Hoechst 33342 selectively bound to the double-stranded T-junction, bringing the dye within the Förster radius of FITC, and therefore initiating minor groove binder based energy transfer (MBET), and reporting on the presence of cocaine. The sensor showed a detection limit of 0.2 μM. The sensor was also implemented on a carboxy-functionalized polydimethylsiloxane (PDMS) surface by covalently immobilizing DNA aptamers. The ability of surface-bound cocaine detection is crucial for the development of microfluidic sensors. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Long-Term Prognostic Effects of Plasma Epstein-Barr Virus DNA by Minor Groove Binder-Probe Real-Time Quantitative PCR on Nasopharyngeal Carcinoma Patients Receiving Concurrent Chemoradiotherapy

    International Nuclear Information System (INIS)

    Lin, J.-C.; Wang, W.-Y.; Liang, W.-M.; Chou, H.-Y.; Jan, J.-S.; Jiang, R.-S.; Wang, J.-Y.; Twu, C.-W.; Liang, K.-L.; Chao, Jeffrey; Shen, W.-C.

    2007-01-01

    Purpose: To evaluate the long-term prognostic impact of plasma Epstein-Barr virus (EBV) DNA concentration measured by real-time quantitative polymerase chain reaction (RTQ-PCR) in nasopharyngeal carcinoma (NPC) patients receiving concurrent chemoradiotherapy (CCRT). Methods and Materials: Epstein-Barr virus DNA was retrospectively measured from stock plasma of 152 biopsy-proven NPC patients with Stage II-IV (M0) disease with a RTQ-PCR using the minor groove binder-probe. All patients received CCRT with a median follow-up of 78 months. We divided patients into three subgroups: (1) low pretreatment EBV DNA (<1,500 copies/mL) and undetectable posttreatment EBV DNA (pre-L/post-U) (2) high pretreatment EBV DNA (≥1,500 copies/mL) and undetectable posttreatment EBV DNA (pre-H/post-U), and (3) low or high pretreatment EBV DNA and detectable posttreatment EBV DNA (pre-L or H/post-D) for prognostic analyses. Results: Epstein-Barr virus DNA (median concentration, 573 copies/mL; interquartile range, 197-3,074) was detected in the pretreatment plasma of 94.1% (143/152) of patients. After treatment, plasma EBV DNA decreased or remained 0 for all patients and was detectable in 31 patients (20.4%) with a median concentration 0 copy/mL (interquartile range, 0-0). The 5-year overall survival rates of the pre-L/post-U, pre-H/post-U, and pre-L or H/post-D subgroups were 87.2%, 71.0%, and 38.7%, respectively (p < 0.0001). The relapse-free survival showed similar results with corresponding rates of 85.6%, 75.9%, and 26.9%, respectively (p < 0.0001). Multivariate Cox analysis confirmed the superior effects of plasma EBV DNA compared to other clinical parameters in prognosis prediction. Conclusion: Plasma EBV DNA is the most valuable prognostic factor for NPC. More chemotherapy should be considered for patients with persistently detectable EBV DNA after CCRT

  3. Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs

    DEFF Research Database (Denmark)

    van Beest, M; Dooijes, D; van De Wetering, M

    2000-01-01

    Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment...

  4. Minor-Groove Binding Drugs: Where Is the Second Hoechst 33258 Molecule?

    KAUST Repository

    Fornander, Louise H.

    2013-05-16

    Hoechst 33258 binds with high affinity into the minor groove of AT-rich sequences of double-helical DNA. Despite extensive studies of this and analogous DNA binding molecules, there still remains uncertainty concerning the interactions when multiple ligand molecules are accommodated within close distance. Albeit not of direct concern for most biomedical applications, which are at low drug concentrations, interaction studies for higher drug binding are important as they can give fundamental insight into binding mechanisms and specificity, including drug self-stacking interactions that can provide base-sequence specificity. Using circular dichroism (CD), isothermal titration calorimetry (ITC), and proton nuclear magnetic resonance (1H NMR), we examine the binding of Hoechst 33258 to three oligonucleotide duplexes containing AT regions of different lengths: [d(CGCGAATTCGCG)]2 (A2T2), [d(CGCAAATTTGCG)]2 (A3T 3), and [d(CGAAAATTTTCG)]2 (A4T4). We find similar binding geometries in the minor groove for all oligonucleotides when the ligand-to-duplex ratio is less than 1:1. At higher ratios, a second ligand can be accommodated in the minor groove of A4T4 but not A2T2 or A3T3. We conclude that the binding of the second Hoechst to A4T4 is not cooperative and that the molecules are sitting with a small separation apart, one after the other, and not in a sandwich structure as previously proposed. © 2013 American Chemical Society.

  5. Minor-Groove Binding Drugs: Where Is the Second Hoechst 33258 Molecule?

    KAUST Repository

    Fornander, Louise H.; Wu, Lisha; Billeter, Martin; Lincoln, Per; Nordé n, Bengt

    2013-01-01

    Hoechst 33258 binds with high affinity into the minor groove of AT-rich sequences of double-helical DNA. Despite extensive studies of this and analogous DNA binding molecules, there still remains uncertainty concerning the interactions when multiple ligand molecules are accommodated within close distance. Albeit not of direct concern for most biomedical applications, which are at low drug concentrations, interaction studies for higher drug binding are important as they can give fundamental insight into binding mechanisms and specificity, including drug self-stacking interactions that can provide base-sequence specificity. Using circular dichroism (CD), isothermal titration calorimetry (ITC), and proton nuclear magnetic resonance (1H NMR), we examine the binding of Hoechst 33258 to three oligonucleotide duplexes containing AT regions of different lengths: [d(CGCGAATTCGCG)]2 (A2T2), [d(CGCAAATTTGCG)]2 (A3T 3), and [d(CGAAAATTTTCG)]2 (A4T4). We find similar binding geometries in the minor groove for all oligonucleotides when the ligand-to-duplex ratio is less than 1:1. At higher ratios, a second ligand can be accommodated in the minor groove of A4T4 but not A2T2 or A3T3. We conclude that the binding of the second Hoechst to A4T4 is not cooperative and that the molecules are sitting with a small separation apart, one after the other, and not in a sandwich structure as previously proposed. © 2013 American Chemical Society.

  6. Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation | Center for Cancer Research

    Science.gov (United States)

    Dubbed "Tom's T" by Dhruba Chattoraj, the unusually conserved thymine at position +7 in bacteriophage P1 plasmid RepA DNA binding sites rises above repressor and acceptor sequence logos. The T appears to represent base flipping prior to helix opening in this DNA replication initation protein.

  7. 2-Substituted dATP Derivatives as Building Blocks for Polymerase-Catalyzed Synthesis of DNA Modified in the Minor Groove

    Czech Academy of Sciences Publication Activity Database

    Matyašovský, Ján; Perlíková, Pavla; Malnuit, Vincent; Pohl, Radek; Hocek, Michal

    2016-01-01

    Roč. 55, č. 51 (2016), s. 15856-15859 ISSN 1433-7851 R&D Projects: GA ČR GA14-04289S EU Projects: European Commission(XE) 642023 - ClickGene Institutional support: RVO:61388963 Keywords : bioconjugation * DNA modification * DNA polymerase * nucleotides * fluorescent labelling Subject RIV: CC - Organic Chemistry Impact factor: 11.994, year: 2016 http://onlinelibrary.wiley.com/doi/10.1002/anie.201609007/full

  8. Programmable Oligomers Targeting 5′-GGGG-3′ in the Minor Groove of DNA and NF-κB Binding Inhibition

    Science.gov (United States)

    Chenoweth, David M.; Poposki, Julie A.; Marques, Michael A.; Dervan, Peter B.

    2009-01-01

    A series of hairpin oligomers containing benzimidazole (Bi) and imidazopyridine (Ip) rings were synthesized and screened to target 5′-WGGGGW-3′, a core sequence in the DNA binding site of NF-κB, a prolific transcription factor important in biology and disease. Five Bi and Ip containing oligomers bound to the 5′-WGGGGW-3′ site with high affinity. One of the oligomers (Im-Im-Im-Im-γ-PyBi-PyBi-β-Dp) was able to inhibit DNA binding by the transcription factor NF-κB. PMID:17095230

  9. Sensitive detection of African swine fever virus using real-time PCR with a 5' conjugated minor groove binding probe

    DEFF Research Database (Denmark)

    McKillan, John; McMenamy, Michael; Hjertner, Bernt

    2010-01-01

    sensitive than the conventional PCR recommended by the OIE. Linear range was ten logs from 2 × 101 to 2 × 1010. The assay is rapid with an amplification time just over 2 h. The development of this assay provides a useful tool for the specific diagnosis of ASF in statutory or emergency testing programs......The design of a 5′ conjugated minor groove binder (MGB) probe real-time PCR assay is described for the rapid, sensitive and specific detection of African swine fever virus (ASFV) DNA. The assay is designed against the 9GL region and is capable of detecting 20 copies of a DNA standard. It does...

  10. CarD uses a minor groove wedge mechanism to stabilize the RNA polymerase open promoter complex.

    Science.gov (United States)

    Bae, Brian; Chen, James; Davis, Elizabeth; Leon, Katherine; Darst, Seth A; Campbell, Elizabeth A

    2015-09-08

    A key point to regulate gene expression is at transcription initiation, and activators play a major role. CarD, an essential activator in Mycobacterium tuberculosis, is found in many bacteria, including Thermus species, but absent in Escherichia coli. To delineate the molecular mechanism of CarD, we determined crystal structures of Thermus transcription initiation complexes containing CarD. The structures show CarD interacts with the unique DNA topology presented by the upstream double-stranded/single-stranded DNA junction of the transcription bubble. We confirm that our structures correspond to functional activation complexes, and extend our understanding of the role of a conserved CarD Trp residue that serves as a minor groove wedge, preventing collapse of the transcription bubble to stabilize the transcription initiation complex. Unlike E. coli RNAP, many bacterial RNAPs form unstable promoter complexes, explaining the need for CarD.

  11. A rapid minor groove binder PCR method for distinguishing the vaccine strain Brucella abortus 104M.

    Science.gov (United States)

    Nan, Wenlong; Qin, Lide; Wang, Yong; Zhang, Yueyong; Tan, Pengfei; Chen, Yuqi; Mao, Kairong; Chen, Yiping

    2018-01-24

    Brucellosis is a widespread zoonotic disease caused by Gram-negative Brucella bacteria. Immunisation with attenuated vaccine is an effective method of prevention, but it can interfere with diagnosis. Live, attenuated Brucella abortus strain 104M has been used for the prevention of human brucellosis in China since 1965. However, at present, no fast and reliable method exists that can distinguish this strain from field strains. Single nucleotide polymorphism (SNP)-based assays offer a new approach for such discrimination. SNP-based minor groove binder (MGB) and Cycleave assays have been used for rapid identification of four Brucella vaccine strains (B. abortus strains S19, A19 and RB51, and B. melitensis Rev1). The main objective of this study was to develop a PCR assay for rapid and specific detection of strain 104M. We developed a SNP-based MGB PCR assay that could successfully distinguish strain 104M from 18 representative strains of Brucella (B. abortus biovars 1, 2, 3, 4, 5, 6, 7 and 9, B. melitensis biovars 1, 2 and 3, B. suis biovars 1, 2, 3 and 4, B. canis, B. neotomae, and B. ovis), four Brucella vaccine strains (A19, S19, S2, M5), and 55 Brucella clinical field strains. The assay gave a negative reaction with four non-Brucella species (Escherichia coli, Pasteurella multocida, Streptococcus suis and Pseudomonas aeruginosa). The minimum sensitivity of the assay, evaluated using 10-fold dilutions of chromosomal DNA, was 220 fg for the 104M strain and 76 fg for the single non-104M Brucella strain tested (B. abortus A19). The assay was also reproducible (intra- and inter-assay coefficients of variation = 0.006-0.022 and 0.012-0.044, respectively). A SNP-based MGB PCR assay was developed that could straightforwardly and unambiguously distinguish B. abortus vaccine strain 104M from non-104M Brucella strains. Compared to the classical isolation and identification approaches of bacteriology, this real-time PCR assay has substantial advantages in terms of

  12. Mg2+ in the major groove modulates B-DNA structure and dynamics.

    Directory of Open Access Journals (Sweden)

    Marc Guéroult

    Full Text Available This study investigates the effect of Mg(2+ bound to the DNA major groove on DNA structure and dynamics. The analysis of a comprehensive dataset of B-DNA crystallographic structures shows that divalent cations are preferentially located in the DNA major groove where they interact with successive bases of (A/GpG and the phosphate group of 5'-CpA or TpG. Based on this knowledge, molecular dynamics simulations were carried out on a DNA oligomer without or with Mg(2+ close to an ApG step. These simulations showed that the hydrated Mg(2+ forms a stable intra-strand cross-link between the two purines in solution. ApG generates an electrostatic potential in the major groove that is particularly attractive for cations; its intrinsic conformation is well-adapted to the formation of water-mediated hydrogen bonds with Mg(2+. The binding of Mg(2+ modulates the behavior of the 5'-neighboring step by increasing the BII (ε-ζ>0° population of its phosphate group. Additional electrostatic interactions between the 5'-phosphate group and Mg(2+ strengthen both the DNA-cation binding and the BII character of the 5'-step. Cation binding in the major groove may therefore locally influence the DNA conformational landscape, suggesting a possible avenue for better understanding how strong DNA distortions can be stabilized in protein-DNA complexes.

  13. A minor groove binder probe real-time PCR assay for discrimination between type 2-based vaccines and field strains of canine parvovirus.

    Science.gov (United States)

    Decaro, Nicola; Elia, Gabriella; Desario, Costantina; Roperto, Sante; Martella, Vito; Campolo, Marco; Lorusso, Alessio; Cavalli, Alessandra; Buonavoglia, Canio

    2006-09-01

    A minor groove binder (MGB) probe assay was developed to discriminate between type 2-based vaccines and field strains of canine parvovirus (CPV). Considering that most of the CPV vaccines contain the old type 2, no longer circulating in canine population, two MGB probes specific for CPV-2 and the antigenic variants (types 2a, 2b and 2c), respectively, were labeled with different fluorophores. The MGB probe assay was able to discriminate correctly between the old type and the variants, with a detection limit of 10(1) DNA copies and a good reproducibility. Quantitation of the viral DNA loads was accurate, as demonstrated by comparing the CPV DNA titres to those calculated by means of the TaqMan assay recognising all CPV types. This assay will ensure resolution of most diagnostic problems in dogs showing CPV disease shortly after CPV vaccination, although it does not discriminate between field strains and type 2b-based vaccines, recently licensed to market in some countries.

  14. Enhancement of fluorescence quenching and exciplex formation in DNA major groove by double incorporation of modified fluorescent deoxyuridines.

    Science.gov (United States)

    Tanaka, Makiko; Oguma, Kazuhiro; Saito, Yoshio; Saito, Isao

    2012-06-15

    5-(1-Naphthalenylethynyl)-2'-deoxyuridine ((N)U) and 5-[(4-cyano-1-naphthalenyl)ethynyl]-2'-deoxyuridine ((CN)U) were synthesized and incorporated into oligodeoxynucleotides. Fluorescence emissions of modified duplexes containing double (N)U were efficiently quenched depending upon the sequence pattern of the naphthalenes in DNA major groove, as compared to the duplex possessing single (N)U. When one of the naphthalene moieties has a cyano substituent, the exciplex emission from the chromophores in DNA major groove was observed at longer wavelength. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Design, Synthesis, and Analysis of Minor Groove Binder Pyrrolepolyamide-2′-Deoxyguanosine Hybrids

    Directory of Open Access Journals (Sweden)

    Etsuko Kawashima

    2010-01-01

    Full Text Available Pyrrolepolyamide-2′-deoxyguanosine hybrids (Hybrid 2 and Hybrid 3 incorporating the 3-aminopropionyl or 3-aminopropyl linker were designed and synthesized on the basis of previously reported results of a pyrrolepolyamide-adenosine hybrid (Hybrid 1. Evaluation of the DNA binding sequence selectivity of pyrrolepolyamide-2′-deoxyguanosine hybrids was performed by CD spectral and Tm analyses. It was shown that Hybrid 3 possessed greater binding specificity than distamycin A, Hybrid 1 and Hybrid 2.

  16. Comparison of the biological effects of MMS and Me-lex, a minor groove methylating agent: clarifying the role of N3-methyladenine.

    Science.gov (United States)

    Monti, Paola; Foggetti, Giorgia; Menichini, Paola; Inga, Alberto; Gold, Barry; Fronza, Gilberto

    2014-01-01

    N3-methyladenine (3-mA), generated by the reaction of methylating agents with DNA, is considered a highly toxic but weakly mutagenic lesion. However, due to its intrinsic instability, some of the biological effects of the adduct can result from the formation of the corresponding depurination product [an apurinic (AP)-site]. Previously, we exploited Me-lex, i.e. {1-methyl-4-[1-methyl-4-(3-methoxysulfonylpropanamido)pyrrole-2-carboxamido]-pyrrole-2 carboxamido}propane, a minor groove equilibrium binder with selectivity for A/T rich sequences that efficiently reacts with DNA to afford 3-mA as the dominant product, to probe the biology of this lesion. Using human p53 cDNA as a target in a yeast system, a weak increase in mutagenicity was observed in the absence of Mag1 (3-methyladenine-DNA glycosylase 1, mag1), the enzyme devoted to remove 3-mA from DNA. Moreover, a significant increase in mutagenicity occurred in the absence of the enzymes involved in the repair of AP-sites (AP endonucleases 1 and 2, apn1apn2). Since methyl methanesulfonate (MMS) has been extensively used to explore the biological effects of 3-mA, even though it produces 3-mA in low relative yield, we compared the toxicity and mutagenicity induced by MMS and Me-lex in yeast. A mutagenesis reporter plasmid was damaged in vitro by MMS and then transformed into wild-type and Translesion Synthesis (TLS) Polζ (REV3) and Polη (RAD30) deficient strains. Furthermore, a mag1rad30 double mutant strain was constructed and transformed with the DNA plasmid damaged in vitro by Me-lex. The results confirm the important role of Polζ in the mutagenic bypass of MMS and Me-lex induced lesions, with Polη contributing only towards the bypass of Me-lex induced lesions, mainly in an error-free way. Previous and present results point towards the involvement of AP-sites, derived from the depurination of 3-mA, in the observed toxicity and mutagenicity. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Influence of major-groove chemical modifications of DNA on transcription by bacterial RNA polymerases.

    Science.gov (United States)

    Raindlová, Veronika; Janoušková, Martina; Slavíčková, Michaela; Perlíková, Pavla; Boháčová, Soňa; Milisavljevič, Nemanja; Šanderová, Hana; Benda, Martin; Barvík, Ivan; Krásný, Libor; Hocek, Michal

    2016-04-20

    DNA templates containing a set of base modifications in the major groove (5-substituted pyrimidines or 7-substituted 7-deazapurines bearing H, methyl, vinyl, ethynyl or phenyl groups) were prepared by PCR using the corresponding base-modified 2'-deoxyribonucleoside triphosphates (dNTPs). The modified templates were used in an in vitro transcription assay using RNA polymerase from Bacillus subtilis and Escherichia coli Some modified nucleobases bearing smaller modifications (H, Me in 7-deazapurines) were perfectly tolerated by both enzymes, whereas bulky modifications (Ph at any nucleobase) and, surprisingly, uracil blocked transcription. Some middle-sized modifications (vinyl or ethynyl) were partly tolerated mostly by the E. colienzyme. In all cases where the transcription proceeded, full length RNA product with correct sequence was obtained indicating that the modifications of the template are not mutagenic and the inhibition is probably at the stage of initiation. The results are promising for the development of bioorthogonal reactions for artificial chemical switching of the transcription. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. The AT-Hook motif as a versatile minor groove anchor for promoting DNA binding of transcription factor fragments? ?Electronic supplementary information (ESI) available: Peptide synthesis, full experimental procedures and analytical data of the peptides and products obtained. See DOI: 10.1039/c5sc01415h Click here for additional data file.

    OpenAIRE

    Rodr?guez, J?ssica; Mosquera, Jes?s; Couceiro, Jose R.; V?zquez, M. Eugenio; Mascare?as, Jos? L.

    2015-01-01

    We report the development of chimeric DNA binding peptides comprising a DNA binding fragment of natural transcription factors (the basic region of a bZIP protein or a monomeric zinc finger module) and an AT-Hook peptide motif. The resulting peptide conjugates display high DNA affinity and excellent sequence selectivity. Furthermore, the AT-Hook motif also favors the cell internalization of the conjugates.

  19. Diagnostic tools based on minor groove binder probe technology for rapid identification of vaccinal and field strains of canine parvovirus type 2b.

    Science.gov (United States)

    Decaro, Nicola; Martella, Vito; Elia, Gabriella; Desario, Costantina; Campolo, Marco; Buonavoglia, Domenico; Bellacicco, Anna Lucia; Tempesta, Maria; Buonavoglia, Canio

    2006-12-01

    TaqMan-based diagnostic tests have been developed for the identification of canine parvovirus type 2 (CPV-2) strains in the faeces of dogs with diarrhoea, including a minor groove binder (MGB) probe assay for identification of type 2-based vaccines and field strains (types 2a, 2b and 2c). Since type 2b vaccines have been licensed recently in Europe, two novel MGB assays were developed for discrimination between type 2b vaccines and field strains of CPV. Such assays have been found to be highly sensitive, specific and reproducible, allowing for simultaneous detection of type 2b vaccinal and field strains present in the same specimens. These new assays will help resolution of the diagnostic problems related to the detection of a type 2b strain in the faeces of dogs shortly after the administration of a type 2b vaccine.

  20. Selenium nanoparticles synthesized in aqueous extract of Allium sativum perturbs the structural integrity of Calf thymus DNA through intercalation and groove binding

    International Nuclear Information System (INIS)

    Ezhuthupurakkal, Preedia Babu; Polaki, Lokeswara Rao; Suyavaran, Arumugam; Subastri, Ariraman; Sujatha, Venugopal; Thirunavukkarasu, Chinnasamy

    2017-01-01

    Biomedical application of selenium nanoparticles (SeNPs) demands the eco-friendly composite for synthesis of SeNPs. The present study reports an aqueous extract of Allium sativum (AqEAS) plug-up the current need. Modern spectroscopic, microscopic and gravimetric techniques were employed to characterize the synthesized nanoparticles. Characterization studies revealed the formation of crystalline spherical shaped SeNPs. FTIR spectrum brings out the presence of different functional groups in AqEAS, which influence the SeNPs formation and stabilization. Furthermore the different aspects of the interaction between SeNPs and CT-DNA were scrutinized by various spectroscopic and cyclic voltametric studies. The results reveals the intercalation and groove binding mode of interaction of SeNPs with stacked base pair of CT-DNA. The Stern–Volmer quenching constant (K SV ) were found to be 7.02 × 10 6 Mˉ 1 (ethidium bromide), 4.22 × 10 6 Mˉ 1 (acridine orange) and 7.6 × 10 6 Mˉ 1 (Hoechst) indicating strong binding of SeNPs with CT–DNA. The SeNPs - CT-DNA interactions were directly visualized by atomic force microscopy. The present study unveils the cost effective, innocuous, highly stable SeNPs intricate mechanism of DNA interaction, which will be a milestone in DNA targeted chemotherapy. - Graphical abstract: Highly stable, innocuous, biocompatible SeNPs nanoparticle has been synthesized using Allium sativum (garlic) extract as reductant. The purity and crystallinity were characterized, further divulge the base pare interaction with Calf –Thymus DNA through various spectroscopic methods and atomic force microscopy. Display Omitted - Highlights: • Synthesis of SeNPs in aqueous extract of Allium sativum. • Characterization of synthesized SeNPs using high throughput techniques. • SeNPs directly interact with CT-DNA through intercalation and groove binding.

  1. Selenium nanoparticles synthesized in aqueous extract of Allium sativum perturbs the structural integrity of Calf thymus DNA through intercalation and groove binding

    Energy Technology Data Exchange (ETDEWEB)

    Ezhuthupurakkal, Preedia Babu; Polaki, Lokeswara Rao; Suyavaran, Arumugam; Subastri, Ariraman [Department of Biochemistry and Molecular Biology, Pondicherry University, Puducherry 605 014 (India); Sujatha, Venugopal [Department of Chemistry, Periyar University, Salem 636011 (India); Thirunavukkarasu, Chinnasamy, E-mail: tchinnasamy@hotmail.com [Department of Biochemistry and Molecular Biology, Pondicherry University, Puducherry 605 014 (India)

    2017-05-01

    Biomedical application of selenium nanoparticles (SeNPs) demands the eco-friendly composite for synthesis of SeNPs. The present study reports an aqueous extract of Allium sativum (AqEAS) plug-up the current need. Modern spectroscopic, microscopic and gravimetric techniques were employed to characterize the synthesized nanoparticles. Characterization studies revealed the formation of crystalline spherical shaped SeNPs. FTIR spectrum brings out the presence of different functional groups in AqEAS, which influence the SeNPs formation and stabilization. Furthermore the different aspects of the interaction between SeNPs and CT-DNA were scrutinized by various spectroscopic and cyclic voltametric studies. The results reveals the intercalation and groove binding mode of interaction of SeNPs with stacked base pair of CT-DNA. The Stern–Volmer quenching constant (K{sub SV}) were found to be 7.02 × 10{sup 6} Mˉ{sup 1} (ethidium bromide), 4.22 × 10{sup 6} Mˉ{sup 1} (acridine orange) and 7.6 × 10{sup 6} Mˉ{sup 1} (Hoechst) indicating strong binding of SeNPs with CT–DNA. The SeNPs - CT-DNA interactions were directly visualized by atomic force microscopy. The present study unveils the cost effective, innocuous, highly stable SeNPs intricate mechanism of DNA interaction, which will be a milestone in DNA targeted chemotherapy. - Graphical abstract: Highly stable, innocuous, biocompatible SeNPs nanoparticle has been synthesized using Allium sativum (garlic) extract as reductant. The purity and crystallinity were characterized, further divulge the base pare interaction with Calf –Thymus DNA through various spectroscopic methods and atomic force microscopy. Display Omitted - Highlights: • Synthesis of SeNPs in aqueous extract of Allium sativum. • Characterization of synthesized SeNPs using high throughput techniques. • SeNPs directly interact with CT-DNA through intercalation and groove binding.

  2. Smallpox and pan-orthopox virus detection by real-time 3'-minor groove binder TaqMan assays on the roche LightCycler and the Cepheid smart Cycler platforms.

    Science.gov (United States)

    Kulesh, David A; Baker, Robert O; Loveless, Bonnie M; Norwood, David; Zwiers, Susan H; Mucker, Eric; Hartmann, Chris; Herrera, Rafael; Miller, David; Christensen, Deanna; Wasieloski, Leonard P; Huggins, John; Jahrling, Peter B

    2004-02-01

    We designed, optimized, and extensively tested several sensitive and specific real-time PCR assays for rapid detection of both smallpox and pan-orthopox virus DNAs. The assays are based on TaqMan 3'-minor groove binder chemistry and were performed on both the rapid-cycling Roche LightCycler and the Cepheid Smart Cycler platforms. The hemagglutinin (HA) J7R, B9R, and B10R genes were used as targets for the variola virus-specific assays, and the HA and DNA polymerase-E9L genes were used as targets for the pan-orthopox virus assays. The five orthopox virus assays were tested against a panel of orthopox virus DNAs (both genomic and cloned) at the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID). The results indicated that each assay was capable of detecting both the appropriate cloned gene and genomic DNA. The assays showed no cross-reactivity to the 78 DNAs in the USAMRIID bacterial cross-reactivity panel. The limit of detection (LOD) of each assay was determined to be between 12 and 25 copies of target DNA. The assays were also run against a blind panel of DNAs at the Centers for Disease Control and Prevention (CDC) on both the LightCycler and the Smart Cycler. The panel consisted of eight different variola virus isolates, five non-variola virus orthopox virus isolates, two varicella-zoster virus isolates, and one herpes simplex virus isolate. Each sample was tested in triplicate at 2.5 ng, 25 pg, 250 fg, and 2.5 fg, which represent 1.24 x 10(7), 1.24 x 10(5), 1.24 x 10(3), and 1.24 x 10(1) genome equivalents, respectively. The results indicated that each of the five assays was 100% specific (no false positives) when tested against both the USAMRIID panels and the CDC blind panel. With the CDC blind panel, the LightCycler was capable of detecting 96.2% of the orthopox virus DNAs and 93.8% of the variola virus DNAs. The Smart Cycler was capable of detecting 92.3% of the orthopox virus DNAs and between 75 and 93.8% of the variola virus DNAs

  3. Smallpox and pan-Orthopox Virus Detection by Real-Time 3′-Minor Groove Binder TaqMan Assays on the Roche LightCycler and the Cepheid Smart Cycler Platforms

    Science.gov (United States)

    Kulesh, David A.; Baker, Robert O.; Loveless, Bonnie M.; Norwood, David; Zwiers, Susan H.; Mucker, Eric; Hartmann, Chris; Herrera, Rafael; Miller, David; Christensen, Deanna; Wasieloski, Leonard P.; Huggins, John; Jahrling, Peter B.

    2004-01-01

    We designed, optimized, and extensively tested several sensitive and specific real-time PCR assays for rapid detection of both smallpox and pan-orthopox virus DNAs. The assays are based on TaqMan 3′-minor groove binder chemistry and were performed on both the rapid-cycling Roche LightCycler and the Cepheid Smart Cycler platforms. The hemagglutinin (HA) J7R, B9R, and B10R genes were used as targets for the variola virus-specific assays, and the HA and DNA polymerase-E9L genes were used as targets for the pan-orthopox virus assays. The five orthopox virus assays were tested against a panel of orthopox virus DNAs (both genomic and cloned) at the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID). The results indicated that each assay was capable of detecting both the appropriate cloned gene and genomic DNA. The assays showed no cross-reactivity to the 78 DNAs in the USAMRIID bacterial cross-reactivity panel. The limit of detection (LOD) of each assay was determined to be between 12 and 25 copies of target DNA. The assays were also run against a blind panel of DNAs at the Centers for Disease Control and Prevention (CDC) on both the LightCycler and the Smart Cycler. The panel consisted of eight different variola virus isolates, five non-variola virus orthopox virus isolates, two varicella-zoster virus isolates, and one herpes simplex virus isolate. Each sample was tested in triplicate at 2.5 ng, 25 pg, 250 fg, and 2.5 fg, which represent 1.24 × 107, 1.24 × 105, 1.24 × 103, and 1.24 × 101 genome equivalents, respectively. The results indicated that each of the five assays was 100% specific (no false positives) when tested against both the USAMRIID panels and the CDC blind panel. With the CDC blind panel, the LightCycler was capable of detecting 96.2% of the orthopox virus DNAs and 93.8% of the variola virus DNAs. The Smart Cycler was capable of detecting 92.3% of the orthopox virus DNAs and between 75 and 93.8% of the variola virus DNAs. However

  4. Establishment of a minor groove binder-probe based quantitative real time PCR to detect Borrelia burgdorferi sensu lato and differentiation of Borrelia spielmanii by ospA-specific conventional PCR

    Directory of Open Access Journals (Sweden)

    Strube Christina

    2010-08-01

    Full Text Available Abstract Background Borrelia burgdorferi sensu lato (sl, the causative agent of Lyme borreliosis, is transmitted by ticks of the genus Ixodes as vector. For identification of Borrelia infections in ticks a TaqMan™ minor groove binder (MGB probe-based quantitative real time PCR (qPCR was established targeting the 5S-23S intergenic spacer. Extension to a duplex qPCR included an Ixodes spp. positive control to verify successful DNA isolation. Besides qPCR, an ospA-specific conventional PCR for species-specific identification of B. spielmanii was established. Afterwards 1000 I. ricinus flagged in the city of Hanover, Germany, were investigated for B. burgdorferi sl infections followed by species identification. Furthermore, I. hexagonus ticks were investigated to proof applicability of the PCRs. Results Quantitative real time PCR (qPCR identifying B. burgdorferi sl in ticks was able to detect 1-10 copies per reaction. B. spielmanii ospA-specific conventional PCR was also highly specific and showed no cross reactions with the other tested Borrelia species. From 1000 hanoveranian ticks 24.3% were positive compared to only 7.4% positives by dark-field microscopy. Related to tick stage 1.7% larvae, 18.1% nymphs, and 34.6% adults were positive. The most frequent species was B. garinii, followed by B. afzelii, B. spielmanii, B. valaisiana and B. burgdorferi sensu stricto (ss. 70.6% of I. ricinus were mono-infected, whereas 28.0% and 1.4% were infected with two and three Borrelia species, respectively. From 232 I. hexagonus collected from hedgehogs in different sites of Germany, qPCR detected 5.7% to be infected with B. burgdorferi sl, which were identified as B. afzelii, B. garinii and B. spielmanii. Conclusions The evaluated qPCR to detect B. burgdorferi sl in Ixodes spp. is highly specific and sensitive. As a duplex qPCR including detection of Ixodes spp. DNA it is the first DNA based technique incorporating a control for successful DNA isolation from

  5. Cations form sequence selective motifs within DNA grooves via a combination of cation-pi and ion-dipole/hydrogen bond interactions.

    Science.gov (United States)

    Stewart, Mikaela; Dunlap, Tori; Dourlain, Elizabeth; Grant, Bryce; McFail-Isom, Lori

    2013-01-01

    The fine conformational subtleties of DNA structure modulate many fundamental cellular processes including gene activation/repression, cellular division, and DNA repair. Most of these cellular processes rely on the conformational heterogeneity of specific DNA sequences. Factors including those structural characteristics inherent in the particular base sequence as well as those induced through interaction with solvent components combine to produce fine DNA structural variation including helical flexibility and conformation. Cation-pi interactions between solvent cations or their first hydration shell waters and the faces of DNA bases form sequence selectively and contribute to DNA structural heterogeneity. In this paper, we detect and characterize the binding patterns found in cation-pi interactions between solvent cations and DNA bases in a set of high resolution x-ray crystal structures. Specifically, we found that monovalent cations (Tl⁺) and the polarized first hydration shell waters of divalent cations (Mg²⁺, Ca²⁺) form cation-pi interactions with DNA bases stabilizing unstacked conformations. When these cation-pi interactions are combined with electrostatic interactions a pattern of specific binding motifs is formed within the grooves.

  6. Selenium nanoparticles synthesized in aqueous extract of Allium sativum perturbs the structural integrity of Calf thymus DNA through intercalation and groove binding.

    Science.gov (United States)

    Ezhuthupurakkal, Preedia Babu; Polaki, Lokeswara Rao; Suyavaran, Arumugam; Subastri, Ariraman; Sujatha, Venugopal; Thirunavukkarasu, Chinnasamy

    2017-05-01

    Biomedical application of selenium nanoparticles (SeNPs) demands the eco-friendly composite for synthesis of SeNPs. The present study reports an aqueous extract of Allium sativum (AqEAS) plug-up the current need. Modern spectroscopic, microscopic and gravimetric techniques were employed to characterize the synthesized nanoparticles. Characterization studies revealed the formation of crystalline spherical shaped SeNPs. FTIR spectrum brings out the presence of different functional groups in AqEAS, which influence the SeNPs formation and stabilization. Furthermore the different aspects of the interaction between SeNPs and CT-DNA were scrutinized by various spectroscopic and cyclic voltametric studies. The results reveals the intercalation and groove binding mode of interaction of SeNPs with stacked base pair of CT-DNA. The Stern-Volmer quenching constant (K SV ) were found to be 7.02×10 6 M- 1 (ethidium bromide), 4.22×10 6 M- 1 (acridine orange) and 7.6×10 6 M- 1 (Hoechst) indicating strong binding of SeNPs with CT-DNA. The SeNPs - CT-DNA interactions were directly visualized by atomic force microscopy. The present study unveils the cost effective, innocuous, highly stable SeNPs intricate mechanism of DNA interaction, which will be a milestone in DNA targeted chemotherapy. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Allosteric analysis of glucocorticoid receptor-DNA interface induced by cyclic Py-Im polyamide: a molecular dynamics simulation study.

    Directory of Open Access Journals (Sweden)

    Yaru Wang

    Full Text Available BACKGROUND: It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. METHODOLOGY/PRINCIPAL FINDINGS: In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. CONCLUSIONS/SIGNIFICANCE: We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.

  8. Chromosomal locations of four minor rDNA loci and a marker microsatellite sequence in barley

    DEFF Research Database (Denmark)

    Pedersen, C.; Linde-Laursen, I.

    1994-01-01

    is located about 54% out on the short arm of chromosome 4 and it has not previously been reported in barley. We have designated the new locus Nor-I6. rDNA loci on homoeologous group 4 chromosomes have not yet been reported in other Triticeae species. The origin of these 4 minor rDNA loci is discussed...

  9. Anticancer drug mithramycin interacts with core histones: An additional mode of action of the DNA groove binder

    Directory of Open Access Journals (Sweden)

    Amrita Banerjee

    2014-01-01

    Full Text Available Mithramycin (MTR is a clinically approved DNA-binding antitumor antibiotic currently in Phase 2 clinical trials at National Institutes of Health for treatment of osteosarcoma. In view of the resurgence in the studies of this generic antibiotic as a human medicine, we have examined the binding properties of MTR with the integral component of chromatin – histone proteins – as a part of our broad objective to classify DNA-binding molecules in terms of their ability to bind chromosomal DNA alone (single binding mode or both histones and chromosomal DNA (dual binding mode. The present report shows that besides DNA, MTR also binds to core histones present in chromatin and thus possesses the property of dual binding in the chromatin context. In contrast to the MTR–DNA interaction, association of MTR with histones does not require obligatory presence of bivalent metal ion like Mg2+. As a consequence of its ability to interact with core histones, MTR inhibits histone H3 acetylation at lysine 18, an important signature of active chromatin, in vitro and ex vivo. Reanalysis of microarray data of Ewing sarcoma cell lines shows that upon MTR treatment there is a significant down regulation of genes, possibly implicating a repression of H3K18Ac-enriched genes apart from DNA-binding transcription factors. Association of MTR with core histones and its ability to alter post-translational modification of histone H3 clearly indicates an additional mode of action of this anticancer drug that could be implicated in novel therapeutic strategies.

  10. Radiation sensitization by an iodine-labelled DNA ligand

    Energy Technology Data Exchange (ETDEWEB)

    Martin, R F; Murray, V; D' Cunha, G; Pardee, M; Haigh, A; Hodgson, G S [Peter MacCallum Cancer Inst., Melbourne (Australia); Kampouris, E; Kelly, D P [Melbourne Univ., Parkville (Australia)

    1990-05-01

    An iodinated DNA ligand, iodoHoechst 33258, which binds in the minor groove of DNA, enhances DNA strand breakage and cell killing by UV-A irradiation. The sites of UV-induced strand breaks reflect the known sequence specificity of the ligand. (author).

  11. Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures.

    Science.gov (United States)

    Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis

    2013-12-23

    At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

  12. Grooved cold moderator tests

    International Nuclear Information System (INIS)

    Inoue, K.; Kiyanagi, Y.; Iwasa, H.; Watanabe, N.; Ikeda, S.; Carpenter, J.M.; Ishikawa, Y.

    1983-01-01

    We performed some grooved cold moderator experiments for methane at 20 K by using the Hokkaido University linac to obtain information to be used in the planning of the KENS-I' project. Cold neutron gains, spatial distribution of emitted beams and time distribution of the neutrons in the grooved cold moderator were measured. Furthermore, we assessed the effects of the grooved cold moderator on the performances of the spectrometers presently installed at the KENS-I cold source. We concluded that the grooved cold moderator benefited appreciably the performances of the spectrometers

  13. DNA conformational analysis in solution by uranyl mediated photocleavage

    DEFF Research Database (Denmark)

    Nielsen, Peter E.; Møllegaard, N E; Jeppesen, C

    1990-01-01

    Uranyl mediated photocleavage of double stranded DNA is proposed as a general probing for DNA helix conformation in terms of minor groove width/electronegative potential. Specifically, it is found that A/T-tracts known to constitute strong distamycin binding sites are preferentially photocleaved ......, uranyl photocleavage of the internal control region (ICR) of the 5S-RNA gene yields a cleavage modulation pattern fully compatible with that obtained by DNase I which also--in a more complex way--senses DNA minor groove width....

  14. cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications.

    Science.gov (United States)

    Wani, Gowher A; Shah, Manzoor A; Reshi, Zafar A; Atangana, Alain R; Khasa, Damase P

    2014-07-01

    A lack of genetic markers impedes our understanding of the population biology of Lemna minor. Thus, the development of appropriate genetic markers for L. minor promises to be highly useful for population genetic studies and for addressing other life history questions regarding the species. • For the first time, we characterized nine polymorphic and 24 monomorphic chloroplast microsatellite markers in L. minor using DNA samples of 26 individuals sampled from five populations in Kashmir and of 17 individuals from three populations in Quebec. Initially, we designed 33 primer pairs, which were tested on genomic DNA from natural populations. Nine loci provided markers with two alleles. Based on genotyping of the chloroplast DNA fragments from 43 sampled individuals, we identified one haplotype in Quebec and 11 haplotypes in Kashmir, of which one occurs in 56% of the genotypes, one in 8%, and nine in 4%, respectively. There was a maximum of two alleles per locus. • These new chloroplast microsatellite markers for L. minor and haplotype distribution patterns indicate a complex phylogeographic history that merits further investigation.

  15. cpDNA microsatellite markers for Lemna minor (Araceae): Phylogeographic implications1

    Science.gov (United States)

    Wani, Gowher A.; Shah, Manzoor A.; Reshi, Zafar A.; Atangana, Alain R.; Khasa, Damase P.

    2014-01-01

    • Premise of the study: A lack of genetic markers impedes our understanding of the population biology of Lemna minor. Thus, the development of appropriate genetic markers for L. minor promises to be highly useful for population genetic studies and for addressing other life history questions regarding the species. • Methods and Results: For the first time, we characterized nine polymorphic and 24 monomorphic chloroplast microsatellite markers in L. minor using DNA samples of 26 individuals sampled from five populations in Kashmir and of 17 individuals from three populations in Quebec. Initially, we designed 33 primer pairs, which were tested on genomic DNA from natural populations. Nine loci provided markers with two alleles. Based on genotyping of the chloroplast DNA fragments from 43 sampled individuals, we identified one haplotype in Quebec and 11 haplotypes in Kashmir, of which one occurs in 56% of the genotypes, one in 8%, and nine in 4%, respectively. There was a maximum of two alleles per locus. • Conclusions: These new chloroplast microsatellite markers for L. minor and haplotype distribution patterns indicate a complex phylogeographic history that merits further investigation. PMID:25202636

  16. cpDNA Microsatellite Markers for Lemna minor (Araceae: Phylogeographic Implications

    Directory of Open Access Journals (Sweden)

    Gowher A. Wani

    2014-07-01

    Full Text Available Premise of the study: A lack of genetic markers impedes our understanding of the population biology of Lemna minor. Thus, the development of appropriate genetic markers for L. minor promises to be highly useful for population genetic studies and for addressing other life history questions regarding the species. Methods and Results: For the first time, we characterized nine polymorphic and 24 monomorphic chloroplast microsatellite markers in L. minor using DNA samples of 26 individuals sampled from five populations in Kashmir and of 17 individuals from three populations in Quebec. Initially, we designed 33 primer pairs, which were tested on genomic DNA from natural populations. Nine loci provided markers with two alleles. Based on genotyping of the chloroplast DNA fragments from 43 sampled individuals, we identified one haplotype in Quebec and 11 haplotypes in Kashmir, of which one occurs in 56% of the genotypes, one in 8%, and nine in 4%, respectively. There was a maximum of two alleles per locus. Conclusions: These new chloroplast microsatellite markers for L. minor and haplotype distribution patterns indicate a complex phylogeographic history that merits further investigation.

  17. Endosonography of groove pancreatitis

    NARCIS (Netherlands)

    Tio, T. L.; Luiken, G. J.; Tytgat, G. N.

    1991-01-01

    Groove pancreatitis is a rare form of chronic pancreatitis. Distinction between pancreatitis and pancreatic carcinoma is often difficult. Two cases of groove pancreatitis diagnosed by endosonography are described. A hypoechoic pattern between the duodenal wall and pancreas was clearly imaged in both

  18. First branchial groove anomaly.

    Science.gov (United States)

    Kumar, M; Hickey, S; Joseph, G

    2000-06-01

    First branchial groove anomalies are very rare. We report a case of a first branchial groove anomaly presented as an infected cyst in an 11-month-old child. Management of such lesions is complicated because of their close association with the facial nerve. Surgical management must include identification and protection of the facial nerve. Embryology and facial nerve disposition in relation to the anomaly are reviewed.

  19. Dual-phase CT findings of groove pancreatitis

    Energy Technology Data Exchange (ETDEWEB)

    Zaheer, Atif, E-mail: azaheer1@jhmi.edu [The Russell H. Morgan Department of Radiology and Radiological Science, Johns Hopkins Medical Institutions, Baltimore, MD 21231 (United States); Pancreatitis Center, Division of Gastroenterology, Department of Medicine, Johns Hopkins Medical Institutions, Baltimore, MD 21231 (United States); Haider, Maera, E-mail: mhaider3@jhmi.edu [The Russell H. Morgan Department of Radiology and Radiological Science, Johns Hopkins Medical Institutions, Baltimore, MD 21231 (United States); Kawamoto, Satomi, E-mail: skawamo1@jhmi.edu [The Russell H. Morgan Department of Radiology and Radiological Science, Johns Hopkins Medical Institutions, Baltimore, MD 21231 (United States); Hruban, Ralph H., E-mail: rhruban1@jhmi.edu [Department of Pathology, The Sol Goldman Pancreatic Cancer Research Center, the Johns Hopkins University School of Medicine, Baltimore, MD 21231 (United States); Fishman, Elliot K., E-mail: efishma1@jhmi.edu [The Russell H. Morgan Department of Radiology and Radiological Science, Johns Hopkins Medical Institutions, Baltimore, MD 21231 (United States)

    2014-08-15

    Purpose: Groove pancreatitis is a rare focal form of chronic pancreatitis that occurs in the pancreaticoduodenal groove between the major and minor papillae, duodenum and pancreatic head. Radiologic appearance and clinical presentation can result in suspicion of malignancy rendering pancreaticoduodenectomy inevitable. This study reports dual phase CT findings in a series of 12 patients with pathology proven groove pancreatitis. Materials and methods: Retrospective review of preoperative CT findings in 12 patients with histologically proven groove pancreatitis after pancreaticoduodenectomy. Size, location, attenuation, presence of mass or cystic components in the pancreas, groove and duodenum, calcifications, duodenal stenosis and ductal changes were recorded. Clinical data, laboratory values, endoscopic ultrasonographic and histopathological findings were collected. Results: Soft tissue thickening in the groove was seen in all patients. Pancreatic head, groove and duodenum were all involved in 75% patients. A discrete lesion in the pancreatic head was seen in half of the patients, most of which appeared hypodense on both arterial and venous phases. Cystic changes in pancreatic head were seen in 75% patients. Duodenal involvement was seen in 92% patients including wall thickening and cyst formation. The main pancreatic duct was dilated in 7 patients, with an abrupt cut off in 3 and a smooth tapering stricture in 4. Five patients had evidence of chronic pancreatitis with parenchymal calcifications. Conclusion: Presence of mass or soft tissue thickening in the groove with cystic duodenal thickening is highly suggestive of groove pancreatitis. Recognizing common radiological features may help in diagnosis and reduce suspicion of malignancy.

  20. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-13

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

  1. DNA exit ramps are revealed in the binding landscapes obtained from simulations in helical coordinates.

    Directory of Open Access Journals (Sweden)

    Ignacia Echeverria

    2015-02-01

    Full Text Available DNA molecules are highly charged semi-flexible polymers that are involved in a wide variety of dynamical processes such as transcription and replication. Characterizing the binding landscapes around DNA molecules is essential to understanding the energetics and kinetics of various biological processes. We present a curvilinear coordinate system that fully takes into account the helical symmetry of a DNA segment. The latter naturally allows to characterize the spatial organization and motions of ligands tracking the minor or major grooves, in a motion reminiscent of sliding. Using this approach, we performed umbrella sampling (US molecular dynamics (MD simulations to calculate the three-dimensional potentials of mean force (3D-PMFs for a Na+ cation and for methyl guanidinium, an arginine analog. The computed PMFs show that, even for small ligands, the free energy landscapes are complex. In general, energy barriers of up to ~5 kcal/mol were measured for removing the ligands from the minor groove, and of ~1.5 kcal/mol for sliding along the minor groove. We shed light on the way the minor groove geometry, defined mainly by the DNA sequence, shapes the binding landscape around DNA, providing heterogeneous environments for recognition by various ligands. For example, we identified the presence of dissociation points or "exit ramps" that naturally would terminate sliding. We discuss how our findings have important implications for understanding how proteins and ligands associate and slide along DNA.

  2. Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

    Science.gov (United States)

    Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

    2009-01-01

    Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

  3. EDM Electrode for Internal Grooves

    Science.gov (United States)

    Ramani, V.; Werner, A.

    1985-01-01

    Electroerosive process inexpensive alternative to broaching. Hollow brass electrodes, soldered at one end to stainless-steel holding ring, held in grooves in mandrel. These electrodes used to machine grooves electrically in stainless-steel tube three-eights inch (9.5 millimeters) in diameter. Tool used on tubes already in place in equipment.

  4. Mercury induced oxidative stress, DNA damage, and activation of antioxidative system and Hsp70 induction in duckweed (Lemna minor).

    Science.gov (United States)

    Zhang, Tingting; Lu, Qianqian; Su, Chunlei; Yang, Yaru; Hu, Dan; Xu, Qinsong

    2017-09-01

    Mercury uptake and its effects on physiology, biochemistry and genomic stability were investigated in Lemna minor after 2 and 6d of exposure to 0-30μM Hg. The accumulation of Hg increased in a concentration- and duration-dependent manner, and was positively correlated with the leaf damage. Oxidative stress after Hg exposure was evidenced in L. minor by a significant decrease in photosynthetic pigments, an increase in malondialdehyde and lipoxygenase activities (total enzyme activity and isoenzymes activity). Fronds of L. minor exposed to Hg showed an induction of peroxidase, catalase, and ascorbate peroxidase activities (total enzyme activity and some isoenzymes activities). Exposure of L. minor to Hg reduced the activity (total enzyme activity and some isoenzymes activities) of glutathione reductase, and superoxide dismutase. Exposure to Hg produced a transient increase in the content of glutathione and ascorbic acid. The content of dehydroascorbate and oxidized glutathione in L. minor were high during the entire exposure period. Exposure of L. minor to Hg also caused the accumulation of proline and soluble sugars. The amplification of new bands and the absence of normal DNA amplicons in treated plants in the random amplified polymorphic DNA (RAPD) profile indicated that genomic template stability (GTS) was affected by Hg treatment. The accumulation of Hsp70 indicated the occurrence of a heat shock response at all Hg concentrations. These results suggest that L. minor plants were able to cope with Hg toxicity through the activation of various mechanisms involving enzymatic and non-enzymatic antioxidants, up-regulation of proline, and induction of Hsp70. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Room to Groove?

    DEFF Research Database (Denmark)

    Seabrooke, Leonard

    . As long as they stay within the parameters of legitimate financial practice to signal institutional isomorphism, the `groove', creditors may well allow borrowers room for change in self-determined ways. This paper maps out the historical and conceptual terrain concerning civilizing ideas about...... the legitimacy of financial practices within global capital markets, and investigates relationships between Western `civilizers' and Emerging Market Economies during the last two periods of financial globalization, the late-nineteenth/ early-twentieth centuries and the late-twentieth century.......The use of a `standard of civilization', a preferred form of socio-political organization, in global capital markets presents both constraints and opportunities for creditors and borrowers. When imposed, civilizing standards may change how a borrower would prefer to conduct their affairs. Creditors...

  6. Synthesis of acetylene linked double-nucleobase nucleos(t)ide building blocks and polymerase construction of DNA containing cytosines in the major groove

    Czech Academy of Sciences Publication Activity Database

    Kielkowski, Pavel; Pohl, Radek; Hocek, Michal

    2011-01-01

    Roč. 76, č. 9 (2011), s. 3457-3462 ISSN 0022-3263 R&D Projects: GA MŠk LC512; GA ČR GA203/09/0317 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleoside triphosphates * functionalized DNA * cross - coupling reactions * nucleic-acids Subject RIV: CC - Organic Chemistry Impact factor: 4.450, year: 2011

  7. Detection of minor and major satellite DNA in cytokinesis-blocked mouse splenocytes by a PRINS tandem labelling approach.

    Science.gov (United States)

    Russo, A; Tommasi, A M; Renzi, L

    1996-11-01

    A protocol for the simultaneous visualization of minor and major satellite DNA by primed in situ DNA synthesis (PRINS) was developed in cytokinesis-blocked murine splenocytes. After individuation of optimal experimental conditions, a micronucleus (MN) test was carried out by treating splenocytes in vitro with the clastogenic agent mitomycin C and the aneugenic compound Colcemid. It was found that PRINS gives highly reproducible results, also comparable with the literature on MN results obtained by fluorescent in situ hybridization (FISH). Therefore the PRINS methodology may be proposed as a fast alternative to FISH for the characterization of induced MN.

  8. Unusual hydrogen bonding patterns in AF [aminofluorene] and AAF [acetylaminofluorene] modified DNA

    International Nuclear Information System (INIS)

    Broyde, S.; Hingerty, B.E.; Shapiro, R.; Norman, D.; Oak Ridge National Lab., TN; New York Univ., NY; Columbia Univ., New York, NY

    1989-01-01

    New structures are presented for AF and AAF modified DNAs that place the carcinogen in the minor groove of a B-DNA helix. These structures employ non-Watson-Crick base pairing schemes with syn guanine at the modification site. 32 refs., 9 figs

  9. Olfactory groove meningiomas.

    Science.gov (United States)

    Hentschel, Stephen J; DeMonte, Franco

    2003-06-15

    Olfactory groove meningiomas (OGMs) arise over the cribriform plate and may reach very large sizes prior to presentation. They can be differentiated from tuberculum sellae meningiomas because OGMs arise more anterior in the skull base and displace the optic nerve and chiasm inferiorly rather than superiorly. The authors searched the neurosurgery database at the M. D. Anderson Cancer Center for cases of OGM treated between 1993 and 2003. The records of these patients were then reviewed retrospectively for details regarding clinical presentation, imaging findings, surgical results and complications, and follow-up status. Thirteen patients, (12 women and one man, mean age 56 years) harbored OGMs (mean size 5.7 cm). All patients underwent bifrontal craniotomies and biorbital osteotomies. There were 11 complete resections (including the hyperostotic bone and dura of the cribriform plate and any extension into the ethmoid sinuses) and two subtotal resections with minimal residual tumor left in patients with recurrent lesions. No complication directly due to the surgery occurred in any patient. There were no recurrences in a mean follow-up period of 2 years (range 0-5 years). With current microsurgical techniques, the results of OGM resection are excellent, with a high rate of total resection and a low incidence of complications. All hyperostotic bone should be removed with the dura of the anterior skull base to minimize the risk of recurrence.

  10. A survey of the sequence-specific interaction of damaging agents with DNA: emphasis on antitumor agents.

    Science.gov (United States)

    Murray, V

    1999-01-01

    This article reviews the literature concerning the sequence specificity of DNA-damaging agents. DNA-damaging agents are widely used in cancer chemotherapy. It is important to understand fully the determinants of DNA sequence specificity so that more effective DNA-damaging agents can be developed as antitumor drugs. There are five main methods of DNA sequence specificity analysis: cleavage of end-labeled fragments, linear amplification with Taq DNA polymerase, ligation-mediated polymerase chain reaction (PCR), single-strand ligation PCR, and footprinting. The DNA sequence specificity in purified DNA and in intact mammalian cells is reviewed for several classes of DNA-damaging agent. These include agents that form covalent adducts with DNA, free radical generators, topoisomerase inhibitors, intercalators and minor groove binders, enzymes, and electromagnetic radiation. The main sites of adduct formation are at the N-7 of guanine in the major groove of DNA and the N-3 of adenine in the minor groove, whereas free radical generators abstract hydrogen from the deoxyribose sugar and topoisomerase inhibitors cause enzyme-DNA cross-links to form. Several issues involved in the determination of the DNA sequence specificity are discussed. The future directions of the field, with respect to cancer chemotherapy, are also examined.

  11. Optics of multiple grooves in metal

    DEFF Research Database (Denmark)

    Skjølstrup, Enok Johannes Haahr; Søndergaard, Thomas; Pedersen, Kjeld

    2017-01-01

    This paper studies theoretically how the optics of multiple grooves in a metal change as the number of grooves is increased gradually from a single groove to innitely many arranged in a periodic array. In the case of a single groove the out-of-plane scattering (OUP) cross section at resonance can...

  12. Optics of multiple grooves in metal

    DEFF Research Database (Denmark)

    Skjølstrup, Enok Johannes Haahr; Søndergaard, Thomas; Pedersen, Kjeld

    2017-01-01

    This paper theoretically studies how the optics of multiple grooves in a metal change as the number of grooves gradually increased from a single groove to infinitely many arranged in a periodic array. In the case of a single groove, the out-of-plane scattering (OUP) cross section at resonance can...

  13. In-vitro DNA binding and cleavage studies with pBR322 of N,N-Bis(3{beta}-acetoxy-5{alpha}-cholest-6-yl-idene)hydrazine

    Energy Technology Data Exchange (ETDEWEB)

    Tabassum, Zishan [School of Industrial Technology, Universiti Sains Malaysia, 11800 USM, Penang (Malaysia); Muddassir, Mohd [Department of Chemistry, Aligarh Muslim University, Aligarh 202002, U.P. (India); Sulaiman, Othman [School of Industrial Technology, Universiti Sains Malaysia, 11800 USM, Penang (Malaysia); Arjmand, Farukh [Department of Chemistry, Aligarh Muslim University, Aligarh 202002, U.P. (India)

    2012-08-15

    The DNA binding studies of the triterpenoid derivative, cholesterol, N,N-Bis(3{beta}-acetoxy-5{alpha}-cholest-6-yl-idene)hydrazine (L) with CT DNA were carried out by employing different optical methods viz, UV-vis and fluorescence spectroscopy. The ligand binds to DNA through hydrophobic interaction with K{sub b} value found to be 4.7 Multiplication-Sign 10{sup 3} M{sup -1}. These observations have been validated also by fluorescence spectroscopy. (L) exhibits a remarkable DNA cleavage activity with pBR322 DNA in the presence of different activators and the DNA is probably cleaved by an other than oxidative mechanism, possibly by a discernable hydrolytic pathway. In the presence of major and minor groove binding agents, (L) prefers major groove binding of the DNA. - Highlights: Black-Right-Pointing-Pointer DNA binding studies of the triterpenoid derivative, cholesterol, N,N-Bis(3{beta}-acetoxy-5{alpha}-cholest-6-yl-idene)hydrazine. Black-Right-Pointing-Pointer The ligand binds to DNA through hydrophobic interaction with K{sub b} value found to be 4.7 Multiplication-Sign 10{sup 3} M{sup -1}. Black-Right-Pointing-Pointer DNA is probably cleaved by an other than oxidative mechanism, possibly by a discernable hydrolytic pathway. Black-Right-Pointing-Pointer In the presence of major and minor groove binding agents, the (L) prefers major groove binding of the DNA.

  14. In-vitro DNA binding and cleavage studies with pBR322 of N,N-Bis(3β-acetoxy-5α-cholest-6-yl-idene)hydrazine

    International Nuclear Information System (INIS)

    Tabassum, Zishan; Muddassir, Mohd; Sulaiman, Othman; Arjmand, Farukh

    2012-01-01

    The DNA binding studies of the triterpenoid derivative, cholesterol, N,N-Bis(3β-acetoxy-5α-cholest-6-yl-idene)hydrazine (L) with CT DNA were carried out by employing different optical methods viz, UV–vis and fluorescence spectroscopy. The ligand binds to DNA through hydrophobic interaction with K b value found to be 4.7×10 3 M −1 . These observations have been validated also by fluorescence spectroscopy. (L) exhibits a remarkable DNA cleavage activity with pBR322 DNA in the presence of different activators and the DNA is probably cleaved by an other than oxidative mechanism, possibly by a discernable hydrolytic pathway. In the presence of major and minor groove binding agents, (L) prefers major groove binding of the DNA. - Highlights: ► DNA binding studies of the triterpenoid derivative, cholesterol, N,N-Bis(3β-acetoxy-5α-cholest-6-yl-idene)hydrazine. ► The ligand binds to DNA through hydrophobic interaction with K b value found to be 4.7×10 3 M −1 . ► DNA is probably cleaved by an other than oxidative mechanism, possibly by a discernable hydrolytic pathway. ► In the presence of major and minor groove binding agents, the (L) prefers major groove binding of the DNA.

  15. In vitro study on the interaction of 4,4-dimethylcurcumin with calf thymus DNA

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Bing-Mi, E-mail: liubingmi@163.com [Department of Pharmacy, Liaoning University, Shenyang 110036 (China); Bai, Chong-Liang [Centre for Molecular Science and Engineering, Northeastern University, Shenyang 110819 (China); Zhang, Jun; Liu, Yang; Dong, Bo-Yang; Zhang, Yi-Tong [Department of Pharmacy, Liaoning University, Shenyang 110036 (China); Liu, Bin, E-mail: liubinzehao@163.com [Department of Pharmacy, Liaoning University, Shenyang 110036 (China)

    2015-10-15

    The interaction of 4,4-dimethylcurcumin (DMCU), a synthesized analog of curcumin, with calf-thymus DNA (ct-DNA) was investigated using fluorescence, absorption, and circular dichroism (CD) spectroscopy, coupled with viscosity measurements and molecular docking techniques. DMCU was found to bind to ct-DNA with moderate binding affinity through groove binding as evidenced by a decrease in the absorption intensity in combination with no obvious change in the relative specific viscosity of ct-DNA and the CD spectrum. Thermodynamic analysis of the fluorescence data obtained at different temperatures suggested that the binding process was spontaneous and was primarily driven by hydrogen bonding and van der Waals forces. Furthermore, competitive binding experiments with ethidium bromide and 4′,6-diamidino-2-phenylindole as probes showed that DMCU could preferentially bind in the minor groove of double-stranded DNA. The results obtained from the molecular docking studies were consistent with these experimental results. This study explored the potential applicability of the spectroscopic properties of DMCU for studying its interactions with relevant biological or biomimicking targets. - Highlights: • 4,4-dimethylcurcumin (DMCU) has strong fluorescence characteristics. • DMCU could bind to DNA through groove binding. • Docking studies revealed that DMCU bound to the A–T region in the minor groove.

  16. Phosphate vibrations as reporters of DNA hydration

    Science.gov (United States)

    Corcelli, Steven

    The asymmetric phosphate stretch vibrational frequency is extraordinarily sensitive to its local solvent environment. Using density functional theory calculations on the model compound dimethyl phosphate, the asymmetric phosphate stretch vibrational frequency was found to shift linearly with the magnitude of an electric field along the symmetry axis of the PO2 moiety (i.e. the asymmetric phosphate stretch is an excellent linear vibrational Stark effect probe). With this linear relationship established, asymmetric phosphate stretch vibrational frequencies were computed during the course of a molecular dynamics simulation of fully hydrated DNA. Moreover, contributions to shifts in the frequencies from subpopulations of water molecules (e.g. backbone, minor groove, major groove, etc.) were calculated to reveal how phosphate vibrations report the onset of DNA hydration in experiments that vary the relative humidity of non-condensing (dry) DNA samples.

  17. Smallpox and pan-Orthodox Virus Detection by Real-Time 3’-Minor Groove Binder TaqMan Assays Oil the Roche LightCycler and the Cepheid Smart Cycler Platforms

    Science.gov (United States)

    2003-11-08

    Bacillus anthracis BA0068 Ames Sterne SPS 97.13.213 Bacillus cereus Bacillus coagulans Bacillus licheniformis Bacillus macerans Bacillus ...megaterium Bacillus polymyxa Bacillus sphaericus Bacillus stearothermophilus Bacillus subtilis subsp. niger Bacillus thuringiensis Bacillus popilliae...varicella- zoster virus, and Bacillus anthracis DNA by LightCycler polymerase chain reaction after autoclaving:

  18. Essential C-Terminal region of the baculovirus minor capsid protein VP80 binds DNA

    NARCIS (Netherlands)

    Marek, M.; Merten, O.W.; Francis-Devaraj, F.; Oers, van M.M.

    2012-01-01

    The essential Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) minor capsid protein VP80 has been recently shown to interact with the virus-triggered, nuclear F-actin cytoskeleton. A role for VP80 in virus morphogenesis has been proposed in the maturation of progeny nucleocapsids and

  19. Optics of multiple ultrasharp grooves in metal

    DEFF Research Database (Denmark)

    Skjølstrup, Enok Johannes Haahr; Søndergaard, Thomas

    2017-01-01

    . When the multiple-groove array is illuminated by a plane wave the out-of-plane scattering is found to be extraordinarily large compared with the expected maximum from a geometric-optics estimate even for array widths of many wavelengths. The out-of-plane scattering is even higher per groove compared......The optics of multiple ultrasharp sub-wavelength grooves in metal is studied theoretically. Focus is on the transition from a single groove, where the scattering cross section is significant and can exceed the groove width, to infinitely many grooves in a periodic array with very low reflectance...

  20. Strand breaks in plasmid DNA following positional changes of Auger-electron-emitting radionuclides

    International Nuclear Information System (INIS)

    Adelstein, S.J.; Kassis, A.I.

    1996-01-01

    The purpose of our studies is to elucidate the kinetics of DNA strand breaks caused by low-energy Auger electron emitters in close proximity to DNA. Previously we have studied the DNA break yields in plasmids after the decay of indium-111 bound to DNA or free in solution. In this work, we compare the DNA break yields in supercoiled DNA of iodine-125 decaying close to DNA following DNA intercalation, minor-groove binding, or surface binding, and at a distance form DNA. Supercoiled DNA, stored at 4 C to accumulate radiation dose from the decay of 125 I, was then resolved by gel electrophoresis into supercoiled, nicked circular, and linear forms, representing undamaged DNA, single-strand breaks, and double-strand breaks respectively. DNA-intercalated or groove-bound 125 I is more effective than surface-bound radionuclide or 125 I free in solution. The hydroxyl radical scavenger DMSO protects against damage by 125 I free in solution but has minimal effect on damage by groove-bound 125 I. (orig.)

  1. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    International Nuclear Information System (INIS)

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  2. Synthesis of a Hoechst 32258 Analogue Amino Acid Building Block for Direct Incorporation of a Fluorescent High-Affinity DNA Binding Motif into Peptides

    DEFF Research Database (Denmark)

    Harrit, Niels; Behrens, Carsten; Nielsen, P. E.

    2001-01-01

    The synthesis of a new versatile "Hoechst 33258-like" Boc-protected amino acid building block for peptide synthesis is described. It is demonstrated that this new ligand is an effective mimic of Hoechst 33258 in terms of DNA affinity and sequence specificity. Furthermore, this minor groove binder...

  3. Great Lakes DNA barcode reference library: Mollusca, annelida, and minor phyla

    Science.gov (United States)

    In recent years, the research and development of DNA-based tools has improved both their sensitivity and costs. This technology has the potential to be useful in the early detection of aquatic invasive species, and can increase the scope of surveillance compared with traditional ...

  4. Perturbations in DNA structure upon interaction with porphyrins revealed by chemical probes, DNA footprinting and molecular modelling.

    Science.gov (United States)

    Ford, K G; Neidle, S

    1995-06-01

    The interactions of several porphyrins with a 74 base-pair DNA sequence have been examined by footprinting and chemical protection methods. Tetra-(4-N-methyl-(pyridyl)) porphyrin (TMPy), two of its metal complexes and tetra-(4-trimethylanilinium) porphyrin (TMAP) bind to closely similar AT-rich sequences. The three TMPy ligands produce modest changes in DNA structure and base accessibility on binding, in contrast to the large-scale conformational changes observed with TMAP. Molecular modelling studies have been performed on TMPy and TMAP bound in the AT-rich minor groove of an oligonucleotide. These have shown that significant structural change is needed to accommodate the bulky trimethyl substituent groups of TMAP, in contrast to the facile minor groove fit of TMPy.

  5. Crystallographic study of one turn of G/C-rich B-DNA.

    Science.gov (United States)

    Heinemann, U; Alings, C

    1989-11-20

    The DNA decamer d(CCAGGCCTGG) has been studied by X-ray crystallography. At a nominal resolution of 1.6 A, the structure was refined to R = 16.9% using stereochemical restraints. The oligodeoxyribonucleotide forms a straight B-DNA double helix with crystallographic dyad symmetry and ten base-pairs per turn. In the crystal lattice, DNA fragments stack end-to-end along the c-axis to form continuous double helices. The overall helical structure and, notably, the groove dimensions of the decamer are more similar to standard, fiber diffraction-determined B-DNA than A-tract DNA. A unique stacking geometry is observed at the CA/TG base-pair step, where an increased rotation about the helix axis and a sliding motion of the base-pairs along their long axes leads to a superposition of the base rings with neighboring carbonyl and amino functions. Three-center (bifurcated) hydrogen bonds are possible at the CC/GG base-pair steps of the decamer. In their common sequence elements, d(CCAGGCCTGG) and the related G.A mismatch decamer d(CCAAGATTGG) show very similar three-dimensional structures, except that d(CCAGGCCTGG) appears to have a less regularly hydrated minor groove. The paucity of minor groove hydration in the center of the decamer may be a general feature of G/C-rich DNA and explain its relative instability in the B-form of DNA.

  6. Laser grooving of surface cracks on hot work tool steel

    Directory of Open Access Journals (Sweden)

    D. Klobčar

    2011-10-01

    Full Text Available The paper presents the analysis of laser grooving of 1.2343 tool steel hardened to 46 HRC. The effect of laser power and grooving speed on groove shape (i.e. depth and width, the material removal rate and the purity of produced groove as a measure of groove quality was investigated and analyzed using response surface methodology. Optimal parameters of laser grooving were found, which enables pure grooves suitable for laser welding.

  7. Differential diagnosis of groove pancreatic carcinomas vs. groove pancreatitis: Usefulness of the portal venous phase

    International Nuclear Information System (INIS)

    Ishigami, Kousei; Tajima, Tsuyoshi; Nishie, Akihiro; Kakihara, Daisuke; Fujita, Nobuhiro; Asayama, Yoshiki; Ushijima, Yasuhiro; Irie, Hiroyuki; Nakamura, Masafumi; Takahata, Shunichi; Ito, Tetsuhide; Honda, Hiroshi

    2010-01-01

    Purpose: To clarify if the portal venous phase is helpful for the differential diagnosis of groove pancreatic carcinomas and groove pancreatitis. Materials and methods: MDCT and MRI of groove pancreatic carcinomas (n = 7) and groove pancreatitis (n = 15) were retrospectively reviewed by two radiologists independently. The signal intensity on T2-weighted images was subjectively assessed. The presence or absence of common bile duct (CBD) and main pancreatic duct (MPD) strictures, calcifications, and cystic lesions was evaluated. Additionally, the appearance of groove pancreatic carcinoma and that of groove pancreatitis in the portal venous phase on dynamic MDCT and MRI were compared. Results: There were no significant differences in the signal intensity on T2-weighted images and in the presence or absence of CBD and MPD strictures, calcifications, and cystic lesions between groove pancreatic carcinomas and groove pancreatitis. However, patchy focal enhancement in the portal venous phase was more commonly observed in groove pancreatitis than groove pancreatic carcinoma (Reviewers 1 and 2: 14/15 [93.3%] vs. 1/7 [14.3%], P < 0.0001). In addition, peripheral enhancement was only seen in groove pancreatic carcinomas (Reviewer 1: 4/7 [57.1%] vs. 0/15 [0%], P < 0.005, and Reviewer 2: 3/7 [42.9%] vs. 0/15 [0%], P < 0.05). Conclusion: The portal venous phase may be helpful for the differential diagnosis of groove pancreatic carcinomas and groove pancreatitis.

  8. Synthesis of furan-based DNA binders and their interaction with DNA

    International Nuclear Information System (INIS)

    Voege, Andrea; Hoffmann, Sascha; Gabel, Detlef

    2006-01-01

    In recent years, many substances, based on naturally occurring DNA-binding molecules have been developed for the use in cancer therapy and as virostatica. Most of these substances are binding specifically to A-T rich sequences in the DNA minor groove. Neutral and positively charged DNA-binders are known. BNCT is most effective, which the boron is directly located in the cellular nucleus, so that the intercation with thermal neutrons can directly damage the DNA. To reach this aim, we have connected ammonioundecahydrododecaborate(1-) to DNA-binding structures such as 2,5-bis(4-formylphenyl)furan via a Schiff-Base reaction followed by a reduction of the imine to a secondary amine. In a following step the amine can be alkylated to insert positive charges to prevent repulsion between the compounds and the negatively charged sugar-phosphate-backbone of the DNA. (author)

  9. Influence of musical groove on postural sway.

    Science.gov (United States)

    Ross, Jessica M; Warlaumont, Anne S; Abney, Drew H; Rigoli, Lillian M; Balasubramaniam, Ramesh

    2016-03-01

    Timescales of postural fluctuation reflect underlying neuromuscular processes in balance control that are influenced by sensory information and the performance of concurrent cognitive and motor tasks. An open question is how postural fluctuations entrain to complex environmental rhythms, such as in music, which also vary on multiple timescales. Musical groove describes the property of music that encourages auditory-motor synchronization and is used to study voluntary motor entrainment to rhythmic sounds. The influence of groove on balance control mechanisms remains unexplored. We recorded fluctuations in center of pressure (CoP) of standing participants (N = 40) listening to low and high groove music and during quiet stance. We found an effect of musical groove on radial sway variability, with the least amount of variability in the high groove condition. In addition, we observed that groove influenced postural sway entrainment at various temporal scales. For example, with increasing levels of groove, we observed more entrainment to shorter, local timescale rhythmic musical occurrences. In contrast, we observed more entrainment to longer, global timescale features of the music, such as periodicity, with decreasing levels of groove. Finally, musical experience influenced the amount of postural variability and entrainment at local and global timescales. We conclude that groove in music and musical experience can influence the neural mechanisms that govern balance control, and discuss implications of our findings in terms of multiscale sensorimotor coupling. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  10. Effect of ionic strength and cationic DNA affinity binders on the DNA sequence selective alkylation of guanine N7-positions by nitrogen mustards

    International Nuclear Information System (INIS)

    Hartley, J.A.; Forrow, S.M.; Souhami, R.L.

    1990-01-01

    Large variations in alkylation intensities exist among guanines in a DNA sequence following treatment with chemotherapeutic alkylating agents such as nitrogen mustards, and the substituent attached to the reactive group can impose a distinct sequence preference for reaction. In order to understand further the structural and electrostatic factors which determine the sequence selectivity of alkylation reactions, the effect of increase ionic strength, the intercalator ethidium bromide, AT-specific minor groove binders distamycin A and netropsin, and the polyamine spermine on guanine N7-alkylation by L-phenylalanine mustard (L-Pam), uracil mustard (UM), and quinacrine mustard (QM) was investigated with a modification of the guanine-specific chemical cleavage technique for DNA sequencing. The result differed with both the nitrogen mustard and the cationic agent used. The effect, which resulted in both enhancement and suppression of alkylation sites, was most striking in the case of netropsin and distamycin A, which differed from each other. DNA footprinting indicated that selective binding to AT sequences in the minor groove of DNA can have long-range effects on the alkylation pattern of DNA in the major groove

  11. Thermal Bridge Effects in Window Grooves

    DEFF Research Database (Denmark)

    Rose, Jørgen

    1997-01-01

    In this report thermal bridge effects in window grooves are analyzed. The analysis is performed using different thicknesses of the window groove insulation, to evaluate what the optimal solution is.All analysis in the report is performed using both 2- and 3-dimensional numerical analysis....

  12. Mixed convection in a baffled grooved channel

    Indian Academy of Sciences (India)

    MS received 16 May 2014; revised 19 October 2014; accepted 06 November 2014. Abstract. In the present numerical work, flow structure and heat transfer charac- teristics are investigated in a baffled grooved channel, differentially heated from the sides. The baffle is placed vertically downward from the top wall of grooved ...

  13. Spiral groove seal. [for rotating shaft

    Science.gov (United States)

    Ludwig, L. P.; Strom, T. N. (Inventor)

    1974-01-01

    Mating flat surfaces inhibit leakage of a fluid around a stationary shaft. A spiral groove produces a pumping action toward the fluid when the shaft rotates. This prevents leakage while a generated hydraulic lifting force separates the mating surfaces to minimize wear. Provision is made for placing these spiral grooves in communication with the fluid to accelerate the generation of the hydraulic lifting force.

  14. Dielectric image line groove antennas for millimeterwaves

    Science.gov (United States)

    Solbach, K.; Wolff, I.

    Grooves in the ground plane of dielectric image lines are proposed as a new radiating structure. A figure is included showing the proposed groove structure as a discontinuity in a dielectric image line. A wave incident on the dielectric image line is partly reflected by the discontinuity, partly transmitted across the groove, and partly radiated into space above the line. In a travelling-wave antenna, a number of grooves are arranged below a dielectric guide, with spacings around one guide wavelength to produce a beam in the upper half space. A prescribed aperture distribution can be effected by tapering the series radiation resistance of the grooves. This can be done by adjusting the depths of the grooves with a constant width or by varying the widths of the grooves with a constant depth. Attention is also given to circular grooves. Here, the widths of the holes are chosen so that they can be considered as waveguides operating far below the cut-off frequency of the fundamental circular waveguide mode.

  15. The investigation of groove geometry effect on heat transfer for internally grooved tubes

    International Nuclear Information System (INIS)

    Bilen, Kadir; Cetin, Murat; Gul, Hasan; Balta, Tuba

    2009-01-01

    An experimental study of surface heat transfer and friction characteristics of a fully developed turbulent air flow in different grooved tubes is reported. Tests were performed for Reynolds number range 10,000-38,000 and for different geometric groove shapes (circular, trapezoidal and rectangular). The ratio of tube length-to-diameter is 33. Among the grooved tubes, heat transfer enhancement is obtained up to 63% for circular groove, 58% for trapezoidal groove and 47% for rectangular groove, in comparison with the smooth tube at the highest Reynolds number (Re = 38,000). Correlations of heat transfer and friction coefficient were obtained for different grooved tubes. In evaluation of thermal performance, it is seen that the grooved tubes are thermodynamically advantageous (Ns, a < 1) up to Re = 30,000 for circular and trapezoidal grooves and up to Re = 28,000 for rectangular grooves. It is observed that there is an optimum value of the entropy generation number at about Re = 17,000 for all investigated grooves

  16. A Bridging Water Anchors the Tethered 5-(3-Aminopropyl)-2′-deoxyuridine Amine in the DNA Major Groove Proximate to the N+2 C·G Base Pair: Implications for Formation of Interstrand 5′-GNC-3′ Cross-Links by Nitrogen Mustards‡

    Science.gov (United States)

    Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.

    2009-01-01

    Site-specific insertion of 5-(3-aminopropyl)-2′-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5′-d(C1G2C3G4A5A6T7T8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18T19T20-C21Z22C23G24)-3′ (named DDDZ10) and 5′-d(C1G2C3G4A5A6T7X8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18-T19X20C21Z22C23G24)-3′ (named DDD2+Z10)(X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD2+Z10 duplex reveals that the tethered cations at base pairs A5 · X20 and X8 · A17 extend within the major groove in the 3′-direction, toward conserved Mg2+ binding sites located adjacent to N+2 base pairs C3 · Z22 and Z10 · C15. Bridging waters located between the tethered amines and either Z10 or Z22 O6 stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD2+Z10 duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z10 O6 and Z22 O6. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5′-GNC-3′ cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C · G base pair, facilitating interstrand cross-linking. PMID:18549246

  17. Supercoil Formation During DNA Melting

    Science.gov (United States)

    Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan

    2009-03-01

    Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.

  18. Comparison of gamma- and beta radiation stress responses on anti-oxidative defense system and DNA modifications in Lemna minor

    Energy Technology Data Exchange (ETDEWEB)

    Van Hoeck, Arne [SCK.CEN, Boeretang 200 2400 Mol (Belgium); University of Antwerp, Groenenborgerlaan 171, 2020 Antwerpen (Belgium); Horemans, Nele; Van Hees, May; Nauts, Robin; Vandenhove, Hildegarde [SCK.CEN, Boeretang 200 2400 Mol (Belgium); Knapen, Dries; Blust, Ronny [University of Antwerp, Groenenborgerlaan 171, 2020 Antwerpen (Belgium)

    2014-07-01

    The biological effects and interactions of different radiation types in plants are still far from understood. Additional knowledge on the impact of various kinds of ionizing radiation in plants on individual, biochemical and molecular level is needed to unravel and compare the toxic mode of action. Among different radiation types, external gamma radiation treatments have been mostly studied both in lab and field studies to derive the biological impact of radiation toxicity in organisms. However, environmental relevant studies on chronic low-dose gamma exposures are scarce. The radio-ecologically relevant radionuclide {sup 90}Sr is a pure beta emitting isotope and originates from nuclear activities and accidents. Although this radionuclide is not essential for plant metabolism, it bears a chemical analogy with the essential plant macro-nutrient Ca{sup 2+} thereby taking advantage of Ca{sup 2+} transport systems to contaminate plant organs and tissues. Ones plants are exposed to radiation stress, ionization events can cause an increase in reactive oxygen species (ROS) and can induce damage to biological material like DNA, lipids and structural proteins. The following work aimed at evaluating individual, biochemical and molecular endpoints to understand and to compare the mode of action of gamma- and beta radiation stress in plants. Having an equal relative biological effectiveness to non-human biota, it is still not clear in how plants differ or overlap in sensing and interpreting highly penetrating electromagnetic radiation with short-range particle radiation. The floating plant Lemna minor was chosen as model system. Following the OECD guidelines Lemna plants were being exposed separately to an external gamma radiation source or to a {sup 90}Sr-contaminated growth medium to obtain single-dose response curves for each type of radiation. In order to acquire accurate dose rate quantifications for beta radiation exposures, {sup 90}Sr uptake and accumulation of root and

  19. Crystal structure of the Msx-1 homeodomain/DNA complex.

    Science.gov (United States)

    Hovde, S; Abate-Shen, C; Geiger, J H

    2001-10-09

    The Msx-1 homeodomain protein plays a crucial role in craniofacial, limb, and nervous system development. Homeodomain DNA-binding domains are comprised of 60 amino acids that show a high degree of evolutionary conservation. We have determined the structure of the Msx-1 homeodomain complexed to DNA at 2.2 A resolution. The structure has an unusually well-ordered N-terminal arm with a unique trajectory across the minor groove of the DNA. DNA specificity conferred by bases flanking the core TAAT sequence is explained by well ordered water-mediated interactions at Q50. Most interactions seen at the TAAT sequence are typical of the interactions seen in other homeodomain structures. Comparison of the Msx-1-HD structure to all other high resolution HD-DNA complex structures indicate a remarkably well-conserved sphere of hydration between the DNA and protein in these complexes.

  20. DNA and protein binding, double-strand DNA cleavage and cytotoxicity of mixed ligand copper(II) complexes of the antibacterial drug nalidixic acid.

    Science.gov (United States)

    Loganathan, Rangasamy; Ganeshpandian, Mani; Bhuvanesh, Nattamai S P; Palaniandavar, Mallayan; Muruganantham, Amsaveni; Ghosh, Swapan K; Riyasdeen, Anvarbatcha; Akbarsha, Mohammad Abdulkader

    2017-09-01

    The water soluble mixed ligand complexes [Cu(nal)(diimine)(H 2 O)](ClO 4 ) 1-4, where H(nal) is nalidixic acid and diimine is 2,2'-bipyridine (1), 1,10-phenanthroline (2), 5,6-dimethyl-1,10-phenanthroline (3), and 3,4,7,8-tetramethyl-1,10-phenanthroline (4), have been isolated. The coordination geometry around Cu(II) in 1 and that in the Density Functional Theory optimized structures of 1-4 has been assessed as square pyramidal. The trend in DNA binding constants (K b ) determined using absorption spectral titration (K b : 1, 0.79±0.1base pair. In contrast, 3 and 4 are involved in intimate hydrophobic interaction with DNA through the methyl substituents on phen ring, which is supported by viscosity and protein binding studies. DNA docking studies imply that 4 is involved preferentially in DNA major groove binding while 1-3 in minor groove binding and that all the complexes, upon removing the axially coordinated water molecule, bind in the major groove. Interestingly, 3 and 4 display prominent double-strand DNA cleavage while 1 and 2 effect only single-strand DNA cleavage in the absence of an activator. The complexes 3 and 4 show cytotoxicity higher than 1 and 2 against human breast cancer cell lines (MCF-7). The complex 4 induces apoptotic mode of cell death in cancer cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Binding studies of guggulsterone-E to calf thymus DNA by multi-spectroscopic, calorimetric and molecular docking studies

    Science.gov (United States)

    Ikhlas, Shoeb; Ahmad, Masood

    2018-02-01

    Guggulsterone, a sterol found in plants is used as an ayurvedic medicine for many diseases such as obesity, internal tumors, ulcers etc. E and Z are two isoforms of guggulsterone, wherein guggulsterone-E (GUGE) has also been shown to have anticancer potential. Most of the anticancer drugs target nucleic acids. Therefore, we studied the mode of interaction between ctDNA and GUGE using UV-Vis, fluorescence and CD spectroscopy, isothermal calorimetry along with molecular docking studies. Hoechst 3325, ethidium bromide and rhodamine-B displacement experiments confirms that GUGE binds in the minor groove of DNA. ITC results further suggest these interactions to be feasible and spontaneous with hydrogen bond formation and van der waals interactions. Lastly, molecular docking also suggests GUGE to be a minor groove binder interacting through a single hydrogen bond formation between OH group of GUGE and nitrogen (N3) of adenosine (A6).

  2. Accurate Estimation of the Standard Binding Free Energy of Netropsin with DNA

    Directory of Open Access Journals (Sweden)

    Hong Zhang

    2018-01-01

    Full Text Available DNA is the target of chemical compounds (drugs, pollutants, photosensitizers, etc., which bind through non-covalent interactions. Depending on their structure and their chemical properties, DNA binders can associate to the minor or to the major groove of double-stranded DNA. They can also intercalate between two adjacent base pairs, or even replace one or two base pairs within the DNA double helix. The subsequent biological effects are strongly dependent on the architecture of the binding motif. Discriminating between the different binding patterns is of paramount importance to predict and rationalize the effect of a given compound on DNA. The structural characterization of DNA complexes remains, however, cumbersome at the experimental level. In this contribution, we employed all-atom molecular dynamics simulations to determine the standard binding free energy of DNA with netropsin, a well-characterized antiviral and antimicrobial drug, which associates to the minor groove of double-stranded DNA. To overcome the sampling limitations of classical molecular dynamics simulations, which cannot capture the large change in configurational entropy that accompanies binding, we resort to a series of potentials of mean force calculations involving a set of geometrical restraints acting on collective variables.

  3. Interaction of sulforaphane with DNA and RNA.

    Directory of Open Access Journals (Sweden)

    Farzaneh Abassi Joozdani

    Full Text Available Sulforaphane (SFN is an isothiocyanate found in cruciferous vegetables with anti-inflammatory, anti-oxidant and anti-cancer activities. However, the antioxidant and anticancer mechanism of sulforaphane is not well understood. In the present research, we reported binding modes, binding constants and stability of SFN-DNA and -RNA complexes by Fourier transform infrared (FTIR and UV-Visible spectroscopic methods. Spectroscopic evidence showed DNA intercalation with some degree of groove binding. SFN binds minor and major grooves of DNA and backbone phosphate (PO2, while RNA binding is through G, U, A bases with some degree of SFN-phosphate (PO2 interaction. Overall binding constants were estimated to be K(SFN-DNA=3.01 (± 0.035×10(4 M(-1 and K(SFN-RNA= 6.63 (±0.042×10(3 M(-1. At high SFN concentration (SFN/RNA = 1/1, DNA conformation changed from B to A occurred, while RNA remained in A-family structure.

  4. Electrochemical and calorimetric investigation of interaction of novel biscationic anticancer agents with DNA; Investigacao eletroquimica e calorimetrica da interacao de novos agentes antitumorais biscationicos com DNA

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Lauris Lucia da; Donnici, Claudio Luis; Lopes, Julio Cesar Dias, E-mail: cdonnici@terra.com.br [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil). Inst. de Ciencias Exatas. Dept. de Quimica; Goulart, Marilia Oliveira Fonseca; Abreu, Fabiane Caxico de; Paula, Francine Santos de [Universidade Federal de Alagoas (UFAL), Maceio, AL (Brazil). Campus A.C. Simoes. Inst. de Quimica e Biotecnologia; Bravo, Carlos E. Salas; Santoro, Marcelo Matos [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil). Dept. de Bioquimica e Imunologia; Denadai, Angelo Marcio Leite [Centro Federal de Educacao Tecnologica, Timoteo, MG (Brazil). Campus VII; Santos, Alexandre Martins Costa [Universidade Federal do Espirito Santo, Vitoria, ES (Brazil). Dept. de Ciencias Fisiologicas; Montanari, Carlos Alberto [Universidade de Sao Paulo, Sao Carlos, SP (Brazil). Inst. de Quimica

    2012-07-01

    Biscationic amidines bind in the DNA minor groove and present biological activity against a range of infectious diseases. Two new biscationic compounds (bis-{alpha}-{omega}-S-thioureido, amino and sulfide analogues) were synthesized in good yields and fully characterized, and their interaction with DNA was also investigated. Isothermal titration calorimetry (ITC) was used to measure the thermodynamic properties of binding interactions between DNA and these ligands. A double stranded calf thymus DNA immobilized on an electrode surface was used to study the possible DNA-interacting abilities of these compounds towards dsDNA in situ. A remarkable interaction of these compounds with DNA was demonstrated and their potential application as anticancer agents was furthered. (author)

  5. Experimental Studies on Grooved Double Pipe Heat Exchanger with Different Groove Space

    Science.gov (United States)

    Sunu, P. W.; Arsawan, I. M.; Anakottapary, D. S.; Santosa, I. D. M. C.; Yasa, I. K. A.

    2018-01-01

    Experimental studies were performed on grooved double pipe heat exchanger (DPHE) with different groove space. The objective of this work is to determine optimal heat transfer parameter especially logarithmic mean temperature difference (LMTD). The document in this paper also provides the total heat observed by the cold fluid. The rectangular grooves were incised on outer surface of tube side with circumferential pattern and two different grooves space, namely 1 mm and 2 mm. The distance between grooves and the grooves high were kept constant, 8 mm and 0.3 mm respectively. The tube diameter is 20 mm and its made of aluminium. The shell is made of acrylic which has 28 mm in diameter. Water is used as the working fluid. Using counter flow scheme, the cold fluid flows in the annulus room of DPHE. The volume flowrate of hot fluid remains constant at 15 lpm. The volume flowrate of cold fluid were varied from 11 lpm to 15 lpm. Based on logarithmic mean temperature difference analysis, the LMTD of 1 mm grooves space was higher compared to that of 2 mm grooves space. The smaller grooves space has more advantage since the recirculating region are increased which essentially cause larger heat transfer enhancement.

  6. Electrostatic field of the large fragment of Escherichia coli DNA polymerase I.

    Science.gov (United States)

    Warwicker, J; Ollis, D; Richards, F M; Steitz, T A

    1985-12-05

    The electrostatic field of the large fragment of Escherichia coli DNA polymerase I (Klenow fragment) has been calculated by the finite difference procedure on a 2 A grid. The potential field is substantially negative at physiological pH (reflecting the net negative charge at this pH). The largest regions of positive potential are in the deep crevice of the C-terminal domain, which is the proposed binding site for the DNA substrate. Within the crevice, the electrostatic potential has a partly helical form. If the DNA is positioned to fulfil stereochemical requirements, then the positive potential generally follows the major groove and (to a lesser extent) the negative potential is in the minor groove. Such an arrangement could stabilize DNA configurations related by screw symmetry. The histidine residues of the Klenow fragment give the positive field of the groove a sensitivity to relatively small pH changes around neutrality. We suggest that the histidine residues could change their ionization states in response to DNA binding, and that this effect could contribute to the protein-DNA binding energy.

  7. Insights into finding a mismatch through the structure of a mispaired DNA bound by a rhodium intercalator

    Science.gov (United States)

    Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

    2007-01-01

    We report the 1.1-Å resolution crystal structure of a bulky rhodium complex bound to two different DNA sites, mismatched and matched in the oligonucleotide 5′-(dCGGAAATTCCCG)2-3′. At the AC mismatch site, the structure reveals ligand insertion from the minor groove with ejection of both mismatched bases and elucidates how destabilized mispairs in DNA may be recognized. This unique binding mode contrasts with major groove intercalation, observed at a matched site, where doubling of the base pair rise accommodates stacking of the intercalator. Mass spectral analysis reveals different photocleavage products associated with the two binding modes in the crystal, with only products characteristic of mismatch binding in solution. This structure, illustrating two clearly distinct binding modes for a molecule with DNA, provides a rationale for the interrogation and detection of mismatches. PMID:17194756

  8. DNA binding and cleavage studies of new sulfasalazine-derived dipeptide Zn(II) complex: Validation for specific recognition with 5 Prime -TMP

    Energy Technology Data Exchange (ETDEWEB)

    Tabassum, Sartaj [Department of Chemistry, Aligarh Muslim University, Aligarh, UP 202002 (India); Al-Asbahy, Waddhaah M.; Afzal, Mohd.; Shamsi, Manal; Arjmand, Farukh [Department of Chemistry, Aligarh Muslim University, Aligarh, UP 202002 (India)

    2012-11-15

    A new water soluble complex [Zn(glygly)(ssz)(H{sub 2}O)]{center_dot}6H{sub 2}O, 1 derived from dipeptide (glycyl glycine) and sulfasalazine was synthesized and characterized by spectroscopic (IR, UV-vis, NMR, ESI-MS) and analytical methods. The in vitro DNA binding studies of complex 1 with calf-thymus DNA were carried out by employing various biophysical methods and molecular docking technique which reveals strong electrostatic binding via phosphate backbone of DNA helix, in addition to partial intercalation. To gain further insight into the molecular recognition at the target site, interaction studies of complex 1 with 5 Prime -TMP and 5 Prime -GMP were carried out by UV-vis titration which was validated by {sup 1}H and {sup 31}P NMR with 5 Prime -TMP, which implicate the preferential selectivity of 1 towards N3 of thymine. Complex 1 is accessible to minor groove of DNA and cleaved pBR322 DNA via hydrolytic pathway (validated by T4 ligase assay). - Graphical abstract: Synthesis, characterization, DNA binding and cleavage studies of [Zn(glygly)(ssz)(H{sub 2}O)]{center_dot}6H{sub 2}O (1) containing glycyl glycine and sulfasalazine ligand. Complex 1 recognize minor groove of DNA and show hydrolytic DNA cleavage. Highlights: Black-Right-Pointing-Pointer Novel Zn(II) complex 1 bearing bioactive glycyl glycine and sulfasalazine ligand scaffold. Black-Right-Pointing-Pointer Cleavage activity of 1 was enhanced in presence of activators: H{sub 2}O{sub 2}>MPA>GSH>Asc. Black-Right-Pointing-Pointer Complex 1 recognize minor groove as depicted in the cleavage pattern and molecular docking. Black-Right-Pointing-Pointer Complex 1 cleaves pBR322 DNA via hydrolytic mechanism and validated by T4 DNA ligase experiments.

  9. DNA binding and cleavage studies of new sulfasalazine-derived dipeptide Zn(II) complex: Validation for specific recognition with 5′–TMP

    International Nuclear Information System (INIS)

    Tabassum, Sartaj; Al–Asbahy, Waddhaah M.; Afzal, Mohd.; Shamsi, Manal; Arjmand, Farukh

    2012-01-01

    A new water soluble complex [Zn(glygly)(ssz)(H 2 O)]·6H 2 O, 1 derived from dipeptide (glycyl glycine) and sulfasalazine was synthesized and characterized by spectroscopic (IR, UV–vis, NMR, ESI–MS) and analytical methods. The in vitro DNA binding studies of complex 1 with calf–thymus DNA were carried out by employing various biophysical methods and molecular docking technique which reveals strong electrostatic binding via phosphate backbone of DNA helix, in addition to partial intercalation. To gain further insight into the molecular recognition at the target site, interaction studies of complex 1 with 5′-TMP and 5′-GMP were carried out by UV–vis titration which was validated by 1 H and 31 P NMR with 5′-TMP, which implicate the preferential selectivity of 1 towards N3 of thymine. Complex 1 is accessible to minor groove of DNA and cleaved pBR322 DNA via hydrolytic pathway (validated by T4 ligase assay). - Graphical abstract: Synthesis, characterization, DNA binding and cleavage studies of [Zn(glygly)(ssz)(H 2 O)]·6H 2 O (1) containing glycyl glycine and sulfasalazine ligand. Complex 1 recognize minor groove of DNA and show hydrolytic DNA cleavage. Highlights: ► Novel Zn(II) complex 1 bearing bioactive glycyl glycine and sulfasalazine ligand scaffold. ► Cleavage activity of 1 was enhanced in presence of activators: H 2 O 2 >MPA>GSH>Asc. ► Complex 1 recognize minor groove as depicted in the cleavage pattern and molecular docking. ► Complex 1 cleaves pBR322 DNA via hydrolytic mechanism and validated by T4 DNA ligase experiments.

  10. Local-scale stratigraphy of grooved terrain on Ganymede

    Science.gov (United States)

    Murchie, Scott L.; Head, James W.; Helfenstein, Paul; Plescia, Jeffrey B.

    1987-01-01

    The surface of the Jovian satellite, Ganymede, is divided into two main units, dark terrain cut by arcuate and subradial furrows, and light terrain consisting largely of areas with pervasive U-shaped grooves. The grooved terrain may be subdivided on the basis of pervasive morphology of groove domains into four terrain types: (1) elongate bands of parallel grooves (groove lanes); (2) polygonal domains of parallel grooves (grooved polygons); (3) polygonal domains of two orthogonal groove sets (reticulate terrain); and (4) polygons having two to several complexly cross-cutting groove sets (complex grooved terrain). Reticulate terrain is frequently dark and not extensively resurfaced, and grades to a more hummocky terrain type. The other three grooved terrain types have almost universally been resurfaced by light material during their emplacement. The sequence of events during grooved terrain emplacement has been investigated. An attempt is made to integrate observed geologic and tectonic patterns to better constrain the relative ages and styles of emplacement of grooved terrain types. A revised model of grooved terrain emplacement is proposed and is tested using detailed geologic mapping and measurement of crater density.

  11. Multi-spectroscopic and molecular docking studies on the interaction of darunavir, a HIV protease inhibitor with calf thymus DNA.

    Science.gov (United States)

    Shi, Jie-Hua; Zhou, Kai-Li; Lou, Yan-Yue; Pan, Dong-Qi

    2018-03-15

    Molecular interaction of darunavir (DRV), a HIV protease inhibitor with calf thymus deoxyribonucleic acid (ct-DNA) was studied in physiological buffer (pH7.4) by multi-spectroscopic approaches hand in hand with viscosity measurements and molecular docking technique. The UV absorption and fluorescence results together revealed the formation of a DRV-ct-DNA complex having binding affinities of the order of 10 3 M -1 , which was more in keeping with the groove binding. The results that DRV bound to ct-DNA via groove binding mode was further evidenced by KI quenching studies, viscosity measurements, competitive binding investigations with EB and Rhodamine B and CD spectral analysis. The effect of ionic strength indicated the negligible involvement of electrostatic interaction between DRV and ct-DNA. The thermodynamic parameters regarding the binding interaction of DRV with ct-DNA in terms of enthalpy change (ΔH 0 ) and entropy change (ΔS 0 ) were -63.19kJ mol -1 and -141.92J mol -1 K -1 , indicating that hydrogen bonds and van der Waals forces played a predominant role in the binding process. Furthermore, molecular simulation studies suggested that DRV molecule was prone to bind in the A-T rich region of the minor groove of DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Graphene Plasmons in Triangular Wedges and Grooves

    DEFF Research Database (Denmark)

    Gonçalves, P. A. D.; Dias, E. J. C.; Xiao, Sanshui

    2016-01-01

    and tunability of graphene plasmons guided along the apex of a graphene-covered dielectric wedge or groove. In particular, we present a quasi-analytic model to describe the plasmonic eigenmodes in such a system, including the complete determination of their spectrum and corresponding induced potential...... and electric-field distributions. We have found that the dispersion of wedge/groove graphene plasmons follows the same functional dependence as their flat-graphene plasmon counterparts, but now scaled by a (purely) geometric factor in which all the information about the system’s geometry is contained. We...

  13. FT-Raman and QM/MM study of the interaction between histamine and DNA

    International Nuclear Information System (INIS)

    Ruiz-Chica, A.J.; Soriano, A.; Tunon, I.; Sanchez-Jimenez, F.M.; Silla, E.; Ramirez, F.J.

    2006-01-01

    The interaction between histamine and highly polymerized calf-thymus DNA has been investigated using FT-Raman spectroscopy and the hybrid QM/MM (quantum mechanics/molecular mechanics) methodology. Raman spectra of solutions containing histamine and calf-thymus DNA, at different molar ratios, were recorded. Solutions were prepared at physiological settings of pH and ionic strength, using both natural and heavy water as the solvent. The analysis of the spectral changes on the DNA Raman spectra when adding different concentrations of histamine allowed us to identify the reactive sites of DNA and histamine, which were used to built two minor groove and one intercalated binding models. They were further used as starting points of the QM/MM theoretical study. However, minimal energy points were only reached for the two minor groove models. For each optimized structure, we calculated analytical force constants of histamine molecule in order to perform the vibrational dynamics. Normal mode descriptions allowed us to compare calculated wavenumbers for DNA-interacting histamine to those measured in the Raman spectra of DNA-histamine solutions

  14. Spiral groove seal. [for hydraulic rotating shaft

    Science.gov (United States)

    Ludwig, L. P. (Inventor)

    1973-01-01

    Mating flat surfaces inhibit leakage of a fluid around a stationary shaft. A spiral groove pattern produces a pumping action toward the fluid when the shaft rotates which prevents leakage while a generated hydraulic lifting force separates the mating surfaces to minimize wear.

  15. Optimization of Grooved Micromixer for Microengineering Technologies

    DEFF Research Database (Denmark)

    Sabotin, I.; Tristo, G.; Bissacco, Giuliano

    2013-01-01

    Due to the absence of turbulent flow and the slow diffusion process, mixing of solutions at micro-scale is a difficult task. This paper describes the optimization route towards the efficient design of a bottom grooved micromixer. Based on thoroughly discussed mixing mechanisms, the optimization w...

  16. Appraisal of transverse nasal groove: a study.

    Science.gov (United States)

    Sathyanarayana, Belagola D; Basavaraj, Halevoor B; Nischal, Kuchangi C; Swaroop, Mukunda R; Umashankar, Puttagangu N; Agrawal, Dhruv P; Swamy, Suchetha S; Okram, Sarda

    2012-01-01

    Transverse nasal groove is a condition of cosmetic concern which awaits due recognition and has been widely described as a shallow groove that extends transversely over the dorsum of nose. However, we observed variations in the clinical presentations of this entity, hitherto undescribed in literature. We conducted a clinicoepidemiological study of transverse nasal lesions in patients attending our outpatient department. We conducted a prospective observational study. We screened all patients attending our out-patient department for presence of transverse nasal lesions, signs of any dermatosis and associated other skin conditions. One hundred patients were recruited in the study. Females (80%) predominated over males. Most patients were of 15-45 years age group (70%). Majority of the transverse nasal lesions were classical transverse nasal groove (39%) and others included transverse nasal line (28%), strip (28%), ridge (4%) and loop (1%). Seborrhoeic diathesis was the most common condition associated with transverse nasal lesion. Occurrence of transverse nasal line, strip, ridge and loop, in addition to classical transverse nasal groove implies that latter is actually a subset of transverse nasal lesions. Common association of this entity with seborrheic dermatitis, seborrhea and dandruff raises a possibility of whether transverse nasal lesion is a manifestation of seborrheic diathesis.

  17. Spectroscopic profiling and computational study of the binding of tschimgine: A natural monoterpene derivative, with calf thymus DNA

    Science.gov (United States)

    Khajeh, Masoumeh Ashrafi; Dehghan, Gholamreza; Dastmalchi, Siavoush; Shaghaghi, Masoomeh; Iranshahi, Mehrdad

    2018-03-01

    DNA is a major target for a number of anticancer substances. Interaction studies between small molecules and DNA are essential for rational drug designing to influence main biological processes and also introducing new probes for the assay of DNA. Tschimgine (TMG) is a monoterpene derivative with anticancer properties. In the present study we tried to elucidate the interaction of TMG with calf thymus DNA (CT-DNA) using different spectroscopic methods. UV-visible absorption spectrophotometry, fluorescence and circular dichroism (CD) spectroscopies as well as molecular docking study revealed formation of complex between TMG and CT-DNA. Binding constant (Kb) between TMG and DNA was 2.27 × 104 M- 1, that is comparable to groove binding agents. The fluorescence spectroscopic data revealed that the quenching mechanism of fluorescence of TMG by CT-DNA is static quenching. Thermodynamic parameters (ΔH TMG with CT-DNA. Competitive binding assay with methylene blue (MB) and Hoechst 33258 using fluorescence spectroscopy displayed that TMG possibly binds to the minor groove of CT-DNA. These observations were further confirmed by CD spectral analysis, viscosity measurements and molecular docking.

  18. Functional Dissection of the DNA Interface of the Nucleotidyltransferase Domain of Chlorella Virus DNA Ligase*

    Science.gov (United States)

    Samai, Poulami; Shuman, Stewart

    2011-01-01

    Chlorella virus DNA ligase (ChVLig) has pluripotent biological activity and an intrinsic nick-sensing function. ChVLig consists of three structural modules that envelop nicked DNA as a C-shaped protein clamp: a nucleotidyltransferase (NTase) domain and an OB domain (these two are common to all DNA ligases) as well as a distinctive β-hairpin latch module. The NTase domain, which performs the chemical steps of ligation, binds the major groove flanking the nick and the minor groove on the 3′-OH side of the nick. Here we performed a structure-guided mutational analysis of the NTase domain, surveying the effects of 35 mutations in 19 residues on ChVLig activity in vivo and in vitro, including biochemical tests of the composite nick sealing reaction and of the three component steps of the ligation pathway (ligase adenylylation, DNA adenylylation, and phosphodiester synthesis). The results highlight (i) key contacts by Thr-84 and Lys-173 to the template DNA strand phosphates at the outer margins of the DNA ligase footprint; (ii) essential contacts of Ser-41, Arg-42, Met-83, and Phe-75 with the 3′-OH strand at the nick; (iii) Arg-176 phosphate contacts at the nick and with ATP during ligase adenylylation; (iv) the role of Phe-44 in forming the protein clamp around the nicked DNA substrate; and (v) the importance of adenine-binding residue Phe-98 in all three steps of ligation. Kinetic analysis of single-turnover nick sealing by ChVLig-AMP underscored the importance of Phe-75-mediated distortion of the nick 3′-OH nucleoside in the catalysis of DNA 5′-adenylylation (step 2) and phosphodiester synthesis (step 3). Induced fit of the nicked DNA into a distorted conformation when bound within the ligase clamp may account for the nick-sensing capacity of ChVLig. PMID:21335605

  19. Functional dissection of the DNA interface of the nucleotidyltransferase domain of chlorella virus DNA ligase.

    Science.gov (United States)

    Samai, Poulami; Shuman, Stewart

    2011-04-15

    Chlorella virus DNA ligase (ChVLig) has pluripotent biological activity and an intrinsic nick-sensing function. ChVLig consists of three structural modules that envelop nicked DNA as a C-shaped protein clamp: a nucleotidyltransferase (NTase) domain and an OB domain (these two are common to all DNA ligases) as well as a distinctive β-hairpin latch module. The NTase domain, which performs the chemical steps of ligation, binds the major groove flanking the nick and the minor groove on the 3'-OH side of the nick. Here we performed a structure-guided mutational analysis of the NTase domain, surveying the effects of 35 mutations in 19 residues on ChVLig activity in vivo and in vitro, including biochemical tests of the composite nick sealing reaction and of the three component steps of the ligation pathway (ligase adenylylation, DNA adenylylation, and phosphodiester synthesis). The results highlight (i) key contacts by Thr-84 and Lys-173 to the template DNA strand phosphates at the outer margins of the DNA ligase footprint; (ii) essential contacts of Ser-41, Arg-42, Met-83, and Phe-75 with the 3'-OH strand at the nick; (iii) Arg-176 phosphate contacts at the nick and with ATP during ligase adenylylation; (iv) the role of Phe-44 in forming the protein clamp around the nicked DNA substrate; and (v) the importance of adenine-binding residue Phe-98 in all three steps of ligation. Kinetic analysis of single-turnover nick sealing by ChVLig-AMP underscored the importance of Phe-75-mediated distortion of the nick 3'-OH nucleoside in the catalysis of DNA 5'-adenylylation (step 2) and phosphodiester synthesis (step 3). Induced fit of the nicked DNA into a distorted conformation when bound within the ligase clamp may account for the nick-sensing capacity of ChVLig.

  20. N-(2-chloroethyl)-N-nitrosoureas covalently bound to nonionic and monocationic lexitropsin dipeptides. Synthesis, DNA affinity binding characteristics, and reactions with 32P-end-labeled DNA

    International Nuclear Information System (INIS)

    Church, K.M.; Wurdeman, R.L.; Zhang, Yi; Chen, Faxian; Gold, B.

    1990-01-01

    The synthesis and characterization of a series of compounds that contain an N-alkyl-N-nitrosourea functionality linked to DNA minor groove binding bi- and tripeptides (lexitropsins or information-reading peptides) based on methylpyrrole-2-carboxamide subunits are described. The lexitropsins (lex) synthesized have either a 3-(dimethylamino)propyl or propyl substituent on the carboxyl terminus. The preferred DNA affinity binding sequences of these compounds were footprinted in 32 P-end-labeled restriction fragments with methidiumpropyl-EDTA·Fe(II), and in common with other structural analogues, e.g., distamycin and netropsin, these nitrosoureas recognize A-T-rich runs. The affinity binding of the compound with the dimethylamino terminus, which is ionized at near-neutral pH, appeared stronger than that observed for the neutral dipeptide. The sequence specificity for DNA alkylation by (2-chloroethyl)nitrosourea-lex dipeptides (Cl-ENU-lex), with neutral and charged carboxyl termini, using 32 P-end-labeled restriction fragments, was determined by the conversion of the adducted sites into single-strand breaks by sequential heating at neutral pH and exposure to base. The DNA cleavage sites were visualized by polyacrylamide gel electrophoresis and autoradiography. Linking the Cl-ENU moiety to minor groove binders is a viable strategy to qualitatively and quantitatively control the delivery and release of the ultimate DNA alkylating agent in a sequence-dependent fashion

  1. Intentional replantation: A viable alternative for management of palatogingival groove

    OpenAIRE

    Vijay Kumar; Ajay Logani; Naseem Shah

    2013-01-01

    Radicular groove is an anatomical malformation that often leads to combined endodontic-periodontic lesions. Treatment of complex groove presents a clinical challenge to the operator. A case of type III palatogingival groove is successfully treated with intentional replantation. With the understanding of the procedure and strict adherence to guidelines improves, practitioners can use intentional replantation as an easy and cost-effective alternative for the management of radicular groove. The ...

  2. Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease.

    Science.gov (United States)

    Anders, Carolin; Niewoehner, Ole; Duerst, Alessia; Jinek, Martin

    2014-09-25

    The CRISPR-associated protein Cas9 is an RNA-guided endonuclease that cleaves double-stranded DNA bearing sequences complementary to a 20-nucleotide segment in the guide RNA. Cas9 has emerged as a versatile molecular tool for genome editing and gene expression control. RNA-guided DNA recognition and cleavage strictly require the presence of a protospacer adjacent motif (PAM) in the target DNA. Here we report a crystal structure of Streptococcus pyogenes Cas9 in complex with a single-molecule guide RNA and a target DNA containing a canonical 5'-NGG-3' PAM. The structure reveals that the PAM motif resides in a base-paired DNA duplex. The non-complementary strand GG dinucleotide is read out via major-groove interactions with conserved arginine residues from the carboxy-terminal domain of Cas9. Interactions with the minor groove of the PAM duplex and the phosphodiester group at the +1 position in the target DNA strand contribute to local strand separation immediately upstream of the PAM. These observations suggest a mechanism for PAM-dependent target DNA melting and RNA-DNA hybrid formation. Furthermore, this study establishes a framework for the rational engineering of Cas9 enzymes with novel PAM specificities.

  3. Isolation and characterization of a cDNA encoding phytochrome A in the non-photosynthetic parasitic plant, Orobanche minor Sm.

    Science.gov (United States)

    Trakulnaleamsai, Chitra; Okazawa, Atsushi; An, Chung-Il; Kajiyama, Shin'ichiro; Fukusaki, Ei'ichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio

    2005-01-01

    In this study, the isolation and characterization of a phytochrome A (PHYA) homologous cDNA (OmPHYA) in the non-photosynthetic holoparasitic plant Orobanche minor are described. The present findings provide the first report of the presence of a PHYA homolog in the holoparasite. This study found that OmPHYA is of similar size to the other PHYAs of green plants and shows 72, 77, and 77% amino acid sequence identity with PHYA in Arabidopsis, potato, and tobacco respectively. The OmPHYA contains a conserved chromophore attachment cysteine at position 323. Although OmPHYA shows high sequence identity with other PHYAs in green plants, 13 amino acid substitutions located in both the N and C-terminal domains are observed (a total of 26 amino acids). OmPHYA is encoded by a single gene within the O. minor genome. The abundance of the OmPHYA transcript as well as nuclear translocation of OmphyA occurs in a light-dependent manner.

  4. Intentional replantation: A viable alternative for management of palatogingival groove

    Directory of Open Access Journals (Sweden)

    Vijay Kumar

    2013-01-01

    Full Text Available Radicular groove is an anatomical malformation that often leads to combined endodontic-periodontic lesions. Treatment of complex groove presents a clinical challenge to the operator. A case of type III palatogingival groove is successfully treated with intentional replantation. With the understanding of the procedure and strict adherence to guidelines improves, practitioners can use intentional replantation as an easy and cost-effective alternative for the management of radicular groove. The paper presents a brief review of palatogingival groove and highlights an easy and predictable alternative for its management.

  5. Release of 3-methyladenine from linker and core DNA of chromatin by a purified DNA glycosylase

    International Nuclear Information System (INIS)

    Heller, E.P.; Goldthwait, D.A.

    1983-01-01

    Oligonucleosomes were isolated from [ 14 C]thymidine-labeled HeLa cells by digestion of the nuclei with micrococcal nuclease and were then alkylated with [ 3 H]methylnitrosourea. Nucleosome core particles were also prepared by further digestion of the oligonucleosomes. The distribution of 3 H-labeled methyl groups in the linker versus the core DNA was established by a determination of 3 H: 14 C ratios in oligonucleosome and core DNA. The ratios in the core DNA of 145 and 165 base pair DNA fragments were 5.2 and 5.4, respectively, while the ratio in the oligonucleosomal DNA was 8.2. Assuming an equal mixture (as determined) of 145 and 165 base pair fragments of DNA in the 185 base pair repeat, the relative concentration of 3 H methyl groups in the linker versus the core DNA was 4.2. Thus, 45% of the 3 H methyl groups were in the linker DNA, and 55% were in the core DNA. Some shielding of the DNA was evident during alkylation. The concentrations of alkyl groups on the linker and core DNA were 67 and 12% of that found on free DNA alkylated under comparable conditions. No evidence for preferential shielding of the major or minor groove was observed. The purified 3-methyladenine DNA glycosylase I of Escherichia coli released approximately 37% of the 3-methyladenine from the linker DNA and 13% from the core DNA. The limited enzymatic removal of 3-methyladenine in vitro compared to the efficient removal in vivo suggests that conformational changes of the oligonucleosome and core structure must occur for total repair

  6. Labiogingival groove: A rare developmental tooth anomaly

    Directory of Open Access Journals (Sweden)

    Shiva Chauhan

    2017-01-01

    Full Text Available Labiogingival groove is a congenital morphologic dental anomaly, in which an infolding of the inner enamel epithelium and Hertwig's epithelial root sheath create a groove extending varying depth into root. Epithelial attachment can be breached by gingival irritation secondary to plaque accumulation creating a periodontal defect that spreads to the pulp causing primary periodontal/secondary endodontic. A 12-year-old boy reported with the complaint of painful tooth with pus discharge from labial gingival surface in the maxillary right lateral incisor for 4 months. Intraoral examination revealed bluish red gingiva with loss of contour in relation to maxillary right lateral incisor and purulent discharge in relation to it. A provisional diagnosis of localized gingival abscess in relation to maxillary right incisor (primary periodontic and secondary endodontic involvement was given, and required treatment was carried out. On exposure of the involved tooth, a labiogingival groove was noticed which could have been a contributing factor for the progression of the condition.

  7. Conflict RNA modification, host-parasite co-evolution, and the origins of DNA and DNA-binding proteins1.

    Science.gov (United States)

    McLaughlin, Paul J; Keegan, Liam P

    2014-08-01

    Nearly 150 different enzymatically modified forms of the four canonical residues in RNA have been identified. For instance, enzymes of the ADAR (adenosine deaminase acting on RNA) family convert adenosine residues into inosine in cellular dsRNAs. Recent findings show that DNA endonuclease V enzymes have undergone an evolutionary transition from cleaving 3' to deoxyinosine in DNA and ssDNA to cleaving 3' to inosine in dsRNA and ssRNA in humans. Recent work on dsRNA-binding domains of ADARs and other proteins also shows that a degree of sequence specificity is achieved by direct readout in the minor groove. However, the level of sequence specificity observed is much less than that of DNA major groove-binding helix-turn-helix proteins. We suggest that the evolution of DNA-binding proteins following the RNA to DNA genome transition represents the major advantage that DNA genomes have over RNA genomes. We propose that a hypothetical RNA modification, a RRAR (ribose reductase acting on genomic dsRNA) produced the first stretches of DNA in RNA genomes. We discuss why this is the most satisfactory explanation for the origin of DNA. The evolution of this RNA modification and later steps to DNA genomes are likely to have been driven by cellular genome co-evolution with viruses and intragenomic parasites. RNA modifications continue to be involved in host-virus conflicts; in vertebrates, edited cellular dsRNAs with inosine-uracil base pairs appear to be recognized as self RNA and to suppress activation of innate immune sensors that detect viral dsRNA.

  8. A comprehensive approach to ascertain the binding mode of curcumin with DNA

    Science.gov (United States)

    Haris, P.; Mary, Varughese; Aparna, P.; Dileep, K. V.; Sudarsanakumar, C.

    2017-03-01

    Curcumin is a natural phytochemical from the rhizoma of Curcuma longa, the popular Indian spice that exhibits a wide range of pharmacological properties like antioxidant, anticancer, anti-inflammatory, antitumor, and antiviral activities. In the published literatures we can see different studies and arguments on the interaction of curcumin with DNA. The intercalative binding, groove binding and no binding of curcumin with DNA were reported. In this context, we conducted a detailed study to understand the mechanism of recognition of dimethylsulfoxide-solubilized curcumin by DNA. The interaction of curcumin with calf thymus DNA (ctDNA) was confirmed by agarose gel electrophoresis. The nature of binding and energetics of interaction were studied by Isothermal Titration Calorimetry (ITC), Differential Scanning Calorimetry (DSC), UV-visible, fluorescence and melting temperature (Tm) analysis. The experimental data were compared with molecular modeling studies. Our investigation confirmed that dimethylsulfoxide-solubilized curcumin binds in the minor groove of the ctDNA without causing significant structural alteration to the DNA.

  9. Novel synthetic approach to asymmetric monocationic trimethine cyanine dyes derived from N-ethyl quinolinum moiety. Combined fluorescent and ICD probes for AT-DNA labelling

    Energy Technology Data Exchange (ETDEWEB)

    Kurutos, Atanas [Department of Pharmaceutical and Applied Organic Chemistry, Faculty of Chemistry, University of Sofia, 1164 Sofia (Bulgaria); Crnolatac, Ivo; Orehovec, Iva [Laboratory for Study of Interactions of Biomacromolecules, Division of Organic Chemistry and Biochemistry, Ruđer Bošković Institute, Bijenička c. 54, 10000 Zagreb (Croatia); Gadjev, Nikolai [Department of Pharmaceutical and Applied Organic Chemistry, Faculty of Chemistry, University of Sofia, 1164 Sofia (Bulgaria); Piantanida, Ivo, E-mail: pianta@irb.hr [Laboratory for Study of Interactions of Biomacromolecules, Division of Organic Chemistry and Biochemistry, Ruđer Bošković Institute, Bijenička c. 54, 10000 Zagreb (Croatia); Deligeorgiev, Todor, E-mail: ohtak@chem.uni-sofia.bg [Department of Pharmaceutical and Applied Organic Chemistry, Faculty of Chemistry, University of Sofia, 1164 Sofia (Bulgaria)

    2016-06-15

    Two asymmetric monocationic trimethine cyanine dyes were obtained via condensation reaction between 2-methylbenzothialolium salts containing various (aliphatic and benzyl) substituents on the nitrogen atom of the benzothiazolic chromophore, and 1-ethyl−4-(2-(phenylamine)vinyl)quinolin−1-ium iodide, by a novel improved method at room temperature under mild conditions. Both compounds bind non-covalently to double stranded DNA and RNA by micromolar affinity, but give highly selective fluorescent response>650 nm for only AT-DNA sequences at excess of DNA over dye, combined with equally AT-DNA selective ICD response at dye/DNA crowded conditions (r{sub [dye]/[AT-DNA]}>0.2)-namely ICD bands (attributed to dye-dimer formation) allow determination of AT-DNA at submicromolar concentrations. Selectivity was attributed to particular steric properties of AT-DNA minor groove in respect to other studied ds-DNA/RNA. Comparison of aliphatic- and benzyl- dye showed that only aliphatic- derivative revealed ICD band upon binding to AU-RNA major groove and short AT-sequences in mixed sequence (ct-)DNA.

  10. DNA-binding, DNA cleavage and cytotoxicity studies of two anthraquinone derivatives.

    Science.gov (United States)

    Gholivand, M B; Kashanian, S; Peyman, H

    2012-02-15

    The interaction of native calf thymus DNA (CT-DNA) with two anthraquinones including quinizarin (1,4-dihydroxy anthraquinone) and danthron (1,8-dihydroxy anthraquinone) in a mixture of 0.04M Brittone-Robinson buffer and 50% of ethanol were studied at physiological pH by spectrofluorometric and cyclic voltammetry techniques. The former technique was used to calculate the binding constants of anthraquinones-DNA complexes at different temperatures. Thermodynamic study indicated that the reactions of both anthraquinone-DNA systems are predominantly entropically driven. Furthermore, the binding mechanisms on the reaction of the two anthraquinones with DNA and the effect of ionic strength on the fluorescence property of the system have also been investigated. The results of the experiments indicated that the binding modes of quinizarin and danthron with DNA were evaluated to be groove binding. Moreover, the cytotoxic activity of both compounds against human chronic myelogenous leukemia K562 cell line and DNA cleavage were investigated. The results indicated that these compounds slightly cleavage pUC18 plasmid DNA and showed minor antitumor activity against K562 (human chronic myeloid leukemia) cell line. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. The DNA binding site specificity and antiproliferative property of ternary Pt(II) and Zn(II) complexes of phenanthroline and N,N'-ethylenediaminediacetic acid.

    Science.gov (United States)

    Nakamura, Yusuke; Taruno, Yoko; Sugimoto, Masashi; Kitamura, Yusuke; Seng, Hoi Ling; Kong, Siew Ming; Ng, Chew Hee; Chikira, Makoto

    2013-03-14

    The binding site specificity of the ternary complexes, [M(II)(phen)(edda)] (M(II) = Pt(2+) and Zn(2+); phen = 1,10-phenanthroline; edda = N,N'-ethylenediaminediacetic acid), for the self-complementary oligonucleotides (ODNs), ds(C(1)G(2)C(3)G(4)A(5)A(6)T(7)T(8)C(9)G(10)C(11)G(12))(2) (ODN1) and ds(C(1)G(2)C(3)G(4)T(5)A(6)T(7)A(8)C(9)G(10)C(11)G(12))(2) (ODN2), was studied by NMR measurements. The results indicated that [Pt(ii)(phen)(edda)] was partially intercalated between C(3)/G(10) and G(4)/C(9) base pairs of ODN1 and ODN2 in the major grooves, whereas [Zn(II)(phen)(edda)] was bound specifically to the TATA region of ODN2 in the minor groove and to the terminal G(2)/C(11) base pair of ODN1 in the major groove. The preference for the TATA sequence over the AATT sequence in the binding of [Zn(phen)(edda)] was attributed to the wider minor groove width of the TATA sequence. The bindings of the complexes to ct-DNA were also studied by UV, CD, and fluorescence spectroscopy. Additionally, the antiproliferative property of [Pt(II)(phen)(edda)] towards MCF7 breast cancer cells and normal MCF10-A cells was compared with that of [Zn(II)(phen)(edda)].

  12. Metallated DNA Aptamers for Prostate Cancer Treatment

    Science.gov (United States)

    2013-03-01

    backbone, and the deleting the thymidine methyl group and replacement with fluorine. In keeping with our previous work (Ghosh et al. 2011), every...minor groove while the new 320 nm maxima reflect the binding of N- methyl pyrrole moieties of netropsin in the minor groove of 3’FdU.(Zimmer, Marck...malignancies. PSMA is an exopeptidase 2 with folate hydrolase and NAALDase activities. PSMA also associates with anaphase promoting complex and its

  13. Pyrrolobenzodiazepines (PBDs do not bind to DNA G-quadruplexes.

    Directory of Open Access Journals (Sweden)

    Khondaker M Rahman

    Full Text Available The pyrrolo[2,1-c][1,4] benzodiazepines (PBDs are a family of sequence-selective, minor-groove binding DNA-interactive agents that covalently attach to guanine residues. A recent publication in this journal (Raju et al, PloS One, 2012, 7, 4, e35920 reported that two PBD molecules were observed to bind with high affinity to the telomeric quadruplex of Tetrahymena glaucoma based on Electrospray Ionisation Mass Spectrometry (ESI-MS, Circular Dichroism, UV-Visible and Fluorescence spectroscopy data. This was a surprising result given the close 3-dimensional shape match between the structure of all PBD molecules and the minor groove of duplex DNA, and the completely different 3-dimensional structure of quadruplex DNA. Therefore, we evaluated the interaction of eight PBD molecules of diverse structure with a range of parallel, antiparallel and mixed DNA quadruplexes using DNA Thermal Denaturation, Circular Dichroism and Molecular Dynamics Simulations. Those PBD molecules without large C8-substitutents had an insignificant affinity for the eight quadruplex types, although those with large π-system-containing C8-substituents (as with the compounds evaluated by Raju and co-workers were found to interact to some extent. Our molecular dynamics simulations support the likelihood that molecules of this type, including those examined by Raju and co-workers, interact with quadruplex DNA through their C8-substituents rather than the PBD moiety itself. It is important for the literature to be clear on this matter, as the mechanism of action of these agents will be under close scrutiny in the near future due to the growing number of PBD-based agents entering the clinic as both single-agents and as components of antibody-drug conjugates (ADCs.

  14. Studies of base pair sequence effects on DNA solvation based on all-atom molecular dynamics simulations.

    Science.gov (United States)

    Dixit, Surjit B; Mezei, Mihaly; Beveridge, David L

    2012-07-01

    Detailed analyses of the sequence-dependent solvation and ion atmosphere of DNA are presented based on molecular dynamics (MD) simulations on all the 136 unique tetranucleotide steps obtained by the ABC consortium using the AMBER suite of programs. Significant sequence effects on solvation and ion localization were observed in these simulations. The results were compared to essentially all known experimental data on the subject. Proximity analysis was employed to highlight the sequence dependent differences in solvation and ion localization properties in the grooves of DNA. Comparison of the MD-calculated DNA structure with canonical A- and B-forms supports the idea that the G/C-rich sequences are closer to canonical A- than B-form structures, while the reverse is true for the poly A sequences, with the exception of the alternating ATAT sequence. Analysis of hydration density maps reveals that the flexibility of solute molecule has a significant effect on the nature of observed hydration. Energetic analysis of solute-solvent interactions based on proximity analysis of solvent reveals that the GC or CG base pairs interact more strongly with water molecules in the minor groove of DNA that the AT or TA base pairs, while the interactions of the AT or TA pairs in the major groove are stronger than those of the GC or CG pairs. Computation of solvent-accessible surface area of the nucleotide units in the simulated trajectories reveals that the similarity with results derived from analysis of a database of crystallographic structures is excellent. The MD trajectories tend to follow Manning's counterion condensation theory, presenting a region of condensed counterions within a radius of about 17 A from the DNA surface independent of sequence. The GC and CG pairs tend to associate with cations in the major groove of the DNA structure to a greater extent than the AT and TA pairs. Cation association is more frequent in the minor groove of AT than the GC pairs. In general, the

  15. [Microsurgical removal of olfactory groove meningiomas].

    Science.gov (United States)

    Liang, Ri-Sheng; Zhou, Liang-Fu; Mao, Ying; Zhang, Rong; Yang, Wei-Zhong

    2011-01-01

    To explore an effective method for further improving the surgical results of treatment of olfactory groove meningiomas. Sixty seven cases of olfactory groove meningiomas were treated by microneurosurgery, among which fifty seven were de novo cases, eight were recurrent tumors and the other two re-recurrent cases. Modified Derome approach was used in 12 cases, bilateral subfrontal approach in 28 cases, modified pterional approach in 21 cases and unilateral subfrontal approach in six cases. Tumors were resected microsurgically with radical removal of invaded dura, bone, and paranasal sinus mucosa. Reconstruction was performed in patients with skull base defect. Simpson grade I removal was accomplished in 59 cases, grade II in seven cases and grade IV in one case. Among 57 patients with de novo tumor, Simpson I resection was accomplished in 54 cases. Postoperative rhinorrhea and intracranial infection occurred in one case and was cured after temporal lumbar CSF drainage and antibiotic therapy. Two patients (2.9%) died within one month after operation, i.e.one aged patient of heart failure and the other of severe hypothalamus complication. Forty seven patients (72.3%) were followed up from one to ten years with an average of five years and four months. With the exception of two cases died, among the alive 45 patients, there were only three patients with tumor recurrence, which had undergone Simpson II or IV tumor resection. No recurrence was found in cases with Simpson I tumor removal. Previous blurred vision was not improved in three patients, hemiparalysis in two patients, and the other patients recovered well, resuming previous jobs or being able to take care themselves. Total tumor removal (Simpson I) should be the surgical goal for treatment of olfactory groove meningiomas, especially for de novo cases. An appropriate approach is fundamental in the effort to remove an OGM totally. Appropriate anterior skull base reconstruction with vascularized material is

  16. Structure and DNA-binding of meiosis-specific protein Hop2

    Science.gov (United States)

    Zhou, Donghua; Moktan, Hem; Pezza, Roberto

    2014-03-01

    Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

  17. Laser Surface Hardening of Groove Edges

    Science.gov (United States)

    Hussain, A.; Hamdani, A. H.; Akhter, R.; Aslam, M.

    2013-06-01

    Surface hardening of groove-edges made of 3Cr13 Stainless Steel has been carried out using 500 W CO2 laser with a rectangular beam of 2.5×3 mm2. The processing speed was varied from 150-500 mm/min. It was seen that the hardened depth increases with increase in laser interaction time. A maximum hardened depth of around 1mm was achieved. The microhardness of the transformed zone was 2.5 times the hardness of base metal. The XRD's and microstructural analysis were also reported.

  18. Syncopation, body-movement and pleasure in groove music.

    OpenAIRE

    Witek, MA; Clarke, EF; Wallentin, M; Kringelbach, ML; Vuust, P

    2014-01-01

    Moving to music is an essential human pleasure particularly related to musical groove. Structurally, music associated with groove is often characterised by rhythmic complexity in the form of syncopation, frequently observed in musical styles such as funk, hip-hop and electronic dance music. Structural complexity has been related to positive affect in music more broadly, but the function of syncopation in eliciting pleasure and body-movement in groove is unknown. Here we report results from a ...

  19. Wetting morphologies and their transitions in grooved substrates

    Energy Technology Data Exchange (ETDEWEB)

    Seemann, Ralf; Bommer, Stefan; Herrmann, Carsten; Michler, Dominik [Experimental Physics, Saarland University, D-66123 Saarbruecken (Germany); Brinkmann, Martin; Herminghaus, Stephan; Khare, Krishnacharya; Kostourou, Konstantina; Gurevich, Evgeny [Max Planck Institute for Dynamics and Self-Organization, D-37073 Goettingen (Germany); Law, Bruce M; McBride, Sean, E-mail: r.seemann@physik.uni-saarland.de [Department of Physics, Kansas State University, Manhattan, KS 66506 (United States)

    2011-05-11

    When exposed to a partially wetting liquid, many natural and artificial surfaces equipped with complex topographies display a rich variety of liquid interfacial morphologies. In the present article, we focus on a few simple paradigmatic surface topographies and elaborate on the statics and dynamics of the resulting wetting morphologies. It is demonstrated that the spectrum of wetting morphologies increases with increasing complexity of the groove structure. On elastically deformable substrates, additional structures in the liquid morphologies can be observed, which are caused by deformations of the groove geometry in the presence of capillary forces. The emergence of certain liquid morphologies in grooves can be actively controlled by changes in wettability and geometry. For electrically conducting solid substrates, the apparent contact angle can be varied by electrowetting. This allows, depending on groove geometry, a reversible or irreversible transport of liquid along surface grooves. In the case of irreversible liquid transport in triangular grooves, the dynamics of the emerging instability is sensitive to the apparent hydrodynamic slip at the substrate. On elastic substrates, the geometry can be varied in a straightforward manner by stretching or relaxing the sample. The imbibition velocity in deformable grooves is significantly reduced compared to solid grooves, which is a result of the microscopic deformation of the elastic groove material close to the three phase contact line.

  20. Understanding the connection between epigenetic DNA methylation and nucleosome positioning from computer simulations.

    Directory of Open Access Journals (Sweden)

    Guillem Portella

    Full Text Available Cytosine methylation is one of the most important epigenetic marks that regulate the process of gene expression. Here, we have examined the effect of epigenetic DNA methylation on nucleosomal stability using molecular dynamics simulations and elastic deformation models. We found that methylation of CpG steps destabilizes nucleosomes, especially when these are placed in sites where the DNA minor groove faces the histone core. The larger stiffness of methylated CpG steps is a crucial factor behind the decrease in nucleosome stability. Methylation changes the positioning and phasing of the nucleosomal DNA, altering the accessibility of DNA to regulatory proteins, and accordingly gene functionality. Our theoretical calculations highlight a simple physical-based explanation on the foundations of epigenetic signaling.

  1. The order of condensation in capillary grooves

    International Nuclear Information System (INIS)

    Rascón, Carlos; Parry, Andrew O; Nürnberg, Robert; Pozzato, Alessandro; Tormen, Massimo; Bruschi, Lorenzo; Mistura, Giampaolo

    2013-01-01

    We consider capillary condensation in a deep groove of width L. The transition occurs at a pressure p co (L) described, for large widths, by the Kelvin equation p sat − p co (L) = 2σcosθ/L, where θ is the contact angle at the side walls and σ is the surface tension. The order of the transition is determined by the contact angle of the capped end θ cap ; it is continuous if the liquid completely wets the cap, and first-order otherwise. When the transition is first-order, corner menisci at the bottom of the capillary lead to a pronounced metastability, determined by a complementary Kelvin equation Δp(L) = 2σsinθ cap /L. On approaching the wetting temperature of the capillary cap, the corner menisci merge and a single meniscus unbinds from the bottom of the groove. Finite-size scaling shifts, crossover behaviour and critical singularities are determined at mean-field level and beyond. Numerical and experimental results showing the continuous nature of condensation for θ cap = 0 and the influence of corner menisci on adsorption isotherms are presented. (fast track communication)

  2. The order of condensation in capillary grooves.

    Science.gov (United States)

    Rascón, Carlos; Parry, Andrew O; Nürnberg, Robert; Pozzato, Alessandro; Tormen, Massimo; Bruschi, Lorenzo; Mistura, Giampaolo

    2013-05-15

    We consider capillary condensation in a deep groove of width L. The transition occurs at a pressure p(co)(L) described, for large widths, by the Kelvin equation p(sat) - p(co)(L) = 2σ cosθ/L, where θ is the contact angle at the side walls and σ is the surface tension. The order of the transition is determined by the contact angle of the capped end θcap; it is continuous if the liquid completely wets the cap, and first-order otherwise. When the transition is first-order, corner menisci at the bottom of the capillary lead to a pronounced metastability, determined by a complementary Kelvin equation Δp(L) = 2σ sinθcap/L. On approaching the wetting temperature of the capillary cap, the corner menisci merge and a single meniscus unbinds from the bottom of the groove. Finite-size scaling shifts, crossover behaviour and critical singularities are determined at mean-field level and beyond. Numerical and experimental results showing the continuous nature of condensation for θcap = 0 and the influence of corner menisci on adsorption isotherms are presented.

  3. Recognition of AT-Rich DNA Binding Sites by the MogR Repressor

    Energy Technology Data Exchange (ETDEWEB)

    Shen, Aimee; Higgins, Darren E.; Panne, Daniel; (Harvard-Med); (EMBL)

    2009-07-22

    The MogR transcriptional repressor of the intracellular pathogen Listeria monocytogenes recognizes AT-rich binding sites in promoters of flagellar genes to downregulate flagellar gene expression during infection. We describe here the 1.8 A resolution crystal structure of MogR bound to the recognition sequence 5' ATTTTTTAAAAAAAT 3' present within the flaA promoter region. Our structure shows that MogR binds as a dimer. Each half-site is recognized in the major groove by a helix-turn-helix motif and in the minor groove by a loop from the symmetry-related molecule, resulting in a 'crossover' binding mode. This oversampling through minor groove interactions is important for specificity. The MogR binding site has structural features of A-tract DNA and is bent by approximately 52 degrees away from the dimer. The structure explains how MogR achieves binding specificity in the AT-rich genome of L. monocytogenes and explains the evolutionary conservation of A-tract sequence elements within promoter regions of MogR-regulated flagellar genes.

  4. Numerical analysis of flow in a centrifugal compressor with circumferential grooves: influence of groove location and number on flow instability

    Science.gov (United States)

    Chen, X.; Qin, G.; Ai, Z.; Ji, Y.

    2017-08-01

    As an effective and economic method for flow range enhancement, circumferential groove casing treatment (CGCT) is widely used to increase the stall margin of compressors. Different from traditional grooved casing treatments, in which the grooves are always located over the rotor in both axial and radial compressors, one or several circumferential grooves are located along the shroud side of the diffuser passage in this paper. Numerical investigations were conducted to predict the performance of a low flow rate centrifugal compressor with CGCT in diffuser. Computational fluid dynamics (CFD) analysis is performed under stage environment in order to find the optimum location of the circumferential casing groove in consideration of stall margin enhancement and efficiency gain at design point, and the impact of groove number to the effect of this grooved casing treatment configuration in enhancing the stall margin of the compressor stage is studied. The results indicate that the centrifugal compressor with circumferential groove in vaned diffuser can obtain obvious improvement in the stall margin with sacrificing design efficiency a little. Efforts were made to study blade level flow mechanisms to determine how the CGCT impacts the compressor’s stall margin (SM) and performance. The flow structures in the passage, the tip gap, and the grooves as well as their mutual interactions were plotted and analysed.

  5. Non-electrostatic complexes with DNA: towards novel synthetic gene delivery systems.

    Science.gov (United States)

    Soto, J; Bessodes, M; Pitard, B; Mailhe, P; Scherman, D; Byk, G

    2000-05-01

    We have developed new DNA complexing amphiphile based on Hoechst 33258 interaction with DNA grooves. The synthesis and physicochemical characterisation of lipid/DNA complexes, as compared to that of classical lipopolyamine for gene delivery, are described and discussed.

  6. Câncer e agentes antineoplásicos ciclo-celular específicos e ciclo-celular não específicos que interagem com o DNA: uma introdução Cancer and cell cicle-specific and cell cicle nonspecific anticancer DNA-interactive agents: an introduction

    Directory of Open Access Journals (Sweden)

    Vera Lúcia de Almeida

    2005-02-01

    Full Text Available The chemotherapy agents against cancer may be classified as "cell cycle-specific" or "cell cycle-nonspecific". Nevertheless, several of them have their biological activity related to any kind of action on DNA such as: antimetabolic agents (DNA synthesis inhibition, inherently reactive agents (DNA alkylating electrophilic traps for macromolecular nucleophiles from DNA through inter-strand cross-linking - ISC - alkylation and intercalating agents (drug-DNA interactions inherent to the binding made due to the agent penetration in to the minor groove of the double helix. The earliest and perhaps most extensively studied and most heavily employed clinical anticancer agents in use today are the DNA inter-strand cross-linking agents.

  7. CC-1065 and the duocarmycins: unraveling the keys to a new class of naturally derived DNA alkylating agents.

    Science.gov (United States)

    Boger, D L; Johnson, D S

    1995-01-01

    Key studies defining the DNA alkylation properties and selectivity of a new class of exceptionally potent, naturally occurring antitumor antibiotics including CC-1065, duocarmycin A, and duocarmycin SA are reviewed. Recent studies conducted with synthetic agents containing deep-seated structural changes and the unnatural enantiomers of the natural products and related analogs have defined the structural basis for the sequence-selective alkylation of duplex DNA and fundamental relationships between chemical structure, functional reactivity, and biological properties. The agents undergo a reversible, stereoelectronically controlled adenine-N3 addition to the least substituted carbon of the activated cyclopropane within selected AT-rich sites. The preferential AT-rich non-covalent binding selectivity of the agents within the narrower, deeper AT-rich minor groove and the steric accessibility to the alkylation site that accompanies deep AT-rich minor groove penetration control the sequence-selective DNA alkylation reaction and stabilize the resulting adduct. For the agents that possess sufficient reactivity to alkylate DNA, a direct relationship between chemical or functional stability and biological potency has been defined. Images Fig. 1 Fig. 2 PMID:7731958

  8. From the Bandstand to the Classroom: Thinking and Playing Grooves

    Science.gov (United States)

    Baxter, Marsha; Santantasio, Christopher

    2012-01-01

    In this article, narratives of a salsa concert and a lesson with a Native American flute performer provide openings for exploring grooves and their application in the music classroom. The term "groove" is examined, along with some non-Western ideas about time as represented in the music of the West African Kpelle people. A sixth-grade…

  9. Heat transfer and thermal stress analysis in grooved tubes

    Indian Academy of Sciences (India)

    Heat transfer and thermal stresses, induced by temperature differencesin the internally grooved tubes of heat transfer equipment, have been analysed numerically. The analysis has been conducted for four different kinds of internally grooved tubes and three different mean inlet water velocities. Constant temperature was ...

  10. Grooves on the occipital lobe of Indian brains.

    Science.gov (United States)

    Bisaria, K K

    1984-01-01

    The existence of a groove on the occipital lobe formed by the dural venous sinus or ridge has only rarely been described in the past. As observed in this study such grooves are either unilateral or bilateral and their incidence is very high in Indian brains. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:6490537

  11. Grooves on the occipital lobe of Indian brains.

    OpenAIRE

    Bisaria, K K

    1984-01-01

    The existence of a groove on the occipital lobe formed by the dural venous sinus or ridge has only rarely been described in the past. As observed in this study such grooves are either unilateral or bilateral and their incidence is very high in Indian brains.

  12. Observations of secondary oscillations in thermal grain boundary grooves

    International Nuclear Information System (INIS)

    Sachenko, P.P.; Schneibel, J.H.; Zhang, W.

    2004-01-01

    Thermal grain boundary grooving by surface diffusion is accompanied not only by main maxima on either side of a groove, but also by secondary maxima and minima. We measure these oscillations in tungsten and give reasons why the observed secondary maxima and minima are larger than predicted

  13. In vitro DNA binding studies of lenalidomide using spectroscopic in combination with molecular docking techniques

    Science.gov (United States)

    Xu, Liang; Hu, Yan-Xi; Li, Yan-Cheng; Zhang, Li; Ai, Hai-Xin; Liu, Yu-Feng; Liu, Hong-Sheng

    2018-02-01

    In the present work, the binding interaction between lenalidomide (LEN) and calf thymus DNA (ct-DNA) was systematically studied by using fluorescence, ultraviolet-visible (UV-vis) absorption, circular dichroism (CD) spectroscopies under imitated physiological conditions (pH = 7.4) coupled with molecular docking. It was found that LEN was bound to ct-DNA with high binding affinity (Ka = 2.308 × 105 M-1 at 283 K) through groove binding as evidenced by a slight decrease in the absorption intensity in combination with CD spectra. Thermodynamic parameters (ΔG 0 and ΔS interaction. Furthermore, competitive binding experiments with ethidium bromide and 4‧, 6-dia-midino-2-phenylindoleas probes showed that LEN could preferentially bind in the minor groove of double-stranded DNA. The average lifetime of LEN was calculated to be 7.645 ns. The φ of LEN was measured as 0.09 and non-radiation energy transfer between LEN and DNA had occurred. The results of the molecular docking were consistent with the experimental results. This study explored the potential applicability of the spectroscopic properties of LEN and also investigated its interactions with relevant biological targets. In addition, it will provide some theoretical references for the deep research of simultaneous administration of LEN with other drugs.

  14. Interaction and dynamics of homologous pairing protein 2 (HOP2) and DNA studied by MD simulation

    Science.gov (United States)

    Moktan, Hem; Pezza, Roberto; Zhou, Donghua

    2015-03-01

    The homologous pairing protein 2 (Hop2) plays an important role in meiosis and DNA repair. Together with protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. We recently determined the NMR structure of the N-terminal domain of Hop2 and proposed a model of Protein-DNA complex based on NMR chemical shift perturbations and mutagenesis studies (Moktan, J Biol Chem 2014 10.1074/jbc.M114.548180). However structure and dynamics of the complex have not been studied at the atomic level yet. Here, we used classical MD simulations to study the interactions between the N-terminal HOP2 and DNA. The simulated results indicate that helix3 (H3) interacts with DNA in major groove and wing1 (W1) interacts mostly in minor groove mainly via direct hydrogen bonds. Also it is found that binding leads to reduced fluctuations in both protein and DNA. Several water bridge interactions have been identified. The residue-wise contributions to the interaction energy were evaluated. Also the functional motion of the protein is analyzed using principal component analysis. The results confirmed the importance of H3 and W1 for the stability of the complex, which is consistent with our previous experimental studies.

  15. Olfactory groove meningiomas: approaches and complications.

    Science.gov (United States)

    Aguiar, Paulo Henrique Pires de; Tahara, Adriana; Almeida, Antonio Nogueira; Simm, Renata; Silva, Arnaldo Neves da; Maldaun, Marcos Vinicius Calfatt; Panagopoulos, Alexandros Theodoros; Zicarelli, Carlos Alexandre; Silva, Pedro Gabriel

    2009-09-01

    Olfactory groove meningiomas (OGM) account for 4.5% of all intracranial meningiomas. We report 21 patients with OGMs. Tumors were operated on using three surgical approaches: bifrontal (7 patients), fronto-pterional (11 patients) and fronto-orbital (3 patients). Total tumor removal (Simpson Grade 1) was achieved in 13 patients and Simpson II in 8 patients. Perioperative mortality was 4.76%. The average size of the OGM was 4.3+/-1.1cm. The overall recurrence rate was 19%. We preferred to use the pterional approach, which provides quick access to the tumor with less brain exposure. It also allows complete drainage of cisternal cerebrospinal fluid, providing a good level of brain relaxation during surgery. However, for long, thin tumors, hemostasis can be difficult using this approach.

  16. Plasma interaction with emmissive surface with Debye-scale grooves

    Science.gov (United States)

    Schweigert, Irina; Burton, Thomas S.; Thompson, Gregory B.; Langendorf, Samuel; Walker, Mitchell L. R.; Keidar, Michael

    2018-04-01

    The sheath development over emissive grooved surface in dc discharge plasma controlled by an electron beam is studied in the experiment and in 2D kinetic simulations. Grooved hexagonal boron nitride surfaces with different aspect ratios, designed to mimic the erosion channels, were exposed to an argon plasma. The characteristic size of the grooves (1 mm and 5 mm) is about of the Debye length. The secondary electrons emission from the grooved surfaces is provided by the bombardment with energetic electrons originated from the heated powered cathode. The transition between a developed and a collapsed sheaths near emissive surface takes place with an increase of the beam electron energy. For grooved emissive surfaces, the sheath transition happens at essentially higher voltage compared to the planar one. This phenomenon is analyzed in the terms of the electron energy distribution function.

  17. Characteristics of Multiplexed Grooved Nozzles for High Flow Rate Electrospray

    International Nuclear Information System (INIS)

    Kim, Kyoung Tae; Kim, Woo Jin; Kim, Sang Soo

    2007-01-01

    The electrospray operated in the cone-jet mode can generate highly charged micro droplets in an almost uniform size at flow rates. Therefore, the multiplexing system which can retain the characteristics of the cone-jet mode is inevitable for the electrospray application. This experiment reports the multiplexed grooved nozzle system with the extractor. The effects of the grooves and the extractor on the performance of the electrospray were evaluated through experiments. Using the grooved nozzle, the stable cone-jet mode can be achieved at the each groove in the grooved mode. Furthermore, the number of nozzles per unit area is increased by the extractor. The multiplexing density is 12 jets per cm 2 at 30 mm distance from the nozzle tip to the ground plate. The multiplexing system for the high flow rate electrospray is realized with the extractor which can diminish the space charge effect without sacrificing characteristics of the cone-jet mode

  18. Transcriptional blockages in a cell-free system by sequence-selective DNA alkylating agents.

    Science.gov (United States)

    Ferguson, L R; Liu, A P; Denny, W A; Cullinane, C; Talarico, T; Phillips, D R

    2000-04-14

    There is considerable interest in DNA sequence-selective DNA-binding drugs as potential inhibitors of gene expression. Five compounds with distinctly different base pair specificities were compared in their effects on the formation and elongation of the transcription complex from the lac UV5 promoter in a cell-free system. All were tested at drug levels which killed 90% of cells in a clonogenic survival assay. Cisplatin, a selective alkylator at purine residues, inhibited transcription, decreasing the full-length transcript, and causing blockage at a number of GG or AG sequences, making it probable that intrastrand crosslinks are the blocking lesions. A cyclopropylindoline known to be an A-specific alkylator also inhibited transcription, with blocks at adenines. The aniline mustard chlorambucil, that targets primarily G but also A sequences, was also effective in blocking the formation of full-length transcripts. It produced transcription blocks either at, or one base prior to, AA or GG sequences, suggesting that intrastrand crosslinks could again be involved. The non-alkylating DNA minor groove binder Hoechst 33342 (a bisbenzimidazole) blocked formation of the full-length transcript, but without creating specific blockage sites. A bisbenzimidazole-linked aniline mustard analogue was a more effective transcription inhibitor than either chlorambucil or Hoechst 33342, with different blockage sites occurring immediately as compared with 2 h after incubation. The blockages were either immediately prior to AA or GG residues, or four to five base pairs prior to such sites, a pattern not predicted from in vitro DNA-binding studies. Minor groove DNA-binding ligands are of particular interest as inhibitors of gene expression, since they have the potential ability to bind selectively to long sequences of DNA. The results suggest that the bisbenzimidazole-linked mustard does cause alkylation and transcription blockage at novel DNA sites. in addition to sites characteristic of

  19. Double-grooved nanofibre surfaces with enhanced anisotropic hydrophobicity.

    Science.gov (United States)

    Liang, Meimei; Chen, Xin; Xu, Yang; Zhu, Lei; Jin, Xiangyu; Huang, Chen

    2017-11-02

    This study reports a facile method for fabricating double-grooved fibrous surfaces. The primary grooves of the surface are formed by aligned fibres, while the secondary grooves are achieved by oriented nanogrooves on the fibre surface. Investigation into the formation mechanism reveals that the nanogrooves can be readily tailored through adjusting the solvent ratio and relative humidity. With this understanding, a variety of polymers have been successfully electrospun into fibres having the same nanogrooved feature. These fibres show high resemblance to natural hierarchical structures, and thereby endowing the corresponding double-grooved surface with enhanced anisotropic hydrophobicity. A water droplet at a parallel direction to the grooves exhibits a much higher contact angle and a lower roll-off angle than the droplet at a perpendicular direction. The application potential of such anisotropic hydrophobicity has been demonstrated via a fog collection experiment, in which the double-grooved surface can harvest the largest amount of water. Moreover, the fabrication method requires neither post-treatment nor sophisticated equipment, making us anticipate that the double-grooved surface would be competitive in areas where a highly ordered surface, a large surface area and an anisotropic hydrophobicity are preferred.

  20. Binding of the antitumor drug nogalamycin and its derivatives to DNA: Structural comparison

    International Nuclear Information System (INIS)

    Gao, Yi-Gui; Liaw, Yen-Chywan; Robinson, H.; Wang, A. H.-J.

    1990-01-01

    The three-dimensional molecular structures of the complexes between a novel antitumor drug nogalamycin and its derivative U-58872 with a modified DNA hexamer d[m 5 CGT(pS)Am 5 CG] have been determined at 1.7- and 1.8-angstrom resolution, respectively, by X-ray diffraction analyses. Both structures (in space group P6 1 ) have been refined with constrained refinement procedure to final R factors of 0.208 (3386 reflections) and 0.196 (2143 reflections). In both complexes, two nogalamycins bind to the DNA hexamer double helix in a 2:1 ratio with the elongated aglycon chromophore intercalated between the CpG steps at both ends of the helix. The aglycon chromophore spans across the GC Watson-Crick base pairs with its nogalose lying in the minor groove and the aminoglucose lying in the major groove of the distorted B-DNA double helix. Most of the sugars remain in the C2'-endo pucker family, except three deoxycytidine residues (terminal C1, C7, and internal C5). All nucleotides are in the anti conformation. Specific hydrogen bonds are found in the complex between the drug and guanine-cytosine bases in both grooves of the helix. One hydroxyl group of the aminoglucose donates a hydrogen bond to the N7 of guanine, while the other receives a hydrogen bond from the N4 amino group of cytosine. The orientation of these two hydrogen bonds suggests that nogalamycin prefers a GC base pair with its aglycon chromophore intercalating at the 5'-side of a guanine (between NpG), or at the 3'-side of a cytosine (between CpN) with the sugars pointing toward the GC base pair. The binding of nogalamycin to DNA requires that the base pairs in DNA open up transiently to allow the bulky sugars to go through, suggesting that nogalamycin prefers GC sequences embedded in a stretch of AT sequences

  1. Structural and mechanical behaviour of severe plastically deformed high purity aluminium sheets processed by constrained groove pressing technique

    International Nuclear Information System (INIS)

    Satheesh Kumar, S.S.; Raghu, T.

    2014-01-01

    Highlights: • High purity aluminium sheets constrained groove pressed up to plastic strain of 5.8. • Microstructural evolution studied by TEM and X-ray diffraction profile analysis. • Ultrafine grained structure with grain size ∼900 nm achieved in sheets. • Yield strength increased by 5.3 times and tensile strength doubled after first pass. • Enhanced deformation homogeneity seen with increased accumulated plastic strain. - Abstract: High purity aluminium sheets (∼99.9%) are subjected to intense plastic straining by constrained groove pressing method successfully up to 5 passes thereby imparting an effective plastic strain of 5.8. Transmission electron microscopy studies of constrained groove pressed sheets divulged significant grain refinement and the average grain sizes obtained after five pass is estimated to be ∼0.9 μm. In addition to that, microstructural evolution of constrained groove pressed sheets is characterized by X-ray diffraction peak profile analysis employing Williamson–Hall method and the results obtained fairly concur with electron microscopy findings. The tensile behaviour evolution with increased straining indicates substantial improvement of yield strength by ∼5.3 times from 17 MPa to 90 MPa during first pass corroborated to grain refinement observed. Marginal increase in strengths is noticed during second pass followed by minor drop in strengths attributed to predominance of dislocation recovery is noticed in subsequent passes. Quantitative assessment of degree of deformation homogeneity using microhardness profiles reveal relatively better strain homogeneity at higher number of passes

  2. Vacuum sealing with a spiral grooved gas dynamic seal

    International Nuclear Information System (INIS)

    Sawada, Tadashi

    1979-01-01

    Gas dynamic seals with rectangular spiral grooves are studied theoretically taking the effects of sidewalls of the grooves and the effects of gas compressibility into account, and slip boundary conditions are employed. The results are compared with the existing experimental data and the validity of the theory is confirmed over a wide pressure range except for the extremely low pressures. Suggestions are made regarding the choice of the geometrical dimensions, i.e., aspect ratio, helix angle, clearance parameter and groove width ratio. (author)

  3. Grooved Fuel Rings for Nuclear Thermal Rocket Engines

    Science.gov (United States)

    Emrich, William

    2009-01-01

    An alternative design concept for nuclear thermal rocket engines for interplanetary spacecraft calls for the use of grooved-ring fuel elements. Beyond spacecraft rocket engines, this concept also has potential for the design of terrestrial and spacecraft nuclear electric-power plants. The grooved ring fuel design attempts to retain the best features of the particle bed fuel element while eliminating most of its design deficiencies. In the grooved ring design, the hydrogen propellant enters the fuel element in a manner similar to that of the Particle Bed Reactor (PBR) fuel element.

  4. Molecular dynamics simulations and free energy calculations of netropsin and distamycin binding to an AAAAA DNA binding site

    Science.gov (United States)

    Dolenc, Jožica; Oostenbrink, Chris; Koller, Jože; van Gunsteren, Wilfred F.

    2005-01-01

    Molecular dynamics simulations have been performed on netropsin in two different charge states and on distamycin binding to the minor groove of the DNA duplex d(CGCGAAAAACGCG)·d(CGCGTTTTTCGCG). The relative free energy of binding of the two non-covalently interacting ligands was calculated using the thermodynamic integration method and reflects the experimental result. From 2 ns simulations of the ligands free in solution and when bound to DNA, the mobility and the hydrogen-bonding patterns of the ligands were studied, as well as their hydration. It is shown that even though distamycin is less hydrated than netropsin, the loss of ligand–solvent interactions is very similar for both ligands. The relative mobilities of the ligands in their bound and free forms indicate a larger entropic penalty for distamycin when binding to the minor groove compared with netropsin, partially explaining the lower binding affinity of the distamycin molecule. The detailed structural and energetic insights obtained from the molecular dynamics simulations allow for a better understanding of the factors determining ligand–DNA binding. PMID:15687382

  5. Molecular dynamics simulations and free energy calculations of netropsin and distamycin binding to an AAAAA DNA binding site.

    Science.gov (United States)

    Dolenc, Jozica; Oostenbrink, Chris; Koller, Joze; van Gunsteren, Wilfred F

    2005-01-01

    Molecular dynamics simulations have been performed on netropsin in two different charge states and on distamycin binding to the minor groove of the DNA duplex d(CGCGAAAAACGCG).d(CGCGTTTTTCGCG). The relative free energy of binding of the two non-covalently interacting ligands was calculated using the thermodynamic integration method and reflects the experimental result. From 2 ns simulations of the ligands free in solution and when bound to DNA, the mobility and the hydrogen-bonding patterns of the ligands were studied, as well as their hydration. It is shown that even though distamycin is less hydrated than netropsin, the loss of ligand-solvent interactions is very similar for both ligands. The relative mobilities of the ligands in their bound and free forms indicate a larger entropic penalty for distamycin when binding to the minor groove compared with netropsin, partially explaining the lower binding affinity of the distamycin molecule. The detailed structural and energetic insights obtained from the molecular dynamics simulations allow for a better understanding of the factors determining ligand-DNA binding.

  6. Molecular dynamics simulations shed light on the enthalpic and entropic driving forces that govern the sequence specific recognition between netropsin and DNA.

    Science.gov (United States)

    Dolenc, Jozica; Gerster, Sarah; van Gunsteren, Wilfred F

    2010-09-02

    With the aim to gain a better understanding of the various driving forces that govern sequence specific DNA minor groove binding, we performed a thermodynamic analysis of netropsin binding to an AT-containing and to a set of six mixed AT/GC-containing binding sequences in the DNA minor groove. The relative binding free energies obtained using molecular dynamics simulations and free energy calculations show significant variations with the binding sequence. While the introduction of a GC base pair in the middle or close to the middle of the binding site is unfavorable for netropsin binding, a GC base pair at the end of the binding site appears to have no negative influence on the binding. The results of the structural and energetic analyses of the netropsin-DNA complexes reveal that the differences in the calculated binding affinities cannot be explained solely in terms of netropsin-DNA hydrogen-bonding or interaction energies. In addition, solvation effects and entropic contributions to the relative binding free energy provide a more complete picture of the various factors determining binding. Analysis of the relative binding entropy indicates that its magnitude is highly sequence-dependent, with the ratio |TDeltaDeltaS|/|DeltaDeltaH| ranging from 0.07 for the AAAGA to 1.7 for the AAGAG binding sequence, respectively.

  7. Design, synthesis and DNA interactions of a chimera between a platinum complex and an IHF mimicking peptide.

    Science.gov (United States)

    Rao, Harita; Damian, Mariana S; Alshiekh, Alak; Elmroth, Sofi K C; Diederichsen, Ulf

    2015-12-28

    Conjugation of metal complexes with peptide scaffolds possessing high DNA binding affinity has shown to modulate their biological activities and to enhance their interaction with DNA. In this work, a platinum complex/peptide chimera was synthesized based on a model of the Integration Host Factor (IHF), an architectural protein possessing sequence specific DNA binding and bending abilities through its interaction with a minor groove. The model peptide consists of a cyclic unit resembling the minor grove binding subdomain of IHF, a positively charged lysine dendrimer for electrostatic interactions with the DNA phosphate backbone and a flexible glycine linker tethering the two units. A norvaline derived artificial amino acid was designed to contain a dimethylethylenediamine as a bidentate platinum chelating unit, and introduced into the IHF mimicking peptides. The interaction of the chimeric peptides with various DNA sequences was studied by utilizing the following experiments: thermal melting studies, agarose gel electrophoresis for plasmid DNA unwinding experiments, and native and denaturing gel electrophoresis to visualize non-covalent and covalent peptide-DNA adducts, respectively. By incorporation of the platinum metal center within the model peptide mimicking IHF we have attempted to improve its specificity and DNA targeting ability, particularly towards those sequences containing adjacent guanine residues.

  8. Mapping the structural and dynamical features of multiple p53 DNA binding domains: insights into loop 1 intrinsic dynamics.

    Directory of Open Access Journals (Sweden)

    Suryani Lukman

    Full Text Available The transcription factor p53 regulates cellular integrity in response to stress. p53 is mutated in more than half of cancerous cells, with a majority of the mutations localized to the DNA binding domain (DBD. In order to map the structural and dynamical features of the DBD, we carried out multiple copy molecular dynamics simulations (totaling 0.8 μs. Simulations show the loop 1 to be the most dynamic element among the DNA-contacting loops (loops 1-3. Loop 1 occupies two major conformational states: extended and recessed; the former but not the latter displays correlations in atomic fluctuations with those of loop 2 (~24 Å apart. Since loop 1 binds to the major groove whereas loop 2 binds to the minor groove of DNA, our results begin to provide some insight into the possible mechanism underpinning the cooperative nature of DBD binding to DNA. We propose (1 a novel mechanism underlying the dynamics of loop 1 and the possible tread-milling of p53 on DNA and (2 possible mutations on loop 1 residues to restore the transcriptional activity of an oncogenic mutation at a distant site.

  9. DNA-directed alkylating ligands as potential antitumor agents: sequence specificity of alkylation by intercalating aniline mustards.

    Science.gov (United States)

    Prakash, A S; Denny, W A; Gourdie, T A; Valu, K K; Woodgate, P D; Wakelin, L P

    1990-10-23

    The sequence preferences for alkylation of a series of novel parasubstituted aniline mustards linked to the DNA-intercalating chromophore 9-aminoacridine by an alkyl chain of variable length were studied by using procedures analogous to Maxam-Gilbert reactions. The compounds alkylate DNA at both guanine and adenine sites. For mustards linked to the acridine by a short alkyl chain through a para O- or S-link group, 5'-GT sequences are the most preferred sites at which N7-guanine alkylation occurs. For analogues with longer chain lengths, the preference of 5'-GT sequences diminishes in favor of N7-adenine alkylation at the complementary 5'-AC sequence. Magnesium ions are shown to selectively inhibit alkylation at the N7 of adenine (in the major groove) by these compounds but not the alkylation at the N3 of adenine (in the minor groove) by the antitumor antibiotic CC-1065. Effects of chromophore variation were also studied by using aniline mustards linked to quinazoline and sterically hindered tert-butyl-9-aminoacridine chromophores. The results demonstrate that in this series of DNA-directed mustards the noncovalent interactions of the carrier chromophores with DNA significantly modify the sequence selectivity of alkylation by the mustard. Relationships between the DNA alkylation patterns of these compounds and their biological activities are discussed.

  10. Surgical Management of Olfactory Groove Meningiomas | El-Naggar ...

    African Journals Online (AJOL)

    Objective: To study the bifrontal approach to olfactory groove meningiomas ... in all patients was Grade I meningiomas (World Health Organization grading). ... Bifrontal approach offers excellent exposure, and when combined with modern ...

  11. Interproximal grooving in the Atapuerca-SH hominid dentitions.

    Science.gov (United States)

    Bermúdez de Castro, J M; Arsuaga, J L; Pérez, P J

    1997-03-01

    The dental sample recovered from the Sima de los Huesos (SH) Middle Pleistocene cave site of the Sierra de Atapuerca (Spain) includes 296 specimens. Interproximal wear grooves have been observed in 20 maxillary and mandibular posterior teeth belonging to at least five of the 32 individuals identified so far in the SH hypodigm. Interproximal grooving affected only the adults, and at an age between 25 and 40 years. The appearance, morphology, and location pattern of the SH wear grooves are similar to those reported in other fossil hominids and in more recent human populations. Two alternative proposals, the toothpicking and the fiber or sinew processing hypotheses, compete for explaining the formation of this anomalous wear. The characteristics observed in the wear grooves of the SH teeth are compatible only with the habitual probing of interdental spaces by means of hard and inflexible objects. Dietary grit may also have contributed to the abrasion of the root walls during the motion of the dental probes.

  12. Fractures of the proximal humerus involving the intertubercular groove

    International Nuclear Information System (INIS)

    Ahovuo, J.; Paavolainen, P.; Bjoerkenheim, J.M.; Helsinki Univ. Central Hospital

    1989-01-01

    The purpose of this study was to analyse the involvement of the gliding surface of the biceps tendon in fractures of the proximal humerus. Fifteen patients had a fracture of the proximal humerus verified with antero-posterior and axillary radiographs. Tangential radiographs of the intertubercular groove, obtained from the shoulder joint, showed involvement of the intertubercular groove in 13 patients (87%), which could not be shown with other projections. Groove radiographs revealed in 3 patients a dislocation of the fragments of the greater tuberosity large enough to require surgical treatment, but which had not been found using conventional techniques. Therefore, a groove radiograph should be used to precise fractures of the proximal humerus. (orig.)

  13. V-groove plasmonic waveguides fabricated by nanoimprint lithography

    DEFF Research Database (Denmark)

    Fernandez-Cuesta, I.; Nielsen, R.B.; Boltasseva, Alexandra

    2007-01-01

    Propagation of channel plasmon-polariton modes in the bottom of a metal V groove has been recently demonstrated. It provides a unique way of manipulating light at nanometer length scale. In this work, we present a method based on nanoimprint lithography that allows parallel fabrication of integra...... of integrated optical devices composed of metal V grooves. This method represents an improvement with respect to previous works, where the V grooves were fabricated by direct milling of the metal, in terms of robustness and throughput. © 2007 American Vacuum Society......Propagation of channel plasmon-polariton modes in the bottom of a metal V groove has been recently demonstrated. It provides a unique way of manipulating light at nanometer length scale. In this work, we present a method based on nanoimprint lithography that allows parallel fabrication...

  14. A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT.

    Directory of Open Access Journals (Sweden)

    Pengfei Ding

    2015-06-01

    Full Text Available Bacterial xenogeneic silencing proteins selectively bind to and silence expression from many AT rich regions of the chromosome. They serve as master regulators of horizontally acquired DNA, including a large number of virulence genes. To date, three distinct families of xenogeneic silencers have been identified: H-NS of Proteobacteria, Lsr2 of the Actinomycetes, and MvaT of Pseudomonas sp. Although H-NS and Lsr2 family proteins are structurally different, they all recognize the AT-rich DNA minor groove through a common AT-hook-like motif, which is absent in the MvaT family. Thus, the DNA binding mechanism of MvaT has not been determined. Here, we report the characteristics of DNA sequences targeted by MvaT with protein binding microarrays, which indicates that MvaT prefers binding flexible DNA sequences with multiple TpA steps. We demonstrate that there are clear differences in sequence preferences between MvaT and the other two xenogeneic silencer families. We also determined the structure of the DNA-binding domain of MvaT in complex with a high affinity DNA dodecamer using solution NMR. This is the first experimental structure of a xenogeneic silencer in complex with DNA, which reveals that MvaT recognizes the AT-rich DNA both through base readout by an "AT-pincer" motif inserted into the minor groove and through shape readout by multiple lysine side chains interacting with the DNA sugar-phosphate backbone. Mutations of key MvaT residues for DNA binding confirm their importance with both in vitro and in vivo assays. This novel DNA binding mode enables MvaT to better tolerate GC-base pair interruptions in the binding site and less prefer A tract DNA when compared to H-NS and Lsr2. Comparison of MvaT with other bacterial xenogeneic silencers provides a clear picture that nature has evolved unique solutions for different bacterial genera to distinguish foreign from self DNA.

  15. [Developmental radicular groove as a cause of endodontic failure].

    Science.gov (United States)

    Fabra Campos, H; Millet Part, J

    1989-01-01

    A clinical case of apical injury on an upper lateral incisor with endodontical and surgical failures in its treatment is presented. Extraction of the incisor and its study at the stereoscopic microscope showed the existence of a developmental groove running from the cingulum to the end of the root, establishing a communication between the crevice and the apical part of the tooth. Bacterial infection through the groove could provide an explanation for treatment failure.

  16. Experimental and Numerical Investigation on Tribological Performance of Grooved Texture

    Directory of Open Access Journals (Sweden)

    CHEN Ping

    2016-06-01

    Full Text Available In order to study the influence of the angle and arrangement forms of micro-grooves on the tribological performance of the contact surface, the finite element analysis software was used to simulate the grooved textures with different angles and arrangements. The YLP-20 laser processing system was used to process grooved texture on stainless steel disk surfaces, and the Tribometer (UMT-2 was also used to conduct tribological test under the condition of rotation. The results show that the numerical simulation values are basically consistent with experimental results of grooved textures, and the tribological performance of the friction pairs with textures is also improved. The grooved textures with different angles and arrangement forms have different influence on tribological performance of friction pairs. When the friction velocity is less than 300r/min, the parallel texture with 0° has smaller friction coefficients. While the friction velocity is larger than 300r/min, the parallel texture with 90° has a better ability of reducing friction. Therefore, different grooved textures should be chosen according to operation conditions.

  17. Model of a DNA-protein complex of the architectural monomeric protein MC1 from Euryarchaea.

    Directory of Open Access Journals (Sweden)

    Françoise Paquet

    Full Text Available In Archaea the two major modes of DNA packaging are wrapping by histone proteins or bending by architectural non-histone proteins. To supplement our knowledge about the binding mode of the different DNA-bending proteins observed across the three domains of life, we present here the first model of a complex in which the monomeric Methanogen Chromosomal protein 1 (MC1 from Euryarchaea binds to the concave side of a strongly bent DNA. In laboratory growth conditions MC1 is the most abundant architectural protein present in Methanosarcina thermophila CHTI55. Like most proteins that strongly bend DNA, MC1 is known to bind in the minor groove. Interaction areas for MC1 and DNA were mapped by Nuclear Magnetic Resonance (NMR data. The polarity of protein binding was determined using paramagnetic probes attached to the DNA. The first structural model of the DNA-MC1 complex we propose here was obtained by two complementary docking approaches and is in good agreement with the experimental data previously provided by electron microscopy and biochemistry. Residues essential to DNA-binding and -bending were highlighted and confirmed by site-directed mutagenesis. It was found that the Arg25 side-chain was essential to neutralize the negative charge of two phosphates that come very close in response to a dramatic curvature of the DNA.

  18. Tool wear of a single-crystal diamond tool in nano-groove machining of a quartz glass plate

    International Nuclear Information System (INIS)

    Yoshino, Masahiko; Nakajima, Satoshi; Terano, Motoki

    2015-01-01

    Tool wear characteristics of a diamond tool in ductile mode machining are presented in this paper. Nano-groove machining of a quartz glass plate was conducted to examine the tool wear rate of a single-crystal diamond tool. Effects of lubrication on the tool wear rate were also evaluated. A numerical simulation technique was developed to evaluate the tool temperature and normal stress acting on the wear surface. From the simulation results it was found that the tool temperature does not increase during the machining experiment. It is also demonstrated that tool wear is attributed to the abrasive wear mechanism, but the effect of the adhesion wear mechanism is minor in nano-groove machining. It is found that the tool wear rate is reduced by using water or kerosene as a lubricant. (paper)

  19. Biophysical characterization of the basic cluster in the transcription repression domain of human MeCP2 with AT-rich DNA.

    Science.gov (United States)

    Mushtaq, Ameeq Ul; Lee, Yejin; Hwang, Eunha; Bang, Jeong Kyu; Hong, Eunmi; Byun, Youngjoo; Song, Ji-Joon; Jeon, Young Ho

    2018-01-01

    MeCP2 is a chromatin associated protein which is highly expressed in brain and relevant with Rett syndrome (RTT). There are AT-hook motifs in MeCP2 which can bind with AT-rich DNA, suggesting a role in chromatin binding. Here, we report the identification and characterization of another AT-rich DNA binding motif (residues 295 to 313) from the C-terminal transcription repression domain of MeCP2 by nuclear magnetic resonance (NMR) and isothermal calorimetry (ITC). This motif shows a micromolar affinity to AT-rich DNA, and it binds to the minor groove of DNA like AT-hook motifs. Together with the previous studies, our results provide an insight into a critical role of this motif in chromatin structure and function. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Synthesis and structure elucidation of a copper(II) Schiff-base complex: in vitro DNA binding, pBR322 plasmid cleavage and HSA binding studies.

    Science.gov (United States)

    Tabassum, Sartaj; Ahmad, Musheer; Afzal, Mohd; Zaki, Mehvash; Bharadwaj, Parimal K

    2014-11-01

    New copper(II) complex with Schiff base ligand 4-[(2-Hydroxy-3-methoxy-benzylidene)-amino]-benzoic acid (H₂L) was synthesized and characterized by spectroscopic and analytical and single crystal X-ray diffraction studies which revealed that the complex 1 exist in a distorted octahedral environment. In vitro CT-DNA binding studies were performed by employing different biophysical technique which indicated that the 1 strongly binds to DNA in comparison to ligand via electrostatic binding mode. Complex 1 cleaves pBR322 DNA via hydrolytic pathway and recognizes minor groove of DNA double helix. The HSA binding results showed that ligand and complex 1 has ability to quench the fluorescence emission intensity of Trp 214 residue available in the subdomain IIA of HSA. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Structure determination of uracil-DNA N-glycosylase from Deinococcus radiodurans in complex with DNA.

    Science.gov (United States)

    Pedersen, Hege Lynum; Johnson, Kenneth A; McVey, Colin E; Leiros, Ingar; Moe, Elin

    2015-10-01

    Uracil-DNA N-glycosylase (UNG) is a DNA-repair enzyme in the base-excision repair (BER) pathway which removes uracil from DNA. Here, the crystal structure of UNG from the extremophilic bacterium Deinococcus radiodurans (DrUNG) in complex with DNA is reported at a resolution of 1.35 Å. Prior to the crystallization experiments, the affinity between DrUNG and different DNA oligonucleotides was tested by electrophoretic mobility shift assays (EMSAs). As a result of this analysis, two 16 nt double-stranded DNAs were chosen for the co-crystallization experiments, one of which (16 nt AU) resulted in well diffracting crystals. The DNA in the co-crystal structure contained an abasic site (substrate product) flipped into the active site of the enzyme, with no uracil in the active-site pocket. Despite the high resolution, it was not possible to fit all of the terminal nucleotides of the DNA complex into electron density owing to disorder caused by a lack of stabilizing interactions. However, the DNA which was in contact with the enzyme, close to the active site, was well ordered and allowed detailed analysis of the enzyme-DNA interaction. The complex revealed that the interaction between DrUNG and DNA is similar to that in the previously determined crystal structure of human UNG (hUNG) in complex with DNA [Slupphaug et al. (1996). Nature (London), 384, 87-92]. Substitutions in a (here defined) variable part of the leucine loop result in a shorter loop (eight residues instead of nine) in DrUNG compared with hUNG; regardless of this, it seems to fulfil its role and generate a stabilizing force with the minor groove upon flipping out of the damaged base into the active site. The structure also provides a rationale for the previously observed high catalytic efficiency of DrUNG caused by high substrate affinity by demonstrating an increased number of long-range electrostatic interactions between the enzyme and the DNA. Interestingly, specific interactions between residues

  2. Analysis of mandibular second molars with fused roots and shallow radicular grooves by using micro-computed tomography.

    Science.gov (United States)

    Amoroso-Silva, Pablo; De Moraes, Ivaldo Gomes; Marceliano-Alves, Marilia; Bramante, Clovis Monteiro; Zapata, Ronald Ordinola; Hungaro Duarte, Marco Antonio

    2018-01-01

    This study aimed to describe the morphological and morphometric aspects of fused mandibular second molars with radicular shallow grooves using micro-computed tomography (CT). Eighty-eight mandibular second molars with fused roots were scanned in a micro-CT scanner at a voxel size of 19.6 μm. After reconstruction, only molars without C-shaped roots and presenting shallow radicular grooves were selected. 30 molars were chosen for further analysis. Canal cross-sections were classified according to Fan's modified classification (C1, C2, C3, and C4) and morphometric parameters at the apical region, examination of accessory foramina and tridimensional configuration were evaluated. Three-dimensional reconstructions indicated a higher prevalence of merging type ( n = 22). According to Fan's modified classification, the C4 configuration was predominant in the 3 apical mm. Roundness median values revealed a more round-shaped canals at 3 mm (0.72) than at 2 (0.63) and 1 (0.61) mm from the apex. High values of major and minor diameters were observed in the canals of these evaluated sections. In addition, few accessory apical foramina were observed at 1 and 2 mm from the apex. The average distance between last accessory foramina and the anatomic apex was 1.17 mm. A less complex internal anatomy is found when a mandibular second molar presents fused roots with shallow radicular grooves. The merging type canal was frequently observed. Moreover, the C4 configuration was predominant at a point 3 mm from the apex and presented rounded canals, large apical diameters, and few accessory foramina. The cervical and middle thirds presented C3 and C1 canal configurations most frequently. A minor morphological complexity is found when fused mandibular second molars present shallow radicular grooves.

  3. Ion implantation planar in targets with semi-cylindrical grooves

    International Nuclear Information System (INIS)

    Filiz, Y.; Demokan, O.

    2002-01-01

    The experimental and numerical investigations suggest that the ion-matrix phase of the sheath evolution plays a crucial role in determining the ion flux to the target surfaces . It can easily be realized that conformal mapping of the target's surface by the sheath is questionable, or even inapplicable in the case of surfaces with fine irregularities or this continuities. The theoretical analysis of such cases is evidently quite complicated. On the other hand, most actual targets fall into this category, and hence, the understanding of the corresponding sheath behavior remains vital for accomplishing uniform implantation. The ion- matrix sheaths have been treated analytically by Conrad for planar, cylindrical and spherical targets successfully. Similar y, Sheridan and Zang et al. have investigated the ion matrix sheath in cylindrical bores, without and with axial electrodes, respectively. All these works assumed targets with infinite areas or length, Zeng et al. and Kwok et al. have started studying implantation into grooves, by carrying out simulations for the inner and outer races of bearings, which are modeled as semi- cylinders of infinite length. Finally, Demokan has presented the first analytic treatment of on matrix sheaths in two- dimensions, by considering targets with rectangular grooves of infinite length, representing a broad range of industrial items. In this work, ion-matrix sheath near infinite length are theoretically analysed. Understanding the sheath formation near such targets is essential for achieving successful ion implantation on the surfaces of a broad range of industrial products, including all types of bearings. The potential profiles both inside and outside the groove are derived and the consequent ion velocity higher plasma densities may improve the uniformity of implantation on the surfaces of such grooves. Furthermore, the sheath edge deformation due to the grooves, the variation of the angle of incidence on the surface of the groove

  4. Formation Mechanisms for Spur and Groove Features on Fringing Reefs

    Science.gov (United States)

    Bramante, J. F.; Ashton, A. D.; Perron, J. T.

    2016-12-01

    Spur and groove systems (SAGs) are ubiquitous morphological features found on fore-reef slopes globally. SAGs consist of parallel, roughly shore-normal ridges of actively growing coral and coralline algae (spurs) separated by offshore-sloping depressions typically carpeted by a veneer of sediment (grooves). Although anecdotal observations and recent statistical analyses have reported correlations between wave exposure and the distribution of SAGs on fore-reef slopes, the physical mechanisms driving SAG formation remain poorly understood. For example, there remains significant debate regarding the importance of coral growth versus bed erosion for SAG formation. Here we investigate a hypothesis that SAG formation is controlled by feedbacks between sediment production and diffusion and coral growth. Using linear stability analysis, we find that sediment production, coral growth, and the feedbacks between them are unable to produce stable periodic structures without a sediment sink. However, if incipient grooves act as conduits for sediment transport offshore, a positive feedback can develop as the groove bed erodes through wave-driven abrasion during offshore transport. Eventually a negative feedback slows groove deepening when the groove bed is armored by sediment, and the groove bed relaxes to a sediment-veneered equilibrium profile analogous to sediment-rich shorefaces. To test this hypothesis, we apply a numerical model that incorporates coral growth and sediment production, sediment diffusion, non-linear wave-driven abrasion, and sediment advection offshore. This model produces the periodic, linear features characteristic of SAG morphology. The relative magnitude of growth, production, diffusion, abrasion, and advection rates affect periodic spacing or wavelength of the modeled SAGs. Finally, we evaluate the ability of the model to replicate geographical variability in SAG characteristics using previously published datasets and reanalysis wave data.

  5. Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Snodin, Benedict E. K., E-mail: benedict.snodin@chem.ox.ac.uk; Mosayebi, Majid; Schreck, John S.; Romano, Flavio; Doye, Jonathan P. K., E-mail: jonathan.doye@chem.ox.ac.uk [Physical and Theoretical Chemistry Laboratory, Department of Chemistry, University of Oxford, South Parks Road, Oxford OX1 3QZ (United Kingdom); Randisi, Ferdinando [Life Sciences Interface Doctoral Training Center, South Parks Road, Oxford OX1 3QU (United Kingdom); Rudolf Peierls Centre for Theoretical Physics, 1 Keble Road, Oxford OX1 3NP (United Kingdom); Šulc, Petr [Center for Studies in Physics and Biology, The Rockefeller University, 1230 York Avenue, New York, New York 10065 (United States); Ouldridge, Thomas E. [Department of Mathematics, Imperial College, 180 Queen’s Gate, London SW7 2AZ (United Kingdom); Tsukanov, Roman; Nir, Eyal [Department of Chemistry and the Ilse Katz Institute for Nanoscale Science and Technology, Ben-Gurion University of the Negev, Beer Sheva (Israel); Louis, Ard A. [Rudolf Peierls Centre for Theoretical Physics, 1 Keble Road, Oxford OX1 3NP (United Kingdom)

    2015-06-21

    We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na{sup +}] = 0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.

  6. Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

    International Nuclear Information System (INIS)

    Snodin, Benedict E. K.; Mosayebi, Majid; Schreck, John S.; Romano, Flavio; Doye, Jonathan P. K.; Randisi, Ferdinando; Šulc, Petr; Ouldridge, Thomas E.; Tsukanov, Roman; Nir, Eyal; Louis, Ard A.

    2015-01-01

    We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na + ] = 0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA

  7. Structure of a DNA glycosylase that unhooks interstrand cross-links

    Energy Technology Data Exchange (ETDEWEB)

    Mullins, Elwood A.; Warren, Garrett M.; Bradley, Noah P.; Eichman, Brandt F. (Vanderbilt)

    2017-04-10

    DNA glycosylases are important editing enzymes that protect genomic stability by excising chemically modified nucleobases that alter normal DNA metabolism. These enzymes have been known only to initiate base excision repair of small adducts by extrusion from the DNA helix. However, recent reports have described both vertebrate and microbial DNA glycosylases capable of unhooking highly toxic interstrand cross-links (ICLs) and bulky minor groove adducts normally recognized by Fanconi anemia and nucleotide excision repair machinery, although the mechanisms of these activities are unknown. Here we report the crystal structure of Streptomyces sahachiroi AlkZ (previously Orf1), a bacterial DNA glycosylase that protects its host by excising ICLs derived from azinomycin B (AZB), a potent antimicrobial and antitumor genotoxin. AlkZ adopts a unique fold in which three tandem winged helix-turn-helix motifs scaffold a positively charged concave surface perfectly shaped for duplex DNA. Through mutational analysis, we identified two glutamine residues and a β-hairpin within this putative DNA-binding cleft that are essential for catalytic activity. Additionally, we present a molecular docking model for how this active site can unhook either or both sides of an AZB ICL, providing a basis for understanding the mechanisms of base excision repair of ICLs. Given the prevalence of this protein fold in pathogenic bacteria, this work also lays the foundation for an emerging role of DNA repair in bacteria-host pathogenesis.

  8. Continuous blood fractionation using an array of slanted grooves

    Science.gov (United States)

    Bernate, Jorge A.; Chengxun, Liu; Lagae, Liesbet; Drazer, German

    2011-11-01

    Blood is a complex fluid having different specialized biological functions and containing a plethora of clinical information. The separation of different blood components is a crucial step in many research and clinical applications. In this work we take advantage of the flow characteristics in microfluidic devices in which the bottom surface is patterned with slanted rectangular grooves to continuously fractionate blood. We exploit the flow in the vicinity of the patterned surface when the dimensions of the grooves are much smaller than the dimensions of the main channel. In these devices, we observed that the grooves act as open channels guiding flow along them with the flow over them being in the direction of the main channel. We present experiments in which the different blood components are deflected laterally to a different extent by the flow along the grooves depending on their sedimentation velocity, which allows their continuous fractionation. In particular, the heavier red blood cells experience the largest deflection while the lighter white blood cells deflect the least, allowing their passive and minimally invasive isolation. In addition, this fluidic platform can also be used to separate magnetically labeled circulating cancer cells which can be retained in the flow along the grooves using a sufficiently strong magnetic force.

  9. Performance optimization of grooved slippers for aero hydraulic pumps

    Directory of Open Access Journals (Sweden)

    Juan Chen

    2016-06-01

    Full Text Available A computational fluid dynamics (CFD simulation method based on 3-D Navier–Stokes equation and Arbitrary Lagrangian–Eulerian (ALE method is presented to analyze the grooved slipper performance of piston pump. The moving domain of grooved slipper is transformed into a fixed reference domain by the ALE method, which makes it convenient to take the effects of rotate speed, body force, temperature, and oil viscosity into account. A geometric model to express the complex structure, which covers the orifice of piston and slipper, vented groove and the oil film, is constructed. Corresponding to different oil film thicknesses calculated in light of hydrostatic equilibrium theory and boundary conditions, a set of simulations is conducted in COMSOL to analyze the pump characteristics and effects of geometry (groove width and radius, orifice size on these characteristics. Furthermore, the mechanics and hydraulics analyses are employed to validate the CFD model, and there is an excellent agreement between simulation and analytical results. The simulation results show that the sealing land radius, orifice size and groove width all dramatically affect the slipper behavior, and an optimum tradeoff among these factors is conducive to optimizing the pump design.

  10. Documentation of roller-bearing effect on butterfly inspired grooves

    Science.gov (United States)

    Gautam, Sashank; Lang, Amy

    2017-11-01

    Butterfly wings are covered with scales in a roof shingle pattern which align together to form grooves. The increase or decrease of laminar friction drag depends on the flow orientation to the scales. Flow in the longitudinal direction to the grooves encounters increased surface area which increases the friction drag. However, in the transverse direction, for low Re laminar flow, a single vortex is formed inside each groove and is predicted to remain stable due to the very low Re of the flow in each cavity. These embedded vortices act as roller bearings to the flow above, such that the fluid from the outer boundary layer does not mix with fluid inside the cavities. This leads to a reduction of skin friction drag when compared to a smooth surface. When the cavity flow Re is increased beyond a critical point, the vortex becomes unstable and the low-momentum fluid in the grooves mixes with the outer boundary layer flow, increasing the drag. The objective of this experiment is to determine the critical Re where the embedded vortex transitions from a stable to an unstable state using DPIV. Subsequently, for steady vortex conditions, a comparison of skin friction drag between the grooved and flat plate can show that the butterfly scaled surface can result in sub-laminar friction drag. The National Science Foundation (Grant No. 1335848).

  11. Design of pellet surface grooves for fission gas plenum

    International Nuclear Information System (INIS)

    Carter, T.J.; Jones, L.R.; Macici, N.; Miller, G.C.

    1986-01-01

    In the Canada deuterium uranium pressurized heavy water reactor, short (50-cm) Zircaloy-4 clad bundles are fueled on-power. Although internal void volume within the fuel rods is adequate for the present once-through natural uranium cycle, the authors have investigated methods for increasing the internal gas storage volume needed in high-power, high-burnup, experimental ceramic fuels. This present work sought to prove the methodology for design of gas storage volume within the fuel pellets - specifically the use of grooves pressed or machined into the relatively cool pellet/cladding interface. Preanalysis and design of pellet groove shape and volume was accomplished using the TRUMP heat transfer code. Postirradiation examination (PIE) was used to check the initial design and heat transfer assumptions. Fission gas release was found to be higher for the grooved pellet rods than for the comparison rods with hollow or unmodified pellets. This had been expected from the initial TRUMP thermal analyses. The ELESIM fuel modeling code was used to check in-reactor performance, but some modifications were necessary to accommodate the loss of heat transfer surface to the grooves. It was concluded that for plenum design purposes, circumferential pellet grooves could be adequately modeled by the codes TRUMP and ELESIM

  12. Reduction of absorption loss in multicrystalline silicon via combination of mechanical grooving and porous silicon

    Energy Technology Data Exchange (ETDEWEB)

    Ben Rabha, Mohamed; Mohamed, Seifeddine Belhadj; Dimassi, Wissem; Gaidi, Mounir; Ezzaouia, Hatem; Bessais, Brahim [Laboratoire de Photovoltaique, Centre de Recherches et des Technologies de l' Energie, Technopole de Borj-Cedria, BP 95, 2050 Hammam-Lif (Tunisia)

    2011-03-15

    Surface texturing of silicon wafer is a key step to enhance light absorption and to improve the solar cell performances. While alkaline-texturing of single crystalline silicon wafers was well established, no efficient chemical solution has been successfully developed for multicrystalline silicon wafers. Thus, the use of alternative new methods for effective texturization of multicrystalline silicon is worth to be investigated. One of the promising texturing techniques of multicrystalline silicon wafers is the use of mechanical grooves. However, most often, physical damages occur during mechanical grooves of the wafer surface, which in turn require an additional step of wet processing-removal damage. Electrochemical surface treatment seems to be an adequate solution for removing mechanical damage throughout porous silicon formation. The topography of untreated and porous silicon-treated mechanically textured surface was investigated using scanning electron microscopy (SEM). As a result of the electrochemical surface treatment, the total reflectivity drops to about 5% in the 400-1000 nm wavelength range and the effective minority carrier diffusion length enhances from 190 {mu}m to about 230 {mu}m (copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  13. Structure-function analysis of the OB and latch domains of chlorella virus DNA ligase.

    Science.gov (United States)

    Samai, Poulami; Shuman, Stewart

    2011-06-24

    Chlorella virus DNA ligase (ChVLig) is a minimized eukaryal ATP-dependent DNA sealing enzyme with an intrinsic nick-sensing function. ChVLig consists of three structural domains, nucleotidyltransferase (NTase), OB-fold, and latch, that envelop the nicked DNA as a C-shaped protein clamp. The OB domain engages the DNA minor groove on the face of the duplex behind the nick, and it makes contacts to amino acids in the NTase domain surrounding the ligase active site. The latch module occupies the DNA major groove flanking the nick. Residues at the tip of the latch contact the NTase domain to close the ligase clamp. Here we performed a structure-guided mutational analysis of the OB and latch domains. Alanine scanning defined seven individual amino acids as essential in vivo (Lys-274, Arg-285, Phe-286, and Val-288 in the OB domain; Asn-214, Phe-215, and Tyr-217 in the latch), after which structure-activity relations were clarified by conservative substitutions. Biochemical tests of the composite nick sealing reaction and of each of the three chemical steps of the ligation pathway highlighted the importance of Arg-285 and Phe-286 in the catalysis of the DNA adenylylation and phosphodiester synthesis reactions. Phe-286 interacts with the nick 5'-phosphate nucleotide and the 3'-OH base pair and distorts the DNA helical conformation at the nick. Arg-285 is a key component of the OB-NTase interface, where it forms a salt bridge to the essential Asp-29 side chain, which is imputed to coordinate divalent metal catalysts during the nick sealing steps.

  14. Structure-Function Analysis of the OB and Latch Domains of Chlorella Virus DNA Ligase*

    Science.gov (United States)

    Samai, Poulami; Shuman, Stewart

    2011-01-01

    Chlorella virus DNA ligase (ChVLig) is a minimized eukaryal ATP-dependent DNA sealing enzyme with an intrinsic nick-sensing function. ChVLig consists of three structural domains, nucleotidyltransferase (NTase), OB-fold, and latch, that envelop the nicked DNA as a C-shaped protein clamp. The OB domain engages the DNA minor groove on the face of the duplex behind the nick, and it makes contacts to amino acids in the NTase domain surrounding the ligase active site. The latch module occupies the DNA major groove flanking the nick. Residues at the tip of the latch contact the NTase domain to close the ligase clamp. Here we performed a structure-guided mutational analysis of the OB and latch domains. Alanine scanning defined seven individual amino acids as essential in vivo (Lys-274, Arg-285, Phe-286, and Val-288 in the OB domain; Asn-214, Phe-215, and Tyr-217 in the latch), after which structure-activity relations were clarified by conservative substitutions. Biochemical tests of the composite nick sealing reaction and of each of the three chemical steps of the ligation pathway highlighted the importance of Arg-285 and Phe-286 in the catalysis of the DNA adenylylation and phosphodiester synthesis reactions. Phe-286 interacts with the nick 5′-phosphate nucleotide and the 3′-OH base pair and distorts the DNA helical conformation at the nick. Arg-285 is a key component of the OB-NTase interface, where it forms a salt bridge to the essential Asp-29 side chain, which is imputed to coordinate divalent metal catalysts during the nick sealing steps. PMID:21527793

  15. Research on performance of upstream pumping mechanical seal with different deep spiral groove

    International Nuclear Information System (INIS)

    Wang, Q; Chen, H L; Liu, T; Liu, Y H; Liu, Z B; Liu, D H

    2012-01-01

    As one new type of mechanical seal, Upstream Pumping Mechanical Seal has been widely used in fluid machinery. In this paper, structure of spiral groove is innovatively optimized to improve performance of Upstream Pumping Mechanical Seal with Spiral Groove: keeping the dam zone and the weir zone not changed, changing the bottom shape of spiral groove only, substituting different deep spiral groove for equal deep spiral groove. The simulation on Upstream Pumping Mechanical Seal with different deep spiral grooves is done using FVM method. According to calculation, the performances of opening force and pressure distribution on seals face are obtained. Five types of spiral grooves are analyzed, namely equal deep spiral groove, circumferential convergent ladder-like different deep spiral groove, circumferential divergent ladder-like different deep spiral groove, radial convergent ladder-like different deep spiral groove and radial divergent ladder-like different deep spiral groove. This paper works on twenty-five working conditions. The results indicate the performances of circumferential divergent 2-ladder different deep spiral groove are better than the others, with more opening force and better stabilization, while with the same leakage. The outcome provides theoretical support for application of Upstream Pumping Mechanical Seal with circumferential convergent ladder-like different deep spiral groove.

  16. Research on performance of upstream pumping mechanical seal with different deep spiral groove

    Science.gov (United States)

    Wang, Q.; Chen, H. L.; Liu, T.; Liu, Y. H.; Liu, Z. B.; Liu, D. H.

    2012-11-01

    As one new type of mechanical seal, Upstream Pumping Mechanical Seal has been widely used in fluid machinery. In this paper, structure of spiral groove is innovatively optimized to improve performance of Upstream Pumping Mechanical Seal with Spiral Groove: keeping the dam zone and the weir zone not changed, changing the bottom shape of spiral groove only, substituting different deep spiral groove for equal deep spiral groove. The simulation on Upstream Pumping Mechanical Seal with different deep spiral grooves is done using FVM method. According to calculation, the performances of opening force and pressure distribution on seals face are obtained. Five types of spiral grooves are analyzed, namely equal deep spiral groove, circumferential convergent ladder-like different deep spiral groove, circumferential divergent ladder-like different deep spiral groove, radial convergent ladder-like different deep spiral groove and radial divergent ladder-like different deep spiral groove. This paper works on twenty-five working conditions. The results indicate the performances of circumferential divergent 2-ladder different deep spiral groove are better than the others, with more opening force and better stabilization, while with the same leakage. The outcome provides theoretical support for application of Upstream Pumping Mechanical Seal with circumferential convergent ladder-like different deep spiral groove.

  17. DNA Mismatch Binding and Antiproliferative Activity of Rhodium Metalloinsertors

    Science.gov (United States)

    Ernst, Russell J.; Song, Hang; Barton, Jacqueline K.

    2009-01-01

    Deficiencies in mismatch repair (MMR) are associated with carcinogenesis. Rhodium metalloinsertors bind to DNA base mismatches with high specificity and inhibit cellular proliferation preferentially in MMR-deficient cells versus MMR-proficient cells. A family of chrysenequinone diimine complexes of rhodium with varying ancillary ligands that serve as DNA metalloinsertors has been synthesized, and both DNA mismatch binding affinities and antiproliferative activities against the human colorectal carcinoma cell lines HCT116N and HCT116O, an isogenic model system for MMR deficiency, have been determined. DNA photocleavage experiments reveal that all complexes bind to the mismatch sites with high specificities; DNA binding affinities to oligonucleotides containing single base CA and CC mismatches, obtained through photocleavage titration or competition, vary from 104 to 108 M−1 for the series of complexes. Significantly, binding affinities are found to be inversely related to ancillary ligand size and directly related to differential inhibition of the HCT116 cell lines. The observed trend in binding affinity is consistent with the metalloinsertion mode where the complex binds from the minor groove with ejection of mismatched base pairs. The correlation between binding affinity and targeting of the MMR-deficient cell line suggests that rhodium metalloinsertors exert their selective biological effects on MMR-deficient cells through mismatch binding in vivo. PMID:19175313

  18. Atypical olfactory groove meningioma associated with uterine fibromatosis; case report

    Directory of Open Access Journals (Sweden)

    Toma I. Papacocea

    2016-11-01

    Full Text Available The concomitant presence of the olfactory groove meningioma with uterine fibrosis is very rare. Our report presents the case of a giant olfactory groove meningioma revealed after a uterine fibroma resection in a 44 years-old female, due to a generalized seizure 10 days after operation. Cranial CT-scan identified the tumor as an olfactory groove meningioma. The tumor was operated with a macroscopically complete resection; the endothermal coagulation of the dura attachment was performed (Simpson II with a good postoperative evolution. Laboratory results showed the presence of receptors for steroid hormones both in meningioma and uterine tumor, and the histopathological examination revealed an atypical meningioma with 17% proliferation markers. Our findings suggest that even though meningiomas are benign tumors and a complete resection usually indicates a good prognosis, the association with uterine fibromatosis and the presence of high percentage of steroid receptors creates a higher risk to relapse, imposing therefore a good monitoring.

  19. Gap and channeled plasmons in tapered grooves: a review

    DEFF Research Database (Denmark)

    Smith, C. L. C.; Stenger, Nicolas; Kristensen, Anders

    2015-01-01

    Tapered metallic grooves have been shown to support plasmons - electromagnetically coupled oscillations of free electrons at metal-dielectric interfaces - across a variety of configurations and V-like profiles. Such plasmons may be divided into two categories: gap-surface plasmons (GSPs) that are......Tapered metallic grooves have been shown to support plasmons - electromagnetically coupled oscillations of free electrons at metal-dielectric interfaces - across a variety of configurations and V-like profiles. Such plasmons may be divided into two categories: gap-surface plasmons (GSPs...... platform to explore the fundamental science of plasmon excitations and their interactions. In this Review, we provide a research status update of plasmons in tapered grooves, starting with a presentation of the theory and important features of GSPs and CPPs, and follow with an overview of the broad range...

  20. DAMAGE TO DNA PRIMARY STRUCTURE AND ANTIOXIDANT ENZYMES IN LEMNA MINOR INDUCED BY HG2+%Hg2+ 胁迫对浮萍体细胞DNA一级结构和抗氧化酶系的损伤

    Institute of Scientific and Technical Information of China (English)

    徐楠; 施国新; 曾晓敏; 丁小余; 徐勤松; 陈源

    2003-01-01

    主要从DNA一级结构及抗氧化酶系变化两方面,研究了Hg2+胁迫下浮萍体细胞的损伤.结果表明:运用随机扩增多态性DNA法(Random amplified polymorphism DNA, RAPD)和DNA梯法(DNA Ladder),5~10 mg*L-1 Hg2+处理组可检测到基因组DNA的明显损伤,20 mg*L-1Hg2+已导致细胞坏死;RAPD法较DNA Ladder法更灵敏.本文还发现,活性氧和抗氧化酶系很可能参与了浮萍体细胞凋亡过程.低浓度的Hg2+胁迫可刺激抗氧化酶活性升高,以清除体内活性氧,而一旦活性氧水平超出一定域值,抗氧化酶活性急速下降,导致细胞凋亡.%The damage to Lemna minor cells induced by Hg2+ was studied in this article. Most damage occurred to DNA primary structure and changes in antioxidant enzyme activities were investigated by using RAPD and DNA ladder methods. The results showed that obvious damage to DNA was found in the process of apoptosis induced by 5-10 mg*L-1 Hg2+, and 20 mg*L-1 Hg2+ had already caused necrotic injury. The RAPD method was the more sensitive of the two methods, and so could be considered as an important method for monitoring apoptosis. The results also indicated that reactive oxygen species (ROS) and antioxidant enzymes are involved in the process of apoptosis. The activities of antioxidant enzymes could be stimulated to eliminate active oxygen by exposing the Lemna minor to low Hg2+ concentration; the cells declined rapidly when ROS were unable to be eliminated effectively.

  1. Structure-guided mutational analysis of the OB, HhH, and BRCT domains of Escherichia coli DNA ligase.

    Science.gov (United States)

    Wang, Li Kai; Nair, Pravin A; Shuman, Stewart

    2008-08-22

    NAD(+)-dependent DNA ligases (LigAs) are ubiquitous in bacteria and essential for growth. LigA enzymes have a modular structure in which a central catalytic core composed of nucleotidyltransferase and oligonucleotide-binding (OB) domains is linked via a tetracysteine zinc finger to distal helix-hairpin-helix (HhH) and BRCT (BRCA1-like C-terminal) domains. The OB and HhH domains contribute prominently to the protein clamp formed by LigA around nicked duplex DNA. Here we conducted a structure-function analysis of the OB and HhH domains of Escherichia coli LigA by alanine scanning and conservative substitutions, entailing 43 mutations at 22 amino acids. We thereby identified essential functional groups in the OB domain that engage the DNA phosphodiester backbone flanking the nick (Arg(333)); penetrate the minor grove and distort the nick (Val(383) and Ile(384)); or stabilize the OB fold (Arg(379)). The essential constituents of the HhH domain include: four glycines (Gly(455), Gly(489), Gly(521), Gly(553)), which bind the phosphate backbone across the minor groove at the outer margins of the LigA-DNA interface; Arg(487), which penetrates the minor groove at the outer margin on the 3 (R)-OH side of the nick; and Arg(446), which promotes protein clamp formation via contacts to the nucleotidyltransferase domain. We find that the BRCT domain is required in its entirety for effective nick sealing and AMP-dependent supercoil relaxation.

  2. Insights from the structure of a smallpox virus topoisomerase-DNA transition state mimic

    Science.gov (United States)

    Perry, Kay; Hwang, Young; Bushman, Frederic D.; Van Duyne, Gregory D.

    2010-01-01

    Summary Poxviruses encode their own type IB topoisomerases (TopIBs) which release superhelical tension generated by replication and transcription of their genomes. To investigate the reaction catalyzed viral TopIBs, we have determined the structure of a variola virus topoisomerase-DNA complex trapped as a vanadate transition state mimic. The structure reveals how the viral TopIB enzymes are likely to position the DNA duplex for ligation following relaxation of supercoils and identifies the sources of friction observed in single molecule experiments that argue against free rotation. The structure also identifies a conformational change in the leaving group sugar that must occur prior to cleavage and reveals a mechanism for promoting ligation following relaxation of supercoils that involves a novel Asp-minor groove interaction. Overall, the new structural data support a common catalytic mechanism for the TopIB superfamily but indicate distinct methods for controlling duplex rotation in the small vs. large enzyme subfamilies. PMID:20152159

  3. Raphides with barbs and grooves in Xanthosoma sagittifolium (Araceae).

    Science.gov (United States)

    Sakai, W S; Hanson, M; Jones, R C

    1972-10-20

    Raphides in petioles of Xanthosoma sagittifolium are needlelike crystals about 50 micrometers long. The rectangular cross sections have maximum dimensions of approximately 850 by 250 nanometers. The raphides have two distinct end structures. One end is narrow, acute, and tapered to a point; the other is broad, acute, and abruptly pointed. Barbs, about 750 angstroms long with tips oriented away from the narrow end, occur along the length of the raphide on ridges on either side of two longitudinal grooves. These grooves, located opposite each other, give the raphide cross section an H-shape.

  4. A Bulky Rhodium Complex Bound to an Adenosine-Adenosine DNA Mismatch: General Architecture of the Metalloinsertion Binding Mode†

    Science.gov (United States)

    Zeglis, Brian M.; Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

    2009-01-01

    Two crystal structures are determined for Δ-Rh(bpy)2(chrysi)3+ (chrysi = 5,6-chrysenequinone diimine) bound to the oligonucleotide duplex 5′-CGGAAATTACCG-3′ containing two adenosine-adenosine mismatches (italics) through metalloinsertion. Diffraction quality crystals with two different space groups (P3221 and P43212) were obtained under very similar crystallization conditions. In both structures, the bulky rhodium complex inserts into the two mismatched sites from the minor groove side, ejecting the mismatched bases into the major groove. The conformational changes are localized to the mismatched site; the metal complex replaces the mismatched base pair without an increase in base pair rise. The expansive metal complex is accommodated in the duplex by a slight opening in the phosphodiester backbone; all sugars retain a C2′-endo puckering, and flanking base pairs neither stretch nor shear. The structures differ, however, in that in one of the structures, an additional metal complex is bound by intercalation from the major groove at the central 5′-AT-3′ step. We conclude that this additional metal complex is intercalated into this central step because of crystal packing forces. The structures described here of Δ-Rh(bpy)2(chrysi)3+ bound to thermodynamically destabilized AA mismatches share critical features with binding by metalloinsertion in two other oligonucleotides containing different single base mismatches. These results underscore the generality of the metalloinsertion as a new mode of non-covalent binding by small molecules with a DNA duplex. PMID:19374348

  5. Methylproamine protects against ionizing radiation by preventing DNA double-strand breaks

    International Nuclear Information System (INIS)

    Sprung, Carl N.; Vasireddy, Raja S.; Karagiannis, Tom C.; Loveridge, Shanon J.; Martin, Roger F.; McKay, Michael J.

    2010-01-01

    Purpose: The majority of cancer patients will receive radiotherapy (RT), therefore, investigations into advances of this modality are important. Conventional RT dose intensities are limited by adverse responses in normal tissues and a primary goal is to ameliorate adverse normal tissue effects. The aim of these experiments is to further our understanding regarding the mechanism of radioprotection by the DNA minor groove binder, methylproamine, in a cellular context at the DNA level. Materials and methods: We used immunocytochemical methods to measure the accumulation of phosphorylated H2AX (γH2AX) foci following ionizing radiation (IR) in patient-derived lymphoblastoid cells exposed to methylproamine. Furthermore, we performed pulsed field gel electrophoresis DNA damage and repair assays to directly interrogate the action of methylproamine on DNA in irradiated cells. Results: We found that methylproamine-treated cells had fewer γH2AX foci after IR compared to untreated cells. Also, the presence of methylproamine decreased the amount of lower molecular weight DNA entering the gel as shown by the pulsed field gel electrophoresis assay. Conclusions: These results suggest that methylproamine acts by preventing the formation of DNA double-strand breaks (dsbs) and support the hypothesis that radioprotection by methylproamine is mediated, at least in part, by decreasing initial DNA damage.

  6. Tailoring channeled plasmon polaritons in metallic V-grooves

    DEFF Research Database (Denmark)

    Smith, Cameron; Thilsted, Anil Haraksingh; Marie, Rodolphe

    2013-01-01

    of propagating plasmons to optimize the trade-off between lateral confinement and loss [2]. Accordingly, the traits of CPPs in metallic V-grooves suggest their widespread implementation, with applications ranging from ultracompact photonic circuitry [3] to lab-on-a-chip sensing. Current CPP research focuses...

  7. Flow characterization in periodic microchannels containing asymmetric grooves

    Energy Technology Data Exchange (ETDEWEB)

    Osorio-Nesme, A; Delgado, A, E-mail: anuhar.nesme@fau.de [Institute of Fluid Mechanics, Friedrich-Alexander Erlangen-Nuremberg University, Cauerstrasse 4, D-91058 Erlangen (Germany)

    2017-10-15

    Characterization of two-dimensional flows in microchannels with anisotropic periodic grooves is numerically carried out by using the lattice Boltzmann method. Periodically placed microstructures, consisting of novel nozzle-diffuser-like grooves are deliberately designed to introduce a flow-direction dependent resistance. Simulations were conducted for a low-to-moderate Reynolds number in the laminar-transition flow regime. Different channel geometries, defined by the half-angle ϕ of the periodic grooves are considered. The influence of the half-angle on both the flow field and the onset of oscillatory flow regime at different driving body forces is analyzed. At a low Reynolds number, the flow is observed stationary and fully reversible, regardless of the groove geometry. In this regime, higher Reynolds numbers were observed when the geometry acts as a diffuser (negative flow) than as a nozzle (positive flow) for a given driving body force. At sufficiently high Reynolds number the flow turns from a steady state to a time-dependent oscillatory regime through a Hopf bifurcation. Successive flow bifurcations lead the flow structure from a periodic regime to a quasi-chaotic regime with three-dimensional structures. The onset of unsteady flow occurs earlier for positive flows and geometries with small half-angles. For higher driving forces, there is a reduction in the volume flow rate due to the advected material in the transversal direction, causing consequently a decrease in the Reynolds number. (paper)

  8. Syncopation, body-movement and pleasure in groove music.

    Science.gov (United States)

    Witek, Maria A G; Clarke, Eric F; Wallentin, Mikkel; Kringelbach, Morten L; Vuust, Peter

    2014-01-01

    Moving to music is an essential human pleasure particularly related to musical groove. Structurally, music associated with groove is often characterised by rhythmic complexity in the form of syncopation, frequently observed in musical styles such as funk, hip-hop and electronic dance music. Structural complexity has been related to positive affect in music more broadly, but the function of syncopation in eliciting pleasure and body-movement in groove is unknown. Here we report results from a web-based survey which investigated the relationship between syncopation and ratings of wanting to move and experienced pleasure. Participants heard funk drum-breaks with varying degrees of syncopation and audio entropy, and rated the extent to which the drum-breaks made them want to move and how much pleasure they experienced. While entropy was found to be a poor predictor of wanting to move and pleasure, the results showed that medium degrees of syncopation elicited the most desire to move and the most pleasure, particularly for participants who enjoy dancing to music. Hence, there is an inverted U-shaped relationship between syncopation, body-movement and pleasure, and syncopation seems to be an important structural factor in embodied and affective responses to groove.

  9. Novel scaffold design with multi-grooved PLA fibers

    International Nuclear Information System (INIS)

    Chung, Sangwon; King, Martin W; Gamcsik, Mike P

    2011-01-01

    A novel prototype nonwoven textile structure containing polylactide (PLA) multigrooved fibers has been proposed as a possible scaffold material for superior cell attachment and proliferation. Grooved cross-sectional fibers with larger surface area were obtained by a bi-component spinning system and the complete removal of the sacrificial component was confirmed by Fourier transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM) and x-ray photon spectroscopy (XPS) analysis. These PLA nonwoven scaffolds containing the grooved fibers exhibited enhanced wettability, greater flexibility and tensile properties, and a larger surface area compared to a traditional PLA nonwoven fabric containing round fibers. To evaluate cellular attachment on the two types of PLA nonwoven scaffolds, NIH 3T3 fibroblasts were cultured for up to 12 days. It was evident that the initial cellular attachment was superior on the scaffold with grooved fibers, which was confirmed by MTT viability assay (p < 0.01) and SEM analysis. In the future, by modulating the size of the grooves on the fibers, such a scaffold material with a large surface area could serve as an alternative matrix for culturing different types of cells.

  10. Wet Weather Crater Repair Technologies for Grooved and Smooth Pavements

    Science.gov (United States)

    2018-04-30

    Dean Geotechnical and Structures Laboratory U.S. Army Engineer Research and Development Center 3909 Halls Ferry Road Vicksburg, MS 39180-6199...ORGANIZATION REPORT NUMBER U.S. Army Engineer Research and Development Center Geotechnical and Structures Laboratory 3909 Halls Ferry Road ...SUBJECT TERMS Crater Concrete Rain and rainfall ADR Grooved pavement Smooth pavement Runoff Runways (Aeronautics) – Maintenance and repair

  11. Syncopation, body-movement and pleasure in groove music.

    Directory of Open Access Journals (Sweden)

    Maria A G Witek

    Full Text Available Moving to music is an essential human pleasure particularly related to musical groove. Structurally, music associated with groove is often characterised by rhythmic complexity in the form of syncopation, frequently observed in musical styles such as funk, hip-hop and electronic dance music. Structural complexity has been related to positive affect in music more broadly, but the function of syncopation in eliciting pleasure and body-movement in groove is unknown. Here we report results from a web-based survey which investigated the relationship between syncopation and ratings of wanting to move and experienced pleasure. Participants heard funk drum-breaks with varying degrees of syncopation and audio entropy, and rated the extent to which the drum-breaks made them want to move and how much pleasure they experienced. While entropy was found to be a poor predictor of wanting to move and pleasure, the results showed that medium degrees of syncopation elicited the most desire to move and the most pleasure, particularly for participants who enjoy dancing to music. Hence, there is an inverted U-shaped relationship between syncopation, body-movement and pleasure, and syncopation seems to be an important structural factor in embodied and affective responses to groove.

  12. Aryl-1H-imidazole[4,5f][1,10]phenanthroline Cu(II) complexes: Electrochemical and DNA interaction studies.

    Science.gov (United States)

    Rajebhosale, Bharati S; Dongre, Shivali N; Deshpande, Sameer S; Kate, Anup N; Kumbhar, Anupa A

    2017-10-01

    The reaction of aryl imidazo[4,5f] [1,10]phenanthrolines with Cu(NO 3 ) 2 lead to the formation of Cu(II) complexes of the type [Cu(L)(NO 3 ) 2 ] where L=PIP, 2-(phenyl) [4,5f] imidazo phenanthroline; HPIP=2-(2-hydroxyphenyl)imidazo [4,5f] phenanthroline and NIP=2-(naphthyl) [4,5f] imidazo phenanthroline. The interaction of these complexes with calf thymus DNA has been studied using viscosity measurements, UV-visible and fluorescence spectroscopy. Chemical nuclease activity of these complexes has also been investigated. All complexes cleave DNA via oxidative pathway involving singlet oxygen. Molecular docking studies revealed that these complexes bind to DNA through minor groove. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. A mononuclear zinc(II) complex with piroxicam: Crystal structure, DNA- and BSA-binding studies; in vitro cell cytotoxicity and molecular modeling of oxicam complexes

    Science.gov (United States)

    Jannesari, Zahra; Hadadzadeh, Hassan; Amirghofran, Zahra; Simpson, Jim; Khayamian, Taghi; Maleki, Batool

    2015-02-01

    A new mononuclear Zn(II) complex, trans-[Zn(Pir)2(DMSO)2], where Pir- is 4-hydroxy-2-methyl-N-2-pyridyl-2H-1,2-benzothiazine-3-carboxamide-1,1-dioxide (piroxicam), has been synthesized and characterized. The crystal structure of the complex was obtained by the single crystal X-ray diffraction technique. The interaction of the complex with DNA and BSA was investigated. The complex interacts with FS-DNA by two binding modes, viz., electrostatic and groove binding (major and minor). The microenvironment and the secondary structure of BSA are changed in the presence of the complex. The anticancer effects of the seven complexes of oxicam family were also determined on the human K562 cell lines and the results showed reasonable cytotoxicities. The interactions of the oxicam complexes with BSA and DNA were modeled by molecular docking and molecular dynamic simulation methods.

  14. Minority Games

    International Nuclear Information System (INIS)

    Metzler, R

    2005-01-01

    New branches of scientific disciplines often have a few paradigmatic models that serve as a testing ground for theories and a starting point for new inquiries. In the late 1990s, one of these models found fertile ground in the growing field of econophysics: the Minority Game (MG), a model for speculative markets that combined conceptual simplicity with interesting emergent behaviour and challenging mathematics. The two basic ingredients were the minority mechanism (a large number of players have to choose one of two alternatives in each round, and the minority wins) and limited rationality (each player has a small set of decision rules, and chooses the more successful ones). Combining these, one observes a phase transition between a crowded and an inefficient market phase, fat-tailed price distributions at the transition, and many other nontrivial effects. Now, seven years after the first paper, three of the key players-Damien Challet, Matteo Marsili and Yi-Cheng Zhang-have published a monograph that summarizes the current state of the science. The book consists of two parts: a 100-page overview of the various aspects of the MG, and reprints of many essential papers. The first chapters of Part I give a well-written description of the motivation and the history behind the MG, and then go into the phenomenology and the mathematical treatment of the model. The authors emphasize the 'physics' underlying the behaviour and give coherent, intuitive explanations that are difficult to extract from the original papers. The mathematics is outlined, but calculations are not carried out in great detail (maybe they could have been included in an appendix). Chapter 4 then discusses how and why the MG is a model for speculative markets, how it can be modified to give a closer fit to observed market statistics (in particular, reproducing the 'stylized facts' of fat-tailed distributions and volatility clustering), and what conclusions one can draw from the behaviour of the MG when

  15. A large-scale association study for nanoparticle C60 uncovers mechanisms of nanotoxicity disrupting the native conformations of DNA/RNA.

    Science.gov (United States)

    Xu, Xue; Wang, Xia; Li, Yan; Wang, Yonghua; Yang, Ling

    2012-09-01

    Nano-scale particles have attracted a lot of attention for its potential use in medical studies, in particular for the diagnostic and therapeutic purposes. However, the toxicity and other side effects caused by the undesired interaction between nanoparticles and DNA/RNA are not clear. To address this problem, a model to evaluate the general rules governing how nanoparticles interact with DNA/RNA is demanded. Here by, use of an examination of 2254 native nucleotides with molecular dynamics simulation and thermodynamic analysis, we demonstrate how the DNA/RNA native structures are disrupted by the fullerene (C60) in a physiological condition. The nanoparticle was found to bind with the minor grooves of double-stranded DNA and trigger unwinding and disrupting of the DNA helix, which indicates C60 can potentially inhibit the DNA replication and induce potential side effects. In contrast to that of DNA, C60 only binds to the major grooves of RNA helix, which stabilizes the RNA structure or transforms the configuration from stretch to curl. This finding sheds new light on how C60 inhibits reverse transcription as HIV replicates. In addition, the binding of C60 stabilizes the structures of RNA riboswitch, indicating that C60 might regulate the gene expression. The binding energies of C60 with different genomic fragments varies in the range of -56 to -10 kcal mol(-1), which further verifies the role of nanoparticle in DNA/RNA damage. Our findings reveal a general mode by which C60 causes DNA/RNA damage or other toxic effects at a systematic level, suggesting it should be cautious to handle these nanomaterials in various medical applications.

  16. The complex radicular groove: interdisciplinary management with mineral trioxide aggregate and bone substitute.

    Science.gov (United States)

    Narmatha, V J; Thakur, Sophia; Shetty, Sheetal; Bali, Praveen Kumar

    2014-11-01

    This article is a case report of the successful interdisciplinary management of a maxillary lateral incisor with a deep palatogingival groove. The tooth presented with severe periodontal destruction owing to the deep extension of the groove up to the root apex. The groove was meticulously diagnosed and treated by endodontic and subsequent periodontal surgery leading to complete resolution of the pathological process.

  17. R248Q mutation--Beyond p53-DNA binding.

    Science.gov (United States)

    Ng, Jeremy W K; Lama, Dilraj; Lukman, Suryani; Lane, David P; Verma, Chandra S; Sim, Adelene Y L

    2015-12-01

    R248 in the DNA binding domain (DBD) of p53 interacts directly with the minor groove of DNA. Earlier nuclear magnetic resonance (NMR) studies indicated that the R248Q mutation resulted in conformation changes in parts of DBD far from the mutation site. However, how information propagates from the mutation site to the rest of the DBD is still not well understood. We performed a series of all-atom molecular dynamics (MD) simulations to dissect sterics and charge effects of R248 on p53-DBD conformation: (i) wild-type p53 DBD; (ii) p53 DBD with an electrically neutral arginine side-chain; (iii) p53 DBD with R248A; (iv) p53 DBD with R248W; and (v) p53 DBD with R248Q. Our results agree well with experimental observations of global conformational changes induced by the R248Q mutation. Our simulations suggest that both charge- and sterics are important in the dynamics of the loop (L3) where the mutation resides. We show that helix 2 (H2) dynamics is altered as a result of a change in the hydrogen bonding partner of D281. In turn, neighboring L1 dynamics is altered: in mutants, L1 predominantly adopts the recessed conformation and is unable to interact with the major groove of DNA. We focused our attention the R248Q mutant that is commonly found in a wide range of cancer and observed changes at the zinc-binding pocket that might account for the dominant negative effects of R248Q. Furthermore, in our simulations, the S6/S7 turn was more frequently solvent exposed in R248Q, suggesting that there is a greater tendency of R248Q to partially unfold and possibly lead to an increased aggregation propensity. Finally, based on the observations made in our simulations, we propose strategies for the rescue of R248Q mutants. © 2015 Wiley Periodicals, Inc.

  18. Major and minor crRNA annealing sites facilitate low stringency DNA protospacer binding prior to Type I-A CRISPR-Cas interference in Sulfolobus

    DEFF Research Database (Denmark)

    Mousaei, Marzieh; Deng, Ling; She, Qunxin

    2016-01-01

    The stringency of crRNA-protospacer DNA base pair matching required for effective CRISPR-Cas interference is relatively low in crenarchaeal Sulfolobus species in contrast to that required in some bacteria. To understand its biological significance we studied crRNA-protospacer interactions...... in Sulfolobus islandicus REY15A which carries multiple, and functionally diverse, interference complexes. A range of mismatches were introduced into a vector-borne protospacer that was identical to spacer 1 of CRISPR locus 2, with a cognate CCN PAM sequence. Two important crRNA annealing regions were identified...

  19. Inhibition of radiation-induced DNA strand breaks by hoechst 33258: OH-radical scavenging and DNA radical quenching

    International Nuclear Information System (INIS)

    Adhikary, A.; Bothe, E.; Von Sonntag, C.; Adhikary, A.

    1997-01-01

    The minor-groove-binding dye Hoechst 33258 has been found to protect pBR322 DNA in aqueous solution against radiation-induced single-strand breaks (ssb). This protective effect has been assumed to be largely due to the scavenging of the strand-break-generating OH radicals by Hoechst. From D 37 values for ssb at different Hoechst concentrations the value of the OH radical scavenging constant of DNA-bound Hoechst has been estimated at k Ho/DNA = 2.7 * 10 11 dm 3 mol -1 . This unexpectedly high value has led us to study the reactions of OH radicals with Hoechst in the absence and in the presence of double-stranded calf thymus DNA (ds DNA) by pulse radiolysis, and the formation of radiation-induced ssb by low angle laser light scattering. The D 37 /D 37 0 values at different Hoechst concentrations agree with the values obtained by Martin and al. and demonstrate the protection. However, this protection cannot be explained on the basis of OH radical scavenging alone using the above rate constants. There must, in addition, be some quenching of DNA radicals. Hoechst radicals are formed in the later ms time range, i.e a long time after the disappearance of the OH radicals. This delayed Hoechst radical formation has been assigned to a a reaction of DNA radicals with Hoechst, thereby inhibiting strand breakage. In confirmation, pulse radiolysis of aqueous solution of nucleotides in the presence of Hoechst yields a similar delayed Hoechst radical formation. The data indicate that in DNA the cross-section of this quenching has a diameter of 3 to 4 base pairs per Hoechst molecule. (N.C.)

  20. Minority Games

    Energy Technology Data Exchange (ETDEWEB)

    Metzler, R [Institut fuer Theoretische Physik, Universitaet Wuerzburg, Am Hubland, D-97074 Wuerzburg (Germany)

    2005-02-25

    New branches of scientific disciplines often have a few paradigmatic models that serve as a testing ground for theories and a starting point for new inquiries. In the late 1990s, one of these models found fertile ground in the growing field of econophysics: the Minority Game (MG), a model for speculative markets that combined conceptual simplicity with interesting emergent behaviour and challenging mathematics. The two basic ingredients were the minority mechanism (a large number of players have to choose one of two alternatives in each round, and the minority wins) and limited rationality (each player has a small set of decision rules, and chooses the more successful ones). Combining these, one observes a phase transition between a crowded and an inefficient market phase, fat-tailed price distributions at the transition, and many other nontrivial effects. Now, seven years after the first paper, three of the key players-Damien Challet, Matteo Marsili and Yi-Cheng Zhang-have published a monograph that summarizes the current state of the science. The book consists of two parts: a 100-page overview of the various aspects of the MG, and reprints of many essential papers. The first chapters of Part I give a well-written description of the motivation and the history behind the MG, and then go into the phenomenology and the mathematical treatment of the model. The authors emphasize the 'physics' underlying the behaviour and give coherent, intuitive explanations that are difficult to extract from the original papers. The mathematics is outlined, but calculations are not carried out in great detail (maybe they could have been included in an appendix). Chapter 4 then discusses how and why the MG is a model for speculative markets, how it can be modified to give a closer fit to observed market statistics (in particular, reproducing the 'stylized facts' of fat-tailed distributions and volatility clustering), and what conclusions one can draw from the

  1. Numerical investigation of the effects of geometric parameters on transverse motion with slanted-groove micro-mixers

    Energy Technology Data Exchange (ETDEWEB)

    Baik, Seung Joo; Cho, Jae Yong; Choi, Se Bin; Lee, Joon Sang [School of Mechanical Engineering, Yonsei University, Seoul (Korea, Republic of)

    2016-08-15

    We investigated hydrodynamic phenomena inside several passive microfluidic mixers using a Lattice Boltzmann method (LBM) based on particle mesoscopic kinetic equations. Mixing processes were simulated in a Slanted grooved micro-mixer (SGM), a Staggered herringbone grooved micro-mixer (SHM), and a Bi-layered staggered herringbone grooved micro-mixer (BSHM). Then, the effects of six geometric mixer parameters (i.e., groove height to channel height ratio, groove width to groove pitch length ratio, groove pitch to groove height ratio, groove intersection angle, herringbone groove asymmetric ratio and bi-layered groove asymmetric ratio) on mixing were investigated using computed cross-flow velocity and helicity density distributions in the flow cross-section. We demonstrated that helicity density provides sufficient information to analyze micro helical motion within a micro-mixer, allowing for micro-mixer design optimization.

  2. Ultrafast dynamics of solvation and charge transfer in a DNA-based biomaterial.

    Science.gov (United States)

    Choudhury, Susobhan; Batabyal, Subrata; Mondol, Tanumoy; Sao, Dilip; Lemmens, Peter; Pal, Samir Kumar

    2014-05-01

    Charge migration along DNA molecules is a key factor for DNA-based devices in optoelectronics and biotechnology. The association of a significant amount of water molecules in DNA-based materials for the intactness of the DNA structure and their dynamic role in the charge-transfer (CT) dynamics is less documented in contemporary literature. In the present study, we have used a genomic DNA-cetyltrimethyl ammonium chloride (CTMA) complex, a technological important biomaterial, and Hoechest 33258 (H258), a well-known DNA minor groove binder, as fluorogenic probe for the dynamic solvation studies. The CT dynamics of CdSe/ZnS quantum dots (QDs; 5.2 nm) embedded in the as-prepared and swollen biomaterial have also been studied and correlated with that of the timescale of solvation. We have extended our studies on the temperature-dependent CT dynamics of QDs in a nanoenvironment of an anionic, sodium bis(2-ethylhexyl)sulfosuccinate reverse micelle (AOT RMs), whereby the number of water molecules and their dynamics can be tuned in a controlled manner. A direct correlation of the dynamics of solvation and that of the CT in the nanoenvironments clearly suggests that the hydration barrier within the Arrhenius framework essentially dictates the charge-transfer dynamics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Grooved windows for scintillation crystals and light pipes of high refractive index

    International Nuclear Information System (INIS)

    Swinehart, C.F.

    1975-01-01

    Scintillation crystals are disclosed which have improved resolution and pulse height. An improved crystal has shallow grooves or spot depressions cut in the window, usually an end surface. Typical grooves are about 1.5 mm wide and about .1 mm deep. The grooves may be either horizontal, generally parallel grooves in spaced apart relationship, or concentric rings in radially spaced apart relationship. A light pipe of high refractive index, such as a crystal of pure sodium iodide, may also be improved with shallow grooves or spot depressions cut in an end surface

  4. Molecular Dynamics Insights into Polyamine-DNA Binding Modes: Implications for Cross-Link Selectivity.

    Science.gov (United States)

    Bignon, Emmanuelle; Chan, Chen-Hui; Morell, Christophe; Monari, Antonio; Ravanat, Jean-Luc; Dumont, Elise

    2017-09-18

    Biogenic polyamines, which play a role in DNA condensation and stabilization, are ubiquitous and are found at millimolar concentration in the nucleus of eukaryotic cells. The interaction modes of three polyamines-putrescine (Put), spermine (Spm), and spermidine (Spd)-with a self-complementary 16 base pair (bp) duplex, are investigated by all-atom explicit-solvent molecular dynamics. The length of the amine aliphatic chain leads to a change of the interaction mode from minor groove binding to major groove binding. Through all-atom dynamics, noncovalent interactions that stabilize the polyamine-DNA complex and prefigure the reactivity, leading to the low-barrier formation of deleterious DNA-polyamine cross-links, after one-electron oxidation of a guanine nucleobase, are unraveled. The binding strength is quantified from the obtained trajectories by molecular mechanics generalized Born surface area post-processing (MM-GBSA). The values of binding free energies provide the same affinity order, PutDNA-polyamine cross-link formation through the extraction of average approaching distances between the C8 atom of guanines and the ammonium group. These results imply that the formation of DNA-polyamine cross-links involves deprotonation of the guanine radical cation to attack the polyamines, which must be positively charged to lie in the vicinity of the B-helix. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Unified design of sinusoidal-groove fused-silica grating.

    Science.gov (United States)

    Feng, Jijun; Zhou, Changhe; Cao, Hongchao; Lu, Peng

    2010-10-20

    A general design rule of deep-etched subwavelength sinusoidal-groove fused-silica grating as a highly efficient polarization-independent or polarization-selective device is studied based on the simplified modal method, which shows that the device structure depends little on the incident wavelength, but mainly on the ratio of groove depth to incident wavelength and the ratio of wavelength to grating period. These two ratios could be used as the design guidelines for wavelength-independent structure from deep ultraviolet to far infrared. The optimized grating profile with a different function as a polarizing beam splitter, a polarization-independent two-port beam splitter, or a polarization-independent grating with high efficiency of -1st order is obtained at a wavelength of 1064 nm, and verified by using the rigorous coupled-wave analysis. The performance of the sinusoidal grating is better than a conventional rectangular one, which could be useful for practical applications.

  6. Dance, Music, Meter and Groove: A Forgotten Partnership

    Directory of Open Access Journals (Sweden)

    W Tecumseh eFitch

    2016-03-01

    Full Text Available I argue that core aspects of musical rhythm, especially groove and syncopation, can only be fully understood in the context of their origins in the participatory social experience of dance. Musical meter is first considered in the context of bodily movement. I then offer an interpretation of the pervasive but somewhat puzzling phenomenon of syncopation in terms of acoustic emphasis on certain offbeat components of the accompanying dance style. The reasons for the historical tendency of many musical styles to divorce themselves from their dance-based roots are also briefly considered. To the extent that musical rhythms only make sense in the context of bodily movement, researchers interested in ecologically valid approaches to music cognition should make a more concerted effort to extend their analyses to dance, particularly if we hope to understand the cognitive constraints underlying rhythmic aspects of music like meter and groove.

  7. Dance, Music, Meter and Groove: A Forgotten Partnership.

    Science.gov (United States)

    Fitch, W Tecumseh

    2016-01-01

    I argue that core aspects of musical rhythm, especially "groove" and syncopation, can only be fully understood in the context of their origins in the participatory social experience of dance. Musical meter is first considered in the context of bodily movement. I then offer an interpretation of the pervasive but somewhat puzzling phenomenon of syncopation in terms of acoustic emphasis on certain offbeat components of the accompanying dance style. The reasons for the historical tendency of many musical styles to divorce themselves from their dance-based roots are also briefly considered. To the extent that musical rhythms only make sense in the context of bodily movement, researchers interested in ecologically valid approaches to music cognition should make a more concerted effort to extend their analyses to dance, particularly if we hope to understand the cognitive constraints underlying rhythmic aspects of music like meter and groove.

  8. Hydrodynamic simulations of microjetting from shock-loaded grooves

    Science.gov (United States)

    Roland, C.; de Rességuier, T.; Sollier, A.; Lescoute, E.; Soulard, L.; Loison, D.

    2017-01-01

    The interaction of a shock wave with a free surface which has geometrical defects, such as cavities or grooves, may lead to the ejection of micrometric debris at velocities of km/s. This process can be involved in many applications, like pyrotechnics or industrial safety. Recent laser shock experiments reported elsewhere in this conference have provided some insight into jet formation as well as jet tip velocities for various groove angles and shock pressures. Here, we present hydrodynamic simulations of these experiments, in both 2D and 3D geometries, using both finite element method and smoothed particle hydrodynamics. Numerical results are compared to several theoretical predictions including the Richtmyer-Meshkov instabilities. The role of the elastic-plastic behavior on jet formation is illustrated. Finally, the possibility to simulate the late stage of jet expansion and fragmentation is explored, to evaluate the mass distribution of the ejecta and their ballistic properties, still essentially unknown in the experiments.

  9. Numerical analysis of lateral illumination lightpipes using elliptical grooves

    Science.gov (United States)

    Sánchez-Guerrero, Guillermo E.; Viera-González, Perla M.; Martínez-Guerra, Edgar; Ceballos-Herrera, Daniel E.

    2017-09-01

    Lightpipes are used for illumination in applications such as back-lighting or solar cell concentrators due to the high irradiance uniformity, but its optimal design requires several parameters. This work presents a procedure to design a square lightpipe to control the light-extraction on its lateral face using commercial LEDs placed symmetrically in the lightpipe frontal face. We propose the use of grooves using total internal reflection placed successively in the same face of extraction to control the area of emission. The LED area of emission is small compared with the illuminated area, and, as expected, the lateral face total power is attenuated. These grooves reduce the optical elements in the system and can control areas of illumination. A mathematical and numerical analysis are presented to determine the dependencies on the light-extraction.

  10. Condensation and Evaporation Transitions in Deep Capillary Grooves

    OpenAIRE

    Malijevský, A. (Alexandr); Parry, A.O.

    2014-01-01

    We study the order of capillary condensation and evaporation transitions of a simple fluid adsorbed in a deep capillary groove using a fundamental measure density functional theory (DFT). The walls of the capillary interact with the fluid particles via long-ranged, dispersion, forces while the fluid-fluid interaction is modelled as a truncated Lennard-Jones-like potential. We find that below the wetting temperature $T_w$ condensation is first-order and evaporation is continuous with the metas...

  11. Groove Pancreatitis – A Mimic of Pancreatic and Periampullary Tumors

    Directory of Open Access Journals (Sweden)

    Sivakami R Pradheepkumar

    2017-10-01

    Full Text Available Groove Pancreatitis (GP is a rare form of focal chronic pancreatitis involving the pancreatico-duodenal groove (PDG. GP was first described by Becker in 1973. Though, GP has been described so many years ago, it is still unfamiliar among most physicians because of lack of sufficient case studies and clinical similarity of GP to conventional pancreatitis. Imaging based differentiation of GP from other lesions, like pancreatic and periampullary adenocarcinoma is also not possible in all the cases, unless there are typical findings favoring GP. Since, the line of treatment and outcome is totally different in these two conditions, appreciation of the fine differences between these two entities is very significant. Groove pancreatitis is symptomatically treated with medicines and only for patients with continuous and severe symptoms which are not amenable to medical treatment surgical management is considered. Radiological differentiation of GP from pancreatic and periampullary malignancies will help to avoid unnecessary surgery in the initial stages. We report two cases of GP, one of pure and other of segmental form where we found typical imaging features which pointed to the diagnosis of GP with a small discussion about the Computed tomography (CT and Magnetic Resonance Imaging (MRI appearance of this entity as well as its differential diagnosis.

  12. New DNA-binding radioprotectors

    Science.gov (United States)

    Martin, Roger

    facilitated by the fact that, like the parent minor groove-binding drug Hoechst 33342, DNA-bound MP (and its analogues) are fluorescent, enabling quantitative assessment of delivery of topically applied drug to basal cells in the mouse oral mucosa. Comparison with the data from prior in vitro experiments described above, indicate that topical delivery is sufficient to confer radioprotection. Although the primary motivation for this project relates to Radiation Oncology, the new ra-dioprotectors obviously have more general potential.

  13. Mixed ligand complexes of Cu(II)/Zn(II) ions containing (m-)/(p-) carboxylato phenyl azo pentane 2,4-dione and 2,2‧-bipyridine/1,10 phenanthroline: Synthesis, characterization, DNA binding, nuclease and topoisomerase I inhibitory activity

    Science.gov (United States)

    Hasan, Md. Amin; Kumari, Niraj; Singh, Kanhaiya; Singh, Kiran; Mishra, Lallan

    2016-01-01

    Metal complexes of type [Cu(L1H)2(bpy)] (1), [Zn(L1H)2(bpy)] (2), [Cu(L2H)2(bpy)] (3) and [Cu(L2H)2(Phen)] (4) (L1H2 = 3-[N‧-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, L2H2 = 4-[N‧-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, bpy = 2,2‧-bipyridine, Phen = 1,10 phenanthroline) are synthesized and characterized using spectroscopic techniques (FT-IR, 1H NMR, 13C NMR, electronic absorption and emission) and elemental analysis data. The assembly of the complexes involving intramolecular H-bonding is displayed using corresponding crystal structure. Binding of the complexes separately with Calf Thymus DNA is monitored using UV-vis spectral titrations. The displacement of ethidium bromide (EB) bound to DNA by the complexes, in phosphate buffer solution (pH ∼ 7.2) is monitored using fluorescence spectral titrations. Nuclease activity of the complexes follow the order 4 > 3 > 1 > 2. The gel electrophoretic mobility assay measurement in presence of minor groove binder 4‧,6-diamidino-2-phenylindole (DAPI), suggests that complexes preferably bind with the minor groove of DNA. Topoisomerase I inhibitory activity of the complexes 3 and 4 inhibit topoisomerase I activity with IC50 values of 112 and 87 μM respectively.

  14. Mixed ligand complexes of Cu(II)/Zn(II) ions containing (m-)/(p-) carboxylato phenyl azo pentane 2,4-dione and 2,2'-bipyridine/1,10 phenanthroline: Synthesis, characterization, DNA binding, nuclease and topoisomerase I inhibitory activity.

    Science.gov (United States)

    Hasan, Md Amin; Kumari, Niraj; Singh, Kanhaiya; Singh, Kiran; Mishra, Lallan

    2016-01-05

    Metal complexes of type [Cu(L1H)2(bpy)] (1), [Zn(L1H)2(bpy)] (2), [Cu(L2H)2(bpy)] (3) and [Cu(L2H)2(Phen)] (4) (L1H2=3-[N'-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, L2H2=4-[N'-(1-acetyl-2-oxo-propylidene)-hydrazino]-benzoic acid, bpy=2,2'-bipyridine, Phen=1,10 phenanthroline) are synthesized and characterized using spectroscopic techniques (FT-IR, (1)H NMR, (13)C NMR, electronic absorption and emission) and elemental analysis data. The assembly of the complexes involving intramolecular H-bonding is displayed using corresponding crystal structure. Binding of the complexes separately with Calf Thymus DNA is monitored using UV-vis spectral titrations. The displacement of ethidium bromide (EB) bound to DNA by the complexes, in phosphate buffer solution (pH∼7.2) is monitored using fluorescence spectral titrations. Nuclease activity of the complexes follow the order 4>3>1>2. The gel electrophoretic mobility assay measurement in presence of minor groove binder 4',6-diamidino-2-phenylindole (DAPI), suggests that complexes preferably bind with the minor groove of DNA. Topoisomerase I inhibitory activity of the complexes 3 and 4 inhibit topoisomerase I activity with IC50 values of 112 and 87μM respectively. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Minority Language Rights.

    Science.gov (United States)

    O Riagain, Padraig; Shuibhne, Niamh Nic

    1997-01-01

    A survey of literature since 1990 on minority languages and language rights focuses on five issues: definition of minorities; individual vs. collective rights; legal bases for minority linguistic rights; applications and interpretations of minority language rights; and assessments of the impact of minority rights legislation. A nine-item annotated…

  16. Synthesis of schiff bases of pyridine-4-carbaldehyde and their antioxidant and DNA binding studies

    International Nuclear Information System (INIS)

    Shamim, S.; Murtaza, S.; Nazar, M.F.

    2016-01-01

    A series of Schiff bases of pyridine-4-carbaldehyde with 3-aminobenzoic acid, 2-aminobenzoic acid, 4-aminobenzoic acid, 1,3-phenylenediamine, 1,2-phenylenediamine, 2-aminothiophenol, 4-aminoantipyrene, 2-aminophenol and naphthalene-1-amine was synthesized and compounds were characterized by FTIR, NMR and mass spectrometry. The synthesized compounds were evaluated for their antioxidant and DNA binding interaction studies. DPPH scavenging method was used to evaluate the antioxidant activities of synthesized Schiff bases at six gradually increasing concentrations of 0.5-5mg/ml. 2-((pyridin-4-ylmethylidene)amino)phenol came out to be the most efficient antioxidant at a concentration of 4mg/ml with 74% inhibition of free radicals generated by DPPH. The DNA binding interaction of the synthesized Schiff bases was determined using UV-Vis absorption titration method. Both the hypochromic and hyperchromic effects were observed along the series. The values for the binding constant (K) and free energy change (G) were calculated and most of the Schiff bases have high positive K values which indicate the efficient binding of Schiff bases with DNA. Molecular docking studies as carried out using PatchDock molecular algorithm software also indicated the high values for geometrical shape complementarity score suggesting the stabilities of Schiff bases/DNA complex. Docking studies also suggested the minor groove binding of the Schiff bases with DNA. Drug-likeness of the synthesized compounds was also tested in silico and the results are accordingly discussed. (author)

  17. Anthraquinone-chalcone hybrids: synthesis, preliminary antiproliferative evaluation and DNA-interaction studies.

    Science.gov (United States)

    Marković, Violeta; Debeljak, Nevena; Stanojković, Tatjana; Kolundžija, Branka; Sladić, Dušan; Vujčić, Miroslava; Janović, Barbara; Tanić, Nikola; Perović, Milka; Tešić, Vesna; Antić, Jadranka; Joksović, Milan D

    2015-01-07

    Novel anthraquinone based chalcone compounds were synthesized starting from 1-acetylanthraquinone in a Claisen-Schmidt reaction and evaluated for their anticancer potential against three human cancer cell lines. Compounds 4a, 4b and 4j showed promising activity in inhibition of HeLa cells with IC50 values ranging from 2.36 to 2.73 μM and low cytotoxicity against healthy MRC-5 cell lines. The effects that compounds produces on the cell cycle were investigated by flow cytometry. It was found that 4a, 4b and 4j cause the accumulation of cells in the S and G2/M phases in a dose-dependent manner and induce caspase-dependent apoptosis. All of three compounds exhibit calf thymus DNA-binding activity. The determined binding constants by absorption titrations (2.65 × 10(3) M(-1), 1.36 × 10(3) M(-1)and 2.51 × 10(3) M(-1) of 4a/CT-DNA, 4b/CT-DNA and 4j/CT-DNA, respectively) together with fluorescence displacement analysis designate 4a, 4b and 4j as strong minor groove binders, but no cleavage of plasmid DNA was observed. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  18. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    Science.gov (United States)

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.

    2016-01-01

    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  19. Dissecting direct and indirect readout of cAMP receptor protein DNA binding using an inosine and 2,6-diaminopurine in vitro selection system

    DEFF Research Database (Denmark)

    Lindemose, Søren; Nielsen, Peter E.; Møllegaard, Niels Erik

    2008-01-01

    The DNA interaction of the Escherichia coli cyclic AMP receptor protein (CRP) represents a typical example of a dual recognition mechanism exhibiting both direct and indirect readout. We have dissected the direct and indirect components of DNA recognition by CRP employing in vitro selection...... is functionally intact. The majority of the selected sites contain the natural consensus sequence TGTGAN(6)TCACA (i.e. TITIDN(6)TCDCD). Thus, direct readout of the consensus sequence is independent of minor groove conformation. Consequently, the indirect readout known to occur in the TG/CA base pair step (primary...... kink site) in the consensus sequence is not affected by I-D substitutions. In contrast, the flanking regions are selected as I/C rich sequences (mostly I-tracts) instead of A/T rich sequences which are known to strongly increase CRP binding, thereby demonstrating almost exclusive indirect readout...

  20. Structure and dynamics of a [1:1] drug-DNA complex: Analysis of 2D NMR data using molecular mechanics and molecular dynamics calculations

    International Nuclear Information System (INIS)

    Sarma, R.H.; Sarma, M.H.; Umemoto, K.

    1990-01-01

    1D/2D NMR studies are reported for a [1:1] complex of d(GA 4 T 4 C) 2 and Dst2 (an analogue of distamycin A). Full- Matrix NOESY Simulations, Molecular Mechanics and Molecular Dynamics Calculations are performed to analyze the NMR data. Results show that drug-DNA complex formation is driven by static features like H-bonding and steric interactions in the minor-groove of DNA. As a consequence of drug binding, a non-linear oscillatory mode is activated. In this mode the molecule samples equilibrium structural states of difference degrees of bending. It is noted that these structures belong to three distinctly different energy wells that satisfy the same NMR data. 14 refs., 4 figs., 2 tabs

  1. Pulse radiolysis studies on DNA-Binding radioprotectors

    International Nuclear Information System (INIS)

    Anderson, R.F.

    1996-01-01

    Full text: Hoechst 33342 and newly-synthesised analogues exhibit radioprotective activity in cultured cells and in vivo, as described in accompanying abstracts. These minor groove binding ligands bind at discreet sites in DNA, characterised by 3 to 4 consecutive AT base pairs, and DNA sequencing studies have shown focussed radioprotection at these binding sites. There is evidence that the bound ligands also confer more 'global' protection including the intervening DNA between the binding sites. The observed focussed radioprotection could be explained by H-atom donation from the ligand to radiation-induced carbon-centred deoxyribosyl radicals, but this mechanism is unlikely to account for the global radioprotection. We now report pulse radiolysis studies on another possible mechanism, namely reduction of transient radiation-induced oxidising species on DNA by the ligand, which is consistent with the report of reduction of G + by TMPD. Oxidation of deoxyguanosine (dG) by Br 2 - , produced by radiolysis of Br- in N 2 0-saturated solutions, in the presence of Hoechst 33342 results in the appearance of a transient ligand species which is kinetically resolvable from that obtained from direct oxidation of Hoechst 33342 by Br 2 - . A plot of reaction rate versus ligand concentration indicates that the rate constant for reduction of G + is approximately 3 x 10 8 dm 3 M -1 sec -1 . Similar experiments with DNA, rather than dG, also revealed a transient species corresponding to oxidation of the ligand, but the absolute rate of oxidation was considerably slower for the DNA-bound ligand compared to that for oxidation of the free ligand by G+. These results are clearly consistent with the proposed mechanism of radioprotection by Hoechst 33342 and its analogues, moreover, pulse radiolysis may provide a very useful endpoint for screening new analogues, as a preliminary to radiobiological evaluation

  2. Minority engineering scholarships, 2012.

    Science.gov (United States)

    2014-02-01

    Scholarships for Minority Students Studying Engineering and Science: Support will make scholarships available to minority students : interested in engineering and science and will increase significantly the number of minority students that Missouri S...

  3. Binding of Bisphenol-F, a bisphenol analogue, to calf thymus DNA by multi-spectroscopic and molecular docking studies.

    Science.gov (United States)

    Usman, Afia; Ahmad, Masood

    2017-08-01

    BPF (Bisphenol-F), a member of the bisphenol family, having a wide range of industrial applications is gradually replacing Bisphenol-A. It is a recognized endocrine disrupting chemical (EDC). EDCs have been implicated in increased incidences of breast, prostate and testis cancers besides diabetes, obesity and decreased fertility. Due to the adverse effects of EDCs on human health, attempts have been directed towards their mechanism of toxicity especially at the molecular level. Hence, to understand the mechanism at the DNA level, interaction of BPF with calf thymus DNA was studied employing multi-spectroscopic, voltammetric and molecular docking techniques. Fluorescence spectra, cyclic voltammetry (CV), circular dichroism (CD) and molecular docking studies of BPF with DNA were suggestive of minor groove binding of BPF. UV-visible absorption and fluorescence spectra suggested static quenching due to complex formation between BPF and ctDNA. Hoechst 33258 (HO) and ethidium bromide (EB) displacement studies further confirmed such mode of BPF interaction. Thermodynamic and molecular docking parameters revealed the mechanism of binding of BPF with ctDNA to be favorable and spontaneous due to negative ΔG and occurring through hydrogen bonds and van der waals interactions. BPF induced DNA cleavage under in vitro conditions by plasmid nicking assay suggested it to be genotoxic. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

    Science.gov (United States)

    Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

    2010-01-01

    DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

  5. Correcting groove error in gratings ruled on a 500-mm ruling engine using interferometric control.

    Science.gov (United States)

    Mi, Xiaotao; Yu, Haili; Yu, Hongzhu; Zhang, Shanwen; Li, Xiaotian; Yao, Xuefeng; Qi, Xiangdong; Bayinhedhig; Wan, Qiuhua

    2017-07-20

    Groove error is one of the most important factors affecting grating quality and spectral performance. To reduce groove error, we propose a new ruling-tool carriage system based on aerostatic guideways. We design a new blank carriage system with double piezoelectric actuators. We also propose a completely closed-loop servo-control system with a new optical measurement system that can control the position of the diamond relative to the blank. To evaluate our proposed methods, we produced several gratings, including an echelle grating with 79  grooves/mm, a grating with 768  grooves/mm, and a high-density grating with 6000  grooves/mm. The results show that our methods effectively reduce groove error in ruled gratings.

  6. Coronary sinus and atrioventricular groove avulsion after motor vehicle crash

    Directory of Open Access Journals (Sweden)

    Bradley M Dennis

    2014-01-01

    Full Text Available Simultaneous cardiac and pericardial rupture from blunt chest trauma is a highly lethal combination with rarely reported survival. We report of a case of young patient with a right atrioventricular groove injury, pericardial rupture and a unique description of a coronary sinus avulsion following blunt chest trauma. Rapid recognition of this injury is crucial to patient survival, but traditional diagnostic adjuncts such as ultrasound, echocardiography and computed tomography are often unhelpful. Successful repair of these injuries requires high suspicion of injury, early cardiac surgery involvement of and possible even placement of the patient on cardiopulmonary bypass.

  7. Constitutional Syndrome, Ascites and Duodenal Thickening Presenting as Groove Pancreatitis

    Directory of Open Access Journals (Sweden)

    Jose Maria Frutos Perez

    2017-12-01

    Full Text Available Groove pancreatitis (GP is a very infrequent subtype of chronic pancreatitis affecting the pancreatic-duodenal junction. It usually manifests in middle-aged men with a history of chronic alcoholism, though it has also been described in women and in individuals who do not consume alcohol[1]. Even though the underlying etiology is unclear, chronic alcohol consumption is known to increase the viscosity of the pancreatic juice and exacerbate the inflammatory process[2]. We present a case of GP that posed diagnostic difficulties because it manifested as ascites and duodenal thickening, with pancreatic imaging findings initially normal.

  8. Narrow groove gas metal-arc welding of aluminum

    International Nuclear Information System (INIS)

    Armstrong, R.E.

    1975-01-01

    The Gas Metal-Arc (GMA) welding process is explained and the equipment used described with an analysis of power supply function and the action of the arc, followed by discussion of general applications and problems. GMA braze welding of beryllium is then described, as is the development of a special high purity filler wire and a narrow deep groove joint design for improved weld strength in beryllium. This joint design and the special wire are applied in making high strength welds in high strength aluminum for special applications. High speed motion pictures of the welding operation are shown to illustrate the talk. (auth)

  9. Combined endodontic-periodontic treatment of a palatal groove: a case report.

    Science.gov (United States)

    Schwartz, Scott A; Koch, Michael A; Deas, David E; Powell, Charles A

    2006-06-01

    The palatal groove is a developmental anomaly that predisposes the tooth involved to a severe periodontal defect. When further complicated by pulp necrosis, these grooves often present a diagnostic and treatment planning challenge that requires an interdisciplinary treatment approach. This case report describes the successful collaborative management of a maxillary lateral incisor with an extensive palatal groove using a combination of nonsurgical endodontic therapy, odontoplasty, and periodontal regenerative techniques.

  10. Management of endodontic-periodontic lesion of a maxillary lateral incisor with palatoradicular groove

    Directory of Open Access Journals (Sweden)

    Jayshree Ramakrishna Vishwas

    2014-01-01

    Full Text Available Presence of palatal radicular grooves are considered to be an important contributing factor to the development of localized periodontitis, as it favored the accumulation and proliferation of bacterial plaque deep into the periodontium. Pulp involvement could result due to the introduction of bacterial toxins through channels that existed between the root canal system and the groove. Early diagnosis, elimination of inflammation and correction of anatomic complications are the key to a favorable outcome for managing palatoradicular groove. Present report describes successful management with an interdisciplinary approach of maxillary lateral incisor with combined endodontic periodontic lesion associated with palatoradicular groove.

  11. Enhanced heat transfer performances of molten salt receiver with spirally grooved pipe

    International Nuclear Information System (INIS)

    Lu, Jianfeng; Ding, Jing; Yu, Tao; Shen, Xiangyang

    2015-01-01

    The enhanced heat transfer performances of solar receiver with spirally grooved pipe were theoretically investigated. The physical model of heat absorption process was proposed using the general heat transfer correlation of molten salt in smooth and spirally grooved pipe. According to the calculation results, the convective heat transfer inside the receiver can remarkably enhance the heat absorption process, and the absorption efficiency increased with the flow velocity and groove height, while the wall temperature dropped. As the groove height increased, the heat losses of convection and radiation dropped with the decrease of wall temperature, and the average absorption efficiency of the heat receiver can be increased. Compared with the heat receiver with smooth pipe, the heat absorption efficiency of heat receiver with spirally grooved pipe e/d = 0.0475 can rise for 0.7%, and the maximum bulk fluid temperature can be increased for 31.1 °C. As a conclusion, spirally grooved pipe can be a very effective way for heat absorption enhancement of solar receiver, and it can also increase the operating temperature of molten salt. - Highlights: • Spirally grooved tube is a very effective way for solar receiver enhancement. • Heat absorption model of receiver is proposed with general heat transfer correlation. • Spirally groove tube increases absorption efficiency and reduces wall temperature. • Operating temperature of molten salt remarkably increases with groove height. • Heat absorption performance is promoted for first and second thermodynamics laws

  12. Space qualification of high capacity grooved heat pipes

    Energy Technology Data Exchange (ETDEWEB)

    Dubois, M; Mullender, B; Druart, J [SABCA, Societe Anomyme Belgel de Construction Aeronautique (Belgium); Supper, W; Beddows, A [ESTEC-The (Netherlands)

    1997-12-31

    Based on the thermal requirements of the future telecommunication satellites, the development of a High Capacity Grooved Heat Pipe (HPG), was contracted by ESA to SABCA leading to an aluminium extruded heat pipe (outer diameter of 25 mm) based on a multi re-entrant grooves design. After an intensive acceptance test campaign whose results showed a good confidence in the design and the fulfillment of the required specifications of heat transport and on tilt capability (experimental maximum heat transport capability of 1500 Watt metres for a vapour temperature of 20 deg C), similar heat pipes have been developed with various outer diameters (11 mm, 15 mm and 20 mm) and with various shapes (circular outer shapes, integrated saddles). Several of these heat pipes were tested during two parabolic flight campaigns, by varying the heat loads during the micro-gravity periods. This HGP heat pipe family is now being submitted to a space qualification program according to ESA standards (ESA PSS-49), both in straight and bent configuration. Within this qualification, the heat pipes are submitted to an extended test campaign including environmental (random/sinus vibration, constant acceleration) and thermal tests (thermal performance, thermal cycle, thermal soak, ageing). (authors) 9 refs.

  13. Syncopation affects free body-movement in musical groove

    DEFF Research Database (Denmark)

    Witek, Maria A. G.; Popescu, Tudor; Clarke, Eric F

    2016-01-01

    One of the most immediate and overt ways in which people respond to music is by moving their bodies to the beat. However, the extent to which the rhythmic complexity of groove-specifically its syncopation-contributes to how people spontaneously move to music is largely unexplored. Here, we measur...... on the body-part. We demonstrate that while people do not move or synchronise much to rhythms with high syncopation when dancing spontaneously to music, the relationship between rhythmic complexity and synchronisation is less linear than in simple finger-tapping studies.......One of the most immediate and overt ways in which people respond to music is by moving their bodies to the beat. However, the extent to which the rhythmic complexity of groove-specifically its syncopation-contributes to how people spontaneously move to music is largely unexplored. Here, we measured...... free movements in hand and torso while participants listened to drum-breaks with various degrees of syncopation. We found that drum-breaks with medium degrees of syncopation were associated with the same amount of acceleration and synchronisation as low degrees of syncopation. Participants who enjoyed...

  14. Capillary contact angle in a completely wet groove.

    Science.gov (United States)

    Parry, A O; Malijevský, A; Rascón, C

    2014-10-03

    We consider the phase equilibria of a fluid confined in a deep capillary groove of width L with identical side walls and a bottom made of a different material. All walls are completely wet by the liquid. Using density functional theory and interfacial models, we show that the meniscus separating liquid and gas phases at two phase capillary coexistence meets the bottom capped end of the groove at a capillary contact angle θ(cap)(L) which depends on the difference between the Hamaker constants. If the bottom wall has a weaker wall-fluid attraction than the side walls, then θ(cap) > 0 even though all the isolated walls are themselves completely wet. This alters the capillary condensation transition which is now first order; this would be continuous in a capped capillary made wholly of either type of material. We show that the capillary contact angle θ(cap)(L) vanishes in two limits, corresponding to different capillary wetting transitions. These occur as the width (i) becomes macroscopically large, and (ii) is reduced to a microscopic value determined by the difference in Hamaker constants. This second wetting transition is characterized by large scale fluctuations and essential critical singularities arising from marginal interfacial interactions.

  15. Flight trajectory of a rotating golf ball with grooves

    Science.gov (United States)

    Baek, Moonheum; Kim, Jooha; Choi, Haecheon

    2014-11-01

    Dimples are known to reduce drag on a sphere by the amount of 50% as compared to a smooth surface. Despite the advantage of reducing drag, dimples deteriorate the putting accuracy owing to their sharp edges. To minimize this putting error but maintain the same flight distance, we have devised a grooved golf ball (called G ball hereafter) for several years. In this study, we modify the shape and pattern of grooves, and investigate the flow characteristics of the G ball by performing wind-tunnel experiments at the Reynolds numbers of 0 . 5 ×105 - 2 . 5 ×105 and the spin ratios (ratio of surface velocity to the free-stream velocity) of 0 - 0.6 that include the real golf-ball velocity and rotational speed. We measure the drag and lift forces on the rotating G ball and compare them with those of a smooth ball and two well-known dimpled balls. The lift-to-drag ratio of the G ball is much higher than that of a smooth ball and is in between those of the two dimpled balls. The trajectories of flying golf balls are computed. The flight distance of G ball is almost the same as that of one dimpled ball but slightly shorter than that of the other dimpled ball. The fluid-dynamic aspects of these differences will be discussed at the talk. Supported by 2011-0028032, 2014M3C1B1033980.

  16. Space qualification of high capacity grooved heat pipes

    Energy Technology Data Exchange (ETDEWEB)

    Dubois, M.; Mullender, B.; Druart, J. [SABCA, Societe Anomyme Belgel de Construction Aeronautique (Belgium); Supper, W.; Beddows, A. [ESTEC-The (Netherlands)

    1996-12-31

    Based on the thermal requirements of the future telecommunication satellites, the development of a High Capacity Grooved Heat Pipe (HPG), was contracted by ESA to SABCA leading to an aluminium extruded heat pipe (outer diameter of 25 mm) based on a multi re-entrant grooves design. After an intensive acceptance test campaign whose results showed a good confidence in the design and the fulfillment of the required specifications of heat transport and on tilt capability (experimental maximum heat transport capability of 1500 Watt metres for a vapour temperature of 20 deg C), similar heat pipes have been developed with various outer diameters (11 mm, 15 mm and 20 mm) and with various shapes (circular outer shapes, integrated saddles). Several of these heat pipes were tested during two parabolic flight campaigns, by varying the heat loads during the micro-gravity periods. This HGP heat pipe family is now being submitted to a space qualification program according to ESA standards (ESA PSS-49), both in straight and bent configuration. Within this qualification, the heat pipes are submitted to an extended test campaign including environmental (random/sinus vibration, constant acceleration) and thermal tests (thermal performance, thermal cycle, thermal soak, ageing). (authors) 9 refs.

  17. Reassessing the Function of Grooves in Mycenaean Tombs

    Directory of Open Access Journals (Sweden)

    Constantina Katsari

    2001-11-01

    Full Text Available Normal 0 0 2 false false false MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Times New Roman"; mso-fareast-font-family:"Times New Roman"; mso-ansi-language:#0400; mso-fareast-language:#0400; mso-bidi-language:#0400;} Among the Chamber and Tholos Tombs that were built in Greece during the Late Helladic period are some that show a particular feature: a pair of grooves that are carved on the floor of the 'stomion '(a short corridor that leads inside the tomb, leading from the 'dromos '(a long road that leads towards the tomb itself into the chamber. Archaeologists have suggested a number of explanations regarding their function; however, none of these seems entirely plausible. In this article, we offer a different kind of hypothesis mostly based on architectural evidence. We will suggest that, rather than being related to ritual practices, the grooves were mainly used to facilitate the construction of the graves.

  18. Optoelectronic enhancement of monocrystalline silicon solar cells by porous silicon-assisted mechanical grooving

    Energy Technology Data Exchange (ETDEWEB)

    Ben Rabha, Mohamed; Mohamed, Seifeddine Belhadj; Dimassi, Wissem; Gaidi, Mounir; Ezzaouia, Hatem; Bessais, Brahim [Laboratoire de Photovoltaique, Centre de Recherches et des Technologies de l' Energie, Technopole de Borj-Cedria, BP 95, 2050 Hammam-Lif (Tunisia)

    2011-03-15

    One of the most important factors influencing silicon solar cells performances is the front side reflectivity. Consequently, new methods for efficient reduction of this reflectivity are searched. This has always been done by creating a rough surface that enables incident light of being absorbed within the solar cell. Combination of texturization-porous silicon surface treatment was found to be an attractive technical solution for lowering the reflectivity of monocrystalline silicon (c-Si). The texturization of the monocrystalline silicon wafer was carried out by means of mechanical grooving. A specific etching procedure was then applied to form a thin porous silicon layer enabling to remove mechanical damages. This simple and low cost method reduces the total reflectivity from 29% to 7% in the 300 - 950 nm wavelength range and enhances the diffusion length of the minority carriers from 100 {mu}m to 790 {mu}m (copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  19. Twist-writhe partitioning in a coarse-grained DNA minicircle model

    Science.gov (United States)

    Sayar, Mehmet; Avşaroǧlu, Barış; Kabakçıoǧlu, Alkan

    2010-04-01

    Here we present a systematic study of supercoil formation in DNA minicircles under varying linking number by using molecular-dynamics simulations of a two-bead coarse-grained model. Our model is designed with the purpose of simulating long chains without sacrificing the characteristic structural properties of the DNA molecule, such as its helicity, backbone directionality, and the presence of major and minor grooves. The model parameters are extracted directly from full-atomistic simulations of DNA oligomers via Boltzmann inversion; therefore, our results can be interpreted as an extrapolation of those simulations to presently inaccessible chain lengths and simulation times. Using this model, we measure the twist/writhe partitioning in DNA minicircles, in particular its dependence on the chain length and excess linking number. We observe an asymmetric supercoiling transition consistent with experiments. Our results suggest that the fraction of the linking number absorbed as twist and writhe is nontrivially dependent on chain length and excess linking number. Beyond the supercoiling transition, chains of the order of one persistence length carry equal amounts of twist and writhe. For longer chains, an increasing fraction of the linking number is absorbed by the writhe.

  20. Analysis of substrate specificity of Schizosaccharomyces pombe Mag1 alkylpurine DNA glycosylase

    Energy Technology Data Exchange (ETDEWEB)

    Adhikary, Suraj; Eichman, Brandt F. (Vanderbilt)

    2014-10-02

    DNA glycosylases specialized for the repair of alkylation damage must identify, with fine specificity, a diverse array of subtle modifications within DNA. The current mechanism involves damage sensing through interrogation of the DNA duplex, followed by more specific recognition of the target base inside the active site pocket. To better understand the physical basis for alkylpurine detection, we determined the crystal structure of Schizosaccharomyces pombe Mag1 (spMag1) in complex with DNA and performed a mutational analysis of spMag1 and the close homologue from Saccharomyces cerevisiae (scMag). Despite strong homology, spMag1 and scMag differ in substrate specificity and cellular alkylation sensitivity, although the enzymological basis for their functional differences is unknown. We show that Mag preference for 1,N{sup 6}-ethenoadenine ({var_epsilon}A) is influenced by a minor groove-interrogating residue more than the composition of the nucleobase-binding pocket. Exchanging this residue between Mag proteins swapped their {var_epsilon}A activities, providing evidence that residues outside the extrahelical base-binding pocket have a role in identification of a particular modification in addition to sensing damage.

  1. Design, synthesis and DNA-binding study of some novel morpholine linked thiazolidinone derivatives.

    Science.gov (United States)

    War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi

    2017-02-15

    The emergence of multiple drug resistance amongst bacterial strains resulted in many clinical drugs to be ineffective. Being vulnerable to bacterial infections any lack in the development of new antimicrobial drugs could pose a serious threat to public health. Here we report design and synthesis of a novel class of morpholine linked thiazolidinone hybrid molecules. The compounds were characterized by FT-IR, NMR and HRMS techniques. Susceptibility tests showed that most of the synthesized molecules were highly active against multiple bacterial strains. Compound 3f displayed MIC values which were better than the standard drug for most of the tested strains. DNA being a well defined target for many antimicrobial drugs was probed as possible target for these synthetic molecules. DNA-binding study of 3f with sm-DNA was probed through UV-vis absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. The studies revealed that compound 3f has strong affinity towards DNA and binds at the minor groove. The docking studies revealed that the compound 3f shows preferential binding towards A/T residues. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Design, synthesis and DNA-binding study of some novel morpholine linked thiazolidinone derivatives

    Science.gov (United States)

    War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi

    2017-02-01

    The emergence of multiple drug resistance amongst bacterial strains resulted in many clinical drugs to be ineffective. Being vulnerable to bacterial infections any lack in the development of new antimicrobial drugs could pose a serious threat to public health. Here we report design and synthesis of a novel class of morpholine linked thiazolidinone hybrid molecules. The compounds were characterized by FT-IR, NMR and HRMS techniques. Susceptibility tests showed that most of the synthesized molecules were highly active against multiple bacterial strains. Compound 3f displayed MIC values which were better than the standard drug for most of the tested strains. DNA being a well defined target for many antimicrobial drugs was probed as possible target for these synthetic molecules. DNA-binding study of 3f with sm-DNA was probed through UV-vis absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. The studies revealed that compound 3f has strong affinity towards DNA and binds at the minor groove. The docking studies revealed that the compound 3f shows preferential binding towards A/T residues.

  3. Presence of High-Risk HPV mRNA in Relation to Future High-Grade Lesions among High-Risk HPV DNA Positive Women with Minor Cytological Abnormalities.

    Directory of Open Access Journals (Sweden)

    Hanna Johansson

    Full Text Available Continuous expression of E6- and E7-oncogenes of high-risk human papillomavirus (HPV types is necessary for the development and maintenance of the dysplastic phenotype. The aim of the study was to determine the sensitivity and specificity of the APTIMA HPV mRNA assay (Hologic in predicting future development of high-grade cervical intraepithelial neoplasia (CIN among high-risk HPV-DNA-positive women with atypical squamous cells of undetermined significance (ASCUS or low-grade squamous epithelial lesion (LSIL cytology.Archived SurePath cervical samples of women ≥ 35 years of age with high-risk HPV DNA-positive ASCUS (n = 211 or LSIL, (n = 131 were tested for the presence of high-risk HPV E6/E7 mRNA using the APTIMA HPV assay, and the women were monitored for development of histopathologically verified CIN2+.Twenty-nine percent (61/211 of the women in the ASCUS group, and 34.3% (45/131 in the LSIL group developed CIN2+ within 4.5 years of follow-up. The prevalence of HPV mRNA was 90.0% (95% CI 85.9-94.0 among women with ASCUS and 95.4% (95% CI 91.8-99.0 among women with LSIL. The presence of HPV E6/E7 mRNA was associated with future development of CIN2+ among women with ASCUS and LSIL (p=0.02. The mRNA assay demonstrated high sensitivity in predicting future CIN2+ and CIN3 for index ASCUS (96.7%; 95% CI 87.6-99.4 and 100%; 95% CI 82.2-100, respectively and LSIL (97.8%, 95% CI 86.8-99.9 and 100%, 95% CI 79.9-100, respectively. The corresponding specificity was low, 12.7% (95% CI 7.9-19.3 and 5.8% (95% CI 2.2-13.6, for future CIN2+, respectively. The negative predictive value of the HPV mRNA assay for detecting future CIN3 was 100%, since no mRNA-negative woman developed CIN3 (0/27 as compared to 13.6% (43/315 of the mRNA-positive women (p = 0.03.The APTIMA mRNA assay demonstrated high sensitivity but low specificity in predicting future CIN2+ among women with minor cytological abnormalities. The assay had high negative predictive value for future

  4. Presence of High-Risk HPV mRNA in Relation to Future High-Grade Lesions among High-Risk HPV DNA Positive Women with Minor Cytological Abnormalities

    Science.gov (United States)

    Johansson, Hanna; Bjelkenkrantz, Kaj; Darlin, Lotten; Dilllner, Joakim; Forslund, Ola

    2015-01-01

    Objective Continuous expression of E6- and E7-oncogenes of high-risk human papillomavirus (HPV) types is necessary for the development and maintenance of the dysplastic phenotype. The aim of the study was to determine the sensitivity and specificity of the APTIMA HPV mRNA assay (Hologic) in predicting future development of high-grade cervical intraepithelial neoplasia (CIN) among high-risk HPV-DNA-positive women with atypical squamous cells of undetermined significance (ASCUS) or low-grade squamous epithelial lesion (LSIL) cytology. Methods Archived SurePath cervical samples of women ≥ 35 years of age with high-risk HPV DNA-positive ASCUS (n = 211) or LSIL, (n = 131) were tested for the presence of high-risk HPV E6/E7 mRNA using the APTIMA HPV assay, and the women were monitored for development of histopathologically verified CIN2+. Results Twenty-nine percent (61/211) of the women in the ASCUS group, and 34.3% (45/131) in the LSIL group developed CIN2+ within 4.5 years of follow-up. The prevalence of HPV mRNA was 90.0% (95% CI 85.9-94.0) among women with ASCUS and 95.4% (95% CI 91.8-99.0) among women with LSIL. The presence of HPV E6/E7 mRNA was associated with future development of CIN2+ among women with ASCUS and LSIL (p=0.02). The mRNA assay demonstrated high sensitivity in predicting future CIN2+ and CIN3 for index ASCUS (96.7%; 95% CI 87.6-99.4 and 100%; 95% CI 82.2-100, respectively) and LSIL (97.8%, 95% CI 86.8-99.9 and 100%, 95% CI 79.9-100, respectively). The corresponding specificity was low, 12.7% (95% CI 7.9-19.3) and 5.8% (95% CI 2.2-13.6), for future CIN2+, respectively. The negative predictive value of the HPV mRNA assay for detecting future CIN3 was 100%, since no mRNA-negative woman developed CIN3 (0/27) as compared to 13.6% (43/315) of the mRNA-positive women (p = 0.03). Conclusion The APTIMA mRNA assay demonstrated high sensitivity but low specificity in predicting future CIN2+ among women with minor cytological abnormalities. The assay had

  5. DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.

    Science.gov (United States)

    Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford

    2017-10-01

    Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  6. Treatment of combined endodontic: periodontic lesion by sealing of palato-radicular groove using biodentine

    OpenAIRE

    Naik, Mayuri; de Ataide, Ida de Noronha; Fernandes, Marina; Lambor, Rajan

    2014-01-01

    Introduction: Palatoradicular groove is a developmental anomaly which is predominantly found in maxillary lateral incisors. It provides a susceptible alcove for the progression of localised periodontal inflammation which can further cause pulpal involvement. This case report describes the successful treatment of a large periodontic - endodontic lesion usingnon surgical endodontic therapy and biodentine for the sealing of the palatoradicular groove.

  7. Treatment of combined endodontic: periodontic lesion by sealing of palato-radicular groove using biodentine.

    Science.gov (United States)

    Naik, Mayuri; de Ataide, Ida de Noronha; Fernandes, Marina; Lambor, Rajan

    2014-11-01

    Palatoradicular groove is a developmental anomaly which is predominantly found in maxillary lateral incisors. It provides a susceptible alcove for the progression of localised periodontal inflammation which can further cause pulpal involvement. This case report describes the successful treatment of a large periodontic - endodontic lesion usingnon surgical endodontic therapy and biodentine for the sealing of the palatoradicular groove.

  8. Grooved floor system for cattle housing: ammonia emission reduction and good slip resistance

    NARCIS (Netherlands)

    Swierstra, D.; Braam, C.R.; Smits, M.C.J.

    2001-01-01

    To improve the slip resistance of solid floors in dairy cow houses and to achieve the ammonia emission reduction prescribed by the Dutch government, precast concrete floors with grooves and a dung scraper were investigated. The grooves parallel to the alley had 160 mm center-to-center spacing and

  9. Side-coupled cavity model for surface plasmon-polariton transmission across a groove

    International Nuclear Information System (INIS)

    Liu, J.S.Q.

    2010-01-01

    We demonstrate that the transmission properties of surface plasmon-polaritons (SPPs) across a rectangular groove in a metallic film can be described by an analytical model that treats the groove as a side-coupled cavity to propagating SPPs on the metal surface. The coupling efficiency to the groove is quantified by treating it as a truncated metal-dielectric-metal (MDM) waveguide. Finite-difference frequency-domain (FDFD) simulations and mode orthogonality relations are employed to derive the basic scattering coefficients that describe the interaction between the relevant modes in the system. The modeled SPP transmission and reflection intensities show excellent agreement with full-field simulations over a wide range of groove dimensions, validating this intuitive model. The model predicts the sharp transmission minima that occur whenever an incident SPP resonantly couples to the groove. We also for the first time show the importance of evanescent, reactive MDM SPP modes to the transmission behavior. SPPs that couple to this mode are resonantly enhanced upon reflection from the bottom of the groove, leading to high field intensities and sharp transmission minima across the groove. The resonant behavior exhibited by the grooves has a number of important device applications, including SPP mirrors, filters, and modulators.

  10. Solving the N-Queens Problem with GROOVE - Towards a Compendium of Best Practices

    NARCIS (Netherlands)

    Zambon, Eduardo; Rensink, Arend; Hermann, F.; Sauer, S.

    We present a detailed solution to the N-queens puzzle using GROOVE, a graph transformation tool especially designed for state space exploration and analysis. While GROOVE has been freely available for more than a decade and has attracted a reasonable number of users, it is safe to say that only a

  11. Synonymous codon bias and functional constraint on GC3-related DNA backbone dynamics in the prokaryotic nucleoid.

    Science.gov (United States)

    Babbitt, Gregory A; Alawad, Mohammed A; Schulze, Katharina V; Hudson, André O

    2014-01-01

    While mRNA stability has been demonstrated to control rates of translation, generating both global and local synonymous codon biases in many unicellular organisms, this explanation cannot adequately explain why codon bias strongly tracks neighboring intergene GC content; suggesting that structural dynamics of DNA might also influence codon choice. Because minor groove width is highly governed by 3-base periodicity in GC, the existence of triplet-based codons might imply a functional role for the optimization of local DNA molecular dynamics via GC content at synonymous sites (≈GC3). We confirm a strong association between GC3-related intrinsic DNA flexibility and codon bias across 24 different prokaryotic multiple whole-genome alignments. We develop a novel test of natural selection targeting synonymous sites and demonstrate that GC3-related DNA backbone dynamics have been subject to moderate selective pressure, perhaps contributing to our observation that many genes possess extreme DNA backbone dynamics for their given protein space. This dual function of codons may impose universal functional constraints affecting the evolution of synonymous and non-synonymous sites. We propose that synonymous sites may have evolved as an 'accessory' during an early expansion of a primordial genetic code, allowing for multiplexed protein coding and structural dynamic information within the same molecular context. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Hybrid plasmonic waveguide in a metal V-groove

    Directory of Open Access Journals (Sweden)

    Zhao-xian Chen

    2014-01-01

    Full Text Available We propose and investigate a type of hybrid plasmonic waveguide in a metal V-groove. A high-permittivity nanowire was placed in the metal channel covered with a dielectric film of lower permittivity. Deeper sub-wavelength confinement and much longer propagation distance were achieved in comparison with conventional channel plasmonic waveguides. The overall performance was improved as compared with the conventional hybrid plasmonic structure based on a flat metal surface. Finite element analysis showed that both the mode propagation and field profile can be adjusted by changing the nanowire radius and film thickness. Some benefits, such as a reduced scattering loss caused by the surface roughness, are also expected owing to the unique mode profile. The proposed approach has potential for application in high-level photonic integration.

  13. Influence of edge conditions on material ejection from periodic grooves in laser shock-loaded tin

    Energy Technology Data Exchange (ETDEWEB)

    Rességuier, T. de; Roland, C. [Institut PPRIME, UPR 3346, CNRS, ENSMA, Université de Poitiers, 1 ave. Clément Ader, 86961 Futuroscope Cedex (France); Prudhomme, G.; Lescoute, E.; Mercier, P. [CEA, DAM, DIF, 91297 Arpajon (France); Loison, D. [Institut de Physique de Rennes, CNRS, Université de Rennes 1, 35042 Rennes (France)

    2016-05-14

    In a material subjected to high dynamic compression, the breakout of a shock wave at a rough free surface can lead to the ejection of high velocity debris. Anticipating the ballistic properties of such debris is a key safety issue in many applications involving shock loading, including pyrotechnics and inertial confinement fusion experiments. In this paper, we use laser driven shocks to investigate particle ejection from calibrated grooves of micrometric dimensions and approximately sinusoidal profile in tin samples, with various boundary conditions at the groove edges, including single groove and periodic patterns. Fast transverse shadowgraphy provides ejection velocities after shock breakout. They are found to depend not only on the groove depth and wavelength, as predicted theoretically and already observed in the past, but also, unexpectedly, on the edge conditions, with a jet tip velocity significantly lower in the case of a single groove than behind a periodic pattern.

  14. Dispersion characteristics of planar grating with arbitrary grooves for terahertz Smith-Purcell radiation

    International Nuclear Information System (INIS)

    Cao, Miaomiao; Li, Ke; Liu, Wenxin; Wang, Yong

    2015-01-01

    In this paper, a novel method of getting the dispersion relations in planar grating with arbitrary grooves for terahertz Smith-Purcell radiation is investigated analytically. The continuous profile of the groove is approximately replaced by a series of rectangular steps. By making use of field matches method and the continuity of transverse admittance, the universal dispersion equation for grating with arbitrarily shaped grooves is derived. By solving the dispersion equation in presence of electron beam, the growth rate is obtained directly and the dependence on beam parameters is analyzed. Comparisons of the dispersion characteristics among some special groove shapes have been made by numerical calculation. The results show that the rectangular-step approximation method provides a novel approach to obtain the universal dispersion relation for grating with arbitrary grooves for Smith-Purcell radiation

  15. Treatment of a Developmental Groove and Supernumerary Root Using Guided Tissue Regeneration Technique

    Directory of Open Access Journals (Sweden)

    Zahra Alizadeh Tabari

    2016-01-01

    Full Text Available Introduction. The radicular groove is a developmental groove which is usually found on the palatal or lateral aspects of the maxillary incisor teeth. The present case is a maxillary lateral incisor with a small second root and a deep radicular groove. The developmental groove caused a combined periodontal-endodontic lesion. Methods. Case was managed using a combined treatment procedure involving nonsurgical root canal therapy and surgical periodontal treatment. After completion of root canal treatment, guided tissue regeneration (GTR was carried out using decalcified freeze dried bone allograft (DFDBA and a bioabsorbable collagenous membrane. Tooth also was splinted for two months. Results. After 12 months the tooth was asymptomatic. The periapical radiolucency disappeared and probing depth did not exceed 3 mm. Conclusion. Combined treatment procedure involving nonsurgical root canal therapy and surgical periodontal regenerative treatment can be a predictable technique in treating combined endodontic-periodontal lesions caused by radicular groove.

  16. The rem mutations in the ATP-binding groove of the Rad3/XPD helicase lead to Xeroderma pigmentosum-Cockayne syndrome-like phenotypes.

    Science.gov (United States)

    Herrera-Moyano, Emilia; Moriel-Carretero, María; Montelone, Beth A; Aguilera, Andrés

    2014-12-01

    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease.

  17. Individual differences in beat perception affect gait responses to low- and high-groove music.

    Directory of Open Access Journals (Sweden)

    Li-Ann eLeow

    2014-10-01

    Full Text Available Slowed gait in Parkinson’s disease (PD patients can be improved when patients synchronize footsteps to isochronous metronome cues, but limited retention of such improvements suggest that permanent cueing regimes are needed for long-term improvements. If so, music might make permanent cueing regimes more pleasant, improving adherence; however, music cueing requires patients to synchronize movements to the beat, which might be difficult for PD patients who tend to show weak beat perception. One solution may be to use high groove music, which has high beat salience that may facilitate synchronization, and affective properties which may improve motivation to move. As a first step in understanding how beat perception affects gait in complex neurological disorders, we examined how beat perception ability affected gait in neurotypical adults. Synchronization performance and gait parameters were assessed as healthy young adults with strong or weak beat perception synchronized to low groove music, high groove music, and metronome cues. High groove music was predicted to elicit better synchronization than low groove music, due to its higher beat salience. Two musical tempi, or rates, were used: (1 preferred tempo: beat rate matched to preferred step rate and (2 faster tempo: beat rate adjusted to 22.5% faster than preferred step rate. For both strong and weak beat-perceivers, synchronization performance was best with metronome cues, followed by high groove music, and worst with low groove music. In addition, high groove music elicited longer and faster steps than low groove music, both at preferred tempo and at faster tempo. Low groove music was particularly detrimental to gait in weak beat-perceivers, who showed slower and shorter steps compared to uncued walking. The findings show that individual differences in beat perception affect gait when synchronizing footsteps to music, and have implications for using music in gait rehabilitation.

  18. Individual Differences in Beat Perception Affect Gait Responses to Low- and High-Groove Music

    Science.gov (United States)

    Leow, Li-Ann; Parrott, Taylor; Grahn, Jessica A.

    2014-01-01

    Slowed gait in patients with Parkinson’s disease (PD) can be improved when patients synchronize footsteps to isochronous metronome cues, but limited retention of such improvements suggest that permanent cueing regimes are needed for long-term improvements. If so, music might make permanent cueing regimes more pleasant, improving adherence; however, music cueing requires patients to synchronize movements to the “beat,” which might be difficult for patients with PD who tend to show weak beat perception. One solution may be to use high-groove music, which has high beat salience that may facilitate synchronization, and affective properties, which may improve motivation to move. As a first step to understanding how beat perception affects gait in complex neurological disorders, we examined how beat perception ability affected gait in neurotypical adults. Synchronization performance and gait parameters were assessed as healthy young adults with strong or weak beat perception synchronized to low-groove music, high-groove music, and metronome cues. High-groove music was predicted to elicit better synchronization than low-groove music, due to its higher beat salience. Two musical tempi, or rates, were used: (1) preferred tempo: beat rate matched to preferred step rate and (2) faster tempo: beat rate adjusted to 22.5% faster than preferred step rate. For both strong and weak beat-perceivers, synchronization performance was best with metronome cues, followed by high-groove music, and worst with low-groove music. In addition, high-groove music elicited longer and faster steps than low-groove music, both at preferred tempo and at faster tempo. Low-groove music was particularly detrimental to gait in weak beat-perceivers, who showed slower and shorter steps compared to uncued walking. The findings show that individual differences in beat perception affect gait when synchronizing footsteps to music, and have implications for using music in gait rehabilitation. PMID:25374521

  19. Effects of groove shape of notch on the flow characteristics of spool valve

    International Nuclear Information System (INIS)

    Ye, Yi; Yin, Chen-Bo; Li, Xing-Dong; Zhou, Wei-jin; Yuan, Feng-feng

    2014-01-01

    Highlights: • Flow characteristics of notches are studied using CFD simulation and experiment. • Test data is fitted by least square method to analyze discharge coefficient. • The stable value of discharge coefficient is deduced. • Effects of groove shape on steady flow force and throttling stiffness are performed. • The groove shape has significant effects on the flow characteristics. - Abstract: The grooves of notches of hydraulic spool valves are usually designed into various shapes for their desired flow characteristics. The aim of this paper is to clarify the effects of the groove shape on the flow characteristics through computational fluid dynamics (CFD) and experimental investigations. The RNG k–ε turbulence model is used to simulate the pressure distributions of the flow fields inside three notches with their corresponding typical structural grooves in order to analyze the changes of restricted locations along with the openings and, furthermore, to calculate the flow areas of the notches. The accuracy of the employed model is demonstrated by comparing the computational results with the experimental data. Additionally, the flow rate vs. pressure drop data obtained from the experiment is fitted by least square method. On this basis, the discharge coefficient as a function of groove geometry, flow condition, fitting coefficients and its stable value is deduced, proving to be quite consistent with the experimental result. Thanks to the jet flow angles estimated by CFD simulation, the steady flow forces are calculated, which show good agreement with the experimental results except for some small differences. Finally, the throttling stiffness of the three notches is investigated, with that of divergent U-shape groove falls between spheroid-shape groove and triangle-shape groove. Similar results are found for steady flow force. The results indicate that the groove shape has significant effects on the flow characteristics (flow area, discharge

  20. Champagne Groove Lipectomy: A Safe Technique to Contour the Upper Abdomen in Abdominoplasty.

    Science.gov (United States)

    Brooks, Ron; Nguyen, Jonathan; Chowdhry, Saeed; Tutela, John Paul; Kelishadi, Sean; Yonick, David; Choo, Joshua; Wilhelmi, Bradon J

    2017-01-01

    Objective: Combined liposuction and abdominoplasty, or lipoabdominoplasty, is particularly helpful in sculpting a more aesthetically pleasing abdominal contour, particularly in the supraumbilical midline groove. This groove, coined the "champagne groove" by one of our patients, is a frequently sought-after attribute by patients. However, liposuction adds time and cost to an already costly abdominoplasty. We sought to create this groove without the addition of liposuction, utilizing what we call a champagne groove lipectomy. This study reports on our champagne groove lipectomy technique and compares our complication rates with those reported in the literature for standard abdominoplasty techniques. Methods: This is a retrospective review of a single surgeon's experience at our institution over a 6-year period (2007-2012). A total of 74 patients undergoing consecutive abdominoplasty were studied, all female nonsmokers. Two groups were recognized: 64 of 74 patients underwent abdominoplasty, partial belt lipectomy, and champagne groove lipectomy, while 10 of 74 patients underwent fleur-de-lis abdominoplasty without champagne groove lipectomy. Results: Overall, 10 of 74 patients (13.5%) suffered some type of complication, which compares favorably with reported rates in the literature. The majority of complications were related to delayed wound healing or superficial wound dehiscence. Among those patients who underwent champagne groove lipectomy, complications occurred in 6 of 64 patients (9.3%), versus 4 of 10 (40%) patients undergoing fleur-de-lis abdominoplasty. Conclusions: Champagne groove lipectomy is a cost-effective alternative to lipoabdominoplasty for achieving an aesthetically pleasing upper midline abdominal contour, with complication rates comparing favorably with those reported in the literature.

  1. Force-induced rupture of double-stranded DNA in the absence and presence of covalently bonded anti-tumor drugs: Insights from molecular dynamics simulations

    Science.gov (United States)

    Upadhyaya, Anurag; Nath, Shesh; Kumar, Sanjay

    2018-06-01

    DNA intra-strand cross-link (ICL) agents are widely used in the treatment of cancer. ICLs are thought to form a link between the same strand (intra-strand) or complimentary strand (inter-strand) and thereby increase the stability of DNA, which forbids the processes like replication and transcription. As a result, cell death occurs. In this work, we have studied the enhanced stability of a double stranded DNA in the presence of ICLs and compared our findings with the results obtained in the absence of these links. Using atomistic simulations with explicit solvent, a force is applied along and perpendicular to the direction of the helix and we measured the rupture force and the unzipping force of DNA-ICL complexes. Our results show that the rupture and the unzipping forces increase significantly in the presence of these links. The ICLs bind to the minor groove of DNA, which enhance the DNA stabilisation. Such information may be used to design alternative drugs that can stall replication and transcription that are critical to a growing number of anticancer drug discovery efforts.

  2. High quality broadband spatial reflections of slow Rayleigh surface acoustic waves modulated by a graded grooved surface

    KAUST Repository

    Xu, Yanlong; Peng, Pai

    2015-01-01

    . The graded grooved surface is structured by drilling one dimensional array of graded grooves with increased depths on a flat surface. We investigate SAW dispersion relations, wave field distribution at several typical SAW wavelengths, and time evolution of a

  3. Determination of Tongue and Groove parameters for multileaf collimators; Determinaco de parametros de Tongue and Groove de colimadores de multilaminas

    Energy Technology Data Exchange (ETDEWEB)

    Castro, Aluisio; Almeida, Carlos E. de, E-mail: alu_neto@hotmail.com [Universidade Estadual do Rio de Janeiro (UERJ), RJ (Brazil). Laboratorio de Ciencias Radiologicas; Nguyen, Bihn [Prowess Inc., Concord, CA (United States)

    2012-08-15

    The Tongue and Groove effect (TandG) is characterized by an additional attenuation between adjacent and opposing leaves on multileaf collimators (MLCs) in adjacent or complementary fields. This is a typical situation in of intensity-modulated radiotherapy treatments. The aim of this study was to measure the width and transmission of TandG effect for two commercial MLCs: Varian Millennium 120 (6 MV and 16 MV beams) and BrainLab m3 (only for 6 MV). The methodology used was based on the creation of MLC shapes that emphasizes TandG effect, the irradiation of these fields on radiochromic film and the sensitometric evaluation of the films in order to determine the TandG width and transmission. The results for TandG width for studied MLCs were 2.5, 1.8 and 2 mm, respectively, whit transmission TandG values of 87, 90 and 85%. (author)

  4. Antibody Drug Conjugates Differentiate Uptake and DNA Alkylation of Pyrrolobenzodiazepines in Tumors from Organs of Xenograft Mice.

    Science.gov (United States)

    Ma, Yong; Khojasteh, S Cyrus; Hop, Cornelis E C A; Erickson, Hans K; Polson, Andrew; Pillow, Thomas H; Yu, Shang-Fan; Wang, Hong; Dragovich, Peter S; Zhang, Donglu

    2016-12-01

    Pyrrolobenzodiazepine (PBD)-dimer is a DNA minor groove alkylator, and its CD22 THIOMAB antibody drug conjugate (ADC) demonstrated, through a disulfide linker, an efficacy in tumor reduction for more than 7 weeks with minimal body weight loss in xenograft mice after a single 0.5-1 mg/kg i.v. dose. The DNA alkylation was investigated here in tumors and healthy organs of mice to understand the sustained efficacy and tolerability. The experimental procedures included the collection of tumors and organ tissues of xenograft mice treated with the ADC followed by DNA isolation/hydrolysis/quantitation and payload recovery from reversible DNA alkylation. PBD-dimer formed a considerable amount of adducts with tissue DNA, representing approximately 98% (at 24 hours), and 99% (at 96 hours) of the total PBD-dimer in tumors, and 78-89% in liver and lung tissues, suggesting highly efficient covalent binding of the released PBD-dimer to tissue DNA. The amount of PBD-DNA adducts in tumor tissues was approximately 24-fold (at 24 hours) and 70-fold (at 96 hours) greater than the corresponding amount of adducts in liver and lung tissues. In addition, the DNA alkylation levels increased 3-fold to 4-fold from 24 to 96 hours in tumors [41/10 6 base pairs (bp) at 96 hours] but remained at the same level (1/10 6 bp) in livers and lungs. These results support the typical target-mediated cumulative uptake of ADC into tumors and payload release that offers an explanation for its sustained antitumor efficacy. In addition, the low level of DNA alkylation in normal tissues is consistent with the tolerability observed in mice. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  5. The Economics of Minorities

    Science.gov (United States)

    Coles, Flournoy A., Jr.

    1973-01-01

    This article discusses some of the more important economic problems of minorities in the United States, identifying the economics of minorities with the economics of poverty, discrimination, exploitation, urban life, and alienation. (JM)

  6. Minorities and majorities

    NARCIS (Netherlands)

    Nijman, J.E.; Fassbender, B.; Peters, A.

    2012-01-01

    This chapter discusses the paradox of minorities as a constitutive Other of international law. While minorities have been viewed as outside the international legal system for centuries, minorities have at the same time made a significant and fundamental contribution to precisely that system, as they

  7. Laser melting of groove defect repair on high thermal conductivity steel (HTCS-150)

    Science.gov (United States)

    Norhafzan, B.; Aqida, S. N.; Fazliana, F.; Reza, M. S.; Ismail, I.; Khairil, C. M.

    2018-02-01

    This paper presents laser melting repair of groove defect on HTCS-150 surface using Nd:YAG laser system. Laser melting process was conducted using JK300HPS Nd:YAG twin lamp laser source with 1064 nm wavelength and pulsed mode. The parameters are pulse repetition frequency (PRF) that is set from 70 to 100 Hz, average power ( P A) of 50-70 W, and laser spot size of 0.7 mm. HTCS-150 samples were prepared with groove dimension of 0.3 mm width and depths of 0.5 mm using EDM wire cut. Groove defect repaired using laser melting process on groove surface area with various parameters' process. The melted surface within the groove was characterized for subsurface hardness profile, roughness, phase identification, chemical composition, and metallographic study. The roughness analysis indicates high PRF at large spot size caused high surface roughness and low surface hardness. Grain refinement of repaired layer was analyzed within the groove as a result of rapid heating and cooling. The hardness properties of modified HTCS inside the groove and the bulk surface increased two times from as received HTCS due to grain refinement which is in agreement with Hall-Petch equation. These findings are significant to parameter design of die repair for optimum surface integrity and potential for repairing crack depth and width of less than 0.5 and 0.3 mm, respectively.

  8. Effect of groove on socket welds under the condition of vibration fatigue

    International Nuclear Information System (INIS)

    Xiu, Junjie; Jing, Hongyang; Han, Yongdian; Zhao, Lei; Xu, Lianyong

    2013-01-01

    Root failures of socket welds in small bore piping caused by vibration mainly occur at nuclear power plants (NPPs). It was observed that at higher stress level failures tended to originate at the toe while for the case of lower stress failures tended to occur at the root. The groove can increase the penetration depth (PD) of root, which is beneficial to the fatigue life. The effect of groove was also investigated by finite element method (FEM). The simulation results show that groove can decline the stress distribution, stress triaxiality and maximum principal plastic strain in the weld root, and the 5 mm groove suffering σ max (the highest stress of root failure) is almost same as no groove subjecting to σ f (fatigue limit). The test results show that the socket weld with groove can increase the natural frequency and damping of specimen, which make the system more difficult to vibrate. Moreover, the groove can also improve the fatigue property of specimen which do not exist the root failure even under high cycle fatigue (HCF)

  9. The MLC tongue-and-groove effect on IMRT dose distributions

    Energy Technology Data Exchange (ETDEWEB)

    Deng Jun [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, CA 94305 (United States). E-mail: jun@reyes.stanford.edu; Pawlicki, Todd; Chen Yan; Li Jinsheng; Jiang, Steve B.; Ma, C.-M. [Department of Radiation Oncology, Stanford University School of Medicine, Stanford, CA 94305 (United States)

    2001-04-01

    We have investigated the tongue-and-groove effect on the IMRT dose distributions for a Varian MLC. We have compared the dose distributions calculated using the intensity maps with and without the tongue-and-groove effect. Our results showed that, for one intensity-modulated treatment field, the maximum tongue-and-groove effect could be up to 10% of the maximum dose in the dose distributions. For an IMRT treatment with multiple gantry angles ({>=} 5), the difference between the dose distributions with and without the tongue-and-groove effect was hardly visible, less than 1.6% for the two typical clinical cases studied. After considering the patient setup errors, the dose distributions were smoothed with reduced and insignificant differences between plans with and without the tongue-and-groove effect. Therefore, for a multiple-field IMRT plan ({>=} 5), the tongue-and-groove effect on the IMRT dose distributions will be generally clinically insignificant due to the smearing effect of individual fields. The tongue-and-groove effect on an IMRT plan with small number of fields (<5) will vary depending on the number of fields in a plan (coplanar or non-coplanar), the MLC leaf sequences and the patient setup uncertainty, and may be significant (>5% of maximum dose) in some cases, especially when the patient setup uncertainty is small ({<=} 2 mm). (author)

  10. The effect of expert performance microtiming on listeners’ experience of groove in swing or funk music

    Directory of Open Access Journals (Sweden)

    Olivier Senn

    2016-10-01

    Full Text Available This study tested the influence of expert performance microtiming on listeners' groove experience. Two professional rhythm section (bass/drums performances in swing and funk style were recorded, and the performances' original microtemporal deviations from a regular metronomic grid were scaled to several magnitude levels. Music expert (n=79 and non-expert (n=81 listeners rated the groove qualities of stimuli using a newly developed questionnaire that measures three dimensions of the groove experience (Entrainment, Enjoyment, and the absence of Irritation. Findings show that music expert listeners were more sensitive to microtiming manipulations than non-experts. Across both expertise groups and for both styles, groove ratings were high for microtiming magnitudes equal or smaller than those originally performed and decreased for exaggerated microtiming magnitudes. In particular, both the fully quantized music and the music with the originally performed microtiming pattern were rated equally high on groove. This means that neither the claims of PD theory (that microtiming deviations are necessary for groove nor the opposing exactitude hypothesis (that microtiming deviations are detrimental to groove were supported by the data.

  11. Microcirculation within Grooved Substrates regulates Cell Positioning and Cell Docking inside Microfluidic Channels

    Science.gov (United States)

    Manbachi, Amir; Shrivastava, Shamit; Cioffi, Margherita; Chung, Bong Geun; Moretti, Matteo; Demirci, Utkan; Yliperttula, Marjo; Khademhosseini, Ali

    2009-01-01

    Immobilization of cells inside microfluidic devices is a promising approach for enabling studies related to drug screening and cell biology. Despite extensive studies in using grooved substrates for immobilizing cells inside channels, a systematic study of the effects of various parameters that influence cell docking and retention within grooved substrates has not been performed. We demonstrate using computational simulations that the fluid dynamic environment within microgrooves significantly varies with groove width, generating micro-circulation areas in smaller microgrooves. Wall shear stress simulation predicted that shear stresses were in opposite direction in smaller grooves (25 and 50 μm wide) in comparison to those in wider grooves (75 and 100 μm wide). To validate the simulations, cells were seeded within microfluidic devices, where microgrooves of different widths were aligned perpendicularly to the direction of the flow. Experimental results showed that, as predicted, the inversion of the local direction of shear stress within the smaller grooves resulted in alignment of cells on two opposite sides of the grooves under the same flow conditions. Also, the amplitude of shear stress within microgrooved channels significantly influenced cell retainment in the channels. Therefore, our studies suggest that microscale shear stresses greatly influence cellular docking, immobilization, and retention in fluidic systems and should be considered for the design of cell-based microdevices. PMID:18432345

  12. A stereological approach for measuring the groove angles of intergranular corrosion

    International Nuclear Information System (INIS)

    Gwinner, B.; Borgard, J.-M.; Dumonteil, E.; Zoia, A.

    2017-01-01

    Highlights: • The ICG morphology has been characterized in 3D by X-ray μ-tomography. • The measurement of the angles of the IGC groove on 2D cross sections induces a bias. • A methodology is proposed to estimate the true value of the IGC groove angles in 3D. - Abstract: Non-sensitized austenitic stainless steels can be prone to intergranular corrosion when they are in contact with an oxidizing medium like nitric acid. Intergranular corrosion is characterized by the formation of grooves along the grain boundaries. The angle of these grooves is a key parameter, which directly informs of the intergranular corrosion kinetics. Most of the time, the angles of the grooves are experimentally measured on 2-dimensional cross sections of the corroded samples. This study discusses the relationship between the groove angle measured on 2-dimensional sections and the true groove angle in 3-dimensional space. This approach could also be easily extended to the study of crack angle in the domains of corrosion-fatigue, stress corrosion cracking or mechanical fracture.

  13. DNA binding studies of tartrazine food additive.

    Science.gov (United States)

    Kashanian, Soheila; Zeidali, Sahar Heidary

    2011-07-01

    The interaction of native calf thymus DNA with tartrazine in 10 mM Tris-HCl aqueous solution at neutral pH 7.4 was investigated. Tartrazine is a nitrous derivative and may cause allergic reactions, with a potential of toxicological risk. Also, tartrazine induces oxidative stress and DNA damage. Its DNA binding properties were studied by UV-vis and circular dichroism spectra, competitive binding with Hoechst 33258, and viscosity measurements. Tartrazine molecules bind to DNA via groove mode as illustrated by hyperchromism in the UV absorption band of tartrazine, decrease in Hoechst-DNA solution fluorescence, unchanged viscosity of DNA, and conformational changes such as conversion from B-like to C-like in the circular dichroism spectra of DNA. The binding constants (K(b)) of DNA with tartrazine were calculated at different temperatures. Enthalpy and entropy changes were calculated to be +37 and +213 kJ mol(-1), respectively, according to the Van't Hoff equation, which indicated that the reaction is predominantly entropically driven. Also, tartrazine does not cleave plasmid DNA. Tartrazine interacts with calf thymus DNA via a groove interaction mode with an intrinsic binding constant of 3.75 × 10(4) M(-1).

  14. Investigation of enhanced condensation heat transfer outside vertical titanium circularly-grooved tube

    International Nuclear Information System (INIS)

    Zhaorigetu; Huang Weitang; Lv Xiangbo; Liu Feng

    2005-01-01

    The investigation of enhanced condensation heat transfer had been conducted on the outside vertical Titanium circularly-grooved tube. The experimental result indicates that the Titanium circularly-grooved tube is fairly efficient in enhancing the heat transfer. Within the experimental scope, the total heat transfer coefficient of the optimum circularly-grooved tube is 1.12 to 1.36 times of that of the Titanium smooth tube. Through regression analysis on the experimental data, the experimental correlations for the inside heat transfer coefficient, the condensation heat transfer coefficient on film condensation and the friction coefficient were achieved. (authors)

  15. Unusual stress fracture in an adolescent baseball pitcher affecting the trochlear groove of the olecranon

    International Nuclear Information System (INIS)

    Blake, Joseph J.; Block, John J.; Kan, J.H.; Hannah, Gene A.

    2008-01-01

    Stress fractures of the proximal ulna are known to occur in throwing athletes. Most cases extend to involve the olecranon, and cases limited to the trochlear groove are rare. In this report we present a 17-year-old elite baseball pitcher with a stress fracture of the trochlear groove of the proximal ulna. Diagnosis was made by demonstration of characteristic signal changes on MRI of the elbow. The fracture occurred at the cortical notch, also known as the pseudodefect of the trochlear groove. This case suggests that the cortical notch serves as an area of weakness predisposing pitchers to development of a stress fracture. (orig.)

  16. Mathematical modeling of photovoltaic thermal PV/T system with v-groove collector

    Science.gov (United States)

    Zohri, M.; Fudholi, A.; Ruslan, M. H.; Sopian, K.

    2017-07-01

    The use of v-groove in solar collector has a higher thermal efficiency in references. Dropping the working heat of photovoltaic panel was able to raise the electrical efficiency performance. Electrical and thermal efficiency were produced by photovoltaic thermal (PV/T) system concurrently. Mathematical modeling based on steady-state thermal analysis of PV/T system with v-groove was conducted. With matrix inversion method, the energy balance equations are explained by means of the investigative method. The comparison results show that in the PV/T system with the V-groove collector is higher temperature, thermal and electrical efficiency than other collectors.

  17. An NMR study of the covalent and noncovalent interactions of CC-1065 and DNA

    International Nuclear Information System (INIS)

    Scahill, T.A.; Jensen, R.M.; Swenson, D.H.; Hatzenbuhler, N.T.; Petzold, G.; Wierenga, W.; Brahme, N.D.

    1990-01-01

    The binding of the antitumor drug CC-1065 has been studied with nuclear magnetic resonance (NMR) spectroscopy. This study involves two parts, the elucidation of the covalent binding site of the drug to DNA and a detailed investigation of the noncovalent interactions of CC-1065 with a DNA fragment through analysis of 2D NOE (NOESY) experiments. A CC-1065-DNA adduct was prepared, and an adenine adduct was released upon heating. NMR ( 1 H and 13 C) analysis of the adduct shows that the drug binds to N3 of adenine by reaction of its cyclopropyl group. The reaction pathway and product formed were determined by analysis of the 13 C DEPT spectra. An octamer duplex, d(CGATTAGC·GCTAATCG), was synthesized and used in the interaction study of CC-1065 and the oligomer. The duplex and the drug-octamer complex were both analyzed by 2D spectroscopy (COSY, NOESY). The relative intensity of the NOEs observed between the drug (CC-1065) and the octamer duplex shows conclusively that the drug is located in the minor groove, covalently attached to N3 of adenine 6 and positioned from the 3' → 5' end in relation to strand A [d(CGATTA 6 GC)]. A mechanism for drug binding and stabilization can be inferred from the NOE data and model-building studies

  18. Competitive binding affinity of two lanthanum(III) macrocycle complexes toward DNA and bovine serum albumin in water

    Energy Technology Data Exchange (ETDEWEB)

    Asadi, Zahra; Mosallaei, Hamta; Sedaghat, Moslem [Shiraz Univ. (Iran, Islamic Republic of). Dept. of Chemistry; Yousefi, Reza [Shiraz Univ. (Iran, Islamic Republic of). Protein Chemistry Lab. (PCL)

    2017-11-15

    In the present study, two water-soluble lanthanum(III) hexaaza Schiff base complexes were synthesized and characterized and also theoretically investigated. The interactions of these complexes with DNA and bovine serum albumin (BSA) were studied using different spectroscopic assessments and docking simulation analysis. The DNA docking studies suggested that these two complexes are able to interact with DNA through the minor groove, and also the binding affinity is in the order of La(L{sup 1}) > La(L{sup 2}). Furthermore, the spectral titration was carried out and viscosity measurements were taken. In this regard, protein-binding studies revealed that these complexes quench the intrinsic fluorescence of BSA, and indicated that the possible binding site is located on the vicinity of Trp 213, which is further validated by docking simulation analysis. The in vitro anticancer activities of these complexes indicated that the La(L{sup 1}) complex is more effective than the other one and also exhibits a better interaction with DNA.

  19. Free energy landscape and transition pathways from Watson–Crick to Hoogsteen base pairing in free duplex DNA

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-01-01

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116

  20. Free energy landscape and transition pathways from Watson-Crick to Hoogsteen base pairing in free duplex DNA.

    Science.gov (United States)

    Yang, Changwon; Kim, Eunae; Pak, Youngshang

    2015-09-18

    Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Determination of membrane disruption and genomic DNA binding of cinnamaldehyde to Escherichia coli by use of microbiological and spectroscopic techniques.

    Science.gov (United States)

    He, Tian-Fu; Zhang, Zhi-Hong; Zeng, Xin-An; Wang, Lang-Hong; Brennan, Charles S

    2018-01-01

    This work was aimed to investigate the antibacterial action of cinnamaldehyde (CIN) against Escherichia coli ATCC 8735 (E. coli) based on membrane fatty acid composition analysis, alterations of permeability and cell morphology as well as interaction with genomic DNA. Analysis of membrane fatty acids using gas chromatography-mass spectrometry (GC-MS) revealed that the proportion of unsaturated fatty acids (UFA) and saturated fatty acids (SFA) were the major fatty acids in plasmic membrane, and their levels were significantly changed after exposure of E. coli to CIN at low concentrations. For example, the proportion of UFA decreased from 39.97% to 20.98%, while the relative content of SFA increased from 50.14% to 67.80% as E. coli was grown in increasing concentrations of CIN (from 0 to 0.88mM). Scanning electron microscopy (SEM) showed that the morphology of E. coli cells to be wrinkled, distorted and even lysed after exposure to CIN, which therefore decreased the cell viability. The binding of CIN to genomic DNA was probed using fluorescence, UV-Visible absorption spectra, circular dichroism, molecular modeling and atomic force microscopy (AFM). Results indicated that CIN likely bound to the minor groove of genomic DNA, and changed the secondary structure and morphology of this biomacromolecule. Therefore, CIN can be deem as a kind of natural antimicrobial agents, which influence both cell membrane and genomic DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Crystal Structures of SlyA Protein, a Master Virulence Regulator of Salmonella, in Free and DNA-bound States

    Energy Technology Data Exchange (ETDEWEB)

    Dolan, Kyle T.; Duguid, Erica M.; He, Chuan (UC)

    2011-11-17

    SlyA is a master virulence regulator that controls the transcription of numerous genes in Salmonella enterica. We present here crystal structures of SlyA by itself and bound to a high-affinity DNA operator sequence in the slyA gene. SlyA interacts with DNA through direct recognition of a guanine base by Arg-65, as well as interactions between conserved Arg-86 and the minor groove and a large network of non-base-specific contacts with the sugar phosphate backbone. Our structures, together with an unpublished structure of SlyA bound to the small molecule effector salicylate (Protein Data Bank code 3DEU), reveal that, unlike many other MarR family proteins, SlyA dissociates from DNA without large conformational changes when bound to this effector. We propose that SlyA and other MarR global regulators rely more on indirect readout of DNA sequence to exert control over many genes, in contrast to proteins (such as OhrR) that recognize a single operator.

  3. Following the canyon to reach and remove olfactory groove meningiomas.

    Science.gov (United States)

    Stefini, Roberto; Zenga, Francesco; Giacomo, Esposito; Bolzoni, Andrea; Tartara, Fulvio; Spena, Giannantonio; Ambrosi, Claudia; Fontanella, Marco M

    2017-04-01

    Olfactory groove meningiomas (OGMs) represent approximately 10% of all intracranial meningiomas. They arise in the olfactory fossa, a variable depression delimited by the lateral lamella and perpendicular plate. The cribriform plate with the lateral lamella and ethmoidal and orbital roof could be viewed as a 'canyon' with the frontal sinus as the main entrance. Between January 2000 and December 2013, 32 consecutive patients underwent removal of OGMs through this 'canyon' at the Department of Neurosurgery of Brescia and Turin. Complete removal was achieved in all patients with this trans-frontal sinus subcranial approach (Simpson grade I; mean lesion volume, 46.6 cm3). Five patients (15.6%) experienced nasal CSF leakage, treated with external lumbar drain positioning for 4 days and resolved in all cases but one, which was re-operated. Two patients (6.2%) during the CSF leakage experienced meningitis at day 7 after surgery, both successfully treated by intravenous antibiotic therapy. After one month, one patient developed hydrocephalus, treated with a ventricular peritoneal shunt. In one patient, traction on the OGM caused bleeding of the callosomarginal artery, which was coagulated with superior frontal gyrus ischemia without neurological consequences. Glasgow Outcome Scale Score at 6 months was V in 29 patients, IV in one patient, and I in two patients. Advantages with this approach may include easy and early control of blood supply from its insertion in the skull base, minimal frontal lobe retraction, preservation of the frontal veins draining to the sagittal sinus, and a satisfactory aesthetic outcome.

  4. Traction suture modification to tongue-in-groove caudal septoplasty.

    Science.gov (United States)

    Indeyeva, Y A; Lee, T S; Gordin, E; Chan, D; Ducic, Y

    2018-02-01

    Caudal septal deviation leads to unfavorable esthetic as well as functional effects on the nasal airway. A modification to the tongue-in-groove (TIG) technique to correct these caudal septal deformities is described. With placement of a temporary suspension suture to the caudal septum, manual traction is applied, assuring that the caudal septum remains in the midline position while it is being secured with multiple through-and-through, trans-columellar and trans-septal sutures. From 2003 to 2016, 148 patients underwent endonasal septoplasty using this modified technique, with excellent functional and cosmetic outcomes and a revision rate of 1.4%. This modified TIG technique replaces the periosteal suture that secures the caudal septum to the midline nasal crest in the original TIG technique. This simplifies the procedure and minimizes the risk of securing the caudal septum off-midline when used in endonasal septoplasty. Copyright © 2017 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.

  5. Condensation and evaporation transitions in deep capillary grooves

    International Nuclear Information System (INIS)

    Malijevský, Alexandr; Parry, Andrew O

    2014-01-01

    We study the order of capillary condensation and evaporation transitions of a simple fluid adsorbed in a deep capillary groove using a fundamental measure density functional theory (DFT). The walls of the capillary interact with the fluid particles via long-ranged, dispersion, forces while the fluid-fluid interaction is modelled as a truncated Lennard–Jones-like potential. We find that below the wetting temperature T w condensation is first-order and evaporation is continuous with the metastability of the condensation being well described by the complementary Kelvin equation. In contrast above T w both phase transitions are continuous and their critical singularities are determined. In addition we show that for the evaporation transition above T w there is an elegant mapping, or covariance, with the complete wetting transition occurring at a planar wall. Our numerical DFT studies are complemented by analytical slab model calculations which explain how the asymmetry between condensation and evaporation arises out of the combination of long-ranged forces and substrate geometry. (paper)

  6. Condensation and evaporation transitions in deep capillary grooves.

    Science.gov (United States)

    Malijevský, Alexandr; Parry, Andrew O

    2014-09-03

    We study the order of capillary condensation and evaporation transitions of a simple fluid adsorbed in a deep capillary groove using a fundamental measure density functional theory (DFT). The walls of the capillary interact with the fluid particles via long-ranged, dispersion, forces while the fluid-fluid interaction is modelled as a truncated Lennard-Jones-like potential. We find that below the wetting temperature Tw condensation is first-order and evaporation is continuous with the metastability of the condensation being well described by the complementary Kelvin equation. In contrast above Tw both phase transitions are continuous and their critical singularities are determined. In addition we show that for the evaporation transition above Tw there is an elegant mapping, or covariance, with the complete wetting transition occurring at a planar wall. Our numerical DFT studies are complemented by analytical slab model calculations which explain how the asymmetry between condensation and evaporation arises out of the combination of long-ranged forces and substrate geometry.

  7. Characterisation of a grooved heat pipe with an anodised surface

    Science.gov (United States)

    Solomon, A. Brusly; Ram Kumar, A. M.; Ramachandran, K.; Pillai, B. C.; Senthil Kumar, C.; Sharifpur, Mohsen; Meyer, Josua P.

    2017-03-01

    A grooved heat pipe (GHP) is an important device for managing heat in space applications such as satellites and space stations, as it works efficiently in the absence of gravity. Apart from the above application, axial GHPs are used in many applications, such as electronic cooling units for temperature control and permafrost cooling. Improving the performance of GHPs is essential for better cooling and thermal management. In the present study, the effect of anodization on the heat transfer characteristics of a GHP is studied with R600a as a working fluid. In addition, the effects of fill ratio, inclination angle and heat inputs on the heat transfer performance of a GHP are studied. Furthermore, the effect of heat flux on dimensional numbers, such as the Webber, Bond, Kutateladze and condensation numbers, are studied. The inclination angle, heat input and fill ratio of GHPs are varied in the range of 0°-90°, 25-250 W and 10-70 % respectively. It is found that the above parameters have a significant effect on the performance of a GHP. Due to the anodisation, the maximum enhancement in heat transfer coefficient at the evaporator is 39 % for a 90° inclination at a heat flux of 11 kW/m2. The reported performance enhancement of a GHP may be due to the large numbers of nucleation sites created by the anodisation process and enhancement in the capillary force due to the coating.

  8. Induction of heat-labile sites in DNA of mammalian cells by the antitumor alkylating drug CC-1065

    International Nuclear Information System (INIS)

    Zsido, T.J.; Woynarowski, J.M.; Baker, R.M.; Gawron, L.S.; Beerman, T.A.

    1991-01-01

    CC-1065 is a very potent antitumor antibiotic capable of covalent and noncovalent binding to the minor groove of naked DNA. Upon thermal treatment, covalent adducts formed between CC-1065 and DNA generate strand break. The authors have shown that this molecular damage can be detected following CC-1065 treatment of mammalian whole cells. Using alkaline sucrose gradient analysis, They observe thermally induced breakage of [ 14 C]thymidine-prelabeled DNA from drug-treated African green monkey kidney BSC-1 cells. Very little damage to cellular DNA by CC-1065 can be detected without first heating the drug-treated samples. CC-1065 can also generate heat-labile sites within DNA during cell lysis and heating, subsequent to the exposure of cells to drug, suggesting that a pool of free and noncovalently bound drug is available for posttreatment adduct formation. This effect was controlled for by mixing [ 3 H]thymidine-labeled untreated cells with the [ 14 C]thymidine-labeled drug-treated samples. The lowest drug dose at which heat-labile sites were detected was 3 nM CC-1065 (3 single-stranded breaks/10 6 base pairs). This concentration reduced survival of BSC-1 cells to 0.1% in cytotoxicity assays. The generation of CC-1065-induced lesions in cellular DNA is time dependent (the frequency of lesions caused by a 60 nM treatment reaching a plateau at 2 h) and is not readily reversible. The results of this study demonstrate that CC-1065 does generate heat-labile sites with the cellular DNA of intact cells and suggest that a mechanism of cytotoxic action of CC-1065 involves formation of covalent adducts to DNA

  9. Nuclear blebbing of biologically active organoselenium compound towards human cervical cancer cell (HeLa): in vitro DNA/HSA binding, cleavage and cell imaging studies.

    Science.gov (United States)

    Rizvi, Masood Ahmad; Zaki, Mehvash; Afzal, Mohd; Mane, Manoj; Kumar, Manjeet; Shah, Bhahwal Ali; Srivastav, Saurabh; Srikrishna, Saripella; Peerzada, Ghulam Mustafa; Tabassum, Sartaj

    2015-01-27

    New pharmacophore organoselenium compound (1) was designed, synthesized and characterized by various spectroscopic methods (IR, ESI-MS, (1)H, (13)C and (77)Se NMR) and further confirmed by X-ray crystallography. Compound 1 consists of two 3,5-bis(trifluoromethyl)phenyl units which are connected to the selenium atom via the organometallic C-Se bond. In vitro DNA binding studies of 1 was investigated by absorption and emission titration methods which revealed that 1 recognizes the minor groove of DNA in accordance with molecular docking studies with the DNA duplex. Gel electrophoretic assay demonstrates the ability of 1 to cleave pBR322 DNA through hydrolytic process which was further validated by T4 religation assay. To understand the drug-protein interaction of which ultimate molecular target was DNA, the affinity of 1 towards HSA was also investigated by the spectroscopic and molecular modeling techniques which showed hydrophobic interaction in the subdomain IIA of HSA. Furthermore, the intracellular localization of 1 was evidenced by cell imaging studies using HeLa cells. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  10. Palatal radicular groove: Clinical implications of early diagnosis and surgical sealing

    Directory of Open Access Journals (Sweden)

    P Corrêa-Faria

    2011-01-01

    Full Text Available Palatal radicular groove is a discreet alteration in tooth morphology, characterized by an invagination that begins near the cingulum of the tooth and moves in an apical direction. Clinically, palatal radicular groove may be associated with periodontal and/or endodontic problems. This paper describes a clinical case of a young patient with palatal radicular groove with no signs of periodontal disease or endodontic impairment. An early diagnosis was made and treatment consisted of surgical sealing of the defect. After a 2-year period, reexaminations demonstrated adequate hygiene, maintenance of tooth vitality and periodontal health. The early diagnosis and sealing of the groove observed surgically made the root surface smooth, avoiding subgingival bacterial plaque buildup, and preventing possible periodontal and/or pulp impairment stemming from the defect.

  11. Tunable THz notch filter with a single groove inside parallel-plate waveguides.

    Science.gov (United States)

    Lee, Eui Su; Jeon, Tae-In

    2012-12-31

    A single groove in a parallel-plate waveguide (PPWG) has been applied to a tunable terahertz (THz) notch filter with a transverse-electromagnetic (TEM) mode. When the air gap between the metal plates of the PPWG is controlled from 60 to 240 μm using a motor controlled translation stage or a piezo-actuator, the resonant frequency of the notch filter is changed from 1.75 up to 0.62 THz, respectively. Therefore, the measured tunable sensitivity of the notch filter increases to 6.28 GHz/μm. The measured resonant frequencies were found to be in good agreement with the calculation using an effective groove depth. Using a finite-difference time-domain (FDTD) simulation, we also demonstrate that the sensitivity of a THz microfluidic sensor can be increased via a small air gap, a narrow groove width, and a deep groove depth.

  12. Grooving of grain boundaries in multicrystalline silicon: Effect on solar cell performance

    International Nuclear Information System (INIS)

    Dimassi, W.; Bouaicha, M.; Nouri, H.; Boujmil, M.F.; Ben Nasrallah, S.; Bessais, B.

    2006-01-01

    In this work, we investigate the effect of grooving of grain boundaries (GB) in multicrystalline silicon using chemical etching in HF/HNO 3 solutions. The grain boundaries were grooved in order to reduce the area of these highly recombining regions. Using optimized conditions, grooved GBs enable deep phosphorus diffusion and deep metallic contacts. As a result, the internal quantum efficiency (IQE), and the I-V characteristics under the dark and AM1.5 illumination were improved. It was also observed a reduction of the GB recombination velocity, which was deduced from light-beam-induced-current (LBIC) measurements. Such grooving in multicrystalline silicon enables passivation of GB-related defects. These results are discussed and compared to solar cells based on untreated multicrystalline silicon wafers

  13. Groove Pancreatitis with Biliary and Duodenal Stricture: An Unusual Cause of Obstructive Jaundice

    Directory of Open Access Journals (Sweden)

    Marta Gravito-Soares

    2016-05-01

    Discussion: Groove pancreatitis is a benign cause of obstructive jaundice, whose main differential diagnosis is duodenal or pancreatic neoplasia. When this condition causes duodenal or biliary stricture, surgical treatment can be necessary.

  14. Effectiveness of noise barriers installed adjacent to transverse grooved concrete pavement : executive summary report.

    Science.gov (United States)

    2009-10-16

    In recent years the Ohio Department of Transportation (ODOT) has reconstructed a number of roadways where asphalt pavements were replaced with concrete pavements which were finished with a random transverse grooved surface texture (ODOT specification...

  15. Standardized performance tests of collectors of solar thermal energy: Prototype moderately concentrating grooved collectors

    Science.gov (United States)

    1976-01-01

    Prototypes of moderately concentrating grooved collectors were tested with a solar simulator for varying inlet temperature, flux level, and incident angle. Collector performance is correlated in terms of inlet temperature and flux level.

  16. 'Tongue-and-groove' effect in intensity modulated radiotherapy with static multileaf collimator fields

    International Nuclear Information System (INIS)

    Que, W; Kung, J; Dai, J

    2004-01-01

    The 'tongue-and-groove problem' in step-and-shoot delivery of intensity modulated radiotherapy is investigated. A 'tongue-and-groove' index (TGI) is introduced to quantify the 'tongue-and-groove' effect in step-and-shoot delivery. Four different types of leaf sequencing methods are compared. The sliding window method and the reducing level method use the same number of field segments to deliver the same intensity map, but the TGI is much less for the reducing level method. The leaf synchronization method of Van Santvoort and Heijmen fails in step-and-shoot delivery, but a new method inspired by the method of Van Santvoort and Heijmen is shown to eliminate 'tongue-and-groove' underdosage completely

  17. U-shaped micro-groove fiber based on femtosecond laser processing for humidity sensing

    Science.gov (United States)

    Fu, Gui; Ma, Li-li; Su, Fu-fang; Shi, Meng

    2018-05-01

    A novel optical fiber sensor with a U-shaped micro-groove structure ablated by femtosecond laser on single-mode fiber for measuring air relative humidity (RH) is reported in this paper. In order to improve the accuracy of sensor, a graphene oxide (GO)/polyvinyl alcohol (PVA) composite film is coated on the surface of micro-groove structure. In the U-shaped micro-groove structure, the remaining core and micro-cavity in the micro-groove make up two major optical propagation paths, forming a Mach-Zehnder interferometer (MZI). The sensor has a good linear response within the RH range of 30%—85%, and the maximum sensitivity can reach 0.638 1 nm/%RH. The effect of temperature on the overall performance of the humidity sensor is also investigated. As a new type of all-fiber device, the sensor shows excellent sensitivity and stability.

  18. Determinig the Shape Coefficient A of Groove on the Pen for the Shaft

    Science.gov (United States)

    Křístek, Ivo; Havlík, Jiří; Mosler, Václav; Daniš, Igor

    2017-12-01

    This article focuses on creating a diagram for determining the shape coefficient α for a tongue groove on the shaft. Experimental determination of curve diagrams by comparing diagrams and monograms used using FEM calculations.

  19. Large eddy simulation of the subcritical flow over a V grooved circular cylinder

    International Nuclear Information System (INIS)

    Alonzo-García, A.; Gutiérrez-Torres, C. del C.; Jiménez-Bernal, J.A.

    2015-01-01

    Highlights: • We compared numerically the turbulent flow over a smooth circular cylinder and a V grooved cylinder in the subcritical regime. • Turbulence intensities in both streamwise and normal direction suffered attenuations. • The swirls structures on grooves peaks seemed to have a cyclic behavior. • The evolution of the flow inside grooves showed that swirls structures located in peaks suffered elongations in the normal direction. • The secondary vortex structures formed in the grooved cylinder near wake were smaller in comparison of the smooth cylinder flow. - Abstract: In this paper, a comparative numerical study of the subcritical flow over a smooth cylinder and a cylinder with V grooves (Re = 140,000) is presented. The implemented technique was the Large Eddy Simulation (LES), which according to Kolmogorov's theory, resolves directly the most energetic largest eddies and models the smallest and considered universal high frequency ones. The Navier-Stokes (N-S) equations were solved using the commercial software ANSYS FLUENT V.12.1, which applied the finite volume method (FVM) to discretize these equations in their unsteady and incompressible forms. The grid densities were 2.6 million cells and 13.5 million cells for the smooth and V grooved cylinder, respectively. Both meshes were composed of structured hexahedral cells and close to the wall of the cylinders, additional refinements were employed in order to obtain y +<5 values. All cases were simulated during at least 15 vortex shedding cycles with the aim of obtaining significant statistical data. Results: showed that for both cases (smooth and V grooved cylinder flow), the numerical code was capable of reproducing the most important physical quantities of the subcritical regime. Velocity distribution and turbulence intensity in the flow direction suffered a slight attenuation along the wake, as a consequence of grooves perturbation, which also caused an increase in the pressure coefficient

  20. Schwann cell interactions with polymer films are affected by groove geometry and film hydrophilicity

    International Nuclear Information System (INIS)

    Mobasseri, S A; Downes, S; Terenghi, G

    2014-01-01

    We have developed a biodegradable polymer scaffold made of a polycaprolactone/polylactic acid (PCL/PLA) film. Surface properties such as topography and chemistry have a vital influence on cell–material interactions. Surface modifications of PCL/PLA films were performed using topographical cues and UV–ozone treatment to improve Schwann cell organisation and behaviour. Schwann cell attachment, alignment and proliferation were evaluated on the grooved UV–ozone treated and non-treated films. Solvent casting of the polymer solution on patterned silicon substrates resulted in films with different groove shapes: V (V), sloped (SL) and square (SQ) shapes. Pitted films, with no grooves, were prepared as a negative control. The UV–ozone treatment was performed to increase hydrophilicity. The process specifications for UV–ozone treatment were evaluated and 5 min radiation time and 6 cm distance to the UV source were suggested as the optimal practise. When cultured on grooved films, Schwann cells elongated on the V and SL shape grooves without crossing over, and grew in the direction of the grooves. However, there was less elongation with more crossing over on the SQ shape grooves. The maximum cell length (511 μm) was observed on the treated V-grooved films. The cells cultured on pitted UV–ozone treated surfaces showed random arrangements with no increase in length. We have demonstrated that the synergic effects of physical cues combined with UV–ozone treatment have the potential to enhance Schwann cell morphology and alignment. (paper)

  1. Management of endodontic-periodontic lesion of a maxillary lateral incisor with palatoradicular groove

    OpenAIRE

    Jayshree Ramakrishna Vishwas; Shoeb Yakub Shaikh; Varsha H. Tambe; Fareedi Mukram Ali; Mohammed Mustafa

    2014-01-01

    Presence of palatal radicular grooves are considered to be an important contributing factor to the development of localized periodontitis, as it favored the accumulation and proliferation of bacterial plaque deep into the periodontium. Pulp involvement could result due to the introduction of bacterial toxins through channels that existed between the root canal system and the groove. Early diagnosis, elimination of inflammation and correction of anatomic complications are the key to a favorabl...

  2. Optimal Tempo for Groove: Its Relation to Directions of Body Movement and Japanese nori.

    Science.gov (United States)

    Etani, Takahide; Marui, Atsushi; Kawase, Satoshi; Keller, Peter E

    2018-01-01

    The tendency for groove-based music to induce body movements has been linked to multiple acoustical factors. However, it is unclear how or whether tempo affects groove, although tempo significantly affects other aspects of music perception. To address this issue, the present study investigated effects of tempo, specific rhythmic organizations of patterns, and syncopation on groove and the induction of the sensation of wanting to move. We focused on the directions of body movement in particular by taking into account nori , which is an indigenous Japanese musical term used not only synonymously with groove, but also as a spatial metaphor indicating vertical or horizontal movement directions. Thus, the present study explored how groove was felt and defined, as well as how musical factors induced the sensation of wanting to move in cross-cultural context. A listening experiment was conducted using drum breaks as stimuli. Stimuli consisted of various rhythm patterns at six tempi from 60 to 200 BPM. The main findings are that: (1) an optimal tempo for groove existed for drum breaks at around 100-120 BPM, (2) an optimal tempo existed for the sensation of wanting to move the body in specific directions (i.e., back-and-forth and side-to-side), (3) groove and nori shared a similar concept of wanting to move but differed on several points (i.e., association with sense of pulse and fast tempo). Overall, the present study suggests that there is an optimal tempo for body movement related to groove. This finding has implications for the use of music or rhythmic stimuli to induce smooth motion in rehabilitation, therapy, or dance.

  3. Effect of heat treatment on the grooving corrosion resistance of ERW pipes

    International Nuclear Information System (INIS)

    Lee, Jong Kwon; Lee, Jae Young; Lim, Soo Hyun; Park, Ji Hwan; Seo, Bo Min; Kim, Seon Hwa

    2002-01-01

    The v-sharp grooving corrosion of ERW(electrical resistance welding) steel pipes limited their wide application in the industry in spite of their high productivity and efficiency. The grooving corrosion is caused mainly by the different microstructures between the matrix and weld that is formed during the rapid heating and cooling cycle in welding. By this localized corrosion reaction of pipes, it evolves economic problems such as the early damage of industrial facilities and pipe lines of apartment, and water pollution. Even though the diminishing of sulfur content is most effective to decrease the susceptibility of grooving corrosion, it requires costly process. In this study, improvement of grooving corrosion resistance was pursuited by post weld heat treatment in the temperature range between 650 .deg. C and 950 .deg. C. Also, the effect of heat input in the welding was investigated. By employing chromnoamperometry and potentiodynamic experiment, the corrosion rate and grooving corrosion index(α) were obtained. It was found that heat treatment could improve the grooving corrosion resistance. Among them, the heat treated at 900 .deg. C and 950 .deg. C had excellent grooving corrosion resistance. The index of heat treated specimen at 900 .deg. C and 950 .deg. C were 1.0, 1.2, respectively, which are almost immune to the grooving corrosion. Potential difference after the heat treatment, between base and weld metal was decreased considerably. While the as-received one measured 61∼71 mV, that of the 900 .deg. C heat treated steel pipe measured only 10mV. The results were explained and discussed

  4. Optimal Tempo for Groove: Its Relation to Directions of Body Movement and Japanese nori

    Directory of Open Access Journals (Sweden)

    Takahide Etani

    2018-04-01

    Full Text Available The tendency for groove-based music to induce body movements has been linked to multiple acoustical factors. However, it is unclear how or whether tempo affects groove, although tempo significantly affects other aspects of music perception. To address this issue, the present study investigated effects of tempo, specific rhythmic organizations of patterns, and syncopation on groove and the induction of the sensation of wanting to move. We focused on the directions of body movement in particular by taking into account nori, which is an indigenous Japanese musical term used not only synonymously with groove, but also as a spatial metaphor indicating vertical or horizontal movement directions. Thus, the present study explored how groove was felt and defined, as well as how musical factors induced the sensation of wanting to move in cross-cultural context. A listening experiment was conducted using drum breaks as stimuli. Stimuli consisted of various rhythm patterns at six tempi from 60 to 200 BPM. The main findings are that: (1 an optimal tempo for groove existed for drum breaks at around 100–120 BPM, (2 an optimal tempo existed for the sensation of wanting to move the body in specific directions (i.e., back-and-forth and side-to-side, (3 groove and nori shared a similar concept of wanting to move but differed on several points (i.e., association with sense of pulse and fast tempo. Overall, the present study suggests that there is an optimal tempo for body movement related to groove. This finding has implications for the use of music or rhythmic stimuli to induce smooth motion in rehabilitation, therapy, or dance.

  5. Recognition and repair of the CC-1065-(N3-Adenine)-DNA adduct by the UVRABC nuclease

    International Nuclear Information System (INIS)

    Tang, M.; Lee, C.S.; Doisy, R.; Ross, L.; Needham-VanDevanter, D.R.; Hurley, L.H.

    1988-01-01

    The recognition and repair of the helix-stabilizing and relatively nondistortive CC-1065-(N3-adenine)-DNA adduct by UVRABC nuclease has been investigated both in vivo with phi X174RFI DNA by a transfection assay and in vitro by a site-directed adduct in a 117 base pair fragment from M13mp1. CC-1065 is a potent antitumor antibiotic produced by Streptomyces zelensis which binds within the minor groove of DNA through N3 of adenine. In contrast to the helix-destabilizing and distortive modifications of DNA caused by ultraviolet light or N-acetoxy-2-(acetylamino)fluorene, CC-1065 increases the melting point of DNA and decreases the S1 nuclease activity. Using a viral DNA-Escherichia coli transfection system, the authors have found that the uvrA, uvrB, and uvrC genes, which code for the major excision repair proteins for UV- and NAAAF-induced DNA damage, are also involved in the repair of CC-1065-DNA adducts. In contrast, the uvrD gene product, which has been found to be involved in the repair of UV damage, has no effect in repairing CC-1065-DNA adducts. Purified UVRA, UVRB, and UVRC proteins must work in concert to incise the drug-modified phi X174RFI DNA. Using a site-directed and multiple CC-1065 modified (MspI-BstNI) 117 base pair fragment from M13mp1, they have found that UVRABC nuclease incises at the eight phosphodiester bond on the 5' side of the CC-1065-DNA adduct on the drug-modified strand. The enzymes do not cut the noncovalently modified strand. The DNA sequence and/or helix-stabilizing effect of multiple adducts may determine the recognition and/or incision of the drug-DNA adduct by UVRABC nuclease. These results are discussed in relation to the structure of the CC-1065-DNA adduct and the effect of drug binding on local DNA structure

  6. Synthesis and DNA-binding study of imidazole linked thiazolidinone derivatives.

    Science.gov (United States)

    War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi

    2017-02-01

    A novel series of imidazole-linked thiazolidinone hybrid molecules were designed and synthesized through a feasible synthetic protocol. The molecules were characterized with Fourier transform infrared (FT-IR), 1 H nuclear magnetic resonance (NMR), 13 C NMR and high-resolution mass spectrometry (HRMS) techniques. In vitro susceptibility tests against Gram-positive (S. aureus and B. subtilis) and Gram-negative bacteria (E. coli and P. aeruginosa) gave highly promising results. The most active molecule (3e) gave a minimal inhibitory concentration (MIC) value of 3.125 μg/mL which is on par with the reference drug streptomycin. Structure-activity relationships revealed activity enhancement by nitro and chloro groups when they occupied meta position of the arylidene ring in 2-((3-(imidazol-1-yl)propyl)amino)-5-benzylidenethiazolidin-4-ones. DNA-binding study of the most potent molecule 3e with salmon milt DNA (sm-DNA) under simulated physiological pH was probed with UV-visible absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. These studies established that compound 3e has a strong affinity towards DNA and binds at DNA minor groove with a binding constant (K b ) 0.18 × 10 2  L mol -1 . Molecular docking simulations predicted strong affinity of 3e towards DNA with a binding affinity (ΔG) -8.5 kcal/mol. Van der Waals forces, hydrogen bonding and hydrophobic interactions were predicted as the main forces of interaction. The molecule 3e exhibited specific affinity towards adenine-thiamine base pairs. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  7. Grooved surface topography alters matrix-metalloproteinase production by human fibroblasts

    International Nuclear Information System (INIS)

    Brydone, Alistair S; Dominic Meek, R M; Dalby, Matthew J; Berry, Catherine C; McNamara, Laura E

    2011-01-01

    Extracellular matrix (ECM) remodelling is an essential physiological process in which matrix-metalloproteinases (MMPs) have a key role. Manipulating the manner in which cells produce MMPs and ECMs may enable the creation of a desired tissue type, i.e. effect repair, or the prevention of tissue invasion (e.g. metastasis). The aim of this project was to determine if culturing fibroblasts on grooved topography altered collagen deposition or MMP production. Human fibroblasts were seeded on planar or grooved polycaprolactone substrates (grooves were 12.5 μm wide with varying depths of 240 nm, 540 nm or 2300 nm). Cell behaviour and collagen production were studied using fluorescence microscopy and the spent culture medium was assessed using gel zymography to detect MMPs. Total collagen deposition was high on the 240 nm deep grooves, but decreased as the groove depth increased, i.e. as cell contact guidance decreased. There was an increase in gelatinase on the 2300 nm deep grooved topography and there was a difference in the temporal expression of MMP-3 observed on the planar surface compared to the 540 nm and 2300 nm topographies. These results show that topography can alter collagen and MMP production. A fuller understanding of these processes may permit the design of surfaces tailored to tissue regeneration e.g. tendon repair.

  8. Cold test of deep groove plarizer for 170 GHz ECCD system

    International Nuclear Information System (INIS)

    Saigusa, M.; Ookouti, K.; Sazawa, S.; Yuasa, S.; Takei, N.; Takahashi, K.; Sakamoto, K.; Imai, T.

    2001-01-01

    The single deep groove mirror was proposed as a new concept polarizer instead of the conventional two mirror polarizers for producing ordinary (or extraordinary) wave with high mode purity at an arbitrary injection angle in electron cyclotron current drive (ECCD) experiments. The estimated mode purity of O and X waves on the plasma surface is expected to be higher than about 93% for reasonable ECCD experimental conditions. The three types of deep groove mirrors, which are the rectangular groove mirror and the non-rectangular one, are manufactured and tested at the frequency range from 140 GHz to 170 GHz and the power level of 30 mW. The groove parameters are the period of 0.9-1 mm, the ridge width of 0.45-0.5 mm, and the groove depth of 1.98 mm, which is deeper than a wavelength at 170 GHz. The measured results of deep groove polarizers agree with the theoretical predictions, qualitatively. Those prove the feasibility of a single mirror polarizer for ECCD system

  9. V-groove SnO2 nanowire sensors: fabrication and Pt-nanoparticle decoration

    International Nuclear Information System (INIS)

    Sun, Gun-Joo; Choi, Sun-Woo; Jung, Sung-Hyun; Katoch, Akash; Kim, Sang Sub

    2013-01-01

    Networked SnO 2 nanowire sensors were achieved using the selective growth of SnO 2 nanowires and their tangling ability, particularly on on-chip V-groove structures, in an effort to overcome the disadvantages imposed on the conventional trench-structured SnO 2 nanowire sensors. The sensing performance of the V-groove-structured SnO 2 nanowire sensors was highly dependent on the geometrical dimension of the groove, being superior to those of their conventional trench-structured counterparts. Pt nanoparticles were decorated on the surface of the networked SnO 2 nanowires via γ-ray radiolysis to enhance the sensing performances of the V-groove sensors whose V-groove widths had been optimized. The V-groove-structured Pt-nanoparticle-decorated SnO 2 nanowire sensors exhibited outstanding and reliable sensing capabilities towards toluene and nitrogen dioxide gases, indicating their potential for use as a platform for chemical gas sensors. (paper)

  10. Structure of a Pheromone Receptor-Associated Mhc Molecule With An Open And Empty Groove

    Energy Technology Data Exchange (ETDEWEB)

    Olson, R.; Huey-Tubman, K.E.; Dulac, C.; Bjorkman, P.J.; /Caltech /Harvard U.

    2006-10-06

    Neurons in the murine vomeronasal organ (VNO) express a family of class Ib major histocompatibility complex (MHC) proteins (M10s) that interact with the V2R class of VNO receptors. This interaction may play a direct role in the detection of pheromonal cues that initiate reproductive and territorial behaviors. The crystal structure of M10.5, an M10 family member, is similar to that of classical MHC molecules. However, the M10.5 counterpart of the MHC peptide-binding groove is open and unoccupied, revealing the first structure of an empty class I MHC molecule. Similar to empty MHC molecules, but unlike peptide-filled MHC proteins and non-peptide-binding MHC homologs, M10.5 is thermally unstable, suggesting that its groove is normally occupied. However, M10.5 does not bind endogenous peptides when expressed in mammalian cells or when offered a mixture of class I-binding peptides. The F pocket side of the M10.5 groove is open, suggesting that ligands larger than 8-10-mer class I-binding peptides could fit by extending out of the groove. Moreover, variable residues point up from the groove helices, rather than toward the groove as in classical MHC structures. These data suggest that M10s are unlikely to provide specific recognition of class I MHC-binding peptides, but are consistent with binding to other ligands, including proteins such as the V2Rs.

  11. Structure of a pheromone receptor-associated MHC molecule with an open and empty groove.

    Directory of Open Access Journals (Sweden)

    2005-08-01

    Full Text Available Neurons in the murine vomeronasal organ (VNO express a family of class Ib major histocompatibility complex (MHC proteins (M10s that interact with the V2R class of VNO receptors. This interaction may play a direct role in the detection of pheromonal cues that initiate reproductive and territorial behaviors. The crystal structure of M10.5, an M10 family member, is similar to that of classical MHC molecules. However, the M10.5 counterpart of the MHC peptide-binding groove is open and unoccupied, revealing the first structure of an empty class I MHC molecule. Similar to empty MHC molecules, but unlike peptide-filled MHC proteins and non-peptide-binding MHC homologs, M10.5 is thermally unstable, suggesting that its groove is normally occupied. However, M10.5 does not bind endogenous peptides when expressed in mammalian cells or when offered a mixture of class I-binding peptides. The F pocket side of the M10.5 groove is open, suggesting that ligands larger than 8-10-mer class I-binding peptides could fit by extending out of the groove. Moreover, variable residues point up from the groove helices, rather than toward the groove as in classical MHC structures. These data suggest that M10s are unlikely to provide specific recognition of class I MHC-binding peptides, but are consistent with binding to other ligands, including proteins such as the V2Rs.

  12. Grooved surface topography alters matrix-metalloproteinase production by human fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Brydone, Alistair S; Dominic Meek, R M [Department of Orthopaedics, Southern General Hospital, 1345 Govan Road, Glasgow G51 4TF (United Kingdom); Dalby, Matthew J; Berry, Catherine C; McNamara, Laura E, E-mail: alibrydone@gmail.com [Centre for Cell Engineering, Joseph Black Building, Institute of Molecular, Cell and Systems Biology, College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow G12 8QQ (United Kingdom)

    2011-06-15

    Extracellular matrix (ECM) remodelling is an essential physiological process in which matrix-metalloproteinases (MMPs) have a key role. Manipulating the manner in which cells produce MMPs and ECMs may enable the creation of a desired tissue type, i.e. effect repair, or the prevention of tissue invasion (e.g. metastasis). The aim of this project was to determine if culturing fibroblasts on grooved topography altered collagen deposition or MMP production. Human fibroblasts were seeded on planar or grooved polycaprolactone substrates (grooves were 12.5 {mu}m wide with varying depths of 240 nm, 540 nm or 2300 nm). Cell behaviour and collagen production were studied using fluorescence microscopy and the spent culture medium was assessed using gel zymography to detect MMPs. Total collagen deposition was high on the 240 nm deep grooves, but decreased as the groove depth increased, i.e. as cell contact guidance decreased. There was an increase in gelatinase on the 2300 nm deep grooved topography and there was a difference in the temporal expression of MMP-3 observed on the planar surface compared to the 540 nm and 2300 nm topographies. These results show that topography can alter collagen and MMP production. A fuller understanding of these processes may permit the design of surfaces tailored to tissue regeneration e.g. tendon repair.

  13. Modified Kelvin Equations for Capillary Condensation in Narrow and Wide Grooves

    Science.gov (United States)

    Malijevský, Alexandr; Parry, Andrew O.

    2018-03-01

    We consider the location and order of capillary condensation transitions occurring in deep grooves of width L and depth D . For walls that are completely wet by liquid (contact angle θ =0 ) the transition is continuous and its location is not sensitive to the depth of the groove. However, for walls that are partially wet by liquid, where the transition is first order, we show that the pressure at which it occurs is determined by a modified Kelvin equation characterized by an edge contact angle θE describing the shape of the meniscus formed at the top of the groove. The dependence of θE on the groove depth D relies, in turn, on whether corner menisci are formed at the bottom of the groove in the low density gaslike phase. While for macroscopically wide grooves these are always present when θ condensation transition is different depending on whether the contact angle is greater or less than a universal value θ*≈31 °. Our arguments are supported by detailed microscopic density functional theory calculations that show that the modified Kelvin equation remains highly accurate even when L and D are of the order of tens of molecular diameters.

  14. Measurement of sheath thickness by lining out grooves in the Hall-type stationary plasma thrusters

    International Nuclear Information System (INIS)

    Yu Daren; Wu Zhiwen; Ning Zhongxi; Wang Xiaogang

    2007-01-01

    Using grooves created along the axial direction of the discharge channel, a method for measuring sheath thickness in Hall-type stationary plasma thrusters has been developed. By distorting the wall surface using these grooves, it is possible to numerically study the effect of the wall surface on the sheath and near wall conductivity. Monte Carlo method is applied to calculate the electron temperature variation with different groove depths. The electron dynamic process in the plasma is described by a test particle method with the electron randomly entering the sheath from the discharge channel and being reflected back. Numerical results show that the reflected electron temperature is hardly affected by the wall surface if the groove depth is much less than the sheath thickness. On the other hand, the reflected electron temperature increases if the groove depth is much greater than the sheath thickness. The reflected electron temperature has a sharp jump when the depth of groove is on the order of the sheath thickness. The simulation is repeated with different sheath thicknesses and the results are the same. Therefore, a diagnosis mean of the sheath thickness can be developed based on the method. Also the simulation results are in accord with the experimental data. Besides, the measurement method may be applicable to other plasma device with similar orthogonal steady state electrical and magnetic fields

  15. Cycle time improvement for plastic injection moulding process by sub groove modification in conformal cooling channel

    Science.gov (United States)

    Kamarudin, K.; Wahab, M. S.; Batcha, M. F. M.; Shayfull, Z.; Raus, A. A.; Ahmed, Aqeel

    2017-09-01

    Mould designers have been struggling for the improvement of the cooling system performance, despite the fact that the cooling system complexity is physically limited by the fabrication capability of the conventional tooling methods. However, the growth of Solid Free Form Technology (SFF) allow the mould designer to develop more than just a regular conformal cooling channel. Numerous researchers demonstrate that conformal cooling channel was tremendously given significant result in the improvement of productivity and quality in the plastic injection moulding process. This paper presents the research work that applies the passive enhancement method in square shape cooling channel to enhance the efficiency of cooling performance by adding the sub groove to the cooling channel itself. Previous design that uses square shape cooling channel was improved by adding various numbers of sub groove to meet the best sub groove design that able reduced the cooling time. The effect of sub groove design on cooling time was investigated by Autodesk Modlflow Insight software. The simulation results showed that the various sub groove designs give different values to ejection time. The Design 7 showed the lowest value of ejection time with 24.3% increment. The addition of sub groove significantly increased a coolant velocity and a rate of heat transfer from molten plastic to coolant.

  16. The Trojan minor planets

    Science.gov (United States)

    Spratt, Christopher E.

    1988-08-01

    There are (March, 1988) 3774 minor planets which have received a permanent number. Of these, there are some whose mean distance to the sun is very nearly equal to that of Jupiter, and whose heliocentric longitudes from that planet are about 60°, so that the three bodies concerned (sun, Jupiter, minor planet) make an approximate equilateral triangle. These minor planets, which occur in two distinct groups, one preceding Jupiter and one following, have received the names of the heroes of the Trojan war. This paper concerns the 49 numbered minor planets of this group.

  17. Preservation of olfaction in surgery of olfactory groove meningiomas.

    Science.gov (United States)

    Jang, Woo-Youl; Jung, Shin; Jung, Tae-Young; Moon, Kyung-Sub; Kim, In-Young

    2013-08-01

    Olfaction is commonly considered as secondary among the sensory functions, perhaps reflecting a lack of interest in sparing olfaction after surgery for the olfactory groove meningiomas (OGM). However, considering the repercussions of olfaction for the quality of life, the assessment of post-operative olfaction should be necessary. We retrospectively reviewed the olfactory outcome in patients with OGM and investigated the factors associated with sparing the post-operative olfaction. Between 1993 and 2012, 40 patients with OGM underwent surgical resection and estimated the olfactory function using the Korean version of "Sniffin'Sticks" test (KVSS). Variable factors, such as tumor size, degree of preoperative edema, tumor consistency, preoperative olfactory function, surgical approaches, patient's age, and gender were analyzed with attention to the post-operative olfactory function. Anatomical and functional preservation of olfactory structures were achieved in 26 patients (65%) and 22 patients (55%), respectively. Among the variable factors, size of tumor was significant related to the preservation of post-operative olfaction. (78.6% in size4 cm, p=0.035). Sparing the olfaction was significantly better in patients without preoperative olfactory dysfunction (84.6%) compared with ones with preoperative olfactory dysfunction (40.7%, p=0.016). The frontolateral approach achieved much more excellent post-operative olfactory function (71.4%) than the bifrontal approach (36.8%, p=0.032). If the tumor was smaller than 4 cm and the patients did not present olfactory dysfunction preoperatively, the possibility of sparing the post-operative olfaction was high. Among the variable surgical approaches, frontolateral route may be preferable sparing the post-operative olfaction. Copyright © 2012 Elsevier B.V. All rights reserved.

  18. Clinical, radiological, surgical, and pathological determinants of olfactory groove schwannoma

    Directory of Open Access Journals (Sweden)

    Andi Sadayandi Ramesh

    2014-01-01

    Full Text Available Background: Olfactory groove schwannomas (OGS are rare anterior cranial fossa base tumors with only 41 cases reported in literature. Olfactory ensheathing cell schwannoma (OECS has similar clinico-radiological features as OGS, but a different cell of origin. In recent years, there is growing interest in OECS as more cases are being reported. Aims: The objective was to study the clinico-radiological features of OGS and define the histological differentiation from OECS. Materials and Methods: We retrospectively analyzed clinical, radiological, surgical and histopathological picture of all cases of OGS managed in our institute. Immuno histochemical studies were performed in these tumors for differentiating from OECS. A comprehensive review of articles published until date describing the operative treatment was done. Results: All three cases had presented with seizures, two had anosmia and papilledema. Gross-total resection was achieved in all our patients. One patient expired in the postoperative period due to septicemia. Positive expression to newer immuno histochemical biomarker CD57 (Leu7, with negative staining to smooth muscle α-actin (SMA was helpful in confirming the diagnosis of OGS and differentiating it from OECS in all our cases. Conclusions: OECS, though rare has to be differentiated from OGS using immuno histochemistry. Gross-total resection of OGS with preservation of olfactory function is often possible and curative. Although these tumors are commonly treated with microsurgical skull base approaches, an endoscopic endonasal approach can be considered in some cases, with repair using mucoperiosteal pedicled flap to prevent cerebrospinal fluid leak.

  19. Influence of major-groove chemical modifications of DNA on transcription by bacterial RNA polymerases

    Czech Academy of Sciences Publication Activity Database

    Raindlová, Veronika; Janoušková, Martina; Slavíčková, Michaela; Perlíková, Pavla; Boháčová, Soňa; Milisavljevič, Nemanja; Šanderová, Hana; Benda, Martin; Barvík, I.; Krásný, Libor; Hocek, Michal

    2016-01-01

    Roč. 44, č. 7 (2016), s. 3000-3012 ISSN 0305-1048 R&D Projects: GA ČR GA14-04289S Institutional support: RVO:61388963 ; RVO:61388971 Keywords : Escherichia coli RNA * Bacillus subtilis * restriction endonucleases Subject RIV: CC - Organic Chemistry; EE - Microbiology, Virology (MBU-M) Impact factor: 10.162, year: 2016 http://nar.oxfordjournals.org/content/44/7/3000.full

  20. How Y-Family DNA polymerase IV is more accurate than Dpo4 at dCTP insertion opposite an N2-dG adduct of benzo[a]pyrene.

    Science.gov (United States)

    Sholder, Gabriel; Creech, Amanda; Loechler, Edward L

    2015-11-01

    To bypass DNA damage, cells have Y-Family DNA polymerases (DNAPs). One Y-Family-class includes DNAP κ and DNAP IV, which accurately insert dCTP opposite N(2)-dG adducts, including from the carcinogen benzo[a]pyrene (BP). Another class includes DNAP η and DNAP V, which insert accurately opposite UV-damage, but inaccurately opposite BP-N(2)-dG. To investigate structural differences between Y-Family-classes, regions are swapped between DNAP IV (a κ/IV-class-member) and Dpo4 (a η/V-class-member); the kinetic consequences are evaluated via primer-extension studies with a BP-N(2)-dG-containing template. Four key structural elements are revealed. (1) Y-Family DNAPs have discreet non-covalent contacts between their little finger-domain (LF-Domain) and their catalytic core-domain (CC-Domain), which we call "non-covalent bridges" (NCBs). Arg37 and Arg38 in DNAP IV's CC-Domain near the active site form a non-covalent bridge (AS-NCB) by interacting with Glu251 and Asp252, respectively, in DNAP IV's LF-Domain. Without these interactions dATP/dGTP/dTTP misinsertions increase. DNAP IV's AS-NCB suppresses misinsertions better than Dpo4's equivalent AS-NCB. (2) DNAP IV also suppresses dATP/dGTP/dTTP misinsertions via a second non-covalent bridge, which is ∼8Å from the active site (Distal-NCB). Dpo4 has no Distal-NCB, rendering it inferior at dATP/dGTP/dTTP suppression. (3) dCTP insertion is facilitated by the larger minor groove opening near the active site in DNAP IV versus Dpo4, which is sensible given that Watson/Crick-like [dCTP:BP-N(2)-dG] pairing requires the BP-moiety to be in the minor groove. (4) Compared to Dpo4, DNAP IV has a smaller major groove opening, which suppresses dGTP misinsertion, implying BP-N(2)-dG bulk in the major groove during Hoogsteen syn-adduct-dG:dGTP pairing. In summary, DNAP IV has a large minor groove opening to enhance dCTP insertion, a plugged major groove opening to suppress dGTP misinsertion, and two non-covalent bridges (near and distal

  1. Minorities and Malnutrition.

    Science.gov (United States)

    Kornegay, Francis A.

    Various aspects of the relationship between minorities and malnutrition are discussed in this brief paper. Malnutrition, one of the byproducts of low economic status, is creating a crisis-proportion health problem affecting minority citizens. Malnutrition seriously affects children, older people in poverty, and chronically unemployed or…

  2. Surveying ethnic minorities

    NARCIS (Netherlands)

    Joost Kappelhof

    2015-01-01

    Obtaining accurate survey data on ethnic minorities is not easy. Ethnic minorities are usually underrepresented in surveys, and it is moreover not certain that those who do take part in surveys are representative of the group the researcher is interested in. For example, is it only people with

  3. Autonomy and minority rights

    DEFF Research Database (Denmark)

    Barten, Ulrike

    2008-01-01

    on the content of the syllabus. When autonomy is understood in the literal sense, of giving oneself one's own laws, then there is a clear connection. Autonomy is usually connected to politics and a geographically limited territory. Special political rights of minorities - e.g. is the Danish minority party SSW...

  4. Extreme bendability of DNA double helix due to bending asymmetry

    NARCIS (Netherlands)

    Salari, H.; Eslami-Mossallam, B.; Nederi, S.; Ejtehadi, M.R.

    2015-01-01

    Experimental data of the DNA cyclization (J-factor) at short length scales exceed the theoretical expectation based on the wormlike chain (WLC) model by several orders of magnitude. Here, we propose that asymmetric bending rigidity of the double helix in the groove direction can be responsible for

  5. The impact of postoperative supraclavicular radiotherapy on tracheoesophageal groove lymph node metastasis in esophageal carcinoma

    International Nuclear Information System (INIS)

    Qian Pudong; Lu Jinchen; Mei Zeru; Zhu Jun

    2005-01-01

    Objective: To evaluate the prognostic factors of tracheoesophageal groove lymph node (TEGLN) metastasis in postoperative esophageal carcinoma. Methods: From January 1996 to December 1997, 101 postoperative cervical and thoracic esophageal carcinoma patients proved absence from tracheoesophageal groove lymph node (TEGIAN) metastasis before and after operation by physical examination and computer tomography examination were entered into this study. The patients were divided into three groups according to the treatment of supraclavicular region: no prophylactic radiotherapy (group A-, 30 patients); prophylactic radiotherapy with local dose < 45 Gy (Group B-, 71 patients); and prophylactic radiotherapy with local dose ≥45 Gy (Group C-, 19 patients). Radiotherapy was delivered by cobalt- 60 or 6 MV X-ray with the prescribed dose normalized to the point of tracheoesophageal groove, i. e, 5 cm in depth. The tracheoesophageal groove lymph node metastasis after treatment was observed. Results: The incidence of tracheoesophageal groove lymph node metastasis was 20% (6/30), 9.6% (5/71) and 0% (0/19) in groups A, B and C. Univariate analysis showed that there was significant difference of TEGLN metastasis between groups A and C only (P=0.039), but higher dose to supraclavicular region tended to lower the incidence of TEGLN metastasis. Multivariate analysis showed that only prophylactic radiotherapy to the supraclavicular region was independent prognostic factor for TEGLN metastasis (P=0.037). Gender, primary tumor site and pathological stage had no significant impact on TEGLN metastasis. Conclusions: Postoperative prophylactic supraclavicular region irradiation can lower the incidence of tracheoesophageal groove lymph node metastasis in esophageal carcinoma. Radiotherapy dose should not be less than 45 Gy and should be routinely normalized to a point 5 cm deep in the tracheoesophageal groove. (authors)

  6. A simplified strategy for studying the etiology of viral diseases: Apple stem grooving virus as a case study.

    Science.gov (United States)

    Dhir, Sunny; Walia, Yashika; Zaidi, A A; Hallan, Vipin

    2015-03-01

    A simple method to amplify infective, complete genomes of single stranded RNA viruses by long distance PCR (LD PCR) from woody plant tissues is described in detail. The present protocol eliminates partial purification of viral particles and the amplification is achieved in three steps: (i) easy preparation of template RNA by incorporating a pre processing step before loading onto the column (ii) reverse transcription by AMV or Superscript reverse transcriptase and (iii) amplification of cDNA by LD PCR using LA or Protoscript Taq DNA polymerase. Incorporation of a preprocessing step helped to isolate consistent quality RNA from recalcitrant woody tissues such as apple, which was critical for efficient amplification of the complete genomes of Apple stem pitting virus (ASPV), Apple stem grooving virus (ASGV) and Apple chlorotic leaf spot virus (ACLSV). Complete genome of ASGV was cloned under T7 RNA polymerase promoter and was confirmed to be infectious through transcript inoculation producing symptoms similar to the wild type virus. This is the first report for the largest RNA virus genome amplified by PCR from total nucleic acid extracts of woody plant tissues. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Ternary iron(II) complex with an emissive imidazopyridine arm from Schiff base cyclizations and its oxidative DNA cleavage activity.

    Science.gov (United States)

    Mukherjee, Arindam; Dhar, Shanta; Nethaji, Munirathinam; Chakravarty, Akhil R

    2005-01-21

    The ternary iron(II) complex [Fe(L')(L")](PF6)3(1) as a synthetic model for the bleomycins, where L' and L" are formed from metal-mediated cyclizations of N,N'-(2-hydroxypropane-1,3-diyl)bis(pyridine-2-aldimine)(L), is synthesized and structurally characterized by X-ray crystallography. In the six-coordinate iron(ii) complex, ligands L' and L" show tetradentate and bidentate chelating modes of bonding. Ligand L' is formed from an intramolecular attack of the alcoholic OH group of L to one imine moiety leading to the formation of a stereochemically constrained five-membered ring. Ligand L" which is formed from an intermolecular reaction involving one imine moiety of L and pyridine-2-carbaldehyde has an emissive cationic imidazopyridine pendant arm. The complex binds to double-stranded DNA in the minor groove giving a Kapp value of 4.1 x 10(5) M(-1) and displays oxidative cleavage of supercoiled DNA in the presence of H2O2 following a hydroxyl radical pathway. The complex also shows photo-induced DNA cleavage activity on UV light exposure involving formation of singlet oxygen as the reactive species.

  8. Metal based biologically active compounds: Design, synthesis, DNA binding and antidiabetic activity of 6-methyl-3-formyl chromone derived hydrazones and their metal (II) complexes.

    Science.gov (United States)

    Philip, Jessica Elizabeth; Shahid, Muhammad; Prathapachandra Kurup, M R; Velayudhan, Mohanan Puzhavoorparambil

    2017-10-01

    Two chromone hydrazone ligands HL 1 and HL 2 were synthesized and characterized by elemental analyses, IR, 1 H NMR & 13 C NMR, electronic absorption and mass spectra. The reactions of the chromone hydrazones with transition metals such as Ni, Cu, and Zn (II) salts of acetate afforded mononuclear metal complexes. Characterization and structure elucidation of the prepared chromone hydrazone metal (II) complexes were done by elemental, IR, electronic, EPR spectra and thermo gravimetric analyses as well as conductivity and magnetic susceptibility measurements. The spectroscopic data showed that the ligand acts as a mono basic bidentate with coordination sites are azomethine nitrogen and hydrazonic oxygen, and they exhibited distorted geometry. The biological studies involved antidiabetic activity i.e. enzyme inhibition of α-amylase and α-glucosidase, Calf Thymus - DNA (CT-DNA) interaction and molecular docking. Potential capacity of synthesized compounds to inhibit the α-amylase and α-glucosidase activity was assayed whereas DNA interaction studies were carried out with the help UV-Vis absorption titration and viscosity method. The docking studies of chromone hydrazones show that they are minor groove binders. Complexes were found to be good DNA - intercalates. Chromone hydrazones and its transition metal complexes have shown comparable antidiabetic activity with a standard drug acarbose. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Membrane Destruction and DNA Binding of Staphylococcus aureus Cells Induced by Carvacrol and Its Combined Effect with a Pulsed Electric Field.

    Science.gov (United States)

    Wang, Lang-Hong; Wang, Man-Sheng; Zeng, Xin-An; Zhang, Zhi-Hong; Gong, De-Ming; Huang, Yan-Bo

    2016-08-17

    Carvacrol (5-isopropyl-2-methylphenol, CAR) is an antibacterial ingredient that occurs naturally in the leaves of the plant Origanum vulgare. The antimicrobial mechanism of CAR against Staphylococcus aureus ATCC 43300 was investigated in the study. Analysis of the membrane fatty acids by gas chromatography-mass spectrometry (GC-MS) showed that exposure to CAR at low concentrations induced a marked increase in the level of unbranched fatty acids (from 34.90 ± 1.77% to 62.37 ± 4.26%). Moreover, CAR at higher levels severely damaged the integrity and morphologies of the S. aureus cell membrane. The DNA-binding properties of CAR were also investigated using fluorescence, circular dichroism, molecular modeling, and atomic-force microscopy. The results showed that CAR bound to DNA via the minor-groove mode, mildly perturbed the DNA secondary structure, and induced DNA molecules to be aggregated. Furthermore, a combination of CAR with a pulsed-electric field was found to exhibit strong synergistic effects on S. aureus.

  10. What musicians do to induce the sensation of groove in simple and complex melodies, and how listeners perceive it

    Directory of Open Access Journals (Sweden)

    Guy eMadison

    2014-08-01

    Full Text Available Groove is the experience of wanting to move when hearing music, such as snapping fingers or tapping feet. This is a central aspect of much music, in particular of music intended for dancing. While previous research has found considerable consistency in ratings of groove across individuals, it remains unclear how groove is induced, that is, what are the physical properties of the acoustic signal that differ between more and less groove-inducing versions. Here, we examined this issue with a performance experiment, in which 4 musicians performed 6 simple and 6 complex melodies in two conditions with the intention of minimizing and maximizing groove. Analyses of rhythmical and temporal properties from the performances demonstrated some general effects. For example, more groove was associated with more notes on faster metrical levels and syncopation, and less groove was associated with deadpan timing and destruction of the regular pulse. We did not observe that deviations from the metrical grid (i.e. micro-timing were a predictor of groove. A listener experiment confirmed that the musicians’ manipulations had the intended effects on the experience of groove. A Brunswikian lens model was applied, which estimates the performer-perceiver communication across the two experiments. It showed that the communication achievement for simple melodies was 0.62, and that the matching of performers’ and listeners’ use of 9 rhythmical cues was 0.83. For complex melodies with an already high level of groove, the corresponding values were 0.39 and 0.34, showing that it was much more difficult to take out groove from musical structures designed to induce groove.

  11. Molecular mechanisms of conformational specificity: A study of Hox in vivo target DNA binding specificities and the structure of a Ure2p mutation that affects fibril formation rates

    Science.gov (United States)

    Bauer, William Joseph, Jr.

    The fate of an individual cell, or even an entire organism, is often determined by minute, yet very specific differences in the conformation of a single protein species. Very often, proteins take on alternate folds or even side chain conformations to deal with different situations present within the cell. These differences can be as large as a whole domain or as subtle as the alteration of a single amino acid side chain. Yet, even these seemingly minor side chain conformational differences can determine the development of a cell type during differentiation or even dictate whether a cell will live or die. Two examples of situations where minor conformational differences within a specific protein could lead to major differences in the life cycle of a cell are described herein. The first example describes the variations seen in DNA conformations which can lead to slightly different Hox protein binding conformations responsible for recognizing biologically relevant regulatory sites. These specific differences occur in the minor groove of the bound DNA and are limited to the conformation of only two side chains. The conformation of the bound DNA, however, is not solely determined by the sequence of the DNA, as multiple sequences can result in the same DNA conformation. The second example takes place in the context of a yeast prion protein which contains a mutation that decreases the frequency at which fibrils form. While the specific interactions leading to this physiological change were not directly detected, it can be ascertained from the crystal structure that the structural changes are subtle and most likely involve another binding partner. In both cases, these conformational changes are very slight but have a profound effect on the downstream processes.

  12. Hydration forces between aligned DNA helices undergoing B to A conformational change: In-situ X-ray fiber diffraction studies in a humidity and temperature controlled environment.

    Science.gov (United States)

    Case, Ryan; Schollmeyer, Hauke; Kohl, Phillip; Sirota, Eric B; Pynn, Roger; Ewert, Kai E; Safinya, Cyrus R; Li, Youli

    2017-12-01

    Hydration forces between DNA molecules in the A- and B-Form were studied using a newly developed technique enabling simultaneous in situ control of temperature and relative humidity. X-ray diffraction data were collected from oriented calf-thymus DNA fibers in the relative humidity range of 98%-70%, during which DNA undergoes the B- to A-form transition. Coexistence of both forms was observed over a finite humidity range at the transition. The change in DNA separation in response to variation in humidity, i.e. change of chemical potential, led to the derivation of a force-distance curve with a characteristic exponential decay constant of∼2Å for both A- and B-DNA. While previous osmotic stress measurements had yielded similar force-decay constants, they were limited to B-DNA with a surface separation (wall-to-wall distance) typically>5Å. The current investigation confirms that the hydration force remains dominant even in the dry A-DNA state and at surface separation down to∼1.5Å, within the first hydration shell. It is shown that the observed chemical potential difference between the A and B states could be attributed to the water layer inside the major and minor grooves of the A-DNA double helices, which can partially interpenetrate each other in the tightly packed A phase. The humidity-controlled X-ray diffraction method described here can be employed to perform direct force measurements on a broad range of biological structures such as membranes and filamentous protein networks. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Transverse grooved artefacts from southwestern Asia and northern Eurasia: Common traits and the reconstruction of function

    Directory of Open Access Journals (Sweden)

    Irina Usacheva

    2016-10-01

    Full Text Available Transverse grooved artefacts (TGA appeared as a new cultural element in Mesolithic-Proto-Neolithic sites in southwestern Asia. We know of similar artefacts from northern Africa. Hundreds of TGA have also been found in northern Eurasia. Some common traits were found in specimens from far apart territories, such as the non-abrasive heat-resistant nature of the raw materials, specificity of fragmentation without any signs of physical impact, the standard size of the grooves, association with a specific type of landscape, the similar economic level of the societies with which the items are associated, and use-wear marks in the grooves. Based on these regularities we can speak of a single main function for these artefacts which support the earlier reconstruction of R.L. and R.S. Solecki, suggesting that grooved stones were used for straightening cane and reed shafts under heating. Other evidence and traces that have been identified on the surface of TGA outside the groove could be associated with a variety of additional functions.

  14. Development of an equine groove model to induce metacarpophalangeal osteoarthritis: a pilot study on 6 horses.

    Science.gov (United States)

    Maninchedda, Ugo; Lepage, Olivier M; Gangl, Monika; Hilairet, Sandrine; Remandet, Bernard; Meot, Francoise; Penarier, Geraldine; Segard, Emilie; Cortez, Pierre; Jorgensen, Christian; Steinberg, Régis

    2015-01-01

    The aim of this work was to develop an equine metacarpophalangeal joint model that induces osteoarthritis that is not primarily mediated by instability or inflammation. The study involved six Standardbred horses. Standardized cartilage surface damage or "grooves" were created arthroscopically on the distal dorsal aspect of the lateral and medial metacarpal condyles of a randomly chosen limb. The contralateral limb was sham operated. After 2 weeks of stall rest, horses were trotted 30 minutes every other day for 8 weeks, then evaluated for lameness and radiographed. Synovial fluid was analyzed for cytology and biomarkers. At 10 weeks post-surgery, horses were euthanized for macroscopic and histologic joint evaluation. Arthroscopic grooving allowed precise and identical damage to the cartilage of all animals. Under the controlled exercise regime, this osteoarthritis groove model displayed significant radiographic, macroscopic, and microscopic degenerative and reactive changes. Histology demonstrated consistent surgically induced grooves limited to non-calcified cartilage and accompanied by secondary adjacent cartilage lesions, chondrocyte necrosis, chondrocyte clusters, cartilage matrix softening, fissuring, mild subchondral bone inflammation, edema, and osteoblastic margination. Synovial fluid biochemistry and cytology demonstrated significantly elevated total protein without an increase in prostaglandin E2, neutrophils, or chondrocytes. This equine metacarpophalangeal groove model demonstrated that standardized non-calcified cartilage damage accompanied by exercise triggered altered osteochondral morphology and cartilage degeneration with minimal or inefficient repair and little inflammatory response. This model, if validated, would allow for assessment of disease processes and the effects of therapy.

  15. Development of an equine groove model to induce metacarpophalangeal osteoarthritis: a pilot study on 6 horses.

    Directory of Open Access Journals (Sweden)

    Ugo Maninchedda

    Full Text Available The aim of this work was to develop an equine metacarpophalangeal joint model that induces osteoarthritis that is not primarily mediated by instability or inflammation. The study involved six Standardbred horses. Standardized cartilage surface damage or "grooves" were created arthroscopically on the distal dorsal aspect of the lateral and medial metacarpal condyles of a randomly chosen limb. The contralateral limb was sham operated. After 2 weeks of stall rest, horses were trotted 30 minutes every other day for 8 weeks, then evaluated for lameness and radiographed. Synovial fluid was analyzed for cytology and biomarkers. At 10 weeks post-surgery, horses were euthanized for macroscopic and histologic joint evaluation. Arthroscopic grooving allowed precise and identical damage to the cartilage of all animals. Under the controlled exercise regime, this osteoarthritis groove model displayed significant radiographic, macroscopic, and microscopic degenerative and reactive changes. Histology demonstrated consistent surgically induced grooves limited to non-calcified cartilage and accompanied by secondary adjacent cartilage lesions, chondrocyte necrosis, chondrocyte clusters, cartilage matrix softening, fissuring, mild subchondral bone inflammation, edema, and osteoblastic margination. Synovial fluid biochemistry and cytology demonstrated significantly elevated total protein without an increase in prostaglandin E2, neutrophils, or chondrocytes. This equine metacarpophalangeal groove model demonstrated that standardized non-calcified cartilage damage accompanied by exercise triggered altered osteochondral morphology and cartilage degeneration with minimal or inefficient repair and little inflammatory response. This model, if validated, would allow for assessment of disease processes and the effects of therapy.

  16. A test for the minimum scale of grooving on the Amatrice and Norcia earthquakes

    Science.gov (United States)

    Okamoto, K.; Brodsky, E. E.; Billi, A.

    2017-12-01

    As stress builds up along a fault, elastic strain energy builds until it cannot be accommodated by small-scale ductile deformation and then the fault brittlely fails. This brittle failure is associated with the grooving process that causes slickensides along fault planes. Therefore the scale at which slickensides disappear could be geological evidence of earthquake nucleation. Past studies found the minimum scale of grooving, however the studied fault surfaces were not exposed by recent earthquakes. These measurements could have been a product of chemical or mechanical weathering. On August 24th and October 30th of 2016, MW 6.0 and 6.5 earthquakes shook central Italy. The earthquakes caused decimeter to meter scale fault scarps along the Mt. Vettoretto Fault. Here, we analyze samples of a scarp using white light interferometry in order to determine if the minimum scale of grooving is present. Results suggest that grooving begins around 100 μm for these samples, which is consistent with previous findings of faults without any direct evidence of earthquakes. The measurement is also consistent with typical values of the frictional weakening distance Dc, which also is associated with a transition between ductile and brittle behavior. The measurements show that the minimum scale of grooving is a useful measure of the behavior of faults.

  17. Thermal performance comparison of oscillating heat pipes with and without helical micro-grooves

    Science.gov (United States)

    Qu, Jian; Li, Xiaojun; Xu, Qian; Wang, Qian

    2017-11-01

    This paper presents an experimental investigation to compare the thermal performance of three closed loop oscillating heat pipes (OHPs) with and without internal helical microgrooves at vertical and horizontal orientations. All of these OHPs were made from copper tubes and have three turns with lengths of 70, 230 and 110 mm at the evaporator, adiabatic and condenser sections, respectively. Deionized water was used as the working fluid at a volumetric filling ratio of 50%. The internal diameters (IDs) of two smooth-tube OHPs are 4.0 and 4.8 mm, respectively, and the internal diameter of micro-grooved OHP without groove structures is about 4.5 mm. Experimental results demonstrated that the addition of groove structures make the OHP remarkably outperform smooth-tube OHPs in both effective thermal conductivity and thermal resistance. The thermal resistance of vertically-oriented micro-grooved OHP could be lowered to 0.057 °C/W associated with an effective thermal conductivity of 6.1 × 104 W/ (m·K) at the input heat flux of 3.8 × 104 W/m2. Compared to smooth-tube OHPs, preliminary mechanism analysis reveals that local heat transfer coefficients both at the heating and cooling sections of micro-grooved OHP could be significantly improved. Moreover, enhanced liquid backflow to the evaporator due to microgroove-induced capillarity is also responsible for the OHP performance enhancement.

  18. Study of mastoid canals and grooves in north karnataka human skulls.

    Science.gov (United States)

    Hadimani, Gavishiddappa Andanappa; Bagoji, Ishwar Basavantappa

    2013-08-01

    This study was undertaken to observe the frequency of mastoid canals and grooves in north Karnataka dry human skulls. 100 dry human skulls of unknown age and sex from the department of Anatomy were selected and observed for the present study. The mastoid regions of dry skulls were observed for the presence of mastoid canals and grooves, if any. A metallic wire was passed through the canal for its confirmation and then the length was measured. The Mastoid canals were present in 53% of the total 100 skulls observed either bilaterally or unilaterally. Mastoid grooves were present in 18% of the total skulls (100) observed. Double mastoid canal was found in 01% of total skull studied and both Mastoid canals & Mastoid grooves together were present in 02% of the total skulls (100) observed. The knowledge of mastoid canals and grooves is very important for otolaryngologists and neurosurgeons. Because they contain an arterial branch of occipital artery with its accompanying vein which is liable to injury resulting into severe bleeding.

  19. Research on fatigue behavior and residual stress of large-scale cruciform welding joint with groove

    International Nuclear Information System (INIS)

    Zhao, Xiaohui; Liu, Yu; Liu, Yong; Gao, Yuan

    2014-01-01

    Highlights: • The fatigue behavior of the large-scale cruciform welding joint with groove was studied. • The longitudinal residual stress of the large-scale cruciform welding joint was tested by contour method. • The fatigue fracture mechanism of the large-scale cruciform welding joint with groove was analyzed. - Abstract: Fatigue fracture behavior of the 30 mm thick Q460C-Z steel cruciform welded joint with groove was investigated. The fatigue test results indicated that fatigue strength of 30 mm thick Q460C-Z steel cruciform welded joint with groove can reach fatigue level of 80 MPa (FAT80). Fatigue crack source of the failure specimen initiated from weld toe. Meanwhile, the microcrack was also found in the fusion zones of the fatigue failure specimen, which was caused by weld quality and weld metal integrity resulting from the multi-pass welds. Two-dimensional map of the longitudinal residual stress of 30 mm thick Q460C-Z steel cruciform welded joint with groove was obtained by using the contour method. The stress nephogram of Two-dimensional map indicated that longitudinal residual stress in the welding center is the largest

  20. DNA-Directed alkylating agents. 7. Synthesis, DNA interaction, and antitumor activity of bis(hydroxymethyl)- and bis(carbamate)-substituted pyrrolizines and imidazoles.

    Science.gov (United States)

    Atwell, G J; Fan, J Y; Tan, K; Denny, W A

    1998-11-19

    A series of bis(hydroxymethyl)-substituted imidazoles, thioimidazoles, and pyrrolizines and related bis(carbamates), linked to either 9-anilinoacridine (intercalating) or 4-(4-quinolinylamino)benzamide (minor groove binding) carriers, were synthesized and evaluated for sequence-specific DNA alkylation and cytotoxicity. The imidazole and thioimidazole analogues were prepared by initial synthesis of [(4-aminophenyl)alkyl]imidazole-, thioimidazole-, or pyrrolizine dicarboxylates, coupling of these with the desired carrier, and reduction to give the required bis(hydroxymethyl) alkylating moiety. The pyrrolizines were the most reactive alkylators, followed by the thioimidazoles, while the imidazoles were unreactive. The pyrrolizines and some of the thioimidazoles cross-linked DNA, as measured by agarose gel electrophoresis. Strand cleavage assays showed that none of the compounds reacted at purine N7 or N3 sites in the gpt region of the plasmid gpt2Eco, but the polymerase stop assay showed patterns of G-alkylation in C-rich regions. The corresponding thioimidazole bis(carbamates) were more selective than the bis(hydroxymethyl) pyrrolizines, with high-intensity bands at 5'-NCCN, 5'-NGCN and 5'-NCGN sequences in the PCR stopping assay ( indicates block sites). The data suggest that these targeted compounds, like the known thioimidazole bis(carbamate) carmethizole, alkylate exclusively at guanine residues via the 2-amino group, with little or no alkylation at N3 and N7 guanine or adenine sites. The cytotoxicities of the compounds correlated broadly with their reactivities, with the bis(hydroxymethyl)imidazoles being the least cytotoxic (IC50s >1 microM; P388 leukemia) and with the intercalator-linked analogues being more cytotoxic than the corresponding minor-groove-targeted ones. This was true also for the more reactive thioimidazole bis(carbamates) (IC50s 0.8 and 11 microM, respectively), but both were more active than the analogous "untargeted" carmethizole (IC50 20

  1. BCDC Minor Permits

    Data.gov (United States)

    California Natural Resource Agency — An administrative permit can be issued for an activity that qualifies as a minor repair or improvement in a relatively short period of time and without a public...

  2. Minority Veteran Report 2014

    Data.gov (United States)

    Department of Veterans Affairs — This report is the first comprehensive report that chronicles the history of racial and ethnic minorities in the military and as Veterans, profiles characteristics...

  3. Minorities in Iran

    DEFF Research Database (Denmark)

    Elling, Rasmus Christian

    Contrary to the popular understanding of Iran as a Persian nation, half of the country's population consists of minorities, among whom there has been significant ethnic mobilization at crucial stages in Iranian history. One such stage is now: suppressed minority demands, identity claims, and deba......Contrary to the popular understanding of Iran as a Persian nation, half of the country's population consists of minorities, among whom there has been significant ethnic mobilization at crucial stages in Iranian history. One such stage is now: suppressed minority demands, identity claims......, and debates on diversity have entered public discourse and politics. In 2005–2007, Iran was rocked by the most widespread ethnic unrest experienced in that country since the revolution. The same period was also marked by the re-emergence of nationalism. This interdisciplinary book takes a long-overdue step...

  4. Minority Veteran Report

    Data.gov (United States)

    Department of Veterans Affairs — This report is the first comprehensive report that chronicles the history of racial and ethnic minorities in the military and as Veterans, profiles characteristics...

  5. Multichoice minority game

    International Nuclear Information System (INIS)

    Ein-Dor, Liat; Metzler, Richard; Kanter, Ido; Kinzel, Wolfgang

    2001-01-01

    The generalization of the problem of adaptive competition, known as the minority game, to the case of K possible choices for each player, is addressed, and applied to a system of interacting perceptrons with input and output units of a type of K-state Potts spins. An optimal solution of this minority game, as well as the dynamic evolution of the adaptive strategies of the players, are solved analytically for a general K and compared with numerical simulations

  6. Ancient schwannoma at the olfactory groove mimicking meningioma: A case report

    Energy Technology Data Exchange (ETDEWEB)

    Heo, Young Jin; Jeong, Hae Woong [Dept. of Radiology, Busan Paik Hospital, Inje University College of Medicine, Busan (Korea, Republic of)

    2015-12-15

    Schwannomas are benign slow-growing nerve sheath tumors, which can develop in any peripheral or central nerve that contains Schwann cells. Schwannomas located near the olfactory groove are extremely rare and radiological diagnosis can be difficult. Moreover, ancient schwannoma is an uncommon variant, and radiologic findings are rarely reported. Herein, we reported a surgically confirmed case of ancient schwannoma at the olfactory groove in a 44-year-old woman presenting with headache and visual disturbance. Brain magnetic resonance imaging (MRI) showed a solid and cystic extra-axial mass located in the subfrontal area mimicking an olfactory groove meningioma. Histopathologic diagnosis of ancient schwannoma was confirmed by immunohistochemical staining for S100, CD56, vimentin, and other markers. Furthermore, we described the clinical manifestations, MRI characteristics, and histopathologic findings of the case, and presented a review of related literature.

  7. Polarizing beam splitter of deep-etched triangular-groove fused-silica gratings.

    Science.gov (United States)

    Zheng, Jiangjun; Zhou, Changhe; Feng, Jijun; Wang, Bo

    2008-07-15

    We investigated the use of a deep-etched fused-silica grating with triangular-shaped grooves as a highly efficient polarizing beam splitter (PBS). A triangular-groove PBS grating is designed at a wavelength of 1550 nm to be used in optical communication. When it is illuminated in Littrow mounting, the transmitted TE- and TM-polarized waves are mainly diffracted in the minus-first and zeroth orders, respectively. The design condition is based on the average differences of the grating mode indices, which is verified by using rigorous coupled-wave analysis. The designed PBS grating is highly efficient over the C+L band range for both TE and TM polarizations (>97.68%). It is shown that such a triangular-groove PBS grating can exhibit a higher diffraction efficiency, a larger extinction ratio, and less reflection loss than the binary-phase fused-silica PBS grating.

  8. Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

    Science.gov (United States)

    Lenzmeier, B A; Giebler, H A; Nyborg, J K

    1998-02-01

    Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

  9. Minority engineering scholarships renewal, 2011.

    Science.gov (United States)

    2012-08-01

    Scholarships for Minority Students Studying Engineering and Science : Support will make scholarships available to minority students : interested in engineering and science and will increase significantly the number of minority students that Missouri ...

  10. Comparative evaluation of three heat transfer enhancement strategies in a grooved channel

    Energy Technology Data Exchange (ETDEWEB)

    Herman, C.; Kang, E. [Dept. of Mechanical Engineering, Johns Hopkins Univ., Baltimore, MD (United States)

    2001-09-01

    Results of a comparative evaluation of three heat transfer enhancement strategies for forced convection cooling of a parallel plate channel populated with heated blocks, representing electronic components mounted on printed circuit boards, are reported. Heat transfer in the reference geometry, the asymmetrically heated parallel plate channel, is compared with that for the basic grooved channel, and the same geometry enhanced by cylinders and vanes placed above the downstream edge of each heated block. In addition to conventional heat transfer and pressure drop measurements, holographic interferometry combined with high-speed cinematography was used to visualize the unsteady temperature fields in the self-sustained oscillatory flow. The locations of increased heat transfer within one channel periodicity depend on the enhancement technique applied, and were identified by analyzing the unsteady temperature distributions visualized by holographic interferometry. This approach allowed gaining insight into the mechanisms responsible for heat transfer enhancement. Experiments were conducted at moderate flow velocities in the laminar, transitional and turbulent flow regimes. Reynolds numbers were varied in the range Re = 200-6500, corresponding to flow velocities from 0.076 to 2.36 m/s. Flow oscillations were first observed between Re = 1050 and 1320 for the basic grooved channel, and around Re = 350 and 450 for the grooved channels equipped with cylinders and vanes, respectively. At Reynolds numbers above the onset of oscillations and in the transitional flow regime, heat transfer rates in the investigated grooved channels exceeded the performance of the reference geometry, the asymmetrically heated parallel plate channel. Heat transfer in the grooved channels enhanced with cylinders and vanes showed an increase by a factor of 1.2-1.8 and 1.5-3.5, respectively, when compared to data obtained for the basic grooved channel; however, the accompanying pressure drop penalties

  11. Conjugation of Benzylvanillin and Benzimidazole Structure Improves DNA Binding with Enhanced Antileukemic Properties

    Science.gov (United States)

    Al-Mudarris, Ban A.; Chen, Shih-Hsun; Liang, Po-Huang; Osman, Hasnah; Jamal Din, Shah Kamal Khan; Abdul Majid, Amin M. S.

    2013-01-01

    Benzyl-o-vanillin and benzimidazole nucleus serve as important pharmacophore in drug discovery. The benzyl vanillin (2-(benzyloxy)-3-methoxybenzaldehyde) compound shows anti-proliferative activity in HL60 leukemia cancer cells and can effect cell cycle progression at G2/M phase. Its apoptosis activity was due to disruption of mitochondrial functioning. In this study, we have studied a series of compounds consisting of benzyl vanillin and benzimidazole structures. We hypothesize that by fusing these two structures we can produce compounds that have better anticancer activity with improved specificity particularly towards the leukemia cell line. Here we explored the anticancer activity of three compounds namely 2-(2-benzyloxy-3-methoxyphenyl)-1H-benzimidazole, 2MP, N-1-(2-benzyloxy-3-methoxybenzyl)-2-(2-benzyloxy-3-methoxyphenyl)-1H-benzimidazole, 2XP, and (R) and (S)-1-(2-benzyloxy-3-methoxyphenyl)-2, 2, 2-trichloroethyl benzenesulfonate, 3BS and compared their activity to 2-benzyloxy-3-methoxybenzaldehyde, (Bn1), the parent compound. 2XP and 3BS induces cell death of U937 leukemic cell line through DNA fragmentation that lead to the intrinsic caspase 9 activation. DNA binding study primarily by the equilibrium binding titration assay followed by the Viscosity study reveal the DNA binding through groove region with intrinsic binding constant 7.39 µM/bp and 6.86 µM/bp for 3BS and 2XP respectively. 2XP and 3BS showed strong DNA binding activity by the UV titration method with the computational drug modeling showed that both 2XP and 3BS failed to form any electrostatic linkages except via hydrophobic interaction through the minor groove region of the nucleic acid. The benzylvanillin alone (Bn1) has weak anticancer activity even after it was combined with the benzimidazole (2MP), but after addition of another benzylvanillin structure (2XP), stronger activity was observed. Also, the combination of benzylvanillin with benzenesulfonate (3BS) significantly improved the

  12. Disk in a groove with friction: An analysis of static equilibrium and indeterminacy

    Science.gov (United States)

    Donolato, Cesare

    2018-05-01

    This note studies the statics of a rigid disk placed in a V-shaped groove with frictional walls and subjected to gravity and a torque. The two-dimensional equilibrium problem is formulated in terms of the angles that contact forces form with the normal to the walls. This approach leads to a single trigonometric equation in two variables whose domain is determined by Coulomb's law of friction. The properties of solutions (existence, uniqueness, or indeterminacy) as functions of groove angle, friction coefficient and applied torque are derived by a simple geometric representation. The results modify some of the conclusions by other authors on the same problem.

  13. Genetic Algorithm-Based Optimization for Surface Roughness in Cylindrically Grinding Process Using Helically Grooved Wheels

    Science.gov (United States)

    Çaydaş, Ulaş; Çelik, Mahmut

    The present work is focused on the optimization of process parameters in cylindrical surface grinding of AISI 1050 steel with grooved wheels. Response surface methodology (RSM) and genetic algorithm (GA) techniques were merged to optimize the input variable parameters of grinding. The revolution speed of workpiece, depth of cut and number of grooves on the wheel were changed to explore their experimental effects on the surface roughness of machined bars. The mathematical models were established between the input parameters and response by using RSM. Then, the developed RSM model was used as objective functions on GA to optimize the process parameters.

  14. Efficient Excitation of Channel Plasmons in Tailored, UV-Lithography-Defined V-Grooves

    DEFF Research Database (Denmark)

    Smith, Cameron L. C.; Thilsted, Anil Haraksingh; Garcia-Ortiz, Cesar E.

    2014-01-01

    We demonstrate the highly efficient (>50%) conversion of freely propagating light to channel plasmon-polaritons (CPPs) in gold V-groove waveguides using compact 1.6 μm long waveguide-termination coupling mirrors. Our straightforward fabrication process, involving UV-lithography and crystallographic...... silicon etching, forms the coupling mirrors innately and ensures exceptional-quality, wafer-scale device production. We tailor the V-shaped profiles by thermal silicon oxidation in order to shift initially wedge-located modes downward into the V-grooves, resulting in well-confined CPPs suitable...

  15. Numerical Calculation for Whirling Motion of a Centrifugal Blood Pump with Conical Spiral Groove Bearings

    Science.gov (United States)

    Shigemaru, Daichi; Tsukamoto, Hiroshi

    2010-06-01

    Whirling motion of a pump impeller was calculated for the centrifugal blood pump with Conical Spiral Groove Bearings to get a criterion for the instability of impeller whirling motion. The motion of the centrifugal blood pump impeller was calculated based on a spring damping model, and unsteady flow in the pump was computed using the commercial CFD package ANSYS CFX. Also the whirling motion of rotating impeller was measured using two displacement sensors fixed to the blood pump casing. The numerical calculations were done for the blood pump impeller with conical spiral groove bearings, and impeller whirling motion was evaluated.

  16. Liquid phase solvent bonding of plastic microfluidic devices assisted by retention grooves.

    Science.gov (United States)

    Wan, Alwin M D; Sadri, Amir; Young, Edmond W K

    2015-01-01

    We report a novel method for achieving consistent liquid phase solvent bonding of plastic microfluidic devices via the use of retention grooves at the bonding interface. The grooves are patterned during the regular microfabrication process, and can be placed at the periphery of a device, or surrounding microfluidic features with open ports, where they effectively mitigate solvent evaporation, and thus substantially reduce poor bond coverage. This method is broadly applicable to a variety of plastics and solvents, and produces devices with high bond quality (i.e., coverage, strength, and microfeature fidelity) that are suitable for studies in physics, chemistry, and cell biology at the microscale.

  17. Bifurcation analysis of an aerodynamic journal bearing system considering the effect of stationary herringbone grooves

    International Nuclear Information System (INIS)

    Wang, C.-C.

    2007-01-01

    This paper investigates the bifurcation and nonlinear behavior of an aerodynamic journal bearing system taking into account the effect of stationary herringbone grooves. A finite difference method based on the successive over relation approach is employed to solve the Reynolds' equation. The analysis reveals a complex dynamical behavior comprising periodic and quasi-periodic responses of the rotor center. The dynamic behavior of the bearing system varies with changes in the bearing number and rotor mass. The results of this study provide a better understanding of the nonlinear dynamics of aerodynamic grooved journal bearing systems

  18. High Excitation Efficiency of Channel Plasmon Polaritons in Tailored, UV-Lithography-Defined V-Grooves

    DEFF Research Database (Denmark)

    Smith, Cameron; Thilsted, Anil Haraksingh; Garcia-Ortiz, Cesar E.

    2014-01-01

    We demonstrate >50% conversion of light to V-groove channel plasmon-polaritons (CPPs) via compact waveguide-termination mirrors. Devices are fabricated using UV-lithography and crystallographic silicon etching. The V-shape is tailored by thermal oxidation to support confined CPPs.......We demonstrate >50% conversion of light to V-groove channel plasmon-polaritons (CPPs) via compact waveguide-termination mirrors. Devices are fabricated using UV-lithography and crystallographic silicon etching. The V-shape is tailored by thermal oxidation to support confined CPPs....

  19. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  20. Non-Covalent Interactions: Complexes of Guanidinium with DNA and RNA Nucleobases

    Czech Academy of Sciences Publication Activity Database

    Blanco, F.; Kelly, B.; Sanchez-Sanz, Goar; Trujillo, Cristina; Alkorta, I.; Elguero, J.; Rozas, I.

    2013-01-01

    Roč. 117, č. 39 (2013), s. 11608-11616 ISSN 1520-6106 Grant - others:Seventh Framework Programme of the European Union(XE) FP7-274988 People Institutional support: RVO:61388963 Keywords : molecular -orbital methods * cation-pi interactions * minor-groove binders Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.377, year: 2013

  1. Strong and weak hydrogen bonds in drug–DNA complexes: A ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    minor groove-binding interactions are electrostatic, van der Waals, hydrophobic ... the protein data bank (PDB) and the nucleic acid data bank. (NDB) (Berman et al ... is defined as an interaction X–H···A wherein a hydrogen atom forms a bond ...

  2. Defining minors' abortion rights.

    Science.gov (United States)

    Rhodes, A M

    1988-01-01

    The right to abortion is confirmed in the Roe versus Wade case, by the US Supreme Court. It is a fundamental right of privacy but not an absolute right, and must consider state interests. During the first trimester of pregnancy abortion is a decision of the woman and her doctor. During the second trimester of pregnancy the state may control the abortion practice to protect the mothers health, and in the last trimester, it may prohibit abortion, except in cases where the mother's life or health are in danger. The states enacted laws, including one that required parents to give written consent for a unmarried minor's abortion. This law was struck down by the US Court, but laws on notification were upheld as long as there was alternative procedures where the minor's interests are upheld. Many of these law have been challenged successfully, where the minor was judged mature and where it served her best interests. The state must enact laws on parental notification that take into consideration basic rights of the minor woman. Health professionals and workers should be aware of these laws and should encourage the minor to let parents in on the decision making process where possible.

  3. Observations on the effects of grooved surfaces on the interfacial torque in highly loaded rolling and sliding tests

    DEFF Research Database (Denmark)

    Janakiraman, Shravan; Klit, Peder; Jensen, Niels Steenfeldt

    2014-01-01

    Some efforts have been undertaken to study the effects of grooved surfaces on the interfacial film thickness and torque between two contacting non-conformal surfaces under heavy loads. Transverse grooves of micrometer scale depth were engraved on polished, flat ring surfaces using established ind...

  4. Modeling and simulation of stamp deflections in nanoimprint lithography: Exploiting backside grooves to enhance residual layer thickness uniformity

    DEFF Research Database (Denmark)

    Taylor, Hayden; Smistrup, Kristian; Boning, Duane

    2011-01-01

    We describe a model for the compliance of a nanoimprint stamp etched with a grid of backside grooves. We integrate the model with a fast simulation technique that we have previously demonstrated, to show how etched grooves help reduce the systematic residual layer thickness (RLT) variations...

  5. Teaching minority children hygiene

    DEFF Research Database (Denmark)

    Rheinländer, Thilde; Samuelsen, Helle; Dalsgaard, Anders

    2015-01-01

    infrastructures were important barriers for the implementation of safe home child hygiene. Furthermore, the everyday life of highland villages, with parents working away from the households resulted in little daily adult supervision of safe child hygiene practices. While kindergartens were identified......Objectives. Ethnic minority children in Vietnam experience high levels of hygiene- and sanitation-related diseases. Improving hygiene for minority children is therefore vital for improving child health. The study objective was to investigate how kindergarten and home environments influence...... children were further disadvantaged as teaching was only provided in non-minority language. Conclusions. Kindergartens can be important institutions for the promotion of safe hygiene practices among children, but they must invest in the maintenance of hygiene and sanitation infrastructures and adopt...

  6. Investigation on the toxic interaction of typical plasticizers with calf thymus DNA

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Xiaojing [School of Environmental Science and Engineering, China–America CRC for Environment & Health, Shandong University, 27# Shanda South Road, Jinan 250100, Shandong Province (China); Zong, Wansong, E-mail: gaocz@sdu.edu.cn [College of Population, Resources and Environment, Shandong Normal University, 88# East Wenhua Road, Jinan 250014 (China); Liu, Chunguang; Liu, Yang [School of Environmental Science and Engineering, China–America CRC for Environment & Health, Shandong University, 27# Shanda South Road, Jinan 250100, Shandong Province (China); Gao, Canzhu, E-mail: rutaoliu@sdu.edu.cn [School of Environmental Science and Engineering, China–America CRC for Environment & Health, Shandong University, 27# Shanda South Road, Jinan 250100, Shandong Province (China); Liu, Rutao [School of Environmental Science and Engineering, China–America CRC for Environment & Health, Shandong University, 27# Shanda South Road, Jinan 250100, Shandong Province (China)

    2015-05-15

    The interactions of typical plasticizers dimethyl phthalate (DMP), diethyl phthalate (DEP) and dibutyl phthalate (DBP) with calf thymus DNA (ctDNA) were investigated by fluorescence spectroscopic techniques and molecular modeling. Experimental results indicated that the characteristic fluorescence intensity of phthalic acid rose with the increase of DNA concentration; while the characteristic fluorescence intensities of plasticizers decreased with the increase of DNA concentration. Experiments on native and denatured DNA determined that plasticizers interacted with DNA both in groove and electrostatic binding mode. The molecular modeling results further illustrated that there is groove binding between them; hydrogen bonding and Van der Waals interactions were the main forces. With the extension of branched-chains, the binding effects between plasticizers and DNA were weakened, which could be related to the increased steric hindrance. - Highlights: • This work established the binding mode of plasticizers with DNA on molecular level. • The mechanism was explored by fluorescence spectroscopic and molecular docking methods. • There are two kinds of binding mode between DMP, DEP, DBP and DNA, electrostatic and groove. • With the branched chain extension, the binding effect of plasticizers and DNA has been weakened.

  7. Energetic studies on DNA-peptide interaction in relation to the enthalpy-entropy compensation paradox.

    Science.gov (United States)

    Yang, Robin C K; Huang, Jonathan T B; Chien, Shih-Chuan; Huang, Roy; Jeng, Kee-Ching G; Chen, Yen-Chung; Liao, Mokai; Wu, Jia-Rong; Hung, Wei-Kang; Hung, Chia-Chun; Chen, Yu-Ling; Waring, Michael J; Sheh, Leung

    2013-01-07

    This study aims to interpret the energetic basis of complex DNA-peptide interactions according to a novel allosteric interaction network approach. In common with other designed peptides, five new conjugates incorporating the XPRK or XHypRK motif (Hyp = hydroxyproline) attached to a N-methylpyrrole (Py) tract with a basic tail have been found to display cooperative binding to DNA involving multiple monodentate as well as interstrand bidentate interactions. Using quantitative DNase I footprinting it appears that allosteric communication via cooperative binding to multiple sites on complementary DNA strands corresponds to two different types of DNA-peptide interaction network. Temperature variation experiments using a dodecapeptide RY-12 show that lower temperature (25 °C) favor a circuit type of allosteric interaction network, whereas higher temperatures (31 and 37 °C) afford only a partial-circuit type of network. Circular dichroism studies show that our five peptides induce significant local conformational changes in DNA via the minor groove, with apparently dimeric binding stoichiometry. Isothermal titration calorimetry reveals that these peptides, together with another seven for comparison, are strongly exothermic upon binding to a model 13-mer DNA duplex, characterized by ΔH ranging from -14.7 to -74.4 kcal mol(-1), and also high TΔS ranging from -6.5 to -65.9 kcal mol(-1). Multiple monodentate and bidentate interactions, as well as ionic forces that mediate positive cooperativity in sequence recognition, are consistent with a dramatic decrease in entropy and a 'tightening' effect of DNA conformation. Distinctive enthalpy-entropy compensation (EEC) relationships are demonstrated for the interaction of all twelve designed peptides with DNA, affording a straight line of slope close to unity when ΔH is plotted versus TΔS, with a y-axis intercept (average ΔG) corresponding to -8.5 kcal mol(-1), while the observed ΔG ranges from -8.2 to -9.1 kcal mol(-1) for

  8. SEBACEOUS CYSTS MINOR SURGERY

    Directory of Open Access Journals (Sweden)

    I Gusti Ayu Agung Laksemi

    2013-12-01

    Full Text Available Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 Minor surgery is small surgery or localized example cut ulcers and boils, cyst excision, and suturing. Somethings that need to be considered in the preparation of the surgery is minor tools, operating rooms and operating tables, lighting, maintenance of tools and equipment, sterilization and desinfection equipment, preparation of patients and anesthesia. In general cysts is walled chamber that consist of fluid, cells and the remaining cells. Cysts are formed not due to inflammation although then be inflamed. Lining of the cysts wall is composed of fibrous tissue and usually coated epithelial cells or endothelial. Cysts formed by dilated glands and closed channels, glands, blood vessels, lymph channels or layers of the epidermis. Contents of the cysts wall consists of the results is serum, lymph, sweat sebum, epithelial cells, the stratum corneum, and hair. /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0in 5.4pt 0in 5.4pt; mso-para-margin:0in; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;}

  9. Analysis of GAA/TTC DNA triplexes using nuclear magnetic resonance and electrospray ionization mass spectrometry.

    Science.gov (United States)

    Mariappan, S V Santhana; Cheng, Xun; van Breemen, Richard B; Silks, Louis A; Gupta, Goutam

    2004-11-15

    The formation of a GAA/TTC DNA triplex has been implicated in Friedreich's ataxia. The destabilization of GAA/TTC DNA triplexes either by pH or by binding to appropriate ligands was analyzed by nuclear magnetic resonance (NMR) and positive-ion electrospray mass spectrometry. The triplexes and duplexes were identified by changes in the NMR chemical shifts of H8, H1, H4, 15N7, and 15N4. The lowest pH at which the duplex is detectable depends upon the overall stability and the relative number of Hoogsteen C composite function G to T composite function A basepairs. A melting pH (pHm) of 7.6 was observed for the destabilization of the (GAA)2T4(TTC)2T4(CTT)2 triplex to the corresponding Watson-Crick duplex and the T4(CTT)2 overhang. The mass spectrometric analyses of (TTC)6.(GAA)6 composite function(TTC)6 triplex detected ions due to both triplex and single-stranded oligonucleotides under acidic conditions. The triplex ions disappeared completely at alkaline pH. Duplex and single strands were detectable only at neutral and alkaline pH values. Mass spectrometric analyses also showed that minor groove-binding ligands berenil, netropsin, and distamycin and the intercalating ligand acridine orange destabilize the (TTC)6.(GAA)6 composite function (TTC)6 triplex. These NMR and mass spectrometric methods may function as screening assays for the discovery of agents that destabilize GAA/TTC triplexes and as general methods for the characterization of structure, dynamics, and stability of DNA and DNA-ligand complexes.

  10. Saying Hello World with GROOVE - A Solution to the TTC 2011 Instructive Case

    Directory of Open Access Journals (Sweden)

    Amir Hossein Ghamarian

    2011-11-01

    Full Text Available This report presents a solution to the Hello World case study of TTC 2011 using GROOVE. We provide and explain the grammar that we used to solve the case study. Every requested question of the case study was solved by a single rule application.

  11. Saying Hello World with GROOVE - A Solution to the TTC 2011 Instructive Case

    NARCIS (Netherlands)

    Ghamarian, A.H.; de Mol, M.J.; Rensink, Arend; Zambon, Eduardo; van Gorp, Pieter; Mazanek, Steffen; Rose, Louis

    2011-01-01

    This report presents a solution to the Hello World case study using GROOVE. We provide and explain the grammar that we used to solve the case study. Every requested question of the case study was solved by a single rule application.

  12. Measurement repeatability of tibial tuberosity-trochlear groove offset distance in red fox (Vulpes vulpes) cadavers

    NARCIS (Netherlands)

    Miles, J.E.; Jensen, B.R.; Kirpensteijn, J.; Svalastoga, E.L.; Eriksen, T.

    2013-01-01

    Abstract OBJECTIVE: To describe CT image reconstruction criteria for measurement of the tibial tuberosity-trochlear groove (TT-TG) offset distance, evaluate intra- and inter-reconstruction repeatability, and identify key sources of error in the measurement technique, as determined in vulpine hind

  13. Erosion of a grooved surface caused by impact of particle-laden flow

    Science.gov (United States)

    Jung, Sohyun; Yang, Eunjin; Kim, Ho-Young

    2016-11-01

    Solid erosion can be a life-limiting process for mechanical elements in erosive environments, thus it is of practical importance in many industries such as construction, mining, and coal conversion. Erosion caused by particle-laden flow occurs through diverse mechanisms, such as cutting, plastic deformation, brittle fracture, fatigue and melting, depending on particle velocity, total particle mass and impingement angle. Among a variety of attempts to lessen erosion, here we investigate the effectiveness of millimeter-sized grooves on the surface. By experimentally measuring the erosion rates of smooth and triangular-grooved surfaces under various impingement angles, we find that erosion can be significantly reduced within a finite range of impingement angles. We show that such erosion resistance is attributed to the swirls of air within grooves and the differences in erosive strength of normal and slanted impact. In particular, erosion is mitigated when we increase the effective area under normal impact causing plastic deformation and fracture while decreasing the area under slanted impact that cuts the surface to a large degree. Our quantitative model for the erosion rate of grooved surfaces considering the foregoing effects agrees with the measurement results.

  14. Optimal leaf sequencing with elimination of tongue-and-groove underdosage

    International Nuclear Information System (INIS)

    Kamath, Srijit; Sahni, Sartaj; Palta, Jatinder; Ranka, Sanjay; Li, Jonathan

    2004-01-01

    The individual leaves of a multileaf collimator (MLC) have a tongue-and-groove or stepped-edge design to minimize leakage radiation between adjacent leaves. This design element has a drawback in that it creates areas of underdosages in intensity-modulated photon beams unless a leaf trajectory is specifically designed such that for any two adjacent leaf pairs, the direct exposure under the tongue-and-groove is equal to the lower of the direct exposures of the leaf pairs. In this work, we present a systematic study of the optimization of a leaf sequencing algorithm for segmental multileaf collimator beam delivery that completely eliminates areas of underdosages due to tongue-and-groove or stepped-edge design of the MLC. Simultaneous elimination of tongue-and-groove effect and leaf interdigitation is also studied. This is an extension of our previous work (Kamath et al 2003a Phys. Med. Biol. 48 307) in which we described a leaf sequencing algorithm that is optimal for monitor unit (MU) efficiency under most common leaf movement constraints that include minimum leaf separation. Compared to our previously published algorithm (without constraints), the new algorithms increase the number of sub-fields by approximately 21% and 25%, respectively, but are optimal in MU efficiency for unidirectional schedules. (note)

  15. Torque scaling in small-gap Taylor-Couette flow with smooth or grooved wall

    Science.gov (United States)

    Zhu, Bihai; Ji, Zengqi; Lou, Zhengkun; Qian, Pengcheng

    2018-03-01

    The torque in the Taylor-Couette flow for radius ratios η ≥0.97 , with smooth or grooved wall static outer cylinders, is studied experimentally, with the Reynolds number of the inner cylinder reaching up to Rei=2 ×105 , corresponding to the Taylor number up to Ta =5 ×1010 . The grooves are perpendicular to the mean flow, and similar to the structure of a submersible motor stator. It is found that the dimensionless torque G , at a given Rei and η , is significantly greater for grooved cases than smooth cases. We compare our experimental torques for the smooth cases to the fit proposed by Wendt [F. Wendt, Ing.-Arch. 4, 577 (1993), 10.1007/BF02084936] and the fit proposed by Bilgen and Boulos [E. Bilgen and R. Boulos, J Fluids Eng. 95, 122 (1973), 10.1115/1.3446944], which shows both fits are outside their range for small gaps. Furthermore, an additional dimensionless torque (angular velocity flux) N uω in the smooth cases exhibits an effective scaling of N uω˜T a0.39 in the ultimate regime, which occurs at a lower Taylor number, Ta ≈3.5 ×107 , than the well-explored η =0.714 case (at Ta ≈3 ×108 ). The same effective scaling exponent, 0.39, is also evident in the grooved cases, but for η =0.97 and 0.985, there is a peak before this exponent appears.

  16. Effect of longitudinal grooves of the scallop surface on aerodynamic performance

    International Nuclear Information System (INIS)

    Kim, Tae Hun; Choi, Hae Cheon

    2008-01-01

    Some of the scallops like Amesium balloti have an excellent level-swimming ability, i.e. they can swim about 20m by single level swimming with a maximum swimming velocity of about 1.6m/s in the sea. On the other hand, some species like Patinopecten yessoensis have longitudinal grooves on the upper and lower surfaces and others do not. Therefore, in the present study, we measure the lift and drag forces on a real scallop model (Patinopecten yessoensis) in a wind tunnel. Experiments are performed at the Reynolds number of 75,000 based on the maximum chord length, which is within the swimming condition of real scallop (Re=30,000∼300,000). To see the effect of longitudinal grooves, we measure the aerodynamic forces on a scallop model by removing the grooves. With the grooves, the lift force increases at low angles of attack (α<10 .deg.). The drag force increases slightly at all the attack angles considered. The lift-to-drag ratio is increased by about 10% at α<10 .deg.

  17. Nanoscale Plasmonic V-Groove Waveguides for the Interrogation of Single Fluorescent Bacterial Cells

    DEFF Research Database (Denmark)

    Lotan, Oren; Bar-David, Jonathan; Smith, Cameron

    2017-01-01

    We experimentally demonstrate the interrogation of an individual Escherichia coli cell using a nanoscale plasmonic V-groove waveguide. Several different configurations were studied. The first involved the excitation of the cell in a liquid environment because it flows on top of the waveguide...

  18. Formation of grooves during the breakdown of a coal block by a water jet

    Energy Technology Data Exchange (ETDEWEB)

    Shavlovskii, S.S.

    1979-02-01

    A description is given of a method of coal excavation which provides for the initial formation of a grooved slit along the width of the opening equal in height to the diameter of the sinkhole. The formation of a groove in the coal block and the excavation of coal by water jets using the grooved crater method are illustrated in diagrams. Data are given on changes in the performance of the hydraulic jet in coal excavation in relation to the distance between the nozzle and the face and at given pressures in front of the nozzle. Functional relationships were mathematically constructed for the performance of the water jet in dimensionless coordinates. Data are also given on the comparative performance of a water jet when coal is excavated by the grooved funnel method and by hydraulic fracturing. The analytical computations indicate that the hydraulic fracturing of a coal block by water jets is economical with respect to the consumption of electric power and the unit rate of coal extraction, in addition to being a safe method. 4 references, 4 figures, 2 tables.

  19. Excitation of fluorescent nanoparticles by channel plasmon polaritons propagating in V-grooves

    DEFF Research Database (Denmark)

    Cuesta, Irene Fernandez; Nielsen, Rasmus Bundgaard; Boltasseva, Alexandra

    2009-01-01

    Recently, it has been proven that light can be squeezed into metallic channels with subwavelength lateral dimensions. Here, we present the study of the propagation of channel plasmon polaritons confined in gold V-grooves, filled with fluorescent particles. In this way, channel plasmon polaritons......-diameter beads, we show the possibility of individual excitation, what may have applications to develop very sensitive biosensors....

  20. Optimal leaf sequencing with elimination of tongue-and-groove underdosage

    Energy Technology Data Exchange (ETDEWEB)

    Kamath, Srijit [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Sahni, Sartaj [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Palta, Jatinder [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States); Ranka, Sanjay [Department of Computer and Information Science and Engineering, University of Florida, Gainesville, FL (United States); Li, Jonathan [Department of Radiation Oncology, University of Florida, Gainesville, FL (United States)

    2004-02-07

    The individual leaves of a multileaf collimator (MLC) have a tongue-and-groove or stepped-edge design to minimize leakage radiation between adjacent leaves. This design element has a drawback in that it creates areas of underdosages in intensity-modulated photon beams unless a leaf trajectory is specifically designed such that for any two adjacent leaf pairs, the direct exposure under the tongue-and-groove is equal to the lower of the direct exposures of the leaf pairs. In this work, we present a systematic study of the optimization of a leaf sequencing algorithm for segmental multileaf collimator beam delivery that completely eliminates areas of underdosages due to tongue-and-groove or stepped-edge design of the MLC. Simultaneous elimination of tongue-and-groove effect and leaf interdigitation is also studied. This is an extension of our previous work (Kamath et al 2003a Phys. Med. Biol. 48 307) in which we described a leaf sequencing algorithm that is optimal for monitor unit (MU) efficiency under most common leaf movement constraints that include minimum leaf separation. Compared to our previously published algorithm (without constraints), the new algorithms increase the number of sub-fields by approximately 21% and 25%, respectively, but are optimal in MU efficiency for unidirectional schedules. (note)

  1. Ledges and grooves at γ/γ′ interfaces of single crystal superalloys

    Czech Academy of Sciences Publication Activity Database

    Parsa, A. B.; Wollgramm, P.; Buck, H.; Kostka, A.; Somsen, C.; Dlouhý, Antonín; Eggeler, G.

    2015-01-01

    Roč. 90, MAY (2015), s. 105-117 ISSN 1359-6454 R&D Projects: GA ČR(CZ) GA14-22834S Institutional support: RVO:68081723 Keywords : Ni-base single crystal superalloys * γ/γ′ interfaces * Interface dislocations * Rafting * Grooves Subject RIV: JG - Metallurgy Impact factor: 5.058, year: 2015

  2. Does Loading Influence the Severity of Cartilage Degeneration in the Canine Groove-Model of OA?

    NARCIS (Netherlands)

    Vos, Petra; Intema, Femke; van El, Benno; DeGroot, Jeroen; Bijlsma, J. W. J.; Lafeber, Floris; Mastbergen, Simon

    2009-01-01

    Many animal models are used to study osteoarthritis (OA). In these models the role of joint loading in the development of CA is not fully understood. We studied the effect of loading on the development of CIA in the canine Groove-model. In ten female beagle dogs OA was induced in one knee according

  3. Research on Grooved Concrete Pavement Based on the Durability of Its Anti-Skid Performance

    Directory of Open Access Journals (Sweden)

    Mulian Zheng

    2018-05-01

    Full Text Available The objectives of the present study are to investigate the anti-skid performance of concrete pavement and to attempt to enhance its durability by two different methods: using a longitudinally-transversely grooved (LT form, and using a self-developed composite curing agent containing paraffin and Na2SiO3 as the main ingredients. The friction coefficient (μ was measured by self-developed equipment to evaluate the anti-skid performance of samples with three different groove forms (LT, longitudinally grooved (L, and transversely grooved (T. Abrasion tests were then carried out to evaluate the durability of the anti-skid performance. The results indicated that anti-skid performance of LT samples was approximately 46.2% greater than that of T samples, but its durability was not as significant as that of T samples. However, the resistance to abrasion could be improved by using the aforementioned curing agent. Comparisons were carried out between samples sprayed the curing agent and control samples without any curing agent under standard conditions. It was found that the application of the curing agent increased the anti-skid durability of concrete by 35.4%~47.8%, proving it to be a useful and promising technique.

  4. Biomimetic "Cactus Spine" with Hierarchical Groove Structure for Efficient Fog Collection.

    Science.gov (United States)

    Bai, Fan; Wu, Juntao; Gong, Guangming; Guo, Lin

    2015-07-01

    A biomimetic "cactus spine" with hierarchical groove structure is designed and fabricated using simple electrospinning. This novel artificial cactus spine possesses excellent fog collection and water transportation ability. A model cactus equipped with artificial spines also shows a great water storage capacity. The results can be helpful in the development of water collectors and may make a contribution to the world water crisis.

  5. Study of Mastoid Canals and Grooves in North Karnataka Human Skulls

    OpenAIRE

    Hadimani, Gavishiddappa Andanappa; Bagoji, Ishwar Basavantappa

    2013-01-01

    Introduction: This study was undertaken to observe the frequency of mastoid canals and grooves in north Karnataka dry human skulls. 100 dry human skulls of unknown age and sex from the department of Anatomy were selected and observed for the present study.

  6. A surface embossing technique to create micro-grooves on an aluminum fin stock for drainage enhancement

    International Nuclear Information System (INIS)

    Liu Liping; Jacobi, Anthony M; Chvedov, Dmitri

    2009-01-01

    Recent advances using a surface embossing technique allow us to inexpensively impart micro-scale surface features on heat exchanger construction material, which we exploit to reduce condensate retention. The retention of condensate is important to the performance of heat exchangers in a broad range of air-cooling and dehumidification applications. We report a study of wetting behavior and drainage performance on a series of embossed surfaces with different micro-groove dimensions. Static contact angles, critical sliding angles, droplet aspect ratios, etc, are reported with detailed surface topographical information. Our results show that unless the spacing between grooves is very large (>100 µm), the parallel-grooved surface feature normally increases the apparent contact angle of a droplet on the surface. The micro-groove structure causes anisotropic wetting behavior of the droplets, and apparent contact angles measured by viewing along with the micro-grooves (θ p erpendicular) were found to be larger than those measured from the other direction (θ || ) (by viewing perpendicular to the grooves). A consistent reduction of a critical sliding angle was observed on surfaces after embossing (the micro-grooves are aligned to be parallel with gravity). This may be due to contact line discontinuities and contact-line pinning induced by a groove structure of the surface. Water droplets exhibit an elongated shape along the micro-grooves, which is in contrast to the nearly circular base contour observed on an isotropic surface. Smaller groove spacing, larger depth and steeper sidewalls are observed to be favorable for drainage enhancement and recommended as design guidelines in the future

  7. TR-PIV measurement of the wake behind a grooved cylinder at low Reynolds number

    Science.gov (United States)

    Liu, Ying Zheng; Shi, Liu Liu; Yu, Jun

    2011-04-01

    A comparative study of the wakes behind cylinders with grooved and smooth surfaces was performed with a view to understand the wake characteristics associated with the adult Saguaro cacti. A low-speed recirculation water channel was established for the experiment; the Reynolds number, based on the free-stream velocity and cylinder diameter (D), was kept at ReD=1500. State-of-the-art time-resolved particle image velocimetry (TR-PIV) was employed to measure a total of 20 480 realizations of the wake field at a frame rate of 250 Hz, enabling a comprehensive view of the time- and phase-averaged wake pattern. In comparison to the wake behind the smooth cylinder, the length of the recirculation zone behind the grooved cylinder was extended by nearly 18.2%, yet the longitudinal velocity fluctuation intensity was considerably weakened. A global view of the peaked spectrum of the longitudinal velocity component revealed that the intermediate region for the grooved cylinder, which approximately corresponds to the transition region where the shear layer vortices interact, merge and shed before the formation of the Karman-like vortex street, was much wider than that for the smooth one. The unsteady events near St=0.3-0.4 were detected in the intermediate region behind the grooved cylinder, but no such events were found in the smooth cylinder system. Although the formation of the Karman-like vortex street was delayed by about 0.6D downstream for the grooved cylinder, no prominent difference in the vortex street region was found in the far wake for both cylinders. The Proper Orthogonal Decomposition (POD) method was used extensively to decompose the vector and swirling strength fields, which gave a close-up view of the vortices in the near wake. The first two POD modes of the swirling strength clarified the spatio-temporal characteristics of the shear layer vortices behind the grooved cylinder. The small-scale vortices superimposed on the shear layers behind the grooved cylinder

  8. Housing Problems of Minorities

    Science.gov (United States)

    Weaver, Robert

    1975-01-01

    This testimony, before a public hearing of the New York City Commission on Human Rights in May 1974, reviews the status of minority group housing and the effects of federal programs upon it, advocating an approach which recognizes the intrinsic locational and real estate value of many black ghettos. (Author/JM)

  9. Minority Language Teaching

    NARCIS (Netherlands)

    Monique Turkenburg

    2001-01-01

    Original title: Onderwijs in alochtone levende talen. At the request of the Dutch Ministry of Education, Culture and Science, an exploratory study was carried out of minority Language teaching for primary school pupils. This exploratory study in seven municipalities not only shows the way in

  10. Ethnic Minorities and Integration

    NARCIS (Netherlands)

    Mérove Gijsberts

    2005-01-01

    There has been a great deal of discussion in the Netherlands recently about the integration of ethnic minorities. The tenor of that discussion is sombre: some observers speak of a 'multicultural drama', while others claim that the government's integration policy has failed completely. Recent

  11. Becoming (ethnic minority) teenagers

    DEFF Research Database (Denmark)

    Tørslev, Mette Kirstine; Nørredam, Marie Louise; Vitus, Kathrine

    2017-01-01

    and majority students in two school classes from the fifth to seventh grades. Taking a practice approach, the article first analyses school as a social site before turning phenomenological attention to experiences and expectations of becoming teenagers, focusing on the experiences of ethnic minority students...

  12. Britain's Ethnic Minorities.

    Science.gov (United States)

    Central Office of Information, London (England).

    This pamphlet discusses the situation of ethnic minorities--particularly those of Caribbean, Asian, or African origin--in the United Kingdom. Following introductory material, the background to immigration in Britain is described and the numbers and geographic distribution of the different ethnic groups are discussed. Next comes a general…

  13. DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

    Science.gov (United States)

    Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

    2008-01-01

    We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

  14. Helical chirality: a link between local interactions and global topology in DNA.

    Directory of Open Access Journals (Sweden)

    Youri Timsit

    Full Text Available DNA supercoiling plays a major role in many cellular functions. The global DNA conformation is however intimately linked to local DNA-DNA interactions influencing both the physical properties and the biological functions of the supercoiled molecule. Juxtaposition of DNA double helices in ubiquitous crossover arrangements participates in multiple functions such as recombination, gene regulation and DNA packaging. However, little is currently known about how the structure and stability of direct DNA-DNA interactions influence the topological state of DNA. Here, a crystallographic analysis shows that due to the intrinsic helical chirality of DNA, crossovers of opposite handedness exhibit markedly different geometries. While right-handed crossovers are self-fitted by sequence-specific groove-backbone interaction and bridging Mg(2+ sites, left-handed crossovers are juxtaposed by groove-groove interaction. Our previous calculations have shown that the different geometries result in differential stabilisation in solution, in the presence of divalent cations. The present study reveals that the various topological states of the cell are associated with different inter-segmental interactions. While the unstable left-handed crossovers are exclusively formed in negatively supercoiled DNA, stable right-handed crossovers constitute the local signature of an unusual topological state in the cell, such as the positively supercoiled or relaxed DNA. These findings not only provide a simple mechanism for locally sensing the DNA topology but also lead to the prediction that, due to their different tertiary intra-molecular interactions, supercoiled molecules of opposite signs must display markedly different physical properties. Sticky inter-segmental interactions in positively supercoiled or relaxed DNA are expected to greatly slow down the slithering dynamics of DNA. We therefore suggest that the intrinsic helical chirality of DNA may have oriented the early

  15. Triage of HR-HPV positive women with minor cytological abnormalities: a comparison of mRNA testing, HPV DNA testing, and repeat cytology using a 4-year follow-up of a population-based study.

    Science.gov (United States)

    Persson, Maria; Elfström, K Miriam; Brismar Wendel, Sophia; Weiderpass, Elisabete; Andersson, Sonia

    2014-01-01

    Expression of the viral E6/E7 oncogenes of high-risk human papillomaviruses (HR-HPV) is necessary for malignant conversion and maintenance in cervical tissue. In order to determine whether HR-HPV E6/E7 mRNA testing more effectively predicts precancerous lesions and invasive cervical cancer than HR-HPV DNA testing, we aimed to compare triage using HR-HPV E6/E7 mRNA testing by APTIMA HPV Assay (APTIMA) to HPV16 DNA testing, HPV16/18 DNA testing, and repeat cytology. Liquid-based (PreservCyt) cell samples were obtained from HR-HPV-positive women diagnosed with atypical squamous cells of undetermined significance (ASCUS) and low-grade squamous intraepithelial lesions (LSIL) within the framework of the population-based cervical cancer screening program in Stockholm, Sweden. Samples were tested for HR-HPV E6/E7 mRNA by APTIMA (Gene-Probe Inc., San Diego, CA, USA). Women were followed up for 4 years after the index cytology via medical and laboratory records, and the Stockholm Oncology Center. Nine of 25 (36%) women in the ASCUS group, and 64 of 180 (36%) women in the LSIL group developed cervical intraepithelial neoplasia (CIN) grade 2 or worse during 4 years of follow-up. 162 (74%) women were APTIMA-positive, and APTIMA had the highest sensitivity to predict CIN2 or worse and CIN3 or worse in the ASCUS (77.8% and 100%) and LSIL (78.1 and 75.8%) groups, although specificity was insufficient (cytology were more specific than APTIMA. The results of this population-based study with comprehensive follow-up support the use of APTIMA as a triage test for women with ASCUS. More focused investigation is required for women with LSIL.

  16. Validation of eDNA markers for New Zealand mudsnail surveillance and initial eDNA monitoring at Mississippi River Basin sites

    Science.gov (United States)

    Merkes, Christopher; Turnquist, Keith N.; Rees, Christopher B.; Amberg, Jon J.

    2015-01-01

    The performance of newly developed New Zealand mudsnail (Potamopyrgus antipodarum; NZMS) genetic markers for environmental (eDNA) analysis of water were compared across two laboratories. The genetic markers were tested in four quantitative polymerase chain reaction assays targeting two regions of the NZMS mitochondrial genome, specifically the cytochrome c oxidase subunit 1 (coi) and cytochrome b (cytb) genes. In a blind study, analysts tested each sample eight times with each assay. There were 10 expected-negative samples from the Black River in La Crosse, Wisconsin, 10 expected-positive samples from the Black Earth Creek in Black Earth, Wisconsin, and 10 known-positive samples from the Black River spiked with NZMS DNA. Previously extracted samples, kept at the Upper Midwest Environmental Sciences Center, were pooled by sample location and then equal quantities were distributed between the Upper Midwest Environmental Sciences Center and the Molecular Conservation Genetics Laboratory at the University of Wisconsin-Stevens Point for analysis. The assays tested were (1) the assay targeting cytb with a minor groove binder probe described by Goldberg and others (2013), (2) the cytb assay with a modified double-quenched probe, (3) an assay targeting coi with a double-quenched probe, and (4) a duplex reaction combining the modified cytb assay and the coi assay. Samples were considered positive for the presence of NZMS DNA when quantitative polymerase chain reaction amplification and probe signal was higher than the normalized threshold value above baseline fluorescence. For the duplex assay, samples were considered positive only when both probe signals were higher than the normalized threshold value above baseline fluorescence. Positive results were then confirmed by sequencing the products.

  17. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...

  18. Getting into the GROOVE: How Building Effective Education Partnerships and Promoting Authentic Student Research through the Girls' Remotely Operated Ocean Vehicle Exploration (GROOVE) Workshop.

    Science.gov (United States)

    Pelz, M.; Heesemann, M.; Hoeberechts, M.

    2017-12-01

    This presentation outlines the pilot year of Girls' Remotely Operated Ocean Vehicle Exploration or GROOVE, a hands-on learning program created collaboratively with education partners Ocean Networks Canada and St. Margaret's School (Victoria, BC, Canada). The program features student-led activities, authentic student experiences, clearly outlined learning outcomes, teacher and student self-assessment tools, and curriculum-aligned content. Presented through the lens of STEM, students build a modified Seaperch ROV and explore and research thematic scientific concepts such as buoyancy, electronic circuitry, and deep-sea exploration. Further, students learn engineering skills such as isotropic scaling, soldering, and assembly as they build their ROV. Ocean Networks Canada (ONC), an initiative of the University of Victoria, develops, operates, and maintains cabled ocean observatory systems. These include technologies developed on the world-leading NEPTUNE and VENUS observatories and the ever-expanding network of community observatories in the Arctic and coastal British Columbia. These observatories, large and small, enable communities, users, scientists, teachers, and students to monitor real-time and historical data from the local marine environment from anywhere on the globe. GROOVE, Girls' Remotely Operated Ocean Vehicle Exploration, is ONC's newest educational program and is related to their foundational program K-12 Ocean Sense educational program. This presentation will share our experiences developing, refining, and assessing our efforts to implement GROOVE using a train-the-trainer model aimed at formal and informal K-12 educators. We will highlight lessons learned from multiple perspectives (students, participants, developers, and mentors) with the intent of informing future education and outreach initiatives.

  19. High affinity RNA targeting by oligonucleotides displaying aromatic stacking and amino groups in the major groove. Comparison of triazoles and phenylsubstituents

    DEFF Research Database (Denmark)

    Kumar, Pawan; Hornum, Mick; Nielsen, Lise Junker

    2014-01-01

    Three 5-modified 2'-deoxyuridine nucleosides were synthesized and incorporated into oligonucleotides and compared with the previously published 5-(1-phenyl-1,2,3-triazol-4-yl)-2'-deoxyuridine monomer W. The introduction of an aminomethyl group on the phenyl group led to monomer X, which was found...... to thermally stabilize a 9-mer DNA:RNA duplex, presumably through the partial neutralization of the negative charge of the backbone. By also taking advantage of the stacking interactions in the major groove of two or more of the monomer X, an extremely high thermal stability was obtained. A regioisomer...... monomer Z was incorporated for comparison, and it was found to give a more neutral influence on duplex stability indicating less efficient stacking interactions. The duplexes were investigated by CD spectroscopy and MD simulations....

  20. Study on the Correlation Between Dynamical Behavior and Friction/Wear Mechanism Under the Effect of Grooves

    Science.gov (United States)

    Zhu, Z. Y.; Mo, J. L.; Wang, D. W.; Zhao, J.; Zhu, M. H.; Zhou, Z. R.

    2018-04-01

    In this work, the interfacial friction and wear and vibration characteristics are studied by sliding a chromium bearing steel ball (AISI 52100) over both multi-grooved and single-grooved forged steel disks (20CrMnMo) at low and high rotating speeds in order to reveal the effect mechanism of groove-textured surface on tribological behaviors. The results show that the grooves modify the contact state of the ball and the disk at the contact interface. This consequently causes variations in the normal displacement, normal force, and friction force signals. The changes in these three signals become more pronounced with increasing groove width at a low speed. The collision behavior between the ball and the groove increase the amplitude of vibration acceleration at a high speed. The test results suggest that grooves with appropriate widths could trap wear debris on the ball surface while avoiding a strong collision between the disk and the ball, resulting in an improvement in the wear states.

  1. Trial design and manufacture of double spiral grooved vacuum pump; Double neji mizoshiki shinku pump no shisaku

    Energy Technology Data Exchange (ETDEWEB)

    Iguchi, M.; Sawada, T.; Sugiyama, W. [Akita University, Akita (Japan). Faculty of Mining; Watanabe, M.

    1997-04-25

    A spiral grooved vacuum pump and a compound molecular pump (the combination of a spiral grooved pump and a turbomolecular pump) are widely used in the thin-film industry for processes such as semiconductor production. Pumping performance is high at pressures below 1 000 Pa and low at pressures above 1000 Pa when the clearance between rotor and stator is on the order of 0.1 mm, which is the practical value for industrial use. The double spiral grooved vacuum pump is thought to have better pumping performance at such high pressures than the conventional spiral grooved vacuum pump. The aim of this study is to investigate the feasibility of use of the double spiral grooved vacuum pump at pressures above 1000 Pa. A double spiral grooved vacuum pump with a rotor of 150 mm diameter and 190 mm length has been designed and manufactured. Its pumping performance has been tested by experiments. The test results show the improvement in the performance at pressures above 1000 Pa compared to the conventional spiral grooved vacuum pump. 2 refs., 12 figs., 2 tabs.

  2. Theoretical study on the interaction of pregabalin and olanzapine with DNA

    Directory of Open Access Journals (Sweden)

    ZibaHooshiarSodagar

    2016-12-01

    Full Text Available This paper aims is to study the interaction of two drugs including pregabalin and olanzapine with DNA. For this purpose, density functional theory calculations and docking were used. The structure of pregabalin and olanzapine using B3Lyp theory level and the basis set 6-311 G(d,p was optimized. Highest occupied molecular orbital (HOMO and lowest unoccupied molecular orbital (LUMO calculated for each drugs. The obtained results showed that olanzapine is more reactive than pregabalin. Docking of drugs with DNA was performed and the results showed that binding affinity of olanzapine is higher than pregabalin. Also, the graphical results revealed that olanzapine interact with DNA via 5-terminal major groove of DNA, whereas pregabalin interact with DNA via 3- termind major groove.

  3. CFD Validation of Gas Injection in Flowing Mercury over Vertical Smooth and Grooved Wall

    International Nuclear Information System (INIS)

    Abdou, Ashraf A.; Wendel, Mark W.; Felde, David K.; Riemer, Bernie

    2009-01-01

    The Spallation Neutron Source (SNS) is an accelerator-based neutron source at Oak Ridge National Laboratory (ORNL). The nuclear spallation reaction occurs when a proton beam hits liquid mercury. This interaction causes thermal expansion of the liquid mercury which produces high pressure waves. When these pressure waves hit the target vessel wall, cavitation can occur and erode the wall. Research and development efforts at SNS include creation of a vertical protective gas layer between the flowing liquid mercury and target vessel wall to mitigate the cavitation damage erosion and extend the life time of the target. Since mercury is opaque, computational fluid dynamics (CFD) can be used as a diagnostic tool to see inside the liquid mercury and guide the experimental efforts. In this study, CFD simulations of three dimensional, unsteady, turbulent, two-phase flow of helium gas injection in flowing liquid mercury over smooth, vertically grooved and horizontally grooved walls are carried out with the commercially available CFD code Fluent-12 from ANSYS. The Volume of Fluid (VOF) model is used to track the helium-mercury interface. V-shaped vertical and horizontal grooves with 0.5 mm pitch and about 0.7 mm depth were machined in the transparent wall of acrylic test sections. Flow visualization data of helium gas coverage through transparent test sections is obtained with a high-speed camera at the ORNL target test facility (TTF). The helium gas mass flow rate is 8 mg/min and introduced through a 0.5 mm diameter port. The local mercury velocity is 0.9 m/s. In this paper, the helium gas flow rate and the local mercury velocity are kept constant for the three cases. Time integration of predicted helium gas volume fraction over time is done to evaluate the gas coverage and calculate the average thickness of the helium gas layer. The predicted time-integrated gas coverage over vertically grooved and horizontally grooved test sections is better than over a smooth wall. The

  4. Quantum spill-out in few-nanometer metal gaps: Effect on gap plasmons and reflectance from ultrasharp groove arrays

    DEFF Research Database (Denmark)

    Skjølstrup, Enok Johannes Haahr; Søndergaard, Thomas; Pedersen, Thomas Garm

    2018-01-01

    Plasmons in ultranarrow metal gaps are highly sensitive to the electron density profile at the metal surfaces. Using a quantum mechanical approach and assuming local response, we study the effects of electron spill-out on gap plasmons and reflectance from ultrasharp metal grooves.We demonstrate...... the reflectance from arrays of ultrasharp metal grooves. These findings are explained in terms of enhanced gap plasmon absorption taking place inside the gap 1–2 °A from the walls and delocalization near the groove bottom. Reflectance calculations taking spill-out into account are shown to be in much better...

  5. Use of the Composite Pedicled Pectoralis Minor Flap after Resection of Soft Tissue Sarcoma in Reconstruction of the Glenohumeral Joint

    Directory of Open Access Journals (Sweden)

    Michiel A. J. van de Sande

    2014-01-01

    Full Text Available The surgical repair of an extensive anterior glenohumeral soft tissue defect is complicated by glenohumeral instability and subsequent significant functional deficit. This surgical note offers a relatively simple reconstruction of the anterior capsule and subscapularis muscle using a pectoralis minor pedicle flap. This reconstruction is supplemented with functional reconstruction of the anterior glenohumeral joint. A conventional deltopectoral approach is utilized and pectoralis minor is freed from its coracoid insertion, released, and mobilized without compromising the pedicle entering from the dorsum and inferior one-third of the muscle. The mobilized pectoralis minor vascular pedicle has sufficient length for the pectoralis minor to be transferred to provide coverage of the anterior shoulder joint even in full external rotation, providing anterior stability. To further improve glenohumeral stability and shoulder function, the pectoralis major muscle can be split with the clavicular part reinserted lateral to the bicipital groove onto the lesser tuberosity replacing subscapularis function while stabilising the glenohumeral joint.

  6. Minor burn - first aid - slideshow

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/presentations/100213.htm Minor burn - first aid - series—Procedure, part 1 To use ... out of 2 Overview To treat a minor burn, run cool water over the area of the ...

  7. Performance of an inclined solar still with rectangular grooves and ridges

    International Nuclear Information System (INIS)

    Anburaj, P.; Kalidasa, Murugavel K.; Samuel Hansen, R.

    2013-01-01

    This work investigates the experimental performance of a new type inclined solar still with rectangular grooves and ridges in absorber plate. The still was fabricated and tested for various inclination angles of 25, 30 and 35 facing south with absorber plate. Performances of the still were compared with different wick materials (Black cotton cloth, Jute cloth, and Waste cotton pieces) on the absorber plate. The effect of placing porous material (Clay pot) and energy storing material (Mild steel pieces) in the grooves were studied. The results demonstrate that 30 inclination is optimum which yielded 3.77 L/day production. Compared to different wick materials, black cotton cloth helps to achieve maximum productivity of 4.21 L/day. The addition of permeable materials and energy absorbing materials also enhances the distillate output to 4.27 L/day. (authors)

  8. Palato-gingival groove: An innocuous culprit for endo-perio lesion

    Directory of Open Access Journals (Sweden)

    Rafeza Sultana

    2016-09-01

    Full Text Available This case report represents the clinical management of tooth with palato-gingival groove in a right maxillary lateral incisor with endo-perio lesion leading to dento-alveolar abscess and sinus tract. The right maxillary lateral incisor was examined clinico-radiographically. On clinical examination, the offending tooth revealed localized swelling and an intraoral draining sinus pointing on the labial gingiva without any evidence of caries, discoloration and trauma. The palatal surface of lateral incisor showed a groove with mild calculus embedded in it. The radiographic examination revealed periapical radiolucency. This case provides an evidence of morphological defect of tooth. Complete clinical and radiological examination and adequate knowledge of such morphological/ developmental defects of teeth are necessary for recognition and identification especially because of their diagnostic complexity and further consequences. 

  9. Propagation of Channel Plasmons at the Visible Regime in Aluminum V-Groove Waveguides

    DEFF Research Database (Denmark)

    Lotan, Oren; Smith, Cameron; Bar-David, Jonathan

    2016-01-01

    Aluminum plasmonics is emerging as a promising platform in particular for the ultraviolet-blue spectral band. We present the experimental results of propagating channel plasmon-polaritons (CPP) waves in aluminum coated V-shaped waveguides at the short visible wavelength regime. The V-grooves are ......Aluminum plasmonics is emerging as a promising platform in particular for the ultraviolet-blue spectral band. We present the experimental results of propagating channel plasmon-polaritons (CPP) waves in aluminum coated V-shaped waveguides at the short visible wavelength regime. The V......-grooves are fabricated by a process involving UV-photolithography, crystallographic silicon etching, and metal deposition. Polarization measurements of coupling demonstrate a preference to the TM-aligned mode, as predicted in simulations....

  10. Influence of structural parameters of deep groove ball bearings on vibration

    Science.gov (United States)

    Yu, Guangwei; Wu, Rui; Xia, Wei

    2018-04-01

    Taking 6201 bearing as the research object, a dynamic model of 4 degrees of freedom is established to solve the vibration characteristics such as the displacement, velocity and acceleration of deep groove ball bearings by MATLAB and Runge-Kutta method. By calculating the theoretical value of the frequency of the rolling element passing through the outer ring and the simulation value of the model, it can be known that the theoretical calculation value and the simulation value have good consistency. By the experiments, the measured values and simulation values are consistent. Using the mathematical model, the effect of structural parameters on vibration is obtained. The method in the paper is testified to be feasible and the results can be used as references for the design, manufacturing and testing of deep groove ball bearings.

  11. Research on Degeneration Model of Neural Network for Deep Groove Ball Bearing Based on Feature Fusion

    Directory of Open Access Journals (Sweden)

    Lijun Zhang

    2018-02-01

    Full Text Available Aiming at the pitting fault of deep groove ball bearing during service, this paper uses the vibration signal of five different states of deep groove ball bearing and extracts the relevant features, then uses a neural network to model the degradation for identifying and classifying the fault type. By comparing the effects of training samples with different capacities through performance indexes such as the accuracy and convergence speed, it is proven that an increase in the sample size can improve the performance of the model. Based on the polynomial fitting principle and Pearson correlation coefficient, fusion features based on the skewness index are proposed, and the performance improvement of the model after incorporating the fusion features is also validated. A comparison of the performance of the support vector machine (SVM model and the neural network model on this dataset is given. The research shows that neural networks have more potential for complex and high-volume datasets.

  12. Nanoscale Plasmonic V-Groove Waveguides for the Interrogation of Single Fluorescent Bacterial Cells.

    Science.gov (United States)

    Lotan, Oren; Bar-David, Jonathan; Smith, Cameron L C; Yagur-Kroll, Sharon; Belkin, Shimshon; Kristensen, Anders; Levy, Uriel

    2017-09-13

    We experimentally demonstrate the interrogation of an individual Escherichia coli cell using a nanoscale plasmonic V-groove waveguide. Several different configurations were studied. The first involved the excitation of the cell in a liquid environment because it flows on top of the waveguide nanocoupler, while the obtained fluorescence is coupled into the waveguide and collected at the other nanocoupler. The other two configurations involved the positioning of the bacterium within the nanoscale waveguide and its excitation in a dry environment either directly from the top or through waveguide modes. This is achieved by taking advantage of the waveguide properties not only for light guiding but also as a mechanical tool for trapping the bacteria within the V-grooves. The obtained results are supported by a set of numerical simulations, shedding more light on the mechanism of excitation. This demonstration paves the way for the construction of an efficient bioplasmonic chip for diverse cell-based sensing applications.

  13. Steady State Thermo-Hydrodynamic Analysis of Two-Axial groove and Multilobe Hydrodynamic Bearings

    Directory of Open Access Journals (Sweden)

    C. Bhagat

    2014-12-01

    Full Text Available Steady state thermo-hydrodynamic analysis of two axial groove and multi lobe oil journal bearings is performed in this paper. To study the steady state thermo-hydrodynamic characteristics Reynolds equation is solved simultaneously along with the energy equation and heat conduction equation in bush and shaft. The effect of groove geometry, cavitation in the fluid film, the recirculation of lubricant, shaft speed has also been taken into account. Film temperature in case of three-lobe bearing is found to be high as compared to other studied bearing configurations. The data obtained from this analysis can be used conveniently in the design of such bearings, which are presented in dimensionless form.

  14. A Short Review on the Synthetic Strategies of Duocarmycin Analogs that are Powerful DNA Alkylating Agents.

    Science.gov (United States)

    Patil, Pravin C; Satam, Vijay; Lee, Moses

    2015-01-01

    The duocarmycins and CC-1065 are members of a class of DNA minor groove, AT-sequence selective, and adenine-N3 alkylating agents, isolated from Streptomyces sp. that exhibit extremely potent cytotoxicity against the growth of cancer cells grown in culture. Initial synthesis and structural modification of the cyclopropa[c] pyrrolo[3,2-e]indole (CPI) DNA-alkylating motif as well as the indole non-covalent binding region in the 1980s have led to several compounds that entered clinical trials as potential anticancer drugs. However, due to significant systemic toxicity none of the analogs have passed clinical evaluation. As a result, the intensity in the design, synthesis, and development of novel analogs of the duocarmycins has continued. Accordingly, in this review, which covers a period from the 1990s through the present time, the design and synthesis of duocarmycin SA are described along with the synthesis of novel and highly cytotoxic analogs that lack the chiral center. Examples of achiral analogs of duocarmycin SA described in this review include seco-DUMSA (39 and 40), seco-amino-CBI-TMI (13, Centanamycin), and seco-hydroxy-CBI-TMI (14). In addition, another novel class of biologically active duocarmycin SA analogs that contained the seco-iso-cyclopropylfurano[2,3-e]indoline (seco-iso-CFI) and seco-cyclopropyltetrahydrofurano[2,3-f]quinoline (seco-CFQ) DNA alkylating submit was also designed and synthesized. The synthesis of seco-iso-CFI-TMI (10, Tafuramycin A) and seco-CFQ-TMI (11, Tafuramycin B) is included in this review.

  15. Minor actinide transmutation using minor actinide burner reactors

    International Nuclear Information System (INIS)

    Mukaiyama, T.; Yoshida, H.; Gunji, Y.

    1991-01-01

    The concept of minor actinide burner reactor is proposed as an efficient way to transmute long-lived minor actinides in order to ease the burden of high-level radioactive waste disposal problem. Conceptual design study of minor actinide burner reactors was performed to obtain a reactor model with very hard neutron spectrum and very high neutron flux in which minor actinides can be fissioned efficiently. Two models of burner reactors were obtained, one with metal fuel core and the other with particle fuel core. Minor actinide transmutation by the actinide burner reactors is compared with that by power reactors from both the reactor physics and fuel cycle facilities view point. (author)

  16. Institutional Investors as Minority Shareholders

    OpenAIRE

    Assaf Hamdani; Yishay Yafeh

    2013-01-01

    We examine the link between minority shareholders' rights and corporate governance by studying institutional investors' voting patterns in a concentrated ownership environment. Institutions rarely vote against insider-sponsored proposals even when the law empowers the minority. Institutions vote against compensation-related proposals more often than against related party transactions even when minority shareholders cannot influence outcomes. Potentially conflicted institutions are more likely...

  17. Tube with helical grooving for a heat exchanger and its manufacturing process

    International Nuclear Information System (INIS)

    Yampolsky, J.S.

    1980-01-01

    This claim broadly concerns heat transfer tubes for heat exchangers of the kind described in the main patent specification and, in particular, a heat transfer tube and a process for manufacturing it. This tube includes a strip of metal, the opposite sides of which extend to form a certain number of longitudinal grooves of specific profile and height. This strip is helically wound and the lateral edges are joined butt to butt so as to be leak tight to fluids [fr

  18. Highly efficient absorption of visible and near infrared light in convex gold and nickel grooves

    DEFF Research Database (Denmark)

    Eriksen, René Lynge; Beermann, Jonas; Søndergaard, Thomas

    The realization of nonresonant light absorption with nanostructured metal surfaces by making practical use of nanofocusing optical energy in tapered plasmonic waveguides, is of one of the most fascinating and fundamental phenomena in plasmonics [1,2]. We recently realized broadband light absorption...... in gold via adiabatic nanofocusing of gap surface plasmon modes in well-defined geometries of ultra-sharp convex grooves and being excited by scattering off subwavelength-sized wedges [3]....

  19. Effects of Gas Rarefaction on Dynamic Characteristics of Micro Spiral-Grooved Thrust Bearing

    OpenAIRE

    Liu, Ren; Wang, Xiao-Li; Zhang, Xiao-Qing

    2012-01-01

    The effects of gas-rarefaction on dynamic characteristics of micro spiral-grooved-thrust-bearing are studied. The Reynolds equation is modified by the first order slip model, and the corresponding perturbation equations are then obtained on the basis of the linear small perturbation method. In the converted spiral-curve-coordinates system, the finite-volume-method (FVM) is employed to discrete the surface domain of micro bearing. The results show, compared with the continuum-flow model, that ...

  20. Apical groove type and molecular phylogeny suggests reclassification of Cochlodinium geminatum as Polykrikos geminatum.

    Science.gov (United States)

    Qiu, Dajun; Huang, Liangmin; Liu, Sheng; Zhang, Huan; Lin, Senjie

    2013-01-01

    Traditionally Cocholodinium and Gymnodinium sensu lato clade are distinguished based on the cingulum turn number, which has been increasingly recognized to be inadequate for Gymnodiniales genus classification. This has been improved by the combination of the apical groove characteristics and molecular phylogeny, which has led to the erection of several new genera (Takayama, Akashiwo, Karenia, and Karlodinium). Taking the apical groove characteristics and molecular phylogeny combined approach, we reexamined the historically taxonomically uncertain species Cochlodinium geminatum that formed massive blooms in Pearl River Estuary, China, in recent years. Samples were collected from a bloom in 2011 for morphological, characteristic pigment, and molecular analyses. We found that the cingulum in this species wraps around the cell body about 1.2 turns on average but can appear under the light microscopy to be >1.5 turns after the cells have been preserved. The shape of its apical groove, however, was stably an open-ended anticlockwise loop of kidney bean shape, similar to that of Polykrikos. Furthermore, the molecular phylogenetic analysis using 18S rRNA-ITS-28S rRNA gene cistron we obtained in this study also consistently placed this species closest to Polykrikos within the Gymnodinium sensu stricto clade and set it far separated from the clade of Cochlodinium. These results suggest that this species should be transferred to Polykrikos as Polykrikos geminatum. Our results reiterate the need to use the combination of apical groove morphology and molecular phylogeny for the classification of species within the genus of Cochlodinium and other Gymnodiniales lineages.

  1. Apical groove type and molecular phylogeny suggests reclassification of Cochlodinium geminatum as Polykrikos geminatum.

    Directory of Open Access Journals (Sweden)

    Dajun Qiu

    Full Text Available Traditionally Cocholodinium and Gymnodinium sensu lato clade are distinguished based on the cingulum turn number, which has been increasingly recognized to be inadequate for Gymnodiniales genus classification. This has been improved by the combination of the apical groove characteristics and molecular phylogeny, which has led to the erection of several new genera (Takayama, Akashiwo, Karenia, and Karlodinium. Taking the apical groove characteristics and molecular phylogeny combined approach, we reexamined the historically taxonomically uncertain species Cochlodinium geminatum that formed massive blooms in Pearl River Estuary, China, in recent years. Samples were collected from a bloom in 2011 for morphological, characteristic pigment, and molecular analyses. We found that the cingulum in this species wraps around the cell body about 1.2 turns on average but can appear under the light microscopy to be >1.5 turns after the cells have been preserved. The shape of its apical groove, however, was stably an open-ended anticlockwise loop of kidney bean shape, similar to that of Polykrikos. Furthermore, the molecular phylogenetic analysis using 18S rRNA-ITS-28S rRNA gene cistron we obtained in this study also consistently placed this species closest to Polykrikos within the Gymnodinium sensu stricto clade and set it far separated from the clade of Cochlodinium. These results suggest that this species should be transferred to Polykrikos as Polykrikos geminatum. Our results reiterate the need to use the combination of apical groove morphology and molecular phylogeny for the classification of species within the genus of Cochlodinium and other Gymnodiniales lineages.

  2. Importance of the Sequence-Directed DNA Shape for Specific Binding Site Recognition by the Estrogen-Related Receptor

    Directory of Open Access Journals (Sweden)

    Kareem Mohideen-Abdul

    2017-06-01

    Full Text Available Most nuclear receptors (NRs bind DNA as dimers, either as hetero- or as homodimers on DNA sequences organized as two half-sites with specific orientation and spacing. The dimerization of NRs on their cognate response elements (REs involves specific protein–DNA and protein–protein interactions. The estrogen-related receptor (ERR belongs to the steroid hormone nuclear receptor (SHR family and shares strong similarity in its DNA-binding domain (DBD with that of the estrogen receptor (ER. In vitro, ERR binds with high affinity inverted repeat REs with a 3-bps spacing (IR3, but in vivo, it preferentially binds to single half-site REs extended at the 5′-end by 3 bp [estrogen-related response element (ERREs], thus explaining why ERR was often inferred as a purely monomeric receptor. Since its C-terminal ligand-binding domain is known to homodimerize with a strong dimer interface, we investigated the binding behavior of the isolated DBDs to different REs using electrophoretic migration, multi-angle static laser light scattering (MALLS, non-denaturing mass spectrometry, and nuclear magnetic resonance. In contrast to ER DBD, ERR DBD binds as a monomer to EREs (IR3, such as the tff1 ERE-IR3, but we identified a DNA sequence composed of an extended half-site embedded within an IR3 element (embedded ERRE/IR3, where stable dimer binding is observed. Using a series of chimera and mutant DNA sequences of ERREs and IR3 REs, we have found the key determinants for the binding of ERR DBD as a dimer. Our results suggest that the sequence-directed DNA shape is more important than the exact nucleotide sequence for the binding of ERR DBD to DNA as a dimer. Our work underlines the importance of the shape-driven DNA readout mechanisms based on minor groove recognition and electrostatic potential. These conclusions may apply not only to ERR but also to other members of the SHR family, such as androgen or glucocorticoid, for which a strong well-conserved half

  3. Grooved stone tools from Calabria region (Italy: Archaeological evidence and research perspectives

    Directory of Open Access Journals (Sweden)

    Felice Larocca

    2016-10-01

    Full Text Available Since the end of the 19th century the Calabria region in southern Italy has been known for an abundance of grooved stone axes and hammers used during late prehistory. These artefacts are characterized by a wide and often pronounced groove in the middle of the implement, thought to have aided securing the head to a wooden haft. Their widespread presence is known both in prehistoric archaeological literature and in the archaeological collections of various regional and extra-regional museums. At first, scholars did not relate these tools to the rich Calabrian ore deposits and to possible ancient mining activities; they were regarded simply as a variant of ground lithic industry of Neolithic tradition. However, between 1997 and 2012, about 50 tools were discovered in the prehistoric mine of Grotta della Monaca in northern Calabria where there are outcrops of copper and iron ore. This allowed us to recognize their specific mining value and to consider them as a sort of “guide fossil” for the identification of ancient mining districts. This paper presents the results of a study involving over 150 tools from the entire region, effectively demonstrating an almost perfect co-occurrence of grooved axes and hammers with areas rich in mineral resources, especially metalliferous ores.

  4. Effective slip for Stokes flow between two grooved walls with an arbitrary phase shift

    Energy Technology Data Exchange (ETDEWEB)

    Ng, Chiu-On, E-mail: cong@hku.hk [Department of Mechanical Engineering, The University of Hong Kong, Pokfulam Road (Hong Kong)

    2017-04-15

    This work aims to determine how the effective slip length for a wall-bounded flow may depend on, among other geometrical parameters, the phase shift between patterns on the two walls. An analytical model is developed for Stokes flow through a channel bounded by walls patterned with a regular array of rectangular ribs and grooves, where the patterns on the two walls can be misaligned by any phase shift. This study incorporates several previous studies as limiting or special cases. It is shown that the phase shift can have qualitatively different effects on the flow rate and effective slip length, depending on the flow direction. In a narrow channel, increasing the phase shift may mildly decrease the flow rate and effective slip length for flow parallel to the grooves, but can dramatically increase the flow rate and effective slip length for flow transverse to the grooves. It is found that unless the channel height is much larger than the period of the wall pattern, the effect due to wall confinement has to be taken into account on evaluating the effective slip lengths. (paper)

  5. Design and experimental study of a micro-groove grinding wheel with spray cooling effect

    Directory of Open Access Journals (Sweden)

    Shi Chaofeng

    2014-04-01

    Full Text Available The effectiveness of grinding fluid supply has a crucial impact on grinding quality and efficiency in high speed grinding. In order to improve the cooling and lubrication, through in-depth research of self-inhaling internal cooling method and intermittent grinding mechanism, a new spray cooling method used in high speed grinding is proposed. By referring to the structure of bowl-shaped dispersion disk, the grinding wheel matrix with atomization ability is designed; through studying heat transfer of droplet collision and the influence of micro-groove on the boiling heat transfer, grinding segment with micro-groove is designed to enhance the heat flux of coolant and achieve maximum heat transfer between droplets and grinding contact zone. High-speed grinding experiments on GH4169 with the developed grinding wheel are carried out. The results show that with the micro-groove grinding wheel just 5.4% of pump outlet flow rate and 0.5% of spindle energy is needed to reduce the grinding temperature to 200 °C, which means the developed grinding wheel makes cooling high efficient and low energy consuming.

  6. The Origin of Nanoscopic Grooving on Vesicle Walls in Submarine Basaltic Glass: Implications for Nanotechnology

    Directory of Open Access Journals (Sweden)

    Jason E. French

    2009-01-01

    Full Text Available Dendritic networks of nanoscopic grooves measuring 50–75 nm wide by <50 nm deep occur on the walls of vesicles in the glassy margins of mid-ocean ridge pillow basalts worldwide. Until now, their exact origin and significance have remained unclear. Here we document examples of such grooved patterns on vesicle walls in rocks from beneath the North Atlantic Ocean, and give a fluid mechanical explanation for how they formed. According to this model, individual nanogrooves represent frozen viscous fingers of magmatic fluid that were injected into a thin spheroidal shell of hot glass surrounding each vesicle. The driving mechanism for this process is provided by previous numerical predictions of tangential tensile stress around some vesicles in glassy rocks upon cooling through the glass transition. The self-assembling nature of the dendritic nanogrooves, their small size, and overall complexity in form, are interesting from the standpoint of exploring new applications in the field of nanotechnology. Replicating such structures in the laboratory would compete with state-of-the-art nanolithography techniques, both in terms of pattern complexity and size, which would be useful in the fabrication of a variety of grooved nanodevices. Dendritic nanogrooving in SiO2 glass might be employed in the manufacturing of integrated circuits.

  7. Experimental study of thermal performance of heat pipe with axial trapezoidal grooves

    International Nuclear Information System (INIS)

    Suh, Jeong Se; Lee, Woon

    2003-01-01

    Analysis and experiment are performed to investigate the thermal performance of a heat pipe with axial grooves. The heat pipe was designed in a 6.5 mm I.D., 17 axial trapezoidal grooves, 1000 mm long tube of aluminium, and ammonia as working fluid. A mathematical equations for heat pipe with axial grooves is formulated to obtain the capillary limitation on heat transport rate in a steady state. As a result, heat transport factor of heat pipe has the maximum at the operating temperature of 293K in 0m elevation. As the elevation of heat pipe increases, the heat transport factor of the heat pipe is reduced markedly, comparing with that of horizontal elevation of the heat pipe. It may be considered that such behavior of heat pipe is caused by the working fluid swarmed back to the condenser port due to gravity force and supercooled by a coolant of heat exchanger. Analytical results of heat transport factor are in a good agreement with those of experiment

  8. Regenerated collagen fibers with grooved surface texture: Physicochemical characterization and cytocompatibility

    International Nuclear Information System (INIS)

    Wang, Xiang; Wu, Tong; Wang, Wei; Huang, Chen; Jin, Xiangyu

    2016-01-01

    A novel type of protein fibers, regenerated collagen fibers (RC) from cattle skin, was prepared through wet-spinning. Due to the combined effect of solvent exchange and subsequent drawing process, the fibers were found to have a grooved surface texture. The grooves provided not only ordered topographical cues, but also increased surface area. Protein content of the RC fibers was confirmed by Fourier Transform infrared spectroscopy (FTIR) and ninhydrin color reaction. The fibers could be readily fabricated into nonwovens or other textiles, owning to their comparable physical properties to other commercialized fibers. Cell growth behavior on RC nonwovens suggested both early adhesion and prompt proliferation. The high moisture regain, good processability, along with the excellent cytocompatibility indicated that the RC fibers and nonwovens developed in this study might offer a good candidate for biomedical and healthcare applications. - Highlights: • Wet-spun regenerated collagen fibers having aligned surface grooves • Comparable physiochemical properties to commercialized fibers • Readily processed into nonwovens • Excellent cytocompatibility with prompt cell adhesion and proliferation

  9. Regenerated collagen fibers with grooved surface texture: Physicochemical characterization and cytocompatibility

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Xiang [Engineering Research Center of Technical Textiles, Ministry of Education, College of Textiles, Donghua University, Shanghai 201620 (China); Wu, Tong [College of Chemistry, Chemical Engineering and Biotechnology, Donghua University, Shanghai 201620 (China); Wang, Wei [Engineering Research Center of Technical Textiles, Ministry of Education, College of Textiles, Donghua University, Shanghai 201620 (China); Huang, Chen, E-mail: hc@dhu.edu.cn [Engineering Research Center of Technical Textiles, Ministry of Education, College of Textiles, Donghua University, Shanghai 201620 (China); Jin, Xiangyu [Engineering Research Center of Technical Textiles, Ministry of Education, College of Textiles, Donghua University, Shanghai 201620 (China)

    2016-01-01

    A novel type of protein fibers, regenerated collagen fibers (RC) from cattle skin, was prepared through wet-spinning. Due to the combined effect of solvent exchange and subsequent drawing process, the fibers were found to have a grooved surface texture. The grooves provided not only ordered topographical cues, but also increased surface area. Protein content of the RC fibers was confirmed by Fourier Transform infrared spectroscopy (FTIR) and ninhydrin color reaction. The fibers could be readily fabricated into nonwovens or other textiles, owning to their comparable physical properties to other commercialized fibers. Cell growth behavior on RC nonwovens suggested both early adhesion and prompt proliferation. The high moisture regain, good processability, along with the excellent cytocompatibility indicated that the RC fibers and nonwovens developed in this study might offer a good candidate for biomedical and healthcare applications. - Highlights: • Wet-spun regenerated collagen fibers having aligned surface grooves • Comparable physiochemical properties to commercialized fibers • Readily processed into nonwovens • Excellent cytocompatibility with prompt cell adhesion and proliferation.

  10. Electrophoresis in ice surface grooves for probing protein affinity to a specific plane of ice crystal.

    Science.gov (United States)

    Inagawa, Arinori; Okada, Yusuke; Okada, Tetsuo

    2018-06-01

    Channel-like grooves are formed on the surface of frozen aqueous sucrose. They are filled with a freeze concentrated solution (FCS) and act as an efficient size-tunable separation field for micro and nanoparticles. The width of the channel can be easily varied by changing the temperature. Because the channel width decreases with decreasing temperature, particles become immobilized due to physical interference from the ice wall when the temperature reaches a threshold point specific to the particle size. Surface modification of particles can add a factor of chemical interaction between the particles and ice walls. In this study, anti-freeze proteins (AFPs) are anchored on 1µm-polystyrene (PS) particles, and their behavior in the surface grooves on the ice is studied. The threshold temperature is an effective criterion for evaluating chemical interactions between particles and ice walls. The AFP binding on 1µm PS particles lowers the threshold temperature by 2.5°C, indicating interactions between AFPs on the PS particles and the ice wall. Because the AFPs studied here show selectivity towards the prism plane, it is critical that the prism plane of the ice crystal is in contact with the FCS in the surface grooves. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. High quality broadband spatial reflections of slow Rayleigh surface acoustic waves modulated by a graded grooved surface

    KAUST Repository

    Xu, Yanlong

    2015-01-21

    We report high quality broadband spatial reflections of Rayleigh surface acoustic waves (SAWs) through a graded grooved surface. High quality means that no wave is allowed to transmit and the incident wave is nearly all reflected to the input side. The graded grooved surface is structured by drilling one dimensional array of graded grooves with increased depths on a flat surface. We investigate SAW dispersion relations, wave field distribution at several typical SAW wavelengths, and time evolution of a Gaussian pulse through the graded grooved surface. Results show that the input broadband Rayleigh SAWs can be slowed, spatially enhanced and stopped, and finally reflected to the input side. The study suggests that engraving the flat surface can be used as an efficient and economical way to manipulate Rayleigh SAWs, which has potential application in novel SAW devices such as filters, reflectors, sensors, energy harvesters, and diodes.

  12. Evaluation of the effect of anode groove pitch to ion beam focusibility on spherical plasma focus diode

    Energy Technology Data Exchange (ETDEWEB)

    Imanari, K [Oyama National College of Technology (Japan). Department of Electrical Engineering; Jiang, W; Masugata, K; Yatsui, K [Nagaoka Univ. of Technology (Japan). Laboratory of Beam Technology

    1997-12-31

    A new PIC simulation code was developed to evaluate the effect of anode plasma nonuniformity on LIB focusibility. The plasma nonuniformity was modelled by inducing anode grooves in the code. In the experimental conditions, groove pitch about 2.2 mm and groove width of 1.0 mm, the simulation results are in a good agreement with the observed data. At a groove pitch of 2.4 mm, the local divergence was very small, although the focal length was very long. It was inferred that the focusibility of SPFD will be determined by the z-deflection angle rather than the local divergence angle. Modification of the anode curvature may be advantageous to get a higher power density on the focal point. (author). 6 figs., 3 refs.

  13. Effect of groove design on mechanical and metallurgical properties of quenched and tempered low alloy abrasion resistant steel welded joints

    International Nuclear Information System (INIS)

    Sharma, Varun; Shahi, A.S.

    2014-01-01

    Highlights: • Effect of weld groove design on Q and T steel welded joints is investigated. • Groove design influences heat dissipation characteristics of welded joints. • Double-V groove joint possesses maximum yield strength and UTS. • C-groove joint possesses highest impact energy, both at room temperature and 0 °C. • A wide variation in microhardness exists across different zone of the weldments. - Abstract: Experimental investigations were carried out to study the influence of three different groove designs on mechanical and metallurgical properties of 15 mm thick Q and T (quenched and tempered) steel welded joints. Welding heat input variation corresponding to each joint configuration was kept to a minimal such that the objective of investigating, exclusively, the effect of varied weld volume on the mechanical and metallurgical performance of these joints could be accomplished. Mechanical performance of these joints was evaluated by subjecting them to transverse tensile testing, and Charpy V-notch impact testing of the weld zones at room temperature and 0 °C. The results of this study reveal that among all types of groove formations used for welding, double-V groove joint possessed maximum YS (yield strength) and UTS (ultimate tensile strength), besides maximum strength ratio (YS/UTS) that was followed by U-groove joint and C-groove joint, respectively. However, weld zone tested individually, for the cover as well as the root pass of the C-groove joint possessed highest CVN (Charpy V-notch) values, both at room temperature and 0 °C. Extensive microhardness studies of these weldments showed a wide variation in the microhardness values of the weld zone and the HAZ (heat affected zone). It was concluded that each groove formation/design exerted a significant influence on the heat dissipation characteristics of these joints, which is evident from different morphological features as revealed through optical microscopy. Scanning electron microscopic

  14. Photolithography of thick photoresist coating in anisotropically etched V-grooves for electrically controlled liquid crystal photonic bandgap fiber devices

    DEFF Research Database (Denmark)

    Wei, Lei; Khomtchenko, Elena; Alkeskjold, Thomas Tanggaard

    2009-01-01

    Thick photoresist coating for electrode patterning in anisotropically etched v-grooves is investigated. The photoresist coverage is compared with and without soft baking. Two-step exposure is applied for a complete exposure and minimizing the resolution loss.......Thick photoresist coating for electrode patterning in anisotropically etched v-grooves is investigated. The photoresist coverage is compared with and without soft baking. Two-step exposure is applied for a complete exposure and minimizing the resolution loss....

  15. The relationship of transverse sinus stenosis to bony groove dimensions provides an insight into the aetiology of idiopathic intracranial hypertension

    Energy Technology Data Exchange (ETDEWEB)

    Connor, S.E.J.; Stewart, V.R.; O' Flynn, E.A.M. [King' s College Hospital, Neuroradiology Department, Ruskin Wing, London (United Kingdom); Siddiqui, M.A. [Southern General Hospital, Institute of Neurological Sciences, Glasgow (United Kingdom)

    2008-12-15

    Transverse sinus tapered narrowings are frequently identified in patients with idiopathic intracranial hypertension (IIH); however, it remains unclear whether they are primary stenoses or whether they occur secondary to raised cerebrospinal fluid pressure. Computed tomographic venography demonstrates both the morphology of the venous system and the adjacent bony grooves so it may provide an insight into the aetiology of these transverse sinus stenoses. Tapered transverse sinus narrowings (>50%) were studied in 19 patients without IIH and 14 patients with IIH. Computed tomography vascular studies were reviewed and the dimensions of the venous sinuses and bony grooves at the sites of maximum and minimum transverse sinus area dimensions were recorded. There was demonstrated to be a strong correlation of bony groove height with venous sinus height at the largest portions of the transverse sinus in both IIH patients and non-IIH subjects as well as at the transverse sinus narrowing in non-IIH subjects. There was a discordant relationship between bony groove height and venous sinus height at the site of transverse sinus stenoses in IIH patients. In 5/23 IIH transverse sinus stenoses, the bony groove height was proportionate to that seen in non-IIH subjects. There were a further 8/23 cases where the small or absent sinus was associated with an absent bony groove. Transverse sinus tapered narrowings in subjects without IIH and in the majority of patients with IIH were associated with proportionately small or absent grooves, and these are postulated to be primary or fixed. Some patients with IIH demonstrate tapered transverse sinus stenoses with disproportionately large bony grooves, suggesting a secondary or acquired narrowing. This implies a varied aetiology for the transverse sinus stenoses of IIH. (orig.)

  16. The relationship of transverse sinus stenosis to bony groove dimensions provides an insight into the aetiology of idiopathic intracranial hypertension

    International Nuclear Information System (INIS)

    Connor, S.E.J.; Stewart, V.R.; O'Flynn, E.A.M.; Siddiqui, M.A.

    2008-01-01

    Transverse sinus tapered narrowings are frequently identified in patients with idiopathic intracranial hypertension (IIH); however, it remains unclear whether they are primary stenoses or whether they occur secondary to raised cerebrospinal fluid pressure. Computed tomographic venography demonstrates both the morphology of the venous system and the adjacent bony grooves so it may provide an insight into the aetiology of these transverse sinus stenoses. Tapered transverse sinus narrowings (>50%) were studied in 19 patients without IIH and 14 patients with IIH. Computed tomography vascular studies were reviewed and the dimensions of the venous sinuses and bony grooves at the sites of maximum and minimum transverse sinus area dimensions were recorded. There was demonstrated to be a strong correlation of bony groove height with venous sinus height at the largest portions of the transverse sinus in both IIH patients and non-IIH subjects as well as at the transverse sinus narrowing in non-IIH subjects. There was a discordant relationship between bony groove height and venous sinus height at the site of transverse sinus stenoses in IIH patients. In 5/23 IIH transverse sinus stenoses, the bony groove height was proportionate to that seen in non-IIH subjects. There were a further 8/23 cases where the small or absent sinus was associated with an absent bony groove. Transverse sinus tapered narrowings in subjects without IIH and in the majority of patients with IIH were associated with proportionately small or absent grooves, and these are postulated to be primary or fixed. Some patients with IIH demonstrate tapered transverse sinus stenoses with disproportionately large bony grooves, suggesting a secondary or acquired narrowing. This implies a varied aetiology for the transverse sinus stenoses of IIH. (orig.)

  17. BOOK REVIEW: Minority Games

    Science.gov (United States)

    Metzler, R.

    2005-02-01

    New branches of scientific disciplines often have a few paradigmatic models that serve as a testing ground for theories and a starting point for new inquiries. In the late 1990s, one of these models found fertile ground in the growing field of econophysics: the Minority Game (MG), a model for speculative markets that combined conceptual simplicity with interesting emergent behaviour and challenging mathematics. The two basic ingredients were the minority mechanism (a large number of players have to choose one of two alternatives in each round, and the minority wins) and limited rationality (each player has a small set of decision rules, and chooses the more successful ones). Combining these, one observes a phase transition between a crowded and an inefficient market phase, fat-tailed price distributions at the transition, and many other nontrivial effects. Now, seven years after the first paper, three of the key players—Damien Challet, Matteo Marsili and Yi-Cheng Zhang—have published a monograph that summarizes the current state of the science. The book consists of two parts: a 100-page overview of the various aspects of the MG, and reprints of many essential papers. The first chapters of Part I give a well-written description of the motivation and the history behind the MG, and then go into the phenomenology and the mathematical treatment of the model. The authors emphasize the `physics' underlying the behaviour and give coherent, intuitive explanations that are difficult to extract from the original papers. The mathematics is outlined, but calculations are not carried out in great detail (maybe they could have been included in an appendix). Chapter 4 then discusses how and why the MG is a model for speculative markets, how it can be modified to give a closer fit to observed market statistics (in particular, reproducing the `stylized facts' of fat-tailed distributions and volatility clustering), and what conclusions one can draw from the behaviour of the MG

  18. Successful surgical management of palatogingival groove using platelet-rich fibrin and guided tissue regeneration: A novel approach

    Directory of Open Access Journals (Sweden)

    J V Karunakaran

    2017-01-01

    Full Text Available Palatogingival groove also known as radicularlingual groove is a developmental anomaly involving the lingual surface of the maxillary incisors. They are inconspicuous, funnel-shaped, extend for varying distances on root surface and occur due to infolding of the hertwigs epithelial root sheath. This encourages adherence of microorganisms and plaque to levels significant for pathological changes resulting in endodontic and periodontal lesions. The variations in anatomy of the tooth as a cause of pulp necrosis in teeth of anterior maxillary segment should be considered by the clinician when other etiological factors are ruled out. Recognition of palatogingival groove is critical, especially because of its diagnostic complexity and the problems that may arise if it is not properly interpreted and treated. Regeneration is a new emerging approach in endodontics. Choukroun et al. were among the pioneers for using platelet-rich fibrin (PRF to improve bone healing. PRF is rich in platelet cytokines and growth factors. Numerous techniques have been used to eliminate or seal the groove and regenerate endodontic and periodontal tissues. In this case report of two cases, a novel combination therapy involving ultrasonics, blend of PRF with bone graft, guided tissue regeneration membrane was used in the treatment of a palatogingival groove with an endoperio lesion to ensure arrest of disease progression and promote regeneration. The groove was cleaned and prepared ultrasonically and sealed with a bioactive dentin substitute.

  19. Reversible and formaldehyde-mediated covalent binding of a bis-amino mitoxantrone analogue to DNA.

    Science.gov (United States)

    Konda, Shyam K; Kelso, Celine; Pumuye, Paul P; Medan, Jelena; Sleebs, Brad E; Cutts, Suzanne M; Phillips, Don R; Collins, J Grant

    2016-05-18

    The ability of a bis-amino mitoxantrone anticancer drug (named WEHI-150) to form covalent adducts with DNA, after activation by formaldehyde, has been studied by electrospray ionisation mass spectrometry and HPLC. Mass spectrometry results showed that WEHI-150 could form covalent adducts with d(ACGCGCGT)2 that contained one, two or three covalent links to the octanucleotide, whereas the control drugs (daunorubicin and the anthracenediones mitoxantrone and pixantrone) only formed adducts with one covalent link to the octanucleotide. HPLC was used to examine the extent of covalent bond formation of WEHI-150 with d(CGCGCG)2 and d(CG(5Me)CGCG)2. Incubation of WEHI-150 with d(CG(5Me)CGCG)2 in the presence of formaldehyde resulted in the formation of significantly greater amounts of covalent adducts than was observed with d(CGCGCG)2. In order to understand the observed increase of covalent adducts with d(CG(5Me)CGCG)2, an NMR study of the reversible interaction of WEHI-150 at both CpG and (5Me)CpG sites was undertaken. Intermolecular NOEs were observed in the NOESY spectra of d(ACGGCCGT)2 with added WEHI-150 that indicated that the drug selectively intercalated at the CpG sites and from the major groove. In particular, NOEs were observed from the WEHI-150 H2,3 protons to the H1' protons of G3 and G7 and from the H6,7 protons to the H5 protons of C2 and C6. By contrast, intermolecular NOEs were observed between the WEHI-150 H2,3 protons to the H2'' proton of the (5Me)C3 in d(CG(5Me)CGCG)2, and between the drug aliphatic protons and the H1' proton of G4. This demonstrated that WEHI-150 preferentially intercalates at (5Me)CpG sites, compared to CpG sequences, and predominantly via the minor groove at the (5Me)CpG site. The results of this study demonstrate that WEHI-150 is likely to form interstrand DNA cross-links, upon activation by formaldehyde, and consequently exhibit greater cytotoxicity than other current anthracenedione drugs.

  20. The origin of Phobos grooves from ejecta launched from impact craters on Mars: Tests of the hypothesis

    Science.gov (United States)

    Ramsley, Kenneth R.; Head, James W.

    2013-01-01

    The surface of the martian moon Phobos is characterized by parallel and intersecting grooves that bear resemblance to secondary crater chains observed on planetary surfaces. Murray (2011) has hypothesized that the main groove-forming process on Phobos is the intersection of Phobos with ejecta from primary impact events on Mars to produce chains of secondary craters. The hypothesis infers a pattern of parallel jets of ejecta, either fluidized or solidified, that break into equally-spaced fragments and disperse uniformly along-trajectory during the flight from Mars to Phobos. At the moment of impact with Phobos the dispersed fragments emplace secondary craters that are aligned along strike corresponding to the flight pattern of ejecta along trajectory. The aspects of the characteristics of grooves on Phobos cited by this hypothesis that might be explained by secondary ejecta include: their observed linearity, parallelism, planar alignment, pitted nature, change in character along strike, and a "zone of avoidance" where ejecta from Mars is predicted not to impact (Murray, 2011). To test the hypothesis we plot precise Keplerian orbits for ejecta from Mars (elliptical and hyperbolic with periapsis located below the surface of Mars). From these trajectories we: (1) set the fragment dispersion limits of ejecta patterns required to emplace the more typically well-organized parallel grooves observed in returned images from Phobos; (2) plot ranges of the ejecta flight durations from Mars to Phobos and map regions of exposure; (3) utilize the same exposure map to observe trajectory-defined ejecta exposure shadows; (4) observe hemispheric exposure in response to shorter and longer durations of ejecta flight; (5) assess the viability of ejecta emplacing the large family of grooves covering most of the northern hemisphere of Phobos; and (6) plot the arrival of parallel lines of ejecta emplacing chains of craters at oblique incident angles. We also assess the bulk volume of

  1. LNA effects on DNA binding and conformation

    DEFF Research Database (Denmark)

    Pabon-Martinez, Y Vladimir; Xu, You; Villa, Alessandra

    2017-01-01

    -substitution in the duplex pyrimidine strand alters the double helix structure, affecting x-displacement, slide and twist favoring triplex formation through enhanced TFO major groove accommodation. Collectively, these findings should facilitate the design of potent anti-gene ONs.......The anti-gene strategy is based on sequence-specific recognition of double-strand DNA by triplex forming (TFOs) or DNA strand invading oligonucleotides to modulate gene expression. To be efficient, the oligonucleotides (ONs) should target DNA selectively, with high affinity. Here we combined...... hybridization analysis and electrophoretic mobility shift assay with molecular dynamics (MD) simulations to better understand the underlying structural features of modified ONs in stabilizing duplex- and triplex structures. Particularly, we investigated the role played by the position and number of locked...

  2. Study on morphology of high-aspect-ratio grooves fabricated by using femtosecond laser irradiation and wet etching

    International Nuclear Information System (INIS)

    Chen, Tao; Pan, An; Li, Cunxia; Si, Jinhai; Hou, Xun

    2015-01-01

    Highlights: • We studied morphologies of silicon grooves fabricated by laser irradiation and wet etching. • We found nano-ripple structures formed on the groove sidewall. • Formations of nano-ripples were due to the formation of standing wave and nanoplanes. • Remaining debris on the groove bottom was removed by KOH etching. - Abstract: Morphologies of high-aspect-ratio silicon grooves fabricated by using femtosecond laser irradiation and selective chemical etching of hydrofluoric acid (HF) were studied. Oxygen was deeply doped into silicon under femtosecond laser irradiation in air, and then the oxygen-doped regions were removed by HF etching to form high-aspect-ratio grooves. After HF etching, periodic nano-ripples which were induced in silicon by femtosecond laser were observed on the groove sidewalls. The ripple orientation was perpendicular or parallel to the laser propagation direction (z direction), which depended on the relative direction between the laser polarization direction and the scanning direction. The formation of nano-ripples with orientations perpendicular to z direction could be attributed to the standing wave generated by the interference of the incident light and the reflected light in z direction. The formation of nano-ripples with orientations parallel to z direction could be attributed to the formation of self-organized periodic nanoplanes (bulk nanogratings) induced by femtosecond laser inside silicon. Materials in the tail portion of laser-induced oxygen doping (LIOD) regions were difficult to be etched by HF solution due to low oxygen concentration. The specimen was etched further in KOH solution to remove remaining materials in LIOD regions and all-silicon grooves were fabricated

  3. The Effect of Shoe Sole Tread Groove Depth on the Gait Parameters during Walking on Dry and Slippery Surface

    Directory of Open Access Journals (Sweden)

    M Ziaei

    2012-12-01

    Full Text Available Background: Prevention of slipping accidents requires provision of adequate friction through the use of suitable combinations of footwear and underfoot surfaces. Shoe sole tread groove is one of the important factors on friction coefficient during walking. Objective: To measure the effect of different shoe sole tread groove depths and different surfaces on the required quotient of friction (Q, heel strike velocity and occurrence time of ground reaction forces (GRF in stance phase during walking on slippery and dry surfaces. Methods: In this semi-experimental study, 22 healthy men were studied under different conditions. The studied independent variables were shoe groove depths (included 1, 2.5 and 5 mm and type of walking surface (dry and slippery. Biomechanical gait analysis was carried out with 396 single steps. Data were collected by motion analysis system and two force platform. Results: The occurrence time of GRF was significantly faster on dry surface than slippery surface (p<0.01. Q was significantly lower on slippery surface and with groove depths of 1 and 2.5 mm. The highest value of Q was observed with the deepest groove depth of 5 mm. Heel strike velocity did not differ significantly in the 6 conditions tested. Conclusion: Tread groove depth is a significant factor affecting the Q at the shoes-surface interface on dry and slippery floors. It seems that deeper groove is more appropriate for maintaining the stability during walking. The walking surface affects the occurrence time of GRF; the force components occur sooner on the dry than slippery surface.

  4. [Study of the interaction mechanism between brodifacoum and DNA by spectroscopy].

    Science.gov (United States)

    Duan, Yun-qing; Min, Shun-geng

    2009-04-01

    The interaction between brodifacoum (3-[3-(4'-bromophenyl-4) 1,2,3,4-tetralin-10]-4-hydroxyl-coumarin) (BDF), an anticoagulant rodenticide, and calf thymus DNA (ct-DNA) was studied by UV spectrum and fluorescence spectrum. The results were summarized as follows: There was a hypochromic effect of low concentration ct-DNA on the UV spectra. The fluorescence quenching studies showed a regular decrease in the fluorescence intensity after addition of ct-DNA by the static quenching mode with a quenching constant (Ksv) of 1.21 x 10(4) L x mol(-1) at 27 degrees C. The BDF possibly bonded to ct-DNA mainly via Van der Waals forces by the corresponding thermodynamics parameter. KI quenching experiment found that there was not obvious protection of ct-DNA to BDF. The fluorescence intensity of BDF/ct-DNA system changed with the variation in ionic strength Quenching of ct-DNA on the fluorescence of BDF/beta-CD inclusion complex was reduced in contrast with the free BDF, which showed that beta-CD could provide BDF with protection. So the comprehensive interaction mode of BDF with ct-DNA may be the groove binding by the above results. It was indicated that there had been static-electro interaction between BDF and ct-DNA at the same time. The conjunct action of Van der Waals forces and electrostatic attraction favorably provide BDF bonding interaction in the groove of ct-DNA.

  5. Modern Microsurgical Resection of Olfactory Groove Meningiomas by Classical Bicoronal Subfrontal Approach without Orbital Osteotomies.

    Science.gov (United States)

    Farooq, Ghulam; Rehman, Lal; Bokhari, Irum; Rizvi, Syed Raza Hussain

    2018-01-01

    The olfactory groove meningioma has always been surgically challenging. The common microscopic surgical procedures exercised involve modification of pterional or sub-frontal approaches with or without orbital osteotomies. However, we believe that orbital osteotomies are not mandatory to achieve gross total resection. Hence, this study was performed to evaluate the surgical outcomes of olfactory groove meningioma with bicoronal sub frontal approach but without orbital osteotomies. The study was performed by reviewing the medical charts, neuroimaging data, and follow-up data of 19 patients who were treated micro surgically for olfactory groove meningioma without orbital osteotomies in our department. Mean overall follow up period of our study was 5 years. Statistical analysis was done by means of IBM SPSS Software version 19. Nineteen patients (1 male and 18 female patients, with an age range of 35-67 years; average age of patients' 51±7.5 years) of OGM were managed in our department. All patients were evaluated by MRI Brain with and without Gadolinium, CTA, CT Scan both axial and Coronal sequences. Most common symptom reported was head ache (80%), others include; urinary incontinence (26%), seizures (78%), decreased visual acuity (79%), papilledema (74%), personality changes (68%) and olfactory loss was reported in 57% of the patients. Post-operative complications include; CSF accumulation (5%), hematoma at tumor bed (10%), skin infection (5%) and mild post-operative brain edema (26%). Mortality rate was 5%. During 5 years of follow-up, we recorded one recurrence which was after 26 months and successfully removed in reoperation. Bi-coronal sub frontal approach appears to be an excellent technique for Olfactory Meningioma removal as practiced by most neurosurgeons. Nevertheless, it is not mandatory to carry out orbital osteotomy to acquire optimal surgical outcome as is advocated by some Authors.

  6. Olfactory groove meningioma: discussion of clinical presentation and surgical outcomes following excision via the subcranial approach.

    Science.gov (United States)

    Pepper, Jon-Paul; Hecht, Sarah L; Gebarski, Stephen S; Lin, Erin M; Sullivan, Stephen E; Marentette, Lawrence J

    2011-11-01

    To describe surgical outcomes and radiographic features of olfactory groove meningiomas treated by excision through the subcranial approach. Special emphasis is placed on paranasal sinus and orbit involvement. Retrospective review of a series of patients. Nineteen patients underwent excision of olfactory groove meningioma (OGM) via the transglabellar/subcranial approach between December 1995 and November 2009. Nine patients had previously undergone prior resection at outside institutions, and four had prior radiotherapy in addition to a prior excision. Transglabellar/subcranial surgical approach to the anterior skull base was performed. Tumor histology included three World Health Organization (WHO) grade III lesions, one WHO grade II lesion, and 15 WHO grade I lesions. Fourteen patients had evidence of extension into the paranasal sinuses, with the ethmoid sinus being most commonly involved. Kaplan-Meier estimates of mean overall and disease-free survival were 121.45 months and 93.03 months, respectively. The mean follow-up interval was 41.0 months, and at the time of data analysis three patients had recurrent tumors. Seven (36.8%) patients experienced a major complication in the perioperative period; there were no perioperative mortalities. Orbit invasion was observed in four patients, with optic nerve impingement in 11 patients. Of these, three patients had long-term diplopia. No patients experienced worsening of preoperative visual acuity. Olfactory groove meningiomas demonstrate a propensity to spread into the paranasal sinuses, particularly in recurrent cases. Given a tendency for infiltrative recurrence along the skull base, this disease represents an important area of collaboration between neurosurgery and otolaryngology. The subcranial approach offers excellent surgical access for excision, particularly for recurrences that involve the paranasal sinuses and optic apparatus. Copyright © 2011 The American Laryngological, Rhinological, and Otological Society

  7. Micro-CT evaluation of root and canal morphology of mandibular first premolars with radicular grooves

    Energy Technology Data Exchange (ETDEWEB)

    Boschetti, Emanuele; Mazzi-Chaves, Jardel Francisco; Versiani, Marco Aurélio; Pécora, Jesus Djalma; Saquy, Paulo Cesar; Sousa Neto, Manoel Damião de, E-mail: sousanet@forp.usp.br [Universidade de São Paulo (USP), Ribeirao Preto, SP (Brazil). Departamento de Odontologia Restauradora; Silva-Sousa, Yara Terezinha Correa; Leoni, Graziela Bianchi [Universidade de Ribeirão Preto (UNAERP), Ribeirão Preto, SP (Brazil). Departmento de Endodontia

    2017-09-15

    The aim of this study was to evaluate morphological features of 70 single-rooted mandibular first premolars with radicular grooves (RG) using micro-CT technology. Teeth were scanned and evaluated regarding the morphology of the roots and root canals as well as length, depth and percentage frequency location of the RG. Volume, surface area and Structure Model Index (SMI) of the canals were measured for the full root length. Two-dimensional parameters and frequency of canal orifices were evaluated at 1, 2, and 3 mm levels from the apical foramen. The number of accessory canals, the dentin thickness, and cross-sectional appearance of the canal at different root levels were also recorded. Expression of deep grooves was observed in 21.42% of the sample. Mean lengths of root and RG were 13.43 mm and 8.5 mm, respectively, while depth of the RG ranged from 0.75 to 1.13 mm. Mean canal volume, surface area and SMI were 10.78 mm{sup 3}, 58.51 mm{sup 2}, and 2.84, respectively. Apical delta was present in 4.35% of the sample and accessory canals were observed mostly at the middle and apical thirds. Two-dimensional parameters indicated an oval-shaped cross-sectional appearance of the root canal with a high percentage frequency of canal divisions (87.15%). Canal configuration type V (58.57%) was the most prevalent. C-shaped configuration was observed in 13 premolars (18.57%), whereas dentin thickness ranged from 1.0 to 1.31 mm. Radicular grooves in mandibular first premolars was associated with the occurrence of several anatomical complexities, including C-shaped canals and divisions of the main root canal. (author)

  8. Micro-CT evaluation of root and canal morphology of mandibular first premolars with radicular grooves

    International Nuclear Information System (INIS)

    Boschetti, Emanuele; Mazzi-Chaves, Jardel Francisco; Versiani, Marco Aurélio; Pécora, Jesus Djalma; Saquy, Paulo Cesar; Sousa Neto, Manoel Damião de; Silva-Sousa, Yara Terezinha Correa; Leoni, Graziela Bianchi

    2017-01-01

    The aim of this study was to evaluate morphological features of 70 single-rooted mandibular first premolars with radicular grooves (RG) using micro-CT technology. Teeth were scanned and evaluated regarding the morphology of the roots and root canals as well as length, depth and percentage frequency location of the RG. Volume, surface area and Structure Model Index (SMI) of the canals were measured for the full root length. Two-dimensional parameters and frequency of canal orifices were evaluated at 1, 2, and 3 mm levels from the apical foramen. The number of accessory canals, the dentin thickness, and cross-sectional appearance of the canal at different root levels were also recorded. Expression of deep grooves was observed in 21.42% of the sample. Mean lengths of root and RG were 13.43 mm and 8.5 mm, respectively, while depth of the RG ranged from 0.75 to 1.13 mm. Mean canal volume, surface area and SMI were 10.78 mm 3 , 58.51 mm 2 , and 2.84, respectively. Apical delta was present in 4.35% of the sample and accessory canals were observed mostly at the middle and apical thirds. Two-dimensional parameters indicated an oval-shaped cross-sectional appearance of the root canal with a high percentage frequency of canal divisions (87.15%). Canal configuration type V (58.57%) was the most prevalent. C-shaped configuration was observed in 13 premolars (18.57%), whereas dentin thickness ranged from 1.0 to 1.31 mm. Radicular grooves in mandibular first premolars was associated with the occurrence of several anatomical complexities, including C-shaped canals and divisions of the main root canal. (author)

  9. Study of a Tricarbide Grooved Ring Fuel Element for Nuclear Thermal Propulsion

    Science.gov (United States)

    Taylor, Brian; Emrich, Bill; Tucker, Dennis; Barnes, Marvin; Donders, Nicolas; Benensky, Kelsa

    2018-01-01

    Deep space exploration, especially that of Mars, is on the horizon as the next big challenge for space exploration. Nuclear propulsion, through which high thrust and efficiency can be achieved, is a promising option for decreasing the cost and logistics of such a mission. Work on nuclear thermal engines goes back to the days of the NERVA program. Currently, nuclear thermal propulsion is under development again in various forms to provide a superior propulsion system for deep space exploration. The authors have been working to develop a concept nuclear thermal engine that uses a grooved ring fuel element as an alternative to the traditional hexagonal rod design. The authors are also studying the use of carbide fuels. The concept was developed in order to increase surface area and heat transfer to the propellant. The use of carbides would also raise the operating temperature of the reactor. It is hoped that this could lead to a higher thrust to weight nuclear thermal engine. This paper describes the modeling of neutronics, heat transfer, and fluid dynamics of this alternative nuclear fuel element geometry. Fabrication experiments of grooved rings from carbide refractory metals are also presented along with material characterization and interactions with a hot hydrogen environment. Results of experiments and associated analysis are discussed. The authors demonstrated success in reaching desired densities with some success in material distribution and reaching a solid solution. Future work is needed to improve distribution of material, minimize oxidation during the milling process, and define a fabrication process that will serve for constructing grooved ring fuel rods for large system tests.

  10. Place of the brachytherapy in the therapeutic strategy of rhabdomyosarcomas of the nasogenian groove of children

    International Nuclear Information System (INIS)

    Breton-Callu, C.; Haie-Meder, C.; Oberlin, O.; Delapierre, M.; Gerbaulet, A.

    2000-01-01

    The brachytherapy in the treatment of rhabdomyosarcomas of the nasogenian groove has to be discussed when it exists a residual tumor after an initial chemotherapy and leads to good results, in term of local control. An advantage of the brachytherapy in comparison with external irradiation, in the treatment of children tumors, is the small size of the treated volume, that allows to decrease the aftereffects incidence. The brachytherapy comes in the frame of a therapeutic needing a multidisciplinary approach and a cooperation between surgeons, brachy-therapists and onco-pediatricians. (N.C.)

  11. The morphology of synovial grooves (Fossae synoviales) in joints of cattle of different age groups

    DEFF Research Database (Denmark)

    Wegener, K. M.; Heje, N. I.; Aarestrup, Frank Møller

    1993-01-01

    The joint cartilage of the head of the radius, the metacarpal bone, the tibial cochlea, the proximal trochlea of the talus and the metatarsal bone of 26 cattle in the age groups fetuses, 0 days, 2-5 weeks, 2-5 months, 7-13 months, 2-3.5 years, and 5-7 years were examined macroscopically...... animals aged from 3 weeks to 13 months dyschondroplastic (osteochondrotic) lesions were observed in the joint cartilage both inside and outside the groove areas on one or more joint surfaces....

  12. Design, fabrication, and dynamic testing of a V-groove radiator mechanical development unit

    Science.gov (United States)

    Petrick, S. Walter; Bard, Steven

    1988-01-01

    This paper describes the design, fabrication, and dynamic testing of a V-groove radiator development unit. The intended goal was to survive the dynamic environment of the Mars Observer mission. The development unit was designed to achieve a temperature of 80 K with a heat load of about 80 milliwatts. An analysis was performed to predict the thermal performance of the development unit. The radiator with a mass mockup of a Gamma Ray Spectrometer detector, the most massive of the candidate Mars Observer instrument detectors (1.7 Kg), passed vibration and acoustic testing to the Mars Observer requirements in effect at that time.

  13. Modelling, design and analysis of liquid crystal waveguides in preferentially etched silicon grooves

    International Nuclear Information System (INIS)

    Bellini, Bob; Beccherelli, Romeo

    2009-01-01

    This paper presents a fully consistent theoretical framework for liquid crystal (LC) channel waveguides that have been experimentally demonstrated in previous publications. We revise the optical design of the LC waveguides in silicon grooves and implement here a vectorial, fully consistent model of the LC waveguide electro-optical behaviour, based on the finite element method. The numerical investigation shows that LC waveguides demonstrate properties of propagation control and switching. They switch on and off with a low applied voltage. We discuss the major design parameters of the device and the effect of loss-inducing control electrodes.

  14. DNA:DNA hybridization studies on the pink-pigmented facultative methylotrophs.

    Science.gov (United States)

    Hood, D W; Dow, C S; Green, P N

    1987-03-01

    The genomic relatedness among 36 strains of pink-pigmented facultatively methylotrophic bacteria (PPFMs) was estimated by determination of DNA base composition and by DNA:DNA hybridization studies. A reproducible hybridization system was developed for the rapid analysis of multiple DNA samples. Results indicated that the PPFMs comprise four major and several minor homology groups, and that they should remain grouped in a single genus, Methylobacterium.

  15. In Vitro Retentive Effect of Groove, Sandblasting, and Cement Type on Stainless Steel Crowns in Primary Molars.

    Science.gov (United States)

    Pathak, Sidhant; Shashibhushan, K K; Bharath, K P; Poornima, P; Reddy, V V Subba

    2015-01-01

    The purpose of this study was to evaluate and compare the effect of placing vertical grooves, sandblasting, and luting cements on the retention of stainless steel crowns (SSCs). Eighty extracted primary molars were mounted in acrylic blocks. Specimens were divided into Group 1 (RelyX U200) and Group 2 (Smart Cem2). Teeth in each group were further subdivided into Subgroup A (no vertical grooves and no sandblasting), Subgroup B (vertical grooves), Subgroup C (sandblasting of crowns), and Subgroup D (vertical grooves and sandblasting of crowns). After cementation, SSCs were pulled off using a universal testing machine. One-way analysis of variance was used for statistical analyses. In Groups 1 and 2, the highest retentive strengths were found in Subgroup D (1,124 and 783 kPa, respectively), followed by Subgroup C (1,066 and 748 kPa, respectively), Subgroup A (762 and 356 kPa, respectively), and Subgroup B (743 and 314 kPa, respectively). Retentive strength in Group one was significantly higher than in Group two; Subgroups A and B were significantly lower than C and D. RelyX U200 showed higher retentive strength than Smart Cem2. Sandblasting increased the retention strength, whereas a vertical groove had no significant effect on retention.

  16. Evaluation of J-groove weld residual stress and crack growth rate of PWSCC in reactor pressure vessel closure head

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Seung Hyuk; Ryu, Tae Young; Park, Seung Hyun; Won, Min Gu; Kang, Seok Jun; Kim, Moon Ki; Choi, Jae Boong [Sungkyunkwan University, Suwon (Korea, Republic of); Lee, Kyoung Soo; Lee, Sung Ho [Korea Hydro and Nuclear Power, Daejeon (Korea, Republic of)

    2015-03-15

    Over the last decade, primary water stress corrosion cracking (PWSCC) has been frequently found in pressurized water reactor (PWR) applications. Especially, PWSCC has occurred in long-term operated PWRs. As this phenomenon leads to serious accidents, we must be beforehand with the anticipated problems. A typical PWR consists of J-groove welded components such as reactor pressure vessel closure head and nozzles. Reactor pressure vessel closure head is made of SA508 and it is covered by cladding. Alloy 600 is used for nozzles. And J-groove weld is conducted with alloy 82/182. Different material properties of these metals lead to residual stress and PWSCC consequentially. In this study, J-groove weld residual stress was investigated by a three-dimensional finite element analysis with an actual asymmetric J-groove weld model and process of construction. Also crack growth rate of PWSCC was evaluated from cracks applied on the penetration nozzles. Based on these two values, one cannot only improve the structural integrity of PWR, but also explain PWSCC behavior such that high residual stress at the J-groove weld area causes crack initiation and propagation through the surface of nozzles. In addition, crack behavior was predicted at the various points around the nozzle.

  17. Evaluation of J-groove weld residual stress and crack growth rate of PWSCC in reactor pressure vessel closure head

    International Nuclear Information System (INIS)

    Oh, Seung Hyuk; Ryu, Tae Young; Park, Seung Hyun; Won, Min Gu; Kang, Seok Jun; Kim, Moon Ki; Choi, Jae Boong; Lee, Kyoung Soo; Lee, Sung Ho

    2015-01-01

    Over the last decade, primary water stress corrosion cracking (PWSCC) has been frequently found in pressurized water reactor (PWR) applications. Especially, PWSCC has occurred in long-term operated PWRs. As this phenomenon leads to serious accidents, we must be beforehand with the anticipated problems. A typical PWR consists of J-groove welded components such as reactor pressure vessel closure head and nozzles. Reactor pressure vessel closure head is made of SA508 and it is covered by cladding. Alloy 600 is used for nozzles. And J-groove weld is conducted with alloy 82/182. Different material properties of these metals lead to residual stress and PWSCC consequentially. In this study, J-groove weld residual stress was investigated by a three-dimensional finite element analysis with an actual asymmetric J-groove weld model and process of construction. Also crack growth rate of PWSCC was evaluated from cracks applied on the penetration nozzles. Based on these two values, one cannot only improve the structural integrity of PWR, but also explain PWSCC behavior such that high residual stress at the J-groove weld area causes crack initiation and propagation through the surface of nozzles. In addition, crack behavior was predicted at the various points around the nozzle.

  18. Studies on the arctiin and its interaction with DNA by spectral methods

    International Nuclear Information System (INIS)

    Sun Yantao; Zhang Hanqi; Bi Shuyun; Zhou Xiaofu; Wang Liang; Yan Yongsheng

    2011-01-01

    The emission spectra of arctiin were determined under various experimental conditions. In addition, a fluorescence method was developed to obtain the binding constants and sites of the interaction between arctiin and DNA. A competitive binding experiment and melting temperature mensuration were carried out to investigate the binding mechanism of arctiin and DNA. The experimental results showed that the interaction between arctiin and DNA belongs to a groove binding mode. - Highlights: → Determined the emission spectra of arctiin by fluorescence spectrometry. → Obtain the binding constants and sites of interaction between arctiin and DNA. → Calculate the binding parameters according an improved calculation method.

  19. Ethnic Minority Dropout in Economics

    Science.gov (United States)

    Arnold, Ivo J. M.

    2013-01-01

    This paper investigates the first-year study success of minority students in the bachelor program in economics at Erasmus University Rotterdam. We find that the gap in study success between minority and majority students can be attributed to differences in high school education. Students from similar high school tracks show no significant…

  20. Ethnic minority dropout in economics

    NARCIS (Netherlands)

    Arnold, I.J.M.

    2013-01-01

    This paper investigates the first-year study success of minority students in the bachelor program in economics at Erasmus University Rotterdam. We find that the gap in study success between minority and majority students can be attributed to differences in high school education. Students from