The Ins and Outs of DNA Fingerprinting the Infectious Fungi

Science.gov (United States)

Soll, David R.

2000-01-01

DNA fingerprinting methods have evolved as major tools in fungal epidemiology. However, no single method has emerged as the method of choice, and some methods perform better than others at different levels of resolution. In this review, requirements for an effective DNA fingerprinting method are proposed and procedures are described for testing the efficacy of a method. In light of the proposed requirements, the most common methods now being used to DNA fingerprint the infectious fungi are described and assessed. These methods include restriction fragment length polymorphisms (RFLP), RFLP with hybridization probes, randomly amplified polymorphic DNA and other PCR-based methods, electrophoretic karyotyping, and sequencing-based methods. Procedures for computing similarity coefficients, generating phylogenetic trees, and testing the stability of clusters are then described. To facilitate the analysis of DNA fingerprinting data, computer-assisted methods are described. Finally, the problems inherent in the collection of test and control isolates are considered, and DNA fingerprinting studies of strain maintenance during persistent or recurrent infections, microevolution in infecting strains, and the origin of nosocomial infections are assessed in light of the preceding discussion of the ins and outs of DNA fingerprinting. The intent of this review is to generate an awareness of the need to verify the efficacy of each DNA fingerprinting method for the level of genetic relatedness necessary to answer the epidemiological question posed, to use quantitative methods to analyze DNA fingerprint data, to use computer-assisted DNA fingerprint analysis systems to analyze data, and to file data in a form that can be used in the future for retrospective and comparative studies. PMID:10756003

Generation of DNA profiles from fingerprints developed with columnar thin film technique.

Science.gov (United States)

Plazibat, Stephanie L; Roy, Reena; Swiontek, Stephen E; Lakhtakia, Akhlesh

2015-12-01

Partial-bloody fingerprints and partial fingerprints with saliva are often encountered at crime scenes, potentially enabling the combination of fingerprint and DNA analyses for absolute identification, provided that the development technique for fingerprint analysis does not inhibit DNA analysis. 36 partial-bloody fingerprints and 30 fingerprints wetted with saliva, all deposited on brass, were first developed using the columnar-thin-film (CTF) technique and then subjected to short tandem repeat (STR) DNA analysis. Equal numbers of samples were subjected to the same DNA analysis without development. Tris (8-hydroxyquinolinato) aluminum, or Alq3, was evaporated to deposit CTFs for development of the prints. DNA was extracted from all 132 samples, quantified, and amplified with AmpFlSTR(®) Identifiler Plus Amplification Kit. Additionally, DNA analyses were conducted on four blood smears on un-fingerprinted brass that had been subjected to CTF deposition and four blood smears on un-fingerprinted brass that had not been subjected to CTF deposition. Complete and concordant autosomal STR profiles of the same quality were obtained from both undeveloped and CTF-developed fingerprints, indicating that CTF development of fingerprints preserves DNA and does not inhibit subsequent DNA analysis. Even when there were no fingerprints, CTF deposition did not lead to inhibition of DNA analysis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Graphene Nanopres for DNA Fingerprinting

Science.gov (United States)

Ahmed, Towfiq; Balatsky, Alexander V.; Haraldsen, J. T.; Schuller, Ivan K.; di Ventra, M.; Wikfeldt, K. T.

2013-03-01

The recent progress in nanopore experiments with transverse current is important for the development of fast, accurate and cheap finger-printing techniques for single nucleotide. Despite its enormous potential for the next generation DNA sequencing technology, the presence of large noise in the temporal spectrum of transverse current remains a big challenge for getting highly accurate interpretation of data. In this paper we present our abinitio calculations, and propose graphene based device for DNA fingerprinting. We calculate transmission current through graphene for each DNA base (A,C,G,T). As shown in our work, a proper time-series analysis of a signal provides a higher quality information in identifying single bio-molecule is translocating through the nanopores. This work is supported by LANL, Nordita, US DOE, AFOSR, and NIH.

DNA Fingerprinting Using PCR: A Practical Forensic Science Activity

Science.gov (United States)

Choi, Hyun-Jung; Ahn, Jung Hoon; Ko, Minsu

2008-01-01

This paper describes a forensic science simulation programme applicable for use in colleges. Students were asked to find a putative suspect by DNA fingerprinting using a simple protocol developed in this study. DNA samples were obtained from a hair root and a drop of blood, common sources of DNA in forensic science. The DNA fingerprinting protocol…

DNA Profiles from Fingerprint Lifts-Enhancing the Evidential Value of Fingermarks Through Successful DNA Typing.

Science.gov (United States)

Subhani, Zuhaib; Daniel, Barbara; Frascione, Nunzianda

2018-05-25

This study evaluated the compatibility of the most common enhancement methods and lifting techniques with DNA profiling. Emphasis is placed on modern lifting techniques (i.e., gelatin lifters and Isomark™) and historical fingerprint lifts for which limited research has been previously conducted. A total of 180 fingerprints were deposited on a glass surface, enhanced, lifted, and processed for DNA typing. DNA could be extracted and profiled for all the powders and lifts tested and from both groomed fingerprints and natural prints with no significant difference in the percentage of profile recovered. DNA profiles could also be obtained from historical fingerprint lifts (79.2% of 72 lifts) with one or more alleles detected. These results demonstrate the compatibility between different powder/lift combinations and DNA profiling therefore augmenting the evidential value of fingerprints in forensic casework. © 2018 American Academy of Forensic Sciences.

Multifragment alleles in DNA fingerprints of the parrot, Amazona ventralis

Science.gov (United States)

Brock, M.K.; White, B.N.

1991-01-01

Human DNA probes that identify variable numbers of tandem repeat loci are being used to generate DNA fingerprints in many animal and plant species. In most species the majority of the sc rable autoradiographic bands of the DNA fingerprint represent alleles from numerous unlinked loci. This study was initiated to use DNA fingerprints to determine the amount of band-sharing among captive Hispaniolan parrots (Amazona ventralis) with known genetic relationships. This would form the data base to examine DNA fingerprints of the closely related and endangered Puerto Rican parrot (A. vittata) and to estimate the degree of inbreeding in the relic population. We found by segregation analysis of the bands scored in the DNA fingerprints of the Hispaniolan parrots that there may be as few as two to five loci identified by the human 33.15 probe. Furthermore, at one locus we identified seven alleles, one of which is represented by as many as 19 cosegregating bands. It is unknown how common multiband alleles might be in natural populations, and their existence will cause problems in the assessment of relatedness by band-sharing analysis. We believe, therefore, that a pedigree analysis should be included in all DNA fingerprinting studies, where possible, in order to estimate the number of loci identified by a minisatellite DNA probe and to examine the nature of their alleles.

DNA fingerprinting of glioma cell lines and considerations on similarity measurements.

Science.gov (United States)

Bady, Pierre; Diserens, Annie-Claire; Castella, Vincent; Kalt, Stefanie; Heinimann, Karl; Hamou, Marie-France; Delorenzi, Mauro; Hegi, Monika E

2012-06-01

Glioma cell lines are an important tool for research in basic and translational neuro-oncology. Documentation of their genetic identity has become a requirement for scientific journals and grant applications to exclude cross-contamination and misidentification that lead to misinterpretation of results. Here, we report the standard 16 marker short tandem repeat (STR) DNA fingerprints for a panel of 39 widely used glioma cell lines as reference. Comparison of the fingerprints among themselves and with the large DSMZ database comprising 9 marker STRs for 2278 cell lines uncovered 3 misidentified cell lines and confirmed previously known cross-contaminations. Furthermore, 2 glioma cell lines exhibited identity scores of 0.8, which is proposed as the cutoff for detecting cross-contamination. Additional characteristics, comprising lack of a B-raf mutation in one line and a similarity score of 1 with the original tumor tissue in the other, excluded a cross-contamination. Subsequent simulation procedures suggested that, when using DNA fingerprints comprising only 9 STR markers, the commonly used similarity score of 0.8 is not sufficiently stringent to unambiguously differentiate the origin. DNA fingerprints are confounded by frequent genetic alterations in cancer cell lines, particularly loss of heterozygosity, that reduce the informativeness of STR markers and, thereby, the overall power for distinction. The similarity score depends on the number of markers measured; thus, more markers or additional cell line characteristics, such as information on specific mutations, may be necessary to clarify the origin.

Yeast identification by sequencing, biochemical kits, MALDI-TOF MS and rep-PCR DNA fingerprinting.

Science.gov (United States)

Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Chan, Jasper F W; Lau, Susanna K P; Kong, Fanrong; Xu, Yingchun; Woo, Patrick C Y

2017-12-08

No study has comprehensively evaluated the performance of 28S nrDNA and ITS sequencing, commercial biochemical test kits, MALDI-TOF MS platforms, and the emerging rep-PCR DNA fingerprinting technology using a cohort of yeast strains collected from a clinical microbiology laboratory. In this study, using 71 clinically important yeast isolates (excluding Candida albicans) collected from a single centre, we determined the concordance of 28S nrDNA and ITS sequencing and evaluated the performance of two commercial test kits, two MALDI-TOF MS platforms, and rep-PCR DNA fingerprinting. 28S nrDNA and ITS sequencing showed complete agreement on the identities of the 71 isolates. Using sequencing results as the standard, 78.9% and 71.8% isolates were correctly identified using the API 20C AUX and Vitek 2 YST ID Card systems, respectively; and 90.1% and 80.3% isolates were correctly identified using the Bruker and Vitek MALDI-TOF MS platforms, respectively. Of the 18 strains belonging to the Candida parapsilosis species complex tested by DiversiLab automated rep-PCR DNA fingerprinting, all were identified only as Candida parapsilosis with similarities ≥93.2%, indicating the misidentification of Candida metapsilosis and Candida orthopsilosis. However, hierarchical cluster analysis of the rep-PCR DNA fingerprints of these three species within this species complex formed three different discrete clusters, indicating that this technology can potentially differentiate the three species. To achieve higher accuracies of identification, the databases of commercial biochemical test kits, MALDI-TOF MS platforms, and DiversiLab automated rep-PCR DNA fingerprinting needs further enrichment, particularly for uncommonly encountered yeast species. © The Author 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Application of DNA fingerprints for cell-line individualization.

OpenAIRE

Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

1990-01-01

DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...

Beware of the possibility of fingerprinting techniques transferring DNA.

Science.gov (United States)

van Oorschot, Roland A H; Treadwell, Sally; Beaurepaire, James; Holding, Nicole L; Mitchell, Robert J

2005-11-01

Fingerprinting brushes have the potential to collect and transfer DNA during powdering. Squirrel-hair fingerprint brushes exposed to specific sets of saliva stains and brushes used in routine casework were tested for their ability to collect and transfer DNA containing material using standard DNA extraction procedures and AmpFlSTR Profiler Plus amplification and typing procedures. The tests found that the risk of transferring DNA during powdering and having a detrimental impact on the analysis increases if the examiner powders over either biological stains (such as blood or saliva) or very fresh prints and uses more sensitive PCR amplification and typing procedures. We advocate caution when powdering prints from which DNA may also be collected and provide options for consideration to limit the risk of transferred DNA contamination while fingerprinting.

Diversity of DNA fingerprints in Cryptococcus neoformans.

Science.gov (United States)

Varma, A; Swinne, D; Staib, F; Bennett, J E; Kwon-Chung, K J

1995-07-01

DNA fingerprint patterns of 156 Cryptococcus neoformans isolates (26 AIDS patients, 46 non-AIDS patients, and 40 environmental sources) from both varieties (126 C. neoformans var. neoformans and 30 C. neoformans var. gattii isolates) and from seven countries were analyzed by using the DNA probe UT-4p. Nine and twelve distinct DNA fingerprint patterns were observed for isolates of the C. neoformans var. neoformans and var. gattii, respectively. No pattern was unique to AIDS patients, non-AIDS patients, or the environment. Pattern II was observed more often in non-AIDS patients (8 of 23) than in AIDS patients (0 of 25). Pattern V was the most prevalent pattern (42 of 82) in clinical and environmental isolates. Isolates from three AIDS patients in Burundi and Zaire exhibited patterns identical to each other but different from those of isolates collected from their houses (i.e., dust of floors, walls, etc.) or a nearby pigeon coop. DNA fingerprint stability was determined for 53 isolates from nine non-AIDS patients at different time intervals during 5 to 128 weeks of antifungal therapy. For eight patients, the fingerprint pattern was stable while the ninth may have had a mixed infection. Pattern II was observed in 4 of 9 patients, which is similar to 4 of 14 in other non-AIDS patients as reported here. In spite of the extensive pattern heterogeneity among 15 C. neoformans var. gattii isolates in Australia, the patterns observed in seven California isolates were quite different from those in Australia. Among isolates of C. neoformans var. gattii, one fingerprint pattern (designated b) was observed in several countries of the Far East. The fingerprint patterns of two of three environmental isolates from Eucalyptus camaldulensis trees in Australia were identical to those of 2 of the 12 clinical isolates from the country.

DNA fingerprinting of the NCI-60 cell line panel.

Science.gov (United States)

Lorenzi, Philip L; Reinhold, William C; Varma, Sudhir; Hutchinson, Amy A; Pommier, Yves; Chanock, Stephen J; Weinstein, John N

2009-04-01

The National Cancer Institute's NCI-60 cell line panel, the most extensively characterized set of cells in existence and a public resource, is frequently used as a screening tool for drug discovery. Because many laboratories around the world rely on data from the NCI-60 cells, confirmation of their genetic identities represents an essential step in validating results from them. Given the consequences of cell line contamination or misidentification, quality control measures should routinely include DNA fingerprinting. We have, therefore, used standard DNA microsatellite short tandem repeats to profile the NCI-60, and the resulting DNA fingerprints are provided here as a reference. Consistent with previous reports, the fingerprints suggest that several NCI-60 lines have common origins: the melanoma lines MDA-MB-435, MDA-N, and M14; the central nervous system lines U251 and SNB-19; the ovarian lines OVCAR-8 and OVCAR-8/ADR (also called NCI/ADR); and the prostate lines DU-145, DU-145 (ATCC), and RC0.1. Those lines also show that the ability to connect two fingerprints to the same origin is not affected by stable transfection or by the development of multidrug resistance. As expected, DNA fingerprints were not able to distinguish different tissues-of-origin. The fingerprints serve principally as a barcodes.

DNA fingerprinting in botany: past, present, future

OpenAIRE

Nybom, Hilde; Weising, Kurt; Rotter, Björn

2014-01-01

Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67–73 and Nature 1985, 316:76–79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the n...

DNA fingerprinting techniques for the analysis of genetic and epigenetic alterations in colorectal cancer.

Science.gov (United States)

Samuelsson, Johanna K; Alonso, Sergio; Yamamoto, Fumiichiro; Perucho, Manuel

2010-11-10

Genetic somatic alterations are fundamental hallmarks of cancer. In addition to point and other small mutations targeting cancer genes, solid tumors often exhibit aneuploidy as well as multiple chromosomal rearrangements of large fragments of the genome. Whether somatic chromosomal alterations and aneuploidy are a driving force or a mere consequence of tumorigenesis remains controversial. Recently it became apparent that not only genetic but also epigenetic alterations play a major role in carcinogenesis. Epigenetic regulation mechanisms underlie the maintenance of cell identity crucial for development and differentiation. These epigenetic regulatory mechanisms have been found substantially altered during cancer development and progression. In this review, we discuss approaches designed to analyze genetic and epigenetic alterations in colorectal cancer, especially DNA fingerprinting approaches to detect changes in DNA copy number and methylation. DNA fingerprinting techniques, despite their modest throughput, played a pivotal role in significant discoveries in the molecular basis of colorectal cancer. The aim of this review is to revisit the fingerprinting technologies employed and the oncogenic processes that they unveiled. 2010 Elsevier B.V. All rights reserved.

Recovery of DNA and fingerprints from touched documents.

Science.gov (United States)

Sewell, Jonathan; Quinones, Ignacio; Ames, Carole; Multaney, Bryan; Curtis, Stuart; Seeboruth, Haj; Moore, Stephen; Daniel, Barbara

2008-09-01

This study investigated the various factors affecting DNA profiling from DNA recovered from fingerprints deposited on paper before and after fingerprint enhancement treatments. The DNeasy plant mini kit (QIAGEN) was found to improve DNA recovery from paper by over 150% compared with the QIAamp mini kit. A significant decrease in the amount of DNA recovered was observed following treatment with DFO and/or Ninhydrin. This decrease in yield did not have a comparably significant effect on the quality of the SGM Plus profiles. Furthermore, this study found that whilst certain paper types, such as newspaper, magazine and filter paper allowed for the good recovery of DNA, common office paper and white card, strongly interfered with the recovery of DNA resulting in poor quality profiles.

Laser mass spectrometry for DNA fingerprinting for forensic applications

Science.gov (United States)

Chen, C. H. Winston; Tang, Kai; Taranenko, N. I.; Allman, S. L.; Ch'ang, L. Y.

1994-10-01

The application of DNA fingerprinting has become very broad in forensic analysis, patient identification, diagnostic medicine, and wildlife poaching, since every individual's DNA structure is identical within all tissues oftheir body. DNA fingerprinting was initiated by the use of restriction fragment length polymorphisms (RFLP). In 1987, Nakamura et aL2 found that a variable number of tandem repeats (VNTR) often occurred in the alleles. The probability of different individuals having the same number of tandem repeats in several different alleles is very low. Thus, the identification of VNTR from genomic DNA became a very reliable method for identification of individuals. Take the Huntington gene as an example, there are CAG trinucleotide repeats. For normal people, the number of CAG repeats is usually between 10 and 40. Since people have chromosomes in pairs, the possibility oftwo individuals having the same VNTR in the Huntington gene is less than one percent, ifwe assume equal distribution for various repeats. When several allels containing VNTR are analyzed for the number of repeats, the possibility of two individuals being exactly identical becomes very unlikely. Thus, DNA fingerprinting is a reliable tool for forensic analysis. In DNA fingerprinting, knowledge of the sequence of tandem repeats and restriction endornuclease sites can provide the basis for identification.

Typing DNA profiles from previously enhanced fingerprints using direct PCR.

Science.gov (United States)

Templeton, Jennifer E L; Taylor, Duncan; Handt, Oliva; Linacre, Adrian

2017-07-01

Fingermarks are a source of human identification both through the ridge patterns and DNA profiling. Typing nuclear STR DNA markers from previously enhanced fingermarks provides an alternative method of utilising the limited fingermark deposit that can be left behind during a criminal act. Dusting with fingerprint powders is a standard method used in classical fingermark enhancement and can affect DNA data. The ability to generate informative DNA profiles from powdered fingerprints using direct PCR swabs was investigated. Direct PCR was used as the opportunity to generate usable DNA profiles after performing any of the standard DNA extraction processes is minimal. Omitting the extraction step will, for many samples, be the key to success if there is limited sample DNA. DNA profiles were generated by direct PCR from 160 fingermarks after treatment with one of the following dactyloscopic fingerprint powders: white hadonite; silver aluminium; HiFi Volcano silk black; or black magnetic fingerprint powder. This was achieved by a combination of an optimised double-swabbing technique and swab media, omission of the extraction step to minimise loss of critical low-template DNA, and additional AmpliTaq Gold ® DNA polymerase to boost the PCR. Ninety eight out of 160 samples (61%) were considered 'up-loadable' to the Australian National Criminal Investigation DNA Database (NCIDD). The method described required a minimum of working steps, equipment and reagents, and was completed within 4h. Direct PCR allows the generation of DNA profiles from enhanced prints without the need to increase PCR cycle numbers beyond manufacturer's recommendations. Particular emphasis was placed on preventing contamination by applying strict protocols and avoiding the use of previously used fingerprint brushes. Based on this extensive survey, the data provided indicate minimal effects of any of these four powders on the chance of obtaining DNA profiles from enhanced fingermarks. Copyright © 2017

An Optimized DNA Analysis Workflow for the Sampling, Extraction, and Concentration of DNA obtained from Archived Latent Fingerprints.

Science.gov (United States)

Solomon, April D; Hytinen, Madison E; McClain, Aryn M; Miller, Marilyn T; Dawson Cruz, Tracey

2018-01-01

DNA profiles have been obtained from fingerprints, but there is limited knowledge regarding DNA analysis from archived latent fingerprints-touch DNA "sandwiched" between adhesive and paper. Thus, this study sought to comparatively analyze a variety of collection and analytical methods in an effort to seek an optimized workflow for this specific sample type. Untreated and treated archived latent fingerprints were utilized to compare different biological sampling techniques, swab diluents, DNA extraction systems, DNA concentration practices, and post-amplification purification methods. Archived latent fingerprints disassembled and sampled via direct cutting, followed by DNA extracted using the QIAamp® DNA Investigator Kit, and concentration with Centri-Sep™ columns increased the odds of obtaining an STR profile. Using the recommended DNA workflow, 9 of the 10 samples provided STR profiles, which included 7-100% of the expected STR alleles and two full profiles. Thus, with carefully selected procedures, archived latent fingerprints can be a viable DNA source for criminal investigations including cold/postconviction cases. © 2017 American Academy of Forensic Sciences.

Teaching DNA Fingerprinting using a Hands-on Simulation.

Science.gov (United States)

Schug, Thatcher

1998-01-01

Presents an inexpensive hands-on lesson in DNA fingerprinting that can be completed in a single class period. Involves students in solving a murder in which a drop of blood is fingerprinted and matched with the blood of the murderer. (DDR)

Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.

Science.gov (United States)

Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D

2004-11-01

Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.

DNA Electronic Fingerprints by Local Spectroscopy on Graphene

Science.gov (United States)

Balatsky, Alexander

2013-03-01

Working and scalable alternatives to the conventional chemical methods of DNA sequencing that are based on electronic/ionic signatures would revolutionize the field of sequencing. The approach of a single molecule imaging and spectroscopy with unprecedented resolution, achieved by Scanning Tunneling Spectroscopy (STS) and nanopore electronics could enable this revolution. We use the data from our group and others in applying this local scanning tunneling microscopy and illustrate possibilities of electronic sequencing of freeze dried deposits on graphene. We will present two types of calculated fingerprints: first in Local Density of States (LDOS) of DNA nucleotide bases (A,C,G,T) deposited on graphene. Significant base-dependent features in the LDOS in an energy range within few eV of the Fermi level were found in our calculations. These features can serve as electronic fingerprints for the identification of individual bases in STS. In the second approach we present calculated base dependent electronic transverse conductance as DNA translocates through the graphene nanopore. Thus we argue that the fingerprints of DNA-graphene hybrid structures may provide an alternative route to DNA sequencing using STS. Work supported by US DOE, NORDITA.

Identification and strain differentiation of 'Bacteroides fragilis group' species and Prevotella bivia by PCR fingerprinting.

Science.gov (United States)

Claros, M; Schönian, G; Gräser, Y; Montag, T; Rodloff, A C; Citron, D M; Goldstein, E J

1995-08-01

Using single consensus primers of genomic nucleotide sequences, PCR-generated fingerprints were used for identification and differentiation of the Bacteroides fragilis group (B. fragilis, B. thetaiotaomicron, B. ovatus, B. distasonis, B. vulgatus) and Prevotella bivia (B. bivius) by comparing the DNA profiles with those of reference strains from the American Type Culture Collection and German Culture Collection. When primed by a single primer phage M13 core sequence, intra-species specific differences and species-specific bands were detected. Using primers derived from the evolutionarily conserved tRNA gene sequence, species-specific patterns were produced. A computer program, GelManager, was used to analyze the profiles and generate dendrograms. The correlation coefficients determined from the DNA fingerprint profiles of the clinical isolates (using the M13 core primer) fell within a narrow range, reflecting a high level of homology within the species. Based on the dendrograms, strains of one species were clearly differentiated from strains of other species. For comparison, SDS-PAGE analysis of whole cell extracts was also performed to obtain protein band patterns of various strains. Because of the simplicity of the PCR fingerprinting method and the ease of performance of computerized evaluation of data, this technique is a useful method for both species and strain differentiation, as well as for characterization of Bacteroides species and Prevotella bivia.

Cluster analysis of Helicobacter pylori genomic DNA fingerprints suggests gastroduodenal disease-specific associations.

Science.gov (United States)

Go, M F; Chan, K Y; Versalovic, J; Koeuth, T; Graham, D Y; Lupski, J R

1995-07-01

Helicobacter pylori infection is now accepted as the most common cause of chronic active gastritis and peptic ulcer disease. The etiologies of many infectious diseases have been attributed to specific or clonal strains of bacterial pathogens. Polymerase chain reaction (PCR) amplification of DNA between repetitive DNA sequences, REP elements (REP-PCR), has been utilized to generate DNA fingerprints to examine similarity among strains within a bacterial species. Genomic DNA from H. pylori isolates obtained from 70 individuals (39 duodenal ulcers and 31 simple gastritis) was PCR-amplified using consensus probes to repetitive DNA elements. The H. pylori DNA fingerprints were analyzed for similarity and correlated with disease presentation using the NTSYS-pc computer program. Each H. pylori strain had a distinct DNA fingerprint except for two pairs. Single-colony DNA fingerprints of H. pylori from the same patient were identical, suggesting that each patient harbors a single strain. Computer-assisted cluster analysis of the REP-PCR DNA fingerprints showed two large clusters of isolates, one associated with simple gastritis and the other with duodenal ulcer disease. Cluster analysis of REP-PCR DNA fingerprints of H. pylori strains suggests that duodenal ulcer isolates, as a group, are more similar to one another and different from gastritis isolates. These results suggest that disease-specific strains may exist.

Cloning and Characterization of a Complex DNA Fingerprinting Probe for Candida parapsilosis

Science.gov (United States)

Enger, Lee; Joly, Sophie; Pujol, Claude; Simonson, Patricia; Pfaller, Michael; Soll, David R.

2001-01-01

Candida parapsilosis accounts for a significant number of nosocomial fungemias, but in fact, no effective and verified genetic fingerprinting method has emerged for assessing the relatedness of independent isolates for epidemiological studies. A complex 15-kb DNA fingerprinting probe, Cp3-13, was therefore isolated from a library of C. parapsilosis genomic DNA fragments. The efficacy of Cp3-13 for DNA fingerprinting was verified by a comparison of its clustering capacity with those of randomly amplified polymorphic DNA analysis and internally transcribed spacer region sequencing, by testing species specificity, and by assessing its capacity to identify microevolutionary changes both in vitro and in vivo. Southern blot hybridization of EcoRI/SalI-digested DNA with Cp3-13 provides a fingerprinting system that (i) identifies the same strain in independent isolates, (ii) discriminates between unrelated isolates, (iii) separates independent isolates into valid groups in a dendrogram, (iv) identifies microevolution in infecting populations, and (v) is amenable to automatic computer-assisted DNA fingerprint analysis. This probe is now available for epidemiological studies. PMID:11158125

Acetone facilitated DNA sampling from electrical tapes improves DNA recovery and enables latent fingerprints development.

Science.gov (United States)

Feine, Ilan; Shpitzen, Moshe; Geller, Boris; Salmon, Eran; Peleg, Tsach; Roth, Jonathan; Gafny, Ron

2017-07-01

Electrical tapes (ETs) are a common component of improvised explosive devices (IEDs) used by terrorists or criminal organizations and represent a valuable forensic resource for DNA and latent fingerprints recovery. However, DNA recovery rates are typically low and usually below the minimal amount required for amplification. In addition, most DNA extraction methods are destructive and do not allow further latent fingerprints development. In the present study a cell culture based touch DNA model was used to demonstrate a two-step acetone-water DNA recovery protocol from ETs. This protocol involves only the adhesive side of the ET and increases DNA recovery rates by up to 70%. In addition, we demonstrated partially successful latent fingerprints development from the non-sticky side of the ETs. Taken together, this protocol maximizes the forensic examination of ETs and is recommended for routine casework processing. Copyright © 2017 Elsevier B.V. All rights reserved.

DNA fingerprints come to court

International Nuclear Information System (INIS)

Anon.

1988-01-01

DNA fingerprinting, a new technique, which produces a visual representation of a person's genome, enables the identification of perpetrators from as little as a single hair root, providing they have left some biologic evidence-hair, skin cells, blood, or semen-at the scene of the crime. DNA fingerprinting was developed by British geneticist Alec Jeffreys, PhD, in 1985. Jeffreys, professor genetics at the University of Leicester, built upon a discovery, five years earlier, of certain hypervariable regions called minisatellites in unexpressed areas of DNA. The hypervariability was evidenced in the number of repetitions of certain sequences of base pairs. It was this aspect that revealed to Jeffreys something that had eluded other investigators. He realized that these minisatellite regions had a potential for identification far greater than that of conventional genetic markers, which are defined by restriction fragment length polymorphisms (RFLPs). RFLPs are characterized by the substitution of one base pair for another, resulting in the presence or absence of a restriction enzyme site. Thus, each offers a limited number of alleles. In contrast, minisatellite regions have an accordion-like range of length, as the number of repetitions of a given sequence varies widely from person to person

Characterization of Actinomyces with genomic DNA fingerprints and rRNA gene probes.

Science.gov (United States)

Bowden, G; Johnson, J; Schachtele, C

1993-08-01

Cellular DNA from 25 Actinomyces naeslundii and Actinomyces viscosus strains belonging to the 7 taxonomic clusters of Fillery et al. (1978) and several unclustered strains was obtained by enzymatic and N-lauroylsarcosine/guanidine isothiocyanate treatment of whole cells, followed by extraction of the nucleic acid. The DNA samples were digested with restriction endonucleases BamHI or PvuII, and agarose gel electrophoresis was used to obtain DNA fingerprints. The DNA fragments were subjected to Southern blot hybridization with a digoxigenin-labeled cDNA probe transcribed from Escherichia coli 16S and 23S rRNA. The patterns of bands from genomic (DNA fingerprints) and rDNA fingerprints (ribotypes) were used for comparison between the taxonomic cluster strains and strains within clusters. Representative strains from each taxonomic cluster provided different BamHI DNA fingerprints and ribotype patterns with 3 to 9 distinct bands. Some strains within a cluster showed identical ribotype patterns with both endonucleases (A. naeslundii B120 and A. naeslundii B102 from cluster 3), while others showed the same pattern with BamHI but a different pattern with PvuII (A. naeslundii ATCC 12104 and 398A from cluster 5). A viscosus ATCC 15987 (cluster 7) and its parent strain T6 yielded identical fingerprint and ribotype patterns. The genomic diversity revealed by DNA fingerprinting and ribotyping demonstrates that these techniques, which do not require phenotypic expression, are suited for study of the oral ecology of the Actinomyces, and for epidemiological tracking of specific Actinomyces strains associated with caries lesions and sites of periodontal destruction.

Touch DNA collection versus firearm fingerprinting: comparing evidence production and identification outcomes.

Science.gov (United States)

Nunn, Samuel

2013-05-01

A project by a metropolitan police agency in 2008-2009 had police use touch DNA kits to collect cell samples from seized firearms. To assess outcomes, results of touch DNA swabbing of firearms were compared to fingerprinting firearm evidence. The rationale was that fingerprinting, as the older technology, was the baseline against which to compare touch DNA. But little is known about ways to measure touch DNA productivity compared to fingerprinting. To examine differences between the two requires comparable measurements. Two measures were used: quantity of probative or investigative evidence produced and identification outcomes. When applied to firearms seized within an Indianapolis, IN police district, touch DNA produced a larger volume of evidence than fingerprinting, but identification outcomes for the two methods were equal. Because touch DNA was deployed by police patrol officers, there are implications for firearm forensics and the choice of forensic approaches used by police. © 2013 American Academy of Forensic Sciences.

Microbial DNA fingerprinting of human fingerprints: dynamic colonization of fingertip microflora challenges human host inferences for forensic purposes.

Science.gov (United States)

Tims, Sebastian; van Wamel, Willem; Endtz, Hubert P; van Belkum, Alex; Kayser, Manfred

2010-09-01

Human fingertip microflora is transferred to touched objects and may provide forensically relevant information on individual hosts, such as on geographic origins, if endogenous microbial skin species/strains would be retrievable from physical fingerprints and would carry geographically restricted DNA diversity. We tested the suitability of physical fingerprints for revealing human host information, with geographic inference as example, via microbial DNA fingerprinting. We showed that the transient exogenous fingertip microflora is frequently different from the resident endogenous bacteria of the same individuals. In only 54% of the experiments, the DNA analysis of the transient fingertip microflora allowed the detection of defined, but often not the major, elements of the resident microflora. Although we found microbial persistency in certain individuals, time-wise variation of transient and resident microflora within individuals was also observed when resampling fingerprints after 3 weeks. While microbial species differed considerably in their frequency spectrum between fingerprint samples from volunteers in Europe and southern Asia, there was no clear geographic distinction between Staphylococcus strains in a cluster analysis, although bacterial genotypes did not overlap between both continental regions. Our results, though limited in quantity, clearly demonstrate that the dynamic fingerprint microflora challenges human host inferences for forensic purposes including geographic ones. Overall, our results suggest that human fingerprint microflora is too dynamic to allow for forensic marker developments for retrieving human information.

Genetic diversity and DNA fingerprinting in jute (Corchorus spp. based on SSR markers

Directory of Open Access Journals (Sweden)

Liwu Zhang

2015-10-01

Full Text Available Genetic diversity analysis and DNA finger printing are very useful in breeding programs, seed conservation and management. Jute (Corchorus spp. is the second most important natural fiber crop after cotton. DNA fingerprinting studies in jute using SSR markers are limited. In this study, 58 jute accessions, including two control varieties (Huangma 179 and Kuanyechangguo from the official variety registry in China were evaluated with 28 pairs of SSR primers. A total of 184 polymorphic loci were identified. Each primer detected 3 to 15 polymorphic loci, with an average of 6.6. The 58 jute accessions were DNA-fingerprinted with 67 SSR markers from the 28 primer pairs. These markers differentiated the 58 jute accessions from one another, with CoSSR305-120 and CoSSR174-195 differentiating Huangma 179 and Kuanyechangguo, respectively. NTSYS-pc2.10 software was used to analyze the genetic diversity in the 58 jute accessions. Their genetic similarity coefficients ranged from 0.520 to 0.910 with an average of 0.749, indicating relatively great genetic diversity among them. The 58 jute accessions were divided into four groups with the coefficient 0.710 used as a value for classification, consistent with their species and pedigrees. All these results may be useful both for protection of intellectual property rights of jute accessions and for jute improvement.

Genetic diversity and DNA fingerprinting in jute(Corchorus spp.) based on SSR markers

Institute of Scientific and Technical Information of China (English)

Liwu; Zhang; Rongrong; Cai; Minhang; Yuan; Aifen; Tao; Jiantang; Xu; Lihui; Lin; Pingping; Fang; Jianmin; Qi

2015-01-01

Genetic diversity analysis and DNA finger printing are very useful in breeding programs,seed conservation and management. Jute(Corchorus spp.) is the second most important natural fiber crop after cotton. DNA fingerprinting studies in jute using SSR markers are limited. In this study, 58 jute accessions, including two control varieties(Huangma 179 and Kuanyechangguo) from the official variety registry in China were evaluated with 28 pairs of SSR primers. A total of 184 polymorphic loci were identified. Each primer detected 3 to 15 polymorphic loci, with an average of 6.6. The 58 jute accessions were DNA-fingerprinted with 67 SSR markers from the 28 primer pairs. These markers differentiated the 58 jute accessions from one another, with Co SSR305-120 and Co SSR174-195 differentiating Huangma 179 and Kuanyechangguo, respectively. NTSYS-pc2.10 software was used to analyze the genetic diversity in the 58 jute accessions. Their genetic similarity coefficients ranged from 0.520 to 0.910 with an average of 0.749, indicating relatively great genetic diversity among them. The 58 jute accessions were divided into four groups with the coefficient 0.710 used as a value for classification, consistent with their species and pedigrees. All these results may be useful both for protection of intellectual property rights of jute accessions and for jute improvement.

[An analysis of the DNA fingerprinting of intestinal flora in inflammatory bowel disease].

Science.gov (United States)

Li, Run-mei; Han, Ying; Wang, Ji-heng; Wang, Zhi-hong

2007-02-01

DNA fingerprinting for inflammatory bowel disease (IBD) patients and healthy subjects was carried out to compare the difference of intestinal flora between the two groups. DNA fingerprinting for IBD patients and healthy persons was set up with enterobacterial repetitive intergenic consensus (ERIC-PCR) technology and the difference of intestinal flora between the two groups compared. DNA fingerprinting of the IBD patients and healthy subjects was identified and a significant difference was noticed between them. There were lots of bands in the DNA fingerprinting of the healthy subjects but few in that of the IBD patients. Strikingly, same distribution of the principal band of DNA fingerprinting was noticed in IBD patients. The variety of intestinal flora in healthy subjects is more apparent than that in IBD patients. An unique principal band might be the sequence of the presence of specific etiopathogenetic bacterium, or it might be the combined sequence of mixed bacterial flora.

An overview of DNA fingerprinting with 32P nucleotides

International Nuclear Information System (INIS)

Pappas, G.G.

1992-01-01

The DNA probes radiolabeled with 32 P, a primary tool employed by researchers in the life sciences for > 20 yr, are used by private companies, state-run laboratories, and the FBI to generate autoradiographs displaying the unique banding patterns that constitute the DNA fingerprint. The ability to identify an individual or animal from a biological sample has profound implications. Unidentified bodies, unrecognizable remains, and missing children can be tested and the DNA fingerprint compared to those of family members for positive identification. Paternity can be established before a child's birth. Immigration disputes can easily be resolved. Other uses include pedigree determination and testing for cell-line cross-contamination. Using a DNA fingerprint to determine the guilt or innocence of an individual allegedly involved in a violent crime is very controversial and has great legal and moral implications for society. Forensic laboratories have been challenged to ensure a level of quality control and quality assurance consistent with the weight given to these tests when used as evidence in a court of law

ENHANCING NETWORK SECURITY USING 'LEARNING-FROM-SIGNALS' AND FRACTIONAL FOURIER TRANSFORM BASED RF-DNA FINGERPRINTS

Energy Technology Data Exchange (ETDEWEB)

Buckner, Mark A [ORNL; Bobrek, Miljko [ORNL; Farquhar, Ethan [ORNL; Harmer, Paul K [Air Force Institute of Technology; Temple, Michael A [Air Force Institute of Technology

2011-01-01

Wireless Access Points (WAP) remain one of the top 10 network security threats. This research is part of an effort to develop a physical (PHY) layer aware Radio Frequency (RF) air monitoring system with multi-factor authentication to provide a first-line of defense for network security--stopping attackers before they can gain access to critical infrastructure networks through vulnerable WAPs. This paper presents early results on the identification of OFDM-based 802.11a WiFi devices using RF Distinct Native Attribute (RF-DNA) fingerprints produced by the Fractional Fourier Transform (FRFT). These fingerprints are input to a "Learning from Signals" (LFS) classifier which uses hybrid Differential Evolution/Conjugate Gradient (DECG) optimization to determine the optimal features for a low-rank model to be used for future predictions. Results are presented for devices under the most challenging conditions of intra-manufacturer classification, i.e., same-manufacturer, same-model, differing only in serial number. The results of Fractional Fourier Domain (FRFD) RF-DNA fingerprints demonstrate significant improvement over results based on Time Domain (TD), Spectral Domain (SD) and even Wavelet Domain (WD) fingerprints.

[Identification of a repetitive sequence element for DNA fingerprinting in Phytophthora sojae].

Science.gov (United States)

Yin, Lihua; Wang, Qinhu; Ning, Feng; Zhu, Xiaoying; Zuo, Yuhu; Shan, Weixing

2010-04-01

Establishment of DNA fingerprinting in Phytophthora sojae and an analysis of genetic relationship of Heilongjiang and Xinjiang populations. Bioinformatics tools were used to search repetitive sequences in P. sojae and Southern blot analysis was employed for DNA fingerprinting analysis of P. sojae populations from Heilongjiang and Xinjiang using the identified repetitive sequence. A moderately repetitive sequence was identified and designated as PS1227. Southern blot analysis indicated 34 distinct bands ranging in size from 1.5 kb-23 kb, of which 21 were polymorphic among 49 isolates examined. Analysis of single-zoospore progenies showed that the PS1227 fingerprint pattern was mitotically stable. DNA fingerprinting showed that the P. sojae isolates HP4002, SY6 and GJ0105 of Heilongjiang are genetically identical to DW303, 71228 and 71222 of Xinjiang, respectively. A moderately repetitive sequence designated PS1227 which will be useful for epidemiology and population biology studies of P. sojae was obtained, and a PS1227-based DNA fingerprinting analysis provided molecular evidence that P. sojae in Xinjiang was likely introduced from Heilongjiang.

Converting Panax ginseng DNA and chemical fingerprints into two-dimensional barcode.

Science.gov (United States)

Cai, Yong; Li, Peng; Li, Xi-Wen; Zhao, Jing; Chen, Hai; Yang, Qing; Hu, Hao

2017-07-01

In this study, we investigated how to convert the Panax ginseng DNA sequence code and chemical fingerprints into a two-dimensional code. In order to improve the compression efficiency, GATC2Bytes and digital merger compression algorithms are proposed. HPLC chemical fingerprint data of 10 groups of P. ginseng from Northeast China and the internal transcribed spacer 2 (ITS2) sequence code as the DNA sequence code were ready for conversion. In order to convert such data into a two-dimensional code, the following six steps were performed: First, the chemical fingerprint characteristic data sets were obtained through the inflection filtering algorithm. Second, precompression processing of such data sets is undertaken. Third, precompression processing was undertaken with the P. ginseng DNA (ITS2) sequence codes. Fourth, the precompressed chemical fingerprint data and the DNA (ITS2) sequence code were combined in accordance with the set data format. Such combined data can be compressed by Zlib, an open source data compression algorithm. Finally, the compressed data generated a two-dimensional code called a quick response code (QR code). Through the abovementioned converting process, it can be found that the number of bytes needed for storing P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can be greatly reduced. After GTCA2Bytes algorithm processing, the ITS2 compression rate reaches 75% and the chemical fingerprint compression rate exceeds 99.65% via filtration and digital merger compression algorithm processing. Therefore, the overall compression ratio even exceeds 99.36%. The capacity of the formed QR code is around 0.5k, which can easily and successfully be read and identified by any smartphone. P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can form a QR code after data processing, and therefore the QR code can be a perfect carrier of the authenticity and quality of P. ginseng information. This study provides a theoretical

Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

Energy Technology Data Exchange (ETDEWEB)

Winston Chen, C.H.; Taranenko, N.I.; Zhu, Y.F.; Chung, C.N.; Allman, S.L.

1997-03-01

Since laser mass spectrometry has the potential for achieving very fast DNA analysis, the authors recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Snager`s enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. The preliminary results indicate laser mass spectrometry can possibly be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, the authors applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

Usefulness of the DNA-fingerprinting pattern and the multilocus enzyme electrophoresis profile in the assessment of outbreaks of meningococcal disease

DEFF Research Database (Denmark)

Weis, N; Lind, I

1996-01-01

cases were identical to the outbreak strain. None of the local serogroup C carrier strains isolated during the outbreak of serogroup C disease were identical to the outbreak strain. Both DNA-fingerprinting and MEE improved the differentiation of meningococci when compared with phenotypic......The objective of the study was to assess whether genotypic characterization by means of DNA-fingerprinting pattern (DFP) and multilocus enzyme electrophoresis (MEE) profile as compared to phenotypic characterization would improve the differentiation of Neisseria meningitidis strains associated...... in each outbreak were designated the index strains. Among the remaining 55 outbreak strains 52 were either DFP-identical or DFP-indistinguishable when compared with the one relevant out of the 4 index strains. This was only the case for 17 of the 37 strains isolated from sporadic cases caused by the same...

Application of a clustering-based peak alignment algorithm to analyze various DNA fingerprinting data.

Science.gov (United States)

Ishii, Satoshi; Kadota, Koji; Senoo, Keishi

2009-09-01

DNA fingerprinting analysis such as amplified ribosomal DNA restriction analysis (ARDRA), repetitive extragenic palindromic PCR (rep-PCR), ribosomal intergenic spacer analysis (RISA), and denaturing gradient gel electrophoresis (DGGE) are frequently used in various fields of microbiology. The major difficulty in DNA fingerprinting data analysis is the alignment of multiple peak sets. We report here an R program for a clustering-based peak alignment algorithm, and its application to analyze various DNA fingerprinting data, such as ARDRA, rep-PCR, RISA, and DGGE data. The results obtained by our clustering algorithm and by BioNumerics software showed high similarity. Since several R packages have been established to statistically analyze various biological data, the distance matrix obtained by our R program can be used for subsequent statistical analyses, some of which were not previously performed but are useful in DNA fingerprinting studies.

DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

Science.gov (United States)

Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

2012-01-01

Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications.

DNA Fingerprinting of Chinese Melon Provides Evidentiary Support of Seed Quality Appraisal

Science.gov (United States)

Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

2012-01-01

Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications. PMID:23285039

DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

Directory of Open Access Journals (Sweden)

Peng Gao

Full Text Available Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines. Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR codes of 471 melon varieties (lines were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications.

DNA fingerprinting on trial: the dramatic early history of a new forensic technique.

Science.gov (United States)

Aronson, Jay D

2005-09-01

The early history of "DNA fingerprinting" in the UK might have been different were it not for the accounts of two dramatic courtroom trials, made by the participants and the media, in the mid-1980s. But these reports, which misrepresented the importance DNA evidence had in the trials, left a strong impression on the British public and on judges on both sides of the Atlantic. These trials, widely considered to be the first "victories" for DNA fingerprinting, have been frequently cited as proof of the utility and reliability of the technique, in both the UK and beyond. But in reality, it was the threat of DNA evidence being used rather than the integrity or validity of it that resolved these cases. At that time, DNA fingerprinting was still in its infancy, an untried and untested technology.

Genetic, epigenetic, and HPLC fingerprint differentiation between natural and ex situ populations of Rhodiola sachalinensis from Changbai Mountain, China.

Science.gov (United States)

Zhao, Wei; Shi, Xiaozheng; Li, Jiangnan; Guo, Wei; Liu, Chengbai; Chen, Xia

2014-01-01

Rhodiola sachalinensis is an endangered species with important medicinal value. We used inter-simple sequence repeat (ISSR) and methylation-sensitive amplified polymorphism (MSAP) markers to analyze genetic and epigenetic differentiation in different populations of R. sachalinensis, including three natural populations and an ex situ population. Chromatographic fingerprint was used to reveal HPLC fingerprint differentiation. According to our results, the ex situ population of R. sachalinensis has higher level genetic diversity and greater HPLC fingerprint variation than natural populations, but shows lower epigenetic diversity. Most genetic variation (54.88%) was found to be distributed within populations, and epigenetic variation was primarily distributed among populations (63.87%). UPGMA cluster analysis of ISSR and MSAP data showed identical results, with individuals from each given population grouping together. The results of UPGMA cluster analysis of HPLC fingerprint patterns was significantly different from results obtained from ISSR and MSAP data. Correlation analysis revealed close relationships among altitude, genetic structure, epigenetic structure, and HPLC fingerprint patterns (R2 = 0.98 for genetic and epigenetic distance; R2 = 0.90 for DNA methylation level and altitude; R2 = -0.95 for HPLC fingerprint and altitude). Taken together, our results indicate that ex situ population of R. sachalinensis show significantly different genetic and epigenetic population structures and HPLC fingerprint patterns. Along with other potential explanations, these findings suggest that the ex situ environmental factors caused by different altitude play an important role in keeping hereditary characteristic of R. sachalinensis.

Characterization of human glioblastoma cell lines in vitro and their xenografts in nude mice by DNA fingerprinting

DEFF Research Database (Denmark)

Türeci, O; Fischer, H; Lagoda, P

1990-01-01

Human gliomas were grown as permanent tissue cultures and xenografts in nude mice. DNA fingerprint patterns from two human gliomas were established using two different hypervariable multilocus probes [( GTG]5 and 33.15). In general the cell lines investigated showed an overall stability in the DNA...... fingerprint pattern. However, differences in the DNA fingerprint patterns were shown to occur depending upon the above mentioned parameters....

DNA Fingerprinting of Olive Varieties by Microsatellite Markers

Directory of Open Access Journals (Sweden)

Dunja Bandelj

2002-01-01

Full Text Available Microsatellites combine several features of an ultimate molecular marker and they are used increasingly in various plant genetic studies and applications. In this work we report on the utilisation of fourteen previously developed olive microsatellite markers for the identification and differentiation of a set of nineteen olive varieties. All analysed microsatellite markers revealed a high level of polymorphism that allowed unique genotyping of the examined varieties. Ninety-six alleles were detected at all 14 loci, which multiplied into a large number of observed genotypes, giving high discrimination value for varietal identification. A minimum number of three microsatellite markers was chosen for the rapid and unambiguous varietal identification of nineteen olive varieties and only two markers were sufficient for differentiation of five local varieties. DNA fingerprints of olive cultivars by means of microsatellites provided meaningful data, which can be extended by additional olive varieties or new microsatellites and used for accurate inter-laboratory comparison. The data obtained can be used for the varietal survey and construction of a database of all olive varieties grown in Slovenia providing also additional genetic information on the agronomic and quality characteristics of the olive varieties.

DNA fingerprinting based on simple sequence repeat (SSR ...

African Journals Online (AJOL)

New varieties of sugarcane are protected using morphological descriptors, which have limitations in identifying morphologically similar cultivars. Development of a reliable DNA fingerprint system for identification of new varieties would contribute greatly to the breeding of these species. Microsatellite markers are tools with ...

Analysis of fingerprint samples, testing various conditions, for forensic DNA identification.

Science.gov (United States)

Ostojic, Lana; Wurmbach, Elisa

2017-01-01

Fingerprints can be of tremendous value for forensic biology, since they can be collected from a wide variety of evident types, such as handles of weapons, tools collected in criminal cases, and objects with no apparent staining. DNA obtained from fingerprints varies greatly in quality and quantity, which ultimately affects the quality of the resulting STR profiles. Additional difficulties can arise when fingerprint samples show mixed STR profiles due to the handling of multiple persons. After applying a tested protocol for sample collection (swabbing with 5% Triton X-100), DNA extraction (using an enzyme that works at elevated temperatures), and PCR amplification (AmpFlSTR® Identifiler® using 31cycles) extensive analysis was performed to better understand the challenges inherent to fingerprint samples, with the ultimate goal of developing valuable profiles (≥50% complete). The impact of time on deposited fingerprints was investigated, revealing that while the quality of profiles deteriorated, full STR profiles could still be obtained from samples after 40days of storage at room temperature. By comparing the STR profiles from fingerprints of the dominant versus the non-dominant hand, we found a slightly better quality from the non-dominant hand, which was not always significant. Substrates seem to have greater effects on fingerprints. Tests on glass, plastic, paper and metal (US Quarter dollar, made of Cu and Ni), common substrates in offices and homes, showed best results for glass, followed by plastic and paper, while almost no profiles were obtained from a Quarter dollar. Important for forensic casework, we also assessed three-person mixtures of touched fingerprint samples. Unlike routinely used approaches for sampling evidence, the surface of an object (bottle) was sectioned into six equal parts and separate samples were taken from each section. The samples were processed separately for DNA extraction and STR amplification. The results included a few single

Multilocus DNA fingerprints in gallinaceous birds: general approach and problems.

Science.gov (United States)

Hanotte, O; Bruford, M W; Burke, T

1992-06-01

Multilocus profiles were investigated in five different species of Galliformes (ring-necked pheasant Phasianus colchicus, Indian peafowl Pavo cristatus, Japanese quail Coturnix coturnix japonica, domestic chicken Gallus gallus, and red grouse Lagopus lagopus scoticus) using two human multilocus probes (33.6 and 33.15) in combination with each of four restriction enzymes (AluI, DdeI, HaeIII or HinfI). All the species show a DNA fingerprint-like pattern using at least one restriction enzyme in combination with each multilocus probe. The number of bands detected and the value of the index of similarity for each species differ significantly between the profiles obtained with each multilocus probe. Some enzyme/probe combinations reveal strong cross-hybridization of the multilocus probes with satellite or satellite-like DNA sequences in pheasant, peacock, quail and chicken, which partially or completely prevented scoring of the profile. The choice of restriction enzyme was found to influence the number of bands, the value of the index of similarity and the probability of obtaining an identical fingerprint between unrelated individuals. The Mendelian inheritance and independent segregation of the fragments detected using AluI was investigated in three species (ring-necked pheasant, Indian peafowl and red grouse). Some bands were shown to be tightly linked. An extreme case was encountered in the red grouse, where 12 of the 15 bands scored in one parent represented only two, apparently allelic, haplotypes and so derived from a single locus. However, fingerprint patterns will often be adequate for use in paternity analyses, such as in behavioural studies, despite the occurrence of haplotypic sets of bands. Identical DNA multilocus profiles were sometimes observed between captive-bred siblings in one species. These results emphasize the desirability of determining, in each new species, the optimal experimental conditions as a preliminary to any behavioural or population

Applications of the rep-PCR DNA fingerprinting technique to study microbial diversity, ecology and evolution.

Science.gov (United States)

Ishii, Satoshi; Sadowsky, Michael J

2009-04-01

A large number of repetitive DNA sequences are found in multiple sites in the genomes of numerous bacteria, archaea and eukarya. While the functions of many of these repetitive sequence elements are unknown, they have proven to be useful as the basis of several powerful tools for use in molecular diagnostics, medical microbiology, epidemiological analyses and environmental microbiology. The repetitive sequence-based PCR or rep-PCR DNA fingerprint technique uses primers targeting several of these repetitive elements and PCR to generate unique DNA profiles or 'fingerprints' of individual microbial strains. Although this technique has been extensively used to examine diversity among variety of prokaryotic microorganisms, rep-PCR DNA fingerprinting can also be applied to microbial ecology and microbial evolution studies since it has the power to distinguish microbes at the strain or isolate level. Recent advancement in rep-PCR methodology has resulted in increased accuracy, reproducibility and throughput. In this minireview, we summarize recent improvements in rep-PCR DNA fingerprinting methodology, and discuss its applications to address fundamentally important questions in microbial ecology and evolution.

Genetic, epigenetic, and HPLC fingerprint differentiation between natural and ex situ populations of Rhodiola sachalinensis from Changbai Mountain, China.

Directory of Open Access Journals (Sweden)

Wei Zhao

Full Text Available Rhodiola sachalinensis is an endangered species with important medicinal value. We used inter-simple sequence repeat (ISSR and methylation-sensitive amplified polymorphism (MSAP markers to analyze genetic and epigenetic differentiation in different populations of R. sachalinensis, including three natural populations and an ex situ population. Chromatographic fingerprint was used to reveal HPLC fingerprint differentiation. According to our results, the ex situ population of R. sachalinensis has higher level genetic diversity and greater HPLC fingerprint variation than natural populations, but shows lower epigenetic diversity. Most genetic variation (54.88% was found to be distributed within populations, and epigenetic variation was primarily distributed among populations (63.87%. UPGMA cluster analysis of ISSR and MSAP data showed identical results, with individuals from each given population grouping together. The results of UPGMA cluster analysis of HPLC fingerprint patterns was significantly different from results obtained from ISSR and MSAP data. Correlation analysis revealed close relationships among altitude, genetic structure, epigenetic structure, and HPLC fingerprint patterns (R2 = 0.98 for genetic and epigenetic distance; R2 = 0.90 for DNA methylation level and altitude; R2 = -0.95 for HPLC fingerprint and altitude. Taken together, our results indicate that ex situ population of R. sachalinensis show significantly different genetic and epigenetic population structures and HPLC fingerprint patterns. Along with other potential explanations, these findings suggest that the ex situ environmental factors caused by different altitude play an important role in keeping hereditary characteristic of R. sachalinensis.

Usage of DNA Fingerprinting Technology for Quality Control in Molecular Lab Bench Work.

Science.gov (United States)

McIntosh, Linda Y; Lal, Janella E; Qin, Dahui

2018-01-01

One of the major quality assurance (QA) goals in many molecular laboratories is to avoid sample pipetting errors on the lab bench; especially when pipetting into multiwell plates. A pipetting error can cause a switch in patient samples, which can lead to recording the wrong results for the patient samples involved. Such pipetting errors are difficult to identify when it happens in lab bench work. DNA fingerprinting is a powerful tool in determining sample identities. Our laboratory has explored the usage of this technology in our QA process and successfully established that DNA fingerprinting can be used to monitor possible sample switch in gene rearrangement lab bench work. We use florescent light to quench the florescence in the gene rearrangement polymerase chain reaction products. After that, DNA fingerprinting technology is used to identify the sample DNA in the gene rearrangement polymerase chain reaction plate. The result is compared with the corresponding patient's blood sample DNA to determine whether there is a sample switch during the lab bench work.

Differentiation of species of the family Acetobacteraceae by AFLP DNA fingerprinting: Gluconacetobacter kombuchae is a later heterotypic synonym of Gluconacetobacter hansenii.

Science.gov (United States)

Cleenwerck, Ilse; De Wachter, Marjan; González, Angel; De Vuyst, Luc; De Vos, Paul

2009-07-01

Amplified fragment length polymorphism (AFLP) DNA fingerprinting was investigated as a tool for fast and accurate identification of acetic acid bacteria (AAB) to the species level. One hundred and thirty five reference strains and 15 additional strains, representing 50 recognized species of the family Acetobacteraceae, were subjected to AFLP analysis using the restriction enzyme combination ApaI/TaqI and the primer combination A03/T03. The reference strains had been previously subjected to either DNA-DNA hybridization or 16S-23S rRNA spacer region gene sequence analysis and were regarded as being accurately classified at the species level. The present study revealed that six of these strains should be reclassified, namely Gluconacetobacter europaeus LMG 1518 and Gluconacetobacter xylinus LMG 1510 as Gluconacetobacter xylinus and Gluconacetobacter europaeus, respectively; Gluconacetobacter kombuchae LMG 23726(T) as Gluconacetobacter hansenii; and Acetobacter orleanensis strains LMG 1545, LMG 1592 and LMG 1608 as Acetobacter cerevisiae. Cluster analysis of the AFLP DNA fingerprints of the reference strains revealed one cluster for each species, showing a linkage level below 50 % with other clusters, except for Acetobacter pasteurianus, Acetobacter indonesiensis and Acetobacter cerevisiae. These three species were separated into two, two, and three clusters, respectively. At present, confusion exists regarding the taxonomic status of Gluconacetobacter oboediens and Gluconacetobacter intermedius; the AFLP data from this study supported their classification as separate taxa. The 15 additional strains could all be identified at the species level. AFLP analysis further revealed that some species harboured genetically diverse strains, whereas other species consisted of strains showing similar banding patterns, indicating a more limited genetic diversity. It can be concluded that AFLP DNA fingerprinting is suitable for accurate identification and classification of a broad

Qualitative and quantitative assessment of single fingerprints in forensic DNA analysis.

Science.gov (United States)

Ostojic, Lana; Klempner, Stacey A; Patel, Rosni A; Mitchell, Adele A; Axler-DiPerte, Grace L; Wurmbach, Elisa

2014-11-01

Fingerprints and touched items are important sources of DNA for STR profiling, since this evidence can be recovered in a wide variety of criminal offenses. However, there are some fundamental difficulties in working with these samples, including variability in quantity and quality of extracted DNA. In this study, we collected and analyzed over 700 fingerprints. We compared a commercially available extraction protocol (Zygem) to two methods developed in our laboratory, a simple one-tube protocol and a high sensitivity protocol (HighSens) that includes additional steps to concentrate and purify the DNA. The amplification protocols tested were AmpFLSTR® Identifiler® using either 28 or 31 amplification cycles, and Identifiler® Plus using 32 amplification cycles. We found that the HighSens and Zygem extraction methods were significantly better in their DNA yields than the one-tube method. Identifiler® Plus increased the quality of the STR profiles for the one-tube extraction significantly. However, this effect could not be verified for the other extraction methods. Furthermore, microscopic analysis of single fingerprints revealed that some individuals tended to shed more material than others onto glass slides. However, a dense deposition of skin flakes did not strongly correlate with a high quality STR profile. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Fingerprint image enhancement by differential hysteresis processing.

Science.gov (United States)

Blotta, Eduardo; Moler, Emilce

2004-05-10

A new method to enhance defective fingerprints images through image digital processing tools is presented in this work. When the fingerprints have been taken without any care, blurred and in some cases mostly illegible, as in the case presented here, their classification and comparison becomes nearly impossible. A combination of spatial domain filters, including a technique called differential hysteresis processing (DHP), is applied to improve these kind of images. This set of filtering methods proved to be satisfactory in a wide range of cases by uncovering hidden details that helped to identify persons. Dactyloscopy experts from Policia Federal Argentina and the EAAF have validated these results.

The use of DNA fingerprinting to resolve conflicting results in patients with suspected gastrointestinal malignancy.

Science.gov (United States)

Islam, Sameer; Miller, Ethan D; Patel, Neal; De Petris, Giovanni; Highsmith, Edward W; Fleischer, David E

2013-03-01

To underscore the utility of DNA fingerprinting for clarifying disparate results from endoscopic pathologic specimens. Occasionally, serially obtained gastrointestinal biopsies may yield inconsistent results. These discrepancies pose a dilemma for gastroenterologists and their patients, especially when malignancy is a consideration. Patients referred to our tertiary care center from outside institutions had undergone endoscopically obtained esophageal biopsies showing malignancy, verified by pathologists at both our site and from the referring center. Repeat endoscopic biopsies at our center did not show malignancy. To verify that different sets of biopsies came from the same patient, we performed a polymerase chain reaction-based analysis comparing the 2 specimens. This analysis, called DNA fingerprinting, can show a high degree of certainty whether 2 specimens came from the same patient. In each case, DNA fingerprinting verified a match, laying the groundwork for intervention. One patient underwent endoscopic radiofrequency ablation to the esophageal mucosa involved. Another underwent esophagectomy with partial gastrectomy. Both are doing well clinically and remain cancer-free on follow-up. DNA fingerprinting is a powerful and a relatively inexpensive tool. Usually, only small amounts of tissue are required, and even degraded or archival tissue is adequate. DNA fingerprinting can be an important tool in the gastroenterologist's arsenal to help clarify conflicting results, allowing the patient and physician to move forward with the management.

A study of the genetic relationships within and among wolf packs using DNA fingerprinting and mitochondrial DNA

Science.gov (United States)

Lehman, Niles; Clarkson, Peter; Mech, L. David; Meier, Thomas J.; Wayne, Robert K.

1992-01-01

DNA fingerprinting and mitochondrial DNA analyses have not been used in combination to study relatedness in natural populations. We present an approach that involves defining the mean fingerprint similarities among individuals thought to be unrelated because they have different mtDNA genotypes. Two classes of related individuals are identified by their distance in standard errors above this mean value. The number of standard errors is determined by analysis of the association between fingerprint similarity and relatedness in a population with a known genealogy. We apply this approach to gray wolf packs from Minnesota, Alaska, and the Northwest Territories. Our results show that: (1) wolf packs consist primarily of individuals that are closely related genetically, but some packs contain unrelated, non-reproducing individuals; (2) dispersal among packs within the same area is common; and (3) short-range dispersal appears more common for female than male wolves. The first two of these genetically-based observations are consistent with behavioral data on pack structure and dispersal in wolves, while the apparent sex bias in dispersal was not expected.

DIFFERENTIATION OF Curcuma longa, Curcuma xanthorrhiza and Zingiber cassumunar BY THIN LAYER CHROMATOGRAPHY FINGERPRINT ANALYSIS

Directory of Open Access Journals (Sweden)

Mohamad Rafi

2011-07-01

Full Text Available Turmeric (Curcuma longa, java turmeric (Curcuma xanthorrhiza and cassumunar ginger (Zingiber cassumunar are widely used in traditional Indonesian medicine. These three herbs have relatively similar rhizomes colour so it is difficult to be differentiated especially if they are in powder form. A rapid and reliable method, thin layer chromatography (TLC fingerprint, has been developed in order to identify, authenticate and differentiate these three herbs through fingerprint profile of chemical compounds. TLC fingerprints of the three herbs were obtained by visualization of separate zones with visible and UV (254 and 366 nm light. The TLC fingerprint pattern is different each other and showed a specific marker zones respectively. Therefore, TLC fingerprint can be utilized for identification, authentication and differentiation method in quality control of the three herbs tested.

Effect of dactyloscopic powders on DNA profiling from enhanced fingerprints: results from an experimental study.

Science.gov (United States)

Tozzo, Pamela; Giuliodori, Alice; Rodriguez, Daniele; Caenazzo, Luciana

2014-03-01

We conducted a study on the effect of fingerprint enhancement methods on subsequent short tandem repeat profiling. First, we performed a study typing blood traces deposited on 5 different surfaces, treated with 8 types of dactyloscopic powders. Three different DNA extraction methods were used. Subsequently, we analyzed latent fingerprints on the same 5 surfaces enhanced with the 8 different powders used in the first part of the study. This study has demonstrated that DNA profiling can be performed on fingerprints left on different substrates, and the substrate will affect the amount of DNA that can be recovered for DNA typing. In the first phase of the study, a profile was obtained in 92% of the 120 samples analyzed; in the second part, in 55% of the 80 samples analyzed, we obtained a profile complete in 32.5% of the cases. From the results obtained, it seems that the powders used in latent fingerprints enhancement, rather than having a direct inhibitory effect on extraction and amplification of DNA, may cause partial degradation of DNA, reducing the efficiency of amplification reaction. It should not be forgotten that these results were obtained under laboratory conditions, and in real caseworks, there may still be different problems involved.

Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

Science.gov (United States)

Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

2010-05-01

This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

On some surprising statistical properties of a DNA fingerprinting technique called AFLP

NARCIS (Netherlands)

Gort, G.

2010-01-01

AFLP is a widely used DNA fingerprinting technique, resulting in band absence - presence profiles, like a bar code. Bands represent DNA fragments, sampled from the genome of an individual plant or other organism. The DNA fragments travel through a lane of an electrophoretic gel or microcapillary

Comparison of Quantifiler(®) Trio and InnoQuant™ human DNA quantification kits for detection of DNA degradation in developed and aged fingerprints.

Science.gov (United States)

Goecker, Zachary C; Swiontek, Stephen E; Lakhtakia, Akhlesh; Roy, Reena

2016-06-01

The development techniques employed to visualize fingerprints collected from crime scenes as well as post-development ageing may result in the degradation of the DNA present in low quantities in such evidence samples. Amplification of the DNA samples with short tandem repeat (STR) amplification kits may result in partial DNA profiles. A comparative study of two commercially available quantification kits, Quantifiler(®) Trio and InnoQuant™, was performed on latent fingerprint samples that were either (i) developed using one of three different techniques and then aged in ambient conditions or (ii) undeveloped and then aged in ambient conditions. The three fingerprint development techniques used were: cyanoacrylate fuming, dusting with black powder, and the columnar-thin-film (CTF) technique. In order to determine the differences between the expected quantities and actual quantities of DNA, manually degraded samples generated by controlled exposure of DNA standards to ultraviolet radiation were also analyzed. A total of 144 fingerprint and 42 manually degraded DNA samples were processed in this study. The results indicate that the InnoQuant™ kit is capable of producing higher degradation ratios compared to the Quantifiler(®) Trio kit. This was an expected result since the degradation ratio is a relative value specific for a kit based on the length and extent of amplification of the two amplicons that vary from one kit to the other. Additionally, samples with lower concentrations of DNA yielded non-linear relationships of degradation ratio with the duration of aging, whereas samples with higher concentrations of DNA yielded quasi-linear relationships. None of the three development techniques produced a noticeably different degradation pattern when compared to undeveloped fingerprints, and therefore do not impede downstream DNA analysis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Fingerprinting of cell lines by directed amplification of minisatellite-region DNA (DAMD

Directory of Open Access Journals (Sweden)

Silva L.M.

2001-01-01

Full Text Available The development of in vitro propagation of cells has been an extraordinary technical advance for several biological studies. The correct identification of the cell line used, however, is crucial, as a mistaken identity or the presence of another contaminating cell may lead to invalid and/or erroneous conclusions. We report here the application of a DNA fingerprinting procedure (directed amplification of minisatellite-region DNA, developed by Heath et al. [Nucleic Acids Research (1993 21: 5782-5785], to the characterization of cell lines. Genomic DNA of cells in culture was extracted and amplified by PCR in the presence of VNTR core sequences, and the amplicons were separated by agarose gel electrophoresis. After image capture with a digital camera, the banding profiles obtained were analyzed using a software (AnaGel specially developed for the storage and analysis of electrophoretic fingerprints. The fingerprints are useful for construction of a data base for identification of cell lines by comparison to reference profiles as well as comparison of similar lines from different sources and periodic follow-up of cells in culture.

DNA Fingerprinting of Single Colonies of Helicobacter pylori from Gastric Cancer Patients Suggests Infection with a Single Predominant Strain

OpenAIRE

Miehlke, Stephan; Thomas, Rachel; Guiterrez, Oscar; Graham, David Y.; Go, Mae F.

1999-01-01

In each of six gastric cancer patients, repetitive extragenic palindromic PCR DNA fingerprints of 18 single colonies of Helicobacter pylori from the gastric antrum, corpus, and cardia were identical and matched that of the parental isolate. In three additional gastric cancer patients, 17 of 18 single-colony DNA fingerprints were identical to each other and to the DNA fingerprint of the corresponding parental isolate.

Examining DNA fingerprinting as an epidemiology tool in the tuberculosis program in the Northwest Territories, Canada.

Science.gov (United States)

Case, Cheryl; Kandola, Kami; Chui, Linda; Li, Vincent; Nix, Nancy; Johnson, Rhonda

2013-01-01

Tuberculosis (TB) is an important public health problem in the Northwest Territories (NWT), particularly among Canadian Aboriginal people. To analyse the transmission patterns of tuberculosis among the population living in the NWT, a territorial jurisdiction located within Northern Canada. This population-based retrospective study examined the DNA fingerprints of all laboratory confirmed cases of TB in the NWT, Canada, between 1990 and 2009. An isolate of each lab-confirmed case had genotyping done using IS6110 Restriction Fragment Length Polymorphism. DNA patterns were assigned to each DNA fingerprint, and indistinguishable fingerprints patterns were assigned a cluster. Social network analysis (SNA) was used to examine direct linkages among cases determined through conventional contact tracing (CCT), their DNA fingerprint and home community. Of the 225 lab-confirmed cases identified, the study was limited to 195 subjects due to DNA fingerprinting data availability. The mean age of the cases was 43.8 years (±22.6) and 120 (61.5%) males. The Dene (First Nations) encompassed 120 of the cases (87.7%), 8 cases (4.1%) were Inuit, 2 cases (1.0%) were Metis, 7 cases (3.6%) were Immigrants and 1 case had unknown ethnicity. One hundred and eighty six (95.4%) subjects were clustered, resulting in 8 clusters. Trend analysis showed significant relationships between with risk factors for unemployment (p=0.020), geographic location (p≤0.001) and homelessness (p≤0.001). Other significant risk factors included excessive alcohol consumption, prior infection with Mycobacterium tuberculosis and prior contact with a case of TB. This study demonstrates how DNA fingerprinting and SNA can be additional epidemiological tools, along with CCT method, to determine transmission patterns of TB.

A DNA Fingerprinting Simulation Laboratory for Biology Students: Hands-on Experimentation To Solve a Mock Forensic Problem.

Science.gov (United States)

Palladino, Michael A.; Cosentino, Emily

2001-01-01

Presents an alternative approach to DNA fingerprinting. Demonstrates how undergraduate students can be involved in many aspects of this type of experiment and how DNA fingerprinting experiments can be incorporated into the laboratory curriculum of courses for majors and nonmajors. (NB)

The Influence of Selected Fingerprint Enhancement Techniques on Forensic DNA Typing of Epithelial Cells Deposited on Porous Surfaces.

Science.gov (United States)

Tsai, Li-Chin; Lee, Cheng-Chang; Chen, Chun-Chieh; Lee, James Chun-I; Wang, Sheng-Meng; Huang, Nu-En; Linacre, Adrian; Hsieh, Hsing-Mei

2016-01-01

Fingerprints deposited at crime scene can be a source of DNA. Previous reports on the effects of fingerprint enhancement methods have focused mainly on fingermarks deposited in blood or saliva. Here, we evaluate the effects of fingerprint enhancement methods on fingerprints deposited on porous surfaces. We performed real-time quantification and STR typing, the results of which indicated that two methods (iodine fuming and 1,2-indanedione in ethyl acetate enhancement) had no effect on the quantity of DNA isolated and resultant STR alleles when compared to control samples. DNA quantities and allele numbers were lower for samples enhanced with silver nitrate and 1,2-indanedione in acetic acid when compared to control samples. Based on DNA quantity, quality, and observable stochastic effects, our data indicated that iodine fuming and 1,2-indanedione in ethyl acetate were the preferred options for the enhancement of fingerprints on porous surfaces. © 2015 American Academy of Forensic Sciences.

[Genomic DNA fingerprints of Legionella pneumophila serogroup 2 strains as an epidemiologic marker].

Science.gov (United States)

Bender-Beck, L; Mühlenberg, W; Lück, P C; Ott, M; Horbach, I; Fehrenbach, F J; Wewalka, G; Hacker, J

1995-08-01

Using pulsed-field gel electrophoresis, DNA fingerprints of eleven Legionella pneumophila isolates of serogroup 2 were generated. It was shown that two strains from a patient suffering from pneumonia as well as three environmental strains isolated from the shower in the hotel where the patient stayed 5 days before his illness were identical. Six strains of the same serogroup isolated from other sources were clearly separated. Thus, DNA fingerprints by pulsed-field gel electrophoresis are excellent epidemiological markers for the rarely occurring serogroup 2 of Legionella pneumophila.

DNA fingerprinting of pearls to determine their origins.

Directory of Open Access Journals (Sweden)

Joana B Meyer

Full Text Available We report the first successful extraction of oyster DNA from a pearl and use it to identify the source oyster species for the three major pearl-producing oyster species Pinctada margaritifera, P. maxima and P. radiata. Both mitochondrial and nuclear gene fragments could be PCR-amplified and sequenced. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP assay in the internal transcribed spacer (ITS region was developed and used to identify 18 pearls of unknown origin. A micro-drilling technique was developed to obtain small amounts of DNA while maintaining the commercial value of the pearls. This DNA fingerprinting method could be used to document the source of historic pearls and will provide more transparency for traders and consumers within the pearl industry.

Rapid discrimination and classification of the Lactobacillus plantarum group based on a partial dnaK sequence and DNA fingerprinting techniques.

Science.gov (United States)

Huang, Chien-Hsun; Lee, Fwu-Ling; Liou, Jong-Shian

2010-03-01

The Lactobacillus plantarum group comprises five very closely related species. Some species of this group are considered to be probiotic and widely applied in the food industry. In this study, we compared the use of two different molecular markers, the 16S rRNA and dnaK gene, for discriminating phylogenetic relationships amongst L. plantarum strains using sequencing and DNA fingerprinting. The average sequence similarity for the dnaK gene (89.2%) among five type strains was significantly less than that for the 16S rRNA (99.4%). This result demonstrates that the dnaK gene sequence provided higher resolution than the 16S rRNA and suggests that the dnaK could be used as an additional phylogenetic marker for L. plantarum. Species-specific profiles of the Lactobacillus strains were obtained with RAPD and RFLP methods. Our data indicate that phylogenetic relationships between these strains are easily resolved using sequencing of the dnaK gene or DNA fingerprinting assays.

Two dimensional molecular electronics spectroscopy for molecular fingerprinting, DNA sequencing, and cancerous DNA recognition.

Science.gov (United States)

Rajan, Arunkumar Chitteth; Rezapour, Mohammad Reza; Yun, Jeonghun; Cho, Yeonchoo; Cho, Woo Jong; Min, Seung Kyu; Lee, Geunsik; Kim, Kwang S

2014-02-25

Laser-driven molecular spectroscopy of low spatial resolution is widely used, while electronic current-driven molecular spectroscopy of atomic scale resolution has been limited because currents provide only minimal information. However, electron transmission of a graphene nanoribbon on which a molecule is adsorbed shows molecular fingerprints of Fano resonances, i.e., characteristic features of frontier orbitals and conformations of physisorbed molecules. Utilizing these resonance profiles, here we demonstrate two-dimensional molecular electronics spectroscopy (2D MES). The differential conductance with respect to bias and gate voltages not only distinguishes different types of nucleobases for DNA sequencing but also recognizes methylated nucleobases which could be related to cancerous cell growth. This 2D MES could open an exciting field to recognize single molecule signatures at atomic resolution. The advantages of the 2D MES over the one-dimensional (1D) current analysis can be comparable to those of 2D NMR over 1D NMR analysis.

Comparative study of five different DNA fingerprint techniques for molecular typing of Streptococcus pneumoniae strains

NARCIS (Netherlands)

P.W.M. Hermans (Peter); M. Sluijter (Marcel); T. Hoogenboezem (Theo); H. Heersma; A.F. van Belkum (Alex); R. de Groot (Ronald)

1995-01-01

textabstractThe aim of this study was to identify the strengths and weaknesses of five DNA fingerprint methods for epidemiological typing of Streptococcus pneumoniae. We investigated the usefulness of (i) ribotyping, (ii) BOX fingerprinting with the BOX repetitive sequence of S.

A DNA fingerprinting procedure for ultra high-throughput genetic analysis of insects.

Science.gov (United States)

Schlipalius, D I; Waldron, J; Carroll, B J; Collins, P J; Ebert, P R

2001-12-01

Existing procedures for the generation of polymorphic DNA markers are not optimal for insect studies in which the organisms are often tiny and background molecular information is often non-existent. We have used a new high throughput DNA marker generation protocol called randomly amplified DNA fingerprints (RAF) to analyse the genetic variability in three separate strains of the stored grain pest, Rhyzopertha dominica. This protocol is quick, robust and reliable even though it requires minimal sample preparation, minute amounts of DNA and no prior molecular analysis of the organism. Arbitrarily selected oligonucleotide primers routinely produced approximately 50 scoreable polymorphic DNA markers, between individuals of three independent field isolates of R. dominica. Multivariate cluster analysis using forty-nine arbitrarily selected polymorphisms generated from a single primer reliably separated individuals into three clades corresponding to their geographical origin. The resulting clades were quite distinct, with an average genetic difference of 37.5 +/- 6.0% between clades and of 21.0 +/- 7.1% between individuals within clades. As a prelude to future gene mapping efforts, we have also assessed the performance of RAF under conditions commonly used in gene mapping. In this analysis, fingerprints from pooled DNA samples accurately and reproducibly reflected RAF profiles obtained from individual DNA samples that had been combined to create the bulked samples.

SSR marker based DNA fingerprinting and diversity study in rice ...

African Journals Online (AJOL)

The genetic diversity and DNA fingerprinting of 15 elite rice genotypes using 30 SSR primers on chromosome numbers 7-12 was investigated. The results revealed that all the primers showed distinct polymorphism among the cultivars studied indicating the robust nature of microsatellites in revealing polymorphism. Cluster ...

Evaluation of three methods for DNA fingerprinting of Corynebacterium pseudotuberculosis strains isolated from goats in Poland.

Science.gov (United States)

Stefańska, Ilona; Rzewuska, Magdalena; Binek, Marian

2008-01-01

Phenotypic approaches based on metabolic and biological characteristics of Corynebacterium pseudotuberculosis have been limited due to insufficient discrimination between closely related isolates. In this paper we present performance and convenience of three molecular typing methods: BOX-PCR, random amplification of polymorphic DNA (RAPD) and amplification of DNA fragments surrounding rare restriction site (ADSRRS-fingerprinting) in genome analysis of these bacteria. Among examined 61 strains there were distinguished four, eight and 10 different genotypes by BOX-PCR, RAPD and ADSRRS-fingerprinting, respectively. The value of discrimination index was the lowest for BOX-PCR (D = 0.265), much bigger for RAPD (D = 0.539) and the highest for ADSRRS-fingerprinting (D = 0.604). The good discriminatory ability and reproducibility of RAPD and ADSRRS-fingerprinting indicates that those techniques may be particularly applied for epidemiological studies of C. pseudotuberculosis isolates. We found that ADSRRS-fingerprinting is a rapid method offering good discrimination power, excellent reproducibility and may be applied for epidemiological studies of intraspecific genetic relatedness of C. pseudotuberculosis strains.

Efficient DNA Fingerprinting Based on the Targeted Sequencing of Active Retrotransposon Insertion Sites Using a Bench-Top High-Throughput Sequencing Platform

OpenAIRE

Monden, Yuki; Yamamoto, Ayaka; Shindo, Akiko; Tahara, Makoto

2014-01-01

In many crop species, DNA fingerprinting is required for the precise identification of cultivars to protect the rights of breeders. Many families of retrotransposons have multiple copies throughout the eukaryotic genome and their integrated copies are inherited genetically. Thus, their insertion polymorphisms among cultivars are useful for DNA fingerprinting. In this study, we conducted a DNA fingerprinting based on the insertion polymorphisms of active retrotransposon families (Rtsp-1 and LI...

ESDA®-Lite collection of DNA from latent fingerprints on documents.

Science.gov (United States)

Plaza, Dane T; Mealy, Jamia L; Lane, J Nicholas; Parsons, M Neal; Bathrick, Abigail S; Slack, Donia P

2015-05-01

The ability to detect and non-destructively collect biological samples for DNA processing would benefit the forensic community by preserving the physical integrity of evidentiary items for more thorough evaluations by other forensic disciplines. The Electrostatic Detection Apparatus (ESDA®) was systemically evaluated for its ability to non-destructively collect DNA from latent fingerprints deposited on various paper substrates for short tandem repeat (STR) DNA profiling. Fingerprints were deposited on a variety of paper substrates that included resume paper, cotton paper, magazine paper, currency, copy paper, and newspaper. Three DNA collection techniques were performed: ESDA collection, dry swabbing, and substrate cutting. Efficacy of each collection technique was evaluated by the quantity of DNA present in each sample and the percent profile generated by each sample. Both the ESDA and dry swabbing non-destructive sampling techniques outperformed the destructive methodology of substrate cutting. A greater number of full profiles were generated from samples collected with the non-destructive dry swabbing collection technique than were generated from samples collected with the ESDA; however, the ESDA also allowed the user to visualize the area of interest while non-destructively collecting the biological material. The ability to visualize the biological material made sampling straightforward and eliminated the need for numerous, random swabbings/cuttings. Based on these results, the evaluated non-destructive ESDA collection technique has great potential for real-world forensic implementation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Lanthanide mixed ligand chelates for DNA profiling and latent fingerprint detection

Science.gov (United States)

Menzel, E. R.; Allred, Clay

1997-02-01

It is our aim to develop a universally applicable latent fingerprint detection method using lanthanide (rare-earth) complexes as a source of luminescence. Use of these lanthanide complexes offers advantages on several fronts, including benefits from large Stokes shifts, long luminescence lifetimes, narrow emissions, ability of sequential assembly of complexes, and chemical variability of the ligands. Proper exploitation of these advantages would lead to a latent fingerprint detection method superior to any currently available. These same characteristics also lend themselves to many of the problems associated with DNA processing in the forensic science context.

Cranberry SSR multiplexing panels for DNA horticultural fingerprinting and genetic studies

Science.gov (United States)

Cranberry (Vaccinium macrocarpon) is in need of inexpensive high-throughput DNA fingerprinting methods for genetic research and germplasm purity testing for agricultural purposes. Therefore, we designed and validated 16-multiplexing panels containing 61 evenly distributed simple sequence (SSR) marke...

Integrated DNA and fingerprint analyses in the identification of 60-year-old mummified human remains discovered in an Alaskan glacier.

Science.gov (United States)

Loreille, Odile M; Parr, Ryan L; McGregor, Kevin A; Fitzpatrick, Colleen M; Lyon, Chriss; Yang, Dongya Y; Speller, Camilla F; Grimm, Michael R; Grimm, Michael J; Irwin, Jodi A; Robinson, Edward M

2010-05-01

This report describes the identification of a merchant mariner who perished in 1948 when Northwest Airlines Flight 4422, a DC-4 carrying 24 seamen and six crew members crashed into Mount Sanford, Alaska. Fifty-one years later, a human forearm and hand were found close by the wreckage of the plane, prompting identification efforts using DNA and fingerprints. There were significant challenges to both the fingerprint and DNA analyses. The hand was badly desiccated, making fingerprint friction-ridge detail almost invisible and the remains had been embalmed upon discovery, making DNA amplification difficult. We present the results of an interdisciplinary approach that successfully addressed these challenges and ultimately led to the identification of the remains. These efforts relied on efficient fingerprint rejuvenation and imaging techniques that improved print resolution, as well as new DNA extraction techniques optimized for aggressively embalmed remains.

Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

Science.gov (United States)

Caetano-Anollés, G; Gresshoff, P M

1996-06-01

DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

Development of an efficient fungal DNA extraction method to be used in random amplified polymorphic DNA-PCR analysis to differentiate cyclopiazonic acid mold producers.

Science.gov (United States)

Sánchez, Beatriz; Rodríguez, Mar; Casado, Eva M; Martín, Alberto; Córdoba, Juan J

2008-12-01

A variety of previously established mechanical and chemical treatments to achieve fungal cell lysis combined with a semiautomatic system operated by a vacuum pump were tested to obtain DNA extract to be directly used in randomly amplified polymorphic DNA (RAPD)-PCR to differentiate cyclopiazonic acid-producing and -nonproducing mold strains. A DNA extraction method that includes digestion with proteinase K and lyticase prior to using a mortar and pestle grinding and a semiautomatic vacuum system yielded DNA of high quality in all the fungal strains and species tested, at concentrations ranging from 17 to 89 ng/microl in 150 microl of the final DNA extract. Two microliters of DNA extracted with this method was directly used for RAPD-PCR using primer (GACA)4. Reproducible RAPD fingerprints showing high differences between producer and nonproducer strains were observed. These differences in the RAPD patterns did not differentiate all the strains tested in clusters by cyclopiazonic acid production but may be very useful to distinguish cyclopiazonic acid producer strains from nonproducer strains by a simple RAPD analysis. Thus, the DNA extracts obtained could be used directly without previous purification and quantification for RAPD analysis to differentiate cyclopiazonic acid producer from nonproducer mold strains. This combined analysis could be adaptable to other toxigenic fungal species to enable differentiation of toxigenic and non-toxigenic molds, a procedure of great interest in food safety.

Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

Directory of Open Access Journals (Sweden)

Stefan Niemann

2009-10-01

Full Text Available Mycobacterium tuberculosis complex (MTBC, the causative agent of tuberculosis (TB, is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients.Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1 and one multidrug resistant (MDR isolate (K-2 of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan. Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1 and 33.0 million (K-2 paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations.Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using

Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

Science.gov (United States)

Niemann, Stefan; Köser, Claudio U; Gagneux, Sebastien; Plinke, Claudia; Homolka, Susanne; Bignell, Helen; Carter, Richard J; Cheetham, R Keira; Cox, Anthony; Gormley, Niall A; Kokko-Gonzales, Paula; Murray, Lisa J; Rigatti, Roberto; Smith, Vincent P; Arends, Felix P M; Cox, Helen S; Smith, Geoff; Archer, John A C

2009-10-12

Mycobacterium tuberculosis complex (MTBC), the causative agent of tuberculosis (TB), is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients. Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1) and one multidrug resistant (MDR) isolate (K-2) of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan). Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1) and 33.0 million (K-2) paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations. Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using standard

New optimized DNA extraction protocol for fingerprints deposited on a special self-adhesive security seal and other latent samples used for human identification.

Science.gov (United States)

Kopka, Julieta; Leder, Monika; Jaureguiberry, Stella M; Brem, Gottfried; Boselli, Gabriel O

2011-09-01

Obtaining complete short tandem repeat (STR) profiles from fingerprints containing minimal amounts of DNA, using standard extraction techniques, can be difficult. The aim of this study was to evaluate a new kit, Fingerprint DNA Finder (FDF Kit), recently launched for the extraction of DNA and STR profiling from fingerprints placed on a special device known as Self-Adhesive Security Seal Sticker(®) and other latent fingerprints on forensic evidentiary material like metallic guns. The DNA extraction system is based on a reversal of the silica principle, and all the potential inhibiting substances are retained on the surface of a special adsorbent, while nucleic acids are not bound and remain in solution dramatically improving DNA recovery. DNA yield was quite variable among the samples tested, rendering in most of the cases (>90%) complete STR profiles, free of PCR inhibitors, and devoid of artifacts. Even samples with DNA amount below 100 pg could be successfully analyzed. © 2011 American Academy of Forensic Sciences.

Fingerprint enhancement revisited and the effects of blood enhancement chemicals on subsequent profiler Plus fluorescent short tandem repeat DNA analysis of fresh and aged bloody fingerprints.

Science.gov (United States)

Frégeau, C J; Germain, O; Fourney, R M

2000-03-01

This study was aimed at determining the effect of seven blood enhancement reagents on the subsequent Profiler Plus fluorescent STR DNA analysis of fresh or aged bloody fingerprints deposited on various porous and nonporous surfaces. Amido Black, Crowle's Double Stain. 1,8-diazafluoren-9-one (DFO), Hungarian Red, leucomalachite green, luminol and ninhydrin were tested on linoleum, glass, metal, wood (pine, painted white), clothing (85% polyester/15% cotton, 65% polyester/35% cotton, and blue denim) and paper (Scott 2-ply and Xerox-grade). Preliminary experiments were designed to determine the optimal blood dilutions to use to ensure a DNA typing result following chemical enhancement. A 1:200 blood dilution deposited on linoleum and enhanced with Crowle's Double Stain generated enough DNA for one to two rounds of Profiler Plus PCR amplification. A comparative study of the DNA yields before and after treatment indicated that the quantity of DNA recovered from bloody fingerprints following enhancement was reduced by a factor of 2 to 12. Such a reduction in the DNA yields could potentially compromise DNA typing analysis in the case of small stains. The blood enhancement chemicals selected were also evaluated for their capability to reveal bloodmarks on the various porous and nonporous surfaces chosen in this study. Luminol. Amido Black and Crowle's Double Stain showed the highest sensitivity of all seven chemicals tested and revealed highly diluted (1:200) bloody fingerprints. Both luminol and Amido Black produced excellent results on both porous and nonporous surfaces, but Crowle's Double Stain failed to produce any results on porous substrates. Hungarian Red, DFO, leucomalachite green and ninhydrin showed lower sensitivities. Enhancement of bloodmarks using any of the chemicals selected, and short-term exposure to these same chemicals (i.e., less than 54 days), had no adverse effects on the PCR amplification of the nine STR systems surveyed (D3S 1358, HumvWA, Hum

Use of LH-PCR as a DNA fingerprint technique to trace sediment-associated microbial communities from various land uses

Science.gov (United States)

Joe-Strack, J. A.; Petticrew, E. L.

2012-04-01

The search for new techniques to effectively and efficiently trace sediment from its source along catchment pathways continues, with a range of new methods being developed and tested annually. A relatively recent approach marries genetic techniques to sediment analysis in order to characterize and differentiate the bacterial populations associated with soil and/or sediment originating from specific locations. Here we present the preliminary results of DNA fingerprint profiles of soil and sediment-associated bacterial communities in and around two different industrial land uses in the central interior of British Columbia, a feedlot and a copper/gold mining site. We assessed the naturally varying 16S rDNA gene using amplicon length heterogeneity-polymerase chain reaction (LH-PCR). Statistical differences between bacterial community profiles were investigated using a suite of methods of which non-metric multidimensional scaling (NMS) and indicator species analysis (ISA) were the most useful. Stronger statistical results were observed for the feedlot data set with spatial differences observed from the source location and within the adjacent creek. Results from the mine site were more difficult to assess although responses were detected in downstream waterways. While bacterial DNA fingerprinting of soil and sediment appears to be a promising tracing technique issues of scale and transferability may limit its use. Lessons learned from this preliminary study will be presented.

Comparison of DNA-based techniques for differentiation of production strains of ale and lager brewing yeast.

Science.gov (United States)

Kopecká, J; Němec, M; Matoulková, D

2016-06-01

Brewing yeasts are classified into two species-Saccharomyces pastorianus and Saccharomyces cerevisiae. Most of the brewing yeast strains are natural interspecies hybrids typically polyploids and their identification is thus often difficult giving heterogenous results according to the method used. We performed genetic characterization of a set of the brewing yeast strains coming from several yeast culture collections by combination of various DNA-based techniques. The aim of this study was to select a method for species-specific identification of yeast and discrimination of yeast strains according to their technological classification. A group of 40 yeast strains were characterized using PCR-RFLP analysis of ITS-5·8S, NTS, HIS4 and COX2 genes, multiplex PCR, RAPD-PCR of genomic DNA, mtDNA-RFLP and electrophoretic karyotyping. Reliable differentiation of yeast to the species level was achieved by PCR-RFLP of HIS4 gene. Numerical analysis of the obtained RAPD-fingerprints and karyotype revealed species-specific clustering corresponding with the technological classification of the strains. Taxonomic position and partial hybrid nature of strains were verified by multiplex PCR. Differentiation among species using the PCR-RFLP of ITS-5·8S and NTS region was shown to be unreliable. Karyotyping and RFLP of mitochondrial DNA evinced small inaccuracies in strain categorization. PCR-RFLP of HIS4 gene and RAPD-PCR of genomic DNA are reliable and suitable methods for fast identification of yeast strains. RAPD-PCR with primer 21 is a fast and reliable method applicable for differentiation of brewing yeasts with only 35% similarity of fingerprint profile between the two main technological groups (ale and lager) of brewing strains. It was proved that PCR-RFLP method of HIS4 gene enables precise discrimination among three technologically important Saccharomyces species. Differentiation of brewing yeast to the strain level can be achieved using the RAPD-PCR technique. © 2016 The

Detection of DNA fingerprints of cultivated rice by hybridization with a human minisatellite DNA probe

International Nuclear Information System (INIS)

Dallas, J.F.

1988-01-01

A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species

Somatic mutations in stilbene estrogen-induced Syrian hamster kidney tumors identified by DNA fingerprinting

Directory of Open Access Journals (Sweden)

Roy Deodutta

2004-01-01

Full Text Available Abstract Kidney tumors from stilbene estrogen (diethylstilbestrol-treated Syrian hamsters were screened for somatic genetic alterations by Random Amplified Polymorphic DNA-polymerase chain-reaction (RAPD-PCR fingerprinting. Fingerprints from tumor tissue were generated by single arbitrary primers and compared with fingerprints for normal tissue from the same animal, as well as normal and tumor tissues from different animals. Sixty one of the arbitrary primers amplified 365 loci that contain approximately 476 kbp of the hamster genome. Among these amplified DNA fragments, 44 loci exhibited either qualitative or quantitative differences between the tumor tissues and normal kidney tissues. RAPD-PCR loci showing decreased and increased intensities in tumor tissue DNA relative to control DNA indicate that loci have undergone allelic losses and gains, respectively, in the stilbene estrogen-induced tumor cell genome. The presence or absence of the amplified DNA fragments indicate homozygous insertions or deletions in the kidney tumor DNA compared to the age-matched normal kidney tissue DNA. Seven of 44 mutated loci also were present in the kidney tissues adjacent to tumors (free of macroscopic tumors. The presence of mutated loci in uninvolved (non-tumor surrounding tissue adjacent to tumors from stilbene estrogen-treated hamsters suggests that these mutations occurred in the early stages of carcinogenesis. The cloning and sequencing of RAPD amplified loci revealed that one mutated locus had significant sequence similarity with the hamster Cyp1A1 gene. The results show the ability of RAPD-PCR to detect and isolate, in a single step, DNA sequences representing genetic alterations in stilbene estrogen-induced cancer cells, including losses of heterozygosity, and homozygous deletion and insertion mutations. RAPD-PCR provides an alternative molecular approach for studying cancer cytogenetics in stilbene estrogen-induced tumors in humans and experimental

Genetic effect of A-bomb radiation- Analysis of minisatellite regions detected by DNA fingerprint probe

International Nuclear Information System (INIS)

Kodaira, Mieko

1999-01-01

In author's laboratory, screening of mutation in germ cells of A-bomb survivors is under investigation with use of 8 single-locus minisatellite probes and no increase in mutation rate has been detected hitherto. This paper reported results of screening on the minisatellite region, which consisting of short repeated base sequence, using a DNA fingerprint probe for 33.15 core sequence. Subjects were 50 A-bomb survivor families exposed to mean dose of 1.9 Sv (exposed group) or 0 Gy (control), having 64 or 60 children, respectively. DNA was extracted from their B cells established by EB virus and subjected to agarose-gel electrophoresis followed by southern blotting with some improvements for fingerprinting. On the fingerprints, numbers of the band detected in regions of >3.5 kb were 1080 in children of the exposed group (16.9/child) and 1024 (17.1) in the control group, indicating no detectable effect of exposure on the germ cell mutation rate in the region.(K.H.)

Analysis of bacterial core communities in the central Baltic by comparative RNA-DNA-based fingerprinting provides links to structure-function relationships.

Science.gov (United States)

Brettar, Ingrid; Christen, Richard; Höfle, Manfred G

2012-01-01

Understanding structure-function links of microbial communities is a central theme of microbial ecology since its beginning. To this end, we studied the spatial variability of the bacterioplankton community structure and composition across the central Baltic Sea at four stations, which were up to 450 km apart and at a depth profile representative for the central part (Gotland Deep, 235 m). Bacterial community structure was followed by 16S ribosomal RNA (rRNA)- and 16S rRNA gene-based fingerprints using single-strand conformation polymorphism (SSCP) electrophoresis. Species composition was determined by sequence analysis of SSCP bands. High similarities of the bacterioplankton communities across several hundred kilometers were observed in the surface water using RNA- and DNA-based fingerprints. In these surface communities, the RNA- and DNA-based fingerprints resulted in very different pattern, presumably indicating large difference between the active members of the community as represented by RNA-based fingerprints and the present members represented by the DNA-based fingerprints. This large discrepancy changed gradually over depth, resulting in highly similar RNA- and DNA-based fingerprints in the anoxic part of the water column below 130 m depth. A conceivable mechanism explaining this high similarity could be the reduced oxidative stress in the anoxic zone. The stable communities on the surface and in the anoxic zone indicate the strong influence of the hydrography on the bacterioplankton community structure. Comparative analysis of RNA- and DNA-based community structure provided criteria for the identification of the core community, its key members and their links to biogeochemical functions.

Trophectoderm DNA fingerprinting by quantitative real-time PCR successfully distinguishes sibling human embryos.

Science.gov (United States)

Scott, Richard T; Su, Jing; Tao, Xin; Forman, Eric J; Hong, Kathleen H; Taylor, Deanne; Treff, Nathan R

2014-11-01

To validate a novel and more practical system for trophectoderm DNA fingerprinting which reliably distinguishes sibling embryos from each other. In this prospective and blinded study two-cell and 5-cell samples from commercially available sibling cell lines and excess DNA from trophectoderm biopsies of sibling human blastocysts were evaluated for accurate assignment of relationship using qPCR-based allelic discrimination from 40 single nucleotide polymorphisms (SNPs) with low allele frequency variation and high heterozygosity. Cell samples with self relationships averaged 95.1 ± 5.9 % similarity. Sibling relationships averaged 57.2 ± 5.9 % similarity for all 40 SNPs, and 40.8 ± 8.2 % similarity for the 25 informative SNPs. Assignment of relationships was accomplished with 100 % accuracy for cell lines and embryos. These data demonstrate the first trophectoderm qPCR-based DNA fingerprinting technology capable of unequivocal discrimination of sibling human embryos. This methodology will empower research and development of new markers of, and interventions that influence embryonic reproductive potential.

Single-strand conformation polymorphism (SSCP)-based mutation scanning approaches to fingerprint sequence variation in ribosomal DNA of ascaridoid nematodes.

Science.gov (United States)

Zhu, X Q; Gasser, R B

1998-06-01

In this study, we assessed single-strand conformation polymorphism (SSCP)-based approaches for their capacity to fingerprint sequence variation in ribosomal DNA (rDNA) of ascaridoid nematodes of veterinary and/or human health significance. The second internal transcribed spacer region (ITS-2) of rDNA was utilised as the target region because it is known to provide species-specific markers for this group of parasites. ITS-2 was amplified by PCR from genomic DNA derived from individual parasites and subjected to analysis. Direct SSCP analysis of amplicons from seven taxa (Toxocara vitulorum, Toxocara cati, Toxocara canis, Toxascaris leonina, Baylisascaris procyonis, Ascaris suum and Parascaris equorum) showed that the single-strand (ss) ITS-2 patterns produced allowed their unequivocal identification to species. While no variation in SSCP patterns was detected in the ITS-2 within four species for which multiple samples were available, the method allowed the direct display of four distinct sequence types of ITS-2 among individual worms of T. cati. Comparison of SSCP/sequencing with the methods of dideoxy fingerprinting (ddF) and restriction endonuclease fingerprinting (REF) revealed that also ddF allowed the definition of the four sequence types, whereas REF displayed three of four. The findings indicate the usefulness of the SSCP-based approaches for the identification of ascaridoid nematodes to species, the direct display of sequence variation in rDNA and the detection of population variation. The ability to fingerprint microheterogeneity in ITS-2 rDNA using such approaches also has implications for studying fundamental aspects relating to mutational change in rDNA.

Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

Science.gov (United States)

Dingman, Douglas W

2012-07-01

Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc

DNA fingerprinting demonstrates extremely low levels of genetic variation among blackberry cultivars grown in Finland

Directory of Open Access Journals (Sweden)

K. ANTONIUS

2008-12-01

Full Text Available Most blackberry plants cultivated in Finland closely resemble the American species Rubus allegheniensis. Thirty nine such blackberry accessions in the University of Helsinki clone collection were studied by hybridization-based DNA fingerprinting and compared with some known cultivars of R. allegheniensis derivation. 'Imperial' appears to be identical to the old cultivar 'Majestät', but 'Earliest of All' differs considerably. In addition, 37 of the accessions analysed also have DNA fingerprints that appear to be completely identical to that of 'Majestät'! The remaining two accessions, although identical to each other, exhibit one band not found in 'Majestät' that is probably caused by a somatic mutation.

Usefulness of the secondary probe pTBN12 in DNA fingerprinting of Mycobacterium tuberculosis.

OpenAIRE

Chaves, F; Yang, Z; el Hajj, H; Alonso, M; Burman, W J; Eisenach, K D; Dronda, F; Bates, J H; Cave, M D

1996-01-01

A comparison was made between DNA fingerprints of Mycobacterium tuberculosis produced with the insertion sequence IS6110 and those produced with the polymorphic GC-rich repetitive sequence contained in the plasmid pTBN12. A total of 302 M. tuberculosis isolates from the prison system in Madrid, Spain, and the Denver Public Health Department (Denver, Colo.) were analyzed with the two probes. Both probes identified the same isolates in the same clusters when the fingerprints had six or more cop...

DNA fingerprinting: a quality control case study for human biospecimen authentication.

Science.gov (United States)

Kofanova, Olga A; Mathieson, William; Thomas, Gerry A; Betsou, Fotini

2014-04-01

This case study illustrates the usefulness of the DNA fingerprinting method in biobank quality control (QC) procedures and emphasizes the need for detailed and accurate record keeping during processing of biological samples. It also underlines the value of independent third-party assessment to identify points at which errors are most likely to have occurred when unexpected results are obtained from biospecimens.

Genetic diversity in different populations of sloths assessed by DNA fingerprinting

Directory of Open Access Journals (Sweden)

MORAES N.

2002-01-01

Full Text Available In this study we analyzed a population of Bradypus torquatus with individuals originally distributed in different localities of Bahia, and two populations of B. variegatus with individuals from Bahia and São Paulo States. Using the DNA fingerprinting method, we assessed the genetic variability within and between populations. Analysis of the DNA profiles revealed genetic similarity indices ranging from 0.34 ± 0.07 to 0.87 ± 0.04. Similar low levels of genetic variability were found only in isolated mammalian populations or among related individuals. This study presents the first analyses of genetic diversity in sloth populations.

Fluorescence- and capillary electrophoresis (CE)-based SSR DNA fingerprinting and a molecular identity database for the Louisiana sugarcane industry

Science.gov (United States)

A database of Louisiana sugarcane molecular identity has been constructed and is being updated annually using FAM or HEX or NED fluorescence- and capillary electrophoresis (CE)-based microsatellite (SSR) fingerprinting information. The fingerprints are PCR-amplified from leaf DNA samples of current ...

Age Estimation with DNA: From Forensic DNA Fingerprinting to Forensic (Epi)Genomics: A Mini-Review.

Science.gov (United States)

Parson, Walther

2018-01-23

Forensic genetics developed from protein-based techniques a quarter of a century ago and became famous as "DNA fingerprinting," this being based on restriction fragment length polymorphisms (RFLPs) of high-molecular-weight DNA. The amplification of much smaller short tandem repeat (STR) sequences using the polymerase chain reaction soon replaced RFLP analysis and advanced to become the gold standard in genetic identification. Meanwhile, STR multiplexes have been developed and made commercially available which simultaneously amplify up to 30 STR loci from as little as 15 cells or fewer. The enormous information content that comes with the large variety of observed STR genotypes allows for genetic individualisation (with the exception of identical twins). Carefully selected core STR loci form the basis of intelligence-led DNA databases that provide investigative leads by linking unsolved crime scenes and criminals through their matched STR profiles. Nevertheless, the success of modern DNA fingerprinting depends on the availability of reference material from suspects. In order to provide new investigative leads in cases where such reference samples are absent, forensic scientists started to explore the prediction of phenotypic traits from the DNA of the evidentiary sample. This paradigm change now uses DNA and epigenetic markers to forecast characteristics that are useful to triage further investigative work. So far, the best investigated externally visible characteristics are eye, hair and skin colour, as well as geographic ancestry and age. Information on the chronological age of a stain donor (or any sample donor) is elemental for forensic investigations in a number of aspects and has, therefore, been explored by researchers in some detail. Among different methodological approaches tested to date, the methylation-sensitive analysis of carefully selected DNA markers (CpG sites) has brought the most promising results by providing prediction accuracies of ±3-4 years

Amplified fragment length polymorphism fingerprints support limited gene flow among social spider populations

NARCIS (Netherlands)

Smith, Deborah; van Rijn, Sander; Henschel, Joh; Bilde, Trine; Lubin, Yael

We used DNA fingerprints to determine whether the population structure and colony composition of the cooperative social spider Stegodyphus dumicola are compatible with requirements of interdemic ('group') selection: differential proliferation of demes or groups and limited gene flow among groups. To

Detection of γ-ray-induced DNA damages in malformed dominant lethal embryos of the Japanese medaka (Oryzias latipes) using AP-PCR fingerprinting

International Nuclear Information System (INIS)

Kubota, Yoshiko; Shimada, Atsuko; Shima, Akihiro

1992-01-01

Adult male fish of the medaka HNI strain exposed to 9.5 Gy or 19 Gy (0.95 Gy/min) of γ-rays were mated with non-irradiated female fish of the Hd-rR strain. Genomic DNA was prepared from malformed individual embryos which were expected to be dominant lethal and used for AP-PCR fingerprinting. By the use of a part of the T3 promoter sequence (20 mer), which is not found in the medaka genome as an arbitrary primer, polymorphisms were found in genomic fingerprints which could distinguish the parental strains. On the other hand, fingerprints of F1 hybrids were found to be the sum of those of their parents. Based on these findings, the fingerprints of genomic DNA of each severely malformed embryo were analyzed, because it was expected that radiation-induced genomic damages resulting in severe malformation and eventually in dominant lethals should be detected as changes in paternal fingerprints of F1 hybrids. Indeed, changes were found in genomic DNA as loss of some paternal bands in fingerprints of malformed embryos. One of 10 malformed embryos obtained from 9.5 Gy γ-irradiated males had lost 5 bands. These results indicated a possibility that quantitative as well as qualitative estimation of γ-ray-induced DNA damages can be made by this method which does not require the functional selection based on a specific target gene. (author). 16 refs., 3 figs., 1 tab

Ab initio Calculations of Electronic Fingerprints of DNA bases on Graphene

Science.gov (United States)

Ahmed, Towfiq; Rehr, John J.; Kilina, Svetlana; Das, Tanmoy; Haraldsen, Jason T.; Balatsky, Alexander V.

2012-02-01

We have carried out first principles DFT calculations of the electronic local density of states (LDOS) of DNA nucleotide bases (A,C,G,T) adsorbed on graphene using LDA with ultra-soft pseudo-potentials. We have also calculated the longitudinal transmission currents T(E) through graphene nano-pores as an individual DNA base passes through it, using a non-equilibrium Green's function (NEGF) formalism. We observe several dominant base-dependent features in the LDOS and T(E) in an energy range within a few eV of the Fermi level. These features can serve as electronic fingerprints for the identification of individual bases from dI/dV measurements in scanning tunneling spectroscopy (STS) and nano-pore experiments. Thus these electronic signatures can provide an alternative approach to DNA sequencing.

A reliable and reproducible technique for DNA fingerprinting in biorepositories: a pilot study from BioBIM.

Science.gov (United States)

Palmirotta, Raffaele; De Marchis, Maria Laura; Ludovici, Giorgia; Ialongo, Cristiano; Leone, Barbara; Lopez, Nadia; Valente, Maria Giovanna; Spila, Antonella; Ferroni, Patrizia; Della-Morte, David; Guadagni, Fiorella

2013-12-17

Standard operating procedures (SOPs) optimization for nucleic acid extraction from stored samples is of crucial importance in a biological repository, considering the large number of collected samples and their future downstream molecular and biological applications. However, the validity of molecular studies using stored specimens depends not only on the integrity of the biological samples, but also on the procedures that ensure the traceability of the same sample, certifying its uniqueness, and ensuring the identification of potential sample contaminations. With this aim, we have developed a rapid, reliable, low-cost, and simple DNA fingerprinting tool for a routine use in quality control of biorepositories samples. The method consists of a double ALU insertion/deletion genotyping panel suitable for uniqueness, identification of sample contaminations, and gender validation. Preliminary data suggest that this easy-to-use DNA fingerprinting protocol could routinely provide assurances of DNA identity and quality in a biorepository setting.

Efficient DNA fingerprinting based on the targeted sequencing of active retrotransposon insertion sites using a bench-top high-throughput sequencing platform.

Science.gov (United States)

Monden, Yuki; Yamamoto, Ayaka; Shindo, Akiko; Tahara, Makoto

2014-10-01

In many crop species, DNA fingerprinting is required for the precise identification of cultivars to protect the rights of breeders. Many families of retrotransposons have multiple copies throughout the eukaryotic genome and their integrated copies are inherited genetically. Thus, their insertion polymorphisms among cultivars are useful for DNA fingerprinting. In this study, we conducted a DNA fingerprinting based on the insertion polymorphisms of active retrotransposon families (Rtsp-1 and LIb) in sweet potato. Using 38 cultivars, we identified 2,024 insertion sites in the two families with an Illumina MiSeq sequencing platform. Of these insertion sites, 91.4% appeared to be polymorphic among the cultivars and 376 cultivar-specific insertion sites were identified, which were converted directly into cultivar-specific sequence-characterized amplified region (SCAR) markers. A phylogenetic tree was constructed using these insertion sites, which corresponded well with known pedigree information, thereby indicating their suitability for genetic diversity studies. Thus, the genome-wide comparative analysis of active retrotransposon insertion sites using the bench-top MiSeq sequencing platform is highly effective for DNA fingerprinting without any requirement for whole genome sequence information. This approach may facilitate the development of practical polymerase chain reaction-based cultivar diagnostic system and could also be applied to the determination of genetic relationships. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches.

Science.gov (United States)

Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P

2017-01-01

Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL , matK , trnH - psbA , trnLC - trnLD , their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus , Conophallus and Amorphophallus . In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK , trnH - psbA , trnLC - trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL .

Assessing the Risk of Secondary Transfer Via Fingerprint Brush Contamination Using Enhanced Sensitivity DNA Analysis Methods.

Science.gov (United States)

Bolivar, Paula-Andrea; Tracey, Martin; McCord, Bruce

2016-01-01

Experiments were performed to determine the extent of cross-contamination of DNA resulting from secondary transfer due to fingerprint brushes used on multiple items of evidence. Analysis of both standard and low copy number (LCN) STR was performed. Two different procedures were used to enhance sensitivity, post-PCR cleanup and increased cycle number. Under standard STR typing procedures, some additional alleles were produced that were not present in the controls or blanks; however, there was insufficient data to include the contaminant donor as a contributor. Inclusion of the contaminant donor did occur for one sample using post-PCR cleanup. Detection of the contaminant donor occurred for every replicate of the 31 cycle amplifications; however, using LCN interpretation recommendations for consensus profiles, only one sample would include the contaminant donor. Our results indicate that detection of secondary transfer of DNA can occur through fingerprint brush contamination and is enhanced using LCN-DNA methods. © 2015 American Academy of Forensic Sciences.

Genetic variation in Phoca vitulina (the harbour seal) revealed by DNA fingerprinting and RAPDs

NARCIS (Netherlands)

Kappe, A.L.; van de Zande, L.; Vedder, E.J.; Bijlsma, R.; van Delden, Wilke

Genetic variation in two harbour seal (Phoca vitulina) populations from the Dutch Wadden Sea and Scotland was examined by RAPD analysis and DNA fingerprinting. For comparison a population of grey seals (Halichoerus grypus) was studied. The RAPD method revealed a very low number of polymorphic bands.

Acute and chronic gregarisation are associated with distinct DNA methylation fingerprints in desert locusts.

Science.gov (United States)

Mallon, Eamonn B; Amarasinghe, Harindra E; Ott, Swidbert R

2016-10-18

Desert locusts (Schistocerca gregaria) show a dramatic form of socially induced phenotypic plasticity known as phase polyphenism. In the absence of conspecifics, locusts occur in a shy and cryptic solitarious phase. Crowding with conspecifics drives a behavioural transformation towards gregariousness that occurs within hours and is followed by changes in physiology, colouration and morphology, resulting in the full gregarious phase syndrome. We analysed methylation-sensitive amplified fragment length polymorphisms (MS-AFLP) to compare the effect of acute and chronic crowding on DNA methylation in the central nervous system. We find that crowd-reared and solitary-reared locusts show markedly different neural MS-AFLP fingerprints. However, crowding for a day resulted in neural MS-AFLP fingerprints that were clearly distinct from both crowd-reared and uncrowded solitary-reared locusts. Our results indicate that changes in DNA methylation associated with behavioural gregarisation proceed through intermediate states that are not simply partial realisations of the endpoint states.

DNA fingerprinting approaches to trace Escherichia coli sharing between dogs and owners.

Science.gov (United States)

Naziri, Z; Derakhshandeh, A; Firouzi, R; Motamedifar, M; Shojaee Tabrizi, A

2016-02-01

To determine the prevalence of cross-species sharing of Escherichia coli between healthy dogs and humans living in the same household. Two faecal E. coli isolates from 25 healthy dog-owner pairs and 16 healthy control humans were tested using three fingerprinting methods. The prevalence of within-household sharing of E. coli was 4, 8 and 8% using pulsed-field gel electrophoresis, randomly amplified polymorphic DNA and enterobacterial repetitive intergenic consensus-PCR analyses respectively. Within-household bacterial sharing was more prevalent than across-household sharing (P fingerprinting techniques will help to find ways for reducing the economic impact of E. coli infections. This study support claims that public health concerns regarding the cross-species sharing of E. coli are warranted but this risk is minimal. © 2015 The Society for Applied Microbiology.

Development of an optimized random amplified polymorphic DNA protocol for fingerprinting of Klebsiella pneumoniae.

Science.gov (United States)

Ashayeri-Panah, M; Eftekhar, F; Feizabadi, M M

2012-04-01

To develop an optimized random amplified polymorphic DNA (RAPD) protocol for fingerprinting clinical isolates of Klebsiella pneumoniae. Employing factorial design of experiments, repeatable amplification patterns were obtained for 54 nosocomial isolates using 1 μmol 1(-1) primer, 4 mmol 1(-1) MgCl(2), 0·4 mmol 1(-1) dNTPs, 2·5 U Taq DNA polymerase and 90 ng DNA template in a total volume of 25 μl. The optimum thermocycling program was: initial denaturation at 94°C for 4 min followed by 50 cycles of 1 min at 94°C, 2 min at 34°C, 2 min at 72°C and a final extension at 72°C for 10 min. The optimized RAPD protocol was highly discriminatory (Simpson's diversity index, 0·982), and all isolates were typable with repeatable patterns (Pearson's similarity coefficient ≈ 100%). Seven main clusters were obtained on a similarity level of 70% and 32 distinct clusters on a similarity level of 85%, reflecting the heterogeneity of the isolates. Systematic optimization of RAPD generated reliable DNA fingerprints for nosocomial isolates of K. pneumoniae. This is the first report on RAPD optimization based on factorial design of experiments for discrimination of K. pneumoniae. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

Genetic variation and DNA fingerprinting of durian types in Malaysia using simple sequence repeat (SSR) markers.

Science.gov (United States)

Siew, Ging Yang; Ng, Wei Lun; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Tan, Soon Guan; Yeap, Swee Keong

2018-01-01

Durian ( Durio zibethinus ) is one of the most popular tropical fruits in Asia. To date, 126 durian types have been registered with the Department of Agriculture in Malaysia based on phenotypic characteristics. Classification based on morphology is convenient, easy, and fast but it suffers from phenotypic plasticity as a direct result of environmental factors and age. To overcome the limitation of morphological classification, there is a need to carry out genetic characterization of the various durian types. Such data is important for the evaluation and management of durian genetic resources in producing countries. In this study, simple sequence repeat (SSR) markers were used to study the genetic variation in 27 durian types from the germplasm collection of Universiti Putra Malaysia. Based on DNA sequences deposited in Genbank, seven pairs of primers were successfully designed to amplify SSR regions in the durian DNA samples. High levels of variation among the 27 durian types were observed (expected heterozygosity, H E  = 0.35). The DNA fingerprinting power of SSR markers revealed by the combined probability of identity (PI) of all loci was 2.3×10 -3 . Unique DNA fingerprints were generated for 21 out of 27 durian types using five polymorphic SSR markers (the other two SSR markers were monomorphic). We further tested the utility of these markers by evaluating the clonal status of shared durian types from different germplasm collection sites, and found that some were not clones. The findings in this preliminary study not only shows the feasibility of using SSR markers for DNA fingerprinting of durian types, but also challenges the current classification of durian types, e.g., on whether the different types should be called "clones", "varieties", or "cultivars". Such matters have a direct impact on the regulation and management of durian genetic resources in the region.

Genetic diversity analysis of nine chewing cane varieties (lines) and construction of their DNA fingerprints

Science.gov (United States)

In order to provide theoretical basis for variety identification and parental selection during sugarcane breeding process, the present study was conducted to analyze genetic diversity of nine chewing cane varieties (lines) and construct their DNA fingerprints. Combining twenty-one SSR molecular mark...

DNA Fingerprint Analysis of Three Short Tandem Repeat (STR) Loci for Biochemistry and Forensic Science Laboratory Courses

Science.gov (United States)

McNamara-Schroeder, Kathleen; Olonan, Cheryl; Chu, Simon; Montoya, Maria C.; Alviri, Mahta; Ginty, Shannon; Love, John J.

2006-01-01

We have devised and implemented a DNA fingerprinting module for an upper division undergraduate laboratory based on the amplification and analysis of three of the 13 short tandem repeat loci that are required by the Federal Bureau of Investigation Combined DNA Index System (FBI CODIS) data base. Students first collect human epithelial (cheek)…

Recovery of DNA from latent fingerprint tape lifts archived against matte acetate.

Science.gov (United States)

Steadman, Shelly A; Hoofer, Steven R; Geering, Sarah C; King, Stephanie; Bennett, Marc A

2015-05-01

This study was driven by court order to examine methods to remove, extract, and STR-type potential DNA entrapped between latent fingerprint lifting tape and matte acetate that was collected from a 1977 crime scene. Results indicate that recovery of appreciable quantities of DNA is more challenging once adhesive is attached to matte acetate cards and even more difficult when fixed following black powder enhancement. STR amplification of extracts from entrapped fingermarks collected following the dusting/lifting procedure did not produce robust profiles, and extraneous peaks not expressed by print donors were detected for some samples. A hearing was set to argue whether there was DNA remaining to be tested, and if so, whether that DNA could be exculpatory in this postconviction matter. The studies herein provided the basis for the court's decision to not require the testing. © 2015 American Academy of Forensic Sciences.

[Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

Science.gov (United States)

Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

2009-02-01

To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

Estimates of population genetic diversity in brown bullhead catfish by DNA fingerprinting

Energy Technology Data Exchange (ETDEWEB)

Roth, A.C.; Wessendarp, T.K.; Gordon, D.A.; Smith, M.K. [Environmental Protection Agency, Cincinnati, OH (United States); Lattier, D.L. [Oak Ridge Inst. for Science and Education, Cincinnati, OH (United States); Hertzberg, V.; Leonard, A. [Univ. of Cincinnati, OH (United States). Dept. of Environmental Health

1994-12-31

Estimates of population genetic diversity may be a sensitive indicator of environmental impact, since limiting the effective breeding population by any means will result in loss of some variant genotypes, as has been demonstrated by allozyme analysis. DNA fingerprinting techniques are also coming into use for population analyses, and the authors chose to apply fingerprinting analysis three populations of brown bullhead catfish collected in Northern Ohio. DNA was isolated from the red blood cells of individual fish. Purified DNAs were digested with EcoR1 restriction enzyme; the digests were then sized on a 1% agarose gel, transferred to nylon membranes and probed with a radiolabeled M13 probe using the Westneat hybridization protocol (Southern blotting). This method effects fragments containing VNTR (variable number of tandem repeat) sequences complementary to the M13, which are highly variable among individual catfish. Hybridized bands were visualized by a Molecular Dynamics phosphorimager and recorded and analyzed with its proprietary Imagequant image analysis program, Excel and SAS. A total of 10 variable bands were identified and their presence or absence scored in each individual. These data were analyzed to determine between and within-population similarity indices as well as population heterozygosity and genetic diversity measures.

DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

International Nuclear Information System (INIS)

Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet

2004-01-01

The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

Science.gov (United States)

Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

2001-04-01

Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

Effects of latent fingerprint development reagents on subsequent forensic DNA typing: a review.

Science.gov (United States)

Kumar, Parveen; Gupta, Ritika; Singh, Rajinder; Jasuja, Om Prakash

2015-05-01

Successful development of latent fingerprints can be helpful in solving the case but in case where fingerprints are smudged, distorted or overlapped, the question arises whether it is still possible to identify the person apart from dermatoglyphic features. Sweat residue present in the latent prints is supposed to have quite good quantity of cellular material which if analyzed properly can be used to generate forensic DNA profile of the individual and may answer the queries related to the effect of reagents used to develop the prints, as they may have a significant effect on the process of examination of this evidentiary material. In the present work an effort has been made to summarize the published review of literature on this aspect of personal identification. Copyright © 2015 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

DNA fingerprinting, biological and chemical investigation of certain Yucca species.

Science.gov (United States)

El Hawary, Seham; El Sayed, Abeer; Helmy, Maged W; El Naggar, El Moataz Bellah; Marzouk, Hanan S; Bassam, Samar M

2018-01-05

Yucca aloifolia, Y. aloifolia variegata, Y. elephantipes and Y. filamentosa were investigated. DNA sequencing was performed for the four plants and a genomic DNA fingerprint was obtained and provided. The cytotoxic activities against four human cancer cell lines were investigated. The ethanolic extracts of leaves of Y. aloifolia variegata prevailed, especially against liver cancer HepG-2 and breast cancer MCF-7. In vivo assessment of hepatoprotective activity in rats also revealed the hepatoprotective potential of the ethanolic extracts of the four plants against CCl 4 - induced rats' liver damage. Qualitative and quantitative analysis of the flavonoid and phenolic content of the promising species was performed using HPLC. The analysis identified and quantified 18 flavonoids and 19 phenolic acids in the different fractions of Y. aloifolia variegata, among which the major flavonoids were hesperidin and kaemp-3-(2-p-coumaroyl) glucose and the major phenolic acids were gallic acid and protocatechuic acid.

Use of flow injection mass spectrometric fingerprinting and chemometrics for differentiation of three black cohosh species

International Nuclear Information System (INIS)

Huang, Huilian; Sun, Jianghao; McCoy, Joe-Ann; Zhong, Haiyan; Fletcher, Edward J.; Harnly, James; Chen, Pei

2015-01-01

Flow injection mass spectrometry (FIMS) was used to provide chemical fingerprints of black cohosh (Actaea racemosa L.) in a manner of minutes by omitting the separation step. This method has proven to be a powerful tool for botanical authentication and in this study it was used to distinguish between three Actaea species prior to a more detailed chemical analysis using ultra high-performance liquid chromatography high-resolution mass spectrometry (UHPLC–HRMS). Black cohosh has become increasingly popular as a dietary supplement in the United States for the treatment of symptoms related to menopause. However, it has been known to be adulterated with the Asian Actaea dahurica (Turcz. ex Fisch. & C.A.Mey.) Franch. species (syn. Cimicifuga dahurica (Turcz.) Maxim). Existing methods for identification of black cohosh and differentiation of Actaea species are usually lengthy, laborious, and lack robustness, often based on the comparison of a few pre-selected components. Chemical fingerprints were obtained for 77 black cohosh samples and their related species using FIMS in the negative ion mode. The analysis time for each sample was less than 2 min. All data were processed using principal component analysis (PCA). FIMS fingerprints could readily differentiate all three species. Representative samples from each of the three species were further examined using UHPLC–MS to provide detailed profiles of the chemical differences between the three species and were compared to the PCA loadings. This study demonstrates a simple, fast, and easy analytical method that can be used to differentiate A. racemosa, Actaea podocarpa, and A. dahurica. - Highlights: • Flow injection mass spectrometry (FIMS) was used to provide chemical fingerprints of black cohosh (Actaea racemosa L.) in a manner of minutes by omitting the separation step. • FIMS can discriminate between A. dahurica, A. podocarpa, and A. racemosa. • FIMS is a valuable screening tool for authentication of botanicals

Use of flow injection mass spectrometric fingerprinting and chemometrics for differentiation of three black cohosh species

Energy Technology Data Exchange (ETDEWEB)

Huang, Huilian [Food Composition and Methods Development Laboratory, Beltsville Human Nutrition Research Center, Agricultural Research Service, U.S. Department of Agriculture, Beltsville, MD (United States); Key Laboratory of Modern Preparation of TCM, Jiangxi University of Traditional Chinese Medicine, Ministry of Education, Nanchang, Jiangxi Province (China); Sun, Jianghao [Food Composition and Methods Development Laboratory, Beltsville Human Nutrition Research Center, Agricultural Research Service, U.S. Department of Agriculture, Beltsville, MD (United States); McCoy, Joe-Ann [The North Carolina Arboretum Germplasm Repository, UNC Affiliate Campus, Asheville, NC (United States); Zhong, Haiyan [College of Food Science and Engineering, Central South University of Forestry and Technology, Changsha, Hunan Province (China); Fletcher, Edward J. [Strategic Sourcing, Inc., Banner Elk, NC 28604 (United States); Harnly, James, E-mail: harnly.james@ars.usda.gov [Food Composition and Methods Development Laboratory, Beltsville Human Nutrition Research Center, Agricultural Research Service, U.S. Department of Agriculture, Beltsville, MD (United States); Chen, Pei, E-mail: pei.chen@ars.usda.gov [Food Composition and Methods Development Laboratory, Beltsville Human Nutrition Research Center, Agricultural Research Service, U.S. Department of Agriculture, Beltsville, MD (United States)

2015-03-01

Flow injection mass spectrometry (FIMS) was used to provide chemical fingerprints of black cohosh (Actaea racemosa L.) in a manner of minutes by omitting the separation step. This method has proven to be a powerful tool for botanical authentication and in this study it was used to distinguish between three Actaea species prior to a more detailed chemical analysis using ultra high-performance liquid chromatography high-resolution mass spectrometry (UHPLC–HRMS). Black cohosh has become increasingly popular as a dietary supplement in the United States for the treatment of symptoms related to menopause. However, it has been known to be adulterated with the Asian Actaea dahurica (Turcz. ex Fisch. & C.A.Mey.) Franch. species (syn. Cimicifuga dahurica (Turcz.) Maxim). Existing methods for identification of black cohosh and differentiation of Actaea species are usually lengthy, laborious, and lack robustness, often based on the comparison of a few pre-selected components. Chemical fingerprints were obtained for 77 black cohosh samples and their related species using FIMS in the negative ion mode. The analysis time for each sample was less than 2 min. All data were processed using principal component analysis (PCA). FIMS fingerprints could readily differentiate all three species. Representative samples from each of the three species were further examined using UHPLC–MS to provide detailed profiles of the chemical differences between the three species and were compared to the PCA loadings. This study demonstrates a simple, fast, and easy analytical method that can be used to differentiate A. racemosa, Actaea podocarpa, and A. dahurica. - Highlights: • Flow injection mass spectrometry (FIMS) was used to provide chemical fingerprints of black cohosh (Actaea racemosa L.) in a manner of minutes by omitting the separation step. • FIMS can discriminate between A. dahurica, A. podocarpa, and A. racemosa. • FIMS is a valuable screening tool for authentication of botanicals.

Establishment of dna fingerprinting in clonal tea improved cultivars from yunnan of china using issr markers

International Nuclear Information System (INIS)

Liu, B.Y.; Zhao, C.M.; Sun, X.M.; Jiang, H.B.

2015-01-01

In this study, DNA fingerprints were constructed by using ISSR markers for 20 clonal improved varieties developed by two breeding institutes in Yunnan province. Seven core ISSR primers were selected from 15 primers. A total of 110 bands were generated by PAGE with seven core primers, 93 of which were polymorphic bands, the percentage of polymorphic band (PPB) was 84.54%, and the mean value of polymorphism information content (PIC) reached 0.417; the genetic similarity coefficient of the cultivars was 0.574-0.854. The two primers, UBC835 and ISSR2, had high PIC values, and could be used to distinguish all cultivars, presenting the most efficient single primers. Among the all of primer combinations from the seven core primers, the three combinations, UBC835/UBC811, UBC835/ISSR2, and UBC835/ISSR3 showed lower similar coefficients, and more efficient in identifying the 20 improved varieties than the other primer combinations. Then these three primer combinations were further scored in 15 traditional cultivars. The results showed that UBC835/ISSR2 was the optimal primer combination, which could be used to distinguish each material among the 20 clonal improved varieties and 15 traditional cultivals. Finally, the DNA fingerprints of the 20 clonal improved varieties were constructed based on country and region code, breeding institute, core primer name and ISSR marker data. The established fingerprints could provide reliable scientific base for the protection of intellectual property right for these clonal improved varieties, and the important molecular information contained in these fingerprints would be useful for the authenticity identification and genetic relationship analysis of tea varieties. (author)

Low frequency of extra-pair fertilizations in the Great Tit Parus major revealed by DNA fingerprinting

NARCIS (Netherlands)

Verboven, N.; Mateman, A.C.

1997-01-01

Multilocus DNA fingerprinting was used to estimate the frequency of extra-pair fertilizations in a low density, island population of Great Tits Parus major. A total of 69 pairs and 516 offspring from 82 breeding attempts were examined. Only 18 offspring (3.5%) in seven different nests were not

Analysis on the DNA Fingerprinting of Aspergillus Oryzae Mutant Induced by High Hydrostatic Pressure

International Nuclear Information System (INIS)

Wang Hua; Zhang Jian; Wang Kai; Liu Bing-Bing; Zou Bo; Zou Guang-Tian; Yang Fan; Shen Si-Le

2011-01-01

The mutant strains of aspergillus oryzae (HP300a) are screened under 300 MPa for 20 min. Compared with the control strains, the screened mutant strains have unique properties such as genetic stability, rapid growth, lots of spores, and high protease activity. Random amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) are used to analyze the DNA fingerprinting of HP300a and the control strains. There are 67.9% and 51.3% polymorphic bands obtained by these two markers, respectively, indicating significant genetic variations between HP300a and the control strains. In addition, comparison of HP300a and the control strains, the genetic distances of random sequence and simple sequence repeat of DNA are 0.51 and 0.34, respectively. (general)

Analysis on the DNA Fingerprinting of Aspergillus Oryzae Mutant Induced by High Hydrostatic Pressure

Science.gov (United States)

Wang, Hua; Zhang, Jian; Yang, Fan; Wang, Kai; Shen, Si-Le; Liu, Bing-Bing; Zou, Bo; Zou, Guang-Tian

2011-01-01

The mutant strains of aspergillus oryzae (HP300a) are screened under 300 MPa for 20 min. Compared with the control strains, the screened mutant strains have unique properties such as genetic stability, rapid growth, lots of spores, and high protease activity. Random amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) are used to analyze the DNA fingerprinting of HP300a and the control strains. There are 67.9% and 51.3% polymorphic bands obtained by these two markers, respectively, indicating significant genetic variations between HP300a and the control strains. In addition, comparison of HP300a and the control strains, the genetic distances of random sequence and simple sequence repeat of DNA are 0.51 and 0.34, respectively.

DNA-fingerprinting di stipiti di Chryseobacterium spp isolati da pazienti con Fibrosi Cistica

Directory of Open Access Journals (Sweden)

Antonietta Lambiase

2007-03-01

Full Text Available Objectives: Pulmonary infections by Gram-negative bacteria, as Pseudomonas aeruginosa, Burkholderia cepacia, Stenotrophomonas maltophilia, are the major cause of morbidity in Cystic Fibrosis patients. In the past decade, several pathogens as Alcaligenes spp and no tuberculosis mycobacteria have been recovered in these patients. Bacteria of genus Chryseobacterium are widespread Gram-negative microrganisms and involved in human infections. Aims of this study were to value the isolation frequency of Chryseobacterium strains in a cohort of Cystic Fibrosis patients, to investigate their antimicrobial sensibility and to establish possible clonal likeness between strains. Methods:A retrospective study was undertaken between January 2003 and December 2005 on 300 patients receiving care at the Regional Cystic Fibrosis Centre of Naples University “Federico II”. Sputum samples were checked: for bacterial identification, selective media and commercial identification systems were used.The activity of antimicrobial agents was determined using diffusion and microdiluthion methods. For DNA-fingerprinting, a genomic DNA macrorestriction followed by pulsed-field electrophoresis was carried out. Results:A total of 26 strains from 17 patients were isolated (7 C. meningosepticum, 14 C. indologenes, 5 C. gleum. Strains were resistant to cephalosporins and carbapenems; some were sensitive to ciprofloxacin, levofloxacin and trimethoprim-sulphamethoxazole. Macrorestriction analysis showed substantial heterogeneity among strains. Conclusions: Actually, the prognostic role of Chryseobacterium in Cystic Fibrosis is unclear and although the small number of isolations, it is need to be on the look out regard such microorganisms. The considerable resistance implies difficulties on therapeutic approach. Results of DNA-fingerprinting indicate no evidence of clonal likeness and then of patient-to-patient spread.

Nucleus fingerprinting for the unique identification of Feulgen-stained nuclei

Science.gov (United States)

Friedrich, David; Brozio, Matthias; Bell, André; Biesterfeld, Stefan; Böcking, Alfred; Aach, Til

2012-03-01

DNA Image Cytometry is a method for non-invasive cancer diagnosis which measures the DNA content of Feulgen-stained nuclei. DNA content is measured using a microscope system equipped with a digital camera as a densitometer and estimating the DNA content from the absorption of light when passing through the nuclei. However, a DNA Image Cytometry measurement is only valid if each nucleus is only measured once. To assist the user in preventing multiple measurements of the same nucleus, we have developed a unique digital identifier for the characterization of Feulgen-stained nuclei, the so called Nucleus Fingerprint. Only nuclei with a new fingerprint can be added to the measurement. This fingerprint is based on basic nucleus features, the contour of the nucleus and the spatial relationship to nuclei in the vicinity. Based on this characterization, a classifier for testing two nuclei for identity is presented. In a pairwise comparison of ~40000 pairs of mutually different nuclei, 99.5% were classified as different. In another 450 tests, the fingerprints of the same nucleus recorded a second time were in all cases judged identical. We therefore conclude that our Nucleus Fingerprint approach robustly prevents the repeated measurement of nuclei in DNA Image Cytometry.

DNA fingerprint similarity between female and juvenile brown-headed cowbirds trapped together

Science.gov (United States)

Hahn, D.C.; Fleischer, R.C.

1995-01-01

This DNA fingerprinting study investigates whether females of the brood parasite brown-headed cowbird, Molothrus ater, associate with their own juvenile offspring at feeding sites more often than would be expected by chance. Cowbirds lay their eggs in the nests of a variety of host species and, as far as is known, leave them to the care of foster parents. Using baited walk-in funnel traps, 36 adult female-juvenile pairs (or trios) of cowbirds were trapped. Blood samples were collected from these individuals to conduct DNA fingerprinting analyses, calculate similarity indices, and to compare S-values for the 11 comparisons of juveniles and the females with which they were caught with S-values of random pairings of juveniles and the females in adjacent gel lanes with which they were not caught. Overall band-sharing was significantly higher for the individuals trapped together than for the random pairings. These associations between juvenile cowbirds and their mothers could occur as a result of female cowbirds monitoring the development of their young in the nests where they have laid. Alternatively, nestling cowbirds in the nest could become familiar visually and locally with a female parent that is frequently in their territory and could follow her when she departs for feeding grounds. In either case these data suggest that adult cowbirds associate with juveniles, in some cases their own offspring, and that offspring may learn to function as cowbirds in part from this association.

Tuberculosis outbreaks predicted by characteristics of first patients in a DNA fingerprint cluster.

Science.gov (United States)

Kik, Sandra V; Verver, Suzanne; van Soolingen, Dick; de Haas, Petra E W; Cobelens, Frank G; Kremer, Kristin; van Deutekom, Henk; Borgdorff, Martien W

2008-07-01

Some clusters of patients who have Mycobacterium tuberculosis isolates with identical DNA fingerprint patterns grow faster than others. It is unclear what predictors determine cluster growth. To assess whether the development of a tuberculosis (TB) outbreak can be predicted by the characteristics of its first two patients. Demographic and clinical data of all culture-confirmed patients with TB in the Netherlands from 1993 through 2004 were combined with DNA fingerprint data. Clusters were restricted to cluster episodes of 2 years to only detect newly arising clusters. Characteristics of the first two patients were compared between small (2-4 cases) and large (5 or more cases) cluster episodes. Of 5,454 clustered cases, 1,756 (32%) were part of a cluster episode of 2 years. Of 622 cluster episodes, 54 (9%) were large and 568 (91%) were small episodes. Independent predictors for large cluster episodes were as follows: less than 3 months' time between the diagnosis of the first two patients, one or both patients were young (<35 yr), both patients lived in an urban area, and both patients came from sub-Saharan Africa. In the Netherlands, patients in new cluster episodes should be screened for these risk factors. When the risk pattern applies, targeted interventions (e.g., intensified contact investigation) should be considered to prevent further cluster expansion.

Identification of a new hominin bone from Denisova Cave, Siberia using collagen fingerprinting and mitochondrial DNA analysis

Science.gov (United States)

Brown, Samantha; Higham, Thomas; Slon, Viviane; Pääbo, Svante; Meyer, Matthias; Douka, Katerina; Brock, Fiona; Comeskey, Daniel; Procopio, Noemi; Shunkov, Michael; Derevianko, Anatoly; Buckley, Michael

2016-03-01

DNA sequencing has revolutionised our understanding of archaic humans during the Middle and Upper Palaeolithic. Unfortunately, while many Palaeolithic sites contain large numbers of bones, the majority of these lack the diagnostic features necessary for traditional morphological identification. As a result the recovery of Pleistocene-age human remains is extremely rare. To circumvent this problem we have applied a method of collagen fingerprinting to more than 2000 fragmented bones from the site of Denisova Cave, Russia, in order to facilitate the discovery of human remains. As a result of our analysis a single hominin bone (Denisova 11) was identified, supported through in-depth peptide sequencing analysis, and found to carry mitochondrial DNA of the Neandertal type. Subsequent radiocarbon dating revealed the bone to be >50,000 years old. Here we demonstrate the huge potential collagen fingerprinting has for identifying hominin remains in highly fragmentary archaeological assemblages, improving the resources available for wider studies into human evolution.

Examining the effects of a DNA fingerprinting workshop on science teachers' professional development and student learning

Science.gov (United States)

Sonmez, Duygu

behavior. The goal is to understand what factors affect teachers' decision making to implement the new knowledge and skills in their classrooms. For this purpose, the study focuses on the effects of a DNA fingerprinting workshop, which has been developed and is regularly offered by a large Midwestern university in the United States for secondary science teachers and their students through cooperation between the university and a large Midwestern public school district. The workshop focuses on the biotechnology applications of genetics---specifically, use of DNA fingerprinting technology in different areas of social life---while forensic science is emphasized. Results indicate that the teachers' motivation to attend the DNA Fingerprinting professional development workshop was mainly influenced by two variables: (1) the need to improve content knowledge and skills, and (2) requirements associated with current educational policies. Level of content knowledge was also found to be a factor contributing to teachers' motivation to implement the workshop. Concerns related to student maturity and classroom management were also identified as factors influencing teachers' implementation behavior. Evidence that the DNA Fingerprinting workshop can be successfully implemented by classroom teachers was obtained. The DNA fingerprinting workshop was found to be a successful model for packaging professional development experiences for content intensive areas.

Donor-derived metastatic melanoma in a liver transplant recipient established by DNA fingerprinting.

Science.gov (United States)

Bilal, Muhammad; Eason, James D; Das, Kanak; Sylvestre, Pamela B; Dean, Amanda G; Vanatta, Jason M

2013-10-01

Metastatic melanoma is a donor-derived malignancy that has rarely been reported in liver allograft recipients. We present a case of a transmitted donor-derived melanoma to a liver allograft recipient in whom the diagnosis was established by polymerase chain reaction-based DNA fingerprinting. A 52-year-old African-American man underwent a successful orthotropic liver transplant for alcohol-induced cirrhosis. One year after the orthotropic liver transplant, he presented at our institution with diffuse abdominal pain, and a computed tomography scan of the abdomen and chest showed innumerable masses diffusely involving the liver and multiple subcutaneous nodules in the abdominal and chest wall. A liver biopsy confirmed the diagnosis of metastatic melanoma. The origin of melanoma was traced to the donor by DNA fingerprinting of the native liver, the donor liver, and the donor gallbladder. Chemotherapy was initiated with temozolomide (75 mg/m² daily) and thalidomide (50 mg daily), to which he responded within 8 weeks with radiologic improvement in metastatic lesions. Tacrolimus was switched to sirolimus because of renal insufficiency as well as reported effectiveness against melanoma. Our patient survived for 9 months after the diagnosis of metastatic melanoma. He ultimately died of brain metastases. Donor-derived metastatic melanoma is a rare cancer with the highest transmission and mortality rates, which requires better recognition. Prompt diagnosis of donor-derived melanoma is critical and can be achieved reliably with polymerase chain reaction-based DNA analysis. Management options after diagnosis include de-escalation of immunosuppression, with or without urgent organ removal or retransplant. The roles of chemotherapy, immunotherapy, and radiotherapy require further study.

DNA fingerprinting of lactic acid bacteria in sauerkraut fermentations.

Science.gov (United States)

Plengvidhya, Vethachai; Breidt, Fredrick; Lu, Zhongjing; Fleming, Henry P

2007-12-01

Previous studies using traditional biochemical identification methods to study the ecology of commercial sauerkraut fermentations revealed that four species of lactic acid bacteria, Leuconostoc mesenteroides, Lactobacillus plantarum, Pediococcus pentosaceus, and Lactobacillus brevis, were the primary microorganisms in these fermentations. In this study, 686 isolates were collected from four commercial fermentations and analyzed by DNA fingerprinting. The results indicate that the species of lactic acid bacteria present in sauerkraut fermentations are more diverse than previously reported and include Leuconostoc citreum, Leuconostoc argentinum, Lactobacillus paraplantarum, Lactobacillus coryniformis, and Weissella sp. The newly identified species Leuconostoc fallax was also found. Unexpectedly, only two isolates of P. pentosaceus and 15 isolates of L. brevis were recovered during this study. A better understanding of the microbiota may aid in the development of low-salt fermentations, which may have altered microflora and altered sensory characteristics.

Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

Science.gov (United States)

Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

1998-01-01

We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

Verifying the geographic origin of mahogany (Swietenia macrophylla King) with DNA-fingerprints.

Science.gov (United States)

Degen, B; Ward, S E; Lemes, M R; Navarro, C; Cavers, S; Sebbenn, A M

2013-01-01

Illegal logging is one of the main causes of ongoing worldwide deforestation and needs to be eradicated. The trade in illegal timber and wood products creates market disadvantages for products from sustainable forestry. Although various measures have been established to counter illegal logging and the subsequent trade, there is a lack of practical mechanisms for identifying the origin of timber and wood products. In this study, six nuclear microsatellites were used to generate DNA fingerprints for a genetic reference database characterising the populations of origin of a large set of mahogany (Swietenia macrophylla King, Meliaceae) samples. For the database, leaves and/or cambium from 1971 mahogany trees sampled in 31 stands from Mexico to Bolivia were genotyped. A total of 145 different alleles were found, showing strong genetic differentiation (δ(Gregorious)=0.52, F(ST)=0.18, G(ST(Hedrick))=0.65) and clear correlation between genetic and spatial distances among stands (r=0.82, P<0.05). We used the genetic reference database and Bayesian assignment testing to determine the geographic origins of two sets of mahogany wood samples, based on their multilocus genotypes. In both cases the wood samples were assigned to the correct country of origin. We discuss the overall applicability of this methodology to tropical timber trading. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Fingerprints for main varieties of argentinean wines: terroir differentiation by inorganic, organic, and stable isotopic analyses coupled to chemometrics.

Science.gov (United States)

Di Paola-Naranjo, Romina D; Baroni, Maria V; Podio, Natalia S; Rubinstein, Hector R; Fabani, Maria P; Badini, Raul G; Inga, Marcela; Ostera, Hector A; Cagnoni, Mariana; Gallegos, Ernesto; Gautier, Eduardo; Peral-Garcia, Pilar; Hoogewerff, Jurian; Wunderlin, Daniel A

2011-07-27

Our main goal was to investigate if robust chemical fingerprints could be developed for three Argentinean red wines based on organic, inorganic, and isotopic patterns, in relation to the regional soil composition. Soils and wines from three regions (Mendoza, San Juan, and Córdoba) and three varieties (Cabernet Sauvignon, Malbec, and Syrah) were collected. The phenolic profile was determined by HPLC-MS/MS and multielemental composition by ICP-MS; (87)Sr/(86)Sr and δ(13)C were determined by TIMS and IRMS, respectively. Chemometrics allowed robust differentiation between regions, wine varieties, and the same variety from different regions. Among phenolic compounds, resveratrol concentration was the most useful marker for wine differentiation, whereas Mg, K/Rb, Ca/Sr, and (87)Sr/(86)Sr were the main inorganic and isotopic parameters selected. Generalized Procrustes analysis (GPA) using two studied matrices (wine and soil) shows consensus between them and clear differences between studied areas. Finally, we applied a canonical correlation analysis, demonstrating significant correlation (r = 0.99; p wine composition. To our knowledge this is the first report combining independent variables, constructing a fingerprint including elemental composition, isotopic, and polyphenol patterns to differentiate wines, matching part of this fingerprint with the soil provenance.

Polynucleotide probes that target a hypervariable region of 16S rRNA genes to identify bacterial isolates corresponding to bands of community fingerprints.

Science.gov (United States)

Heuer, H; Hartung, K; Wieland, G; Kramer, I; Smalla, K

1999-03-01

Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in hybridizations with dot blotted 16S rDNA amplified from bacterial isolates. Within 16S rDNA, the hypervariable V6 region, corresponding to positions 984 to 1047 (Escherichia coli 16S rDNA sequence), which is a subset of the region used for TGGE (positions 968 to 1401), best met the criteria of high phylogenetic variability, required for sufficient probe specificity, and closely flanking conserved priming sites for amplification. Removal of flanking conserved bases was necessary to enable the differentiation of closely related species. This was achieved by 5' exonuclease digestion, terminated by phosphorothioate bonds which were synthesized into the primers. The remaining complementary strand was removed by single-strand-specific digestion. Standard hybridization with truncated probes allowed differentiation of bacteria which differed by only two bases within the probe target site and 1.2% within the complete 16S rDNA. However, a truncated probe, derived from an excised TGGE band of a rhizosphere community, hybridized with three phylogenetically related isolates with identical V6 sequences. Only one of the isolates comigrated with the excised band in TGGE, which was shown to be due to identical sequences, demonstrating the utility of a combined TGGE and V6 probe approach.

Rapid differentiation of Chinese hop varieties (Humulus lupulus) using volatile fingerprinting by HS-SPME-GC-MS combined with multivariate statistical analysis.

Science.gov (United States)

Liu, Zechang; Wang, Liping; Liu, Yumei

2018-01-18

Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

Discrimination of Arcobacter butzleri isolates by polymerase chain reaction-mediated DNA fingerprinting

DEFF Research Database (Denmark)

Atabay, H. I.; Bang, Dang Duong; Aydin, F.

2002-01-01

Aims: The objective of this study was to subtype Arcobacter butzleri isolates using RAPD-PCR. Methods and Results: Thirty-five A. butzleri isolates obtained from chicken carcasses were examined. PCR-mediated DNA fingerprinting technique with primers of the variable sequence motifs was used...... to detect polymorphism within the isolates. Eleven distinct DNA profiles were obtained as follows: Of the 35 strains, 10 as profile 4; seven as profile 1; five as profile 3; three as profiles 2 and 9; two as profile 10; one as profiles 5, 6, 7, 8 and 11. Conclusions: Chicken carcasses sold in markets were...... found to be contaminated with several different strains of A. butzleri . RAPD-PCR technique was found to be a useful technique for distinguishing A. butzleri isolates. Significance and Impact of the Study: The presence of several different A. butzleri strains on chicken carcasses may indicate multiple...

Pasteurella multocida isolated from wild birds of North America: a serotype and DNA fingerprint study of isolates from 1978 to 1993

Science.gov (United States)

Wilson, M.A.; Duncan, R.M.; Nordholm, G.E.; Berlowski, B.M.

1995-01-01

Serotype and DNA fingerprint methods were used to study Pasteurella multocida isolated from 320 wild birds of North America. Isolates were collected during 1978-93. The HhaI profiles of 314 isolates matched the HhaI profile of somatic reference type 1, strain X-73; somatic type 1 antigen was expressed by 310 isolates, and the serotype of four isolates was undetected. Differentiation of the 314 isolates was observed by digestion of DNA with HpaII. None of the HpaII profiles matched the HpaII profile of X-73 (designated HhaI 001/HpaII 001). Three HpaII profiles were recognized among the somatic type 1 isolates: HpaII 002 (n = 18), HpaII 003 (n = 122), and HpaII 004 (n = 174). Profile HpaII 002 was found among isolates collected during 1979-83. Profile HpaII 003 was identified from isolates collected during 1979-89, with the exception of two isolates in 1992. The HpaII 004 profile was identified from isolates collected during 1983-93. Of the six remaining isolates, four expressed somatic type 4 and had HhaI profiles identical to the somatic type 4 reference strain P-1662 profile (designated HhaI 004); these isolates were differentiated by digestion of DNA with HpaII. One isolate was identified as serotype F:11, and another was serotype A:3,4. In the present study, 314 of 316 (99.4%) isolates from wild birds in the Central, Mississippi, and Pacific flyways during 1978-93, were P. multocida somatic type 1.

dna and seed proteins fingerprinting of egyptian crop plants

African Journals Online (AJOL)

Dr. Haddad

2012-11-01

Nov 1, 2012 ... combinations were used for fingerprinting six cultivars which belongs to barley, rice and wheat cultivars leading to the production of numerous AFLP bands, 300 of them were polymorphic. Thirty SSR markers were obtained from fingerprinting eight cultivars belonging to the five studied species using 11.

DNA type analysis to differentiate strains of Xylophilus ampelinus from Europe and Hokkaido, Japan

OpenAIRE

Komatsu, Tsutomu; Shinmura, Akinori; Kondo, Norio

2016-01-01

Strains of the bacterium Xylophilus ampelinus were collected from Europe and Hokkaido, Japan. Genomic fingerprints generated from 43 strains revealed four DNA types (A-D) using the combined results of Rep-, ERIC-, and Box-PCR. Genetic variation was found among the strains examined; strains collected from Europe belonged to DNA types A or B, and strains collected from Hokkaido belonged to DNA types C or D. However, strains belonging to each DNA type showed the same pathogenicity to grapevines ...

Genetic relatedness of artichoke (Cynara scolymus L.) hybrids using random amplified polymorphic DNA (RAPD) fingerprinting.

Science.gov (United States)

Sharaf-Eldin, M A; Al-Tamimi, A; Alam, P; Elkholy, S F; Jordan, J R

2015-12-28

The artichoke (Cynara scolymus L.) is an important food and medicinal crop that is cultivated in Mediterranean countries. Morphological characteristics, such as head shape and diameter, leaf shape, and bract shape, are mainly affected by environmental conditions. A molecular marker approach was used to analyze the degree of polymorphism between artichoke hybrid lines. The degree of genetic difference among three artichoke hybrids was evaluated using random amplified polymorphic DNA-PCR (RAPD-PCR). In this study, the DNA fingerprints of three artichoke lines (A13-010, A11-018, and A12-179) were generated, and a total of 10 decamer primers were applied for RAPD-PCR analyses. Polymorphism  (16.66 to 62.50%) was identified using eight arbitrary decamers and total genomic DNA extracted from the hybrids. Of the 59 loci detected, there were 25 polymorphic and 34 monomorphic loci. Jaccard's similarity index (JSI) ranged between 1.0 and 0.84. Based on the unweighted pair group method with arithmetic mean (UPGMA) similarity matrix and dendrogram, the results indicated that two hybrids (A13-010 and A11-018) were closely related to each other, and the A12-179 line showed more divergence. When identifying correct accessions, consideration of the genetic variation and genetic relationships among the genotypes are required. The RAPD-PCR fingerprinting of artichoke lines clearly showed that it is possible to analyze the RAPD patterns for correlation between genetic means and differences or resemblance between close accessions (A13-010 and A11- 018) at the genomic level.

A novel approach for differentiating pathogenic and non-pathogenic Leptospira based on molecular fingerprinting.

Science.gov (United States)

Xiao, Di; Zhang, Cuicai; Zhang, Huifang; Li, Xiuwen; Jiang, Xiugao; Zhang, Jianzhong

2015-04-24

Leptospirosis is a worldwide, deadly zoonotic disease. Pathogenic Leptospira causes leptospirosis. The rapid and accurate identification of pathogenic and non-pathogenic Leptospira strains is essential for appropriate therapeutic management and timely intervention for infection control. The molecular fingerprint is a simple and rapid alternative tool for microorganisms identification, which is based on matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). In this study, molecular fingerprint was performed to identify pathogenic strains of Leptospira. Phylogenetic analysis based on 16S rRNA gene sequences was used as the reference method. In addition, a label-free technique was used to reveal the different proteins of pathogenic or non-pathogenic Leptospira. A reference database was constructed using 30 Leptospira strains, including 16 pathogenic strains and 14 non-pathogenic strains. Two super reference spectra that were associated with pathogenicity were established. Overall, 33 Leptospira strains were used for validation, and 32 of 33 Leptospira strains could be identified on the species level and all the 33 could be classified as pathogenic or non-pathogenic. The super reference spectra and the major spectra projection (MSP) dendrogram correctly categorized the Leptospira strains into pathogenic and non-pathogenic groups, which was consistent with the 16S rRNA reference methods. Between the pathogenic and non-pathogenic strains, 108 proteins were differentially expressed. molecular fingerprint is an alternative to conventional molecular identification and can rapidly distinguish between pathogenic and non-pathogenic Leptospira strains. Therefore, molecular fingerprint may play an important role in the clinical diagnosis, treatment, surveillance, and tracking of epidemic outbreaks of leptospirosis. Leptospirosis is a worldwide zoonosis that is caused by spirochetes of the genus Leptospira. Leptospirosis is a serious zoonotic

Characterization of selection effects on broiler lines using DNA fingerprinting

Directory of Open Access Journals (Sweden)

GS Schmidt

2003-05-01

Full Text Available The objective of this study was to evaluate the effect of selection for body weight on the genetic variability and diversity in broiler lines. Two paternal broiler lines (LL and LLc were used. LL line was selected for 12 generations for growth and carcass and reproduction characteristics. The LLc line was established from LL line in 1985 and mated at random. Blood samples from six chickens per line were collected and used for molecular analysis. Also, a DNA pool was made for each line to compare effects between lines. Data were analyzed considering the collected information on the presence or absence of DNA bands. Band sharing scores were calculated using the DICE coefficient. The pattern of the 21 most representative bands was used. DNA fingerprinting (DFP showed 90.48 % of polymorphism bands for both lines. Difference between lines was not due to the presence or absence of bands, but to the frequency of such bands in each genotype. Considering that both lines had the same genetic background, changes on band frequency were probably due to selection. Selection for body weight had an effect on the band frequency as evaluated by DFP, and for this reason this technique could be used as a tool in the selection process. Results also suggest that bands 4, 5 and 19 were linked to body weight traits, and bands 9, 10, 12, 13 and 21 were linked to reproductive traits such as egg production.

DNA fingerprinting in zoology: past, present, future.

Science.gov (United States)

Chambers, Geoffrey K; Curtis, Caitlin; Millar, Craig D; Huynen, Leon; Lambert, David M

2014-02-03

In 1962, Thomas Kuhn famously argued that the progress of scientific knowledge results from periodic 'paradigm shifts' during a period of crisis in which new ideas dramatically change the status quo. Although this is generally true, Alec Jeffreys' identification of hypervariable repeat motifs in the human beta-globin gene, and the subsequent development of a technology known now as 'DNA fingerprinting', also resulted in a dramatic shift in the life sciences, particularly in ecology, evolutionary biology, and forensics. The variation Jeffreys recognized has been used to identify individuals from tissue samples of not just humans, but also of many animal species. In addition, the technology has been used to determine the sex of individuals, as well as paternity/maternity and close kinship. We review a broad range of such studies involving a wide diversity of animal species. For individual researchers, Jeffreys' invention resulted in many ecologists and evolutionary biologists being given the opportunity to develop skills in molecular biology to augment their whole organism focus. Few developments in science, even among the subsequent genome discoveries of the 21st century, have the same wide-reaching significance. Even the later development of PCR-based genotyping of individuals using microsatellite repeats sequences, and their use in determining multiple paternity, is conceptually rooted in Alec Jeffreys' pioneering work.

Diversities in virulence, antifungal activity, pigmentation and DNA fingerprint among strains of Burkholderia glumae.

Science.gov (United States)

Karki, Hari S; Shrestha, Bishnu K; Han, Jae Woo; Groth, Donald E; Barphagha, Inderjit K; Rush, Milton C; Melanson, Rebecca A; Kim, Beom Seok; Ham, Jong Hyun

2012-01-01

Burkholderia glumae is the primary causal agent of bacterial panicle blight of rice. In this study, 11 naturally avirulent and nine virulent strains of B. glumae native to the southern United States were characterized in terms of virulence in rice and onion, toxofalvin production, antifungal activity, pigmentation and genomic structure. Virulence of B. glumae strains on rice panicles was highly correlated to virulence on onion bulb scales, suggesting that onion bulb can be a convenient alternative host system to efficiently determine the virulence of B. glumae strains. Production of toxoflavin, the phytotoxin that functions as a major virulence factor, was closely associated with the virulence phenotypes of B. glumae strains in rice. Some strains of B. glumae showed various levels of antifungal activity against Rhizoctonia solani, the causal agent of sheath blight, and pigmentation phenotypes on casamino acid-peptone-glucose (CPG) agar plates regardless of their virulence traits. Purple and yellow-green pigments were partially purified from a pigmenting strain of B. glumae, 411gr-6, and the purple pigment fraction showed a strong antifungal activity against Collectotrichum orbiculare. Genetic variations were detected among the B. glumae strains from DNA fingerprinting analyses by repetitive element sequence-based PCR (rep-PCR) for BOX-A1R-based repetitive extragenic palindromic (BOX) or enterobacterial repetitive intergenic consensus (ERIC) sequences of bacteria; and close genetic relatedness among virulent but pigment-deficient strains were revealed by clustering analyses of DNA fingerprints from BOX-and ERIC-PCR.

Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

NARCIS (Netherlands)

van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

1994-01-01

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

NARCIS (Netherlands)

VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

Accommodating error analysis in comparison and clustering of molecular fingerprints.

OpenAIRE

Salamon, H.; Segal, M. R.; Ponce de Leon, A.; Small, P. M.

1998-01-01

Molecular epidemiologic studies of infectious diseases rely on pathogen genotype comparisons, which usually yield patterns comprising sets of DNA fragments (DNA fingerprints). We use a highly developed genotyping system, IS6110-based restriction fragment length polymorphism analysis of Mycobacterium tuberculosis, to develop a computational method that automates comparison of large numbers of fingerprints. Because error in fragment length measurements is proportional to fragment length and is ...

Diversity of DNA fingerprints of Mycobacterium tuberculosis isolates in the United States.

Science.gov (United States)

Yang, Z; Barnes, P F; Chaves, F; Eisenach, K D; Weis, S E; Bates, J H; Cave, M D

1998-04-01

To investigate the diversity of IS6110 fingerprints of Mycobacterium tuberculosis isolates in the United States and to determine if matching IS6110 fingerprints represent recent interstate tuberculosis transmission, we performed restriction fragment length polymorphism analysis of M. tuberculosis isolates from 1,326 patients in three geographically separated states. Seven hundred ninety-five different IS6110 fingerprint patterns were generated, and pattern diversity was similar in each state. Ninety-six percent of the fingerprint patterns were observed in only one state, demonstrating that most IS6110 fingerprint patterns are confined to a single geographic location. Of the IS6110 fingerprint patterns that were shared by isolates from more than one state, most isolates with 1 to 5 IS6110 copies were separable by pTBN12 fingerprinting whereas those with > 15 copies were not. One high-copy-number M. tuberculosis strain had identical IS6110 and pTBN12 fingerprints and included 57 isolates from three states. Epidemiological data demonstrated significant recent transmission of tuberculosis within each city but not among the states. This suggests that identical fingerprints of isolates from geographically separate locations most likely reflect interstate tuberculosis transmission in the past, with subsequent intrastate spread of disease. Further evaluation of M. tuberculosis strains that cause outbreaks in different geographic locations will provide insight into the epidemiological and bacteriological factors that facilitate the spread of tuberculosis.

Investigating the Effects of a DNA Fingerprinting Workshop on 10th Grade Students' Self Efficacy and Attitudes toward Science.

Science.gov (United States)

Sonmez, Duygu; Simcox, Amanda

The purpose of this study was investigate the effects of a DNA Fingerprinting Workshop on 10th grade students' self efficacy and attitudes toward science. The content of the workshop based on high school science curriculum and includes multimedia instruction, laboratory experiment and participation of undergraduate students as mentors. N=93…

Genetic and chemical diversity of high mucilaginous plants of Sida complex by ISSR markers and chemical fingerprinting.

Science.gov (United States)

Thul, Sanjog T; Srivastava, Ankit K; Singh, Subhash C; Shanker, Karuna

2011-09-01

A method was developed based on multiple approaches wherein DNA and chemical analysis was carried out toward differentiation of important species of Sida complex that is being used for commercial preparation. Isolated DNA samples were successfully performed through PCR amplification using ISSR markers and degree of genetic diversity among the different species of Sida is compared with that of chemical diversity. For genetic fingerprint investigation, selected 10 ISSR primers generating reproducible banding patterns were used. Among the total of 63 amplicons, 62 were recorded as polymorphic, genetic similarity index deduced from ISSR profiles ranged from 12 to 51%. Based on similarity index, S. acuta and S. rhombifolia found to be most similar (51%). High number of species-specific bands played pivotal role to delineate species at genetic level. Investigation based on HPTLC fingerprints analysis revealed 23 bands representing to characteristic chemicals and similarity index ranged from 73 to 91%. Prominent distinguishable bands were observed only in S. acuta, while S. cordifolia and S. rhombifolia shared most bands making them difficult to identify on chemical fingerprint basis. This report summarizes the genotypic and chemotypic diversity and the use of profiles for authentication of species of Sida complex.

Accommodating error analysis in comparison and clustering of molecular fingerprints.

Science.gov (United States)

Salamon, H; Segal, M R; Ponce de Leon, A; Small, P M

1998-01-01

Molecular epidemiologic studies of infectious diseases rely on pathogen genotype comparisons, which usually yield patterns comprising sets of DNA fragments (DNA fingerprints). We use a highly developed genotyping system, IS6110-based restriction fragment length polymorphism analysis of Mycobacterium tuberculosis, to develop a computational method that automates comparison of large numbers of fingerprints. Because error in fragment length measurements is proportional to fragment length and is positively correlated for fragments within a lane, an align-and-count method that compensates for relative scaling of lanes reliably counts matching fragments between lanes. Results of a two-step method we developed to cluster identical fingerprints agree closely with 5 years of computer-assisted visual matching among 1,335 M. tuberculosis fingerprints. Fully documented and validated methods of automated comparison and clustering will greatly expand the scope of molecular epidemiology.

DNA-fingerprinting (AFLP and RFLP) for genotypic identification in species of the Pleurotus eryngii complex.

Science.gov (United States)

Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C

2007-03-01

Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.

Molecular Fingerprinting Approach in Plant Species Evaluation for a Nuclear Power Programme

International Nuclear Information System (INIS)

Azhar Mohamed

2011-01-01

Deoxyribonucleic acid (DNA) as a tool for marker technology is found to be remarkable, advanced and exciting in recent years. DNA markers are valuable tools and important in various plant breeding analyses for identification, gene mapping, marker systems and mutagenesis response. As gene expression is related to concurrent cellular activities and is mobilised in the adaptation of plants to adverse environmental conditions, changes at the DNA levels can be detected simultaneously. The changes also reflect response onto plant traits in which selection for better quality plant materials can be made and/or used as bio-indicator response in tracking any environmental change. The objective of the present study is to show Inter Simple Sequence Repeat (ISSR) markers as an important technique in differentiating plant DNA genomic in various species for the evaluation of their diversity and radiation effects in population. The technique has been found to be rapid, simple, reliable and robust in generating molecular fingerprinting database in bio surveillance for a nuclear power programme. (author)

One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

Science.gov (United States)

Swanson, Colby A; Sliwinski, Marek K

2013-09-01

DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

DNA fingerprinting of some pakistani date palm (phoenix dactylifera L.) cultive ARS using issr markers

International Nuclear Information System (INIS)

Mirbahar, A.; Khan, S.; Markhand, G.S.

2016-01-01

Date palm is one of the oldest cultivated and economically important fruit trees. First time Inter Simple Sequence Repeats (ISSR) markers were used with twenty five economically important date palm cultivars of Pakistan for DNA fingerprinting analysis. Samples were collected from four provinces of Pakistan i.e., Sindh, Punjab, Khyber Pakhtoonkhwa and Balochistan. The study was carried out using seven ISSR markers. The twenty five date palm cultivars showed variation at the DNA level. The ISSR primers showed high polymorphism (84%) in the studied date palm cultivars. Dice similarity index was in range from 0.608 to 0.980 and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) divided twenty five date palm cultivars into two main clusters and sub-clusters. However ISSR markers efficiently discriminated for assessing genetic diversity among commercial Pakistani date palm cultivars. (author)

45,X product of conception after preimplantation genetic diagnosis and euploid embryo transfer: evidence of a spontaneous conception confirmed by DNA fingerprinting.

Science.gov (United States)

Bettio, Daniela; Capalbo, Antonio; Albani, Elena; Rienzi, Laura; Achille, Valentina; Venci, Anna; Ubaldi, Filippo Maria; Levi Setti, Paolo Emanuele

2016-09-06

Preimplantation genetic screening (PGS) provides an opportunity to eliminate a potential implantation failure due to aneuploidy in infertile couples. Some studies clearly show that twins following single embryo transfer (SET) can be the result of a concurrent natural conception and an incidence as high as 1 in 5 twins has been reported. In our case PGS was performed on trophectoderm (TE) biopsies by quantitative polymerase chain reaction (qPCR). The product of conception (POC) was cytogenetically investigated after selection of the placental villi by means of the direct method. Molecular cytogenetic characterization of the POC was performed by fluorescence in situ hybridization (FISH) and array-comparative genomic hybridization (a-CGH) analyses. To investigate the possibility of a spontaneous conception, a panel of 40 single nucleotide polymorphisms (SNPs) was used to compare genetic similarity between the DNA of the POC and the DNA leftover of the TE biopsy. We describe a 36-year old infertile woman undergoing PGS who had a spontaneous abortion after a single euploid embryo transfer on a spontaneous cycle. The POC showed a 45,X karyotype confirmed by FISH and a-CGH. DNA fingerprinting demonstrated a genetic similarity of 75 % between the DNA of the POC and TE biopsy, consistent with a sibling status. All supernumerary euploid embryos were also tested showing a non-self relationship with the POC, excluding a mix-up event at the time of fetal embryo transfer. DNA fingerprinting of the transferred blastocyst and POC, confirmed the occurrence of a spontaneous conception. This case challenges the assumption that a pregnancy after assisted reproductive technology (ART) is always a result of ART, and strengthens the importance to avoid intercourses during PGS and natural transfer cycles. Moreover, cytogenetic analysis of the POCs is strongly recommended along with fingerprinting children born after PGS to see what the concordance is between the embryo transferred and

Fingerprint: A Unique and Reliable Method for Identification

Directory of Open Access Journals (Sweden)

Palash Kumar Bose

2017-01-01

Full Text Available Fingerprints have been the gold standard for personal identification within the forensic community for more than one hundred years. It is still universal in spite of discovery of DNA fingerprint. The science of fingerprint identification has evolved over time from the early use of finger prints to mark business transactions in ancient Babylonia to their use today as core technology in biometric security devices and as scientific evidence in courts of law throughout the world. The science of fingerprints, dactylography or dermatoglyphics, had long been widely accepted, and well acclaimed and reputed as panacea for individualization, particularly in forensic investigations. Human fingerprints are detailed, unique, difficult to alter, and durable over the life of an individual, making them suitable as lifelong markers of human identity. Fingerprints can be readily used by police or other authorities to identify individuals who wish to conceal their identity, or to identify people who are incapacitated or deceased, as in the aftermath of a natural disaster

Development of simple and rapid PCR-fingerprinting methods for Vibrio cholerae on the basis of genetic diversity of the superintegron.

Science.gov (United States)

Chowdhury, N; Asakura, M; Neogi, S B; Hinenoya, A; Haldar, S; Ramamurthy, T; Sarkar, B L; Faruque, S M; Yamasaki, S

2010-07-01

To develop simple and rapid PCR-fingerprinting methods for Vibrio cholerae O1 (El Tor and classical biotypes) and O139 serogroup strains which cause major cholera epidemics, on the basis of the diversity of superintegron (SI) carried by these strains. PCR-restriction fragment length polymorphism (PCR-RFLP) assay was developed targeting region between integrase gene in the SI and its nearby ORF, followed by BglI digestion. Besides, a V. cholerae repeat-amplified fragment length polymorphism (VCR-AFLP) assay was also developed. In the PCR-RFLP, 94 El Tor, 29 classical and 54 O139 strains produced nine, three and six different DNA fingerprints, respectively. On the other hand, VCR-AFLP distinguished these El Tor, classical and O139 strains into five, nine and two DNA fingerprints, respectively. Combining both assays the El Tor, classical and O139 strains could be differentiated into 11, 10 and seven different types, respectively. In a comparative study, pulsed-field gel electrophoresis (PFGE) showed similar differentiation for El Tor (11 types), but lower discrimination for O139 (two types) and classical strains (five types). The PCR assays based on SI diversity can be used as a useful typing tool for epidemiological studies of V. cholerae. This newly developed method is more discriminatory, simple, rapid and cost-effective in comparison with PFGE, and thus can be widely applicable. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

Science.gov (United States)

Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

2012-03-01

The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

Reduction in DNA repair capacity following differentiation of murine proadipocytes

International Nuclear Information System (INIS)

Tofilon, P.J.; Meyn, R.E.

1988-01-01

It has been suggested that terminally differentiated mammalian cells have a decreased DNA repair capacity, compared with proliferating stem cells. To investigate this hypothesis, we have examined γ-ray-induced DNA strand breaks and their repair in the murine proadipocyte stem cell line 3T3-T. By exposure to human plasma, 3T3-T cells can be induced to undergo nonterminal and then terminal differentiation. DNA strand breaks were evaluated using the technique of alkaline elution. No difference was detected among stem, nonterminally differentiated, and terminally differentiated cells in the initial levels of radiation-induced DNA strand breaks. Each of the strand break dose responses increased as a linear function of γ-ray dose. The strand breaks induced by 4 Gy rejoined following biphasic kinetics for each cell type. At each time point examined after irradiation, however, the percentage of strand breaks that had not rejoined in terminally differentiated cells was three to six times greater than in stem cells. The rate of strand break rejoining in nonterminally differentiated cells was of an intermediate value between that of the stem and of the terminally differentiated cells. These results indicate that, at least for 3T3-T cells, differentiated cells have a reduced capacity for DNA repair

Role of DNA profiling in forensic odontology

Directory of Open Access Journals (Sweden)

S Leena Sakari

2015-01-01

Full Text Available The recent advances in DNA profiling have made DNA evidence to be more widely accepted in courts. This has revolutionized the aspect of forensic odontology. DNA profiling/DNA fingerprinting has come a long way from the conventional fingerprints. DNA that is responsible for all the cell′s activities, yields valuable information both in the healthy and diseased individuals. When other means of traditional identification become impossible following mass calamities or fire explosions, teeth provide a rich source of DNA as they have a high chemical as well as physical resistance. The recent evolution in the isolation of DNA and the ways of running a DNA fingerprint are highlighted in this literature review.

Modulation of DNA base excision repair during neuronal differentiation

DEFF Research Database (Denmark)

Sykora, Peter; Yang, Jenq-Lin; Ferrarelli, Leslie K

2013-01-01

DNA damage susceptibility and base excision DNA repair (BER) capacity in undifferentiated and differentiated human neural cells. The results show that undifferentiated human SH-SY5Y neuroblastoma cells are less sensitive to oxidative damage than their differentiated counterparts, in part because...

DNA fingerprinting validates seed dispersal curves from observational studies in the neotropical legume parkia.

Science.gov (United States)

Heymann, Eckhard W; Lüttmann, Kathrin; Michalczyk, Inga M; Saboya, Pedro Pablo Pinedo; Ziegenhagen, Birgit; Bialozyt, Ronald

2012-01-01

Determining the distances over which seeds are dispersed is a crucial component for examining spatial patterns of seed dispersal and their consequences for plant reproductive success and population structure. However, following the fate of individual seeds after removal from the source tree till deposition at a distant place is generally extremely difficult. Here we provide a comparison of observationally and genetically determined seed dispersal distances and dispersal curves in a Neotropical animal-plant system. In a field study on the dispersal of seeds of three Parkia (Fabaceae) species by two Neotropical primate species, Saguinus fuscicollis and Saguinus mystax, in Peruvian Amazonia, we observationally determined dispersal distances. These dispersal distances were then validated through DNA fingerprinting, by matching DNA from the maternally derived seed coat to DNA from potential source trees. We found that dispersal distances are strongly right-skewed, and that distributions obtained through observational and genetic methods and fitted distributions do not differ significantly from each other. Our study showed that seed dispersal distances can be reliably estimated through observational methods when a strict criterion for inclusion of seeds is observed. Furthermore, dispersal distances produced by the two primate species indicated that these primates fulfil one of the criteria for efficient seed dispersers. Finally, our study demonstrated that DNA extraction methods so far employed for temperate plant species can be successfully used for hard-seeded tropical plants.

[Study of genome instability using DNA fingerprinting of the offspring of male mice subjected to chronic low dose gamma irradiation].

Science.gov (United States)

Bezlepkin, V G; Vasil'eva, G V; Lomaeva, M G; Sirota, N P; Gaziev, A I

2000-01-01

By a polymerase chain reaction with an arbitrary primer (AP-PCR), the possibility of transmission of genome instability to somatic cells of the offspring (F1 generation) from male parents of mice exposed to chronic low-level gamma-radiation was studied. Male BALB/c mice 15 days after exposure to 10-50 cGy were mated with unirradiated females. Biopsies were taken from tale tips of two month-old offspring mice and DNA was isolated. The primer in the AP-PCR was a 20-mer oligonucleotide flanking the microsatellite locus Atp1b2 on chromosome 11 of the mouse. A comparative analysis of individual fingerprints of AP-PCR products on DNA-templates from the offspring of irradiated and unirradiated male mice revealed an increased variability of microsatellite-associated sequences in the genome of the offspring of the males exposed to 25 and 50 cGy. The DNA-fingerprints of the offspring of male mice exposed to chronic irradiation with the doses 10 and 25 cGy 15 days before fertilization (at the post-meiotic stage of spermatogenesis) showed an increased frequency of "non-parent bands". The results of the study point to the possibility of transmission to the offspring somatic cells of changes increasing genome instability from male parents exposed to chronic low-level radiation prior to fertilization.

Fingerprint fake detection by optical coherence tomography

Science.gov (United States)

Meissner, Sven; Breithaupt, Ralph; Koch, Edmund

2013-03-01

The most established technique for the identification at biometric access control systems is the human fingerprint. While every human fingerprint is unique, fingerprints can be faked very easily by using thin layer fakes. Because commercial fingerprint scanners use only a two-dimensional image acquisition of the finger surface, they can only hardly differentiate between real fingerprints and fingerprint fakes applied on thin layer materials. A Swept Source OCT system with an A-line rate of 20 kHz and a lateral and axial resolution of approximately 13 μm, a centre wavelength of 1320 nm and a band width of 120 nm (FWHM) was used to acquire fingerprints and finger tips with overlying fakes. Three-dimensional volume stacks with dimensions of 4.5 mm x 4 mm x 2 mm were acquired. The layering arrangement of the imaged finger tips and faked finger tips was analyzed and subsequently classified into real and faked fingerprints. Additionally, sweat gland ducts were detected and consulted for the classification. The manual classification between real fingerprints and faked fingerprints results in almost 100 % correctness. The outer as well as the internal fingerprint can be recognized in all real human fingers, whereby this was not possible in the image stacks of the faked fingerprints. Furthermore, in all image stacks of real human fingers the sweat gland ducts were detected. The number of sweat gland ducts differs between the test persons. The typical helix shape of the ducts was observed. In contrast, in images of faked fingerprints we observe abnormal layer arrangements and no sweat gland ducts connecting the papillae of the outer fingerprint and the internal fingerprint. We demonstrated that OCT is a very useful tool to enhance the performance of biometric control systems concerning attacks by thin layer fingerprint fakes.

Fingerprinting of Peptides with a Large Channel of Bacteriophage Phi29 DNA Packaging Motor.

Science.gov (United States)

Ji, Zhouxiang; Wang, Shaoying; Zhao, Zhengyi; Zhou, Zhi; Haque, Farzin; Guo, Peixuan

2016-09-01

Nanopore technology has become a highly sensitive and powerful tool for single molecule sensing of chemicals and biopolymers. Protein pores have the advantages of size amenability, channel homogeneity, and fabrication reproducibility. But most well-studied protein pores for sensing are too small for passage of peptide analytes that are typically a few nanometers in dimension. The funnel-shaped channel of bacteriophage phi29 DNA packaging motor has previously been inserted into a lipid membrane to serve as a larger pore with a narrowest N-terminal constriction of 3.6 nm and a wider C-terminal end of 6 nm. Here, the utility of phi29 motor channel for fingerprinting of various peptides using single molecule electrophysiological assays is reported. The translocation of peptides is proved unequivocally by single molecule fluorescence imaging. Current blockage percentage and distinctive current signatures are used to distinguish peptides with high confidence. Each peptide generated one or two distinct current blockage peaks, serving as typical fingerprint for each peptide. The oligomeric states of peptides can also be studied in real time at single molecule level. The results demonstrate the potential for further development of phi29 motor channel for detection of disease-associated peptide biomarkers. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Fingerprint recognition with identical twin fingerprints.

Science.gov (United States)

Tao, Xunqiang; Chen, Xinjian; Yang, Xin; Tian, Jie

2012-01-01

Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

Fingerprint recognition with identical twin fingerprints.

Directory of Open Access Journals (Sweden)

Xunqiang Tao

Full Text Available Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6 images. Compared to the previous work, our contributions are summarized as follows: (1 Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2 Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3 A larger sample (83 pairs was collected. (4 A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5 A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

Agro-ecological variations of sheath rot disease of rice caused by Sarocladium oryzae and DNA fingerprinting of the pathogen's population structure.

Science.gov (United States)

Tajul Islam Chowdhury, M; Salim Mian, M; Taher Mia, M A; Rafii, M Y; Latif, M A

2015-12-28

To examine the impact of regional and seasonal variations on the incidence and severity of sheath rot, a major seed-borne disease of rice caused by Sarocladium oryzae, data on incidence and severity were collected from 27 selected fields in the Gazipur, Rangpur, Bogra, Chittagong, Comilla, Gopalgonj, Jessore, Manikgonj, and Bhola districts of Bangladesh in rain-fed and irrigated conditions. Cultural variability of 29 pathogen isolates obtained from 8 different locations was studied on potato dextrose agar (PDA) and genetic variability was determined by DNA fingerprinting using variable number tandem repeat-polymerase chain reaction markers. Overall, disease incidence and severity were higher in irrigated rice. Disease incidence and severity were highest in the Bhola district in rain-fed rice and lowest in irrigated rice. Mycelial growth of 29 representative isolates was found to vary on PDA and the isolates were divided into 6 groups. The range of the overall size of conidia of the selected isolates was 2.40-7.20 x 1.20-2.40 μm. Analysis of the DNA fingerprint types of the 29 isolates of S. oryzae, obtained from the amplification reactions, revealed 10 fingerprinting types (FPTs) that were 80% similar. FPT-1 was the largest group and included 13 isolates (44.8%), while FPT-2 was the third largest group and included 3 isolates. Each of FPT-3, 4, 5, and 6 included only 1 isolate. We observed no relationship between cultural and genetic groupings.

Investigation of genomic instability by assay of DNA fingerprint from the offspring of male mice exposed to chronic low-level γ-radiation

International Nuclear Information System (INIS)

Bezlepkin, V.G.; Vasil'eva, G.V.; Lomaeva, M.G.; Sirota, N.P.; Gaziev, A.I.

2000-01-01

By polymerase chain reaction with arbitrary primer (AP-PCR), the possibility of transmission of genome instability to somatic cells of the offspring (F 1 generation) from male parents of mice exposed to chronic low-dose γ-radiation was studied. Male mice 15 days after exposure to 10-50 cGy were mated with unirradiated females. Biopsies were taken from tale tips of two month-old mice progeny for DNA separation. Primer in the AP-PCR was 20-mer oligonucleotide flanking the micro-satellite locus Atplb2 on chromosome 11 of the mouse. Comparative analysis of individual fingerprints of AP-PCR products on DNA-templates from the offspring of irradiated and unirradiated male mice revealed an increased variability of micro-satellite-associated sequences in the genome of the offspring of males exposed to 25 and 50 cGy. DNA-fingerprints of the offspring of male mice exposed to chronic irradiation doses 10 and 25 cGy. 15 days before fertilization (at the post-meiotic stage of spermatogenesis) showed an increased frequency of non-parent bands. Result of the study point to the possibility of transmission to the offspring somatic cells of changes increasing genome instability from male parents exposed to chronic low-dose radiation prior to fertilization [ru

Application of DNA fingerprinting to the recovery program of the endangered Puerto Rican parrot

Science.gov (United States)

Brock, M.K.; White, B.N.

1992-01-01

The Puerto Rican parrot was reduced to 13 animals in 1975 and as a conservation measure, a captive population was established from a few founders taken from the wild between 1973 and 1983. The number of successful breeding pairs in captivity has been !ow, and the captive breeding program has not been as productive as that of the closely related Hispaniolan parrot. Therefore, a genetic study was initiated to examine the relative levels of relatedness of the captive founders using levels of bandsharing in DNA fingerprints. Unrelated captive founder Puerto Rican parrots had the same average level of bandsharing (0.41) as second-degree relatives of the Hispaniolan parrot (0.38, P > 0,05), with an inbreeding coefficient of 0.04. High levels of bandsharing (>40%) between pairs of males and females correlated with reproductive failure, suggesting that inbreeding depression is partly responsible for the !ow number of' breeding pairs. Consequently, DNA profiling can be used to guide the captive breeding program for the Puerto Rican parrot, and other endangered species, by identifying pairs of males and females with low levels of bandsharing.

DNA Fingerprinting Validates Seed Dispersal Curves from Observational Studies in the Neotropical Legume Parkia

Science.gov (United States)

Heymann, Eckhard W.; Lüttmann, Kathrin; Michalczyk, Inga M.; Saboya, Pedro Pablo Pinedo; Ziegenhagen, Birgit; Bialozyt, Ronald

2012-01-01

Background Determining the distances over which seeds are dispersed is a crucial component for examining spatial patterns of seed dispersal and their consequences for plant reproductive success and population structure. However, following the fate of individual seeds after removal from the source tree till deposition at a distant place is generally extremely difficult. Here we provide a comparison of observationally and genetically determined seed dispersal distances and dispersal curves in a Neotropical animal-plant system. Methodology/Principal Findings In a field study on the dispersal of seeds of three Parkia (Fabaceae) species by two Neotropical primate species, Saguinus fuscicollis and Saguinus mystax, in Peruvian Amazonia, we observationally determined dispersal distances. These dispersal distances were then validated through DNA fingerprinting, by matching DNA from the maternally derived seed coat to DNA from potential source trees. We found that dispersal distances are strongly right-skewed, and that distributions obtained through observational and genetic methods and fitted distributions do not differ significantly from each other. Conclusions/Significance Our study showed that seed dispersal distances can be reliably estimated through observational methods when a strict criterion for inclusion of seeds is observed. Furthermore, dispersal distances produced by the two primate species indicated that these primates fulfil one of the criteria for efficient seed dispersers. Finally, our study demonstrated that DNA extraction methods so far employed for temperate plant species can be successfully used for hard-seeded tropical plants. PMID:22514748

DNA fingerprinting of Mycobacterium tuberculosis: from phage typing to whole-genome sequencing.

Science.gov (United States)

Schürch, Anita C; van Soolingen, Dick

2012-06-01

Current typing methods for Mycobacterium tuberculosis complex evolved from simple phenotypic approaches like phage typing and drug susceptibility profiling to DNA-based strain typing methods, such as IS6110-restriction fragment length polymorphisms (RFLP) and variable number of tandem repeats (VNTR) typing. Examples of the usefulness of molecular typing are source case finding and epidemiological linkage of tuberculosis (TB) cases, international transmission of MDR/XDR-TB, the discrimination between endogenous reactivation and exogenous re-infection as a cause of relapses after curative treatment of tuberculosis, the evidence of multiple M. tuberculosis infections, and the disclosure of laboratory cross-contaminations. Simultaneously, phylogenetic analyses were developed based on single nucleotide polymorphisms (SNPs), genomic deletions usually referred to as regions of difference (RDs) and spoligotyping which served both strain typing and phylogenetic analysis. National and international initiatives that rely on the application of these typing methods have brought significant insight into the molecular epidemiology of tuberculosis. However, current DNA fingerprinting methods have important limitations. They can often not distinguish between genetically closely related strains and the turn-over of these markers is variable. Moreover, the suitability of most DNA typing methods for phylogenetic reconstruction is limited as they show a high propensity of convergent evolution or misinfer genetic distances. In order to fully explore the possibilities of genotyping in the molecular epidemiology of tuberculosis and to study the phylogeny of the causative bacteria reliably, the application of whole-genome sequencing (WGS) analysis for all M. tuberculosis isolates is the optimal, although currently still a costly solution. In the last years WGS for typing of pathogens has been explored and yielded important additional information on strain diversity in comparison to the

Tools for quality control of fingerprint databases

Science.gov (United States)

Swann, B. Scott; Libert, John M.; Lepley, Margaret A.

2010-04-01

Integrity of fingerprint data is essential to biometric and forensic applications. Accordingly, the FBI's Criminal Justice Information Services (CJIS) Division has sponsored development of software tools to facilitate quality control functions relative to maintaining its fingerprint data assets inherent to the Integrated Automated Fingerprint Identification System (IAFIS) and Next Generation Identification (NGI). This paper provides an introduction of two such tools. The first FBI-sponsored tool was developed by the National Institute of Standards and Technology (NIST) and examines and detects the spectral signature of the ridge-flow structure characteristic of friction ridge skin. The Spectral Image Validation/Verification (SIVV) utility differentiates fingerprints from non-fingerprints, including blank frames or segmentation failures erroneously included in data; provides a "first look" at image quality; and can identify anomalies in sample rates of scanned images. The SIVV utility might detect errors in individual 10-print fingerprints inaccurately segmented from the flat, multi-finger image acquired by one of the automated collection systems increasing in availability and usage. In such cases, the lost fingerprint can be recovered by re-segmentation from the now compressed multi-finger image record. The second FBI-sponsored tool, CropCoeff was developed by MITRE and thoroughly tested via NIST. CropCoeff enables cropping of the replacement single print directly from the compressed data file, thus avoiding decompression and recompression of images that might degrade fingerprint features necessary for matching.

DNA repair in murine embryonic stem cells and differentiated cells

International Nuclear Information System (INIS)

Tichy, Elisia D.; Stambrook, Peter J.

2008-01-01

Embryonic stem (ES) cells are rapidly proliferating, self-renewing cells that have the capacity to differentiate into all three germ layers to form the embryo proper. Since these cells are critical for embryo formation, they must have robust prophylactic mechanisms to ensure that their genomic integrity is preserved. Indeed, several studies have suggested that ES cells are hypersensitive to DNA damaging agents and readily undergo apoptosis to eliminate damaged cells from the population. Other evidence suggests that DNA damage can cause premature differentiation in these cells. Several laboratories have also begun to investigate the role of DNA repair in the maintenance of ES cell genomic integrity. It does appear that ES cells differ in their capacity to repair damaged DNA compared to differentiated cells. This minireview focuses on repair mechanisms ES cells may use to help preserve genomic integrity and compares available data regarding these mechanisms with those utilized by differentiated cells

Huella genética vs. Huella dactilar/Geneticprint vs. Fingerprint

Directory of Open Access Journals (Sweden)

Israel Estrada Camacho

2015-01-01

Full Text Available From the earliest times of history, man has struggled to establish an identification system that would differentiate it from their peers. To this end it has established specific techniques and methods. This study was intended precisely to know them the advantages and disadvantages presented two foolproof methods to identify the geneticprint and the traditional fingerprint. For which was conducted a bibliography search specialized in human identification methods, also had personal communication with experts in the field of Dactiloscopy expert and genetics forensic, with the intention of obtaining data, anecdotes and experiences that provide data for the development of this research, in order to know in depth each technique therefore in conclusion is considered that the time factor is still a great advantage of the use of the Dactiloscopy, since in a few minutes at a low cost and reliable results can be obtained. Unlike the previous main disadvantages of DNA analysis are high cost and time to perform your analysis. Still have to consider that the application of molecular techniques in the identification of persons allowed to solve those cases which could not solved using classical techniques of identification (fingerprint, dental chart, etc..

Evaluating the efficacy of DNA differential extraction methods for sexual assault evidence.

Science.gov (United States)

Klein, Sonja B; Buoncristiani, Martin R

2017-07-01

Analysis of sexual assault evidence, often a mixture of spermatozoa and victim epithelial cells, represents a significant portion of a forensic DNA laboratory's case load. Successful genotyping of sperm DNA from these mixed cell samples, particularly with low amounts of sperm, depends on maximizing sperm DNA recovery and minimizing non-sperm DNA carryover. For evaluating the efficacy of the differential extraction, we present a method which uses a Separation Potential Ratio (SPRED) to consider both sperm DNA recovery and non-sperm DNA removal as variables for determining separation efficiency. In addition, we describe how the ratio of male-to-female DNA in the sperm fraction may be estimated by using the SPRED of the differential extraction method in conjunction with the estimated ratio of male-to-female DNA initially present on the mixed swab. This approach may be useful for evaluating or modifying differential extraction methods, as we demonstrate by comparing experimental results obtained from the traditional differential extraction and the Erase Sperm Isolation Kit (PTC © ) procedures. Copyright © 2017 Elsevier B.V. All rights reserved.

Limited variation of DNA fingerprints (IS6110 and IS1081) in Korean strains of Mycobacterium tuberculosis.

Science.gov (United States)

Huh, Y J; Ahn, D I; Kim, S J

1995-08-01

To establish the usefulness of DNA fingerprinting for the epidemiology of Mycobacterium tuberculosis isolated from Korean tuberculosis patients. Comparison of restriction fragment length polymorphism (RFLP) patterns produced by southern hybridization of PvuII-digested chromosomal DNA. IS6110-associated banding patterns of 41 isolates varied considerably, containing 1-13 copies. The RFLP pattern of the epidemiologically related M. tuberculosis isolates was identical in 8 of 10 groups of close contact patients. No noticeable differences in RFLP were observed between drug-sensitive and drug-resistant isolates. IS1081-containing restriction fragment analysis of 52 isolates showed 6 different banding patterns, and the C type was found dominant in Korea. Identification of G type M. tuberculosis, which has a 8.0 kb IS1081-containing PvuII fragment, is unusual because it has been observed only in M. bovis BCG so far. IS6110 was a very useful tool for tracing the transmission route of tuberculosis; IS1081 was also useful for subdividing M. tuberculosis into several groups.

Diversity among Cynodon accessions and taxa based on DNA amplification fingerprinting.

Science.gov (United States)

Assefa, S; Taliaferro, C M; Anderson, M P; de los Reyes, B G; Edwards, R M

1999-06-01

The genus Cynodon (Gramineae), comprised of 9 species, is geographically widely distributed and genetically diverse. Information on the amounts of molecular genetic variation among and within Cynodon taxa is needed to enhance understanding of phylogenetic relations and facilitate germplasm management and breeding improvement efforts. Genetic relatedness among 62 Cynodon accessions, representing eight species, was assessed using DNA amplification fingerprinting (DAF). Ten 8-mer oligonucleotides were used to amplify specific Cynodon genomic sequences. The DNA amplification products of individual accessions were scored for presence (1) or absence (0) of bands. Similarity matrices were developed and the accessions were grouped by cluster (UPGMA) and principal coordinate analysis. Analyses were conducted within ploidy level (2x = 18 and 4x = 36) and over ploidy levels. Each primer revealed polymorphic loci among accessions within species. Of 539 loci (bands) scored, 496 (92%) were polymorphic. Cynodon arcuatus was clearly separated from other species by numerous monomorphic bands. The strongest species similarities were between C. aethiopicus and C. arcuatus, C. transvaalensis and C. plectostachyus, and C. incompletus and C. nlemfuensis. Intraspecific variation was least for C. aethiopicus, C. arcuatus, and C. transvaalensis, and greatest for C. dactylon. Accessions of like taxonomic classification were generally clustered, except the cosmopolitan C. dactylon var. dactylon and C. dactylon var. afganicus. Within taxa, accessions differing in chromosome number clustered in all instances indicating the 2x and 4x forms to be closely related. Little, if any, relationship was found between relatedness as indicated by the DAF profiles and previous estimates of hybridization potential between the different taxa.

Detecting differential DNA methylation from sequencing of bisulfite converted DNA of diverse species.

Science.gov (United States)

Huh, Iksoo; Wu, Xin; Park, Taesung; Yi, Soojin V

2017-07-21

DNA methylation is one of the most extensively studied epigenetic modifications of genomic DNA. In recent years, sequencing of bisulfite-converted DNA, particularly via next-generation sequencing technologies, has become a widely popular method to study DNA methylation. This method can be readily applied to a variety of species, dramatically expanding the scope of DNA methylation studies beyond the traditionally studied human and mouse systems. In parallel to the increasing wealth of genomic methylation profiles, many statistical tools have been developed to detect differentially methylated loci (DMLs) or differentially methylated regions (DMRs) between biological conditions. We discuss and summarize several key properties of currently available tools to detect DMLs and DMRs from sequencing of bisulfite-converted DNA. However, the majority of the statistical tools developed for DML/DMR analyses have been validated using only mammalian data sets, and less priority has been placed on the analyses of invertebrate or plant DNA methylation data. We demonstrate that genomic methylation profiles of non-mammalian species are often highly distinct from those of mammalian species using examples of honey bees and humans. We then discuss how such differences in data properties may affect statistical analyses. Based on these differences, we provide three specific recommendations to improve the power and accuracy of DML and DMR analyses of invertebrate data when using currently available statistical tools. These considerations should facilitate systematic and robust analyses of DNA methylation from diverse species, thus advancing our understanding of DNA methylation. © The Author 2017. Published by Oxford University Press.

Genetic fingerprinting and phylogenetic diversity of Staphylococcus ...

African Journals Online (AJOL)

Genetic fingerprinting of 18 different isolates of Staphylococcus aureus from Nigeria using random amplified polymorphic DNA (RAPD) was carried out. Ten out of 100 Operon primers showed polymorphism among the isolates tested generating 88 bands, 51 of which were polymorphic with sizes ranging between 200 and ...

DNA fingerprinting and diversity analysis in Aus genotypes using microsatellite markers

Directory of Open Access Journals (Sweden)

MD. MONIRUL ISLAM

2015-08-01

Full Text Available DNA fingerprinting and genetic diversity of 94 Aus (6 BRRI released Aus variety and 88 local Aus landraces genotypes were carried out to protect the Aus landraces from biopiracy. A total of 91 microsatellite markers were tested for screening the genotypes. Among 91 amplified products, 56% have polymorphic bands giving 195 alleles. The number of alleles per locus ranged from four (RM25 and RM147 to twenty seven (RM519, where average allele number was 9.76. The Polymorphism Information Contents (PIC lied between 0.455 (RM5 to 0.934 (RM519. Most robust marker was found RM519 since it provided the highest PIC value (0.934. Pair-wise genetic dissimilarity co-efficient showed the lowest genetic dissimilarity was found BRRI dhan42 and BRRI dhan43 and the highest genetic dissimilarity was found local landraces each other. Here it is shown that most Aus landraces is recognized to have broad genetic base. Thus it is recommended to use these landraces for future breeding program or include new and untouched local landraces to incorporate new genes and broaden genetic base.

Typing of Mycoplasma pneumoniae by PCR-mediated DNA fingerprinting

NARCIS (Netherlands)

Ursi, D; Ieven, M; van Bever, H; Quint, W; Niesters, H G; Goossens, H

1994-01-01

PCR fingerprinting was used to characterize clinical isolates of Mycoplasma pneumoniae. Among 24 strains tested, two types were distinguished. Nineteen strains belonged to type 1, whereas only 5 strains belonged to type 2. The majority of strains isolated since 1991 in Belgium belong to type 1. No

Typing of Mycoplasma pneumoniae by PCR-mediated DNA fingerprinting

NARCIS (Netherlands)

Ursi, D; Ieven, M; van Bever, H; Quint, W; Niesters, H G; Goossens, H

PCR fingerprinting was used to characterize clinical isolates of Mycoplasma pneumoniae. Among 24 strains tested, two types were distinguished. Nineteen strains belonged to type 1, whereas only 5 strains belonged to type 2. The majority of strains isolated since 1991 in Belgium belong to type 1. No

Structural Fingerprints of Transcription Factor Binding Site Regions

Directory of Open Access Journals (Sweden)

Peter Willett

2009-03-01

Full Text Available Fourier transforms are a powerful tool in the prediction of DNA sequence properties, such as the presence/absence of codons. We have previously compiled a database of the structural properties of all 32,896 unique DNA octamers. In this work we apply Fourier techniques to the analysis of the structural properties of human chromosomes 21 and 22 and also to three sets of transcription factor binding sites within these chromosomes. We find that, for a given structural property, the structural property power spectra of chromosomes 21 and 22 are strikingly similar. We find common peaks in their power spectra for both Sp1 and p53 transcription factor binding sites. We use the power spectra as a structural fingerprint and perform similarity searching in order to find transcription factor binding site regions. This approach provides a new strategy for searching the genome data for information. Although it is difficult to understand the relationship between specific functional properties and the set of structural parameters in our database, our structural fingerprints nevertheless provide a useful tool for searching for function information in sequence data. The power spectrum fingerprints provide a simple, fast method for comparing a set of functional sequences, in this case transcription factor binding site regions, with the sequences of whole chromosomes. On its own, the power spectrum fingerprint does not find all transcription factor binding sites in a chromosome, but the results presented here show that in combination with other approaches, this technique will improve the chances of identifying functional sequences hidden in genomic data.

Using DNA fingerprints to infer familial relationships within NHANES III households.

Science.gov (United States)

Katki, Hormuzd A; Sanders, Christopher L; Graubard, Barry I; Bergen, Andrew W

2010-06-01

Developing, targeting, and evaluating genomic strategies for population-based disease prevention require population-based data. In response to this urgent need, genotyping has been conducted within the Third National Health and Nutrition Examination (NHANES III), the nationally-representative household-interview health survey in the U.S. However, before these genetic analyses can occur, family relationships within households must be accurately ascertained. Unfortunately, reported family relationships within NHANES III households based on questionnaire data are incomplete and inconclusive with regards to actual biological relatedness of family members. We inferred family relationships within households using DNA fingerprints (Identifiler(R)) that contain the DNA loci used by law enforcement agencies for forensic identification of individuals. However, performance of these loci for relationship inference is not well understood. We evaluated two competing statistical methods for relationship inference on pairs of household members: an exact likelihood ratio relying on allele frequencies to an Identical By State (IBS) likelihood ratio that only requires matching alleles. We modified these methods to account for genotyping errors and population substructure. The two methods usually agree on the rankings of the most likely relationships. However, the IBS method underestimates the likelihood ratio by not accounting for the informativeness of matching rare alleles. The likelihood ratio is sensitive to estimates of population substructure, and parent-child relationships are sensitive to the specified genotyping error rate. These loci were unable to distinguish second-degree relationships and cousins from being unrelated. The genetic data is also useful for verifying reported relationships and identifying data quality issues. An important by-product is the first explicitly nationally-representative estimates of allele frequencies at these ubiquitous forensic loci.

Modulation of Mitochondrial DNA Copy Number to Induce Hepatocytic Differentiation of Human Amniotic Epithelial Cells.

Science.gov (United States)

Vaghjiani, Vijesh; Cain, Jason E; Lee, William; Vaithilingam, Vijayaganapathy; Tuch, Bernard E; St John, Justin C

2017-10-15

Mitochondrial deoxyribonucleic acid (mtDNA) copy number is tightly regulated during pluripotency and differentiation. There is increased demand of cellular adenosine triphosphate (ATP) during differentiation for energy-intensive cell types such as hepatocytes and neurons to meet the cell's functional requirements. During hepatocyte differentiation, mtDNA copy number should be synchronously increased to generate sufficient ATP through oxidative phosphorylation. Unlike bone marrow mesenchymal cells, mtDNA copy number failed to increase by 28 days of differentiation of human amniotic epithelial cells (hAEC) into hepatocyte-like cells (HLC) despite their expression of some end-stage hepatic markers. This was due to higher levels of DNA methylation at exon 2 of POLGA, the mtDNA-specific replication factor. Treatment with a DNA demethylation agent, 5-azacytidine, resulted in increased mtDNA copy number, reduced DNA methylation at exon 2 of POLGA, and reduced hepatic gene expression. Depletion of mtDNA followed by subsequent differentiation did not increase mtDNA copy number, but reduced DNA methylation at exon 2 of POLGA and increased expression of hepatic and pluripotency genes. We encapsulated hAEC in barium alginate microcapsules and subsequently differentiated them into HLC. Encapsulation resulted in no net increase of mtDNA copy number but a significant reduction in DNA methylation of POLGA. RNAseq analysis showed that differentiated HLC express hepatocyte-specific genes but also increased expression of inflammatory interferon genes. Differentiation in encapsulated cells showed suppression of inflammatory genes as well as increased expression of genes associated with hepatocyte function pathways and networks. This study demonstrates that an increase in classical hepatic gene expression can be achieved in HLC through encapsulation, although they fail to effectively regulate mtDNA copy number.

Effects of DNA Extraction Procedures on Bacteroides Profiles in Fecal Samples From Various Animals Determined by Terminal Restriction Fragment Length Polymorphism Analysis

Science.gov (United States)

A major assumption in microbial source tracking is that some fecal bacteria are specific to a host animal, and thus provide unique microbial fingerprints that can be used to differentiate hosts. However, the DNA information obtained from a particular sample may be biased dependi...

An SDN-Based Fingerprint Hopping Method to Prevent Fingerprinting Attacks

Directory of Open Access Journals (Sweden)

Zheng Zhao

2017-01-01

Full Text Available Fingerprinting attacks are one of the most severe threats to the security of networks. Fingerprinting attack aims to obtain the operating system information of target hosts to make preparations for future attacks. In this paper, a fingerprint hopping method (FPH is proposed based on software-defined networks to defend against fingerprinting attacks. FPH introduces the idea of moving target defense to show a hopping fingerprint toward the fingerprinting attackers. The interaction of the fingerprinting attack and its defense is modeled as a signal game, and the equilibriums of the game are analyzed to develop an optimal defense strategy. Experiments show that FPH can resist fingerprinting attacks effectively.

DNA fingerprinting tags novel altered chromosomal regions and identifies the involvement of SOX5 in the progression of prostate cancer.

Science.gov (United States)

Ma, Stephanie; Chan, Yuen Piu; Woolcock, Bruce; Hu, Liang; Wong, Kai Yau; Ling, Ming Tat; Bainbridge, Terry; Webber, Douglas; Chan, Tim Hon Man; Guan, Xin-Yuan; Lam, Wan; Vielkind, Juergen; Chan, Kwok Wah

2009-05-15

Identification of genomic alterations associated with the progression of prostate cancer may facilitate the better understanding of the development of this highly variable disease. Matched normal, premalignant high-grade prostatic intraepithelial neoplasia and invasive prostate carcinoma cells were procured by laser capture microdissection (LCM) from human radical prostatectomy specimens. From these cells, comparative DNA fingerprints were generated by a modified PCR-based technique called scanning of microdissected archival lesion (SMAL)-PCR. Recurrent polymorphic fingerprint fragments were used in tagging altered chromosomal regions. Altered regions were found at cytobands 1p31.3, 1q44, 2p23.1, 3p26.3, 3q22.3, 4q22.3, 4q35.2, 5q23.2, 8q22.3, 8q24.13, 9q21.3, 9q22.32, 10q11.21, 11p13, 12p12.1, 13q12.1, 16q12.2 and 18q21.31. Candidate genes in the surrounding area that may possibly harbor mutations that change normal prostatic cells to progress into their tumor stages were proposed. Of these fragments, a 420 bp alteration, absent in all 26 normal samples screened, was observed in 2 tumors. This fragment was cloned, sequenced and localized to chromosome 12p12.1. Within this region, candidate gene sex determining region Y-box 5 (SOX5) was proposed. Further studies of SOX5 in cell lines, xenografts and human prostate specimens, at both the RNA and protein levels, found overexpression of the gene in tumors. This overexpression was then subsequently found by fluorescent in situ hybridization to be caused by amplification of the region. In conclusion, our results suggest LCM coupled with SMAL-PCR DNA fingerprinting is a useful method for the screening and identification of chromosomal regions and genes associated with cancer development. Further, overexpression of SOX5 is associated with prostate tumor progression and early development of distant metastasis. (c) 2008 Wiley-Liss, Inc.

Molecular fingerprinting of the Egyptian medicinal plant Cocculus ...

African Journals Online (AJOL)

Since no information about the genome of C. pendulus is available, the current study deals with molecular investigation of C. pendulus expressed by DNA fingerprinting of the young leaves of this plant using amplified fragment length polymorphism (AFLP) technique with four primer combinations. The obtained results ...

Assessing genetic diversity among Brettanomyces yeasts by DNA fingerprinting and whole-genome sequencing.

Science.gov (United States)

Crauwels, Sam; Zhu, Bo; Steensels, Jan; Busschaert, Pieter; De Samblanx, Gorik; Marchal, Kathleen; Willems, Kris A; Verstrepen, Kevin J; Lievens, Bart

2014-07-01

Brettanomyces yeasts, with the species Brettanomyces (Dekkera) bruxellensis being the most important one, are generally reported to be spoilage yeasts in the beer and wine industry due to the production of phenolic off flavors. However, B. bruxellensis is also known to be a beneficial contributor in certain fermentation processes, such as the production of certain specialty beers. Nevertheless, despite its economic importance, Brettanomyces yeasts remain poorly understood at the genetic and genomic levels. In this study, the genetic relationship between more than 50 Brettanomyces strains from all presently known species and from several sources was studied using a combination of DNA fingerprinting techniques. This revealed an intriguing correlation between the B. bruxellensis fingerprints and the respective isolation source. To further explore this relationship, we sequenced a (beneficial) beer isolate of B. bruxellensis (VIB X9085; ST05.12/22) and compared its genome sequence with the genome sequences of two wine spoilage strains (AWRI 1499 and CBS 2499). ST05.12/22 was found to be substantially different from both wine strains, especially at the level of single nucleotide polymorphisms (SNPs). In addition, there were major differences in the genome structures between the strains investigated, including the presence of large duplications and deletions. Gene content analysis revealed the presence of 20 genes which were present in both wine strains but absent in the beer strain, including many genes involved in carbon and nitrogen metabolism, and vice versa, no genes that were missing in both AWRI 1499 and CBS 2499 were found in ST05.12/22. Together, this study provides tools to discriminate Brettanomyces strains and provides a first glimpse at the genetic diversity and genome plasticity of B. bruxellensis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Differential Gene Expression of Fibroblasts: Keloid versus Normal

Directory of Open Access Journals (Sweden)

Michael F. Angel

2002-11-01

Full Text Available Abstract: This study investigated gene regulation and unique gene products in both keloid (KDF and normal (NDF dermal fibroblasts in established cell lines. For gene regulation, NDF versus KDF were compared using Clontech's Atlas™ Human cDNA Expression Array while unique gene products were studied using RNA Fingerprinting Kit. RNA from each sample was converted to cDNA using oligo-dT primers. Down-regulated genes using Atlas Array in KDF were 1 60 S ribosomal protein, 2 Thioredoxin dependent peroxidase, 3 Nuclease sensitive element DNA binding protein, 4 c-myc purine-binding transcription factor, 5 c-AMP dependent protein kinase, and, 6 Heat Shock Protein 90 kDa. Genes that are up regulated in KDF were 1 Tubulin and 2 Heat Shock Protein 27 kDa. With the differential display, we found 17 bands unique to both KDF and NDF. The specific gene and the manner in which they were differentially regulated have direct implications to understanding keloid fibroblast proliferation.

Coomassie Brilliant Blue G-250 Dye: An Application for Forensic Fingerprint Analysis.

Science.gov (United States)

Brunelle, Erica; Le, Anh Minh; Huynh, Crystal; Wingfield, Kelly; Halámková, Lenka; Agudelo, Juliana; Halámek, Jan

2017-04-04

The Bradford reagent, comprised of the Coomassie Brilliant Blue G-250 dye, methanol, and phosphoric acid, has been traditionally used for quantifying proteins. Use of this reagent in the Bradford assay relies on the binding of the Coomassie Blue G-250 dye to proteins. However, the ability of the dye to react with a small group of amino acids (arginine, histidine, lysine, phenylalanine, tyrosine, and tryptophan) makes it a viable chemical assay for fingerprint analysis in order to identify the biological sex of the fingerprint originator. It is recognized that the identification of biological sex has been readily accomplished using two other methods; however, both of those systems are reliant upon a large group of amino acids, 23 to be precise. The Bradford assay, described here, was developed specifically to aid in the transition from targeting large groups of amino acids, as demonstrated in the previous studies, to targeting only a single amino acid without compromising the intensity of the response and/or the ability to differentiate between two attributes. In this work, we aim to differentiate between female fingerprints and male fingerprints.

DNA Fingerprinting of Lactobacillus crispatus Strain CTV-05 by Repetitive Element Sequence-Based PCR Analysis in a Pilot Study of Vaginal Colonization

OpenAIRE

Antonio, May A. D.; Hillier, Sharon L.

2003-01-01

Lactobacillus crispatus is one of the predominant hydrogen peroxide (H2O2)-producing species found in the vagina and is under development as a probiotic for the treatment of bacterial vaginosis. In this study, we assessed whether DNA fingerprinting by repetitive element sequence-based PCR (rep-PCR) can be used to distinguish the capsule strain of L. crispatus (CTV-05) from other endogenous strains as well as other species of vaginal lactobacilli. Vaginal and rectal lactobacilli were identifie...

Advanced Fingerprint Analysis Project Fingerprint Constituents

Energy Technology Data Exchange (ETDEWEB)

GM Mong; CE Petersen; TRW Clauss

1999-10-29

The work described in this report was focused on generating fundamental data on fingerprint components which will be used to develop advanced forensic techniques to enhance fluorescent detection, and visualization of latent fingerprints. Chemical components of sweat gland secretions are well documented in the medical literature and many chemical techniques are available to develop latent prints, but there have been no systematic forensic studies of fingerprint sweat components or of the chemical and physical changes these substances undergo over time.

Microbial DNA fingerprinting of human fingerprints: dynamic colonization of fingertip microflora challenges human host inferences for forensic purposes

NARCIS (Netherlands)

S. Tims (Sebastian); W.J.B. van Wamel (Willem); H.P. Endtz (Hubert); A.F. van Belkum (Alex); M.H. Kayser (Manfred)

2009-01-01

textabstractHuman fingertip microflora is transferred to touched objects and may provide forensically relevant information on individual hosts, such as on geographic origins, if endogenous microbial skin species/strains would be retrievable from physical fingerprints and would carry geographically

Maintenance of DNA repair capacity in differentiating rat muscle cells in vitro

International Nuclear Information System (INIS)

Koval, T.M.; Kaufman, S.J.

1981-01-01

Unscheduled DNA synthesis was measured at several times during the differentiation of cultured rat skeletal muscle cells in response to exposures to 254 nm UV light. There was no change in the amount of repair DNA synthesis as the cells fuse and differentiate from postmitotic prefusion myoblasts to multinucleated contracting myotubes. (author)

Detection of visible and latent fingerprints using micro-X-ray fluorescence elemental imaging.

Science.gov (United States)

Worley, Christopher G; Wiltshire, Sara S; Miller, Thomasin C; Havrilla, George J; Majidi, Vahid

2006-01-01

Using micro-X-ray fluorescence (MXRF), a novel means of detecting fingerprints was examined in which the prints were imaged based on their elemental composition. MXRF is a nondestructive technique. Although this method requires a priori knowledge about the approximate location of a print, it offers a new and complementary means for detecting fingerprints that are also left pristine for further analysis (including potential DNA extraction) or archiving purposes. Sebaceous fingerprints and those made after perspiring were detected based on elements such as potassium and chlorine present in the print residue. Unique prints were also detected including those containing lotion, saliva, banana, or sunscreen. This proof-of-concept study demonstrates the potential for visualizing fingerprints by MXRF on surfaces that can be problematic using current methods.

A clinical and bacteriologic investigation of invasive streptococcal infections in Japan on the basis of serotypes, toxin production, and genomic DNA fingerprints.

Science.gov (United States)

Nakashima, K; Ichiyama, S; Iinuma, Y; Hasegawa, Y; Ohta, M; Ooe, K; Shimizu, Y; Igarashi, H; Murai, T; Shimokata, K

1997-08-01

In a survey of invasive streptococcal infections in Japan, we analyzed isolates of Streptococcus pyogenes collected between 1992 and 1994. Genomic DNA fingerprints produced by pulsed-field gel electrophoresis (PFGE) were compared by computer-assisted analysis. Conventional serologic M types were subdivided into PFGE types showing close genetic similarity. Among the 42 isolates from patients with invasive diseases, 16 PFGE types were identified and genetic diversity was clearly demonstrated. Identical fingerprints were observed in both invasive and noninvasive isolates. Only 43% of invasive isolates produced streptococcal pyrogenic exotoxin A (SPE A), and 31% did not contain the speA gene. These findings suggest that the dissemination of a specific clone is not sufficient to explain all cases of these diseases in Japan and pose a question as to the role of SPE A as a major virulent factor. Bacterial factors other than SPE A and host factors should be considered in evaluation of the pathogenesis of the diseases.

The examination of Hevea brasiliensis plants produced by in vitro culture and mutagenesis by DNA fingerprinting techniques

International Nuclear Information System (INIS)

Low, F.C.; Atan, S.; Jaafar, H.

1998-01-01

Rubber (Hevea brasiliensis) plants derived from anther and ovule culture as well as gamma-irradiated plants were examined by several DNA marker techniques. These include restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPD), sequence tagged microsatellite sites (STMS), DNA amplification fingerprinting (DAF) and amplified fragment length polymorphisms (AFLPs). Compared to control plants produced by vegetative propagation (cutting and budding), plants produced by in vitro culture appeared to have a reduction in the number of rDNA loci. Two RAPD protocols were compared and found to be similar in amplification of the major DNA bands. After confirmation that the RAPD method adopted was reproducible, the technique was applied to the present studies. Eight out of the 60 primers screened were able to elicit polymorphisms between pooled DNA from in vitro culture plants. Variations in DNA patterns were observed between pooled DNA samples of anther-derived plants as well as between anther-derived and ovule-derived plants. Comparisons of RAPD patterns obtained between anther-derived plants exposed to increasing dosages of gamma-irradiation with non irradiated anther-derived plants revealed distinct DNA polymorphisms. The changes in DNA profiles did not appear to be correlated to the dosage of irradiation. Since somaclonal variation was detected, it was difficult to identify changes which were specifically caused by irradiation. Application of the STMS technique to tag micro satellite sequences (GA) n , (TA) n and (TTA) n in the hydroxymethylglutaryl coenzyme A reductase-1 (hmgr-1) gene failed to detect differences between plants derived from anther and ovule culture. Although restriction endonuclease digestions with methylation sensitive enzymes suggested that four in vitro culture plants examined exhibited similar digestion patterns as the controls, a change in cytosine methylation in one anther-derived plant was detected. Examination of

Transparent Fingerprint Sensor System for Large Flat Panel Display.

Science.gov (United States)

Seo, Wonkuk; Pi, Jae-Eun; Cho, Sung Haeung; Kang, Seung-Youl; Ahn, Seong-Deok; Hwang, Chi-Sun; Jeon, Ho-Sik; Kim, Jong-Uk; Lee, Myunghee

2018-01-19

In this paper, we introduce a transparent fingerprint sensing system using a thin film transistor (TFT) sensor panel, based on a self-capacitive sensing scheme. An armorphousindium gallium zinc oxide (a-IGZO) TFT sensor array and associated custom Read-Out IC (ROIC) are implemented for the system. The sensor panel has a 200 × 200 pixel array and each pixel size is as small as 50 μm × 50 μm. The ROIC uses only eight analog front-end (AFE) amplifier stages along with a successive approximation analog-to-digital converter (SAR ADC). To get the fingerprint image data from the sensor array, the ROIC senses a capacitance, which is formed by a cover glass material between a human finger and an electrode of each pixel of the sensor array. Three methods are reviewed for estimating the self-capacitance. The measurement result demonstrates that the transparent fingerprint sensor system has an ability to differentiate a human finger's ridges and valleys through the fingerprint sensor array.

Development of maizeSNP3072, a high-throughput compatible SNP array, for DNA fingerprinting identification of Chinese maize varieties.

Science.gov (United States)

Tian, Hong-Li; Wang, Feng-Ge; Zhao, Jiu-Ran; Yi, Hong-Mei; Wang, Lu; Wang, Rui; Yang, Yang; Song, Wei

2015-01-01

Single nucleotide polymorphisms (SNPs) are abundant and evenly distributed throughout the maize ( Zea mays L.) genome. SNPs have several advantages over simple sequence repeats, such as ease of data comparison and integration, high-throughput processing of loci, and identification of associated phenotypes. SNPs are thus ideal for DNA fingerprinting, genetic diversity analysis, and marker-assisted breeding. Here, we developed a high-throughput and compatible SNP array, maizeSNP3072, containing 3072 SNPs developed from the maizeSNP50 array. To improve genotyping efficiency, a high-quality cluster file, maizeSNP3072_GT.egt, was constructed. All 3072 SNP loci were localized within different genes, where they were distributed in exons (43 %), promoters (21 %), 3' untranslated regions (UTRs; 22 %), 5' UTRs (9 %), and introns (5 %). The average genotyping failure rate using these SNPs was only 6 %, or 3 % using the cluster file to call genotypes. The genotype consistency of repeat sample analysis on Illumina GoldenGate versus Infinium platforms exceeded 96.4 %. The minor allele frequency (MAF) of the SNPs averaged 0.37 based on data from 309 inbred lines. The 3072 SNPs were highly effective for distinguishing among 276 examined hybrids. Comparative analysis using Chinese varieties revealed that the 3072SNP array showed a better marker success rate and higher average MAF values, evaluation scores, and variety-distinguishing efficiency than the maizeSNP50K array. The maizeSNP3072 array thus can be successfully used in DNA fingerprinting identification of Chinese maize varieties and shows potential as a useful tool for germplasm resource evaluation and molecular marker-assisted breeding.

Persistent organic pollutants alter DNA methylation during human adipocyte differentiation

NARCIS (Netherlands)

Dungen, van den Myrthe W.; Murk, Albertinka J.; Gils-Kok, van Dieuwertje; Steegenga, Wilma T.

2017-01-01

Ubiquitous persistent organic pollutants (POPs) can accumulate in humans where they might influence differentiation of adipocytes. The aim of this study was to investigate whether DNA methylation is one of the underlying mechanisms by which POPs affect adipocyte differentiation, and to what

Molecular characterisation of Colombian yam germplasm by "DNA amplification fingerprinting (DAF" in radioactivo conditions

Directory of Open Access Journals (Sweden)

Silvia L. Bustamante

2003-07-01

Full Text Available Samples from the Universidad de Córdoba's yam collection (Dioscorea spp. and others originating from IITA (International Institute of Tropical Agriculture, Ibadan, Nigeria were molecularly characterised to complement existing information about them. The yam (Diosocorea spp. represents a basic crop for small-scale farmers on the Colombian Atlantic Coast who sow around 20,000 hectares per year. Even though they are dioecious species, only one sex is represented in Colombia; it must also be stated that climatic conditions are not propitious for its flowering. This situation has caused difficulty for work in yam breeding. The yam species and varieties used in the Colombian ABP (Agricultural Biotechnology Programme have been molecularly characterised by AFLPs in a previous publication describing a preliminary study emerging from the need to broaden the characterisation of those accessions kept at the Universidad de Córdoba. Comparisons have also been done with some African accessions donated by IITA. In this article, samples were molecularly characterised by another fingerprinting technique, the DAF technique (DNA Amplification Fingerprinting based on PCR, using random oligonucleotides for generating characteristic band patterns from each individual. The results showed 0.0413 population diversity with 0.9587 average similarity, indicating that the yam collection studied had very little genetic diversity and, probably, this could be why the crop is vulnerable to plagues and diseases, as happened at the end of the 1980s when anthracnose practically devastated the crop on the Colombian Atlantic coast. Similarity was also found between those Colombian and African samples analysed, agreeing with low diversity and less distance between common ancestors. The molecular results suggest the need for using other molecular techniques having a greater power of discrimination and also the need to broaden the genetic diversity in yam crops for providing greater

3) 双生児の卵性診断へのアプローチ : 双生児が一卵性であるか二卵性であるかを鑑別する新しい方法(シンポジウム 遺伝子工学による病因解析とその診断, 第435回新潟医学会)

OpenAIRE

高橋, 完明; Takahashi, Hiroaki

1989-01-01

It has become possible to accurately differentiate monozygotic from dizygotic twins in one week after birth. From each newborn twin, a 10 ml sample of umbilical cord blood was obtained at birth. DNA was extracted from the leukocytes. Using mini-satellite DNA as a probe, Southern hybridization was performed to prepare a DNA fingerprint. Identical DNA fingerprints from each twin indicate a monozygotic relationship and different fingerprints indicate a dizygotic relationship.

Mechanisms of dealing with DNA damage in terminally differentiated cells

Energy Technology Data Exchange (ETDEWEB)

Fortini, P. [Department of Environment and Primary Prevention, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy); Dogliotti, E., E-mail: eugenia.dogliotti@iss.it [Department of Environment and Primary Prevention, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy)

2010-03-01

To protect genomic integrity living cells that are continuously exposed to DNA-damaging insults are equipped with an efficient defence mechanism termed the DNA damage response. Its function is to eliminate DNA damage through DNA repair and to remove damaged cells by apoptosis. The DNA damage response has been investigated mainly in proliferating cells, in which the cell cycle machinery is integrated with the DNA damage signalling. The current knowledge of the mechanisms of DNA repair, DNA damage signalling and cell death of post-mitotic cells that have undergone irreversible cell cycle withdrawal will be reviewed. Evidence will be provided that the protection of the genome integrity in terminally differentiated cells is achieved by different strategies than in proliferating cells.

Mechanisms of dealing with DNA damage in terminally differentiated cells

International Nuclear Information System (INIS)

Fortini, P.; Dogliotti, E.

2010-01-01

To protect genomic integrity living cells that are continuously exposed to DNA-damaging insults are equipped with an efficient defence mechanism termed the DNA damage response. Its function is to eliminate DNA damage through DNA repair and to remove damaged cells by apoptosis. The DNA damage response has been investigated mainly in proliferating cells, in which the cell cycle machinery is integrated with the DNA damage signalling. The current knowledge of the mechanisms of DNA repair, DNA damage signalling and cell death of post-mitotic cells that have undergone irreversible cell cycle withdrawal will be reviewed. Evidence will be provided that the protection of the genome integrity in terminally differentiated cells is achieved by different strategies than in proliferating cells.

In Silico Genomic Fingerprints of the Bacillus anthracis Group Obtained by Virtual Hybridization

Directory of Open Access Journals (Sweden)

Hueman Jaimes-Díaz

2015-02-01

Full Text Available In this study we evaluate the capacity of Virtual Hybridization to identify between highly related bacterial strains. Eight genomic fingerprints were obtained by virtual hybridization for the Bacillus anthracis genome set, and a set of 15,264 13-nucleotide short probes designed to produce genomic fingerprints unique for each organism. The data obtained from each genomic fingerprint were used to obtain hybridization patterns simulating a DNA microarray. Two virtual hybridization methods were used: the Direct and the Extended method to identify the number of potential hybridization sites and thus determine the minimum sensitivity value to discriminate between genomes with 99.9% similarity. Genomic fingerprints were compared using both methods and phylogenomic trees were constructed to verify that the minimum detection value is 0.000017. Results obtained from the genomic fingerprints suggest that the distribution in the trees is correct, as compared to other taxonomic methods. Specific virtual hybridization sites for each of the genomes studied were also identified.

Towards secondary fingerprint classification

CSIR Research Space (South Africa)

Msiza, IS

2011-07-01

Full Text Available an accuracy figure of 76.8%. This small difference between the two figures is indicative of the validity of the proposed secondary classification module. Keywords?fingerprint core; fingerprint delta; primary classifi- cation; secondary classification I..., namely, the fingerprint core and the fingerprint delta. Forensically, a fingerprint core is defined as the innermost turning point where the fingerprint ridges form a loop, while the fingerprint delta is defined as the point where these ridges form a...

Development and Characterization of Complex DNA Fingerprinting Probes for the Infectious Yeast Candida dubliniensis

Science.gov (United States)

Joly, Sophie; Pujol, Claude; Rysz, Michal; Vargas, Kaaren; Soll, David R.

1999-01-01

Using a strategy to clone large genomic sequences containing repetitive elements from the infectious yeast Candida dubliniensis, the three unrelated sequences Cd1, Cd24, and Cd25, with respective molecular sizes of 15,500, 10,000, and 16,000 bp, were cloned and analyzed for their efficacy as DNA fingerprinting probes. Each generated a complex Southern blot hybridization pattern with endonuclease-digested genomic DNA. Cd1 generated an extremely variable pattern that contained all of the bands of the pattern generated by the repeat element RPS of Candida albicans. We demonstrated that Cd1 does not contain RPS but does contain a repeat element associated with RPS throughout the C. dubliniensis genome. The Cd1 pattern was the least stable over time both in vitro and in vivo and for that reason proved most effective in assessing microevolution. Cd24, which did not exhibit microevolution in vitro, was highly variable in vivo, suggesting in vivo-dependent microevolution. Cd25 was deemed the best probe for broad epidemiological studies, since it was the most stable over time, was the only truly C. dubliniensis-specific probe of the three, generated the most complex pattern, was distributed throughout all C. dubliniensis chromosomes, and separated a worldwide collection of 57 C. dubliniensis isolates into two distinct groups. The presence of a species-specific repetitive element in Cd25 adds weight to the already substantial evidence that C. dubliniensis represents a bona fide species. PMID:10074523

Molecular characterisation of Colombian yam germplasm by "DNA amplification fingerprinting (DAF" in radioactivo conditions Caracterización molecular del germoplasma de ñame colombiano utilizando "DNA Amplificaron Fingerprinting (DAF" en condiciones radiactivas

Directory of Open Access Journals (Sweden)

Bustamante Silvia L.

2003-12-01

Full Text Available Samples from the Universidad de Córdoba's yam collection (Dioscorea spp. and others originating from IITA (International Institute of Tropical Agriculture, Ibadan, Nigeria were molecularly characterised to complement existing information about them. The yam (Diosocorea spp. represents a basic crop for small-scale farmers on the Colombian Atlantic Coast who sow around 20,000 hectares per year. Even though they are dioecious species, only one sex is represented in Colombia; it must also be stated that climatic conditions are not propitious for its flowering. This situation has caused difficulty for work in yam breeding. The yam species and varieties used in the Colombian ABP (Agricultural Biotechnology Programme have been molecularly characterised by AFLPs in a previous publication describing a preliminary study emerging from the need to broaden the characterisation of those accessions kept at the Universidad de Córdoba. Comparisons have also been done with some African accessions donated by IITA. In this article, samples were molecularly characterised by another fingerprinting technique, the DAF technique (DNA Amplification Fingerprinting based on PCR, using random oligonucleotides for generating characteristic band patterns from each individual. The results showed 0.0413 population diversity with 0.9587 average similarity, indicating that the yam collection studied had very little genetic diversity and, probably, this could be why the crop is vulnerable to plagues and diseases, as happened at the end of the 1980s when anthracnose practically devastated the crop on the Colombian Atlantic coast. Similarity was also found between those Colombian and African samples analysed, agreeing with low diversity and less distance between common ancestors. The molecular results suggest the need for using other molecular techniques having a greater power of discrimination and also the need to broaden the genetic diversity in yam crops for providing greater

Verifying Parentage and Confirming Identity in Blackberry with a Fingerprinting Set

Science.gov (United States)

Parentage and identity confirmation is an important aspect of clonally propagated crops outcrossing. Potential errors resulting misidentification include off-type pollination events, labeling errors, or sports of clones. DNA fingerprinting sets are an excellent solution to quickly identify off-type ...

Transparent Fingerprint Sensor System for Large Flat Panel Display

Directory of Open Access Journals (Sweden)

Wonkuk Seo

2018-01-01

Full Text Available In this paper, we introduce a transparent fingerprint sensing system using a thin film transistor (TFT sensor panel, based on a self-capacitive sensing scheme. An armorphousindium gallium zinc oxide (a-IGZO TFT sensor array and associated custom Read-Out IC (ROIC are implemented for the system. The sensor panel has a 200 × 200 pixel array and each pixel size is as small as 50 μm × 50 μm. The ROIC uses only eight analog front-end (AFE amplifier stages along with a successive approximation analog-to-digital converter (SAR ADC. To get the fingerprint image data from the sensor array, the ROIC senses a capacitance, which is formed by a cover glass material between a human finger and an electrode of each pixel of the sensor array. Three methods are reviewed for estimating the self-capacitance. The measurement result demonstrates that the transparent fingerprint sensor system has an ability to differentiate a human finger’s ridges and valleys through the fingerprint sensor array.

DNA methylation polymorphism in a set of elite rice cultivars and its possible contribution to inter-cultivar differential gene expression.

Science.gov (United States)

Wang, Yongming; Lin, Xiuyun; Dong, Bo; Wang, Yingdian; Liu, Bao

2004-01-01

RAPD (randomly amplified polymorphic DNA) and ISSR (inter-simple sequence repeat) fingerprinting on HpaII/MspI-digested genomic DNA of nine elite japonica rice cultivars implies inter-cultivar DNA methylation polymorphism. Using both DNA fragments isolated from RAPD or ISSR gels and selected low-copy sequences as probes, methylation-sensitive Southern blot analysis confirms the existence of extensive DNA methylation polymorphism in both genes and DNA repeats among the rice cultivars. The cultivar-specific methylation patterns are stably maintained, and can be used as reliable molecular markers. Transcriptional analysis of four selected sequences (RdRP, AC9, HSP90 and MMR) on leaves and roots from normal and 5-azacytidine-treated seedlings of three representative cultivars shows an association between the transcriptional activity of one of the genes, the mismatch repair (MMR) gene, and its CG methylation patterns.

Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

Science.gov (United States)

Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

2017-01-01

Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

Authentication of commercial spices based on the similarities between gas chromatographic fingerprints.

Science.gov (United States)

Matsushita, Takaya; Zhao, Jing Jing; Igura, Noriyuki; Shimoda, Mitsuya

2018-06-01

A simple and solvent-free method was developed for the authentication of commercial spices. The similarities between gas chromatographic fingerprints were measured using similarity indices and multivariate data analyses, as morphological differentiation between dried powders and small spice particles was challenging. The volatile compounds present in 11 spices (i.e. allspice, anise, black pepper, caraway, clove, coriander, cumin, dill, fennel, star anise, and white pepper) were extracted by headspace solid-phase microextraction, and analysed by gas chromatography-mass spectrometry. The largest 10 peaks were selected from each total ion chromatogram, and a total of 65 volatiles were tentatively identified. The similarity indices (i.e. the congruence coefficients) were calculated using the data matrices of the identified compound relative peak areas to differentiate between two sets of fingerprints. Where pairs of similar fingerprints produced high congruence coefficients (>0.80), distinctive volatile markers were employed to distinguish between these samples. In addition, hierarchical cluster analysis and principal component analysis were performed to visualise the similarity among fingerprints, and the analysed spices were grouped and characterised according to their distinctive major components. This method is suitable for screening unknown spices, and can therefore be employed to evaluate the quality and authenticity of various spices. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

A Support Vector Machine Approach for Truncated Fingerprint Image Detection from Sweeping Fingerprint Sensors

Science.gov (United States)

Chen, Chi-Jim; Pai, Tun-Wen; Cheng, Mox

2015-01-01

A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS), successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM), based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates. PMID:25835186

A Support Vector Machine Approach for Truncated Fingerprint Image Detection from Sweeping Fingerprint Sensors

Directory of Open Access Journals (Sweden)

Chi-Jim Chen

2015-03-01

Full Text Available A sweeping fingerprint sensor converts fingerprints on a row by row basis through image reconstruction techniques. However, a built fingerprint image might appear to be truncated and distorted when the finger was swept across a fingerprint sensor at a non-linear speed. If the truncated fingerprint images were enrolled as reference targets and collected by any automated fingerprint identification system (AFIS, successful prediction rates for fingerprint matching applications would be decreased significantly. In this paper, a novel and effective methodology with low time computational complexity was developed for detecting truncated fingerprints in a real time manner. Several filtering rules were implemented to validate existences of truncated fingerprints. In addition, a machine learning method of supported vector machine (SVM, based on the principle of structural risk minimization, was applied to reject pseudo truncated fingerprints containing similar characteristics of truncated ones. The experimental result has shown that an accuracy rate of 90.7% was achieved by successfully identifying truncated fingerprint images from testing images before AFIS enrollment procedures. The proposed effective and efficient methodology can be extensively applied to all existing fingerprint matching systems as a preliminary quality control prior to construction of fingerprint templates.

DNA Methylation Alterations in Breast Cancer

National Research Council Canada - National Science Library

Yamamoto, Fumiichiro

2002-01-01

We have performed the NotI-MseI MS-AFLP experiments using normal and tumor DNA from breast cancer patients and determined the identity of bands exhibiting consistent changes in breast cancer DNA fingerprint...

Differentiation of Human Induced Pluripotent or Embryonic Stem Cells Decreases the DNA Damage Repair by Homologous Recombination

Directory of Open Access Journals (Sweden)

Kalpana Mujoo

2017-11-01

Full Text Available The nitric oxide (NO-cyclic GMP pathway contributes to human stem cell differentiation, but NO free radical production can also damage DNA, necessitating a robust DNA damage response (DDR to ensure cell survival. How the DDR is affected by differentiation is unclear. Differentiation of stem cells, either inducible pluripotent or embryonic derived, increased residual DNA damage as determined by γ-H2AX and 53BP1 foci, with increased S-phase-specific chromosomal aberration after exposure to DNA-damaging agents, suggesting reduced homologous recombination (HR repair as supported by the observation of decreased HR-related repair factor foci formation (RAD51 and BRCA1. Differentiated cells also had relatively increased fork stalling and R-loop formation after DNA replication stress. Treatment with NO donor (NOC-18, which causes stem cell differentiation has no effect on double-strand break (DSB repair by non-homologous end-joining but reduced DSB repair by HR. Present studies suggest that DNA repair by HR is impaired in differentiated cells.

Genetic relationships among wild and cultivated accessions of curry leaf plant (Murraya koenigii (L.) Spreng.), as revealed by DNA fingerprinting methods.

Science.gov (United States)

Verma, Sushma; Rana, T S

2013-02-01

Murraya koenigii (L.) Spreng. (Rutaceae), is an aromatic plant and much valued for its flavor, nutritive and medicinal properties. In this study, three DNA fingerprinting methods viz., random amplification of polymorphic DNA (RAPD), directed amplification of minisatellite DNA (DAMD), and inter-simple sequence repeat (ISSR), were used to unravel the genetic variability and relationships across 92 wild and cultivated M. koenigii accessions. A total of 310, 102, and 184, DNA fragments were amplified using 20 RAPD, 5 DAMD, and 13 ISSR primers, revealing 95.80, 96.07, and 96.73% polymorphism, respectively, across all accessions. The average polymorphic information content value obtained with RAPD, DAMD, and ISSR markers was 0.244, 0.250, and 0.281, respectively. The UPGMA tree, based on Jaccard's similarity coefficient generated from the cumulative (RAPD, DAMD, and ISSR) band data showed two distinct clusters, clearly separating wild and cultivated accessions in the dendrogram. Percentage polymorphism, gene diversity (H), and Shannon information index (I) estimates were higher in cultivated accessions compared to wild accessions. The overall high level of polymorphism and varied range of genetic distances revealed a wide genetic base in M. koenigii accessions. The study suggests that RAPD, DAMD, and ISSR markers are highly useful to unravel the genetic variability in wild and cultivated accessions of M. koenigii.

Fingerprint pores extractor

CSIR Research Space (South Africa)

Mngenge, NA

2012-11-01

Full Text Available , this is not always the case because of diseases and hash working conditions that affect fingerprints. In order to maintain high level of security independent of varying fingerprint image quality research suggests the use of other fingerprint features to compliment...

Touchless fingerprint biometrics

CERN Document Server

Labati, Ruggero Donida; Scotti, Fabio

2015-01-01

Offering the first comprehensive analysis of touchless fingerprint-recognition technologies, Touchless Fingerprint Biometrics gives an overview of the state of the art and describes relevant industrial applications. It also presents new techniques to efficiently and effectively implement advanced solutions based on touchless fingerprinting.The most accurate current biometric technologies in touch-based fingerprint-recognition systems require a relatively high level of user cooperation to acquire samples of the concerned biometric trait. With the potential for reduced constraints, reduced hardw

DNA probe for strain typing of Cryptococcus neoformans.

OpenAIRE

Varma, A; Kwon-Chung, K J

1992-01-01

A 7-kb linear plasmid, harbored by a URA5 transformant, hybridized to all the chromosomes of Cryptococcus neoformans separated by contour-clamped homogeneous electric field electrophoresis. Its linear maintenance was determined to have been facilitated by the presence of telomere-like sequences at its free ends. Hybridization of this plasmid to AccI-digested genomic DNAs of 26 C. neoformans strains generated 21 unique DNA fingerprints. The DNA fingerprints of isolates within the same serotype...

Differential expression analysis of genic male sterility by cDNA-AFLP in maize

International Nuclear Information System (INIS)

Zhang Linbi; Rong Tingzhao; Pan Guangtang; Cao Moju

2009-01-01

The differential expression of male sterility induced by space flight with male fertility was studied using cDNA-AFLP technology. Total RNA was isolated from anther of male sterility and male fertility. Nine differential expression cDNA fragments were obtained with 16 primer combinations. The differential cDNA fragments were eluted, cloned and sequenced. Then half-quantitative RT-PCR was used to stuy the differential expressions of 4 development stages between sterility and fertility. Sequencing analysis shown 2 fragments from male sterility might be novel genes. Four fragments from male fertility were homology as chalcone and stilbene synthases, putative acyl CoA dehydrogenase, putative protein kinases and putative glycine decarboxylase. All these proteins might participate in the energy metabolisms, substance metabolisms or signal pollen development, Z8 took on increasing expression during the middle period of pollen development. These results just met the demand of more energy and more substance during the pollen development. (authors)

Analisis Keanekaragaman Genetik dan Diferensiasi Jati Jawa dan Madura berdasarkan Marka Mikrosatelit untuk Mendukung Fingerprinting Jati

Directory of Open Access Journals (Sweden)

Munisyatul Millah

2010-09-01

Full Text Available Analysis fingerprinting teak is supported by information about teak’s character molecularly. The information is gotten by analyzing 3 primary microsatellite in 46 teak samples that produce total 18 kinds of alel averagely 6 alel per locus. Genetics variety level is shown by Observed Heterozigosity (Ho, Expected Heterozygosity (He, Polimorfi sm Information Content (PIC and Genetics Differentiation Coeffi cient successively 0.5122; 0.6221; 0.5818; and 0.0629. Kinship connection through dendogram analysis produces coeffi cient resemblance 0.3-1.00 that form 2 groups. However it has not shown inclination of forming group based on origin grows yet. Genetics differentiation analysis indicates different genetics in a population is higher then it is between populations. Analysis result has not found specifi c alel yet but has found 12 specifi c genotipe that is potential for analyzing fi ngerprinting if it relates to important useful genes. Keywords: microsatellite teak, DNA fi ngerprinting

Chemical elemental distribution and soil DNA fingerprints provide the critical evidence in murder case investigation.

Directory of Open Access Journals (Sweden)

Giuseppe Concheri

Full Text Available BACKGROUND: The scientific contribution to the solution of crime cases, or throughout the consequent forensic trials, is a crucial aspect of the justice system. The possibility to extract meaningful information from trace amounts of samples, and to match and validate evidences with robust and unambiguous statistical tests, are the key points of such process. The present report is the authorized disclosure of an investigation, carried out by Attorney General appointment, on a murder case in northern Italy, which yielded the critical supporting evidence for the judicial trial. METHODOLOGY/PRINCIPAL FINDINGS: The proportional distribution of 54 chemical elements and the bacterial community DNA fingerprints were used as signature markers to prove the similarity of two soil samples. The first soil was collected on the crime scene, along a corn field, while the second was found in trace amounts on the carpet of a car impounded from the main suspect in a distant location. The matching similarity of the two soils was proven by crossing the results of two independent techniques: a elemental analysis via inductively coupled plasma mass spectrometry (ICP-MS and optical emission spectrometry (ICP-OES approaches, and b amplified ribosomal DNA restriction analysis by gel electrophoresis (ARDRA. CONCLUSIONS: Besides introducing the novel application of these methods to forensic disciplines, the highly accurate level of resolution observed, opens new possibilities also in the fields of soil typing and tracking, historical analyses, geochemical surveys and global land mapping.

Distorted Fingerprint Verification System

Directory of Open Access Journals (Sweden)

Divya KARTHIKAESHWARAN

2011-01-01

Full Text Available Fingerprint verification is one of the most reliable personal identification methods. Fingerprint matching is affected by non-linear distortion introduced in fingerprint impression during the image acquisition process. This non-linear deformation changes both the position and orientation of minutiae. The proposed system operates in three stages: alignment based fingerprint matching, fuzzy clustering and classifier framework. First, an enhanced input fingerprint image has been aligned with the template fingerprint image and matching score is computed. To improve the performance of the system, a fuzzy clustering based on distance and density has been used to cluster the feature set obtained from the fingerprint matcher. Finally a classifier framework has been developed and found that cost sensitive classifier produces better results. The system has been evaluated on fingerprint database and the experimental result shows that system produces a verification rate of 96%. This system plays an important role in forensic and civilian applications.

Defense of fake fingerprint attacks using a swept source laser optical coherence tomography setup

Science.gov (United States)

Meissner, Sven; Breithaupt, Ralph; Koch, Edmund

2013-03-01

The most established technique for the identification at biometric access control systems is the human fingerprint. While every human fingerprint is unique, fingerprints can be faked very easily by using thin layer fakes. Because commercial fingerprint scanners use only a two-dimensional image acquisition of the finger surface, they can only hardly differentiate between real fingerprints and fingerprint fakes applied on thin layer materials. A Swept Source OCT system with an A-line rate of 20 kHz and a lateral and axial resolution of approximately 13 μm, a centre wavelength of 1320 nm and a band width of 120 nm (FWHM) was used to acquire fingerprints and finger tips with overlying fakes. Three-dimensional volume stacks with dimensions of 4.5 mm x 4 mm x 2 mm were acquired. The layering arrangement of the imaged finger tips and faked finger tips was analyzed and subsequently classified into real and faked fingerprints. Additionally, sweat gland ducts were detected and consulted for the classification. The manual classification between real fingerprints and faked fingerprints results in almost 100 % correctness. The outer as well as the internal fingerprint can be recognized in all real human fingers, whereby this was not possible in the image stacks of the faked fingerprints. Furthermore, in all image stacks of real human fingers the sweat gland ducts were detected. The number of sweat gland ducts differs between the test persons. The typical helix shape of the ducts was observed. In contrast, in images of faked fingerprints we observe abnormal layer arrangements and no sweat gland ducts connecting the papillae of the outer fingerprint and the internal fingerprint. We demonstrated that OCT is a very useful tool to enhance the performance of biometric control systems concerning attacks by thin layer fingerprint fakes.

Longitudinal study of fingerprint recognition.

Science.gov (United States)

Yoon, Soweon; Jain, Anil K

2015-07-14

Human identification by fingerprints is based on the fundamental premise that ridge patterns from distinct fingers are different (uniqueness) and a fingerprint pattern does not change over time (persistence). Although the uniqueness of fingerprints has been investigated by developing statistical models to estimate the probability of error in comparing two random samples of fingerprints, the persistence of fingerprints has remained a general belief based on only a few case studies. In this study, fingerprint match (similarity) scores are analyzed by multilevel statistical models with covariates such as time interval between two fingerprints in comparison, subject's age, and fingerprint image quality. Longitudinal fingerprint records of 15,597 subjects are sampled from an operational fingerprint database such that each individual has at least five 10-print records over a minimum time span of 5 y. In regard to the persistence of fingerprints, the longitudinal analysis on a single (right index) finger demonstrates that (i) genuine match scores tend to significantly decrease when time interval between two fingerprints in comparison increases, whereas the change in impostor match scores is negligible; and (ii) fingerprint recognition accuracy at operational settings, nevertheless, tends to be stable as the time interval increases up to 12 y, the maximum time span in the dataset. However, the uncertainty of temporal stability of fingerprint recognition accuracy becomes substantially large if either of the two fingerprints being compared is of poor quality. The conclusions drawn from 10-finger fusion analysis coincide with the conclusions from single-finger analysis.

Comparison of chickpea rhizobia isolates from diverse Portuguese natural populations based on symbiotic effectiveness and DNA fingerprint.

Science.gov (United States)

Laranjo, M; Branco, C; Soares, R; Alho, L; Carvalho, M D E; Oliveira, S

2002-01-01

To test the hypothesis that differences in chickpea yields obtained in four distinct Portuguese regions (Beja, Elvas-Casas Velhas, Elvas-Estação Nacional de Melhoramento de Plantas (ENMP) and Evora) could be due to variation between the natural rhizobia populations. Estimation of the size of the different rhizobial populations showed that Elvas-ENMP population was the largest one. Elvas-ENMP population also revealed a higher proportion of isolates carrying more than one plasmid. Assessment of genetic diversity of the native rhizobia populations by a DNA fingerprinting PCR method, here designated as DAPD (Direct Amplified Polymorphic DNA), showed a higher degree of variation in Elvas-ENMP and Beja populations. The symbiotic effectiveness (SE) of 39 isolates was determined and ranged 13-34%. Statistical analysis showed that SE was negatively correlated with plasmid number of the isolate. The largest indigenous rhizobia population was found in Elvas-ENMP. DAPD pattern and plasmid profile analysis both suggested a higher genetic diversity among the populations of Elvas-ENMP and Beja. No relationship was found between SE of the isolates and their origin site. The large native population, rather than the symbiotic performance of individual rhizobia, could contribute to the higher chickpea yields obtained in Elvas-ENMP.

DNA supercoiling: changes during cellular differentiation and activation of chromatin transcription

International Nuclear Information System (INIS)

Luchnik, A.N.; Bakayev, V.V.; Glaser, V.M.; Moscow State Univ., USSR)

1983-01-01

In this paper it is reported that elastic DNA torsional tension has been observed in a fraction of isolated SV40 minichromosomes, which are shown to be transcriptionally active, and that the number of DNA topological (titratable superhelical) turns in closed superhelical loops of nuclear DNA decreases during cellular differentiation, which, we propose, may be responsible for the coordinate switch in transcription of genes controlling cellular proliferation. 37 references, 6 figures, 2 tables

Differential DNA methylation patterns define status epilepticus and epileptic tolerance.

Science.gov (United States)

Miller-Delaney, Suzanne F C; Das, Sudipto; Sano, Takanori; Jimenez-Mateos, Eva M; Bryan, Kenneth; Buckley, Patrick G; Stallings, Raymond L; Henshall, David C

2012-02-01

Prolonged seizures (status epilepticus) produce pathophysiological changes in the hippocampus that are associated with large-scale, wide-ranging changes in gene expression. Epileptic tolerance is an endogenous program of cell protection that can be activated in the brain by previous exposure to a non-harmful seizure episode before status epilepticus. A major transcriptional feature of tolerance is gene downregulation. Here, through methylation analysis of 34,143 discrete loci representing all annotated CpG islands and promoter regions in the mouse genome, we report the genome-wide DNA methylation changes in the hippocampus after status epilepticus and epileptic tolerance in adult mice. A total of 321 genes showed altered DNA methylation after status epilepticus alone or status epilepticus that followed seizure preconditioning, with >90% of the promoters of these genes undergoing hypomethylation. These profiles included genes not previously associated with epilepsy, such as the polycomb gene Phc2. Differential methylation events generally occurred throughout the genome without bias for a particular chromosomal region, with the exception of a small region of chromosome 4, which was significantly overrepresented with genes hypomethylated after status epilepticus. Surprisingly, only few genes displayed differential hypermethylation in epileptic tolerance. Nevertheless, gene ontology analysis emphasized the majority of differential methylation events between the groups occurred in genes associated with nuclear functions, such as DNA binding and transcriptional regulation. The present study reports select, genome-wide DNA methylation changes after status epilepticus and in epileptic tolerance, which may contribute to regulating the gene expression environment of the seizure-damaged hippocampus.

Chemical fingerprinting of hydrocarbon-contamination in soil

DEFF Research Database (Denmark)

Boll, Esther Sørensen; Nejrup, Jens; Jensen, Julie K.

2015-01-01

Chemical fingerprinting analyses of 29 hydrocarbon-contaminated soils were performed to assess the soil quality and determine the main contaminant sources. The results were compared to an assessment based on concentrations of the 16 priority polycyclic aromatic hydrocarbons pointed out by the U...... and in assessing weathering trends of hydrocarbon contamination in the soils. Multivariate data analysis of sum-normalized concentrations could as a stand-alone tool distinguish between hydrocarbon sources of petrogenic and pyrogenic origin, differentiate within petrogenic sources, and detect weathering trends....... Diagnostic ratios of PACs were not successful for source identification of the heavily weathered hydrocarbon sources in the soils. The fingerprinting of contaminated soils revealed an underestimation of PACs in petrogenic contaminated soils when the assessment was based solely on EPAPAH16. As alkyl...

Reference Device-Assisted Adaptive Location Fingerprinting

Directory of Open Access Journals (Sweden)

Dongjin Wu

2016-06-01

Full Text Available Location fingerprinting suffers in dynamic environments and needs recalibration from time to time to maintain system performance. This paper proposes an adaptive approach for location fingerprinting. Based on real-time received signal strength indicator (RSSI samples measured by a group of reference devices, the approach applies a modified Universal Kriging (UK interpolant to estimate adaptive temporal and environmental radio maps. The modified UK can take the spatial distribution characteristics of RSSI into account. In addition, the issue of device heterogeneity caused by multiple reference devices is further addressed. To compensate the measuring differences of heterogeneous reference devices, differential RSSI metric is employed. Extensive experiments were conducted in an indoor field and the results demonstrate that the proposed approach not only adapts to dynamic environments and the situation of changing APs’ positions, but it is also robust toward measuring differences of heterogeneous reference devices.

DNA restriction fragment length polymorphism analysis of Mycobacterium tuberculosis isolates from HIV-seropositive and HIV-seronegative patients in Kampala, Uganda

Directory of Open Access Journals (Sweden)

Katabazi Fred A

2009-02-01

Full Text Available Abstract Background The identification and differentiation of strains of Mycobacterium tuberculosis by DNA fingerprinting has provided a better understanding of the epidemiology and tracing the transmission of tuberculosis. We set out to determine if there was a relationship between the risk of belonging to a group of tuberculosis patients with identical mycobacterial DNA fingerprint patterns and the HIV sero-status of the individuals in a high TB incidence peri-urban setting of Kampala, Uganda. Methods One hundred eighty three isolates of Mycobacterium tuberculosis from 80 HIV seropositive and 103 HIV seronegative patients were fingerprinted by standard IS6110-RFLP. Using the BioNumerics software, strains were considered to be clustered if at least one other patient had an isolate with identical RFLP pattern. Results One hundred and eighteen different fingerprint patterns were obtained from the 183 isolates. There were 34 clusters containing 54% (99/183 of the patients (average cluster size of 2.9, and a majority (96.2% of the strains possessed a high copy number (≥ 5 copies of the IS6110 element. When strains with P = 0.615, patients aged P = 0.100, and sex (aOR 1.12, 95%CI 0.60–2.06, P = 0.715. Conclusion The sample showed evidence of a high prevalence of recent transmission with a high average cluster size, but infection with an isolate with a fingerprint found to be part of a cluster was not associated with any demographic or clinical characteristics, including HIV status.

iPBS: a universal method for DNA fingerprinting and retrotransposon isolation.

Science.gov (United States)

Kalendar, Ruslan; Antonius, Kristiina; Smýkal, Petr; Schulman, Alan H

2010-11-01

Molecular markers are essential in plant and animal breeding and biodiversity applications, in human forensics, and for map-based cloning of genes. The long terminal repeat (LTR) retrotransposons are well suited as molecular markers. As dispersed and ubiquitous transposable elements, their "copy and paste" life cycle of replicative transposition leads to new genome insertions without excision of the original element. Both the overall structure of retrotransposons and the domains responsible for the various phases of their replication are highly conserved in all eukaryotes. Nevertheless, up to a year has been required to develop a retrotransposon marker system in a new species, involving cloning and sequencing steps as well as the development of custom primers. Here, we describe a novel PCR-based method useful both as a marker system in its own right and for the rapid isolation of retrotransposon termini and full-length elements, making it ideal for "orphan crops" and other species with underdeveloped marker systems. The method, iPBS amplification, is based on the virtually universal presence of a tRNA complement as a reverse transcriptase primer binding site (PBS) in LTR retrotransposons. The method differs from earlier retrotransposon isolation methods because it is applicable not only to endogenous retroviruses and retroviruses, but also to both Gypsy and Copia LTR retrotransposons, as well as to non-autonomous LARD and TRIM elements, throughout the plant kingdom and to animals. Furthermore, the inter-PBS amplification technique as such has proved to be a powerful DNA fingerprinting technology without the need for prior sequence knowledge.

Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

Science.gov (United States)

Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

2017-11-16

 Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

Photogrammetric fingerprint unwrapping

Science.gov (United States)

Paar, Gerhard; del Pilar Caballo Perucha, Maria; Bauer, Arnold; Nauschnegg, Bernhard

2008-04-01

Fingerprints are important biometric cues. Compared to conventional fingerprint sensors the use of contact-free stereoscopic image acquisition of the front-most finger segment has a set of advantages: Finger deformation is avoided, the entire relevant area for biometric use is covered, some technical aspects like sensor maintenance and cleaning are facilitated, and access to a three-dimensional reconstruction of the covered area is possible. We describe a photogrammetric workflow for nail-to-nail fingerprint reconstruction: A calibrated sensor setup with typically 5 cameras and dedicated illumination acquires adjacent stereo pairs. Using the silhouettes of the segmented finger a raw cylindrical model is generated. After preprocessing (shading correction, dust removal, lens distortion correction), each individual camera texture is projected onto the model. Image-to-image matching on these pseudo ortho images and dense 3D reconstruction obtains a textured cylindrical digital surface model with radial distances around the major axis and a grid size in the range of 25-50 µm. The model allows for objective fingerprint unwrapping and novel fingerprint matching algorithms since 3D relations between fingerprint features are available as additional cues. Moreover, covering the entire region with relevant fingerprint texture is particularly important for establishing a comprehensive forensic database. The workflow has been implemented in portable C and is ready for industrial exploitation. Further improvement issues are code optimization, unwrapping method, illumination strategy to avoid highlights and to improve the initial segmentation, and the comparison of the unwrapping result to conventional fingerprint acquisition technology.

D1/D2 domain of large-subunit ribosomal DNA for differentiation of Orpinomyces spp.

Science.gov (United States)

Dagar, Sumit S; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K

2011-09-01

This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation.

Physics and fingerprints

Science.gov (United States)

Voss-de Haan, Patrick

2006-08-01

This article discusses a variety of aspects in the detection and development of fingerprints and the physics involved in it. It gives an introduction to some basic issues like composition and properties of fingerprint deposits and a rudimentary framework of dactyloscopy; it covers various techniques for the visualization of latent fingerprints; and it concludes with a view of current research topics. The techniques range from very common procedures, such as powdering and cyanoacrylate fuming, to more demanding methods, for example luminescence and vacuum metal deposition, to fairly unusual approaches like autoradiography. The emphasis is placed on the physical rather than the forensic aspects of these topics while trying to give the physicist—who is not dealing with fingerprinting and forensic science on a daily basis—a feeling for the problems and solutions in the visualization of latent fingerprints.

Gabor filter based fingerprint image enhancement

Science.gov (United States)

Wang, Jin-Xiang

2013-03-01

Fingerprint recognition technology has become the most reliable biometric technology due to its uniqueness and invariance, which has been most convenient and most reliable technique for personal authentication. The development of Automated Fingerprint Identification System is an urgent need for modern information security. Meanwhile, fingerprint preprocessing algorithm of fingerprint recognition technology has played an important part in Automatic Fingerprint Identification System. This article introduces the general steps in the fingerprint recognition technology, namely the image input, preprocessing, feature recognition, and fingerprint image enhancement. As the key to fingerprint identification technology, fingerprint image enhancement affects the accuracy of the system. It focuses on the characteristics of the fingerprint image, Gabor filters algorithm for fingerprint image enhancement, the theoretical basis of Gabor filters, and demonstration of the filter. The enhancement algorithm for fingerprint image is in the windows XP platform with matlab.65 as a development tool for the demonstration. The result shows that the Gabor filter is effective in fingerprint image enhancement technology.

Mitochondrial DNA differentiates Alzheimer's disease from Creutzfeldt-Jakob disease.

Science.gov (United States)

Podlesniy, Petar; Llorens, Franc; Golanska, Ewa; Sikorska, Beata; Liberski, Pawel; Zerr, Inga; Trullas, Ramon

2016-05-01

Low content of cell-free mitochondrial DNA (mtDNA) in cerebrospinal fluid (CSF) is a biomarker of early stage Alzheimer's disease (AD), but whether mtDNA is altered in a rapid neurodegenerative dementia such as Creutzfeldt-Jakob disease is unknown. CSF mtDNA was measured using digital polymerase chain reaction (dPCR) in two independent cohorts comprising a total of 112 patients diagnosed with sporadic Creutzfeldt-Jakob disease (sCJD), probable AD, or non-Alzheimer's type dementia. Patients with AD exhibit low mtDNA content in CSF compared with patients diagnosed with sCJD or with non-Alzheimer's type dementias. The CSF concentration of mtDNA does not correlate with Aβ, t-tau, p-tau, and 14-3-3 protein levels in CSF. Low-CSF mtDNA is not a consequence of brain damage and allows the differential diagnosis of AD from sCJD and other dementias. These results support the hypothesis that mtDNA in CSF is a pathophysiological biomarker of AD. Copyright © 2015 Alzheimer's Association. Published by Elsevier Inc. All rights reserved.

DNA methyltransferase inhibitor CDA-II inhibits myogenic differentiation

International Nuclear Information System (INIS)

Chen, Zirong; Jin, Guorong; Lin, Shuibin; Lin, Xiumei; Gu, Yumei; Zhu, Yujuan; Hu, Chengbin; Zhang, Qingjiong; Wu, Lizi; Shen, Huangxuan

2012-01-01

Highlights: ► CDA-II inhibits myogenic differentiation in a dose-dependent manner. ► CDA-II repressed expression of muscle transcription factors and structural proteins. ► CDA-II inhibited proliferation and migration of C2C12 myoblasts. -- Abstract: CDA-II (cell differentiation agent II), isolated from healthy human urine, is a DNA methyltransferase inhibitor. Previous studies indicated that CDA-II played important roles in the regulation of cell growth and certain differentiation processes. However, it has not been determined whether CDA-II affects skeletal myogenesis. In this study, we investigated effects of CDA-II treatment on skeletal muscle progenitor cell differentiation, migration and proliferation. We found that CDA-II blocked differentiation of murine myoblasts C2C12 in a dose-dependent manner. CDA-II repressed expression of muscle transcription factors, such as Myogenin and Mef2c, and structural proteins, such as myosin heavy chain (Myh3), light chain (Mylpf) and MCK. Moreover, CDA-II inhibited C1C12 cell migration and proliferation. Thus, our data provide the first evidence that CDA-II inhibits growth and differentiation of muscle progenitor cells, suggesting that the use of CDA-II might affect skeletal muscle functions.

Fingerprints in cancer cells

International Nuclear Information System (INIS)

Servomaa, K.

1994-01-01

Gene research has shown that factors causing cancer, or carcinogens, may leave marks typical of each particular carcinogen (fingerprints) in the genotype of the cell. Radiation, for instance, may leave such fingerprints in a cancer cell. In particular, the discovery of a gene called p53 has yielded much new information on fingerprints. It has been discovered, for example, that toxic fungus and UV-radiation each leave fingerprints in the p53 gene. Based on the detection of fingerprints, it may be possible in the future to tell a cancer patient what factor had trigged the maglinancy

Differentiation of Herba Cistanches by fingerprint with high-performance liquid chromatography-diode array detection-mass spectrometry.

Science.gov (United States)

Jiang, Y; Li, S P; Wang, Y T; Chen, X J; Tu, P F

2009-03-13

Herba Cistanche (Rou Cong Rong in Chinese), dried succulent stems of Cistanche deserticola or C. tubulosa, is a famous Chinese herbal medicine and has been recorded in the Chinese Pharmacopoeia. In recent years, another two non-official species, C. salsa and C. sinensis have also been used as Herba Cistanche in some regions of China. To investigate the possibility of using these two non-official species as alternatives to the official species, a high-performance liquid chromatography-diode array detection-mass spectrometry (HPLC-DAD-MS) fingerprint method was developed to comparatively analyze the crude herbs of these four species. The fingerprint of C. deserticola, a historically certified species of Herba Cistanche, serves as 'standard pattern' for comparing the similarities with the other species by means of similarity and Principle Component Analysis. Additionally, 18 characteristic peaks in the fingerprints were identified by comparing their retention times, UV spectra and ESI-MS data with those of the reference substances and/or the data in the literatures. The comparative results demonstrate that the fingerprints of C. tubulosa and C. salsa possess high similarity to the standard pattern, suggesting that these two species may be used as alternative species; while that of C. sinensis has low similarity (0.053 correlation coefficient) to the standard pattern, indicating that it cannot be used as the substitute of the official herb. However, the varying fingerprint patterns among the samples of C. deserticola collected from various habitats illustrate that the quality consistency of crude herbs is still a problem worthy of serious concern.

A DNA microarray-based methylation-sensitive (MS)-AFLP hybridization method for genetic and epigenetic analyses.

Science.gov (United States)

Yamamoto, F; Yamamoto, M

2004-07-01

We previously developed a PCR-based DNA fingerprinting technique named the Methylation Sensitive (MS)-AFLP method, which permits comparative genome-wide scanning of methylation status with a manageable number of fingerprinting experiments. The technique uses the methylation sensitive restriction enzyme NotI in the context of the existing Amplified Fragment Length Polymorphism (AFLP) method. Here we report the successful conversion of this gel electrophoresis-based DNA fingerprinting technique into a DNA microarray hybridization technique (DNA Microarray MS-AFLP). By performing a total of 30 (15 x 2 reciprocal labeling) DNA Microarray MS-AFLP hybridization experiments on genomic DNA from two breast and three prostate cancer cell lines in all pairwise combinations, and Southern hybridization experiments using more than 100 different probes, we have demonstrated that the DNA Microarray MS-AFLP is a reliable method for genetic and epigenetic analyses. No statistically significant differences were observed in the number of differences between the breast-prostate hybridization experiments and the breast-breast or prostate-prostate comparisons.

DNA fingerprinting sets for four southern pines

Science.gov (United States)

Craig Echt; Sedley Josserand

2018-01-01

DNA markers can provide valuable genetic information for forest tree research, breeding, conservation, and restoration programs. When properly evaluated, selected sets of DNA markers can be used to efficiently get information about genetic diversity in regions, forests, or stands, or in seed lots and orchards. Selected markers also can be used to determine parentage or...

Clonality Analysis of Helicobacter pylori in Patients Isolated from Several Biopsy Specimens and Gastric Juice in a Japanese Urban Population by Random Amplified Polymorphic DNA Fingerprinting

Directory of Open Access Journals (Sweden)

Nariaki Toita

2013-01-01

Full Text Available Background. The number of Helicobacter pylori clones infecting a single host has been discussed in numerous reports. The number has been suggested to vary depending on the regions in the world. Aim. The purpose of this study was to examine the number of clones infecting a single host in a Japanese urban population. Materials and Methods. Thirty-one Japanese patients undergoing upper gastrointestinal endoscopy were enrolled in this study. H. pylori isolates (total 104 strains were obtained from biopsy specimens (antrum, corpus, and duodenum and gastric juice. Clonal diversity was examined by the random amplified polymorphic DNA (RAPD fingerprinting method. Results. The RAPD fingerprinting patterns of isolates from each patient were identical or very similar. And the isolates obtained from several patients with 5- to 9-year intervals showed identical or very similar RAPD patterns. Conclusion. Each Japanese individual of an urban population is predominantly infected with a single H. pylori clone.

Wine fingerprinting using a bio-geochemical approach

Directory of Open Access Journals (Sweden)

Fernandes José Ramiro

2015-01-01

Full Text Available The wine sector is a billion euro business and therefore subjected to multiple attempts of fraudulent practices. This requires the development of rapid and reliable methods to detect such situations. Several methodologies have been developed based on the chemical profiles of the wines, but they are limited due to the environmental conditions that cannot be controlled. The use of DNA-based detection systems are an emergent research field that have been extended to a wide variety of food prod- ucts and are still the most reliable methods for varietal identification. However these methods are not suitable for geographical determination. Soil related fingerprints have a primary role considering that there is a relationship between the elemental compo- sition of wine and the composition of the provenance soil. WineBioCode is a project aiming to define the best strategy for wine authenticity based on a multidisciplinary approach. Two DNA-based strategies have been developed based on Real-time PCR and a label free optical biosensor platform. Both platforms enabled successful identification of specific DNA-targets when applied to Vitis vinifera L., and can be applied throughout the grape-wine chain. The methods are complementary and can be used in dif- ferent situations, according to the requirements. The geographical evaluation has been assessed by the strontium 87Sr/86Sr isotope ratio determination involving soil evaluation in the vineyards followed by its assay in the wine samples. The results are being integrated in order to establish the best procedure to be undertaken for wine fingerprinting, including varietal composition and geographical origin, therefore fulfilling the requirements of the geographical denominations in wine certification.

Genome-wide signatures of differential DNA methylation in pediatric acute lymphoblastic leukemia

DEFF Research Database (Denmark)

Nordlund, Jessica; Bäcklin, Christofer L; Wahlberg, Per

2013-01-01

BACKGROUND: Although aberrant DNA methylation has been observed previously in acute lymphoblastic leukemia (ALL), the patterns of differential methylation have not been comprehensively determined in all subtypes of ALL on a genome-wide scale. The relationship between DNA methylation, cytogenetic...... background, drug resistance and relapse in ALL is poorly understood. RESULTS: We surveyed the DNA methylation levels of 435,941 CpG sites in samples from 764 children at diagnosis of ALL and from 27 children at relapse. This survey uncovered four characteristic methylation signatures. First, compared...... cells at relapse, compared with matched samples at diagnosis. Analysis of relapse-free survival identified CpG sites with subtype-specific differential methylation that divided the patients into different risk groups, depending on their methylation status. CONCLUSIONS: Our results suggest an important...

Development of taxon-specific sequence characterized amplified region (SCAR) markers based on actin sequences and DNA amplification fingerprinting (DAF): a case study in the Phoma exigua species complex.

Science.gov (United States)

Aveskamp, Maikel M; Woudenberg, Joyce H C; de Gruyter, Johannes; Turco, Elena; Groenewald, Johannes Z; Crous, Pedro W

2009-05-01

Phoma exigua is considered to be an assemblage of at least nine varieties that are mainly distinguished on the basis of host specificity and pathogenicity. However, these varieties are also reported to be weak pathogens and secondary invaders on non-host tissue. In practice, it is difficult to distinguish P. exigua from its close relatives and to correctly identify isolates up to the variety level, because of their low genetic variation and high morphological similarity. Because of quarantine issues and phytosanitary measures, a robust DNA-based tool is required for accurate and rapid identification of the separate taxa in this species complex. The present study therefore aims to develop such a tool based on unique nucleotide sequence identifiers. More than 60 strains of P. exigua and related species were compared in terms of partial actin gene sequences, or analysed using DNA amplification fingerprinting (DAF) with short, arbitrary, mini-hairpin primers. Fragments in the fingerprint unique to a single taxon were identified, purified and sequenced. Alignment of the sequence data and subsequent primer trials led to the identification of taxon-specific sequence characterized amplified regions (SCARs), and to a set of specific oligonucleotide combinations that can be used to identify these organisms in plant quarantine inspections.

Genetic variations of Lansium domesticum Corr. accessions from Java, Sumatra and Ceram based on Random Amplified Polymorphic DNA fingerprints

Directory of Open Access Journals (Sweden)

KUSUMADEWI SRI YULITA

2011-07-01

Full Text Available Yulita KS (2011 Genetic variations of Lansium domesticum Corr. accessions from Java, Bengkulu and Ceram based on Random Amplified Polymorphic DNA fingerprints. Biodiversitas 12: 125-130. Duku (Lansium domesticum Corr. is one of popular tropical fruits in SE Asia. The spesies has three varieties, known as duku, langsat and kokosan; and duku is the most popular one for being the sweetiest fruit. Indonesia has several local varieties of duku, such as duku Condet, duku Sumber and duku Palembang. This present study aimed to assess genetic diversity of 47 accessions of duku from Java, Sumatra, and Ceram based on RAPD fingerprints. Ten RAPD’s primers were initially screened and five were selected for the analysis. These five primers (OPA 7, 13, 18, OPB 7, and OPN 12 generated 53 scorable bands with an average of 10.6 polymorphic fragment per primer. Percentage of polymorphism ranged from 16.89% (OPA 7 and OPN 12 to 24.54% (OPB 7 with an average of 20.16% polymorphism. OPB 7 at 450 bp was exclusively possessed by accession 20 (Java, OPA 18 at 500 bp was by accession 6 (Java, 550 bp by 3 clones from Bengkulu. While OPN 12 at 300 bp and OPA 13 at 450 bp were shared among the accessions. Clustering analysis was performed based on RAPD profiles using the UPGMA method. The range of genetic similarity value among accessions was 0.02-0.65 suggesting high variation of gene pool existed among accessions.

DNA-damage-induced differentiation of leukaemic cells as an anti-cancer barrier.

Science.gov (United States)

Santos, Margarida A; Faryabi, Robert B; Ergen, Aysegul V; Day, Amanda M; Malhowski, Amy; Canela, Andres; Onozawa, Masahiro; Lee, Ji-Eun; Callen, Elsa; Gutierrez-Martinez, Paula; Chen, Hua-Tang; Wong, Nancy; Finkel, Nadia; Deshpande, Aniruddha; Sharrow, Susan; Rossi, Derrick J; Ito, Keisuke; Ge, Kai; Aplan, Peter D; Armstrong, Scott A; Nussenzweig, André

2014-10-02

Self-renewal is the hallmark feature both of normal stem cells and cancer stem cells. Since the regenerative capacity of normal haematopoietic stem cells is limited by the accumulation of reactive oxygen species and DNA double-strand breaks, we speculated that DNA damage might also constrain leukaemic self-renewal and malignant haematopoiesis. Here we show that the histone methyl-transferase MLL4, a suppressor of B-cell lymphoma, is required for stem-cell activity and an aggressive form of acute myeloid leukaemia harbouring the MLL-AF9 oncogene. Deletion of MLL4 enhances myelopoiesis and myeloid differentiation of leukaemic blasts, which protects mice from death related to acute myeloid leukaemia. MLL4 exerts its function by regulating transcriptional programs associated with the antioxidant response. Addition of reactive oxygen species scavengers or ectopic expression of FOXO3 protects MLL4(-/-) MLL-AF9 cells from DNA damage and inhibits myeloid maturation. Similar to MLL4 deficiency, loss of ATM or BRCA1 sensitizes transformed cells to differentiation, suggesting that myeloid differentiation is promoted by loss of genome integrity. Indeed, we show that restriction-enzyme-induced double-strand breaks are sufficient to induce differentiation of MLL-AF9 blasts, which requires cyclin-dependent kinase inhibitor p21(Cip1) (Cdkn1a) activity. In summary, we have uncovered an unexpected tumour-promoting role of genome guardians in enforcing the oncogene-induced differentiation blockade in acute myeloid leukaemia.

Genetic polymorphism of Malassezia furfur isolates from Han and Tibetan ethnic groups in China using DNA fingerprinting.

Science.gov (United States)

Zhang, Hao; Zhang, Ruifeng; Ran, Yuping; Dai, Yaling; Lu, Yao; Wang, Peng

2010-12-01

Reported isolation rates of Malassezia yeast from human skin show geographic variations. In China, the populations of the Han (1,182.95 million) and Tibetan (5.41 million) ethnic groups are distributed over 9.6 and 3.27 million square kilometers respectively, making biodiversity research feasible and convenient. Malassezia furfur clinical strains (n = 29) isolated from different individuals, with or without associated dermatoses, of these two ethnic groups (15 Han and 12 Tibetan) were identified and analyzed with DNA fingerprinting using single primers specific to minisatellites. Using the Bionumerics software, we found that almost all M. furfur clinical isolates and type strains formed five distinct group clusters according to their associated skin diseases and the ethnic groups of the patients. These findings are the first to focus on the genetic diversity and relatedness of M. furfur in the Tibetan and Han ethnic groups in China and reveal genetic variation associated with related diseases, host ethnicity and geographic origin.

Bacterial identification and subtyping using DNA microarray and DNA sequencing.

Science.gov (United States)

Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D

2012-01-01

The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.

Characterization of rat lines with normotensive and hypertensive status using genomic fingerprinting

NARCIS (Netherlands)

Adarichev, V A; Korokhov, N P; Ostapchuk, Ia V; Dymshits, G M; Markel', A L; Ostaptchouk, Jana

1996-01-01

The properties of normotensive and hypertensive rat lines were investigated by the DNA fingerprinting method using a multilocus micro-satellite (CAC)5 probe. The HaeIII and HinfI restriction endonucleases were found to be the most informative enzymes in this case. The high genetic homogeneity of the

Genetic signatures from amplification profiles characterize DNA mutation in somatic and radiation-induced sports of chrysanthemum

International Nuclear Information System (INIS)

Trigiano, R.N.; Scott, M.C.; Caetano-Anolles, G.

1998-01-01

The chrysanthemum (Dendranthema grandiflora Tzvelev.) cultivars 'Dark Charm', 'Salmon Charm', 'Coral Charm' and 'Dark Bronze Charm' are either radiation-induced mutants or spontaneous sports of 'Charm' and constitute a family or series of plants that primarily differ in flower color. These cultivars, which were difficult to differentiate genetically by DNA amplification fingerprinting (DAF), were easily identified by using arbitrary signatures from amplification profiles (ASAP). Genomic DNA was first amplified with three standard octamer arbitrary primers, all of which produced monomorphic profiles. Products from each of these DNA fingerprints were subsequently reamplified using four minihairpin decamer primers. The 12 primer combinations produced signatures containing approximately 37% polymorphic character loci, which were used to estimate genetic relationships between cultivars. Forty-six (32%) unique amplification products were associated with individual cultivars. The number of ASAP polymorphisms detected provided an estimate of the mutation rate in the mutant cultivars, ranging from 0.03% to 1.6% of nucleotide changes within an average of 18 kb of arbitrary amplified DAF sequence. The ASAP technique permits the clear genetic identification of somatic mutants and radiation-induced sports that are genetically highly homogeneous and should facilitate marker assisted breeding and protection of plant breeders rights of varieties or cultivars

D1/D2 Domain of Large-Subunit Ribosomal DNA for Differentiation of Orpinomyces spp.▿

Science.gov (United States)

Dagar, Sumit S.; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K.

2011-01-01

This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation. PMID:21784906

Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

Science.gov (United States)

Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

2015-09-01

Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

Differential DNA Methylation Analysis without a Reference Genome

Directory of Open Access Journals (Sweden)

Johanna Klughammer

2015-12-01

Full Text Available Genome-wide DNA methylation mapping uncovers epigenetic changes associated with animal development, environmental adaptation, and species evolution. To address the lack of high-throughput methods for DNA methylation analysis in non-model organisms, we developed an integrated approach for studying DNA methylation differences independent of a reference genome. Experimentally, our method relies on an optimized 96-well protocol for reduced representation bisulfite sequencing (RRBS, which we have validated in nine species (human, mouse, rat, cow, dog, chicken, carp, sea bass, and zebrafish. Bioinformatically, we developed the RefFreeDMA software to deduce ad hoc genomes directly from RRBS reads and to pinpoint differentially methylated regions between samples or groups of individuals (http://RefFreeDMA.computational-epigenetics.org. The identified regions are interpreted using motif enrichment analysis and/or cross-mapping to annotated genomes. We validated our method by reference-free analysis of cell-type-specific DNA methylation in the blood of human, cow, and carp. In summary, we present a cost-effective method for epigenome analysis in ecology and evolution, which enables epigenome-wide association studies in natural populations and species without a reference genome.

Fingerprint analysis of polysaccharides from different Ganoderma by HPLC combined with chemometrics methods.

Science.gov (United States)

Sun, Xiaomei; Wang, Haohao; Han, Xiaofeng; Chen, Shangwei; Zhu, Song; Dai, Jun

2014-12-19

A fingerprint analysis method has been developed for characterization and discrimination of polysaccharides from different Ganoderma by high performance liquid chromatography (HPLC) coupled with chemometrics means. The polysaccharides were extracted under ultrasonic-assisted condition, and then partly hydrolyzed with trifluoroacetic acid. Monosaccharides and oligosaccharides in the hydrolyzates were subjected to pre-column derivatization with 1-phenyl-3-methyl-5-pyrazolone and HPLC analysis, which will generate unique fingerprint information related to chemical composition and structure of polysaccharides. The peak data were imported to professional software in order to obtain standard fingerprint profiles and evaluate similarity of different samples. Meanwhile, the data were further processed by hierarchical cluster analysis and principal component analysis. Polysaccharides from different parts or species of Ganoderma or polysaccharides from the same parts of Ganoderma but from different geographical regions or different strains could be differentiated clearly. This fingerprint analysis method can be applied to identification and quality control of different Ganoderma and their products. Copyright © 2014 Elsevier Ltd. All rights reserved.

DNA stable-isotope probing (DNA-SIP).

Science.gov (United States)

Dunford, Eric A; Neufeld, Josh D

2010-08-02

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and nutrients into cellular biomass. As such, this cultivation-independent technique has been an important methodology for assigning metabolic function to the diverse communities inhabiting a wide range of terrestrial and aquatic environments. Following the incubation of an environmental sample with stable-isotope labelled compounds, extracted nucleic acid is subjected to density gradient ultracentrifugation and subsequent gradient fractionation to separate nucleic acids of differing densities. Purification of DNA from cesium chloride retrieves labelled and unlabelled DNA for subsequent molecular characterization (e.g. fingerprinting, microarrays, clone libraries, metagenomics). This JoVE video protocol provides visual step-by-step explanations of the protocol for density gradient ultracentrifugation, gradient fractionation and recovery of labelled DNA. The protocol also includes sample SIP data and highlights important tips and cautions that must be considered to ensure a successful DNA-SIP analysis.

Development of an efficient retrotransposon-based fingerprinting method for rapid pea variety identification.

Science.gov (United States)

Smýkal, Petr

2006-01-01

Fast and efficient DNA fingerprinting of crop cultivars and individuals is frequently used in both theoretical population genetics and in practical breeding. Numerous DNA marker technologies exist and the ratio of speed, cost and accuracy are of importance. Therefore even in species where highly accurate and polymorphic marker systems are available, such as microsatellite SSR (simple sequence repeats), also alternative methods may be of interest. Thanks to their high abundance and ubiquity, temporary mobile retrotransposable elements come into recent focus. Their properties, such as genome wide distribution and well-defined origin of individual insertions by descent, predetermine them for use as molecular markers. In this study, several Ty3-gypsy type retrotransposons have been developed and adopted for the inter-retrotransposon amplified polymorphism (IRAP) method, which is suitable for fast and efficient pea cultivar fingerprinting. The method can easily distinguish even between genetically closely related pea cultivars and provide high polymorphic information content (PIC) in a single PCR analysis.

Dealing with Insufficient Location Fingerprints in Wi-Fi Based Indoor Location Fingerprinting

Directory of Open Access Journals (Sweden)

Kai Dong

2017-01-01

Full Text Available The development of the Internet of Things has accelerated research in the indoor location fingerprinting technique, which provides value-added localization services for existing WLAN infrastructures without the need for any specialized hardware. The deployment of a fingerprinting based localization system requires an extremely large amount of measurements on received signal strength information to generate a location fingerprint database. Nonetheless, this requirement can rarely be satisfied in most indoor environments. In this paper, we target one but common situation when the collected measurements on received signal strength information are insufficient, and show limitations of existing location fingerprinting methods in dealing with inadequate location fingerprints. We also introduce a novel method to reduce noise in measuring the received signal strength based on the maximum likelihood estimation, and compute locations from inadequate location fingerprints by using the stochastic gradient descent algorithm. Our experiment results show that our proposed method can achieve better localization performance even when only a small quantity of RSS measurements is available. Especially when the number of observations at each location is small, our proposed method has evident superiority in localization accuracy.

DNA Fingerprinting Abnormalities Can Distinguish Ulcerative Colitis Patients with Dysplasia and Cancer from Those Who Are Dysplasia/Cancer-Free

Science.gov (United States)

Chen, Ru; Rabinovitch, Peter S.; Crispin, David A.; Emond, Mary J.; Koprowicz, Kent M.; Bronner, Mary P.; Brentnall, Teresa A.

2003-01-01

Patients with extensive ulcerative colitis (UC) of longer than 8 years duration are at high risk for the development of colorectal cancer. The cancers in these patients appear to develop in a stepwise manner with progressive histological changes from negative for dysplasia → indefinite for dysplasia → dysplasia → cancer. The aim of this study was to determine the timing and extent of genomic instability in the progression of UC dysplasia and cancer. Using two polymerase chain reaction (PCR)-based DNA fingerprinting methods, arbitrarily primed PCR and intersimple sequence repeat PCR, we assessed DNA sequence variation in biopsies across the spectrum of cancerous, dysplastic, and nondysplastic mucosa. UC patients with dysplasia/cancer had substantial genomic instability in both their dysplastic and nondysplastic colonic mucosa, whereas instability was not present in the majority of UC patients without dysplasia/cancer. The degree of instability in nondysplastic tissue was similar to that of dysplastic/cancerous mucosa from the same patient, suggesting that this instability was widespread and reached the maximum level early in neoplastic progression. These results suggest that UC patients who develop dysplasia or cancer have an underlying process of genomic instability in their colonic mucosa whereas UC patients who are dysplasia-free do not. PMID:12547724

DNA fingerprinting for the authentication of Ruta graveolens

African Journals Online (AJOL)

Jane

2011-08-15

Aug 15, 2011 ... In this study, random amplified polymorphic DNA (RAPD) was employed to ... samples using the DNA isolated from the dried leaf, seed and stem of both samples. ..... opposite strands and is complementary to the primer for.

Fingerprint Change: Not Visible, But Tangible.

Science.gov (United States)

Negri, Francesca V; De Giorgi, Annamaria; Bozzetti, Cecilia; Squadrilli, Anna; Petronini, Pier Giorgio; Leonardi, Francesco; Bisogno, Luigi; Garofano, Luciano

2017-09-01

Hand-foot syndrome, a chemotherapy-induced cutaneous toxicity, can cause an alteration in fingerprints causing a setback for cancer patients due to the occurrence of false rejections. A colon cancer patient was fingerprinted after not having been able to use fingerprint recognition devices after 6 months of adjuvant chemotherapy. The fingerprint images were digitally processed to improve fingerprint definition without altering the papillary design. No evidence of skin toxicity was present. Two months later, the situation returned to normal. The fingerprint evaluation conducted on 15 identification points highlighted the quantitative and qualitative fingerprint alteration details detected after the end of chemotherapy and 2 months later. Fingerprint alteration during chemotherapy has been reported, but to our knowledge, this particular case is the first ever reported without evident clinical signs. Alternative fingerprint identification methods as well as improved biometric identification systems are needed in case of unexpected situations. © 2017 American Academy of Forensic Sciences.

DNA polymorphisms revealed by the RAPD technique show differences between radionuclide-contaminated and uncontaminated mosquitofish populations

International Nuclear Information System (INIS)

Theodorakis, C.W.; Shugart, L.R.

1993-01-01

In 1977, approximately 250 Mosquitofish (Gambusia affines) were transplanted from a relatively uncontaminated site into a small pond on the Oak Ridge Reservation that is heavily contaminated with radionuclides. DNA polymorphisms, using the RAPD technique, were examined in order to determine if any genetic differentiation had occurred between the two populations. Also, fish from another radionuclide-contaminated population (White Oak Lake) and two unrelated non-contaminated populations were also examined. The RAPD (Randomly Amplified Polymorphic DNA) technique uses the polymerase chain reaction with a short oligonucleotide primer to produce DNA fragments of various lengths. When analyzed by gel electrophoresis, these fragments form banding patterns similar to DNA fingerprints. A total of 26 primers were used to produce DNA band patterns, many of which revealed population differences. In addition several primers revealed banding patterns which differentiated between the Crystal Springs and Pond 3513 populations. Furthermore, bands found at high frequency in Pond 3513 and White Oak Lake populations were absent or present at a lower frequency in the non-contaminated populations. For some primers, the contaminated populations showed more DNA bands per individual, and fish with more bands had fewer DNA strand breaks than the fish with fewer bands. These data will be discussed with relation to biomonitoring programs and evolution of resistance to genotoxins in natural populations

Use of DNA markers in forest tree improvement research

Science.gov (United States)

D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall

1992-01-01

DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...

Online fingerprint verification.

Science.gov (United States)

Upendra, K; Singh, S; Kumar, V; Verma, H K

2007-01-01

As organizations search for more secure authentication methods for user access, e-commerce, and other security applications, biometrics is gaining increasing attention. With an increasing emphasis on the emerging automatic personal identification applications, fingerprint based identification is becoming more popular. The most widely used fingerprint representation is the minutiae based representation. The main drawback with this representation is that it does not utilize a significant component of the rich discriminatory information available in the fingerprints. Local ridge structures cannot be completely characterized by minutiae. Also, it is difficult quickly to match two fingerprint images containing different number of unregistered minutiae points. In this study filter bank based representation, which eliminates these weakness, is implemented and the overall performance of the developed system is tested. The results have shown that this system can be used effectively for secure online verification applications.

H3K4me1 marks DNA regions hypomethylated during aging in human stem and differentiated cells.

Science.gov (United States)

Fernández, Agustín F; Bayón, Gustavo F; Urdinguio, Rocío G; Toraño, Estela G; García, María G; Carella, Antonella; Petrus-Reurer, Sandra; Ferrero, Cecilia; Martinez-Camblor, Pablo; Cubillo, Isabel; García-Castro, Javier; Delgado-Calle, Jesús; Pérez-Campo, Flor M; Riancho, José A; Bueno, Clara; Menéndez, Pablo; Mentink, Anouk; Mareschi, Katia; Claire, Fabian; Fagnani, Corrado; Medda, Emanuela; Toccaceli, Virgilia; Brescianini, Sonia; Moran, Sebastián; Esteller, Manel; Stolzing, Alexandra; de Boer, Jan; Nisticò, Lorenza; Stazi, Maria A; Fraga, Mario F

2015-01-01

In differentiated cells, aging is associated with hypermethylation of DNA regions enriched in repressive histone post-translational modifications. However, the chromatin marks associated with changes in DNA methylation in adult stem cells during lifetime are still largely unknown. Here, DNA methylation profiling of mesenchymal stem cells (MSCs) obtained from individuals aged 2 to 92 yr identified 18,735 hypermethylated and 45,407 hypomethylated CpG sites associated with aging. As in differentiated cells, hypermethylated sequences were enriched in chromatin repressive marks. Most importantly, hypomethylated CpG sites were strongly enriched in the active chromatin mark H3K4me1 in stem and differentiated cells, suggesting this is a cell type-independent chromatin signature of DNA hypomethylation during aging. Analysis of scedasticity showed that interindividual variability of DNA methylation increased during aging in MSCs and differentiated cells, providing a new avenue for the identification of DNA methylation changes over time. DNA methylation profiling of genetically identical individuals showed that both the tendency of DNA methylation changes and scedasticity depended on nongenetic as well as genetic factors. Our results indicate that the dynamics of DNA methylation during aging depend on a complex mixture of factors that include the DNA sequence, cell type, and chromatin context involved and that, depending on the locus, the changes can be modulated by genetic and/or external factors. © 2015 Fernández et al.; Published by Cold Spring Harbor Laboratory Press.

[Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

Science.gov (United States)

Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

2006-05-01

Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

Flow cytometric fingerprinting for microbial strain discrimination and physiological characterization.

Science.gov (United States)

Buysschaert, Benjamin; Kerckhof, Frederiek-Maarten; Vandamme, Peter; De Baets, Bernard; Boon, Nico

2018-02-01

The analysis of microbial populations is fundamental, not only for developing a deeper understanding of microbial communities but also for their engineering in biotechnological applications. Many methods have been developed to study their characteristics and over the last few decades, molecular analysis tools, such as DNA sequencing, have been used with considerable success to identify the composition of microbial populations. Recently, flow cytometric fingerprinting is emerging as a promising and powerful method to analyze bacterial populations. So far, these methods have primarily been used to observe shifts in the composition of microbial communities of natural samples. In this article, we apply a flow cytometric fingerprinting method to discriminate among 29 Lactobacillus strains. Our results indicate that it is possible to discriminate among 27 Lactobacillus strains by staining with SYBR green I and that the discriminatory power can be increased by combined SYBR green I and propidium iodide staining. Furthermore, we illustrate the impact of physiological changes on the fingerprinting method by demonstrating how flow cytometric fingerprinting is able to discriminate the different growth phases of a microbial culture. The sensitivity of the method is assessed by its ability to detect changes in the relative abundance of a mix of polystyrene beads down to 1.2%. When a mix of bacteria was used, the sensitivity was as between 1.2% and 5%. The presented data demonstrate that flow cytometric fingerprinting is a sensitive and reproducible technique with the potential to be applied as a method for the dereplication of bacterial isolates. © 2017 International Society for Advancement of Cytometry. © 2017 International Society for Advancement of Cytometry.

Differential Immuno-Reactivity to Genomic DNA, RNA and Mitochondrial DNA is Associated with Auto-Immunity

Directory of Open Access Journals (Sweden)

Vilena V. Ivanova

2014-12-01

Full Text Available Background: Circulating auto-reactive antibodies are hallmark features of auto-immune diseases, however little is known with respect to the specificity of such bio-markers. In the present study, we investigated the specificity of anti-nucleic acid antibodies in the blood of subjects with systemic lupus erythematosus (SLE and healthy controls. Methods: Sera from 12 SLE cases and 8 controls were evaluated for immuno-reactivity to purified RNA, DNA and mitochondrial DNA (mtDNA by enzyme-linked immuno-sorbent assay (ELISA. Results: As expected, immuno-reactivity to total nucleic acids was significantly higher in subjects with SLE when compared to healthy controls, however a clear distinction was observed among the various nucleic acid sub-types, with sera from SLE subjects displaying the greatest immuno-reactivity to RNA followed by mtDNA and then total DNA. Conclusion: The identification of auto-reactive antibodies can serve as highly sensitive biomarkers, although their specificity may not always allow diagnostic certainty. The knowledge that auto-antibodies in subjects with SLE display differential immuno-reactivity may help to improve existing diagnostics and may lead to a better understanding of the pathogenesis of auto-immune disorders.

Differentially Methylated DNA Regions in Monozygotic Twin Pairs Discordant for Rheumatoid Arthritis

DEFF Research Database (Denmark)

Svendsen, Anders J; Gervin, Kristina; Lyle, Robert

2016-01-01

: Smoking was significantly associated with hypomethylation of a DMR overlapping the promoter region of the RNF5 and the AGPAT1, which are implicated in inflammation and autoimmunity, whereas DMARD treatment induced hypermethylation of the same region. Additionally, the promotor region of both S100A6......OBJECTIVES: In an explorative epigenome-wide association study (EWAS) to search for gene independent, differentially methylated DNA positions and regions (DMRs) associated with rheumatoid arthritis (RA) by studying monozygotic (MZ) twin pairs discordant for RA. METHODS: Genomic DNA was isolated......: We identified several differentially methylated regions associated with RA, which may represent environmental effects or consequences of the disease and plausible biological pathways pertinent to the pathogenesis of RA....

Fingerprint separation: an application of ICA

Science.gov (United States)

Singh, Meenakshi; Singh, Deepak Kumar; Kalra, Prem Kumar

2008-04-01

Among all existing biometric techniques, fingerprint-based identification is the oldest method, which has been successfully used in numerous applications. Fingerprint-based identification is the most recognized tool in biometrics because of its reliability and accuracy. Fingerprint identification is done by matching questioned and known friction skin ridge impressions from fingers, palms, and toes to determine if the impressions are from the same finger (or palm, toe, etc.). There are many fingerprint matching algorithms which automate and facilitate the job of fingerprint matching, but for any of these algorithms matching can be difficult if the fingerprints are overlapped or mixed. In this paper, we have proposed a new algorithm for separating overlapped or mixed fingerprints so that the performance of the matching algorithms will improve when they are fed with these inputs. Independent Component Analysis (ICA) has been used as a tool to separate the overlapped or mixed fingerprints.

Patent applications for using DNA technologies to authenticate medicinal herbal material

Directory of Open Access Journals (Sweden)

Chan Albert

2009-11-01

Full Text Available Abstract Herbal medicines are used in many countries for maintaining health and treating diseases. Their efficacy depends on the use of the correct materials, and life-threatening poisoning may occur if toxic adulterants or substitutes are administered instead. Identification of a medicinal material at the DNA level provides an objective and powerful tool for quality control. Extraction of high-quality DNA is the first crucial step in DNA authentication, followed by a battery of DNA techniques including whole genome fingerprinting, DNA sequencing and DNA microarray to establish the identity of the material. New or improved technologies have been developed and valuable data have been collected and compiled for DNA authentication. Some of these technologies and data are patentable. This article provides an overview of some recent patents that cover the extraction of DNA from medicinal materials, the amplification of DNA using improved reaction conditions, the generation of DNA sequences and fingerprints, and the development of high-throughput authentication methods. It also briefly explains why these patents have been granted.

Fingerprints in Compressed Strings

DEFF Research Database (Denmark)

Bille, Philip; Cording, Patrick Hagge; Gørtz, Inge Li

2013-01-01

The Karp-Rabin fingerprint of a string is a type of hash value that due to its strong properties has been used in many string algorithms. In this paper we show how to construct a data structure for a string S of size N compressed by a context-free grammar of size n that answers fingerprint queries...... derivative that captures LZ78 compression and its variations) we get O(loglogN) query time. Hence, our data structures has the same time and space complexity as for random access in SLPs. We utilize the fingerprint data structures to solve the longest common extension problem in query time O(logNlogℓ) and O....... That is, given indices i and j, the answer to a query is the fingerprint of the substring S[i,j]. We present the first O(n) space data structures that answer fingerprint queries without decompressing any characters. For Straight Line Programs (SLP) we get O(logN) query time, and for Linear SLPs (an SLP...

Study on internal to surface fingerprint correlation using optical coherence tomography and internal fingerprint extraction

CSIR Research Space (South Africa)

Darlow, LN

2015-11-01

Full Text Available of, the above-mentioned works. Internal fingerprint zone detection is an improvement as it uses fuzzy c-means to improve clustering performance, uses better cluster result postprocessing, and improves upon the fine-tuning procedure through... Internal fingerprint extraction consists of two main parts: fingerprint zone detection and extraction. Zone detection uses fuzzy c-means clustering to approximate the location of the papillary junction (i.e., the internal fingerprint zone). Edge detection...

Differentiation of the guinea pig eye: nuclear ultrastructure, template activity and DNA content

International Nuclear Information System (INIS)

Schmalenberger, B.

1980-01-01

Nuclei of various cell types in the eye of embryonal and adult Guinea pigs were studied by means of electron microscopy, cytophotometry and autoradiography. Striking differences in condensation and arrangement of chromatin were found between the different tissues and cells. Several nuclear types were analyzed quantitatively with regard to their content of condensed and decondensed chromatin by means of electron microscopic morphometry. Structural differences in chromatin organization coincided with different nuclear DNA contents in various cell types of the retina, such as bipolar cells, Mueller cells, rods and cones, and the pigmented epithelium. The differences between DNA-Feulgen means obtained by cytophotometric analysis were highly significant. Template activity as shown by 3 H-uridine incorporation made evident than the rate of RNA synthesis is positively correlated with the quantity of decondensed chromatin. It is speculated that differentiation of the Guinea pig eye involves differential DNA synthesis, and that the extra-DNA could have some ''trigger'' function for the pattern of chromatin condensation and thus the pattern of gene expression. (author)

Integrating prior knowledge in multiple testing under dependence with applications to detecting differential DNA methylation.

Science.gov (United States)

Kuan, Pei Fen; Chiang, Derek Y

2012-09-01

DNA methylation has emerged as an important hallmark of epigenetics. Numerous platforms including tiling arrays and next generation sequencing, and experimental protocols are available for profiling DNA methylation. Similar to other tiling array data, DNA methylation data shares the characteristics of inherent correlation structure among nearby probes. However, unlike gene expression or protein DNA binding data, the varying CpG density which gives rise to CpG island, shore and shelf definition provides exogenous information in detecting differential methylation. This article aims to introduce a robust testing and probe ranking procedure based on a nonhomogeneous hidden Markov model that incorporates the above-mentioned features for detecting differential methylation. We revisit the seminal work of Sun and Cai (2009, Journal of the Royal Statistical Society: Series B (Statistical Methodology)71, 393-424) and propose modeling the nonnull using a nonparametric symmetric distribution in two-sided hypothesis testing. We show that this model improves probe ranking and is robust to model misspecification based on extensive simulation studies. We further illustrate that our proposed framework achieves good operating characteristics as compared to commonly used methods in real DNA methylation data that aims to detect differential methylation sites. © 2012, The International Biometric Society.

Modeling Audio Fingerprints : Structure, Distortion, Capacity

NARCIS (Netherlands)

Doets, P.J.O.

2010-01-01

An audio fingerprint is a compact low-level representation of a multimedia signal. An audio fingerprint can be used to identify audio files or fragments in a reliable way. The use of audio fingerprints for identification consists of two phases. In the enrollment phase known content is fingerprinted,

The Evidentiary Value of DNA Fingerprint as Criminal Evidence

Directory of Open Access Journals (Sweden)

Mussa Masoud Irhouma

2016-12-01

Full Text Available The subject of criminal evidence is considered to be one of the greatest challenges that face authorities concerned with fighting crime at all levels. Due to this, authorities try to benefit as much as possible from scientific evidence due to the important role it plays in revealing the identity of criminals or victims in present or past criminal cases against unknown people through the physical traces that are found at the scene of an event, which include biological traces. DNA is one of these scientific evidences which can be benefited from in the field of crime investigation. Despite the importance of DNA technology in this area of work, there is still some debate surrounding its acceptance as criminal evidence. Some experts believe it to be of great importance whereas others cast doubt on its evidentiary value. They attribute this to a number of factors including the experts who are entrusted to examine DNA samples, the laboratories in which DNA analysis takes place, as well as the fact that resorting to DNA as a criminal evidence raises some legal complexities related to the permissibility of using it and the conditions and scope of its use. This paper sheds light on DNA and its evidentiary value among the judiciary in criminal cases by answering a number of questions such as the possibility of forcing a person to undergo DNA analysis or not to do so and to what extent it is to be relied upon as criminal evidence. This paper concluded the importance of DNA and its role in the field of criminal evidence. Despite this, even if the DNA evidence is sufficient in proving the innocence of the accused, it is only an indication that must not be solely relied upon and treated as a single conclusive evidence, particularly in cases that involve prescribed Islamic or retributive punishments.

Fingerprint re-alignment: a solution based on the true fingerprint center point

CSIR Research Space (South Africa)

Msiza, IS

2011-02-01

Full Text Available Solution Based on the True Fingerprint Center Point Ishmael S. Msiza, Brain Leke-Betechuoh, and Tendani Malumedzha Biometrics Research Group ? Information Security CSIR, Modelling & Digital Science Unit Pretoria, Republic of South Africa e... with a pattern that belongs to the Tented Arch (TA) fingerprint class. Fingerprints that belong to the TA class have a single core and a single delta, with the core located almost directly above the delta, as depicted in figure 3 (b). Many singular...

Characterization of organic and conventional sweet basil leaves using chromatographic and flow-injection mass spectrometric (FIMS) fingerprints combined with principal component analysis

Science.gov (United States)

Lu, Yingjian; Gao, Boyan; Chen, Pei; Charles, Denys; Yu, Liangli (Lucy)

2014-01-01

Sweet basil, Ocimum basilicum., is one of the most important and wildly used spices and has been shown to have antioxidant, antibacterial, and anti-diarrheal activities. In this study, high performance liquid chromatographic (HPLC) and flow-injection mass spectrometric (FIMS) fingerprinting techniques were used to differentiate organic and conventional sweet basil leaf samples. Principal component analysis (PCA) of the fingerprints indicated that both HPLC and FIMS fingerprints could effectively detect the chemical differences in the organic and conventional sweet basil leaf samples. This study suggested that the organic basil sample contained greater concentrations of almost all the major compounds than its conventional counterpart on a per same botanical weight basis. The FIMS method was able to rapidly differentiate the organic and conventional sweet basil leaf samples (1 min analysis time), whereas the HPLC fingerprints provided more information about the chemical composition of the basil samples with a longer analytical time. PMID:24518341

Molecular characterization of the probiotic strain Bacillus cereus var. toyoi NCIMB 40112 and differentiation from food poisoning strains.

Science.gov (United States)

Klein, Günter

2011-07-01

Bacillus cereus var. toyoi strain NCIMB 40112 (Toyocerin), a probiotic authorized in the European Union as feed additive for swine, bovines, poultry, and rabbits, was characterized by DNA fingerprinting applying pulsed-field gel electrophoresis and multilocus sequence typing and was compared with reference strains (of clinical and environmental origins). The probiotic strain was clearly characterized by pulsed-field gel electrophoresis using the restriction enzymes Apa I and Sma I resulting in unique DNA patterns. The comparison to the clinical reference strain B. cereus DSM 4312 was done with the same restriction enzymes, and again a clear differentiation of the two strains was possible by the resulting DNA patterns. The use of the restriction enzymes Apa I and Sma I is recommended for further studies. Furthermore, multilocus sequence typing analysis revealed a sequence type (ST 111) that was different from all known STs of B. cereus strains from food poisoning incidents. Thus, a strain characterization and differentiation from food poisoning strains for the probiotic strain was possible. Copyright ©, International Association for Food Protection

Characterization of Pediococcus acidilactici strains isolated from rainbow trout (Oncorhynchus mykiss) feed and larvae: safety, DNA fingerprinting, and bacteriocinogenicity.

Science.gov (United States)

Araújo, Carlos; Muñoz-Atienza, Estefanía; Poeta, Patrícia; Igrejas, Gilberto; Hernández, Pablo E; Herranz, Carmen; Cintas, Luis M

2016-05-03

The use of lactic acid bacteria (LAB) as probiotics constitutes an alternative or complementary strategy to chemotherapy and vaccination for disease control in aquaculture. The objectives of this work were (1) the in vitro safety assessment of 8 Pediococcus acidilactici strains isolated from rainbow trout (Oncorhynchus mykiss, Walbaum) feed and larvae; (2) the evaluation of their genetic relatedness; (3) the study of their antimicrobial/bacteriocin activity against fish pathogens; and (4) the biochemical and genetic characterization of the bacteriocin produced by the strain displaying the greatest antimicrobial activity. Concerning the safety assessment, none of the pediococci showed antibiotic resistance nor produced hemolysin or gelatinase, degraded gastric mucin, or deconjugated bile salts. Four strains (50%) produced tyramine or putrescine, but the corresponding genes were not amplified by PCR. Enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR) fingerprinting allowed clustering of the pediococci into 2 well-defined groups (68% similarity). From the 8 pediococci displaying direct antimicrobial activity against at least 3 out of 9 fish pathogens, 6 strains (75%) were identified as bacteriocin producers. The bacteriocin produced by P. acidilactici L-14 was purified, and mass spectrometry and DNA sequencing revealed its identity to pediocin PA-1 (PedPA-1). Altogether, our results allowed the identification of 4 (50%) putatively safe pediococci, including 2 bacteriocinogenic strains. ERIC-PCR fingerprinting was a valuable tool for genetic profiling of P. acidilactici strains. This work reports for the first time the characterization of a PedPA-1-producing P. acidilactici strain isolated from an aquatic environment (rainbow trout larvae), which shows interesting properties related to its potential use as a probiotic in aquaculture.

Identification of Tilletia species using rep-PCR fingerprinting technique

Directory of Open Access Journals (Sweden)

Župunski Vesna

2011-01-01

Full Text Available Analyzing 167 non-processed seed samples of wheat, it was found that 145 samples (86.8 % were contaminated with Tilletia species, while 22 (13.2 % samples were not contaminated. By using rep-PCR fingerprinting technique, it was found that DNA isolates of T. tritici originated from Serbian wheat samples had 80 % similarity with positive control for T. tritici. One isolate shared similarity of 60% with T. tritici, T. controversa and T. laevis. It was supposed that this isolate belongs to T. bromi. Isolate of T. laevis shared a similarity of 70 % with isolates of T. tritici and T. controversa, while T. walkeri was more than 10 % similar with T. tritici, T. controversa and T. laevis. Although T. controversa and T. tritici had high percent of genetic similarity, they were clustered separately. Our results suggest that rep-PCR fingerprinting could be a useful tool for monitoring presence of morphologically similar Tilletia species in wheat production areas.

Classical and quantum fingerprinting strategies

International Nuclear Information System (INIS)

Scott, A.; Walgate, J.; Sanders, B.

2005-01-01

Full text: Fingerprinting enables two parties to infer whether the messages they hold are the same or different when the cost of communication is high: each message is associated with a smaller fingerprint and comparisons between messages are made in terms of their fingerprints alone. When the two parties are forbidden access to a public coin, it is known that fingerprints composed of quantum information can be made exponentially smaller than those composed of classical information. We present specific constructions of classical fingerprinting strategies through the use of constant-weight codes and provide bounds on the worst-case error probability with the help of extremal set theory. These classical strategies are easily outperformed by quantum strategies constructed from line packings and equiangular tight frames. (author)

ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

Science.gov (United States)

Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

2004-10-01

Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

Preliminary evaluation of the use of soil bacterial 16S rDNA DNA markers in sediment fingerprinting in two small endorheic lagoons in southern Spain

Science.gov (United States)

Gomez, Jose Alfonso; Landa del Castillo, Blanca; Guzman, Gema; Petticrew, Ellen L.; Owens, Phillip N.

2016-04-01

Recently, several studies have shown the effect of soil management on the soil microbial community in olive orchards, how this might differ due to a combination of management and soil type, and how these can be identified using DNA markers (Landa et al., 2014). Using DNA markers of soil bacteria seems to have the potential to detect differences in soil properties between different areas (Joe-Strack and Petticrew, 2012), particularly in those that by their location and characteristics might not present differences in other chemical or geochemical soil properties. This presentation describes the preliminary results of an exploratory survey to evaluate the potential of soil bacteria community composition in determining the origin of the sediment in two small endorheic lagoons in southern Spain. Two lagoons (Zoñar and Dulce) in southern Spain with a small contributing area (877 and 263 ha respectively) were selected for this study. These lagoons were chosen because of their environmental relevance and increasing siltation problems. The dominant land use in most of their contributing catchments is rain-fed olive tree cultivation. In May 2015, two small subcatchments within each of the lagoon's contributing area were sampled. At each sampling point, a composite sample was collected of three subsamples taken within a 5 m radiusa. We differentiated between 0-20 and 20-40 cm soil depth. Additionally, in both lagoons samples were taken from the sedimentation of the stream draining the subcatchment into the lagoon shores, at 0-20 -cm depth. Prior to each sampling each of the the two subcatchments were explored for indications of different properties or management that could help divide it into different "homogeneous" units, including: soil management, visual indications of erosion symptoms (e.g. rills, soil mounds around olive trees), colour, and landscape position. As a result, the subcatchment in each lagoon was divided into three areas (referred to as 1, 2 and 3). The

Fingerprint multicast in secure video streaming.

Science.gov (United States)

Zhao, H Vicky; Liu, K J Ray

2006-01-01

Digital fingerprinting is an emerging technology to protect multimedia content from illegal redistribution, where each distributed copy is labeled with unique identification information. In video streaming, huge amount of data have to be transmitted to a large number of users under stringent latency constraints, so the bandwidth-efficient distribution of uniquely fingerprinted copies is crucial. This paper investigates the secure multicast of anticollusion fingerprinted video in streaming applications and analyzes their performance. We first propose a general fingerprint multicast scheme that can be used with most spread spectrum embedding-based multimedia fingerprinting systems. To further improve the bandwidth efficiency, we explore the special structure of the fingerprint design and propose a joint fingerprint design and distribution scheme. From our simulations, the two proposed schemes can reduce the bandwidth requirement by 48% to 87%, depending on the number of users, the characteristics of video sequences, and the network and computation constraints. We also show that under the constraint that all colluders have the same probability of detection, the embedded fingerprints in the two schemes have approximately the same collusion resistance. Finally, we propose a fingerprint drift compensation scheme to improve the quality of the reconstructed sequences at the decoder's side without introducing extra communication overhead.

Hydroxylation of methylated DNA by TET1 in chondrocyte differentiation of C3H10T1/2 cells

Directory of Open Access Journals (Sweden)

Ryo Ito

2016-03-01

Full Text Available DNA methylation is closely involved in the regulation of cellular differentiation, including chondrogenic differentiation of mesenchymal stem cells. Recent studies showed that Ten–eleven translocation (TET family proteins converted 5-methylcytosine (5mC to 5-hydroxymethylcytosine, 5-formylcytosine and 5carboxylcytosine by oxidation. These reactions constitute potential mechanisms for active demethylation of methylated DNA. However, the relationship between the DNA methylation patterns and the effects of TET family proteins in chondrocyte differentiation is still unclear. In this study, we showed that DNA hydroxylation of 5mC was increased during chondrocytic differentiation of C3H10T1/2 cells and that the expression of Tet1 was particularly enhanced. Moreover, knockdown experiments revealed that the downregulation of Tet1 expression caused decreases in chondrogenesis markers such as type 2 and type 10 collagens. Furthermore, we found that TET proteins had a site preference for hydroxylation of 5mC on the Insulin-like growth factor 1 (Igf1 promoter in chondrocytes. Taken together, we showed that the expression of Tet1 was specifically facilitated in chondrocyte differentiation and Tet1 can regulate chondrocyte marker gene expression presumably through its hydroxylation activity for DNA.

Chemical fingerprinting of hydrocarbon-contamination in soil.

Science.gov (United States)

Boll, Esther S; Nejrup, Jens; Jensen, Julie K; Christensen, Jan H

2015-03-01

Chemical fingerprinting analyses of 29 hydrocarbon-contaminated soils were performed to assess the soil quality and determine the main contaminant sources. The results were compared to an assessment based on concentrations of the 16 priority polycyclic aromatic hydrocarbons pointed out by the U.S. Environmental Protection Agency (EPAPAH16) and total petroleum hydrocarbon (TPH). The chemical fingerprinting strategy proposed in this study included four tiers: (i) qualitative analysis of GC-FID chromatograms, (ii) comparison of the chemical composition of both un-substituted and alkyl-substituted polycyclic aromatic compounds (PACs), (iii) diagnostic ratios of selected PACs, and (iv) multivariate data analysis of sum-normalized PAC concentrations. The assessment criteria included quantitative analysis of 19 PACs and C1-C4 alkyl-substituted homologues of naphthalene, fluorene, dibenzothiophene, phenanthrene, pyrene, and chrysene; and 13 oxygenated polycyclic aromatic compounds (O-PACs). The chemical composition of un-substituted and alkyl-substituted PACs and visual interpretation of GC-FID chromatograms were in combination successful in differentiating pyrogenic and petrogenic hydrocarbon sources and in assessing weathering trends of hydrocarbon contamination in the soils. Multivariate data analysis of sum-normalized concentrations could as a stand-alone tool distinguish between hydrocarbon sources of petrogenic and pyrogenic origin, differentiate within petrogenic sources, and detect weathering trends. Diagnostic ratios of PACs were not successful for source identification of the heavily weathered hydrocarbon sources in the soils. The fingerprinting of contaminated soils revealed an underestimation of PACs in petrogenic contaminated soils when the assessment was based solely on EPAPAH16. As alkyl-substituted PACs are dominant in petrogenic sources, the evaluation of the total load of PACs based on EPAPAH16 was not representative. Likewise, the O-PACs are not

Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

NARCIS (Netherlands)

Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

1987-01-01

DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

Conformational changes in DNA caused by DNA-ase I, gamma and ultraviolet radiation as revealed by differential pulse polarography

International Nuclear Information System (INIS)

Vorlickova, M.

1979-01-01

The height, potential and half width of differential pulse-polarographic peaks of DNA were investigated in dependence on degradation by DNA-ase I and gamma and UV radiation. It was found that in all cases studied growth of peak II (reflecting conformational changes in the DNA double helix) was limited, and only after it reached a certain height further degradation induced the appearance of peak III of single-stranded DNA. This course is explained as reflecting the limited extent of conformational changes in the framework of the double helix, which probably follows from a limited number of sites that can undergo certain types of conformational changes. The character of the conformational changes is dependent on the chemical nature of the damage. (author)

Advances in fingerprint analysis.

Science.gov (United States)

Hazarika, Pompi; Russell, David A

2012-04-10

Fingerprints have been used in forensic investigations for the identification of individuals since the late 19th century. However, it is now clear that fingerprints can provide significantly more information about an individual. Here, we highlight the considerable advances in fingerprinting technology that can simultaneously provide chemical information regarding the drugs ingested and the explosives and drugs handled by a person as well as the identity of that individual. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Differentiation of strains from the Bacillus cereus group by RFLP-PFGE genomic fingerprinting.

Science.gov (United States)

Otlewska, Anna; Oltuszak-Walczak, Elzbieta; Walczak, Piotr

2013-11-01

Bacillus mycoides, Bacillus pseudomycoides, Bacillus weihenstephanensis, Bacillus anthracis, Bacillus thuringiensis, and Bacillus cereus belong to the B. cereus group. The last three species are characterized by different phenotype features and pathogenicity spectrum, but it has been shown that these species are genetically closely related. The macrorestriction analysis of the genomic DNA with the NotI enzyme was used to generate polymorphism of restriction profiles for 39 food-borne isolates (B. cereus, B. mycoides) and seven reference strains (B. mycoides, B. thuringiensis, B. weihenstephanensis, and B. cereus). The PFGE method was applied to differentiate the examined strains of the B. cereus group. On the basis of the unweighted pair group method with the arithmetic mean method and Dice coefficient, the strains were divided into five clusters (types A-E), and the most numerous group was group A (25 strains). A total of 21 distinct pulsotypes were observed. The RFLP-PFGE analysis was successfully used for the differentiation and characterization of B. cereus and B. mycoides strains isolated from different food products. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Development of oil hydrocarbon fingerprinting and identification techniques

International Nuclear Information System (INIS)

Wang Zhendi; Fingas, Merv F.

2003-01-01

Oil, refined product, and pyrogenic hydrocarbons are the most frequently discovered contaminants in the environment. To effectively determine the fate of spilled oil in the environment and to successfully identify source(s) of spilled oil and petroleum products is, therefore, extremely important in many oil-related environmental studies and liability cases. This article briefly reviews the recent development of chemical analysis methodologies which are most frequently used in oil spill characterization and identification studies and environmental forensic investigations. The fingerprinting and data interpretation techniques discussed include oil spill identification protocol, tiered analytical approach, generic features and chemical composition of oils, effects of weathering on hydrocarbon fingerprinting, recognition of distribution patterns of petroleum hydrocarbons, oil type screening and differentiation, analysis of 'source-specific marker' compounds, determination of diagnostic ratios of specific oil constituents, stable isotopic analysis, application of various statistical and numerical analysis tools, and application of other analytical techniques. The issue of how biogenic and pyrogenic hydrocarbons are distinguished from petrogenic hydrocarbons is also addressed

miR-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells

Science.gov (United States)

Lal, Ashish; Pan, Yunfeng; Navarro, Francisco; Dykxhoorn, Derek M.; Moreau, Lisa; Meire, Eti; Bentwich, Zvi; Lieberman, Judy; Chowdhury, Dipanjan

2010-01-01

Terminally differentiated cells have reduced capacity to repair double strand breaks (DSB), but the molecular mechanism behind this down-regulation is unclear. Here we find that miR-24 is consistently up-regulated during post-mitotic differentiation of hematopoietic cell lines and regulates the histone variant H2AX, a key DSB repair protein that activates cell cycle checkpoint proteins and retains DSB repair factors at DSB foci. The H2AX 3’UTR contains conserved miR-24 binding sites regulated by miR-24. Both H2AX mRNA and protein are substantially reduced during hematopoietic cell terminal differentiation by miR-24 up-regulation both in in vitro differentiated cells and primary human blood cells. miR-24 suppression of H2AX renders cells hypersensitive to γ-irradiation and genotoxic drugs. Antagonizing miR-24 in differentiating cells protects them from DNA damage-induced cell death, while transfecting miR-24 mimics in dividing cells increases chromosomal breaks and unrepaired DNA damage and reduces viability in response to DNA damage. This DNA repair phenotype can be fully rescued by over-expressing miR-24-insensitive H2AX. Therefore, miR-24 up-regulation in post-replicative cells reduces H2AX and thereby renders them highly vulnerable to DNA damage. PMID:19377482

Laser desorption mass spectrometry for high-throughput DNA analysis and its applications

Science.gov (United States)

Chen, C. H. Winston; Golovlev, Valeri V.; Taranenko, N. I.; Allman, S. L.; Isola, Narayana R.; Potter, N. T.; Matteson, K. J.; Chang, Linus Y.

1999-05-01

Laser desorption mass spectrometry (LDMS) has been developed for DNA sequencing, disease diagnosis, and DNA fingerprinting for forensic applications. With LDMS, the speed of DNA analysis can be much faster than conventional gel electrophoresis. No dye or radioactive tagging to DNA segments for detection is needed. LDMS is emerging as a new alternative technology for DNA analysis.

Influence of Skin Diseases on Fingerprint Recognition

Science.gov (United States)

Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

2012-01-01

There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described. PMID:22654483

Influence of Skin Diseases on Fingerprint Recognition

Directory of Open Access Journals (Sweden)

Martin Drahansky

2012-01-01

Full Text Available There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described.

High-resolution genomic fingerprinting of Campylobacter jejuni and Campylobacter coli by analysis of amplified fragment length polymorphisms

DEFF Research Database (Denmark)

Kokotovic, Branko; On, Stephen L.W.

1999-01-01

A method for high-resolution genomic fingerprinting of the enteric pathogens Campylobacter jejuni and Campylobacter coli, based on the determination of amplified fragment length polymorphism, is described. The potential of this method for molecular epidemiological studies of these species...... is evaluated with 50 type, reference, and well-characterised field strains. Amplified fragment length polymorphism fingerprints comprised over 60 bands detected in the size range 35-500 bp. Groups of outbreak strains, replicate subcultures, and 'genetically identical' strains from humans, poultry and cattle......, proved indistinguishable by amplified fragment length polymorphism fingerprinting, but were differentiated fi-om unrelated isolates. Previously unknown relationships between three hippurate-negative C. jejuni strains, and two C. coil var, hyoilei strains, were identified. These relationships corresponded...

Fingerprint start the next generation of payment method : Fingerprint payment: a new mode of mobile payment

OpenAIRE

Wu, Chong

2016-01-01

In the generation of mobile internet, fingerprint payment is one of the most popular topics at the moment. China has a big market and many users are using the mobile payment methods. There are a large number of mobile phones equipped with fingerprint recognition technology. As we know, fingerprint payment brings us more convenience and safety. We do not need to use many bankcards, and fingerprint also eliminates the users from the trouble of queuing to pay. However, users send traditional dig...

Reference point detection for improved fingerprint matching

NARCIS (Netherlands)

Ignatenko, T.; Kalker, A.A.C.M.; Veen, van der M.; Bazen, A.; Delp, E.J.; Wong, P.W.

2006-01-01

One of the important stages of fingerprint recognition is the registration of the fingerprints with respect to the original template. This is not a straightforward task as fingerprint images may have been subject to rotations and translations. Popular techniques for fingerprint registration use a

Optimization of ISSR Markers for Molecular DNA Fingerprinting in Aquilaria sp

International Nuclear Information System (INIS)

Azhar Mohamad; Muhammad Hanif Azhari; Siti Norhayati Ismail; Parween, K.S.A.S.

2013-01-01

Aquilaria sp. belongs to the Thymelaeaceae family and well distributed to Asia region. The species is a multipurpose use from root to shoot and becoming an economic important crop, which generates wide interest in understanding the genetic diversity of the species. Understanding of the effectiveness in differentiating DNA-based markers is an important step towards plant germplasm characterization and evaluation. It is becoming a prerequisite for more effective application of molecular marker techniques in breeding and mapping programs. Polymerase Chain Reaction (PCR)-based approaches are in demanding as its simplicity and requirement for only small quantities of sample genomic DNA. Inter-simple sequence repeats (ISRR) requires no prior genomic information as anchor template in producing multi-loci markers of tandem repeats for polymorphic patterns by PCR amplification which becoming a key of advantageous of ISSR primers. ISSR markers have shown rapid, simple, reproducible and inexpensive means in molecular taxonomy, conservation breeding and genetic diversity analysis. The ISSR for marker applications are essential to facilitate management, conservation and genetic improvement programs towards improvement of standard resin quality for perfume and or pharmaceutical industries. In this paper, a total of 100 ISSR primers were optimized by using Aquilaria malaccensis. Primers optimization resulted, 38 ISSR primers affirmative for the polymorphism evaluation study, which encountered both from specific and degenerate ISSR primers. Marker derived from ISSR profiling is a powerful method for identification and molecular classification of Aquilaria sp from species to accessions and further will useful in identifying any mutant lines derived from nature and/or mutagenesis activities. (author)

Data Compression of Fingerprint Minutiae

OpenAIRE

VISHAL SHRIVASTAVA; SUMIT SHARMA

2012-01-01

Biometric techniques have usual advantages over conventional personal identification technique. Among various commercially available biometric techniques such as face, fingerprint, Iris etc., fingerprint-based techniques are the most accepted recognition system. Fingerprints are trace or impression of patterns created byfriction ridges of the skin in the fingers and thumbs. Steganography usually used in smart card is a safe technique for authenticating a person. In steganography, biometric ch...

Drama Drives a DNA Fingerprinting Lab Exercise.

Science.gov (United States)

Rubenstein, Elaine C.; And Others

1996-01-01

Presents a laboratory exercise for an intermediate cell and molecular biology course that uses a murder-mystery play. Provokes students to think critically about important issues in scientific methodology in general and DNA analysis in particular. (JRH)

Fingerprint Recognition Using Minutia Score Matching

OpenAIRE

J, Ravi.; Raja, K. B.; R, Venugopal. K.

2010-01-01

The popular Biometric used to authenticate a person is Fingerprint which is unique and permanent throughout a person’s life. A minutia matching is widely used for fingerprint recognition and can be classified as ridge ending and ridge bifurcation. In this paper we projected Fingerprint Recognition using Minutia Score Matching method (FRMSM). For Fingerprint thinning, the Block Filter is used, which scans the image at the boundary to preserves the quality of the image and extract the minutiae ...

A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

Science.gov (United States)

Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

2018-05-01

Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

Evaluation of the impact of chitosan/DNA nanoparticles on the differentiation of human naive CD4+ T cells

Science.gov (United States)

Liu, Lanxia; Bai, Yuanyuan; Zhu, Dunwan; Song, Liping; Wang, Hai; Dong, Xia; Zhang, Hailing; Leng, Xigang

2011-06-01

Chitosan (CS) is one of the most widely studied polymers in non-viral gene delivery since it is a cationic polysaccharide that forms nanoparticles with DNA and hence protects the DNA against digestion by DNase. However, the impact of CS/DNA nanoparticle on the immune system still remains poorly understood. Previous investigations did not found CS/DNA nanoparticles had any significant impact on the function of human and murine macrophages. To date, little is known about the interaction between CS/DNA nanoparticles and naive CD4+ T cells. This study was designed to investigate whether CS/DNA nanoparticles affect the initial differentiation direction of human naive CD4+ T cells. The indirect impact of CS/DNA nanoparticles on naive CD4+ T cell differentiation was investigated by incubating the nanoparticles with human macrophage THP-1 cells in one chamber of a transwell co-incubation system, with the enriched human naive CD4+ T cells being placed in the other chamber of the transwell. The nanoparticles were also co-incubated with the naive CD4+ T cells to explore their direct impact on naive CD4+ T cell differentiation by measuring the release of IL-4 and IFN-γ from the cells. It was demonstrated that CS/DNA nanoparticles induced slightly elevated production of IL-12 by THP-1 cells, possibly owing to the presence of CpG motifs in the plasmid. However, this macrophage stimulating activity was much less significant as compared with lipopolysaccharide and did not impact on the differentiation of the naive CD4+ T cells. It was also demonstrated that, when directly exposed to the naive CD4+ T cells, the nanoparticles induced neither the activation of the naive CD4+ T cells in the absence of recombinant cytokines (recombinant human IL-4 or IFN-γ) that induce naive CD4+ T cell polarization, nor any changes in the differentiation direction of naive CD4+ T cells in the presence of the corresponding cytokines.

Evaluation of the impact of chitosan/DNA nanoparticles on the differentiation of human naive CD4+ T cells

International Nuclear Information System (INIS)

Liu Lanxia; Bai Yuanyuan; Zhu Dunwan; Song Liping; Wang Hai; Dong Xia; Zhang Hailing; Leng Xigang

2011-01-01

Chitosan (CS) is one of the most widely studied polymers in non-viral gene delivery since it is a cationic polysaccharide that forms nanoparticles with DNA and hence protects the DNA against digestion by DNase. However, the impact of CS/DNA nanoparticle on the immune system still remains poorly understood. Previous investigations did not found CS/DNA nanoparticles had any significant impact on the function of human and murine macrophages. To date, little is known about the interaction between CS/DNA nanoparticles and naive CD4 + T cells. This study was designed to investigate whether CS/DNA nanoparticles affect the initial differentiation direction of human naive CD4 + T cells. The indirect impact of CS/DNA nanoparticles on naive CD4 + T cell differentiation was investigated by incubating the nanoparticles with human macrophage THP-1 cells in one chamber of a transwell co-incubation system, with the enriched human naive CD4 + T cells being placed in the other chamber of the transwell. The nanoparticles were also co-incubated with the naive CD4 + T cells to explore their direct impact on naive CD4 + T cell differentiation by measuring the release of IL-4 and IFN-γ from the cells. It was demonstrated that CS/DNA nanoparticles induced slightly elevated production of IL-12 by THP-1 cells, possibly owing to the presence of CpG motifs in the plasmid. However, this macrophage stimulating activity was much less significant as compared with lipopolysaccharide and did not impact on the differentiation of the naive CD4 + T cells. It was also demonstrated that, when directly exposed to the naive CD4 + T cells, the nanoparticles induced neither the activation of the naive CD4 + T cells in the absence of recombinant cytokines (recombinant human IL-4 or IFN-γ) that induce naive CD4 + T cell polarization, nor any changes in the differentiation direction of naive CD4 + T cells in the presence of the corresponding cytokines.

Fingerprint verification prediction model in hand dermatitis.

Science.gov (United States)

Lee, Chew K; Chang, Choong C; Johor, Asmah; Othman, Puwira; Baba, Roshidah

2015-07-01

Hand dermatitis associated fingerprint changes is a significant problem and affects fingerprint verification processes. This study was done to develop a clinically useful prediction model for fingerprint verification in patients with hand dermatitis. A case-control study involving 100 patients with hand dermatitis. All patients verified their thumbprints against their identity card. Registered fingerprints were randomized into a model derivation and model validation group. Predictive model was derived using multiple logistic regression. Validation was done using the goodness-of-fit test. The fingerprint verification prediction model consists of a major criterion (fingerprint dystrophy area of ≥ 25%) and two minor criteria (long horizontal lines and long vertical lines). The presence of the major criterion predicts it will almost always fail verification, while presence of both minor criteria and presence of one minor criterion predict high and low risk of fingerprint verification failure, respectively. When none of the criteria are met, the fingerprint almost always passes the verification. The area under the receiver operating characteristic curve was 0.937, and the goodness-of-fit test showed agreement between the observed and expected number (P = 0.26). The derived fingerprint verification failure prediction model is validated and highly discriminatory in predicting risk of fingerprint verification in patients with hand dermatitis. © 2014 The International Society of Dermatology.

An effective one-dimensional anisotropic fingerprint enhancement algorithm

Science.gov (United States)

Ye, Zhendong; Xie, Mei

2012-01-01

Fingerprint identification is one of the most important biometric technologies. The performance of the minutiae extraction and the speed of the fingerprint verification system rely heavily on the quality of the input fingerprint images, so the enhancement of the low fingerprint is a critical and difficult step in a fingerprint verification system. In this paper we proposed an effective algorithm for fingerprint enhancement. Firstly we use normalization algorithm to reduce the variations in gray level values along ridges and valleys. Then we utilize the structure tensor approach to estimate each pixel of the fingerprint orientations. At last we propose a novel algorithm which combines the advantages of onedimensional Gabor filtering method and anisotropic method to enhance the fingerprint in recoverable region. The proposed algorithm has been evaluated on the database of Fingerprint Verification Competition 2004, and the results show that our algorithm performs within less time.

Antimicrobial susceptibilities and random amplified polymorphic DNA-PCR fingerprint characterization of Lactococcus lactis ssp. lactis and Lactococcus garvieae isolated from bovine intramammary infections.

Science.gov (United States)

Plumed-Ferrer, C; Barberio, A; Franklin-Guild, R; Werner, B; McDonough, P; Bennett, J; Gioia, G; Rota, N; Welcome, F; Nydam, D V; Moroni, P

2015-09-01

In total, 181 streptococci-like bacteria isolated from intramammary infections (IMI) were submitted by a veterinary clinic to Quality Milk Production Services (QMPS, Cornell University, Ithaca, NY). The isolates were characterized by sequence analysis, and 46 Lactococcus lactis ssp. lactis and 47 Lactococcus garvieae were tested for susceptibility to 17 antibiotics. No resistant strains were found for β-lactam antibiotics widely used in clinical practice (penicillin, ampicillin, and amoxicillin), and all minimum inhibitory concentrations (MIC) were far from the resistance breakpoints. Eight strains had MIC intermediate to cefazolin. The random amplification of polymorphic DNA (RAPD)-PCR fingerprint patterns showed a slightly higher heterogeneity for Lc. lactis ssp. lactis isolates than for Lc. garvieae isolates. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

An investigation of fake fingerprint detection approaches

Science.gov (United States)

Ahmad, Asraful Syifaa'; Hassan, Rohayanti; Othman, Razib M.

2017-10-01

The most reliable biometrics technology, fingerprint recognition is widely used in terms of security due to its permanence and uniqueness. However, it is also vulnerable to the certain type of attacks including presenting fake fingerprints to the sensor which requires the development of new and efficient protection measures. Particularly, the aim is to identify the most recent literature related to the fake fingerprint recognition and only focus on software-based approaches. A systematic review is performed by analyzing 146 primary studies from the gross collection of 34 research papers to determine the taxonomy, approaches, online public databases, and limitations of the fake fingerprint. Fourteen software-based approaches have been briefly described, four limitations of fake fingerprint image were revealed and two known fake fingerprint databases were addressed briefly in this review. Therefore this work provides an overview of an insight into the current understanding of fake fingerprint recognition besides identifying future research possibilities.

Genetic Fingerprinting of Wheat and Its Progenitors by Mitochondrial Gene orf256

Directory of Open Access Journals (Sweden)

Mona M. Elseehy

2012-04-01

Full Text Available orf256 is a wheat mitochondrial gene associated with cytoplasmic male sterility (CMS that has different organization in various species. This study exploited the orf256 gene as a mitochondrial DNA marker to study the genetic fingerprint of Triticum and Aegilops species. PCR followed by sequencing of common parts of the orf256 gene were employed to determine the fingerprint and molecular evolution of Triticum and Aegilops species. Although many primer pairs were used, two pairs of orf256 specific primers (5:-94/C: 482, 5:253/C: 482, amplified DNA fragments of 576 bp and 230 bp respectively in all species were tested. A common 500 bp of nine species of Triticum and Aegilops were aligned and showed consistent results with that obtained from other similar chloroplast or nuclear genes. Base alignment showed that there were various numbers of base substitutions in all species compared to S. cereal (Sc (the outgroup species. Phylogenetic relationship revealed similar locations and proximity on phylogenetic trees established using plastid and nuclear genes. The results of this study open a good route to use unknown function genes of mitochondria in studying the molecular relationships and evolution of wheat and complex plant genomes.

Predicting the performance of fingerprint similarity searching.

Science.gov (United States)

Vogt, Martin; Bajorath, Jürgen

2011-01-01

Fingerprints are bit string representations of molecular structure that typically encode structural fragments, topological features, or pharmacophore patterns. Various fingerprint designs are utilized in virtual screening and their search performance essentially depends on three parameters: the nature of the fingerprint, the active compounds serving as reference molecules, and the composition of the screening database. It is of considerable interest and practical relevance to predict the performance of fingerprint similarity searching. A quantitative assessment of the potential that a fingerprint search might successfully retrieve active compounds, if available in the screening database, would substantially help to select the type of fingerprint most suitable for a given search problem. The method presented herein utilizes concepts from information theory to relate the fingerprint feature distributions of reference compounds to screening libraries. If these feature distributions do not sufficiently differ, active database compounds that are similar to reference molecules cannot be retrieved because they disappear in the "background." By quantifying the difference in feature distribution using the Kullback-Leibler divergence and relating the divergence to compound recovery rates obtained for different benchmark classes, fingerprint search performance can be quantitatively predicted.

Studies on Chromatographic Fingerprint and Fingerprinting Profile-Efficacy Relationship of Saxifraga stolonifera Meerb.

Directory of Open Access Journals (Sweden)

Xing-Dong Wu

2015-12-01

Full Text Available This work investigated the spectrum-effect relationships between high performance liquid chromatography (HPLC fingerprints and the anti-benign prostatic hyperplasia activities of aqueous extracts from Saxifraga stolonifera. The fingerprints of S. stolonifera from various sources were established by HPLC and evaluated by similarity analysis (SA, hierarchical clustering analysis (HCA and principal component analysis (PCA. Nine samples were obtained from these 24 batches of different origins, according to the results of SA, HCA and the common chromatographic peaks area. A testosterone-induced mouse model of benign prostatic hyperplasia (BPH was used to establish the anti-benign prostatic hyperplasia activities of these nine S. stolonifera samples. The model was evaluated by analyzing prostatic index (PI, serum acid phosphatase (ACP activity, concentrations of serum dihydrotestosterone (DHT, prostatic acid phosphatase (PACP and type II 5α-reductase (SRD5A2. The spectrum-effect relationships between HPLC fingerprints and anti-benign prostatic hyperplasia activities were investigated using Grey Correlation Analysis (GRA and partial least squares regression (PLSR. The results showed that a close correlation existed between the fingerprints and anti-benign prostatic hyperplasia activities, and peak 14 (chlorogenic acid, peak 17 (quercetin 5-O-β-d-glucopyranoside and peak 18 (quercetin 3-O-β-l-rhamno-pyranoside in the HPLC fingerprints might be the main active components against anti-benign prostatic hyperplasia. This work provides a general model for the study of spectrum-effect relationships of S. stolonifera by combing HPLC fingerprints with a testosterone-induced mouse model of BPH, which can be employed to discover the principle components of anti-benign prostatic hyperplasia bioactivity.

Three-dimensional fingerprint recognition by using convolution neural network

Science.gov (United States)

Tian, Qianyu; Gao, Nan; Zhang, Zonghua

2018-01-01

With the development of science and technology and the improvement of social information, fingerprint recognition technology has become a hot research direction and been widely applied in many actual fields because of its feasibility and reliability. The traditional two-dimensional (2D) fingerprint recognition method relies on matching feature points. This method is not only time-consuming, but also lost three-dimensional (3D) information of fingerprint, with the fingerprint rotation, scaling, damage and other issues, a serious decline in robustness. To solve these problems, 3D fingerprint has been used to recognize human being. Because it is a new research field, there are still lots of challenging problems in 3D fingerprint recognition. This paper presents a new 3D fingerprint recognition method by using a convolution neural network (CNN). By combining 2D fingerprint and fingerprint depth map into CNN, and then through another CNN feature fusion, the characteristics of the fusion complete 3D fingerprint recognition after classification. This method not only can preserve 3D information of fingerprints, but also solves the problem of CNN input. Moreover, the recognition process is simpler than traditional feature point matching algorithm. 3D fingerprint recognition rate by using CNN is compared with other fingerprint recognition algorithms. The experimental results show that the proposed 3D fingerprint recognition method has good recognition rate and robustness.

Latent fingerprints on different type of screen protective films

Directory of Open Access Journals (Sweden)

Yuttana Sudjaroen

2016-07-01

Full Text Available The purpose of this research was to study the quality of latent fingerprint on different types of screen protective films including screen protector, matte screen protector, anti-fingerprint clear screen protector and anti-fingerprint matte screen protector by using black powder method in developing latent fingerprints. The fingerprints were performed by 10 volunteers whose fingers (right index, right thumb, left index and left thumb were stubbing at different types of screen protective films and subsequently latent fingerprints were developed by brushing with black powder. Automated Fingerprint Identification System (AFIS counted the numbers of minutiae points from 320 latent fingerprints. Anti-fingerprint matte screen protective film produced the best quality of latent fingerprint with an average minutiae point 72.65, followed by matte screen protective film, clear screen protective film and anti-fingerprint clear screen protective film with an average minutiae point of 155.2, 135.0 and 72.65 respectively. The quality of latent fingerprints developed between a clear and a matte surface of screen protective films showed a significant difference (sig>0.05, whereas the coat and the non-coat with anti-fingerprint chemical revealed a non-significant difference (sig<0.05 in their number of minutiae points.

Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

Science.gov (United States)

Ririe, K M; Rasmussen, R P; Wittwer, C T

1997-02-15

A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

Evaluation of the impact of chitosan/DNA nanoparticles on the differentiation of human naive CD4{sup +} T cells

Energy Technology Data Exchange (ETDEWEB)

Liu Lanxia; Bai Yuanyuan; Zhu Dunwan; Song Liping; Wang Hai; Dong Xia; Zhang Hailing; Leng Xigang, E-mail: lengxg@bme.org.cn [Chinese Academy of Medical Sciences and Peking Union Medical College, Tianjin Key Laboratory of Biomedical Materials, Lab of Bioengineering, Institute of Biomedical Engineering (China)

2011-06-15

Chitosan (CS) is one of the most widely studied polymers in non-viral gene delivery since it is a cationic polysaccharide that forms nanoparticles with DNA and hence protects the DNA against digestion by DNase. However, the impact of CS/DNA nanoparticle on the immune system still remains poorly understood. Previous investigations did not found CS/DNA nanoparticles had any significant impact on the function of human and murine macrophages. To date, little is known about the interaction between CS/DNA nanoparticles and naive CD4{sup +} T cells. This study was designed to investigate whether CS/DNA nanoparticles affect the initial differentiation direction of human naive CD4{sup +} T cells. The indirect impact of CS/DNA nanoparticles on naive CD4{sup +} T cell differentiation was investigated by incubating the nanoparticles with human macrophage THP-1 cells in one chamber of a transwell co-incubation system, with the enriched human naive CD4{sup +} T cells being placed in the other chamber of the transwell. The nanoparticles were also co-incubated with the naive CD4{sup +} T cells to explore their direct impact on naive CD4{sup +} T cell differentiation by measuring the release of IL-4 and IFN-{gamma} from the cells. It was demonstrated that CS/DNA nanoparticles induced slightly elevated production of IL-12 by THP-1 cells, possibly owing to the presence of CpG motifs in the plasmid. However, this macrophage stimulating activity was much less significant as compared with lipopolysaccharide and did not impact on the differentiation of the naive CD4{sup +} T cells. It was also demonstrated that, when directly exposed to the naive CD4{sup +} T cells, the nanoparticles induced neither the activation of the naive CD4{sup +} T cells in the absence of recombinant cytokines (recombinant human IL-4 or IFN-{gamma}) that induce naive CD4{sup +} T cell polarization, nor any changes in the differentiation direction of naive CD4{sup +} T cells in the presence of the corresponding

Fingerprints in compressed strings

DEFF Research Database (Denmark)

Bille, Philip; Gørtz, Inge Li; Cording, Patrick Hagge

2017-01-01

In this paper we show how to construct a data structure for a string S of size N compressed into a context-free grammar of size n that supports efficient Karp–Rabin fingerprint queries to any substring of S. That is, given indices i and j, the answer to a query is the fingerprint of the substring S......[i,j]. We present the first O(n) space data structures that answer fingerprint queries without decompressing any characters. For Straight Line Programs (SLP) we get O(log⁡N) query time, and for Linear SLPs (an SLP derivative that captures LZ78 compression and its variations) we get O(log⁡log⁡N) query time...

Differential Nuclear and Mitochondrial DNA Preservation in Post-Mortem Teeth with Implications for Forensic and Ancient DNA Studies

Science.gov (United States)

Higgins, Denice; Rohrlach, Adam B.; Kaidonis, John; Townsend, Grant; Austin, Jeremy J.

2015-01-01

Major advances in genetic analysis of skeletal remains have been made over the last decade, primarily due to improvements in post-DNA-extraction techniques. Despite this, a key challenge for DNA analysis of skeletal remains is the limited yield of DNA recovered from these poorly preserved samples. Enhanced DNA recovery by improved sampling and extraction techniques would allow further advancements. However, little is known about the post-mortem kinetics of DNA degradation and whether the rate of degradation varies between nuclear and mitochondrial DNA or across different skeletal tissues. This knowledge, along with information regarding ante-mortem DNA distribution within skeletal elements, would inform sampling protocols facilitating development of improved extraction processes. Here we present a combined genetic and histological examination of DNA content and rates of DNA degradation in the different tooth tissues of 150 human molars over short-medium post-mortem intervals. DNA was extracted from coronal dentine, root dentine, cementum and pulp of 114 teeth via a silica column method and the remaining 36 teeth were examined histologically. Real time quantification assays based on two nuclear DNA fragments (67 bp and 156 bp) and one mitochondrial DNA fragment (77 bp) showed nuclear and mitochondrial DNA degraded exponentially, but at different rates, depending on post-mortem interval and soil temperature. In contrast to previous studies, we identified differential survival of nuclear and mtDNA in different tooth tissues. Futhermore histological examination showed pulp and dentine were rapidly affected by loss of structural integrity, and pulp was completely destroyed in a relatively short time period. Conversely, cementum showed little structural change over the same time period. Finally, we confirm that targeted sampling of cementum from teeth buried for up to 16 months can provide a reliable source of nuclear DNA for STR-based genotyping using standard

Case study of 3D fingerprints applications.

Directory of Open Access Journals (Sweden)

Feng Liu

Full Text Available Human fingers are 3D objects. More information will be provided if three dimensional (3D fingerprints are available compared with two dimensional (2D fingerprints. Thus, this paper firstly collected 3D finger point cloud data by Structured-light Illumination method. Additional features from 3D fingerprint images are then studied and extracted. The applications of these features are finally discussed. A series of experiments are conducted to demonstrate the helpfulness of 3D information to fingerprint recognition. Results show that a quick alignment can be easily implemented under the guidance of 3D finger shape feature even though this feature does not work for fingerprint recognition directly. The newly defined distinctive 3D shape ridge feature can be used for personal authentication with Equal Error Rate (EER of ~8.3%. Also, it is helpful to remove false core point. Furthermore, a promising of EER ~1.3% is realized by combining this feature with 2D features for fingerprint recognition which indicates the prospect of 3D fingerprint recognition.

Fingerprint Analysis with Marked Point Processes

DEFF Research Database (Denmark)

Forbes, Peter G. M.; Lauritzen, Steffen; Møller, Jesper

We present a framework for fingerprint matching based on marked point process models. An efficient Monte Carlo algorithm is developed to calculate the marginal likelihood ratio for the hypothesis that two observed prints originate from the same finger against the hypothesis that they originate from...... different fingers. Our model achieves good performance on an NIST-FBI fingerprint database of 258 matched fingerprint pairs....

Collusion-resistant multimedia fingerprinting: a unified framework

Science.gov (United States)

Wu, Min; Trappe, Wade; Wang, Z. Jane; Liu, K. J. Ray

2004-06-01

Digital fingerprints are unique labels inserted in different copies of the same content before distribution. Each digital fingerprint is assigned to an inteded recipient, and can be used to trace the culprits who use their content for unintended purposes. Attacks mounted by multiple users, known as collusion attacks, provide a cost-effective method for attenuating the identifying fingerprint from each coluder, thus collusion poses a reeal challenge to protect the digital media data and enforce usage policies. This paper examines a few major design methodologies for collusion-resistant fingerprinting of multimedia, and presents a unified framework that helps highlight the common issues and the uniqueness of different fingerprinting techniques.

Polymorphism of Paramecium pentaurelia (Ciliophora, Oligohymenophorea) strains revealed by rDNA and mtDNA sequences.

Science.gov (United States)

Przyboś, Ewa; Tarcz, Sebastian; Greczek-Stachura, Magdalena; Surmacz, Marta

2011-05-01

Paramecium pentaurelia is one of 15 known sibling species of the Paramecium aurelia complex. It is recognized as a species showing no intra-specific differentiation on the basis of molecular fingerprint analyses, whereas the majority of other species are polymorphic. This study aimed at assessing genetic polymorphism within P. pentaurelia including new strains recently found in Poland (originating from two water bodies, different years, seasons, and clones of one strain) as well as strains collected from distant habitats (USA, Europe, Asia), and strains representing other species of the complex. We compared two DNA fragments: partial sequences (349 bp) of the LSU rDNA and partial sequences (618 bp) of cytochrome B gene. A correlation between the geographical origin of the strains and the genetic characteristics of their genotypes was not observed. Different genotypes were found in Kraków in two types of water bodies (Opatkowice-natural pond; Jordan's Park-artificial pond). Haplotype diversity within a single water body was not recorded. Likewise, seasonal haplotype differences between the strains within the artificial water body, as well as differences between clones originating from one strain, were not detected. The clustering of some strains belonging to different species was observed in the phylogenies. Copyright © 2010 Elsevier GmbH. All rights reserved.

Electronic fingerprinting of the dead.

Science.gov (United States)

Rutty, G N; Stringer, K; Turk, E E

2008-01-01

To date, a number of methods exist for the capture of fingerprints from cadavers that can then be used in isolation as a primary method for the identification of the dead. We report the use of a handheld, mobile wireless unit used in conjunction with a personal digital assistant (PDA) device for the capture of fingerprints from the dead. We also consider a handheld single-digit fingerprint scanner that utilises a USB laptop connection for the electronic capture of cadaveric fingerprints. Both are single-operator units that, if ridge detail is preserved, can collect a 10-set of finger pad prints in approximately 45 and 90 s, respectively. We present our observations on the restrictions as to when such devices can be used with cadavers. We do, however, illustrate that the images are of sufficient quality to allow positive identification from finger pad prints of the dead. With the development of mobile, handheld, biometric, PDA-based units for the police, we hypothesize that, under certain circumstances, devices such as these could be used for the accelerated acquisition of fingerprint identification data with the potential for rapid near-patient identification in the future.

Expression profiling on high-density DNA grids to detect novel targets in dendritic cells

International Nuclear Information System (INIS)

Weissmann, M.

2000-10-01

Gene expression analyzes on a large scale using DNA microarrays is a novel approach to study transcription of thousands of genes in parallel. By comparing gene expression profiles of different cell-types and of cells in different activation, novel regulatory networks will be identified that are unique to a cell-type and hence, important in its biological function. Among the differentially expressed genes many novel drug targets will be found. The Genetic department of the Novartis Research Institute was following this approach to identify novel genes, which are critical in the antigen presenting function of DCs and could become promising drug targets. Drugs that modulate effector functions of DCs towards induction of energy or tolerance in T-cells could be useful in the treatment of chronic inflammatory or autoimmune diseases. By using specific robotics equipment high-density cDNA grids on nylon membranes have been produced for hybridizations with various radioactive labeled DNA probes. By our format, based on 384 well plates and limited by the resolution power of our current image analysis software, 27.648 cDNA clones, bacterial colonies or pure DNA, were spotted on one filter. For RNA profiling, we generated filters containing a collection of genes expressed in peripheral blood DCs or monocytes and characterized by oligonucleotide fingerprinting (ONF) as being differentially expressed. The gene collection contained many unknown genes. Sequence analysis of to date 18.000 cDNA clones led to an estimate of 5.000 non-redundant genes being represented in the collection. 10 % of them are either completely unknown or homologous to rare ESTs (expressed sequence tags) in the public EST database. These clones occurred predominantly in small fingerprint clusters and were therefore assumed to be rarely expressed in DCs or monocytes. Some of those genes may become novel drug targets if their expression is DC specific or induced by external stimuli driving DCs into

Fingerprinting of near-homogeneous DNA ligase I and II from human cells. Similarity of their AMP-binding domains.

Science.gov (United States)

Yang, S W; Becker, F F; Chan, J Y

1990-10-25

DNA ligases play obligatory roles during replication, repair, and recombination. Multiple forms of DNA ligase have been reported in mammalian cells including DNA ligase I, the high molecular mass species which functions during replication, and DNA ligase II, the low molecular mass species which is associated with repair. In addition, alterations in DNA ligase activities have been reported in acute lymphocytic leukemia cells, Bloom's syndrome cells, and cells undergoing differentiation and development. To better distinguish the biochemical and molecular properties of the various DNA ligases from human cells, we have developed a method of purifying multiple species of DNA ligase from HeLa cells by chromatography through DEAE-Bio-Gel, CM-Bio-Gel, hydroxylapatite, Sephacryl S-300, Mono P, and DNA-cellulose. DNA-cellulose chromatography of the partially purified enzymes resolved multiple species of DNA ligase after labeling the enzyme with [alpha-32P]ATP to form the ligase-[32P]AMP adduct. The early eluting enzyme activity (0.25 M NaCl) contained a major 67-kDa-labeled protein, while the late eluting activity (0.48 M NaCl) contained two major labeled proteins of 90 and 78 kDa. Neutralization experiments with antiligase I antibodies indicated that the early and late eluting activity peaks were DNA ligase II and I, respectively. The three major ligase-[32P]AMP polypeptides (90, 78, and 67 kDa) were subsequently purified to near homogeneity by elution from preparative sodium dodecyl sulfate-polyacrylamide gels. All three polypeptides retained DNA ligase activities after gel elution and renaturation. To further reveal the relationship between these enzymes, partial digestion by V8-protease was performed. All three purified polypeptides gave rise to a common 22-kDa-labeled fragment for their AMP-binding domains, indicating that the catalytic sites of ligase I and II are quite similar, if not identical. Similar findings were obtained from the two-dimensional gel

A Computational Discriminability Analysis on Twin Fingerprints

Science.gov (United States)

Liu, Yu; Srihari, Sargur N.

Sharing similar genetic traits makes the investigation of twins an important study in forensics and biometrics. Fingerprints are one of the most commonly found types of forensic evidence. The similarity between twins’ prints is critical establish to the reliability of fingerprint identification. We present a quantitative analysis of the discriminability of twin fingerprints on a new data set (227 pairs of identical twins and fraternal twins) recently collected from a twin population using both level 1 and level 2 features. Although the patterns of minutiae among twins are more similar than in the general population, the similarity of fingerprints of twins is significantly different from that between genuine prints of the same finger. Twins fingerprints are discriminable with a 1.5%~1.7% higher EER than non-twins. And identical twins can be distinguished by examine fingerprint with a slightly higher error rate than fraternal twins.

Fingerprinting with Wow

Science.gov (United States)

Yu, Eugene; Craver, Scott

2006-02-01

Wow, or time warping caused by speed fluctuations in analog audio equipment, provides a wealth of applications in watermarking. Very subtle temporal distortion has been used to defeat watermarks, and as components in watermarking systems. In the image domain, the analogous warping of an image's canvas has been used both to defeat watermarks and also proposed to prevent collusion attacks on fingerprinting systems. In this paper, we explore how subliminal levels of wow can be used for steganography and fingerprinting. We present both a low-bitrate robust solution and a higher-bitrate solution intended for steganographic communication. As already observed, such a fingerprinting algorithm naturally discourages collusion by averaging, owing to flanging effects when misaligned audio is averaged. Another advantage of warping is that even when imperceptible, it can be beyond the reach of compression algorithms. We use this opportunity to debunk the common misconception that steganography is impossible under "perfect compression."

Using DNA barcoding to differentiate invasive Dreissena species (Mollusca, Bivalvia

Directory of Open Access Journals (Sweden)

Jonathan Marescaux

2013-12-01

Full Text Available The zebra mussel (Dreissena polymorpha and the quagga mussel (Dreissena rostriformis bugensis are considered as the most competitive invaders in freshwaters of Europe and North America. Although shell characteristics exist to differentiate both species, phenotypic plasticity in the genus Dreissena does not always allow a clear identification. Therefore, the need to find an accurate identification method is essential. DNA barcoding has been proven to be an adequate procedure to discriminate species. The cytochrome c oxidase subunit 1 mitochondrial gene (COI is considered as the standard barcode for animals. We tested the use of this gene as an efficient DNA barcode and found that it allow rapid and accurate identification of adult Dreissena individuals.

Using DNA barcoding to differentiate invasive Dreissena species (Mollusca, Bivalvia).

Science.gov (United States)

Marescaux, Jonathan; Van Doninck, Karine

2013-12-30

The zebra mussel (Dreissena polymorpha) and the quagga mussel (Dreissena rostriformis bugensis) are considered as the most competitive invaders in freshwaters of Europe and North America. Although shell characteristics exist to differentiate both species, phenotypic plasticity in the genus Dreissena does not always allow a clear identification. Therefore, the need to find an accurate identification method is essential. DNA barcoding has been proven to be an adequate procedure to discriminate species. The cytochrome c oxidase subunit I mitochondrial gene (COI) is considered as the standard barcode for animals. We tested the use of this gene as an efficient DNA barcode and found that it allow rapid and accurate identification of adult Dreissena individuals.

Enhance Criminal Investigation by Proposed Fingerprint Recognition System

International Nuclear Information System (INIS)

Hashem, S.H.; Maolod, A.T.; Mohammad, A.A.

2014-01-01

Law enforcement officers and forensic specialists spend hours thinking about how fingerprints solve crimes, and trying to find, collect, record and compare these unique identifiers that can connect a specific person to a specific crime. These individuals understand that a basic human feature that most people take for granted, can be one of the most effective tools in crime solving.This research exploits our previous work to be applicable in criminal investigation field. The present study aims to solve the advance crime by strength fingerprint’s criminal investigation to control the alterations happen intentionally to criminals’ fingerprint. That done by suggest strategy introduce an optimal fingerprint image feature’s vector to the person and then considers it to be stored in database for future matching. Selecting optimal fingerprint feature’s vector strategy deal with considering 10 fingerprints for each criminal person (take the fingerprint in different time and different circumstance of criminal such as finger is dirty, wet, trembling, etc.). Proposal begun with apply a proposed enrollment on all 10 fingerprint for each criminal, the enrollment include the following consequence steps; begin with preprocessing step for each of 10 images including enhancement, then two level of feature extraction (first level to extract arches, whorls, and loops, where second level extract minutiae), after that applying proposed Genetic Algorithm to select optimal fingerprint, master fingerprint, which in our point of view present the most universal image which include more detailed features to recognition. Master fingerprint will be feature’s vector which stored in database. Then apply the proposed matching by testing fingerprints with these stored in database.While, measuring of criminal fingerprint investigation performance by calculating False Reject Rate (FRR)and False Accept Rate (FAR) for the traditional system and the proposed in criminal detection field. The

Update on the use of random 10-mers in mapping and fingerprinting genomes

International Nuclear Information System (INIS)

Sinibaldi, R.M.

2001-01-01

The use of Randomly Amplified Polymorphic DNA (RAPDs) has continued to grow for the last several years. A quick assessment of their use can be estimated by searching PubMed at the National Library of Medicine with the acronym RAPD. Since their first report in 1990, the number of citations with RAPD in them has increased from 12 in 1990, to 45 in 1991, to, 112 in 1993, to, 130 in 1994, to 223 in 1995, to 258 in 1996, to 236 in 1997, to 316 in 1998, to 196 to date (August 31) 1999. The utilization of 10-mers for mapping or fingerprinting has many advantages. These include a relatively low cost, no use of radioactivity, easily adapted to automation, requirement for very small amounts of input DNA, rapid results, existing data bases for many organisms, and low cost equipment requirements. In conjunction with a derived technology such as SCARs (sequence characterized amplified regions), it can provide cost effective and thorough methods for mapping and fingerprinting any genome. Newer methods based on microarray technology may offer powerful but expensive alternative approaches in determining genetic diversity. The costs of arrays should come down with time and improved production methods. In the meantime, RAPDs remain a competent and cost effective method for genome characterizations. (author)

Using Differential Evolution to Optimize Learning from Signals and Enhance Network Security

Energy Technology Data Exchange (ETDEWEB)

Harmer, Paul K [Air Force Institute of Technology; Temple, Michael A [Air Force Institute of Technology; Buckner, Mark A [ORNL; Farquhar, Ethan [ORNL

2011-01-01

Computer and communication network attacks are commonly orchestrated through Wireless Access Points (WAPs). This paper summarizes proof-of-concept research activity aimed at developing a physical layer Radio Frequency (RF) air monitoring capability to limit unauthorizedWAP access and mprove network security. This is done using Differential Evolution (DE) to optimize the performance of a Learning from Signals (LFS) classifier implemented with RF Distinct Native Attribute (RF-DNA) fingerprints. Performance of the resultant DE-optimized LFS classifier is demonstrated using 802.11a WiFi devices under the most challenging conditions of intra-manufacturer classification, i.e., using emissions of like-model devices that only differ in serial number. Using identical classifier input features, performance of the DE-optimized LFS classifier is assessed relative to a Multiple Discriminant Analysis / Maximum Likelihood (MDA/ML) classifier that has been used for previous demonstrations. The comparative assessment is made using both Time Domain (TD) and Spectral Domain (SD) fingerprint features. For all combinations of classifier type, feature type, and signal-to-noise ratio considered, results show that the DEoptimized LFS classifier with TD features is uperior and provides up to 20% improvement in classification accuracy with proper selection of DE parameters.

ORIENTATION FIELD RECONSTRUCTION OF ALTERED FINGERPRINT USING ORTHOGONAL WAVELETS

Directory of Open Access Journals (Sweden)

Mini M.G.

2016-11-01

Full Text Available Ridge orientation field is an important feature for fingerprint matching and fingerprint reconstruction. Matching of the altered fingerprint against its unaltered mates can be done by extracting the available features in the altered fingerprint and using it along with approximated ridge orientation. This paper presents a method for approximating ridge orientation field of altered fingerprints. In the proposed method, sine and cosine of doubled orientation of the fingerprint is decomposed using orthogonal wavelets and reconstructed back using only the approximation coefficients. No prior information about the singular points is needed for orientation approximation. The method is found suitable for orientation estimation of low quality fingerprint images also.

Effect of Cassia hirsuta (L) extract on DNA profile of some ...

African Journals Online (AJOL)

The effect of ethanol extract of leaf of Cassia hirsute (L) on the DNA profile of some selected pathogenic microorganisms were investigated using PCR-RAPD analysis to generate DNA fingerprint. The change in molecular configuration of organisms with and without extract shows a wide disparity between the sensitive and ...

Molecular Typing of Borrelia burgdorferi Sensu Lato by Randomly Amplified Polymorphic DNA Fingerprinting Analysis

Science.gov (United States)

Wang, Guiqing; van Dam, Alje P.; Spanjaard, Lodewijk; Dankert, Jacob

1998-01-01

To study whether pathogenic clusters of Borrelia burgdorferi sensu lato strains occur, we typed 136 isolates, cultured from specimens from patients (n = 49) with various clinical entities and from ticks (n = 83) or dogs (n = 4) from different geographic regions, by randomly amplified polymorphic DNA (RAPD) fingerprinting with four arbitrary primers. The RAPD patterns were reproducible up to the 95% similarity level as shown in duplicate experiments. In these experiments the purified DNAs prepared on different days, from different colonies, and after various passages were used as templates. With an intergroup difference of 55%, the 136 strains could be divided into seven genetic clusters. Six clusters comprised and corresponded to the established species B. burgdorferi sensu stricto (n = 23), Borrelia garinii (n = 39), Borrelia afzelii (n = 59), Borrelia japonica (n = 1), Borrelia valaisiana (n = 12), and genomic group DN127 (n = 1). One strain from a patient with erythema migrans (EM) did not belong to any of the species or genomic groups known up to now. The RAPD types of B. burgdorferi sensu stricto, B. garinii, and B. afzelii isolates, which may give rise to human Lyme borreliosis (LB), were associated with their geographic origins. A high degree of genetic diversity was observed among the 39 B. garinii strains, and six subgroups could be recognized. One of these comprised eight isolates from patients with disseminated LB only and no tick isolates. B. afzelii strains from patients with EM or acrodermatitis chronica atrophicans were not clustered in particular branches. Our study showed that RAPD analysis is a powerful tool for discriminating different Borrelia species as well as Borrelia isolates within species. PMID:9508310

Three-dimensional imaging of artificial fingerprint by optical coherence tomography

Science.gov (United States)

Larin, Kirill V.; Cheng, Yezeng

2008-03-01

Fingerprint recognition is one of the popular used methods of biometrics. However, due to the surface topography limitation, fingerprint recognition scanners are easily been spoofed, e.g. using artificial fingerprint dummies. Thus, biometric fingerprint identification devices need to be more accurate and secure to deal with different fraudulent methods including dummy fingerprints. Previously, we demonstrated that Optical Coherence Tomography (OCT) images revealed the presence of the artificial fingerprints (made from different household materials, such as cement and liquid silicone rubber) at all times, while the artificial fingerprints easily spoofed the commercial fingerprint reader. Also we demonstrated that an analysis of the autocorrelation of the OCT images could be used in automatic recognition systems. Here, we exploited the three-dimensional (3D) imaging of the artificial fingerprint by OCT to generate vivid 3D image for both the artificial fingerprint layer and the real fingerprint layer beneath. With the reconstructed 3D image, it could not only point out whether there exists an artificial material, which is intended to spoof the scanner, above the real finger, but also could provide the hacker's fingerprint. The results of these studies suggested that Optical Coherence Tomography could be a powerful real-time noninvasive method for accurate identification of artificial fingerprints real fingerprints as well.

The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

International Nuclear Information System (INIS)

Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

2012-01-01

Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

Energy Technology Data Exchange (ETDEWEB)

Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

2012-11-15

Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

Detection of DNA polymorphisms in Dendrobium Sonia White mutant lines

International Nuclear Information System (INIS)

Affrida Abu Hassan; Putri Noor Faizah Megat Mohd Tahir; Zaiton Ahmad; Mohd Nazir Basiran

2006-01-01

Dendrobium Sonia white mutant lines were obtained through gamma ray induced mutation of purple flower Dendrobium Sonia at dosage 35 Gy. Amplified Fragment Length Polymorphism (AFLP) technique was used to compare genomic variations in these mutant lines with the control. Our objectives were to detect polymorphic fragments from these mutants to provide useful information on genes involving in flower colour expression. AFLP is a PCR based DNA fingerprinting technique. It involves digestion of DNA with restriction enzymes, ligation of adapter and selective amplification using primer with one (pre-amplification) and three (selective amplification) arbitrary nucleotides. A total number of 20 primer combinations have been tested and 7 produced clear fingerprint patterns. Of these, 13 polymorphic bands have been successfully isolate and cloned. (Author)

8 CFR 1236.5 - Fingerprints and photographs.

Science.gov (United States)

2010-01-01

... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Fingerprints and photographs. 1236.5... ORDERED REMOVED Detention of Aliens Prior to Order of Removal § 1236.5 Fingerprints and photographs. Every... photographed. Such fingerprints and photographs shall be made available to Federal, State, and local law...

Near-Optimal Fingerprinting with Constraints

Directory of Open Access Journals (Sweden)

Gulyás Gábor György

2016-10-01

Full Text Available Several recent studies have demonstrated that people show large behavioural uniqueness. This has serious privacy implications as most individuals become increasingly re-identifiable in large datasets or can be tracked, while they are browsing the web, using only a couple of their attributes, called as their fingerprints. Often, the success of these attacks depends on explicit constraints on the number of attributes learnable about individuals, i.e., the size of their fingerprints. These constraints can be budget as well as technical constraints imposed by the data holder. For instance, Apple restricts the number of applications that can be called by another application on iOS in order to mitigate the potential privacy threats of leaking the list of installed applications on a device. In this work, we address the problem of identifying the attributes (e.g., smartphone applications that can serve as a fingerprint of users given constraints on the size of the fingerprint. We give the best fingerprinting algorithms in general, and evaluate their effectiveness on several real-world datasets. Our results show that current privacy guards limiting the number of attributes that can be queried about individuals is insufficient to mitigate their potential privacy risks in many practical cases.

Reliable differentiation of Meyerozyma guilliermondii from Meyerozyma caribbica by internal transcribed spacer restriction fingerprinting.

Science.gov (United States)

Romi, Wahengbam; Keisam, Santosh; Ahmed, Giasuddin; Jeyaram, Kumaraswamy

2014-02-28

Meyerozyma guilliermondii (anamorph Candida guilliermondii) and Meyerozyma caribbica (anamorph Candida fermentati) are closely related species of the genetically heterogenous M. guilliermondii complex. Conventional phenotypic methods frequently misidentify the species within this complex and also with other species of the Saccharomycotina CTG clade. Even the long-established sequencing of large subunit (LSU) rRNA gene remains ambiguous. We also faced similar problem during identification of yeast isolates of M. guilliermondii complex from indigenous bamboo shoot fermentation in North East India. There is a need for development of reliable and accurate identification methods for these closely related species because of their increasing importance as emerging infectious yeasts and associated biotechnological attributes. We targeted the highly variable internal transcribed spacer (ITS) region (ITS1-5.8S-ITS2) and identified seven restriction enzymes through in silico analysis for differentiating M. guilliermondii from M. caribbica. Fifty five isolates of M. guilliermondii complex which could not be delineated into species-specific taxonomic ranks by API 20 C AUX and LSU rRNA gene D1/D2 sequencing were subjected to ITS-restriction fragment length polymorphism (ITS-RFLP) analysis. TaqI ITS-RFLP distinctly differentiated the isolates into M. guilliermondii (47 isolates) and M. caribbica (08 isolates) with reproducible species-specific patterns similar to the in silico prediction. The reliability of this method was validated by ITS1-5.8S-ITS2 sequencing, mitochondrial DNA RFLP and electrophoretic karyotyping. We herein described a reliable ITS-RFLP method for distinct differentiation of frequently misidentified M. guilliermondii from M. caribbica. Even though in silico analysis differentiated other closely related species of M. guilliermondii complex from the above two species, it is yet to be confirmed by in vitro analysis using reference strains. This method can be used

Multidisciplinary fingerprints: forensic reconstruction of an insect reinvasion

Science.gov (United States)

Kim, Kyung Seok; Jones, Gretchen D.; Westbrook, John K.; Sappington, Thomas W.

2010-01-01

An unexpected outbreak of boll weevils, Anthonomus grandis, an insect pest of cotton, across the Southern Rolling Plains (SRP) eradication zone of west-central Texas, USA, was detected soon after passage of Tropical Storm Erin through the Winter Garden district to the south on 16 August 2007. The synchrony and broad geographic distribution of the captured weevils suggest that long-distance dispersal was responsible for the reinvasion. We integrated three types of assessment to reconstruct the geographic origin of the immigrants: (i) DNA fingerprinting; (ii) pollen fingerprinting; and (iii) atmospheric trajectory analysis. We hypothesized the boll weevils originated in the Southern Blacklands zone near Cameron, or in the Winter Garden district near Uvalde, the nearest regions with substantial populations. Genetic tests broadly agree that the immigrants originated southeast of the SRP zone, probably in regions represented by Uvalde or Weslaco. The SRP pollen profile from weevils matched that of Uvalde better than that of Cameron. Wind trajectories supported daily wind-aided dispersal of weevils from the Uvalde region to the SRP from 17 to 24 August, but failed to support migration from the Cameron region. Taken together the forensic evidence strongly implicates the Winter Garden district near Uvalde as the source of reinvading boll weevils. PMID:19828497

Attendance fingerprint identification system using arduino and single board computer

Science.gov (United States)

Muchtar, M. A.; Seniman; Arisandi, D.; Hasanah, S.

2018-03-01

Fingerprint is one of the most unique parts of the human body that distinguishes one person from others and is easily accessed. This uniqueness is supported by technology that can automatically identify or recognize a person called fingerprint sensor. Yet, the existing Fingerprint Sensor can only do fingerprint identification on one machine. For the mentioned reason, we need a method to be able to recognize each user in a different fingerprint sensor. The purpose of this research is to build fingerprint sensor system for fingerprint data management to be centralized so identification can be done in each Fingerprint Sensor. The result of this research shows that by using Arduino and Raspberry Pi, data processing can be centralized so that fingerprint identification can be done in each fingerprint sensor with 98.5 % success rate of centralized server recording.

Security and matching of partial fingerprint recognition systems

Science.gov (United States)

Jea, Tsai-Yang; Chavan, Viraj S.; Govindaraju, Venu; Schneider, John K.

2004-08-01

Despite advances in fingerprint identification techniques, matching incomplete or partial fingerprints still poses a difficult challenge. While the introduction of compact silicon chip-based sensors that capture only a part of the fingerprint area have made this problem important from a commercial perspective, there is also considerable interest on the topic for processing partial and latent fingerprints obtained at crime scenes. Attempts to match partial fingerprints using singular ridge structures-based alignment techniques fail when the partial print does not include such structures (e.g., core or delta). We present a multi-path fingerprint matching approach that utilizes localized secondary features derived using only the relative information of minutiae. Since the minutia-based fingerprint representation, is an ANSI-NIST standard, our approach has the advantage of being directly applicable to already existing databases. We also analyze the vulnerability of partial fingerprint identification systems to brute force attacks. The described matching approach has been tested on one of FVC2002"s DB1 database11. The experimental results show that our approach achieves an equal error rate of 1.25% and a total error rate of 1.8% (with FAR at 0.2% and FRR at 1.6%).

Entropy based fingerprint for local crystalline order

Science.gov (United States)

Piaggi, Pablo M.; Parrinello, Michele

2017-09-01

We introduce a new fingerprint that allows distinguishing between liquid-like and solid-like atomic environments. This fingerprint is based on an approximate expression for the entropy projected on individual atoms. When combined with local enthalpy, this fingerprint acquires an even finer resolution and it is capable of discriminating between different crystal structures.

Forensic Chemistry: The Revelation of Latent Fingerprints

Science.gov (United States)

Friesen, J. Brent

2015-01-01

The visualization of latent fingerprints often involves the use of a chemical substance that creates a contrast between the fingerprint residues and the surface on which the print was deposited. The chemical-aided visualization techniques can be divided into two main categories: those that chemically react with the fingerprint residue and those…

FINGERPRINT DETECTION AND RECOGNIZATION TECHNIQUES USING GABOR FILTER

OpenAIRE

Yogita Verma*, Prof. Bhagwati Charan Patel

2017-01-01

Fingerprints are most extensively and effectively appropriate for the proof of identity in present days. Mostly because of their uniqueness among the people, public acceptance, originality, stability through life, and their least risk of invasion. Fingerprint technology, which is basically a biometric system, is utilized to identify an individual based on their physical qualities. Fingerprint matching is the trendiest biometric method appropriate to provide authentication. Fingerprint verific...

Interoperability between Fingerprint Biometric Systems: An Empirical Study

OpenAIRE

Gashi, I.; Mason, S.; Lugini, L.; Marasco, E.; Cukic, B.

2014-01-01

Fingerprints are likely the most widely used biometric in commercial as well as law enforcement applications. With the expected rapid growth of fingerprint authentication in mobile devices their importance justifies increased demands for dependability. An increasing number of new sensors,applications and a diverse user population also intensify concerns about the interoperability in fingerprint authentication. In most applications, fingerprints captured for user enrollment with one device may...

A medium resolution fingerprint matching system

Directory of Open Access Journals (Sweden)

Ayman Mohammad Bahaa-Eldin

2013-09-01

Full Text Available In this paper, a novel minutiae based fingerprint matching system is proposed. The system is suitable for medium resolution fingerprint images obtained by low cost commercial sensors. The paper presents a new thinning algorithm, a new features extraction and representation, and a novel feature distance matching algorithm. The proposed system is rotation and translation invariant and is suitable for complete or partial fingerprint matching. The proposed algorithms are optimized to be executed on low resource environments both in CPU power and memory space. The system was evaluated using a standard fingerprint dataset and good performance and accuracy were achieved under certain image quality requirements. In addition, the proposed system was compared favorably to that of the state of the art systems.

Information Theoretical Analysis of Identification based on Active Content Fingerprinting

OpenAIRE

Farhadzadeh, Farzad; Willems, Frans M. J.; Voloshinovskiy, Sviatoslav

2014-01-01

Content fingerprinting and digital watermarking are techniques that are used for content protection and distribution monitoring. Over the past few years, both techniques have been well studied and their shortcomings understood. Recently, a new content fingerprinting scheme called {\\em active content fingerprinting} was introduced to overcome these shortcomings. Active content fingerprinting aims to modify a content to extract robuster fingerprints than the conventional content fingerprinting....

Fingerprint matching with optical coherence tomography

CSIR Research Space (South Africa)

Moolla, Y

2015-12-01

Full Text Available Fingerprint recognition is an important security technique with a steadily growing usage for the identification and verification of individuals. However, current fingerprint acquisition systems have certain disadvantages, which include...

Localization of DNA methyltransferase-1 during oocyte differentiation, in vitro maturation and early embryonic development in cow

Directory of Open Access Journals (Sweden)

A. M. Luciano

2009-12-01

Full Text Available DNA methyltransferase-1 (Dnmt1 is involved in the maintenance of DNA methylation patterns and is crucial for normal mammalian development. The aim of the present study was to assess the localization of Dnmt1 in cow, during the latest phases of oocyte differentiation and during the early stages of segmentation. Dnmt1 expression and localization were assessed in oocytes according to the chromatin configuration, which in turn provides an important epigenetic mechanism for the control of global gene expression and represents a morphological marker of oocyte differentiation.We found that the initial chromatin condensation was accompanied by a slight increase in the level of global DNA methylation, as assessed by 5-methyl-cytosine immunostaining followed by laser scanning confocal microscopy analysis (LSCM. RT-PCR confirmed the presence of Dnmt1 transcripts throughout this phase of oocyte differentiation. Analogously, Dnmt1 immunodetection and LSCM indicated that the protein was always present and localized in the cytoplasm, regardless the chromatin configuration and the level of global DNA methylation. Moreover, our data indicate that while Dnmt1 is retained in the cytoplasm in metaphase II stage oocytes and zygotes, it enters the nuclei of 8-16 cell stage embryos. As suggested in mouse, the functional meaning of the presence of Dnmt1 in the bovine embryo nuclei could be the maintainement of the methylation pattern of imprinted genes. In conclusion, the present work provides useful elements for the study of Dnmt1 function during the late stage of oocyte differentiation, maturation and early embryonic development in mammals.

Sex Determination from Fingerprint Ridge Density | Gungadin ...

African Journals Online (AJOL)

This study was conducted with an aim to establish a relationship between sex and fingerprint ridge density. The fingerprints were taken from 500 subjects (250 males and 250 females) in the age group of 18-60 years. After taking fingerprints, the ridges were counted in the upper portion of the radial border of each print for all ...

Evidence of transmission of Mycobacterium tuberculosis by random amplified polymorphic DNA (RAPD) fingerprinting in Taipei City, Taiwan.

Science.gov (United States)

Harn, H J; Shen, K L; Ho, L I; Yu, K W; Liu, G C; Yueh, K C; Lee, J H

1997-01-01

AIMS: To determine, by strain identification of Mycobacterium tuberculosis, whether transmission has occurred between individuals or whether new strains are present. METHODS: A rapid protocol for random amplified polymorphic DNA (RAPD) analysis was developed. This protocol was applied to 64 strains of M tuberculosis that had been confirmed by culture and microbiological methods. RESULTS: There are five groups of M tuberculosis prevalent in Taipei city, Taiwan. The major types are groups I and III. Groups I and II had been prevalent until the end of last year when, according to our group analysis, they had been eradicated. However, group III was continuously present from the middle of 1995 to the middle of 1996, and group IV was present at the end of both years, which indicated that both groups were transmitted continuously. These clustered strains had demographic characteristics consistent with a finding of transmission tuberculosis. Also, there were 13 of 64 strains with unique RAPD fingerprints that were inferred to be due primarily to the reactivation of infection. In the drug resistance analysis, the major type represented included group III and part of group IV. CONCLUSIONS: Our preliminary data imply, not only that the prevalence of M tuberculosis in Taipei city is due to transmission rather than reactivation, but that drug resistance also may play a role in tuberculosis transmission. Images PMID:9378819

Integrated fingerprinting in secure digital cinema projection

Science.gov (United States)

Delannay, Damien; Delaigle, Jean-Francois; Macq, Benoit M. M.; Quisquater, Jean-Jacques; Mas Ribes, Joan M.; Boucqueau, Jean M.; Nivart, Jean-Francois

2001-12-01

This paper describes the functional model of a combined conditional access and fingerprinting copyright (-or projectionright) protection system in a digital cinema framework. In the cinema industry, a large part of early movie piracy comes from copies made in the theater itself with a camera. The evolution towards digital cinema broadcast enables watermark based fingerprinting protection systems. Besides an appropriate fingerprinting technology, a number of well defined security/cryptographic tools are integrated in order to guaranty the integrity of the whole system. The requirements are two-fold: On one side, we must ensure that the media content is only accessible at exhibition time (under specific authorization obtained after an ad-hoc film rental agreement) and contains the related exhibition fingerprint. At the other end, we must prove our ability to retrieve the fingerprint information from an illegal copy of the media.

Enhancing security of fingerprints through contextual biometric watermarking.

Science.gov (United States)

Noore, Afzel; Singh, Richa; Vatsa, Mayank; Houck, Max M

2007-07-04

This paper presents a novel digital watermarking technique using face and demographic text data as multiple watermarks for verifying the chain of custody and protecting the integrity of a fingerprint image. The watermarks are embedded in selected texture regions of a fingerprint image using discrete wavelet transform. Experimental results show that modifications in these locations are visually imperceptible and maintain the minutiae details. The integrity of the fingerprint image is verified through the high matching scores obtained from an automatic fingerprint identification system. There is also a high degree of visual correlation between the embedded images, and the extracted images from the watermarked fingerprint. The degree of similarity is computed using pixel-based metrics and human visual system metrics. The results also show that the proposed watermarked fingerprint and the extracted images are resilient to common attacks such as compression, filtering, and noise.

Multilocus DNA fingerprinting in paternity analysis: a Chilean experience

Directory of Open Access Journals (Sweden)

Cifuentes O. Lucía

2000-01-01

Full Text Available DNA polymorphism is very useful in paternity analysis. The present paper describes paternity studies done using DNA profiles obtained with the (CAC5 probe. All of the subjects studied were involved in nonjudicial cases of paternity. Genomic DNA digested with HaeIII was run on agarose gels and hybridized in the gel with the (CAC5 probe labeled with 32P. The mean number of bands larger than the 4.3 kb per individual was 16.1. The mean proportion of bands shared among unrelated individuals was 0.08 and the mean number of test bands was 7.1. This corresponded to an exclusion probability greater than 0.999999. Paternity was excluded in 34.5% of the cases. The mutation frequency estimated from non-excluded cases was 0.01143 bands per child. In these cases, the paternity was confirmed by a locus-specific analysis of eight independent PCR-based loci. The paternity index was computed in all non-excluded cases. It can be concluded that this method is a powerful and inexpensive alternative to solve paternity doubts.

Implementation of Minutiae Based Fingerprint Identification System Using Crossing Number Concept

Directory of Open Access Journals (Sweden)

Atul S. CHAUDHARI

2014-01-01

Full Text Available Biometric system is essentially a pattern recognition system which recognizes a person by determining the authenticity of a specific physiological (e.g., fingerprints, face, retina, iris or behavioral (e.g., gait, signature characteristic possessed by that person. Among all the presently employed biometric techniques, fingerprint identification systems have received the most attention due to the long history of fingerprints and its extensive use in forensics. Fingerprint is reliable biometric characteristic as it is unique and persistence. Fingerprint is the pattern of ridges and valleys on the surface of fingertip. However, recognizing fingerprints in poor quality images is still a very complex job, so the fingerprint image must be preprocessed before matching. It is very difficult to extract fingerprint features directly from gray scale fingerprint image. In this paper we have proposed the system which uses minutiae based matching algorithm for fingerprint identification. There are three main phases in proposed algorithm. First phase enhance the input fingerprint image by preprocessing it. The enhanced fingerprint image is converted into thinned binary image and then minutiae are extracted by using Crossing Number Concept in second phase. Third stage compares input fingerprint image (after preprocessing and minutiae extraction with fingerprint images enrolled in database and makes decision whether the input fingerprint is matched with the fingerprint stored in database or not.

Differential representation of sunflower ESTs in enriched organ-specific cDNA libraries in a small scale sequencing project

Directory of Open Access Journals (Sweden)

Heinz Ruth A

2003-09-01

Full Text Available Abstract Background Subtractive hybridization methods are valuable tools for identifying differentially regulated genes in a given tissue avoiding redundant sequencing of clones representing the same expressed genes, maximizing detection of low abundant transcripts and thus, affecting the efficiency and cost effectiveness of small scale cDNA sequencing projects aimed to the specific identification of useful genes for breeding purposes. The objective of this work is to evaluate alternative strategies to high-throughput sequencing projects for the identification of novel genes differentially expressed in sunflower as a source of organ-specific genetic markers that can be functionally associated to important traits. Results Differential organ-specific ESTs were generated from leaf, stem, root and flower bud at two developmental stages (R1 and R4. The use of different sources of RNA as tester and driver cDNA for the construction of differential libraries was evaluated as a tool for detection of rare or low abundant transcripts. Organ-specificity ranged from 75 to 100% of non-redundant sequences in the different cDNA libraries. Sequence redundancy varied according to the target and driver cDNA used in each case. The R4 flower cDNA library was the less redundant library with 62% of unique sequences. Out of a total of 919 sequences that were edited and annotated, 318 were non-redundant sequences. Comparison against sequences in public databases showed that 60% of non-redundant sequences showed significant similarity to known sequences. The number of predicted novel genes varied among the different cDNA libraries, ranging from 56% in the R4 flower to 16 % in the R1 flower bud library. Comparison with sunflower ESTs on public databases showed that 197 of non-redundant sequences (60% did not exhibit significant similarity to previously reported sunflower ESTs. This approach helped to successfully isolate a significant number of new reported sequences

An Efficient Reconfigurable Architecture for Fingerprint Recognition

Directory of Open Access Journals (Sweden)

Satish S. Bhairannawar

2016-01-01

Full Text Available The fingerprint identification is an efficient biometric technique to authenticate human beings in real-time Big Data Analytics. In this paper, we propose an efficient Finite State Machine (FSM based reconfigurable architecture for fingerprint recognition. The fingerprint image is resized, and Compound Linear Binary Pattern (CLBP is applied on fingerprint, followed by histogram to obtain histogram CLBP features. Discrete Wavelet Transform (DWT Level 2 features are obtained by the same methodology. The novel matching score of CLBP is computed using histogram CLBP features of test image and fingerprint images in the database. Similarly, the DWT matching score is computed using DWT features of test image and fingerprint images in the database. Further, the matching scores of CLBP and DWT are fused with arithmetic equation using improvement factor. The performance parameters such as TSR (Total Success Rate, FAR (False Acceptance Rate, and FRR (False Rejection Rate are computed using fusion scores with correlation matching technique for FVC2004 DB3 Database. The proposed fusion based VLSI architecture is synthesized on Virtex xc5vlx30T-3 FPGA board using Finite State Machine resulting in optimized parameters.

Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors

DEFF Research Database (Denmark)

Bisarro Dos Reis, Mariana; Barros-Filho, Mateus Camargo; Marchi, Fábio Albuquerque

2017-01-01

Context: Even though the majority of well-differentiated thyroid carcinoma (WDTC) is indolent, a number of cases display an aggressive behavior. Cumulative evidence suggests that the deregulation of DNA methylation has the potential to point out molecular markers associated with worse prognosis. ...

Prospect of bioflavonoid fisetin as a quadruplex DNA ligand: a biophysical approach.

Directory of Open Access Journals (Sweden)

Bidisha Sengupta

Full Text Available Quadruplex (G4 forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3',4',7-tetrahydroxyflavone in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand.

Prospect of Bioflavonoid Fisetin as a Quadruplex DNA Ligand: A Biophysical Approach

Science.gov (United States)

Sengupta, Bidisha; Pahari, Biswapathik; Blackmon, Laura; Sengupta, Pradeep K.

2013-01-01

Quadruplex (G4) forming sequences in telomeric DNA and c-myc promoter regions of human DNA are associated with tumorogenesis. Ligands that can facilitate or stabilize the formation and increase the stabilization of G4 can prevent tumor cell proliferation and have been regarded as potential anti-cancer drugs. In the present study, steady state and time-resolved fluorescence measurements provide important structural and dynamical insights into the free and bound states of the therapeutically potent plant flavonoid fisetin (3,3′,4′,7-tetrahydroxyflavone) in a G4 DNA matrix. The excited state intra-molecular proton transfer (ESPT) of fisetin plays an important role in observing and understanding the binding of fisetin with the G4 DNA. Differential absorption spectra, thermal melting, and circular dichroism spectroscopic studies provide evidences for the formation of G4 DNA and size exclusion chromatography (SEC) proves the binding and 1∶1 stoichiometry of fisetin in the DNA matrix. Comparative analysis of binding in the presence of EtBr proves that fisetin favors binding at the face of the G-quartet, mostly along the diagonal loop. Time resolved fluorescence anisotropy decay analysis indicates the increase in the restrictions in motion from the free to bound fisetin. We have also investigated the fingerprints of the binding of fisetin in the antiparallel quadruplex using Raman spectroscopy. Preliminary results indicate fisetin to be a prospective candidate as a G4 ligand. PMID:23785423

Fingerprint and Face Identification for Large User Population

Directory of Open Access Journals (Sweden)

Teddy Ko

2003-06-01

Full Text Available The main objective of this paper is to present the state-of-the-art of the current biometric (fingerprint and face technology, lessons learned during the investigative analysis performed to ascertain the benefits of using combined fingerprint and facial technologies, and recommendations for the use of current available fingerprint and face identification technologies for optimum identification performance for applications using large user population. Prior fingerprint and face identification test study results have shown that their identification accuracies are strongly dependent on the image quality of the biometric inputs. Recommended methodologies for ensuring the capture of acceptable quality fingerprint and facial images of subjects are also presented in this paper.

cDNA-SRAP and Its Application in Differential Gene Expression Analysis: A Case Study in Erianthus arundinaceum

Directory of Open Access Journals (Sweden)

Youxiong Que

2012-01-01

Full Text Available Erianthus arundinaceum is a wild relative species of sugarcane. The aim of this research was to demonstrate the feasibility of cDNA-SRAP for differential gene expression and to explore the molecular mechanism of drought resistance in E. arundinaceum. cDNA-SRAP technique, for the first time, was applied in the analysis of differential gene expression in E. arundinaceum under drought stress. In total, eight differentially expressed genes with length of 185–427 bp were successfully isolated (GenBank Accession numbers: EU071770, EU071772, EU071774, EU071776, EU071777, EU071779, EU071780, and EU071781. Based on their homologies with genes in GenBank, these genes were assumed to encode ribonuclease III, vacuolar protein, ethylene insensitive protein, aerobactin biosynthesis protein, photosystem II protein, glucose transporter, leucine-rich repeat protein, and ammonia monooxygenase. Real-time PCR analysis on the expression profiling of gene (EU071774 encoding ethylene-insensitive protein and gene (EU071781 encoding ammonia monooxygenase revealed that the expression of these two genes was upregulated both by PEG and ABA treatments, suggesting that they may involve in the drought resistance of E. arundinaceum. This study constitutes the first report of genes activated in E. arundinaceum by drought stress and opens up the application of cDNA-SRAP in differential gene expression analysis in E. arundinaceum under certain stress conditions.

Virulence properties and random amplification of polymorphic DNA ...

African Journals Online (AJOL)

Genotypic and phenotypic characterization as well as studies on the virulence factors of Candida albicans isolates obtained from oral cavity of patients was carried out using random amplified polymorphic DNA (RAPD) fingerprinting and epithelial cells adherence assay, respectively. RAPD patterns revealed the presence of ...

Generalized query-based active learning to identify differentially methylated regions in DNA.

Science.gov (United States)

Haque, Md Muksitul; Holder, Lawrence B; Skinner, Michael K; Cook, Diane J

2013-01-01

Active learning is a supervised learning technique that reduces the number of examples required for building a successful classifier, because it can choose the data it learns from. This technique holds promise for many biological domains in which classified examples are expensive and time-consuming to obtain. Most traditional active learning methods ask very specific queries to the Oracle (e.g., a human expert) to label an unlabeled example. The example may consist of numerous features, many of which are irrelevant. Removing such features will create a shorter query with only relevant features, and it will be easier for the Oracle to answer. We propose a generalized query-based active learning (GQAL) approach that constructs generalized queries based on multiple instances. By constructing appropriately generalized queries, we can achieve higher accuracy compared to traditional active learning methods. We apply our active learning method to find differentially DNA methylated regions (DMRs). DMRs are DNA locations in the genome that are known to be involved in tissue differentiation, epigenetic regulation, and disease. We also apply our method on 13 other data sets and show that our method is better than another popular active learning technique.

Biochemical fingerprinting of Vibrio parahaemolyticus by the PhenePlate system: comparison between pandemic and non-pandemic serotypes.

Science.gov (United States)

Rahman, Mokhlasur; Bhuiyan, N A; Kuhn, I; Ramamurthy, T; Rahman, M; Mollby, R; Nair, G Balakrish

2006-10-01

During recent years a pandemic clone of Vibrio parahaemolyticus has emerged. Isolates of this clone are distributed among several serotypes, but are genotypically related. In the present study, a phenotyping method (biochemical fingerprinting) was used to characterize pandemic and non-pandemic isolates belonging to V. parahaemolyticus. It was found that the pandemic isolates showed a high level of phenotypic homogeneity and a majority of the pandemic isolates belonged to the same biochemical phenotype, whereas non-pandemic V. parahemolyticus isolates were more heterogeneous. In conclusion, biochemical fingerprinting of V. parahaemolyticus can be used as a first screening method to differentiate between pandemic and non-pandemic isolates of V. parahaemolyticus.

Differentiation of Palaeogene sand by glauconitic and geochemical fingerprinting, Siri Canyon, Danish North Sea

Energy Technology Data Exchange (ETDEWEB)

Olivarius, M.; Knudsen, Christian; Svendsen, Johan B.

2011-07-01

The submarine Siri Canyon is NE-SW-oriented and located in the Danish North Sea. It contains a number of oil reservoirs with glauconite-rich sand. The reservoirs of interest in the Nini oil field are the Late Paleocene Tyr Member of the Lista Formation and the Kolga Member of the Sele Formation, presumably of Early Eocene age. These members have previously been known as the Ty and Hermod members. The sand shows signs of injection, both in cores and in seismic data. The aim of this work is to chemically characterise and fingerprint the sand in order to reveal the origin of the sand found in three horizontal wells, which could have been injected from one or both of the Tyr and Kolga members. Core samples were collected from two vertical wells of known stratigraphy to make a basis of comparison, whereas samples of the cuttings were collected from the three horizontal wells with ages primarily corresponding to the Kolga Member. The purpose was moreover to evaluate whether cuttings samples can be used for fingerprinting as an alternative to core samples. The interest in discriminating between the ages of the injected sand is the fact that the reservoir properties (porosity and permeability) are largely controlled by the original composition of the sand. Consequently, results from this study could affect the property modelling of the field. (LN)

OPTIMAL EXPERIMENT DESIGN FOR MAGNETIC RESONANCE FINGERPRINTING

OpenAIRE

Zhao, Bo; Haldar, Justin P.; Setsompop, Kawin; Wald, Lawrence L.

2016-01-01

Magnetic resonance (MR) fingerprinting is an emerging quantitative MR imaging technique that simultaneously acquires multiple tissue parameters in an efficient experiment. In this work, we present an estimation-theoretic framework to evaluate and design MR fingerprinting experiments. More specifically, we derive the Cram��r-Rao bound (CRB), a lower bound on the covariance of any unbiased estimator, to characterize parameter estimation for MR fingerprinting. We then formulate an optimal experi...

Image Processing and Features Extraction of Fingerprint Images ...

African Journals Online (AJOL)

To demonstrate the importance of the image processing of fingerprint images prior to image enrolment or comparison, the set of fingerprint images in databases (a) and (b) of the FVC (Fingerprint Verification Competition) 2000 database were analyzed using a features extraction algorithm. This paper presents the results of ...

SSR-Based DNA Fingerprinting and Diversity Assessment Among Indian Germplasm of Euryale ferox: an Aquatic Underutilized and Neglected Food Crop.

Science.gov (United States)

Kumar, Nitish; Shikha, Divya; Kumari, Swati; Choudhary, Binod Kumar; Kumar, Lokendra; Singh, Indu Shekhar

2017-10-30

Euryale ferox is native to Southeast Asia and China, and it is one of the important aquatic food crops propagated mostly in eastern part of India. The aim of the present study was to characterize and evaluate the genetic diversity of ex situ collections of E. ferox germplasm from different geographical states of India using microsatellite (simple sequence repeats (SSRs)) markers. Ten SSR markers were analyzed to assess DNA fingerprinting and genetic diversity of 16 cultivated germplasm of E. ferox. Total 37 polymorphic alleles were recorded with an average of 3.7 allele frequency per primer. The polymorphic information content value varied from 0.204 to 0.735 with mean of 0.448. A high range of heterozygosity (Ho 0.228; He 0.512) was detected in the present study. The neighbor-joining (N-J) tree and the principle coordinate analysis showed that the germplasm divided in to three main clusters. The results of the present investigation comply that SSR markers are effective for computing genetic assessment of genetic diversity and similarity with classifying cultivated varieties of E. ferox. Evaluation of genetic diversity among Indian E. ferox germplasm could provide useful information for genetic improvement.

FINGERPRINT MATCHING BASED ON PORE CENTROIDS

Directory of Open Access Journals (Sweden)

S. Malathi

2011-05-01

Full Text Available In recent years there has been exponential growth in the use of bio- metrics for user authentication applications. Automated Fingerprint Identification systems have become popular tool in many security and law enforcement applications. Most of these systems rely on minutiae (ridge ending and bifurcation features. With the advancement in sensor technology, high resolution fingerprint images (1000 dpi pro- vide micro level of features (pores that have proven to be useful fea- tures for identification. In this paper, we propose a new strategy for fingerprint matching based on pores by reliably extracting the pore features The extraction of pores is done by Marker Controlled Wa- tershed segmentation method and the centroids of each pore are con- sidered as feature vectors for matching of two fingerprint images. Experimental results shows that the proposed method has better per- formance with lower false rates and higher accuracy.

DNA methylation profiling of embryonic stem cell differentiation into the three germ layers.

Science.gov (United States)

Isagawa, Takayuki; Nagae, Genta; Shiraki, Nobuaki; Fujita, Takanori; Sato, Noriko; Ishikawa, Shumpei; Kume, Shoen; Aburatani, Hiroyuki

2011-01-01

Embryogenesis is tightly regulated by multiple levels of epigenetic regulation such as DNA methylation, histone modification, and chromatin remodeling. DNA methylation patterns are erased in primordial germ cells and in the interval immediately following fertilization. Subsequent developmental reprogramming occurs by de novo methylation and demethylation. Variance in DNA methylation patterns between different cell types is not well understood. Here, using methylated DNA immunoprecipitation and tiling array technology, we have comprehensively analyzed DNA methylation patterns at proximal promoter regions in mouse embryonic stem (ES) cells, ES cell-derived early germ layers (ectoderm, endoderm and mesoderm) and four adult tissues (brain, liver, skeletal muscle and sperm). Most of the methylated regions are methylated across all three germ layers and in the three adult somatic tissues. This commonly methylated gene set is enriched in germ cell-associated genes that are generally transcriptionally inactive in somatic cells. We also compared DNA methylation patterns by global mapping of histone H3 lysine 4/27 trimethylation, and found that gain of DNA methylation correlates with loss of histone H3 lysine 4 trimethylation. Our combined findings indicate that differentiation of ES cells into the three germ layers is accompanied by an increased number of commonly methylated DNA regions and that these tissue-specific alterations in methylation occur for only a small number of genes. DNA methylation at the proximal promoter regions of commonly methylated genes thus appears to be an irreversible mark which functions to fix somatic lineage by repressing the transcription of germ cell-specific genes.

Method for modeling post-mortem biometric 3D fingerprints

Science.gov (United States)

Rajeev, Srijith; Shreyas, Kamath K. M.; Agaian, Sos S.

2016-05-01

Despite the advancements of fingerprint recognition in 2-D and 3-D domain, authenticating deformed/post-mortem fingerprints continue to be an important challenge. Prior cleansing and reconditioning of the deceased finger is required before acquisition of the fingerprint. The victim's finger needs to be precisely and carefully operated by a medium to record the fingerprint impression. This process may damage the structure of the finger, which subsequently leads to higher false rejection rates. This paper proposes a non-invasive method to perform 3-D deformed/post-mortem finger modeling, which produces a 2-D rolled equivalent fingerprint for automated verification. The presented novel modeling method involves masking, filtering, and unrolling. Computer simulations were conducted on finger models with different depth variations obtained from Flashscan3D LLC. Results illustrate that the modeling scheme provides a viable 2-D fingerprint of deformed models for automated verification. The quality and adaptability of the obtained unrolled 2-D fingerprints were analyzed using NIST fingerprint software. Eventually, the presented method could be extended to other biometric traits such as palm, foot, tongue etc. for security and administrative applications.

Fingerprint enhancement using a multispectral sensor

Science.gov (United States)

Rowe, Robert K.; Nixon, Kristin A.

2005-03-01

The level of performance of a biometric fingerprint sensor is critically dependent on the quality of the fingerprint images. One of the most common types of optical fingerprint sensors relies on the phenomenon of total internal reflectance (TIR) to generate an image. Under ideal conditions, a TIR fingerprint sensor can produce high-contrast fingerprint images with excellent feature definition. However, images produced by the same sensor under conditions that include dry skin, dirt on the skin, and marginal contact between the finger and the sensor, are likely to be severely degraded. This paper discusses the use of multispectral sensing as a means to collect additional images with new information about the fingerprint that can significantly augment the system performance under both normal and adverse sample conditions. In the context of this paper, "multispectral sensing" is used to broadly denote a collection of images taken under different illumination conditions: different polarizations, different illumination/detection configurations, as well as different wavelength illumination. Results from three small studies using an early-stage prototype of the multispectral-TIR (MTIR) sensor are presented along with results from the corresponding TIR data. The first experiment produced data from 9 people, 4 fingers from each person and 3 measurements per finger under "normal" conditions. The second experiment provided results from a study performed to test the relative performance of TIR and MTIR images when taken under extreme dry and dirty conditions. The third experiment examined the case where the area of contact between the finger and sensor is greatly reduced.

Differential DNA methylation patterns of polycystic ovarian syndrome in whole blood of Chinese women

DEFF Research Database (Denmark)

Li, Shuxia; Zhu, Dongyi; Duan, Hongmei

2017-01-01

As a universally common endocrinopathy in women of reproductive age, the polycystic ovarian syndrome is characterized by composite clinical phenotypes reflecting the contributions of reproductive impact of ovarian dysfunction and metabolic abnormalities with widely varying symptoms resulting from...... interference of the genome with the environment through integrative biological mechanisms including epigenetics. We have performed a genome-wide DNA methylation analysis on polycystic ovarian syndrome and identified a substantial number of genomic sites differentially methylated in the whole blood of PCOS...... in the DNA methylome from ovarian tissue under PCOS condition. Most importantly, our genome-wide profiling focusing on PCOS patients revealed a large number of DNA methylation sites and their enriched functional pathways significantly associated with diverse clinical features (levels of prolactin, estradiol...

Molecular Fingerprints of the Human Fecal Microbiota From 9 to 18 Months Old and the Effect of Fish Oil Supplementation

DEFF Research Database (Denmark)

Andersen, Anders Daniel; Mølbak, Lars; Michaelsen, Kim Fleischer

2011-01-01

supplementation with 5mL of fish oil (FO) or sunflower oil (SO) from 9 to 18 months of age, stool samples were collected from 132 healthy Danish infants. Molecular fingerprints of the bacterial DNA were obtained by terminal restriction fragment length polymorphism (T-RFLP). Results: The T-RFLP profiles indicated...

Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

NARCIS (Netherlands)

Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

Towards reconstruction of overlapping fingerprints using plasma spectroscopy

Science.gov (United States)

Yang, Jun-Ho; Choi, Soo-Jin; Yoh, Jack J.