WorldWideScience

Sample records for dna fingerprinting differentiation

  1. cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

    OpenAIRE

    Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

    1999-01-01

    A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

  2. Cell kinetics, DNA integrity, differentiation, and lipid fingerprinting analysis of rabbit adipose-derived stem cells.

    Science.gov (United States)

    Barretto, Letícia Siqueira de Sá; Lessio, Camila; Sawaki e Nakamura, Ahy Natally; Lo Turco, Edson Guimarães; da Silva, Camila Gonzaga; Zambon, João Paulo; Gozzo, Fábio César; Pilau, Eduardo Jorge; de Almeida, Fernando Gonçalves

    2014-10-01

    Human adipose tissue has been described as a potential alternative reservoir for stem cells. Although studies have been performed in rabbits using autologous adipose-derived stem cells (ADSC), these cells have not been well characterized. The primary objectives of this study were to demonstrate the presence of adipose-derived stem cells isolated from rabbit inguinal fat pads and to characterize them through osteogenic and adipogenic in vitro differentiation and lipid fingerprinting analysis. The secondary objective was to evaluate cell behavior through growth kinetics, cell viability, and DNA integrity. Rabbit ADSCs were isolated to determine the in vitro growth kinetics and cell viability. DNA integrity was assessed by an alkaline Comet assay in passages 0 and 5. The osteogenic differentiation was evaluated by Von Kossa, and Alizarin Red S staining and adipogenic differentiation were assessed by Oil Red O staining. Lipid fingerprinting analyses of control, adipogenic, and osteogenic differentiated cells were performed by MALDI-TOF/MS. We demonstrate that rabbit ADSC have a constant growth rate at the early passages, with increased DNA fragmentation at or after passage 5. Rabbit ADSC viability was similar in passages 2 and 5 (90.7% and 86.6%, respectively), but there was a tendency to decreased cellular growth rate after passage 3. The ADSC were characterized by the expression of surface markers such as CD29 (67.4%) and CD44 (89.4%), using CD 45 (0.77%) as a negative control. ADSC from rabbits were successfully isolated form the inguinal region. These cells were capable to differentiate into osteogenic and adipogenic tissue when they were placed in inductive media. After each passage, there was a trend towards decreased cell growth. On the other hand, DNA fragmentation increased at each passage. ADSC had a different lipid profile when placed in control, adipogenic, or osteogenic media.

  3. Dna fingerprinting - review paper

    OpenAIRE

    Blundell, Renald

    2006-01-01

    Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.

  4. Making DNA Fingerprints.

    Science.gov (United States)

    Nunley, Kathie F.

    1996-01-01

    Presents an activity to simulate electrophoresis using everyday items. Uses adding machine paper to construct a set of DNA fingerprints that can be used to solve crime cases designed by students in any biology class. (JRH)

  5. An Introduction to DNA Fingerprinting.

    Science.gov (United States)

    Hepfer, Carol Ely; And Others

    1993-01-01

    Provides background information on DNA fingerprinting, and describes exercises for introducing general biology students at the high school or college level to the methodology and applications of DNA fingerprinting. (PR)

  6. Detection of a new submicroscopic Norrie disease deletion interval with a novel DNA probe isolated by differential Alu PCR fingerprint cloning

    NARCIS (Netherlands)

    Bergen, A. A.; Wapenaar, M. C.; Schuurman, E. J.; Diergaarde, P. J.; Lerach, H.; Monaco, A. P.; Bakker, E.; Bleeker-Wagemakers, E. M.; van Ommen, G. J.

    1993-01-01

    Differential Alu PCR fingerprint cloning was used to isolate a DNA probe from the Xp11.4-->p11.21 region of the human X chromosome. This novel sequence, cpXr318 (DXS742), detects a new submicroscopic deletion interval at the Norrie disease locus (NDP). Combining our data with the consensus genetic

  7. Graphene Nanopres for DNA Fingerprinting

    Science.gov (United States)

    Ahmed, Towfiq; Balatsky, Alexander V.; Haraldsen, J. T.; Schuller, Ivan K.; di Ventra, M.; Wikfeldt, K. T.

    2013-03-01

    The recent progress in nanopore experiments with transverse current is important for the development of fast, accurate and cheap finger-printing techniques for single nucleotide. Despite its enormous potential for the next generation DNA sequencing technology, the presence of large noise in the temporal spectrum of transverse current remains a big challenge for getting highly accurate interpretation of data. In this paper we present our abinitio calculations, and propose graphene based device for DNA fingerprinting. We calculate transmission current through graphene for each DNA base (A,C,G,T). As shown in our work, a proper time-series analysis of a signal provides a higher quality information in identifying single bio-molecule is translocating through the nanopores. This work is supported by LANL, Nordita, US DOE, AFOSR, and NIH.

  8. DNA Fingerprinting in a Forensic Teaching Experiment

    Science.gov (United States)

    Wagoner, Stacy A.; Carlson, Kimberly A.

    2008-01-01

    This article presents an experiment designed to provide students, in a classroom laboratory setting, a hands-on demonstration of the steps used in DNA forensic analysis by performing DNA extraction, DNA fingerprinting, and statistical analysis of the data. This experiment demonstrates how DNA fingerprinting is performed and how long it takes. It…

  9. Microsatellite DNA fingerprinting, differentiation, and genetic relationships of clones, cultivars, and varieties of six poplar species from three sections of the genus Populus.

    Science.gov (United States)

    Rahman, Muhammad H; Rajora, Om P

    2002-12-01

    Accurate identification of Populus clones and cultivars is essential for effective selection, breeding, and genetic resource management programs. The unit of cultivation and breeding in poplars is a clone, and individual cultivars are normally represented by a single clone. Microsatellite DNA markers of 10 simple sequence repeat loci were used for genetic fingerprinting and differentiation of 96 clones/cultivars and varieties belonging to six Populus species (P. deltoides, P. nigra, P. balsamifera, P. trichocarpa, P. grandidentata, and P maximowiczii) from three sections of the genus. All 96 clones/cultivars could be uniquely fingerprinted based on their single- or multilocus microsatellite genotypes. The five P. grandidentata clones could be differentiated based on their single-locus genotypes, while six clones of P. trichocarpa and 11 clones of P. maximowiczii could be identified by their two-locus genotypes. Twenty clones of P. deltoides and 25 clones of P. nigra could be differentiated by their multilocus genotypes employing three loci, and 29 clones of P. balsamifera required the use of multilocus genotypes at five loci for their genetic fingerprinting and differentiation. The loci PTR3, PTR5, and PTR7 were found to be the most informative for genetic fingerprinting and differentiation of the clones. The mean number of alleles per locus ranged from 2.9 in P. trichocarpa or P. grandidentata to 6.0 in P. balsamifera and 11.2 in 96 clones of the six species. The mean number of observed genotypes per locus ranged from 2.4 in P. grandidentata to 7.4 in P. balsamifera and 19.6 in 96 clones of the six species. The mean number of unique genotypes per locus ranged from 1.3 in P. grandidentata to 3.9 in P. deltoides and 8.8 in 96 clones of the six species. The power of discrimination of the microsatellite DNA markers in the 96 clones ranged from 0.726 for PTR4 to 0.939 for PTR7, with a mean of 0.832 over the 10 simple sequence repeat loci. Clones/cultivars from the same

  10. DNA fingerprints come to court

    International Nuclear Information System (INIS)

    Anon.

    1988-01-01

    DNA fingerprinting, a new technique, which produces a visual representation of a person's genome, enables the identification of perpetrators from as little as a single hair root, providing they have left some biologic evidence-hair, skin cells, blood, or semen-at the scene of the crime. DNA fingerprinting was developed by British geneticist Alec Jeffreys, PhD, in 1985. Jeffreys, professor genetics at the University of Leicester, built upon a discovery, five years earlier, of certain hypervariable regions called minisatellites in unexpressed areas of DNA. The hypervariability was evidenced in the number of repetitions of certain sequences of base pairs. It was this aspect that revealed to Jeffreys something that had eluded other investigators. He realized that these minisatellite regions had a potential for identification far greater than that of conventional genetic markers, which are defined by restriction fragment length polymorphisms (RFLPs). RFLPs are characterized by the substitution of one base pair for another, resulting in the presence or absence of a restriction enzyme site. Thus, each offers a limited number of alleles. In contrast, minisatellite regions have an accordion-like range of length, as the number of repetitions of a given sequence varies widely from person to person

  11. DNA fingerprinting in forensics: past, present, future.

    Science.gov (United States)

    Roewer, Lutz

    2013-11-18

    DNA fingerprinting, one of the great discoveries of the late 20th century, has revolutionized forensic investigations. This review briefly recapitulates 30 years of progress in forensic DNA analysis which helps to convict criminals, exonerate the wrongly accused, and identify victims of crime, disasters, and war. Current standard methods based on short tandem repeats (STRs) as well as lineage markers (Y chromosome, mitochondrial DNA) are covered and applications are illustrated by casework examples. Benefits and risks of expanding forensic DNA databases are discussed and we ask what the future holds for forensic DNA fingerprinting.

  12. DNA fingerprinting in botany: past, present, future

    OpenAIRE

    Nybom, Hilde; Weising, Kurt; Rotter, Björn

    2014-01-01

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67–73 and Nature 1985, 316:76–79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the n...

  13. DNA fingerprinting in botany: past, present, future.

    Science.gov (United States)

    Nybom, Hilde; Weising, Kurt; Rotter, Björn

    2014-01-03

    Almost three decades ago Alec Jeffreys published his seminal Nature papers on the use of minisatellite probes for DNA fingerprinting of humans (Jeffreys and colleagues Nature 1985, 314:67-73 and Nature 1985, 316:76-79). The new technology was soon adopted for many other organisms including plants, and when Hilde Nybom, Kurt Weising and Alec Jeffreys first met at the very First International Conference on DNA Fingerprinting in Berne, Switzerland, in 1990, everybody was enthusiastic about the novel method that allowed us for the first time to discriminate between humans, animals, plants and fungi on the individual level using DNA markers. A newsletter coined "Fingerprint News" was launched, T-shirts were sold, and the proceedings of the Berne conference filled a first book on "DNA fingerprinting: approaches and applications". Four more conferences were about to follow, one on each continent, and Alec Jeffreys of course was invited to all of them. Since these early days, methodologies have undergone a rapid evolution and diversification. A multitude of techniques have been developed, optimized, and eventually abandoned when novel and more efficient and/or more reliable methods appeared. Despite some overlap between the lifetimes of the different technologies, three phases can be defined that coincide with major technological advances. Whereas the first phase of DNA fingerprinting ("the past") was dominated by restriction fragment analysis in conjunction with Southern blot hybridization, the advent of the PCR in the late 1980s gave way to the development of PCR-based single- or multi-locus profiling techniques in the second phase. Given that many routine applications of plant DNA fingerprinting still rely on PCR-based markers, we here refer to these methods as "DNA fingerprinting in the present", and include numerous examples in the present review. The beginning of the third phase actually dates back to 2005, when several novel, highly parallel DNA sequencing

  14. Diversity of DNA fingerprints in Cryptococcus neoformans.

    Science.gov (United States)

    Varma, A; Swinne, D; Staib, F; Bennett, J E; Kwon-Chung, K J

    1995-07-01

    DNA fingerprint patterns of 156 Cryptococcus neoformans isolates (26 AIDS patients, 46 non-AIDS patients, and 40 environmental sources) from both varieties (126 C. neoformans var. neoformans and 30 C. neoformans var. gattii isolates) and from seven countries were analyzed by using the DNA probe UT-4p. Nine and twelve distinct DNA fingerprint patterns were observed for isolates of the C. neoformans var. neoformans and var. gattii, respectively. No pattern was unique to AIDS patients, non-AIDS patients, or the environment. Pattern II was observed more often in non-AIDS patients (8 of 23) than in AIDS patients (0 of 25). Pattern V was the most prevalent pattern (42 of 82) in clinical and environmental isolates. Isolates from three AIDS patients in Burundi and Zaire exhibited patterns identical to each other but different from those of isolates collected from their houses (i.e., dust of floors, walls, etc.) or a nearby pigeon coop. DNA fingerprint stability was determined for 53 isolates from nine non-AIDS patients at different time intervals during 5 to 128 weeks of antifungal therapy. For eight patients, the fingerprint pattern was stable while the ninth may have had a mixed infection. Pattern II was observed in 4 of 9 patients, which is similar to 4 of 14 in other non-AIDS patients as reported here. In spite of the extensive pattern heterogeneity among 15 C. neoformans var. gattii isolates in Australia, the patterns observed in seven California isolates were quite different from those in Australia. Among isolates of C. neoformans var. gattii, one fingerprint pattern (designated b) was observed in several countries of the Far East. The fingerprint patterns of two of three environmental isolates from Eucalyptus camaldulensis trees in Australia were identical to those of 2 of the 12 clinical isolates from the country.

  15. Fingerprint image enhancement by differential hysteresis processing.

    Science.gov (United States)

    Blotta, Eduardo; Moler, Emilce

    2004-05-10

    A new method to enhance defective fingerprints images through image digital processing tools is presented in this work. When the fingerprints have been taken without any care, blurred and in some cases mostly illegible, as in the case presented here, their classification and comparison becomes nearly impossible. A combination of spatial domain filters, including a technique called differential hysteresis processing (DHP), is applied to improve these kind of images. This set of filtering methods proved to be satisfactory in a wide range of cases by uncovering hidden details that helped to identify persons. Dactyloscopy experts from Policia Federal Argentina and the EAAF have validated these results.

  16. DNA Fingerprinting Using PCR: A Practical Forensic Science Activity

    Science.gov (United States)

    Choi, Hyun-Jung; Ahn, Jung Hoon; Ko, Minsu

    2008-01-01

    This paper describes a forensic science simulation programme applicable for use in colleges. Students were asked to find a putative suspect by DNA fingerprinting using a simple protocol developed in this study. DNA samples were obtained from a hair root and a drop of blood, common sources of DNA in forensic science. The DNA fingerprinting protocol…

  17. Differentiation of species of the family Acetobacteraceae by AFLP DNA fingerprinting: Gluconacetobacter kombuchae is a later heterotypic synonym of Gluconacetobacter hansenii.

    Science.gov (United States)

    Cleenwerck, Ilse; De Wachter, Marjan; González, Angel; De Vuyst, Luc; De Vos, Paul

    2009-07-01

    Amplified fragment length polymorphism (AFLP) DNA fingerprinting was investigated as a tool for fast and accurate identification of acetic acid bacteria (AAB) to the species level. One hundred and thirty five reference strains and 15 additional strains, representing 50 recognized species of the family Acetobacteraceae, were subjected to AFLP analysis using the restriction enzyme combination ApaI/TaqI and the primer combination A03/T03. The reference strains had been previously subjected to either DNA-DNA hybridization or 16S-23S rRNA spacer region gene sequence analysis and were regarded as being accurately classified at the species level. The present study revealed that six of these strains should be reclassified, namely Gluconacetobacter europaeus LMG 1518 and Gluconacetobacter xylinus LMG 1510 as Gluconacetobacter xylinus and Gluconacetobacter europaeus, respectively; Gluconacetobacter kombuchae LMG 23726(T) as Gluconacetobacter hansenii; and Acetobacter orleanensis strains LMG 1545, LMG 1592 and LMG 1608 as Acetobacter cerevisiae. Cluster analysis of the AFLP DNA fingerprints of the reference strains revealed one cluster for each species, showing a linkage level below 50 % with other clusters, except for Acetobacter pasteurianus, Acetobacter indonesiensis and Acetobacter cerevisiae. These three species were separated into two, two, and three clusters, respectively. At present, confusion exists regarding the taxonomic status of Gluconacetobacter oboediens and Gluconacetobacter intermedius; the AFLP data from this study supported their classification as separate taxa. The 15 additional strains could all be identified at the species level. AFLP analysis further revealed that some species harboured genetically diverse strains, whereas other species consisted of strains showing similar banding patterns, indicating a more limited genetic diversity. It can be concluded that AFLP DNA fingerprinting is suitable for accurate identification and classification of a broad

  18. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

    OpenAIRE

    Harmey, Judith H.; Harmey, Matthew A.

    1993-01-01

    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  19. Identification and DNA fingerprinting of Legionella strains by randomly amplified polymorphic DNA analysis.

    OpenAIRE

    Bansal, N S; McDonell, F

    1997-01-01

    The randomly amplified polymorphic DNA (RAPD) technique was used in the development of a fingerprinting (typing) and identification protocol for Legionella strains. Twenty decamer random oligonucleotide primers were screened for their discriminatory abilities. Two candidate primers were selected. By using a combination of these primers, RAPD analysis allowed for the differentiation between all different species, between the serogroups, and further differentiation between subtypes of the same ...

  20. Interstrain polymorphisms of isoenzyme profiles and mitochondrial DNA fingerprints among seven strains assigned to Acanthamoeba polyphaga.

    Science.gov (United States)

    Kong, H H; Park, J H; Chung, D I

    1995-12-01

    Interstrain polymorphisms of isoenzyme profiles and mitochondrial (Mt) DNA fingerprints were observed among seven strains of Acanthamoeba isolated from different sources and morphologically assigned to A. polyphaga. Mt DNA fingerprints by eight restriction endonucleases (Bgl II, Sca I, Cla I, EcoR I, Xba I, Kpn I, Sal I, and Sst I) revealed considerable interstrain polymorphisms. Isoenzyme profiles revealed considerable interstrain polymorphisms for acid phosphatase, lactate dehydrogenase, and glucose-6-phosphate dehydrogenase while those for glucose phosphate isomerase, leucine aminopeptidase, and malate dehydrogenase showed similarity. Despite of the interstrain polymorphisms, the isoenzyme profiles and Mt DNA fingerprints of the strain Ap were found to be identical with those of the strain Jones. Mt DNA fingerprinting was found to be highly applicable for the strain identification, characterization, and differentiation.

  1. Recovery of latent fingerprints and DNA on human skin.

    Science.gov (United States)

    Färber, Doris; Seul, Andrea; Weisser, Hans-Joachim; Bohnert, Michael

    2010-11-01

    The project "Latent Fingerprints and DNA on Human Skin" was the first systematic research in Europe dealing with detection of fingerprints and DNA left by offenders on the skin of corpses. One thousand samples gave results that allow general statements on the materials and methods used. The tests were carried out according to a uniform trial structure. Fingerprints were deposited by natural donors on corpses. The latent fingerprints were treated with magnetic powder or black fingerprint powder. Afterward, they were lifted with silicone casting material (Isomark(®)) or gelatine foil. All lifts were swabbed to recover DNA. It was possible to visualize comparable and identifiable fingerprints on the skin of corpses (16%). In the same categories, magnetic powder (18.4%) yielded better results than black fingerprint powder (13.6%). The number of comparable and identifiable fingerprints decreased on the lifts (12.7%). Isomark(®) (14.9%) was the better lifting material in comparison with gelatine foil (10.1%). In one-third of the samples, DNA could be extracted from the powdered and lifted latents. Black fingerprint powder delivered the better result with a rate of 2.2% for full DNA profiles and profiles useful for exclusion in comparison with 1.8% for the magnetic powder traces. Isomark(®) (3.1%) yielded better results than gelatine foil (0.6%). © 2010 American Academy of Forensic Sciences.

  2. The Ins and Outs of DNA Fingerprinting the Infectious Fungi

    Science.gov (United States)

    Soll, David R.

    2000-01-01

    DNA fingerprinting methods have evolved as major tools in fungal epidemiology. However, no single method has emerged as the method of choice, and some methods perform better than others at different levels of resolution. In this review, requirements for an effective DNA fingerprinting method are proposed and procedures are described for testing the efficacy of a method. In light of the proposed requirements, the most common methods now being used to DNA fingerprint the infectious fungi are described and assessed. These methods include restriction fragment length polymorphisms (RFLP), RFLP with hybridization probes, randomly amplified polymorphic DNA and other PCR-based methods, electrophoretic karyotyping, and sequencing-based methods. Procedures for computing similarity coefficients, generating phylogenetic trees, and testing the stability of clusters are then described. To facilitate the analysis of DNA fingerprinting data, computer-assisted methods are described. Finally, the problems inherent in the collection of test and control isolates are considered, and DNA fingerprinting studies of strain maintenance during persistent or recurrent infections, microevolution in infecting strains, and the origin of nosocomial infections are assessed in light of the preceding discussion of the ins and outs of DNA fingerprinting. The intent of this review is to generate an awareness of the need to verify the efficacy of each DNA fingerprinting method for the level of genetic relatedness necessary to answer the epidemiological question posed, to use quantitative methods to analyze DNA fingerprint data, to use computer-assisted DNA fingerprint analysis systems to analyze data, and to file data in a form that can be used in the future for retrospective and comparative studies. PMID:10756003

  3. Laser mass spectrometry for DNA fingerprinting for forensic applications

    Energy Technology Data Exchange (ETDEWEB)

    Chen, C.H.; Tang, K.; Taranenko, N.I.; Allman, S.L.; Chang, L.Y.

    1994-12-31

    The application of DNA fingerprinting has become very broad in forensic analysis, patient identification, diagnostic medicine, and wildlife poaching, since every individual`s DNA structure is identical within all tissues of their body. DNA fingerprinting was initiated by the use of restriction fragment length polymorphisms (RFLP). In 1987, Nakamura et al. found that a variable number of tandem repeats (VNTR) often occurred in the alleles. The probability of different individuals having the same number of tandem repeats in several different alleles is very low. Thus, the identification of VNTR from genomic DNA became a very reliable method for identification of individuals. DNA fingerprinting is a reliable tool for forensic analysis. In DNA fingerprinting, knowledge of the sequence of tandem repeats and restriction endonuclease sites can provide the basis for identification. The major steps for conventional DNA fingerprinting include (1) specimen processing (2) amplification of selected DNA segments by PCR, and (3) gel electrophoresis to do the final DNA analysis. In this work we propose to use laser desorption mass spectrometry for fast DNA fingerprinting. The process and advantages are discussed.

  4. Application of DNA fingerprints for cell-line individualization.

    OpenAIRE

    Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

    1990-01-01

    DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they d...

  5. Teaching DNA Fingerprinting using a Hands-on Simulation.

    Science.gov (United States)

    Schug, Thatcher

    1998-01-01

    Presents an inexpensive hands-on lesson in DNA fingerprinting that can be completed in a single class period. Involves students in solving a murder in which a drop of blood is fingerprinted and matched with the blood of the murderer. (DDR)

  6. Multifragment alleles in DNA fingerprints of the parrot, Amazona ventralis

    Science.gov (United States)

    Brock, M.K.; White, B.N.

    1991-01-01

    Human DNA probes that identify variable numbers of tandem repeat loci are being used to generate DNA fingerprints in many animal and plant species. In most species the majority of the sc rable autoradiographic bands of the DNA fingerprint represent alleles from numerous unlinked loci. This study was initiated to use DNA fingerprints to determine the amount of band-sharing among captive Hispaniolan parrots (Amazona ventralis) with known genetic relationships. This would form the data base to examine DNA fingerprints of the closely related and endangered Puerto Rican parrot (A. vittata) and to estimate the degree of inbreeding in the relic population. We found by segregation analysis of the bands scored in the DNA fingerprints of the Hispaniolan parrots that there may be as few as two to five loci identified by the human 33.15 probe. Furthermore, at one locus we identified seven alleles, one of which is represented by as many as 19 cosegregating bands. It is unknown how common multiband alleles might be in natural populations, and their existence will cause problems in the assessment of relatedness by band-sharing analysis. We believe, therefore, that a pedigree analysis should be included in all DNA fingerprinting studies, where possible, in order to estimate the number of loci identified by a minisatellite DNA probe and to examine the nature of their alleles.

  7. Laser mass spectrometry for DNA sequencing, disease diagnosis, and fingerprinting

    Energy Technology Data Exchange (ETDEWEB)

    Winston Chen, C.H.; Taranenko, N.I.; Zhu, Y.F.; Chung, C.N.; Allman, S.L.

    1997-03-01

    Since laser mass spectrometry has the potential for achieving very fast DNA analysis, the authors recently applied it to DNA sequencing, DNA typing for fingerprinting, and DNA screening for disease diagnosis. Two different approaches for sequencing DNA have been successfully demonstrated. One is to sequence DNA with DNA ladders produced from Snager`s enzymatic method. The other is to do direct sequencing without DNA ladders. The need for quick DNA typing for identification purposes is critical for forensic application. The preliminary results indicate laser mass spectrometry can possibly be used for rapid DNA fingerprinting applications at a much lower cost than gel electrophoresis. Population screening for certain genetic disease can be a very efficient step to reducing medical costs through prevention. Since laser mass spectrometry can provide very fast DNA analysis, the authors applied laser mass spectrometry to disease diagnosis. Clinical samples with both base deletion and point mutation have been tested with complete success.

  8. DNA fingerprinting in zoology: past, present, future.

    Science.gov (United States)

    Chambers, Geoffrey K; Curtis, Caitlin; Millar, Craig D; Huynen, Leon; Lambert, David M

    2014-02-03

    In 1962, Thomas Kuhn famously argued that the progress of scientific knowledge results from periodic 'paradigm shifts' during a period of crisis in which new ideas dramatically change the status quo. Although this is generally true, Alec Jeffreys' identification of hypervariable repeat motifs in the human beta-globin gene, and the subsequent development of a technology known now as 'DNA fingerprinting', also resulted in a dramatic shift in the life sciences, particularly in ecology, evolutionary biology, and forensics. The variation Jeffreys recognized has been used to identify individuals from tissue samples of not just humans, but also of many animal species. In addition, the technology has been used to determine the sex of individuals, as well as paternity/maternity and close kinship. We review a broad range of such studies involving a wide diversity of animal species. For individual researchers, Jeffreys' invention resulted in many ecologists and evolutionary biologists being given the opportunity to develop skills in molecular biology to augment their whole organism focus. Few developments in science, even among the subsequent genome discoveries of the 21st century, have the same wide-reaching significance. Even the later development of PCR-based genotyping of individuals using microsatellite repeats sequences, and their use in determining multiple paternity, is conceptually rooted in Alec Jeffreys' pioneering work.

  9. Beware of the possibility of fingerprinting techniques transferring DNA.

    Science.gov (United States)

    van Oorschot, Roland A H; Treadwell, Sally; Beaurepaire, James; Holding, Nicole L; Mitchell, Robert J

    2005-11-01

    Fingerprinting brushes have the potential to collect and transfer DNA during powdering. Squirrel-hair fingerprint brushes exposed to specific sets of saliva stains and brushes used in routine casework were tested for their ability to collect and transfer DNA containing material using standard DNA extraction procedures and AmpFlSTR Profiler Plus amplification and typing procedures. The tests found that the risk of transferring DNA during powdering and having a detrimental impact on the analysis increases if the examiner powders over either biological stains (such as blood or saliva) or very fresh prints and uses more sensitive PCR amplification and typing procedures. We advocate caution when powdering prints from which DNA may also be collected and provide options for consideration to limit the risk of transferred DNA contamination while fingerprinting.

  10. Application of DNA fingerprints for cell-line individualization.

    Science.gov (United States)

    Gilbert, D A; Reid, Y A; Gail, M H; Pee, D; White, C; Hay, R J; O'Brien, S J

    1990-09-01

    DNA fingerprints of 46 human cell lines were derived using minisatellite probes for hypervariable genetic loci. The incidence of 121 HaeIII DNA fragments among 33 cell lines derived from unrelated individuals was used to estimate allelic and genotypic frequencies for each fragment and for composite individual DNA fingerprints. We present a quantitative estimate of the extent of genetic difference between individuals, an estimate based on the percentage of restriction fragments at which they differ. The average percent difference (APD) among pairwise combinations from the population of 33 unrelated cell lines was 76.9%, compared with the APD in band sharing among cell lines derived from the same individual (less than or equal to 1.2%). Included in this survey were nine additional cell lines previously implicated as HeLa cell derivatives, and these lines were clearly confirmed as such by DNA fingerprints (APD less than or equal to 0.6%). On the basis of fragment frequencies in the tested cell line population, a simple genetic model was developed to estimate the frequencies of each DNA fingerprint in the population. The median incidence was 2.9 X 10(-17), and the range was 2.4 X 10(-21) to 6.6 X 10(-15). This value approximates the probability that a second cell line selected at random from unrelated individuals will match a given DNA fingerprint. Related calculations address the chance that any two DNA fingerprints would be identical among a large group of cell lines. This estimate is still very slight; for example, the chance of two or more common DNA fingerprints among 1 million distinct individuals is less than .001. The procedure provides a straightforward, easily interpreted, and statistically robust method for identification and individualization of human cells.

  11. Analysis of cellular and extracellular DNA in fingerprints

    Energy Technology Data Exchange (ETDEWEB)

    Button, Julie M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2014-09-09

    It has been previously shown that DNA can be recovered from latent fingerprints left on various surfaces [R. A. H. van Oorschot and M. K. Jones, Nature 387, 767 (1997)]. However, the source of the DNA, extracellular versus cellular origin, is difficult to determine. If the DNA is cellular, it is believed to belong to skin cells while extracellular DNA is believed to originate from body fluids such as sweat [D. J. Daly et. al, Forensic Sci. Int. Genet. 6, 41-46 (2012); V. V. Vlassov et. al, BioEssays 29, 654-667 (2007)]. The origin of the DNA in fingerprints has implications for processing and interpretation of forensic evidence. The determination of the origin of DNA in fingerprints is further complicated by the fact that the DNA in fingerprints tends to be at a very low quantity [R. A. H. van Oorschot and M. K. Jones, Nature 387, 767 (1997)]. This study examined fingerprints from five volunteers left on sterilized glass slides and plastic pens. Three fingerprints were left on each glass slide (thumb, index, and middle fingers) while the pens were held as if one was writing with them. The DNA was collected from the objects using the wet swabbing technique (TE buffer). Following collection, the cellular and extracellular components of each sample were separated using centrifugation and an acoustofluidics system. Centrifugation is still the primary separation technique utilized in forensics laboratories, while acoustic focusing uses sound waves to focus large particles (cells) into low pressure nodes, separating them from the rest of the sample matrix. After separation, all samples were quantified using real-time quantitative PCR (qPCR). The overall trend is that there is more DNA in the extracellular fractions than cellular fractions for both centrifugation and acoustofluidic processing. Additionally, more DNA was generally collected from the pen samples than the samples left on glass slides.

  12. Typing DNA profiles from previously enhanced fingerprints using direct PCR.

    Science.gov (United States)

    Templeton, Jennifer E L; Taylor, Duncan; Handt, Oliva; Linacre, Adrian

    2017-07-01

    Fingermarks are a source of human identification both through the ridge patterns and DNA profiling. Typing nuclear STR DNA markers from previously enhanced fingermarks provides an alternative method of utilising the limited fingermark deposit that can be left behind during a criminal act. Dusting with fingerprint powders is a standard method used in classical fingermark enhancement and can affect DNA data. The ability to generate informative DNA profiles from powdered fingerprints using direct PCR swabs was investigated. Direct PCR was used as the opportunity to generate usable DNA profiles after performing any of the standard DNA extraction processes is minimal. Omitting the extraction step will, for many samples, be the key to success if there is limited sample DNA. DNA profiles were generated by direct PCR from 160 fingermarks after treatment with one of the following dactyloscopic fingerprint powders: white hadonite; silver aluminium; HiFi Volcano silk black; or black magnetic fingerprint powder. This was achieved by a combination of an optimised double-swabbing technique and swab media, omission of the extraction step to minimise loss of critical low-template DNA, and additional AmpliTaq Gold ® DNA polymerase to boost the PCR. Ninety eight out of 160 samples (61%) were considered 'up-loadable' to the Australian National Criminal Investigation DNA Database (NCIDD). The method described required a minimum of working steps, equipment and reagents, and was completed within 4h. Direct PCR allows the generation of DNA profiles from enhanced prints without the need to increase PCR cycle numbers beyond manufacturer's recommendations. Particular emphasis was placed on preventing contamination by applying strict protocols and avoiding the use of previously used fingerprint brushes. Based on this extensive survey, the data provided indicate minimal effects of any of these four powders on the chance of obtaining DNA profiles from enhanced fingermarks. Copyright © 2017

  13. DNA fingerprinting of the NCI-60 cell line panel.

    Science.gov (United States)

    Lorenzi, Philip L; Reinhold, William C; Varma, Sudhir; Hutchinson, Amy A; Pommier, Yves; Chanock, Stephen J; Weinstein, John N

    2009-04-01

    The National Cancer Institute's NCI-60 cell line panel, the most extensively characterized set of cells in existence and a public resource, is frequently used as a screening tool for drug discovery. Because many laboratories around the world rely on data from the NCI-60 cells, confirmation of their genetic identities represents an essential step in validating results from them. Given the consequences of cell line contamination or misidentification, quality control measures should routinely include DNA fingerprinting. We have, therefore, used standard DNA microsatellite short tandem repeats to profile the NCI-60, and the resulting DNA fingerprints are provided here as a reference. Consistent with previous reports, the fingerprints suggest that several NCI-60 lines have common origins: the melanoma lines MDA-MB-435, MDA-N, and M14; the central nervous system lines U251 and SNB-19; the ovarian lines OVCAR-8 and OVCAR-8/ADR (also called NCI/ADR); and the prostate lines DU-145, DU-145 (ATCC), and RC0.1. Those lines also show that the ability to connect two fingerprints to the same origin is not affected by stable transfection or by the development of multidrug resistance. As expected, DNA fingerprints were not able to distinguish different tissues-of-origin. The fingerprints serve principally as a barcodes.

  14. DNA Profiles from Fingerprint Lifts-Enhancing the Evidential Value of Fingermarks Through Successful DNA Typing.

    Science.gov (United States)

    Subhani, Zuhaib; Daniel, Barbara; Frascione, Nunzianda

    2018-05-25

    This study evaluated the compatibility of the most common enhancement methods and lifting techniques with DNA profiling. Emphasis is placed on modern lifting techniques (i.e., gelatin lifters and Isomark™) and historical fingerprint lifts for which limited research has been previously conducted. A total of 180 fingerprints were deposited on a glass surface, enhanced, lifted, and processed for DNA typing. DNA could be extracted and profiled for all the powders and lifts tested and from both groomed fingerprints and natural prints with no significant difference in the percentage of profile recovered. DNA profiles could also be obtained from historical fingerprint lifts (79.2% of 72 lifts) with one or more alleles detected. These results demonstrate the compatibility between different powder/lift combinations and DNA profiling therefore augmenting the evidential value of fingerprints in forensic casework. © 2018 American Academy of Forensic Sciences.

  15. Recovery of DNA and fingerprints from touched documents.

    Science.gov (United States)

    Sewell, Jonathan; Quinones, Ignacio; Ames, Carole; Multaney, Bryan; Curtis, Stuart; Seeboruth, Haj; Moore, Stephen; Daniel, Barbara

    2008-09-01

    This study investigated the various factors affecting DNA profiling from DNA recovered from fingerprints deposited on paper before and after fingerprint enhancement treatments. The DNeasy plant mini kit (QIAGEN) was found to improve DNA recovery from paper by over 150% compared with the QIAamp mini kit. A significant decrease in the amount of DNA recovered was observed following treatment with DFO and/or Ninhydrin. This decrease in yield did not have a comparably significant effect on the quality of the SGM Plus profiles. Furthermore, this study found that whilst certain paper types, such as newspaper, magazine and filter paper allowed for the good recovery of DNA, common office paper and white card, strongly interfered with the recovery of DNA resulting in poor quality profiles.

  16. Laser mass spectrometry for DNA fingerprinting for forensic applications

    Science.gov (United States)

    Chen, C. H. Winston; Tang, Kai; Taranenko, N. I.; Allman, S. L.; Ch'ang, L. Y.

    1994-10-01

    The application of DNA fingerprinting has become very broad in forensic analysis, patient identification, diagnostic medicine, and wildlife poaching, since every individual's DNA structure is identical within all tissues oftheir body. DNA fingerprinting was initiated by the use of restriction fragment length polymorphisms (RFLP). In 1987, Nakamura et aL2 found that a variable number of tandem repeats (VNTR) often occurred in the alleles. The probability of different individuals having the same number of tandem repeats in several different alleles is very low. Thus, the identification of VNTR from genomic DNA became a very reliable method for identification of individuals. Take the Huntington gene as an example, there are CAG trinucleotide repeats. For normal people, the number of CAG repeats is usually between 10 and 40. Since people have chromosomes in pairs, the possibility oftwo individuals having the same VNTR in the Huntington gene is less than one percent, ifwe assume equal distribution for various repeats. When several allels containing VNTR are analyzed for the number of repeats, the possibility of two individuals being exactly identical becomes very unlikely. Thus, DNA fingerprinting is a reliable tool for forensic analysis. In DNA fingerprinting, knowledge of the sequence of tandem repeats and restriction endornuclease sites can provide the basis for identification.

  17. Yeast identification by sequencing, biochemical kits, MALDI-TOF MS and rep-PCR DNA fingerprinting.

    Science.gov (United States)

    Zhao, Ying; Tsang, Chi-Ching; Xiao, Meng; Chan, Jasper F W; Lau, Susanna K P; Kong, Fanrong; Xu, Yingchun; Woo, Patrick C Y

    2017-12-08

    No study has comprehensively evaluated the performance of 28S nrDNA and ITS sequencing, commercial biochemical test kits, MALDI-TOF MS platforms, and the emerging rep-PCR DNA fingerprinting technology using a cohort of yeast strains collected from a clinical microbiology laboratory. In this study, using 71 clinically important yeast isolates (excluding Candida albicans) collected from a single centre, we determined the concordance of 28S nrDNA and ITS sequencing and evaluated the performance of two commercial test kits, two MALDI-TOF MS platforms, and rep-PCR DNA fingerprinting. 28S nrDNA and ITS sequencing showed complete agreement on the identities of the 71 isolates. Using sequencing results as the standard, 78.9% and 71.8% isolates were correctly identified using the API 20C AUX and Vitek 2 YST ID Card systems, respectively; and 90.1% and 80.3% isolates were correctly identified using the Bruker and Vitek MALDI-TOF MS platforms, respectively. Of the 18 strains belonging to the Candida parapsilosis species complex tested by DiversiLab automated rep-PCR DNA fingerprinting, all were identified only as Candida parapsilosis with similarities ≥93.2%, indicating the misidentification of Candida metapsilosis and Candida orthopsilosis. However, hierarchical cluster analysis of the rep-PCR DNA fingerprints of these three species within this species complex formed three different discrete clusters, indicating that this technology can potentially differentiate the three species. To achieve higher accuracies of identification, the databases of commercial biochemical test kits, MALDI-TOF MS platforms, and DiversiLab automated rep-PCR DNA fingerprinting needs further enrichment, particularly for uncommonly encountered yeast species. © The Author 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. DNA fingerprinting, DNA barcoding, and next generation sequencing technology in plants.

    Science.gov (United States)

    Sucher, Nikolaus J; Hennell, James R; Carles, Maria C

    2012-01-01

    DNA fingerprinting of plants has become an invaluable tool in forensic, scientific, and industrial laboratories all over the world. PCR has become part of virtually every variation of the plethora of approaches used for DNA fingerprinting today. DNA sequencing is increasingly used either in combination with or as a replacement for traditional DNA fingerprinting techniques. A prime example is the use of short, standardized regions of the genome as taxon barcodes for biological identification of plants. Rapid advances in "next generation sequencing" (NGS) technology are driving down the cost of sequencing and bringing large-scale sequencing projects into the reach of individual investigators. We present an overview of recent publications that demonstrate the use of "NGS" technology for DNA fingerprinting and DNA barcoding applications.

  19. DNA Fingerprinting of Olive Varieties by Microsatellite Markers

    Directory of Open Access Journals (Sweden)

    Dunja Bandelj

    2002-01-01

    Full Text Available Microsatellites combine several features of an ultimate molecular marker and they are used increasingly in various plant genetic studies and applications. In this work we report on the utilisation of fourteen previously developed olive microsatellite markers for the identification and differentiation of a set of nineteen olive varieties. All analysed microsatellite markers revealed a high level of polymorphism that allowed unique genotyping of the examined varieties. Ninety-six alleles were detected at all 14 loci, which multiplied into a large number of observed genotypes, giving high discrimination value for varietal identification. A minimum number of three microsatellite markers was chosen for the rapid and unambiguous varietal identification of nineteen olive varieties and only two markers were sufficient for differentiation of five local varieties. DNA fingerprints of olive cultivars by means of microsatellites provided meaningful data, which can be extended by additional olive varieties or new microsatellites and used for accurate inter-laboratory comparison. The data obtained can be used for the varietal survey and construction of a database of all olive varieties grown in Slovenia providing also additional genetic information on the agronomic and quality characteristics of the olive varieties.

  20. DNA fingerprinting based on simple sequence repeat (SSR ...

    African Journals Online (AJOL)

    New varieties of sugarcane are protected using morphological descriptors, which have limitations in identifying morphologically similar cultivars. Development of a reliable DNA fingerprint system for identification of new varieties would contribute greatly to the breeding of these species. Microsatellite markers are tools with ...

  1. SSR marker based DNA fingerprinting and diversity study in rice ...

    African Journals Online (AJOL)

    The genetic diversity and DNA fingerprinting of 15 elite rice genotypes using 30 SSR primers on chromosome numbers 7-12 was investigated. The results revealed that all the primers showed distinct polymorphism among the cultivars studied indicating the robust nature of microsatellites in revealing polymorphism. Cluster ...

  2. DNA Electronic Fingerprints by Local Spectroscopy on Graphene

    Science.gov (United States)

    Balatsky, Alexander

    2013-03-01

    Working and scalable alternatives to the conventional chemical methods of DNA sequencing that are based on electronic/ionic signatures would revolutionize the field of sequencing. The approach of a single molecule imaging and spectroscopy with unprecedented resolution, achieved by Scanning Tunneling Spectroscopy (STS) and nanopore electronics could enable this revolution. We use the data from our group and others in applying this local scanning tunneling microscopy and illustrate possibilities of electronic sequencing of freeze dried deposits on graphene. We will present two types of calculated fingerprints: first in Local Density of States (LDOS) of DNA nucleotide bases (A,C,G,T) deposited on graphene. Significant base-dependent features in the LDOS in an energy range within few eV of the Fermi level were found in our calculations. These features can serve as electronic fingerprints for the identification of individual bases in STS. In the second approach we present calculated base dependent electronic transverse conductance as DNA translocates through the graphene nanopore. Thus we argue that the fingerprints of DNA-graphene hybrid structures may provide an alternative route to DNA sequencing using STS. Work supported by US DOE, NORDITA.

  3. DNA fingerprinting sets for four southern pines

    Science.gov (United States)

    Craig Echt; Sedley Josserand

    2018-01-01

    DNA markers can provide valuable genetic information for forest tree research, breeding, conservation, and restoration programs. When properly evaluated, selected sets of DNA markers can be used to efficiently get information about genetic diversity in regions, forests, or stands, or in seed lots and orchards. Selected markers also can be used to determine parentage or...

  4. Drama Drives a DNA Fingerprinting Lab Exercise.

    Science.gov (United States)

    Rubenstein, Elaine C.; And Others

    1996-01-01

    Presents a laboratory exercise for an intermediate cell and molecular biology course that uses a murder-mystery play. Provokes students to think critically about important issues in scientific methodology in general and DNA analysis in particular. (JRH)

  5. DNA fingerprinting of glioma cell lines and considerations on similarity measurements.

    Science.gov (United States)

    Bady, Pierre; Diserens, Annie-Claire; Castella, Vincent; Kalt, Stefanie; Heinimann, Karl; Hamou, Marie-France; Delorenzi, Mauro; Hegi, Monika E

    2012-06-01

    Glioma cell lines are an important tool for research in basic and translational neuro-oncology. Documentation of their genetic identity has become a requirement for scientific journals and grant applications to exclude cross-contamination and misidentification that lead to misinterpretation of results. Here, we report the standard 16 marker short tandem repeat (STR) DNA fingerprints for a panel of 39 widely used glioma cell lines as reference. Comparison of the fingerprints among themselves and with the large DSMZ database comprising 9 marker STRs for 2278 cell lines uncovered 3 misidentified cell lines and confirmed previously known cross-contaminations. Furthermore, 2 glioma cell lines exhibited identity scores of 0.8, which is proposed as the cutoff for detecting cross-contamination. Additional characteristics, comprising lack of a B-raf mutation in one line and a similarity score of 1 with the original tumor tissue in the other, excluded a cross-contamination. Subsequent simulation procedures suggested that, when using DNA fingerprints comprising only 9 STR markers, the commonly used similarity score of 0.8 is not sufficiently stringent to unambiguously differentiate the origin. DNA fingerprints are confounded by frequent genetic alterations in cancer cell lines, particularly loss of heterozygosity, that reduce the informativeness of STR markers and, thereby, the overall power for distinction. The similarity score depends on the number of markers measured; thus, more markers or additional cell line characteristics, such as information on specific mutations, may be necessary to clarify the origin.

  6. Acetone facilitated DNA sampling from electrical tapes improves DNA recovery and enables latent fingerprints development.

    Science.gov (United States)

    Feine, Ilan; Shpitzen, Moshe; Geller, Boris; Salmon, Eran; Peleg, Tsach; Roth, Jonathan; Gafny, Ron

    2017-07-01

    Electrical tapes (ETs) are a common component of improvised explosive devices (IEDs) used by terrorists or criminal organizations and represent a valuable forensic resource for DNA and latent fingerprints recovery. However, DNA recovery rates are typically low and usually below the minimal amount required for amplification. In addition, most DNA extraction methods are destructive and do not allow further latent fingerprints development. In the present study a cell culture based touch DNA model was used to demonstrate a two-step acetone-water DNA recovery protocol from ETs. This protocol involves only the adhesive side of the ET and increases DNA recovery rates by up to 70%. In addition, we demonstrated partially successful latent fingerprints development from the non-sticky side of the ETs. Taken together, this protocol maximizes the forensic examination of ETs and is recommended for routine casework processing. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. An overview of DNA fingerprinting with 32P nucleotides

    International Nuclear Information System (INIS)

    Pappas, G.G.

    1992-01-01

    The DNA probes radiolabeled with 32 P, a primary tool employed by researchers in the life sciences for > 20 yr, are used by private companies, state-run laboratories, and the FBI to generate autoradiographs displaying the unique banding patterns that constitute the DNA fingerprint. The ability to identify an individual or animal from a biological sample has profound implications. Unidentified bodies, unrecognizable remains, and missing children can be tested and the DNA fingerprint compared to those of family members for positive identification. Paternity can be established before a child's birth. Immigration disputes can easily be resolved. Other uses include pedigree determination and testing for cell-line cross-contamination. Using a DNA fingerprint to determine the guilt or innocence of an individual allegedly involved in a violent crime is very controversial and has great legal and moral implications for society. Forensic laboratories have been challenged to ensure a level of quality control and quality assurance consistent with the weight given to these tests when used as evidence in a court of law

  8. Generation of DNA profiles from fingerprints developed with columnar thin film technique.

    Science.gov (United States)

    Plazibat, Stephanie L; Roy, Reena; Swiontek, Stephen E; Lakhtakia, Akhlesh

    2015-12-01

    Partial-bloody fingerprints and partial fingerprints with saliva are often encountered at crime scenes, potentially enabling the combination of fingerprint and DNA analyses for absolute identification, provided that the development technique for fingerprint analysis does not inhibit DNA analysis. 36 partial-bloody fingerprints and 30 fingerprints wetted with saliva, all deposited on brass, were first developed using the columnar-thin-film (CTF) technique and then subjected to short tandem repeat (STR) DNA analysis. Equal numbers of samples were subjected to the same DNA analysis without development. Tris (8-hydroxyquinolinato) aluminum, or Alq3, was evaporated to deposit CTFs for development of the prints. DNA was extracted from all 132 samples, quantified, and amplified with AmpFlSTR(®) Identifiler Plus Amplification Kit. Additionally, DNA analyses were conducted on four blood smears on un-fingerprinted brass that had been subjected to CTF deposition and four blood smears on un-fingerprinted brass that had not been subjected to CTF deposition. Complete and concordant autosomal STR profiles of the same quality were obtained from both undeveloped and CTF-developed fingerprints, indicating that CTF development of fingerprints preserves DNA and does not inhibit subsequent DNA analysis. Even when there were no fingerprints, CTF deposition did not lead to inhibition of DNA analysis. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  9. Multilocus DNA fingerprints in gallinaceous birds: general approach and problems.

    Science.gov (United States)

    Hanotte, O; Bruford, M W; Burke, T

    1992-06-01

    Multilocus profiles were investigated in five different species of Galliformes (ring-necked pheasant Phasianus colchicus, Indian peafowl Pavo cristatus, Japanese quail Coturnix coturnix japonica, domestic chicken Gallus gallus, and red grouse Lagopus lagopus scoticus) using two human multilocus probes (33.6 and 33.15) in combination with each of four restriction enzymes (AluI, DdeI, HaeIII or HinfI). All the species show a DNA fingerprint-like pattern using at least one restriction enzyme in combination with each multilocus probe. The number of bands detected and the value of the index of similarity for each species differ significantly between the profiles obtained with each multilocus probe. Some enzyme/probe combinations reveal strong cross-hybridization of the multilocus probes with satellite or satellite-like DNA sequences in pheasant, peacock, quail and chicken, which partially or completely prevented scoring of the profile. The choice of restriction enzyme was found to influence the number of bands, the value of the index of similarity and the probability of obtaining an identical fingerprint between unrelated individuals. The Mendelian inheritance and independent segregation of the fragments detected using AluI was investigated in three species (ring-necked pheasant, Indian peafowl and red grouse). Some bands were shown to be tightly linked. An extreme case was encountered in the red grouse, where 12 of the 15 bands scored in one parent represented only two, apparently allelic, haplotypes and so derived from a single locus. However, fingerprint patterns will often be adequate for use in paternity analyses, such as in behavioural studies, despite the occurrence of haplotypic sets of bands. Identical DNA multilocus profiles were sometimes observed between captive-bred siblings in one species. These results emphasize the desirability of determining, in each new species, the optimal experimental conditions as a preliminary to any behavioural or population

  10. Two dimensional molecular electronics spectroscopy for molecular fingerprinting, DNA sequencing, and cancerous DNA recognition.

    Science.gov (United States)

    Rajan, Arunkumar Chitteth; Rezapour, Mohammad Reza; Yun, Jeonghun; Cho, Yeonchoo; Cho, Woo Jong; Min, Seung Kyu; Lee, Geunsik; Kim, Kwang S

    2014-02-25

    Laser-driven molecular spectroscopy of low spatial resolution is widely used, while electronic current-driven molecular spectroscopy of atomic scale resolution has been limited because currents provide only minimal information. However, electron transmission of a graphene nanoribbon on which a molecule is adsorbed shows molecular fingerprints of Fano resonances, i.e., characteristic features of frontier orbitals and conformations of physisorbed molecules. Utilizing these resonance profiles, here we demonstrate two-dimensional molecular electronics spectroscopy (2D MES). The differential conductance with respect to bias and gate voltages not only distinguishes different types of nucleobases for DNA sequencing but also recognizes methylated nucleobases which could be related to cancerous cell growth. This 2D MES could open an exciting field to recognize single molecule signatures at atomic resolution. The advantages of the 2D MES over the one-dimensional (1D) current analysis can be comparable to those of 2D NMR over 1D NMR analysis.

  11. Identification and strain differentiation of 'Bacteroides fragilis group' species and Prevotella bivia by PCR fingerprinting.

    Science.gov (United States)

    Claros, M; Schönian, G; Gräser, Y; Montag, T; Rodloff, A C; Citron, D M; Goldstein, E J

    1995-08-01

    Using single consensus primers of genomic nucleotide sequences, PCR-generated fingerprints were used for identification and differentiation of the Bacteroides fragilis group (B. fragilis, B. thetaiotaomicron, B. ovatus, B. distasonis, B. vulgatus) and Prevotella bivia (B. bivius) by comparing the DNA profiles with those of reference strains from the American Type Culture Collection and German Culture Collection. When primed by a single primer phage M13 core sequence, intra-species specific differences and species-specific bands were detected. Using primers derived from the evolutionarily conserved tRNA gene sequence, species-specific patterns were produced. A computer program, GelManager, was used to analyze the profiles and generate dendrograms. The correlation coefficients determined from the DNA fingerprint profiles of the clinical isolates (using the M13 core primer) fell within a narrow range, reflecting a high level of homology within the species. Based on the dendrograms, strains of one species were clearly differentiated from strains of other species. For comparison, SDS-PAGE analysis of whole cell extracts was also performed to obtain protein band patterns of various strains. Because of the simplicity of the PCR fingerprinting method and the ease of performance of computerized evaluation of data, this technique is a useful method for both species and strain differentiation, as well as for characterization of Bacteroides species and Prevotella bivia.

  12. One-dimensional TRFLP-SSCP is an effective DNA fingerprinting strategy for soil Archaea that is able to simultaneously differentiate broad taxonomic clades based on terminal fragment length polymorphisms and closely related sequences based on single stranded conformation polymorphisms.

    Science.gov (United States)

    Swanson, Colby A; Sliwinski, Marek K

    2013-09-01

    DNA fingerprinting methods provide a means to rapidly compare microbial assemblages from environmental samples without the need to first cultivate species in the laboratory. The profiles generated by these techniques are able to identify statistically significant temporal and spatial patterns, correlations to environmental gradients, and biological variability to estimate the number of replicates for clone libraries or next generation sequencing (NGS) surveys. Here we describe an improved DNA fingerprinting technique that combines terminal restriction fragment length polymorphisms (TRFLP) and single stranded conformation polymorphisms (SSCP) so that both can be used to profile a sample simultaneously rather than requiring two sequential steps as in traditional two-dimensional (2-D) gel electrophoresis. For the purpose of profiling Archaeal 16S rRNA genes from soil, the dynamic range of this combined 1-D TRFLP-SSCP approach was superior to TRFLP and SSCP. 1-D TRFLP-SSCP was able to distinguish broad taxonomic clades with genetic distances greater than 10%, such as Euryarchaeota and the Thaumarchaeal clades g_Ca. Nitrososphaera (formerly 1.1b) and o_NRP-J (formerly 1.1c) better than SSCP. In addition, 1-D TRFLP-SSCP was able to simultaneously distinguish closely related clades within a genus such as s_SCA1145 and s_SCA1170 better than TRFLP. We also tested the utility of 1-D TRFLP-SSCP fingerprinting of environmental assemblages by comparing this method to the generation of a 16S rRNA clone library of soil Archaea from a restored Tallgrass prairie. This study shows 1-D TRFLP-SSCP fingerprinting provides a rapid and phylogenetically informative screen of Archaeal 16S rRNA genes in soil samples. © 2013.

  13. DNA fingerprinting in zoology: past, present, future

    Science.gov (United States)

    2014-01-01

    In 1962, Thomas Kuhn famously argued that the progress of scientific knowledge results from periodic ‘paradigm shifts’ during a period of crisis in which new ideas dramatically change the status quo. Although this is generally true, Alec Jeffreys’ identification of hypervariable repeat motifs in the human beta-globin gene, and the subsequent development of a technology known now as ‘DNA fingerprinting’, also resulted in a dramatic shift in the life sciences, particularly in ecology, evolutionary biology, and forensics. The variation Jeffreys recognized has been used to identify individuals from tissue samples of not just humans, but also of many animal species. In addition, the technology has been used to determine the sex of individuals, as well as paternity/maternity and close kinship. We review a broad range of such studies involving a wide diversity of animal species. For individual researchers, Jeffreys’ invention resulted in many ecologists and evolutionary biologists being given the opportunity to develop skills in molecular biology to augment their whole organism focus. Few developments in science, even among the subsequent genome discoveries of the 21st century, have the same wide-reaching significance. Even the later development of PCR-based genotyping of individuals using microsatellite repeats sequences, and their use in determining multiple paternity, is conceptually rooted in Alec Jeffreys’ pioneering work. PMID:24490906

  14. Microbial DNA fingerprinting of human fingerprints: dynamic colonization of fingertip microflora challenges human host inferences for forensic purposes.

    Science.gov (United States)

    Tims, Sebastian; van Wamel, Willem; Endtz, Hubert P; van Belkum, Alex; Kayser, Manfred

    2010-09-01

    Human fingertip microflora is transferred to touched objects and may provide forensically relevant information on individual hosts, such as on geographic origins, if endogenous microbial skin species/strains would be retrievable from physical fingerprints and would carry geographically restricted DNA diversity. We tested the suitability of physical fingerprints for revealing human host information, with geographic inference as example, via microbial DNA fingerprinting. We showed that the transient exogenous fingertip microflora is frequently different from the resident endogenous bacteria of the same individuals. In only 54% of the experiments, the DNA analysis of the transient fingertip microflora allowed the detection of defined, but often not the major, elements of the resident microflora. Although we found microbial persistency in certain individuals, time-wise variation of transient and resident microflora within individuals was also observed when resampling fingerprints after 3 weeks. While microbial species differed considerably in their frequency spectrum between fingerprint samples from volunteers in Europe and southern Asia, there was no clear geographic distinction between Staphylococcus strains in a cluster analysis, although bacterial genotypes did not overlap between both continental regions. Our results, though limited in quantity, clearly demonstrate that the dynamic fingerprint microflora challenges human host inferences for forensic purposes including geographic ones. Overall, our results suggest that human fingerprint microflora is too dynamic to allow for forensic marker developments for retrieving human information.

  15. Serotypes and DNA fingerprint profiles of Pasteurella multocida isolated from raptors

    Science.gov (United States)

    Wilson, M.A.; Duncan, R.M.; Nordholm, G.E.; Berlowski, B.M.

    1995-01-01

    Pasteurella multocida isolates from 21 raptors were examined by DNA fingerprint profile and serotyping methods. Isolates were obtained from noncaptive birds of prey found in 11 states from November 28, 1979, through February 10, 1993. Nine isolates were from bald eagles, and the remaining isolates were from hawks, falcons, and owls. Seven isolates were members of capsule group A, and 14 were nonencapsulated. One isolate was identified as somatic type 3, and another was type 3,4,7; both had unique HhaI DNA fingerprint profiles. Nineteen isolates expressed somatic type 1 antigen; HhaI profiles of all type 1 isolates were identical to each other and to the HhaI profile of the reference somatic type 1, strain X-73. The 19 type 1 isolates were differentiated by sequential digestion of DNA with HpaII; four HpaII fingerprint profiles were obtained. The HpaII profile of one isolate was identical to the HpaII profile of strain X-73. Incidence of P. multocida somatic type 1 in raptors suggests that this type may be prevalent in other wildlife or wildlife environments.

  16. DNA fingerprinting techniques for the analysis of genetic and epigenetic alterations in colorectal cancer.

    Science.gov (United States)

    Samuelsson, Johanna K; Alonso, Sergio; Yamamoto, Fumiichiro; Perucho, Manuel

    2010-11-10

    Genetic somatic alterations are fundamental hallmarks of cancer. In addition to point and other small mutations targeting cancer genes, solid tumors often exhibit aneuploidy as well as multiple chromosomal rearrangements of large fragments of the genome. Whether somatic chromosomal alterations and aneuploidy are a driving force or a mere consequence of tumorigenesis remains controversial. Recently it became apparent that not only genetic but also epigenetic alterations play a major role in carcinogenesis. Epigenetic regulation mechanisms underlie the maintenance of cell identity crucial for development and differentiation. These epigenetic regulatory mechanisms have been found substantially altered during cancer development and progression. In this review, we discuss approaches designed to analyze genetic and epigenetic alterations in colorectal cancer, especially DNA fingerprinting approaches to detect changes in DNA copy number and methylation. DNA fingerprinting techniques, despite their modest throughput, played a pivotal role in significant discoveries in the molecular basis of colorectal cancer. The aim of this review is to revisit the fingerprinting technologies employed and the oncogenic processes that they unveiled. 2010 Elsevier B.V. All rights reserved.

  17. DNA fingerprinting of pearls to determine their origins.

    Directory of Open Access Journals (Sweden)

    Joana B Meyer

    Full Text Available We report the first successful extraction of oyster DNA from a pearl and use it to identify the source oyster species for the three major pearl-producing oyster species Pinctada margaritifera, P. maxima and P. radiata. Both mitochondrial and nuclear gene fragments could be PCR-amplified and sequenced. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP assay in the internal transcribed spacer (ITS region was developed and used to identify 18 pearls of unknown origin. A micro-drilling technique was developed to obtain small amounts of DNA while maintaining the commercial value of the pearls. This DNA fingerprinting method could be used to document the source of historic pearls and will provide more transparency for traders and consumers within the pearl industry.

  18. DNA fingerprinting, biological and chemical investigation of certain Yucca species.

    Science.gov (United States)

    El Hawary, Seham; El Sayed, Abeer; Helmy, Maged W; El Naggar, El Moataz Bellah; Marzouk, Hanan S; Bassam, Samar M

    2018-01-05

    Yucca aloifolia, Y. aloifolia variegata, Y. elephantipes and Y. filamentosa were investigated. DNA sequencing was performed for the four plants and a genomic DNA fingerprint was obtained and provided. The cytotoxic activities against four human cancer cell lines were investigated. The ethanolic extracts of leaves of Y. aloifolia variegata prevailed, especially against liver cancer HepG-2 and breast cancer MCF-7. In vivo assessment of hepatoprotective activity in rats also revealed the hepatoprotective potential of the ethanolic extracts of the four plants against CCl 4 - induced rats' liver damage. Qualitative and quantitative analysis of the flavonoid and phenolic content of the promising species was performed using HPLC. The analysis identified and quantified 18 flavonoids and 19 phenolic acids in the different fractions of Y. aloifolia variegata, among which the major flavonoids were hesperidin and kaemp-3-(2-p-coumaroyl) glucose and the major phenolic acids were gallic acid and protocatechuic acid.

  19. Genetic diversity and DNA fingerprinting in jute(Corchorus spp.) based on SSR markers

    Institute of Scientific and Technical Information of China (English)

    Liwu; Zhang; Rongrong; Cai; Minhang; Yuan; Aifen; Tao; Jiantang; Xu; Lihui; Lin; Pingping; Fang; Jianmin; Qi

    2015-01-01

    Genetic diversity analysis and DNA finger printing are very useful in breeding programs,seed conservation and management. Jute(Corchorus spp.) is the second most important natural fiber crop after cotton. DNA fingerprinting studies in jute using SSR markers are limited. In this study, 58 jute accessions, including two control varieties(Huangma 179 and Kuanyechangguo) from the official variety registry in China were evaluated with 28 pairs of SSR primers. A total of 184 polymorphic loci were identified. Each primer detected 3 to 15 polymorphic loci, with an average of 6.6. The 58 jute accessions were DNA-fingerprinted with 67 SSR markers from the 28 primer pairs. These markers differentiated the 58 jute accessions from one another, with Co SSR305-120 and Co SSR174-195 differentiating Huangma 179 and Kuanyechangguo, respectively. NTSYS-pc2.10 software was used to analyze the genetic diversity in the 58 jute accessions. Their genetic similarity coefficients ranged from 0.520 to 0.910 with an average of 0.749, indicating relatively great genetic diversity among them. The 58 jute accessions were divided into four groups with the coefficient 0.710 used as a value for classification, consistent with their species and pedigrees. All these results may be useful both for protection of intellectual property rights of jute accessions and for jute improvement.

  20. Genetic diversity and DNA fingerprinting in jute (Corchorus spp. based on SSR markers

    Directory of Open Access Journals (Sweden)

    Liwu Zhang

    2015-10-01

    Full Text Available Genetic diversity analysis and DNA finger printing are very useful in breeding programs, seed conservation and management. Jute (Corchorus spp. is the second most important natural fiber crop after cotton. DNA fingerprinting studies in jute using SSR markers are limited. In this study, 58 jute accessions, including two control varieties (Huangma 179 and Kuanyechangguo from the official variety registry in China were evaluated with 28 pairs of SSR primers. A total of 184 polymorphic loci were identified. Each primer detected 3 to 15 polymorphic loci, with an average of 6.6. The 58 jute accessions were DNA-fingerprinted with 67 SSR markers from the 28 primer pairs. These markers differentiated the 58 jute accessions from one another, with CoSSR305-120 and CoSSR174-195 differentiating Huangma 179 and Kuanyechangguo, respectively. NTSYS-pc2.10 software was used to analyze the genetic diversity in the 58 jute accessions. Their genetic similarity coefficients ranged from 0.520 to 0.910 with an average of 0.749, indicating relatively great genetic diversity among them. The 58 jute accessions were divided into four groups with the coefficient 0.710 used as a value for classification, consistent with their species and pedigrees. All these results may be useful both for protection of intellectual property rights of jute accessions and for jute improvement.

  1. [An analysis of the DNA fingerprinting of intestinal flora in inflammatory bowel disease].

    Science.gov (United States)

    Li, Run-mei; Han, Ying; Wang, Ji-heng; Wang, Zhi-hong

    2007-02-01

    DNA fingerprinting for inflammatory bowel disease (IBD) patients and healthy subjects was carried out to compare the difference of intestinal flora between the two groups. DNA fingerprinting for IBD patients and healthy persons was set up with enterobacterial repetitive intergenic consensus (ERIC-PCR) technology and the difference of intestinal flora between the two groups compared. DNA fingerprinting of the IBD patients and healthy subjects was identified and a significant difference was noticed between them. There were lots of bands in the DNA fingerprinting of the healthy subjects but few in that of the IBD patients. Strikingly, same distribution of the principal band of DNA fingerprinting was noticed in IBD patients. The variety of intestinal flora in healthy subjects is more apparent than that in IBD patients. An unique principal band might be the sequence of the presence of specific etiopathogenetic bacterium, or it might be the combined sequence of mixed bacterial flora.

  2. DNA fingerprinting of lactic acid bacteria in sauerkraut fermentations.

    Science.gov (United States)

    Plengvidhya, Vethachai; Breidt, Fredrick; Lu, Zhongjing; Fleming, Henry P

    2007-12-01

    Previous studies using traditional biochemical identification methods to study the ecology of commercial sauerkraut fermentations revealed that four species of lactic acid bacteria, Leuconostoc mesenteroides, Lactobacillus plantarum, Pediococcus pentosaceus, and Lactobacillus brevis, were the primary microorganisms in these fermentations. In this study, 686 isolates were collected from four commercial fermentations and analyzed by DNA fingerprinting. The results indicate that the species of lactic acid bacteria present in sauerkraut fermentations are more diverse than previously reported and include Leuconostoc citreum, Leuconostoc argentinum, Lactobacillus paraplantarum, Lactobacillus coryniformis, and Weissella sp. The newly identified species Leuconostoc fallax was also found. Unexpectedly, only two isolates of P. pentosaceus and 15 isolates of L. brevis were recovered during this study. A better understanding of the microbiota may aid in the development of low-salt fermentations, which may have altered microflora and altered sensory characteristics.

  3. Touch DNA collection versus firearm fingerprinting: comparing evidence production and identification outcomes.

    Science.gov (United States)

    Nunn, Samuel

    2013-05-01

    A project by a metropolitan police agency in 2008-2009 had police use touch DNA kits to collect cell samples from seized firearms. To assess outcomes, results of touch DNA swabbing of firearms were compared to fingerprinting firearm evidence. The rationale was that fingerprinting, as the older technology, was the baseline against which to compare touch DNA. But little is known about ways to measure touch DNA productivity compared to fingerprinting. To examine differences between the two requires comparable measurements. Two measures were used: quantity of probative or investigative evidence produced and identification outcomes. When applied to firearms seized within an Indianapolis, IN police district, touch DNA produced a larger volume of evidence than fingerprinting, but identification outcomes for the two methods were equal. Because touch DNA was deployed by police patrol officers, there are implications for firearm forensics and the choice of forensic approaches used by police. © 2013 American Academy of Forensic Sciences.

  4. Characterization of selection effects on broiler lines using DNA fingerprinting

    Directory of Open Access Journals (Sweden)

    GS Schmidt

    2003-05-01

    Full Text Available The objective of this study was to evaluate the effect of selection for body weight on the genetic variability and diversity in broiler lines. Two paternal broiler lines (LL and LLc were used. LL line was selected for 12 generations for growth and carcass and reproduction characteristics. The LLc line was established from LL line in 1985 and mated at random. Blood samples from six chickens per line were collected and used for molecular analysis. Also, a DNA pool was made for each line to compare effects between lines. Data were analyzed considering the collected information on the presence or absence of DNA bands. Band sharing scores were calculated using the DICE coefficient. The pattern of the 21 most representative bands was used. DNA fingerprinting (DFP showed 90.48 % of polymorphism bands for both lines. Difference between lines was not due to the presence or absence of bands, but to the frequency of such bands in each genotype. Considering that both lines had the same genetic background, changes on band frequency were probably due to selection. Selection for body weight had an effect on the band frequency as evaluated by DFP, and for this reason this technique could be used as a tool in the selection process. Results also suggest that bands 4, 5 and 19 were linked to body weight traits, and bands 9, 10, 12, 13 and 21 were linked to reproductive traits such as egg production.

  5. Cluster analysis of Helicobacter pylori genomic DNA fingerprints suggests gastroduodenal disease-specific associations.

    Science.gov (United States)

    Go, M F; Chan, K Y; Versalovic, J; Koeuth, T; Graham, D Y; Lupski, J R

    1995-07-01

    Helicobacter pylori infection is now accepted as the most common cause of chronic active gastritis and peptic ulcer disease. The etiologies of many infectious diseases have been attributed to specific or clonal strains of bacterial pathogens. Polymerase chain reaction (PCR) amplification of DNA between repetitive DNA sequences, REP elements (REP-PCR), has been utilized to generate DNA fingerprints to examine similarity among strains within a bacterial species. Genomic DNA from H. pylori isolates obtained from 70 individuals (39 duodenal ulcers and 31 simple gastritis) was PCR-amplified using consensus probes to repetitive DNA elements. The H. pylori DNA fingerprints were analyzed for similarity and correlated with disease presentation using the NTSYS-pc computer program. Each H. pylori strain had a distinct DNA fingerprint except for two pairs. Single-colony DNA fingerprints of H. pylori from the same patient were identical, suggesting that each patient harbors a single strain. Computer-assisted cluster analysis of the REP-PCR DNA fingerprints showed two large clusters of isolates, one associated with simple gastritis and the other with duodenal ulcer disease. Cluster analysis of REP-PCR DNA fingerprints of H. pylori strains suggests that duodenal ulcer isolates, as a group, are more similar to one another and different from gastritis isolates. These results suggest that disease-specific strains may exist.

  6. Compatibility of DNA IQ™, QIAamp® DNA Investigator, and QIAsymphony® DNA Investigator® with various fingerprint treatments.

    Science.gov (United States)

    Lin, Sze-Wah; Ip, Stephen C Y; Lam, Tze-Tsun; Tan, Tung-Fai; Yeung, Wai-Lung; Tam, Wai-Ming

    2017-03-01

    Latent fingerprint and touch DNA are the two most important contact evidence for individualization in forensic science which provide complementary information that can lead to direct and unequivocal identification of the culprit. In order to retrieve useful information from both fingerprints and DNA, which are usually mingled together, one strategy is to perform fingerprint examination prior to DNA analysis since common DNA sampling technique such as swabbing could disturb or even destroy fingerprint details. Here, we describe the compatibility of three automatic DNA extraction systems, namely, DNA IQ™, QIAamp ® DNA Investigator, and QIAsymphony ® DNA Investigator ® , with respective to the effects of various fingerprint detection techniques. Our results demonstrate that Super Glue fingerprint treatment followed by DNA IQ™ extraction shows better effectiveness in DNA profiling. Aluminum powder dusting offers the least interference to the three DNA extraction systems above. Magnetic powder dusting, on the other hand, strongly impedes DNA recovery. Physical Developer is the most intrusive, which yields profiles with poor quality, including lower peak heights, poor peak height ratios, and poor intra-color balance. In terms of the choice of extraction method, DNA IQ™ system is recommended for sampling after fingerprint treatments, but not the two DNA Investigator systems.

  7. Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

    Directory of Open Access Journals (Sweden)

    Stefan Niemann

    2009-10-01

    Full Text Available Mycobacterium tuberculosis complex (MTBC, the causative agent of tuberculosis (TB, is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients.Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1 and one multidrug resistant (MDR isolate (K-2 of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan. Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1 and 33.0 million (K-2 paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations.Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using

  8. Genomic diversity among drug sensitive and multidrug resistant isolates of Mycobacterium tuberculosis with identical DNA fingerprints.

    Science.gov (United States)

    Niemann, Stefan; Köser, Claudio U; Gagneux, Sebastien; Plinke, Claudia; Homolka, Susanne; Bignell, Helen; Carter, Richard J; Cheetham, R Keira; Cox, Anthony; Gormley, Niall A; Kokko-Gonzales, Paula; Murray, Lisa J; Rigatti, Roberto; Smith, Vincent P; Arends, Felix P M; Cox, Helen S; Smith, Geoff; Archer, John A C

    2009-10-12

    Mycobacterium tuberculosis complex (MTBC), the causative agent of tuberculosis (TB), is characterized by low sequence diversity making this bacterium one of the classical examples of a genetically monomorphic pathogen. Because of this limited DNA sequence variation, routine genotyping of clinical MTBC isolates for epidemiological purposes relies on highly discriminatory DNA fingerprinting methods based on mobile and repetitive genetic elements. According to the standard view, isolates exhibiting the same fingerprinting pattern are considered direct progeny of the same bacterial clone, and most likely reflect ongoing transmission or disease relapse within individual patients. Here we further investigated this assumption and used massively parallel whole-genome sequencing to compare one drug-susceptible (K-1) and one multidrug resistant (MDR) isolate (K-2) of a rapidly spreading M. tuberculosis Beijing genotype clone from a high incidence region (Karakalpakstan, Uzbekistan). Both isolates shared the same IS6110 RFLP pattern and the same allele at 23 out of 24 MIRU-VNTR loci. We generated 23.9 million (K-1) and 33.0 million (K-2) paired 50 bp purity filtered reads corresponding to a mean coverage of 483.5 fold and 656.1 fold respectively. Compared with the laboratory strain H37Rv both Beijing isolates shared 1,209 SNPs. The two Beijing isolates differed by 130 SNPs and one large deletion. The susceptible isolate had 55 specific SNPs, while the MDR variant had 75 specific SNPs, including the five known resistance-conferring mutations. Our results suggest that M. tuberculosis isolates exhibiting identical DNA fingerprinting patterns can harbour substantial genomic diversity. Because this heterogeneity is not captured by traditional genotyping of MTBC, some aspects of the transmission dynamics of tuberculosis could be missed or misinterpreted. Furthermore, a valid differentiation between disease relapse and exogenous reinfection might be impossible using standard

  9. Application of a clustering-based peak alignment algorithm to analyze various DNA fingerprinting data.

    Science.gov (United States)

    Ishii, Satoshi; Kadota, Koji; Senoo, Keishi

    2009-09-01

    DNA fingerprinting analysis such as amplified ribosomal DNA restriction analysis (ARDRA), repetitive extragenic palindromic PCR (rep-PCR), ribosomal intergenic spacer analysis (RISA), and denaturing gradient gel electrophoresis (DGGE) are frequently used in various fields of microbiology. The major difficulty in DNA fingerprinting data analysis is the alignment of multiple peak sets. We report here an R program for a clustering-based peak alignment algorithm, and its application to analyze various DNA fingerprinting data, such as ARDRA, rep-PCR, RISA, and DGGE data. The results obtained by our clustering algorithm and by BioNumerics software showed high similarity. Since several R packages have been established to statistically analyze various biological data, the distance matrix obtained by our R program can be used for subsequent statistical analyses, some of which were not previously performed but are useful in DNA fingerprinting studies.

  10. Comparative study of five different DNA fingerprint techniques for molecular typing of Streptococcus pneumoniae strains

    NARCIS (Netherlands)

    P.W.M. Hermans (Peter); M. Sluijter (Marcel); T. Hoogenboezem (Theo); H. Heersma; A.F. van Belkum (Alex); R. de Groot (Ronald)

    1995-01-01

    textabstractThe aim of this study was to identify the strengths and weaknesses of five DNA fingerprint methods for epidemiological typing of Streptococcus pneumoniae. We investigated the usefulness of (i) ribotyping, (ii) BOX fingerprinting with the BOX repetitive sequence of S.

  11. Development and assessment of microarray-based DNA fingerprinting in Eucalyptus grandis.

    Science.gov (United States)

    Lezar, Sabine; Myburg, A A; Berger, D K; Wingfield, M J; Wingfield, B D

    2004-11-01

    Development of improved Eucalyptus genotypes involves the routine identification of breeding stock and superior clones. Currently, microsatellites and random amplified polymorphic DNA markers are the most widely used DNA-based techniques for fingerprinting of these trees. While these techniques have provided rapid and powerful fingerprinting assays, they are constrained by their reliance on gel or capillary electrophoresis, and therefore, relatively low throughput of fragment analysis. In contrast, recently developed microarray technology holds the promise of parallel analysis of thousands of markers in plant genomes. The aim of this study was to develop a DNA fingerprinting chip for Eucalyptus grandis and to investigate its usefulness for fingerprinting of eucalypt trees. A prototype chip was prepared using a partial genomic library from total genomic DNA of 23 E. grandis trees, of which 22 were full siblings. A total of 384 cloned genomic fragments were individually amplified and arrayed onto glass slides. DNA fingerprints were obtained for 17 individuals by hybridizing labeled genome representations of the individual trees to the 384-element chip. Polymorphic DNA fragments were identified by evaluating the binary distribution of their background-corrected signal intensities across full-sib individuals. Among 384 DNA fragments on the chip, 104 (27%) were found to be polymorphic. Hybridization of these polymorphic fragments was highly repeatable (R2>0.91) within the E. grandis individuals, and they allowed us to identify all 17 full-sib individuals. Our results suggest that DNA microarrays can be used to effectively fingerprint large numbers of closely related Eucalyptus trees.

  12. Genetic, epigenetic, and HPLC fingerprint differentiation between natural and ex situ populations of Rhodiola sachalinensis from Changbai Mountain, China.

    Directory of Open Access Journals (Sweden)

    Wei Zhao

    Full Text Available Rhodiola sachalinensis is an endangered species with important medicinal value. We used inter-simple sequence repeat (ISSR and methylation-sensitive amplified polymorphism (MSAP markers to analyze genetic and epigenetic differentiation in different populations of R. sachalinensis, including three natural populations and an ex situ population. Chromatographic fingerprint was used to reveal HPLC fingerprint differentiation. According to our results, the ex situ population of R. sachalinensis has higher level genetic diversity and greater HPLC fingerprint variation than natural populations, but shows lower epigenetic diversity. Most genetic variation (54.88% was found to be distributed within populations, and epigenetic variation was primarily distributed among populations (63.87%. UPGMA cluster analysis of ISSR and MSAP data showed identical results, with individuals from each given population grouping together. The results of UPGMA cluster analysis of HPLC fingerprint patterns was significantly different from results obtained from ISSR and MSAP data. Correlation analysis revealed close relationships among altitude, genetic structure, epigenetic structure, and HPLC fingerprint patterns (R2 = 0.98 for genetic and epigenetic distance; R2 = 0.90 for DNA methylation level and altitude; R2 = -0.95 for HPLC fingerprint and altitude. Taken together, our results indicate that ex situ population of R. sachalinensis show significantly different genetic and epigenetic population structures and HPLC fingerprint patterns. Along with other potential explanations, these findings suggest that the ex situ environmental factors caused by different altitude play an important role in keeping hereditary characteristic of R. sachalinensis.

  13. Genetic, epigenetic, and HPLC fingerprint differentiation between natural and ex situ populations of Rhodiola sachalinensis from Changbai Mountain, China.

    Science.gov (United States)

    Zhao, Wei; Shi, Xiaozheng; Li, Jiangnan; Guo, Wei; Liu, Chengbai; Chen, Xia

    2014-01-01

    Rhodiola sachalinensis is an endangered species with important medicinal value. We used inter-simple sequence repeat (ISSR) and methylation-sensitive amplified polymorphism (MSAP) markers to analyze genetic and epigenetic differentiation in different populations of R. sachalinensis, including three natural populations and an ex situ population. Chromatographic fingerprint was used to reveal HPLC fingerprint differentiation. According to our results, the ex situ population of R. sachalinensis has higher level genetic diversity and greater HPLC fingerprint variation than natural populations, but shows lower epigenetic diversity. Most genetic variation (54.88%) was found to be distributed within populations, and epigenetic variation was primarily distributed among populations (63.87%). UPGMA cluster analysis of ISSR and MSAP data showed identical results, with individuals from each given population grouping together. The results of UPGMA cluster analysis of HPLC fingerprint patterns was significantly different from results obtained from ISSR and MSAP data. Correlation analysis revealed close relationships among altitude, genetic structure, epigenetic structure, and HPLC fingerprint patterns (R2 = 0.98 for genetic and epigenetic distance; R2 = 0.90 for DNA methylation level and altitude; R2 = -0.95 for HPLC fingerprint and altitude). Taken together, our results indicate that ex situ population of R. sachalinensis show significantly different genetic and epigenetic population structures and HPLC fingerprint patterns. Along with other potential explanations, these findings suggest that the ex situ environmental factors caused by different altitude play an important role in keeping hereditary characteristic of R. sachalinensis.

  14. Detection of DNA fingerprints of cultivated rice by hybridization with a human minisatellite DNA probe

    International Nuclear Information System (INIS)

    Dallas, J.F.

    1988-01-01

    A human minisatellite DNA probe detects several restriction fragment length polymorphisms in cultivars of Asian and African rice. Certain fragments appear to be inherited in a Mendelian fashion and may represent unlinked loci. The hybridization patterns appear to be cultivar-specific and largely unchanged after the regeneration of plants from tissue culture. The results suggest that these regions of the rice genome may be used to generate cultivar-specific DNA fingerprints. The demonstration of similarity between a human minisatellite sequence and polymorphic regions in the rice genome suggests that such regions also occur in the genomes of many other plant species

  15. Cranberry SSR multiplexing panels for DNA horticultural fingerprinting and genetic studies

    Science.gov (United States)

    Cranberry (Vaccinium macrocarpon) is in need of inexpensive high-throughput DNA fingerprinting methods for genetic research and germplasm purity testing for agricultural purposes. Therefore, we designed and validated 16-multiplexing panels containing 61 evenly distributed simple sequence (SSR) marke...

  16. DIFFERENTIATION OF Curcuma longa, Curcuma xanthorrhiza and Zingiber cassumunar BY THIN LAYER CHROMATOGRAPHY FINGERPRINT ANALYSIS

    Directory of Open Access Journals (Sweden)

    Mohamad Rafi

    2011-07-01

    Full Text Available Turmeric (Curcuma longa, java turmeric (Curcuma xanthorrhiza and cassumunar ginger (Zingiber cassumunar are widely used in traditional Indonesian medicine. These three herbs have relatively similar rhizomes colour so it is difficult to be differentiated especially if they are in powder form. A rapid and reliable method, thin layer chromatography (TLC fingerprint, has been developed in order to identify, authenticate and differentiate these three herbs through fingerprint profile of chemical compounds. TLC fingerprints of the three herbs were obtained by visualization of separate zones with visible and UV (254 and 366 nm light. The TLC fingerprint pattern is different each other and showed a specific marker zones respectively. Therefore, TLC fingerprint can be utilized for identification, authentication and differentiation method in quality control of the three herbs tested.

  17. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  18. An Optimized DNA Analysis Workflow for the Sampling, Extraction, and Concentration of DNA obtained from Archived Latent Fingerprints.

    Science.gov (United States)

    Solomon, April D; Hytinen, Madison E; McClain, Aryn M; Miller, Marilyn T; Dawson Cruz, Tracey

    2018-01-01

    DNA profiles have been obtained from fingerprints, but there is limited knowledge regarding DNA analysis from archived latent fingerprints-touch DNA "sandwiched" between adhesive and paper. Thus, this study sought to comparatively analyze a variety of collection and analytical methods in an effort to seek an optimized workflow for this specific sample type. Untreated and treated archived latent fingerprints were utilized to compare different biological sampling techniques, swab diluents, DNA extraction systems, DNA concentration practices, and post-amplification purification methods. Archived latent fingerprints disassembled and sampled via direct cutting, followed by DNA extracted using the QIAamp® DNA Investigator Kit, and concentration with Centri-Sep™ columns increased the odds of obtaining an STR profile. Using the recommended DNA workflow, 9 of the 10 samples provided STR profiles, which included 7-100% of the expected STR alleles and two full profiles. Thus, with carefully selected procedures, archived latent fingerprints can be a viable DNA source for criminal investigations including cold/postconviction cases. © 2017 American Academy of Forensic Sciences.

  19. On some surprising statistical properties of a DNA fingerprinting technique called AFLP

    NARCIS (Netherlands)

    Gort, G.

    2010-01-01

    AFLP is a widely used DNA fingerprinting technique, resulting in band absence - presence profiles, like a bar code. Bands represent DNA fragments, sampled from the genome of an individual plant or other organism. The DNA fragments travel through a lane of an electrophoretic gel or microcapillary

  20. dna and seed proteins fingerprinting of egyptian crop plants

    African Journals Online (AJOL)

    Dr. Haddad

    2012-11-01

    Nov 1, 2012 ... combinations were used for fingerprinting six cultivars which belongs to barley, rice and wheat cultivars leading to the production of numerous AFLP bands, 300 of them were polymorphic. Thirty SSR markers were obtained from fingerprinting eight cultivars belonging to the five studied species using 11.

  1. ENHANCING NETWORK SECURITY USING 'LEARNING-FROM-SIGNALS' AND FRACTIONAL FOURIER TRANSFORM BASED RF-DNA FINGERPRINTS

    Energy Technology Data Exchange (ETDEWEB)

    Buckner, Mark A [ORNL; Bobrek, Miljko [ORNL; Farquhar, Ethan [ORNL; Harmer, Paul K [Air Force Institute of Technology; Temple, Michael A [Air Force Institute of Technology

    2011-01-01

    Wireless Access Points (WAP) remain one of the top 10 network security threats. This research is part of an effort to develop a physical (PHY) layer aware Radio Frequency (RF) air monitoring system with multi-factor authentication to provide a first-line of defense for network security--stopping attackers before they can gain access to critical infrastructure networks through vulnerable WAPs. This paper presents early results on the identification of OFDM-based 802.11a WiFi devices using RF Distinct Native Attribute (RF-DNA) fingerprints produced by the Fractional Fourier Transform (FRFT). These fingerprints are input to a "Learning from Signals" (LFS) classifier which uses hybrid Differential Evolution/Conjugate Gradient (DECG) optimization to determine the optimal features for a low-rank model to be used for future predictions. Results are presented for devices under the most challenging conditions of intra-manufacturer classification, i.e., same-manufacturer, same-model, differing only in serial number. The results of Fractional Fourier Domain (FRFD) RF-DNA fingerprints demonstrate significant improvement over results based on Time Domain (TD), Spectral Domain (SD) and even Wavelet Domain (WD) fingerprints.

  2. DNA fingerprinting on trial: the dramatic early history of a new forensic technique.

    Science.gov (United States)

    Aronson, Jay D

    2005-09-01

    The early history of "DNA fingerprinting" in the UK might have been different were it not for the accounts of two dramatic courtroom trials, made by the participants and the media, in the mid-1980s. But these reports, which misrepresented the importance DNA evidence had in the trials, left a strong impression on the British public and on judges on both sides of the Atlantic. These trials, widely considered to be the first "victories" for DNA fingerprinting, have been frequently cited as proof of the utility and reliability of the technique, in both the UK and beyond. But in reality, it was the threat of DNA evidence being used rather than the integrity or validity of it that resolved these cases. At that time, DNA fingerprinting was still in its infancy, an untried and untested technology.

  3. DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

    Science.gov (United States)

    Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

    2012-01-01

    Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications.

  4. DNA Fingerprinting of Chinese Melon Provides Evidentiary Support of Seed Quality Appraisal

    Science.gov (United States)

    Gao, Peng; Ma, Hongyan; Luan, Feishi; Song, Haibin

    2012-01-01

    Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs) are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines). Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC) were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines) were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR) codes of 471 melon varieties (lines) were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications. PMID:23285039

  5. DNA fingerprinting of Chinese melon provides evidentiary support of seed quality appraisal.

    Directory of Open Access Journals (Sweden)

    Peng Gao

    Full Text Available Melon, Cucumis melo L. is an important vegetable crop worldwide. At present, there are phenomena of homonyms and synonyms present in the melon seed markets of China, which could cause variety authenticity issues influencing the process of melon breeding, production, marketing and other aspects. Molecular markers, especially microsatellites or simple sequence repeats (SSRs are playing increasingly important roles for cultivar identification. The aim of this study was to construct a DNA fingerprinting database of major melon cultivars, which could provide a possibility for the establishment of a technical standard system for purity and authenticity identification of melon seeds. In this study, to develop the core set SSR markers, 470 polymorphic SSRs were selected as the candidate markers from 1219 SSRs using 20 representative melon varieties (lines. Eighteen SSR markers, evenly distributed across the genome and with the highest contents of polymorphism information (PIC were identified as the core marker set for melon DNA fingerprinting analysis. Fingerprint codes for 471 melon varieties (lines were established. There were 51 materials which were classified into17 groups based on sharing the same fingerprint code, while field traits survey results showed that these plants in the same group were synonyms because of the same or similar field characters. Furthermore, DNA fingerprinting quick response (QR codes of 471 melon varieties (lines were constructed. Due to its fast readability and large storage capacity, QR coding melon DNA fingerprinting is in favor of read convenience and commercial applications.

  6. DNA Fingerprinting of Single Colonies of Helicobacter pylori from Gastric Cancer Patients Suggests Infection with a Single Predominant Strain

    OpenAIRE

    Miehlke, Stephan; Thomas, Rachel; Guiterrez, Oscar; Graham, David Y.; Go, Mae F.

    1999-01-01

    In each of six gastric cancer patients, repetitive extragenic palindromic PCR DNA fingerprints of 18 single colonies of Helicobacter pylori from the gastric antrum, corpus, and cardia were identical and matched that of the parental isolate. In three additional gastric cancer patients, 17 of 18 single-colony DNA fingerprints were identical to each other and to the DNA fingerprint of the corresponding parental isolate.

  7. Characterization of human glioblastoma cell lines in vitro and their xenografts in nude mice by DNA fingerprinting

    DEFF Research Database (Denmark)

    Türeci, O; Fischer, H; Lagoda, P

    1990-01-01

    Human gliomas were grown as permanent tissue cultures and xenografts in nude mice. DNA fingerprint patterns from two human gliomas were established using two different hypervariable multilocus probes [( GTG]5 and 33.15). In general the cell lines investigated showed an overall stability in the DNA...... fingerprint pattern. However, differences in the DNA fingerprint patterns were shown to occur depending upon the above mentioned parameters....

  8. Cloning and Characterization of a Complex DNA Fingerprinting Probe for Candida parapsilosis

    Science.gov (United States)

    Enger, Lee; Joly, Sophie; Pujol, Claude; Simonson, Patricia; Pfaller, Michael; Soll, David R.

    2001-01-01

    Candida parapsilosis accounts for a significant number of nosocomial fungemias, but in fact, no effective and verified genetic fingerprinting method has emerged for assessing the relatedness of independent isolates for epidemiological studies. A complex 15-kb DNA fingerprinting probe, Cp3-13, was therefore isolated from a library of C. parapsilosis genomic DNA fragments. The efficacy of Cp3-13 for DNA fingerprinting was verified by a comparison of its clustering capacity with those of randomly amplified polymorphic DNA analysis and internally transcribed spacer region sequencing, by testing species specificity, and by assessing its capacity to identify microevolutionary changes both in vitro and in vivo. Southern blot hybridization of EcoRI/SalI-digested DNA with Cp3-13 provides a fingerprinting system that (i) identifies the same strain in independent isolates, (ii) discriminates between unrelated isolates, (iii) separates independent isolates into valid groups in a dendrogram, (iv) identifies microevolution in infecting populations, and (v) is amenable to automatic computer-assisted DNA fingerprint analysis. This probe is now available for epidemiological studies. PMID:11158125

  9. Characterization of Actinomyces with genomic DNA fingerprints and rRNA gene probes.

    Science.gov (United States)

    Bowden, G; Johnson, J; Schachtele, C

    1993-08-01

    Cellular DNA from 25 Actinomyces naeslundii and Actinomyces viscosus strains belonging to the 7 taxonomic clusters of Fillery et al. (1978) and several unclustered strains was obtained by enzymatic and N-lauroylsarcosine/guanidine isothiocyanate treatment of whole cells, followed by extraction of the nucleic acid. The DNA samples were digested with restriction endonucleases BamHI or PvuII, and agarose gel electrophoresis was used to obtain DNA fingerprints. The DNA fragments were subjected to Southern blot hybridization with a digoxigenin-labeled cDNA probe transcribed from Escherichia coli 16S and 23S rRNA. The patterns of bands from genomic (DNA fingerprints) and rDNA fingerprints (ribotypes) were used for comparison between the taxonomic cluster strains and strains within clusters. Representative strains from each taxonomic cluster provided different BamHI DNA fingerprints and ribotype patterns with 3 to 9 distinct bands. Some strains within a cluster showed identical ribotype patterns with both endonucleases (A. naeslundii B120 and A. naeslundii B102 from cluster 3), while others showed the same pattern with BamHI but a different pattern with PvuII (A. naeslundii ATCC 12104 and 398A from cluster 5). A viscosus ATCC 15987 (cluster 7) and its parent strain T6 yielded identical fingerprint and ribotype patterns. The genomic diversity revealed by DNA fingerprinting and ribotyping demonstrates that these techniques, which do not require phenotypic expression, are suited for study of the oral ecology of the Actinomyces, and for epidemiological tracking of specific Actinomyces strains associated with caries lesions and sites of periodontal destruction.

  10. Usefulness of the secondary probe pTBN12 in DNA fingerprinting of Mycobacterium tuberculosis.

    OpenAIRE

    Chaves, F; Yang, Z; el Hajj, H; Alonso, M; Burman, W J; Eisenach, K D; Dronda, F; Bates, J H; Cave, M D

    1996-01-01

    A comparison was made between DNA fingerprints of Mycobacterium tuberculosis produced with the insertion sequence IS6110 and those produced with the polymorphic GC-rich repetitive sequence contained in the plasmid pTBN12. A total of 302 M. tuberculosis isolates from the prison system in Madrid, Spain, and the Denver Public Health Department (Denver, Colo.) were analyzed with the two probes. Both probes identified the same isolates in the same clusters when the fingerprints had six or more cop...

  11. The use of DNA fingerprinting to resolve conflicting results in patients with suspected gastrointestinal malignancy.

    Science.gov (United States)

    Islam, Sameer; Miller, Ethan D; Patel, Neal; De Petris, Giovanni; Highsmith, Edward W; Fleischer, David E

    2013-03-01

    To underscore the utility of DNA fingerprinting for clarifying disparate results from endoscopic pathologic specimens. Occasionally, serially obtained gastrointestinal biopsies may yield inconsistent results. These discrepancies pose a dilemma for gastroenterologists and their patients, especially when malignancy is a consideration. Patients referred to our tertiary care center from outside institutions had undergone endoscopically obtained esophageal biopsies showing malignancy, verified by pathologists at both our site and from the referring center. Repeat endoscopic biopsies at our center did not show malignancy. To verify that different sets of biopsies came from the same patient, we performed a polymerase chain reaction-based analysis comparing the 2 specimens. This analysis, called DNA fingerprinting, can show a high degree of certainty whether 2 specimens came from the same patient. In each case, DNA fingerprinting verified a match, laying the groundwork for intervention. One patient underwent endoscopic radiofrequency ablation to the esophageal mucosa involved. Another underwent esophagectomy with partial gastrectomy. Both are doing well clinically and remain cancer-free on follow-up. DNA fingerprinting is a powerful and a relatively inexpensive tool. Usually, only small amounts of tissue are required, and even degraded or archival tissue is adequate. DNA fingerprinting can be an important tool in the gastroenterologist's arsenal to help clarify conflicting results, allowing the patient and physician to move forward with the management.

  12. [Identification of a repetitive sequence element for DNA fingerprinting in Phytophthora sojae].

    Science.gov (United States)

    Yin, Lihua; Wang, Qinhu; Ning, Feng; Zhu, Xiaoying; Zuo, Yuhu; Shan, Weixing

    2010-04-01

    Establishment of DNA fingerprinting in Phytophthora sojae and an analysis of genetic relationship of Heilongjiang and Xinjiang populations. Bioinformatics tools were used to search repetitive sequences in P. sojae and Southern blot analysis was employed for DNA fingerprinting analysis of P. sojae populations from Heilongjiang and Xinjiang using the identified repetitive sequence. A moderately repetitive sequence was identified and designated as PS1227. Southern blot analysis indicated 34 distinct bands ranging in size from 1.5 kb-23 kb, of which 21 were polymorphic among 49 isolates examined. Analysis of single-zoospore progenies showed that the PS1227 fingerprint pattern was mitotically stable. DNA fingerprinting showed that the P. sojae isolates HP4002, SY6 and GJ0105 of Heilongjiang are genetically identical to DW303, 71228 and 71222 of Xinjiang, respectively. A moderately repetitive sequence designated PS1227 which will be useful for epidemiology and population biology studies of P. sojae was obtained, and a PS1227-based DNA fingerprinting analysis provided molecular evidence that P. sojae in Xinjiang was likely introduced from Heilongjiang.

  13. Examining DNA fingerprinting as an epidemiology tool in the tuberculosis program in the Northwest Territories, Canada.

    Science.gov (United States)

    Case, Cheryl; Kandola, Kami; Chui, Linda; Li, Vincent; Nix, Nancy; Johnson, Rhonda

    2013-01-01

    Tuberculosis (TB) is an important public health problem in the Northwest Territories (NWT), particularly among Canadian Aboriginal people. To analyse the transmission patterns of tuberculosis among the population living in the NWT, a territorial jurisdiction located within Northern Canada. This population-based retrospective study examined the DNA fingerprints of all laboratory confirmed cases of TB in the NWT, Canada, between 1990 and 2009. An isolate of each lab-confirmed case had genotyping done using IS6110 Restriction Fragment Length Polymorphism. DNA patterns were assigned to each DNA fingerprint, and indistinguishable fingerprints patterns were assigned a cluster. Social network analysis (SNA) was used to examine direct linkages among cases determined through conventional contact tracing (CCT), their DNA fingerprint and home community. Of the 225 lab-confirmed cases identified, the study was limited to 195 subjects due to DNA fingerprinting data availability. The mean age of the cases was 43.8 years (±22.6) and 120 (61.5%) males. The Dene (First Nations) encompassed 120 of the cases (87.7%), 8 cases (4.1%) were Inuit, 2 cases (1.0%) were Metis, 7 cases (3.6%) were Immigrants and 1 case had unknown ethnicity. One hundred and eighty six (95.4%) subjects were clustered, resulting in 8 clusters. Trend analysis showed significant relationships between with risk factors for unemployment (p=0.020), geographic location (p≤0.001) and homelessness (p≤0.001). Other significant risk factors included excessive alcohol consumption, prior infection with Mycobacterium tuberculosis and prior contact with a case of TB. This study demonstrates how DNA fingerprinting and SNA can be additional epidemiological tools, along with CCT method, to determine transmission patterns of TB.

  14. Typing of Mycoplasma pneumoniae by PCR-mediated DNA fingerprinting

    NARCIS (Netherlands)

    Ursi, D; Ieven, M; van Bever, H; Quint, W; Niesters, H G; Goossens, H

    PCR fingerprinting was used to characterize clinical isolates of Mycoplasma pneumoniae. Among 24 strains tested, two types were distinguished. Nineteen strains belonged to type 1, whereas only 5 strains belonged to type 2. The majority of strains isolated since 1991 in Belgium belong to type 1. No

  15. Typing of Mycoplasma pneumoniae by PCR-mediated DNA fingerprinting

    NARCIS (Netherlands)

    Ursi, D; Ieven, M; van Bever, H; Quint, W; Niesters, H G; Goossens, H

    1994-01-01

    PCR fingerprinting was used to characterize clinical isolates of Mycoplasma pneumoniae. Among 24 strains tested, two types were distinguished. Nineteen strains belonged to type 1, whereas only 5 strains belonged to type 2. The majority of strains isolated since 1991 in Belgium belong to type 1. No

  16. Effect of dactyloscopic powders on DNA profiling from enhanced fingerprints: results from an experimental study.

    Science.gov (United States)

    Tozzo, Pamela; Giuliodori, Alice; Rodriguez, Daniele; Caenazzo, Luciana

    2014-03-01

    We conducted a study on the effect of fingerprint enhancement methods on subsequent short tandem repeat profiling. First, we performed a study typing blood traces deposited on 5 different surfaces, treated with 8 types of dactyloscopic powders. Three different DNA extraction methods were used. Subsequently, we analyzed latent fingerprints on the same 5 surfaces enhanced with the 8 different powders used in the first part of the study. This study has demonstrated that DNA profiling can be performed on fingerprints left on different substrates, and the substrate will affect the amount of DNA that can be recovered for DNA typing. In the first phase of the study, a profile was obtained in 92% of the 120 samples analyzed; in the second part, in 55% of the 80 samples analyzed, we obtained a profile complete in 32.5% of the cases. From the results obtained, it seems that the powders used in latent fingerprints enhancement, rather than having a direct inhibitory effect on extraction and amplification of DNA, may cause partial degradation of DNA, reducing the efficiency of amplification reaction. It should not be forgotten that these results were obtained under laboratory conditions, and in real caseworks, there may still be different problems involved.

  17. [Genomic DNA fingerprints of Legionella pneumophila serogroup 2 strains as an epidemiologic marker].

    Science.gov (United States)

    Bender-Beck, L; Mühlenberg, W; Lück, P C; Ott, M; Horbach, I; Fehrenbach, F J; Wewalka, G; Hacker, J

    1995-08-01

    Using pulsed-field gel electrophoresis, DNA fingerprints of eleven Legionella pneumophila isolates of serogroup 2 were generated. It was shown that two strains from a patient suffering from pneumonia as well as three environmental strains isolated from the shower in the hotel where the patient stayed 5 days before his illness were identical. Six strains of the same serogroup isolated from other sources were clearly separated. Thus, DNA fingerprints by pulsed-field gel electrophoresis are excellent epidemiological markers for the rarely occurring serogroup 2 of Legionella pneumophila.

  18. A DNA Fingerprinting Simulation Laboratory for Biology Students: Hands-on Experimentation To Solve a Mock Forensic Problem.

    Science.gov (United States)

    Palladino, Michael A.; Cosentino, Emily

    2001-01-01

    Presents an alternative approach to DNA fingerprinting. Demonstrates how undergraduate students can be involved in many aspects of this type of experiment and how DNA fingerprinting experiments can be incorporated into the laboratory curriculum of courses for majors and nonmajors. (NB)

  19. Applications of the rep-PCR DNA fingerprinting technique to study microbial diversity, ecology and evolution.

    Science.gov (United States)

    Ishii, Satoshi; Sadowsky, Michael J

    2009-04-01

    A large number of repetitive DNA sequences are found in multiple sites in the genomes of numerous bacteria, archaea and eukarya. While the functions of many of these repetitive sequence elements are unknown, they have proven to be useful as the basis of several powerful tools for use in molecular diagnostics, medical microbiology, epidemiological analyses and environmental microbiology. The repetitive sequence-based PCR or rep-PCR DNA fingerprint technique uses primers targeting several of these repetitive elements and PCR to generate unique DNA profiles or 'fingerprints' of individual microbial strains. Although this technique has been extensively used to examine diversity among variety of prokaryotic microorganisms, rep-PCR DNA fingerprinting can also be applied to microbial ecology and microbial evolution studies since it has the power to distinguish microbes at the strain or isolate level. Recent advancement in rep-PCR methodology has resulted in increased accuracy, reproducibility and throughput. In this minireview, we summarize recent improvements in rep-PCR DNA fingerprinting methodology, and discuss its applications to address fundamentally important questions in microbial ecology and evolution.

  20. DNA fingerprinting: a quality control case study for human biospecimen authentication.

    Science.gov (United States)

    Kofanova, Olga A; Mathieson, William; Thomas, Gerry A; Betsou, Fotini

    2014-04-01

    This case study illustrates the usefulness of the DNA fingerprinting method in biobank quality control (QC) procedures and emphasizes the need for detailed and accurate record keeping during processing of biological samples. It also underlines the value of independent third-party assessment to identify points at which errors are most likely to have occurred when unexpected results are obtained from biospecimens.

  1. Genetic diversity analysis of nine chewing cane varieties (lines) and construction of their DNA fingerprints

    Science.gov (United States)

    In order to provide theoretical basis for variety identification and parental selection during sugarcane breeding process, the present study was conducted to analyze genetic diversity of nine chewing cane varieties (lines) and construct their DNA fingerprints. Combining twenty-one SSR molecular mark...

  2. Genetic variation in Phoca vitulina (the harbour seal) revealed by DNA fingerprinting and RAPDs

    NARCIS (Netherlands)

    Kappe, A.L.; van de Zande, L.; Vedder, E.J.; Bijlsma, R.; van Delden, Wilke

    Genetic variation in two harbour seal (Phoca vitulina) populations from the Dutch Wadden Sea and Scotland was examined by RAPD analysis and DNA fingerprinting. For comparison a population of grey seals (Halichoerus grypus) was studied. The RAPD method revealed a very low number of polymorphic bands.

  3. Evaluation of three methods for DNA fingerprinting of Corynebacterium pseudotuberculosis strains isolated from goats in Poland.

    Science.gov (United States)

    Stefańska, Ilona; Rzewuska, Magdalena; Binek, Marian

    2008-01-01

    Phenotypic approaches based on metabolic and biological characteristics of Corynebacterium pseudotuberculosis have been limited due to insufficient discrimination between closely related isolates. In this paper we present performance and convenience of three molecular typing methods: BOX-PCR, random amplification of polymorphic DNA (RAPD) and amplification of DNA fragments surrounding rare restriction site (ADSRRS-fingerprinting) in genome analysis of these bacteria. Among examined 61 strains there were distinguished four, eight and 10 different genotypes by BOX-PCR, RAPD and ADSRRS-fingerprinting, respectively. The value of discrimination index was the lowest for BOX-PCR (D = 0.265), much bigger for RAPD (D = 0.539) and the highest for ADSRRS-fingerprinting (D = 0.604). The good discriminatory ability and reproducibility of RAPD and ADSRRS-fingerprinting indicates that those techniques may be particularly applied for epidemiological studies of C. pseudotuberculosis isolates. We found that ADSRRS-fingerprinting is a rapid method offering good discrimination power, excellent reproducibility and may be applied for epidemiological studies of intraspecific genetic relatedness of C. pseudotuberculosis strains.

  4. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  5. DNA fingerprinting for the authentication of Ruta graveolens

    African Journals Online (AJOL)

    Jane

    2011-08-15

    Aug 15, 2011 ... In this study, random amplified polymorphic DNA (RAPD) was employed to ... samples using the DNA isolated from the dried leaf, seed and stem of both samples. ..... opposite strands and is complementary to the primer for.

  6. The Influence of Selected Fingerprint Enhancement Techniques on Forensic DNA Typing of Epithelial Cells Deposited on Porous Surfaces.

    Science.gov (United States)

    Tsai, Li-Chin; Lee, Cheng-Chang; Chen, Chun-Chieh; Lee, James Chun-I; Wang, Sheng-Meng; Huang, Nu-En; Linacre, Adrian; Hsieh, Hsing-Mei

    2016-01-01

    Fingerprints deposited at crime scene can be a source of DNA. Previous reports on the effects of fingerprint enhancement methods have focused mainly on fingermarks deposited in blood or saliva. Here, we evaluate the effects of fingerprint enhancement methods on fingerprints deposited on porous surfaces. We performed real-time quantification and STR typing, the results of which indicated that two methods (iodine fuming and 1,2-indanedione in ethyl acetate enhancement) had no effect on the quantity of DNA isolated and resultant STR alleles when compared to control samples. DNA quantities and allele numbers were lower for samples enhanced with silver nitrate and 1,2-indanedione in acetic acid when compared to control samples. Based on DNA quantity, quality, and observable stochastic effects, our data indicated that iodine fuming and 1,2-indanedione in ethyl acetate were the preferred options for the enhancement of fingerprints on porous surfaces. © 2015 American Academy of Forensic Sciences.

  7. A novel approach for differentiating pathogenic and non-pathogenic Leptospira based on molecular fingerprinting.

    Science.gov (United States)

    Xiao, Di; Zhang, Cuicai; Zhang, Huifang; Li, Xiuwen; Jiang, Xiugao; Zhang, Jianzhong

    2015-04-24

    Leptospirosis is a worldwide, deadly zoonotic disease. Pathogenic Leptospira causes leptospirosis. The rapid and accurate identification of pathogenic and non-pathogenic Leptospira strains is essential for appropriate therapeutic management and timely intervention for infection control. The molecular fingerprint is a simple and rapid alternative tool for microorganisms identification, which is based on matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). In this study, molecular fingerprint was performed to identify pathogenic strains of Leptospira. Phylogenetic analysis based on 16S rRNA gene sequences was used as the reference method. In addition, a label-free technique was used to reveal the different proteins of pathogenic or non-pathogenic Leptospira. A reference database was constructed using 30 Leptospira strains, including 16 pathogenic strains and 14 non-pathogenic strains. Two super reference spectra that were associated with pathogenicity were established. Overall, 33 Leptospira strains were used for validation, and 32 of 33 Leptospira strains could be identified on the species level and all the 33 could be classified as pathogenic or non-pathogenic. The super reference spectra and the major spectra projection (MSP) dendrogram correctly categorized the Leptospira strains into pathogenic and non-pathogenic groups, which was consistent with the 16S rRNA reference methods. Between the pathogenic and non-pathogenic strains, 108 proteins were differentially expressed. molecular fingerprint is an alternative to conventional molecular identification and can rapidly distinguish between pathogenic and non-pathogenic Leptospira strains. Therefore, molecular fingerprint may play an important role in the clinical diagnosis, treatment, surveillance, and tracking of epidemic outbreaks of leptospirosis. Leptospirosis is a worldwide zoonosis that is caused by spirochetes of the genus Leptospira. Leptospirosis is a serious zoonotic

  8. Converting Panax ginseng DNA and chemical fingerprints into two-dimensional barcode.

    Science.gov (United States)

    Cai, Yong; Li, Peng; Li, Xi-Wen; Zhao, Jing; Chen, Hai; Yang, Qing; Hu, Hao

    2017-07-01

    In this study, we investigated how to convert the Panax ginseng DNA sequence code and chemical fingerprints into a two-dimensional code. In order to improve the compression efficiency, GATC2Bytes and digital merger compression algorithms are proposed. HPLC chemical fingerprint data of 10 groups of P. ginseng from Northeast China and the internal transcribed spacer 2 (ITS2) sequence code as the DNA sequence code were ready for conversion. In order to convert such data into a two-dimensional code, the following six steps were performed: First, the chemical fingerprint characteristic data sets were obtained through the inflection filtering algorithm. Second, precompression processing of such data sets is undertaken. Third, precompression processing was undertaken with the P. ginseng DNA (ITS2) sequence codes. Fourth, the precompressed chemical fingerprint data and the DNA (ITS2) sequence code were combined in accordance with the set data format. Such combined data can be compressed by Zlib, an open source data compression algorithm. Finally, the compressed data generated a two-dimensional code called a quick response code (QR code). Through the abovementioned converting process, it can be found that the number of bytes needed for storing P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can be greatly reduced. After GTCA2Bytes algorithm processing, the ITS2 compression rate reaches 75% and the chemical fingerprint compression rate exceeds 99.65% via filtration and digital merger compression algorithm processing. Therefore, the overall compression ratio even exceeds 99.36%. The capacity of the formed QR code is around 0.5k, which can easily and successfully be read and identified by any smartphone. P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can form a QR code after data processing, and therefore the QR code can be a perfect carrier of the authenticity and quality of P. ginseng information. This study provides a theoretical

  9. Lanthanide mixed ligand chelates for DNA profiling and latent fingerprint detection

    Science.gov (United States)

    Menzel, E. R.; Allred, Clay

    1997-02-01

    It is our aim to develop a universally applicable latent fingerprint detection method using lanthanide (rare-earth) complexes as a source of luminescence. Use of these lanthanide complexes offers advantages on several fronts, including benefits from large Stokes shifts, long luminescence lifetimes, narrow emissions, ability of sequential assembly of complexes, and chemical variability of the ligands. Proper exploitation of these advantages would lead to a latent fingerprint detection method superior to any currently available. These same characteristics also lend themselves to many of the problems associated with DNA processing in the forensic science context.

  10. Usefulness of the DNA-fingerprinting pattern and the multilocus enzyme electrophoresis profile in the assessment of outbreaks of meningococcal disease

    DEFF Research Database (Denmark)

    Weis, N; Lind, I

    1996-01-01

    cases were identical to the outbreak strain. None of the local serogroup C carrier strains isolated during the outbreak of serogroup C disease were identical to the outbreak strain. Both DNA-fingerprinting and MEE improved the differentiation of meningococci when compared with phenotypic......The objective of the study was to assess whether genotypic characterization by means of DNA-fingerprinting pattern (DFP) and multilocus enzyme electrophoresis (MEE) profile as compared to phenotypic characterization would improve the differentiation of Neisseria meningitidis strains associated...... in each outbreak were designated the index strains. Among the remaining 55 outbreak strains 52 were either DFP-identical or DFP-indistinguishable when compared with the one relevant out of the 4 index strains. This was only the case for 17 of the 37 strains isolated from sporadic cases caused by the same...

  11. Assessing the Risk of Secondary Transfer Via Fingerprint Brush Contamination Using Enhanced Sensitivity DNA Analysis Methods.

    Science.gov (United States)

    Bolivar, Paula-Andrea; Tracey, Martin; McCord, Bruce

    2016-01-01

    Experiments were performed to determine the extent of cross-contamination of DNA resulting from secondary transfer due to fingerprint brushes used on multiple items of evidence. Analysis of both standard and low copy number (LCN) STR was performed. Two different procedures were used to enhance sensitivity, post-PCR cleanup and increased cycle number. Under standard STR typing procedures, some additional alleles were produced that were not present in the controls or blanks; however, there was insufficient data to include the contaminant donor as a contributor. Inclusion of the contaminant donor did occur for one sample using post-PCR cleanup. Detection of the contaminant donor occurred for every replicate of the 31 cycle amplifications; however, using LCN interpretation recommendations for consensus profiles, only one sample would include the contaminant donor. Our results indicate that detection of secondary transfer of DNA can occur through fingerprint brush contamination and is enhanced using LCN-DNA methods. © 2015 American Academy of Forensic Sciences.

  12. Usage of DNA Fingerprinting Technology for Quality Control in Molecular Lab Bench Work.

    Science.gov (United States)

    McIntosh, Linda Y; Lal, Janella E; Qin, Dahui

    2018-01-01

    One of the major quality assurance (QA) goals in many molecular laboratories is to avoid sample pipetting errors on the lab bench; especially when pipetting into multiwell plates. A pipetting error can cause a switch in patient samples, which can lead to recording the wrong results for the patient samples involved. Such pipetting errors are difficult to identify when it happens in lab bench work. DNA fingerprinting is a powerful tool in determining sample identities. Our laboratory has explored the usage of this technology in our QA process and successfully established that DNA fingerprinting can be used to monitor possible sample switch in gene rearrangement lab bench work. We use florescent light to quench the florescence in the gene rearrangement polymerase chain reaction products. After that, DNA fingerprinting technology is used to identify the sample DNA in the gene rearrangement polymerase chain reaction plate. The result is compared with the corresponding patient's blood sample DNA to determine whether there is a sample switch during the lab bench work.

  13. Verifying the geographic origin of mahogany (Swietenia macrophylla King) with DNA-fingerprints.

    Science.gov (United States)

    Degen, B; Ward, S E; Lemes, M R; Navarro, C; Cavers, S; Sebbenn, A M

    2013-01-01

    Illegal logging is one of the main causes of ongoing worldwide deforestation and needs to be eradicated. The trade in illegal timber and wood products creates market disadvantages for products from sustainable forestry. Although various measures have been established to counter illegal logging and the subsequent trade, there is a lack of practical mechanisms for identifying the origin of timber and wood products. In this study, six nuclear microsatellites were used to generate DNA fingerprints for a genetic reference database characterising the populations of origin of a large set of mahogany (Swietenia macrophylla King, Meliaceae) samples. For the database, leaves and/or cambium from 1971 mahogany trees sampled in 31 stands from Mexico to Bolivia were genotyped. A total of 145 different alleles were found, showing strong genetic differentiation (δ(Gregorious)=0.52, F(ST)=0.18, G(ST(Hedrick))=0.65) and clear correlation between genetic and spatial distances among stands (r=0.82, P<0.05). We used the genetic reference database and Bayesian assignment testing to determine the geographic origins of two sets of mahogany wood samples, based on their multilocus genotypes. In both cases the wood samples were assigned to the correct country of origin. We discuss the overall applicability of this methodology to tropical timber trading. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  14. Analysis of fingerprint samples, testing various conditions, for forensic DNA identification.

    Science.gov (United States)

    Ostojic, Lana; Wurmbach, Elisa

    2017-01-01

    Fingerprints can be of tremendous value for forensic biology, since they can be collected from a wide variety of evident types, such as handles of weapons, tools collected in criminal cases, and objects with no apparent staining. DNA obtained from fingerprints varies greatly in quality and quantity, which ultimately affects the quality of the resulting STR profiles. Additional difficulties can arise when fingerprint samples show mixed STR profiles due to the handling of multiple persons. After applying a tested protocol for sample collection (swabbing with 5% Triton X-100), DNA extraction (using an enzyme that works at elevated temperatures), and PCR amplification (AmpFlSTR® Identifiler® using 31cycles) extensive analysis was performed to better understand the challenges inherent to fingerprint samples, with the ultimate goal of developing valuable profiles (≥50% complete). The impact of time on deposited fingerprints was investigated, revealing that while the quality of profiles deteriorated, full STR profiles could still be obtained from samples after 40days of storage at room temperature. By comparing the STR profiles from fingerprints of the dominant versus the non-dominant hand, we found a slightly better quality from the non-dominant hand, which was not always significant. Substrates seem to have greater effects on fingerprints. Tests on glass, plastic, paper and metal (US Quarter dollar, made of Cu and Ni), common substrates in offices and homes, showed best results for glass, followed by plastic and paper, while almost no profiles were obtained from a Quarter dollar. Important for forensic casework, we also assessed three-person mixtures of touched fingerprint samples. Unlike routinely used approaches for sampling evidence, the surface of an object (bottle) was sectioned into six equal parts and separate samples were taken from each section. The samples were processed separately for DNA extraction and STR amplification. The results included a few single

  15. Fluorescence- and capillary electrophoresis (CE)-based SSR DNA fingerprinting and a molecular identity database for the Louisiana sugarcane industry

    Science.gov (United States)

    A database of Louisiana sugarcane molecular identity has been constructed and is being updated annually using FAM or HEX or NED fluorescence- and capillary electrophoresis (CE)-based microsatellite (SSR) fingerprinting information. The fingerprints are PCR-amplified from leaf DNA samples of current ...

  16. The Evidentiary Value of DNA Fingerprint as Criminal Evidence

    Directory of Open Access Journals (Sweden)

    Mussa Masoud Irhouma

    2016-12-01

    Full Text Available The subject of criminal evidence is considered to be one of the greatest challenges that face authorities concerned with fighting crime at all levels. Due to this, authorities try to benefit as much as possible from scientific evidence due to the important role it plays in revealing the identity of criminals or victims in present or past criminal cases against unknown people through the physical traces that are found at the scene of an event, which include biological traces. DNA is one of these scientific evidences which can be benefited from in the field of crime investigation. Despite the importance of DNA technology in this area of work, there is still some debate surrounding its acceptance as criminal evidence. Some experts believe it to be of great importance whereas others cast doubt on its evidentiary value. They attribute this to a number of factors including the experts who are entrusted to examine DNA samples, the laboratories in which DNA analysis takes place, as well as the fact that resorting to DNA as a criminal evidence raises some legal complexities related to the permissibility of using it and the conditions and scope of its use. This paper sheds light on DNA and its evidentiary value among the judiciary in criminal cases by answering a number of questions such as the possibility of forcing a person to undergo DNA analysis or not to do so and to what extent it is to be relied upon as criminal evidence. This paper concluded the importance of DNA and its role in the field of criminal evidence. Despite this, even if the DNA evidence is sufficient in proving the innocence of the accused, it is only an indication that must not be solely relied upon and treated as a single conclusive evidence, particularly in cases that involve prescribed Islamic or retributive punishments.

  17. Genetic diversity and DNA fingerprint study in tomato (Solanum ...

    African Journals Online (AJOL)

    User_Name

    tomato (S. lycopersicon) that have different origin and grown under. Egyptian environment ..... Saccharomyces cerevisiae (Sia et al., 2000) up to 10-3 in the pipefish .... (2000). Analysis of microsatellite mutations in the mitochondrial DNA.

  18. Qualitative and quantitative assessment of single fingerprints in forensic DNA analysis.

    Science.gov (United States)

    Ostojic, Lana; Klempner, Stacey A; Patel, Rosni A; Mitchell, Adele A; Axler-DiPerte, Grace L; Wurmbach, Elisa

    2014-11-01

    Fingerprints and touched items are important sources of DNA for STR profiling, since this evidence can be recovered in a wide variety of criminal offenses. However, there are some fundamental difficulties in working with these samples, including variability in quantity and quality of extracted DNA. In this study, we collected and analyzed over 700 fingerprints. We compared a commercially available extraction protocol (Zygem) to two methods developed in our laboratory, a simple one-tube protocol and a high sensitivity protocol (HighSens) that includes additional steps to concentrate and purify the DNA. The amplification protocols tested were AmpFLSTR® Identifiler® using either 28 or 31 amplification cycles, and Identifiler® Plus using 32 amplification cycles. We found that the HighSens and Zygem extraction methods were significantly better in their DNA yields than the one-tube method. Identifiler® Plus increased the quality of the STR profiles for the one-tube extraction significantly. However, this effect could not be verified for the other extraction methods. Furthermore, microscopic analysis of single fingerprints revealed that some individuals tended to shed more material than others onto glass slides. However, a dense deposition of skin flakes did not strongly correlate with a high quality STR profile. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Somatic mutations in stilbene estrogen-induced Syrian hamster kidney tumors identified by DNA fingerprinting

    Directory of Open Access Journals (Sweden)

    Roy Deodutta

    2004-01-01

    Full Text Available Abstract Kidney tumors from stilbene estrogen (diethylstilbestrol-treated Syrian hamsters were screened for somatic genetic alterations by Random Amplified Polymorphic DNA-polymerase chain-reaction (RAPD-PCR fingerprinting. Fingerprints from tumor tissue were generated by single arbitrary primers and compared with fingerprints for normal tissue from the same animal, as well as normal and tumor tissues from different animals. Sixty one of the arbitrary primers amplified 365 loci that contain approximately 476 kbp of the hamster genome. Among these amplified DNA fragments, 44 loci exhibited either qualitative or quantitative differences between the tumor tissues and normal kidney tissues. RAPD-PCR loci showing decreased and increased intensities in tumor tissue DNA relative to control DNA indicate that loci have undergone allelic losses and gains, respectively, in the stilbene estrogen-induced tumor cell genome. The presence or absence of the amplified DNA fragments indicate homozygous insertions or deletions in the kidney tumor DNA compared to the age-matched normal kidney tissue DNA. Seven of 44 mutated loci also were present in the kidney tissues adjacent to tumors (free of macroscopic tumors. The presence of mutated loci in uninvolved (non-tumor surrounding tissue adjacent to tumors from stilbene estrogen-treated hamsters suggests that these mutations occurred in the early stages of carcinogenesis. The cloning and sequencing of RAPD amplified loci revealed that one mutated locus had significant sequence similarity with the hamster Cyp1A1 gene. The results show the ability of RAPD-PCR to detect and isolate, in a single step, DNA sequences representing genetic alterations in stilbene estrogen-induced cancer cells, including losses of heterozygosity, and homozygous deletion and insertion mutations. RAPD-PCR provides an alternative molecular approach for studying cancer cytogenetics in stilbene estrogen-induced tumors in humans and experimental

  20. A DNA fingerprinting procedure for ultra high-throughput genetic analysis of insects.

    Science.gov (United States)

    Schlipalius, D I; Waldron, J; Carroll, B J; Collins, P J; Ebert, P R

    2001-12-01

    Existing procedures for the generation of polymorphic DNA markers are not optimal for insect studies in which the organisms are often tiny and background molecular information is often non-existent. We have used a new high throughput DNA marker generation protocol called randomly amplified DNA fingerprints (RAF) to analyse the genetic variability in three separate strains of the stored grain pest, Rhyzopertha dominica. This protocol is quick, robust and reliable even though it requires minimal sample preparation, minute amounts of DNA and no prior molecular analysis of the organism. Arbitrarily selected oligonucleotide primers routinely produced approximately 50 scoreable polymorphic DNA markers, between individuals of three independent field isolates of R. dominica. Multivariate cluster analysis using forty-nine arbitrarily selected polymorphisms generated from a single primer reliably separated individuals into three clades corresponding to their geographical origin. The resulting clades were quite distinct, with an average genetic difference of 37.5 +/- 6.0% between clades and of 21.0 +/- 7.1% between individuals within clades. As a prelude to future gene mapping efforts, we have also assessed the performance of RAF under conditions commonly used in gene mapping. In this analysis, fingerprints from pooled DNA samples accurately and reproducibly reflected RAF profiles obtained from individual DNA samples that had been combined to create the bulked samples.

  1. DNA fingerprinting demonstrates extremely low levels of genetic variation among blackberry cultivars grown in Finland

    Directory of Open Access Journals (Sweden)

    K. ANTONIUS

    2008-12-01

    Full Text Available Most blackberry plants cultivated in Finland closely resemble the American species Rubus allegheniensis. Thirty nine such blackberry accessions in the University of Helsinki clone collection were studied by hybridization-based DNA fingerprinting and compared with some known cultivars of R. allegheniensis derivation. 'Imperial' appears to be identical to the old cultivar 'Majestät', but 'Earliest of All' differs considerably. In addition, 37 of the accessions analysed also have DNA fingerprints that appear to be completely identical to that of 'Majestät'! The remaining two accessions, although identical to each other, exhibit one band not found in 'Majestät' that is probably caused by a somatic mutation.

  2. Acute and chronic gregarisation are associated with distinct DNA methylation fingerprints in desert locusts.

    Science.gov (United States)

    Mallon, Eamonn B; Amarasinghe, Harindra E; Ott, Swidbert R

    2016-10-18

    Desert locusts (Schistocerca gregaria) show a dramatic form of socially induced phenotypic plasticity known as phase polyphenism. In the absence of conspecifics, locusts occur in a shy and cryptic solitarious phase. Crowding with conspecifics drives a behavioural transformation towards gregariousness that occurs within hours and is followed by changes in physiology, colouration and morphology, resulting in the full gregarious phase syndrome. We analysed methylation-sensitive amplified fragment length polymorphisms (MS-AFLP) to compare the effect of acute and chronic crowding on DNA methylation in the central nervous system. We find that crowd-reared and solitary-reared locusts show markedly different neural MS-AFLP fingerprints. However, crowding for a day resulted in neural MS-AFLP fingerprints that were clearly distinct from both crowd-reared and uncrowded solitary-reared locusts. Our results indicate that changes in DNA methylation associated with behavioural gregarisation proceed through intermediate states that are not simply partial realisations of the endpoint states.

  3. DNA fingerprinting of Kentucky bluegrass cultivars and hybrids

    Science.gov (United States)

    As a high polyploidy, apomictic, self-incompatible, perennial grass, Kentucky bluegrass has such complex genetic architecture that conducting standard Mendelian genetic selection is currently impossible. One large hurdle is the inability to differentiate true hybrids from other apomictic progenies....

  4. DNA fingerprinting of spore-forming bacterial isolates, using Bacillus ...

    African Journals Online (AJOL)

    User

    Full Length Research Paper ... resulted in a search for better techniques for classifying ... only a few laboratories worldwide are able to perform a ... MATERIALS AND METHODS. Bacterial ... s with distilled water and blotted dry with tissue paper (Kimberly- ... A test on the quality and quantity of DNA extracted was conducted.

  5. Fingerprinting of cell lines by directed amplification of minisatellite-region DNA (DAMD

    Directory of Open Access Journals (Sweden)

    Silva L.M.

    2001-01-01

    Full Text Available The development of in vitro propagation of cells has been an extraordinary technical advance for several biological studies. The correct identification of the cell line used, however, is crucial, as a mistaken identity or the presence of another contaminating cell may lead to invalid and/or erroneous conclusions. We report here the application of a DNA fingerprinting procedure (directed amplification of minisatellite-region DNA, developed by Heath et al. [Nucleic Acids Research (1993 21: 5782-5785], to the characterization of cell lines. Genomic DNA of cells in culture was extracted and amplified by PCR in the presence of VNTR core sequences, and the amplicons were separated by agarose gel electrophoresis. After image capture with a digital camera, the banding profiles obtained were analyzed using a software (AnaGel specially developed for the storage and analysis of electrophoretic fingerprints. The fingerprints are useful for construction of a data base for identification of cell lines by comparison to reference profiles as well as comparison of similar lines from different sources and periodic follow-up of cells in culture.

  6. [Fingerprints identification of Gynostemma pentaphyllum by RAPD and cloning and analysis of its specific DNA fragment].

    Science.gov (United States)

    Jiang, Jun-fu; Li, Xiong-ying; Wu, Yao-sheng; Luo, Yu; Zhao, Rui-qiang; Lan, Xiu-wan

    2009-02-01

    To identify the resources of Gynostemma pentaphyllum and its spurious breed plant Cayratia japonica at level of DNA. Two random primers ( WGS001, WGS004) screened were applied to do random amplification with genomic DNA extracted from Gynostemma pentaphyllum and Cayratia japonica which were collected from different habitats. After amplificated with WGS004, one characteristic fragment about 500 bp which was common to all Gynostemma pentaphyllum samples studied but not to Cayratia japonica was cloned and sequenced. Then these sequences obtained were analyzed for identity and compared by Blastn program in GenBank. There were obvious different bands amplified by above two primers in their fingerprints of genomic DNA. On the basis of these different bands of DNA fingerprints, they could distinguish Gynostemma pentaphyllum and Cayratia japonica obviously. Sequence alignment of seven cloned bands showed that their identities ranged from 45.7% - 94.5%. There was no similar genome sequences searched in GenBank. This indicated that these seven DNA fragments had not been reported before and they should be new sequences. RAPD technique can be used for the accurate identification of Gynostemma pentaphyllum and its counterfeit goods Cayratia japonica. Besides, these specific DNA sequences for Gynostemmna pentaphyllum in this study are useful for the further research on identification of species and assisted selection breeding in Gynostemma pentaphyllum.

  7. A study of the genetic relationships within and among wolf packs using DNA fingerprinting and mitochondrial DNA

    Science.gov (United States)

    Lehman, Niles; Clarkson, Peter; Mech, L. David; Meier, Thomas J.; Wayne, Robert K.

    1992-01-01

    DNA fingerprinting and mitochondrial DNA analyses have not been used in combination to study relatedness in natural populations. We present an approach that involves defining the mean fingerprint similarities among individuals thought to be unrelated because they have different mtDNA genotypes. Two classes of related individuals are identified by their distance in standard errors above this mean value. The number of standard errors is determined by analysis of the association between fingerprint similarity and relatedness in a population with a known genealogy. We apply this approach to gray wolf packs from Minnesota, Alaska, and the Northwest Territories. Our results show that: (1) wolf packs consist primarily of individuals that are closely related genetically, but some packs contain unrelated, non-reproducing individuals; (2) dispersal among packs within the same area is common; and (3) short-range dispersal appears more common for female than male wolves. The first two of these genetically-based observations are consistent with behavioral data on pack structure and dispersal in wolves, while the apparent sex bias in dispersal was not expected.

  8. Multilocus DNA fingerprinting in paternity analysis: a Chilean experience

    Directory of Open Access Journals (Sweden)

    Cifuentes O. Lucía

    2000-01-01

    Full Text Available DNA polymorphism is very useful in paternity analysis. The present paper describes paternity studies done using DNA profiles obtained with the (CAC5 probe. All of the subjects studied were involved in nonjudicial cases of paternity. Genomic DNA digested with HaeIII was run on agarose gels and hybridized in the gel with the (CAC5 probe labeled with 32P. The mean number of bands larger than the 4.3 kb per individual was 16.1. The mean proportion of bands shared among unrelated individuals was 0.08 and the mean number of test bands was 7.1. This corresponded to an exclusion probability greater than 0.999999. Paternity was excluded in 34.5% of the cases. The mutation frequency estimated from non-excluded cases was 0.01143 bands per child. In these cases, the paternity was confirmed by a locus-specific analysis of eight independent PCR-based loci. The paternity index was computed in all non-excluded cases. It can be concluded that this method is a powerful and inexpensive alternative to solve paternity doubts.

  9. Genetic diversity in different populations of sloths assessed by DNA fingerprinting

    Directory of Open Access Journals (Sweden)

    MORAES N.

    2002-01-01

    Full Text Available In this study we analyzed a population of Bradypus torquatus with individuals originally distributed in different localities of Bahia, and two populations of B. variegatus with individuals from Bahia and São Paulo States. Using the DNA fingerprinting method, we assessed the genetic variability within and between populations. Analysis of the DNA profiles revealed genetic similarity indices ranging from 0.34 ± 0.07 to 0.87 ± 0.04. Similar low levels of genetic variability were found only in isolated mammalian populations or among related individuals. This study presents the first analyses of genetic diversity in sloth populations.

  10. ESDA®-Lite collection of DNA from latent fingerprints on documents.

    Science.gov (United States)

    Plaza, Dane T; Mealy, Jamia L; Lane, J Nicholas; Parsons, M Neal; Bathrick, Abigail S; Slack, Donia P

    2015-05-01

    The ability to detect and non-destructively collect biological samples for DNA processing would benefit the forensic community by preserving the physical integrity of evidentiary items for more thorough evaluations by other forensic disciplines. The Electrostatic Detection Apparatus (ESDA®) was systemically evaluated for its ability to non-destructively collect DNA from latent fingerprints deposited on various paper substrates for short tandem repeat (STR) DNA profiling. Fingerprints were deposited on a variety of paper substrates that included resume paper, cotton paper, magazine paper, currency, copy paper, and newspaper. Three DNA collection techniques were performed: ESDA collection, dry swabbing, and substrate cutting. Efficacy of each collection technique was evaluated by the quantity of DNA present in each sample and the percent profile generated by each sample. Both the ESDA and dry swabbing non-destructive sampling techniques outperformed the destructive methodology of substrate cutting. A greater number of full profiles were generated from samples collected with the non-destructive dry swabbing collection technique than were generated from samples collected with the ESDA; however, the ESDA also allowed the user to visualize the area of interest while non-destructively collecting the biological material. The ability to visualize the biological material made sampling straightforward and eliminated the need for numerous, random swabbings/cuttings. Based on these results, the evaluated non-destructive ESDA collection technique has great potential for real-world forensic implementation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet

    2004-01-01

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  12. Genetic variation and DNA fingerprinting of durian types in Malaysia using simple sequence repeat (SSR) markers.

    Science.gov (United States)

    Siew, Ging Yang; Ng, Wei Lun; Tan, Sheau Wei; Alitheen, Noorjahan Banu; Tan, Soon Guan; Yeap, Swee Keong

    2018-01-01

    Durian ( Durio zibethinus ) is one of the most popular tropical fruits in Asia. To date, 126 durian types have been registered with the Department of Agriculture in Malaysia based on phenotypic characteristics. Classification based on morphology is convenient, easy, and fast but it suffers from phenotypic plasticity as a direct result of environmental factors and age. To overcome the limitation of morphological classification, there is a need to carry out genetic characterization of the various durian types. Such data is important for the evaluation and management of durian genetic resources in producing countries. In this study, simple sequence repeat (SSR) markers were used to study the genetic variation in 27 durian types from the germplasm collection of Universiti Putra Malaysia. Based on DNA sequences deposited in Genbank, seven pairs of primers were successfully designed to amplify SSR regions in the durian DNA samples. High levels of variation among the 27 durian types were observed (expected heterozygosity, H E  = 0.35). The DNA fingerprinting power of SSR markers revealed by the combined probability of identity (PI) of all loci was 2.3×10 -3 . Unique DNA fingerprints were generated for 21 out of 27 durian types using five polymorphic SSR markers (the other two SSR markers were monomorphic). We further tested the utility of these markers by evaluating the clonal status of shared durian types from different germplasm collection sites, and found that some were not clones. The findings in this preliminary study not only shows the feasibility of using SSR markers for DNA fingerprinting of durian types, but also challenges the current classification of durian types, e.g., on whether the different types should be called "clones", "varieties", or "cultivars". Such matters have a direct impact on the regulation and management of durian genetic resources in the region.

  13. Genetic effect of A-bomb radiation- Analysis of minisatellite regions detected by DNA fingerprint probe

    International Nuclear Information System (INIS)

    Kodaira, Mieko

    1999-01-01

    In author's laboratory, screening of mutation in germ cells of A-bomb survivors is under investigation with use of 8 single-locus minisatellite probes and no increase in mutation rate has been detected hitherto. This paper reported results of screening on the minisatellite region, which consisting of short repeated base sequence, using a DNA fingerprint probe for 33.15 core sequence. Subjects were 50 A-bomb survivor families exposed to mean dose of 1.9 Sv (exposed group) or 0 Gy (control), having 64 or 60 children, respectively. DNA was extracted from their B cells established by EB virus and subjected to agarose-gel electrophoresis followed by southern blotting with some improvements for fingerprinting. On the fingerprints, numbers of the band detected in regions of >3.5 kb were 1080 in children of the exposed group (16.9/child) and 1024 (17.1) in the control group, indicating no detectable effect of exposure on the germ cell mutation rate in the region.(K.H.)

  14. Recovery of DNA from latent fingerprint tape lifts archived against matte acetate.

    Science.gov (United States)

    Steadman, Shelly A; Hoofer, Steven R; Geering, Sarah C; King, Stephanie; Bennett, Marc A

    2015-05-01

    This study was driven by court order to examine methods to remove, extract, and STR-type potential DNA entrapped between latent fingerprint lifting tape and matte acetate that was collected from a 1977 crime scene. Results indicate that recovery of appreciable quantities of DNA is more challenging once adhesive is attached to matte acetate cards and even more difficult when fixed following black powder enhancement. STR amplification of extracts from entrapped fingermarks collected following the dusting/lifting procedure did not produce robust profiles, and extraneous peaks not expressed by print donors were detected for some samples. A hearing was set to argue whether there was DNA remaining to be tested, and if so, whether that DNA could be exculpatory in this postconviction matter. The studies herein provided the basis for the court's decision to not require the testing. © 2015 American Academy of Forensic Sciences.

  15. Comparative study of Microsporum canis isolates by DNA fingerprinting.

    Science.gov (United States)

    Shafiee, Shabnam; Khosravi, Ali Reza; Ashrafi Tamai, Iradj

    2014-08-01

    Microsporum canis is a zoophilic fungus and it is an important agent of dermatophytosis. Cats act as important reservoirs. Clinically, it is too difficult to differentiate dermatophytosis caused by various species, also this fungus loses its morphological characteristics easily because of subculture; so using of rapid and accurate laboratory techniques for identifying the dermatophytes is important, therefore, RAPD-PCR was applied for the differentiation of the isolates. In this study, 10 M. canis isolates were detected in cats, dog, human, fox and rabbit at the Mycology Research Center, Faculty of Veterinary Medicine, University of Tehran. For running the RAPD-PCR, PCR set system and three random primers OPU 15, OPU 13 and OPA 04 were used. Then phylogenetic tree and similarity coefficient table were drawn. The results showed that there were some common bands between M. canis isolates. There were some specific bands for each isolates, as well. Our study showed, despite the typical morphology of the whole isolates, they were placed in different branches in molecular typing. © 2014 Blackwell Verlag GmbH.

  16. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    Science.gov (United States)

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc

  17. Effects of latent fingerprint development reagents on subsequent forensic DNA typing: a review.

    Science.gov (United States)

    Kumar, Parveen; Gupta, Ritika; Singh, Rajinder; Jasuja, Om Prakash

    2015-05-01

    Successful development of latent fingerprints can be helpful in solving the case but in case where fingerprints are smudged, distorted or overlapped, the question arises whether it is still possible to identify the person apart from dermatoglyphic features. Sweat residue present in the latent prints is supposed to have quite good quantity of cellular material which if analyzed properly can be used to generate forensic DNA profile of the individual and may answer the queries related to the effect of reagents used to develop the prints, as they may have a significant effect on the process of examination of this evidentiary material. In the present work an effort has been made to summarize the published review of literature on this aspect of personal identification. Copyright © 2015 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  18. DNA fingerprinting approaches to trace Escherichia coli sharing between dogs and owners.

    Science.gov (United States)

    Naziri, Z; Derakhshandeh, A; Firouzi, R; Motamedifar, M; Shojaee Tabrizi, A

    2016-02-01

    To determine the prevalence of cross-species sharing of Escherichia coli between healthy dogs and humans living in the same household. Two faecal E. coli isolates from 25 healthy dog-owner pairs and 16 healthy control humans were tested using three fingerprinting methods. The prevalence of within-household sharing of E. coli was 4, 8 and 8% using pulsed-field gel electrophoresis, randomly amplified polymorphic DNA and enterobacterial repetitive intergenic consensus-PCR analyses respectively. Within-household bacterial sharing was more prevalent than across-household sharing (P fingerprinting techniques will help to find ways for reducing the economic impact of E. coli infections. This study support claims that public health concerns regarding the cross-species sharing of E. coli are warranted but this risk is minimal. © 2015 The Society for Applied Microbiology.

  19. Establishment of dna fingerprinting in clonal tea improved cultivars from yunnan of china using issr markers

    International Nuclear Information System (INIS)

    Liu, B.Y.; Zhao, C.M.; Sun, X.M.; Jiang, H.B.

    2015-01-01

    In this study, DNA fingerprints were constructed by using ISSR markers for 20 clonal improved varieties developed by two breeding institutes in Yunnan province. Seven core ISSR primers were selected from 15 primers. A total of 110 bands were generated by PAGE with seven core primers, 93 of which were polymorphic bands, the percentage of polymorphic band (PPB) was 84.54%, and the mean value of polymorphism information content (PIC) reached 0.417; the genetic similarity coefficient of the cultivars was 0.574-0.854. The two primers, UBC835 and ISSR2, had high PIC values, and could be used to distinguish all cultivars, presenting the most efficient single primers. Among the all of primer combinations from the seven core primers, the three combinations, UBC835/UBC811, UBC835/ISSR2, and UBC835/ISSR3 showed lower similar coefficients, and more efficient in identifying the 20 improved varieties than the other primer combinations. Then these three primer combinations were further scored in 15 traditional cultivars. The results showed that UBC835/ISSR2 was the optimal primer combination, which could be used to distinguish each material among the 20 clonal improved varieties and 15 traditional cultivals. Finally, the DNA fingerprints of the 20 clonal improved varieties were constructed based on country and region code, breeding institute, core primer name and ISSR marker data. The established fingerprints could provide reliable scientific base for the protection of intellectual property right for these clonal improved varieties, and the important molecular information contained in these fingerprints would be useful for the authenticity identification and genetic relationship analysis of tea varieties. (author)

  20. Development of an optimized random amplified polymorphic DNA protocol for fingerprinting of Klebsiella pneumoniae.

    Science.gov (United States)

    Ashayeri-Panah, M; Eftekhar, F; Feizabadi, M M

    2012-04-01

    To develop an optimized random amplified polymorphic DNA (RAPD) protocol for fingerprinting clinical isolates of Klebsiella pneumoniae. Employing factorial design of experiments, repeatable amplification patterns were obtained for 54 nosocomial isolates using 1 μmol 1(-1) primer, 4 mmol 1(-1) MgCl(2), 0·4 mmol 1(-1) dNTPs, 2·5 U Taq DNA polymerase and 90 ng DNA template in a total volume of 25 μl. The optimum thermocycling program was: initial denaturation at 94°C for 4 min followed by 50 cycles of 1 min at 94°C, 2 min at 34°C, 2 min at 72°C and a final extension at 72°C for 10 min. The optimized RAPD protocol was highly discriminatory (Simpson's diversity index, 0·982), and all isolates were typable with repeatable patterns (Pearson's similarity coefficient ≈ 100%). Seven main clusters were obtained on a similarity level of 70% and 32 distinct clusters on a similarity level of 85%, reflecting the heterogeneity of the isolates. Systematic optimization of RAPD generated reliable DNA fingerprints for nosocomial isolates of K. pneumoniae. This is the first report on RAPD optimization based on factorial design of experiments for discrimination of K. pneumoniae. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

  1. Efficient DNA Fingerprinting Based on the Targeted Sequencing of Active Retrotransposon Insertion Sites Using a Bench-Top High-Throughput Sequencing Platform

    OpenAIRE

    Monden, Yuki; Yamamoto, Ayaka; Shindo, Akiko; Tahara, Makoto

    2014-01-01

    In many crop species, DNA fingerprinting is required for the precise identification of cultivars to protect the rights of breeders. Many families of retrotransposons have multiple copies throughout the eukaryotic genome and their integrated copies are inherited genetically. Thus, their insertion polymorphisms among cultivars are useful for DNA fingerprinting. In this study, we conducted a DNA fingerprinting based on the insertion polymorphisms of active retrotransposon families (Rtsp-1 and LI...

  2. Use of flow injection mass spectrometric fingerprinting and chemometrics for differentiation of three black cohosh species

    International Nuclear Information System (INIS)

    Huang, Huilian; Sun, Jianghao; McCoy, Joe-Ann; Zhong, Haiyan; Fletcher, Edward J.; Harnly, James; Chen, Pei

    2015-01-01

    Flow injection mass spectrometry (FIMS) was used to provide chemical fingerprints of black cohosh (Actaea racemosa L.) in a manner of minutes by omitting the separation step. This method has proven to be a powerful tool for botanical authentication and in this study it was used to distinguish between three Actaea species prior to a more detailed chemical analysis using ultra high-performance liquid chromatography high-resolution mass spectrometry (UHPLC–HRMS). Black cohosh has become increasingly popular as a dietary supplement in the United States for the treatment of symptoms related to menopause. However, it has been known to be adulterated with the Asian Actaea dahurica (Turcz. ex Fisch. & C.A.Mey.) Franch. species (syn. Cimicifuga dahurica (Turcz.) Maxim). Existing methods for identification of black cohosh and differentiation of Actaea species are usually lengthy, laborious, and lack robustness, often based on the comparison of a few pre-selected components. Chemical fingerprints were obtained for 77 black cohosh samples and their related species using FIMS in the negative ion mode. The analysis time for each sample was less than 2 min. All data were processed using principal component analysis (PCA). FIMS fingerprints could readily differentiate all three species. Representative samples from each of the three species were further examined using UHPLC–MS to provide detailed profiles of the chemical differences between the three species and were compared to the PCA loadings. This study demonstrates a simple, fast, and easy analytical method that can be used to differentiate A. racemosa, Actaea podocarpa, and A. dahurica. - Highlights: • Flow injection mass spectrometry (FIMS) was used to provide chemical fingerprints of black cohosh (Actaea racemosa L.) in a manner of minutes by omitting the separation step. • FIMS can discriminate between A. dahurica, A. podocarpa, and A. racemosa. • FIMS is a valuable screening tool for authentication of botanicals

  3. Use of flow injection mass spectrometric fingerprinting and chemometrics for differentiation of three black cohosh species

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Huilian [Food Composition and Methods Development Laboratory, Beltsville Human Nutrition Research Center, Agricultural Research Service, U.S. Department of Agriculture, Beltsville, MD (United States); Key Laboratory of Modern Preparation of TCM, Jiangxi University of Traditional Chinese Medicine, Ministry of Education, Nanchang, Jiangxi Province (China); Sun, Jianghao [Food Composition and Methods Development Laboratory, Beltsville Human Nutrition Research Center, Agricultural Research Service, U.S. Department of Agriculture, Beltsville, MD (United States); McCoy, Joe-Ann [The North Carolina Arboretum Germplasm Repository, UNC Affiliate Campus, Asheville, NC (United States); Zhong, Haiyan [College of Food Science and Engineering, Central South University of Forestry and Technology, Changsha, Hunan Province (China); Fletcher, Edward J. [Strategic Sourcing, Inc., Banner Elk, NC 28604 (United States); Harnly, James, E-mail: harnly.james@ars.usda.gov [Food Composition and Methods Development Laboratory, Beltsville Human Nutrition Research Center, Agricultural Research Service, U.S. Department of Agriculture, Beltsville, MD (United States); Chen, Pei, E-mail: pei.chen@ars.usda.gov [Food Composition and Methods Development Laboratory, Beltsville Human Nutrition Research Center, Agricultural Research Service, U.S. Department of Agriculture, Beltsville, MD (United States)

    2015-03-01

    Flow injection mass spectrometry (FIMS) was used to provide chemical fingerprints of black cohosh (Actaea racemosa L.) in a manner of minutes by omitting the separation step. This method has proven to be a powerful tool for botanical authentication and in this study it was used to distinguish between three Actaea species prior to a more detailed chemical analysis using ultra high-performance liquid chromatography high-resolution mass spectrometry (UHPLC–HRMS). Black cohosh has become increasingly popular as a dietary supplement in the United States for the treatment of symptoms related to menopause. However, it has been known to be adulterated with the Asian Actaea dahurica (Turcz. ex Fisch. & C.A.Mey.) Franch. species (syn. Cimicifuga dahurica (Turcz.) Maxim). Existing methods for identification of black cohosh and differentiation of Actaea species are usually lengthy, laborious, and lack robustness, often based on the comparison of a few pre-selected components. Chemical fingerprints were obtained for 77 black cohosh samples and their related species using FIMS in the negative ion mode. The analysis time for each sample was less than 2 min. All data were processed using principal component analysis (PCA). FIMS fingerprints could readily differentiate all three species. Representative samples from each of the three species were further examined using UHPLC–MS to provide detailed profiles of the chemical differences between the three species and were compared to the PCA loadings. This study demonstrates a simple, fast, and easy analytical method that can be used to differentiate A. racemosa, Actaea podocarpa, and A. dahurica. - Highlights: • Flow injection mass spectrometry (FIMS) was used to provide chemical fingerprints of black cohosh (Actaea racemosa L.) in a manner of minutes by omitting the separation step. • FIMS can discriminate between A. dahurica, A. podocarpa, and A. racemosa. • FIMS is a valuable screening tool for authentication of botanicals.

  4. DNA Fingerprint Analysis of Three Short Tandem Repeat (STR) Loci for Biochemistry and Forensic Science Laboratory Courses

    Science.gov (United States)

    McNamara-Schroeder, Kathleen; Olonan, Cheryl; Chu, Simon; Montoya, Maria C.; Alviri, Mahta; Ginty, Shannon; Love, John J.

    2006-01-01

    We have devised and implemented a DNA fingerprinting module for an upper division undergraduate laboratory based on the amplification and analysis of three of the 13 short tandem repeat loci that are required by the Federal Bureau of Investigation Combined DNA Index System (FBI CODIS) data base. Students first collect human epithelial (cheek)…

  5. Ab initio Calculations of Electronic Fingerprints of DNA bases on Graphene

    Science.gov (United States)

    Ahmed, Towfiq; Rehr, John J.; Kilina, Svetlana; Das, Tanmoy; Haraldsen, Jason T.; Balatsky, Alexander V.

    2012-02-01

    We have carried out first principles DFT calculations of the electronic local density of states (LDOS) of DNA nucleotide bases (A,C,G,T) adsorbed on graphene using LDA with ultra-soft pseudo-potentials. We have also calculated the longitudinal transmission currents T(E) through graphene nano-pores as an individual DNA base passes through it, using a non-equilibrium Green's function (NEGF) formalism. We observe several dominant base-dependent features in the LDOS and T(E) in an energy range within a few eV of the Fermi level. These features can serve as electronic fingerprints for the identification of individual bases from dI/dV measurements in scanning tunneling spectroscopy (STS) and nano-pore experiments. Thus these electronic signatures can provide an alternative approach to DNA sequencing.

  6. Analysis on the DNA Fingerprinting of Aspergillus Oryzae Mutant Induced by High Hydrostatic Pressure

    International Nuclear Information System (INIS)

    Wang Hua; Zhang Jian; Wang Kai; Liu Bing-Bing; Zou Bo; Zou Guang-Tian; Yang Fan; Shen Si-Le

    2011-01-01

    The mutant strains of aspergillus oryzae (HP300a) are screened under 300 MPa for 20 min. Compared with the control strains, the screened mutant strains have unique properties such as genetic stability, rapid growth, lots of spores, and high protease activity. Random amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) are used to analyze the DNA fingerprinting of HP300a and the control strains. There are 67.9% and 51.3% polymorphic bands obtained by these two markers, respectively, indicating significant genetic variations between HP300a and the control strains. In addition, comparison of HP300a and the control strains, the genetic distances of random sequence and simple sequence repeat of DNA are 0.51 and 0.34, respectively. (general)

  7. Analysis on the DNA Fingerprinting of Aspergillus Oryzae Mutant Induced by High Hydrostatic Pressure

    Science.gov (United States)

    Wang, Hua; Zhang, Jian; Yang, Fan; Wang, Kai; Shen, Si-Le; Liu, Bing-Bing; Zou, Bo; Zou, Guang-Tian

    2011-01-01

    The mutant strains of aspergillus oryzae (HP300a) are screened under 300 MPa for 20 min. Compared with the control strains, the screened mutant strains have unique properties such as genetic stability, rapid growth, lots of spores, and high protease activity. Random amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) are used to analyze the DNA fingerprinting of HP300a and the control strains. There are 67.9% and 51.3% polymorphic bands obtained by these two markers, respectively, indicating significant genetic variations between HP300a and the control strains. In addition, comparison of HP300a and the control strains, the genetic distances of random sequence and simple sequence repeat of DNA are 0.51 and 0.34, respectively.

  8. Trophectoderm DNA fingerprinting by quantitative real-time PCR successfully distinguishes sibling human embryos.

    Science.gov (United States)

    Scott, Richard T; Su, Jing; Tao, Xin; Forman, Eric J; Hong, Kathleen H; Taylor, Deanne; Treff, Nathan R

    2014-11-01

    To validate a novel and more practical system for trophectoderm DNA fingerprinting which reliably distinguishes sibling embryos from each other. In this prospective and blinded study two-cell and 5-cell samples from commercially available sibling cell lines and excess DNA from trophectoderm biopsies of sibling human blastocysts were evaluated for accurate assignment of relationship using qPCR-based allelic discrimination from 40 single nucleotide polymorphisms (SNPs) with low allele frequency variation and high heterozygosity. Cell samples with self relationships averaged 95.1 ± 5.9 % similarity. Sibling relationships averaged 57.2 ± 5.9 % similarity for all 40 SNPs, and 40.8 ± 8.2 % similarity for the 25 informative SNPs. Assignment of relationships was accomplished with 100 % accuracy for cell lines and embryos. These data demonstrate the first trophectoderm qPCR-based DNA fingerprinting technology capable of unequivocal discrimination of sibling human embryos. This methodology will empower research and development of new markers of, and interventions that influence embryonic reproductive potential.

  9. Diversities in virulence, antifungal activity, pigmentation and DNA fingerprint among strains of Burkholderia glumae.

    Science.gov (United States)

    Karki, Hari S; Shrestha, Bishnu K; Han, Jae Woo; Groth, Donald E; Barphagha, Inderjit K; Rush, Milton C; Melanson, Rebecca A; Kim, Beom Seok; Ham, Jong Hyun

    2012-01-01

    Burkholderia glumae is the primary causal agent of bacterial panicle blight of rice. In this study, 11 naturally avirulent and nine virulent strains of B. glumae native to the southern United States were characterized in terms of virulence in rice and onion, toxofalvin production, antifungal activity, pigmentation and genomic structure. Virulence of B. glumae strains on rice panicles was highly correlated to virulence on onion bulb scales, suggesting that onion bulb can be a convenient alternative host system to efficiently determine the virulence of B. glumae strains. Production of toxoflavin, the phytotoxin that functions as a major virulence factor, was closely associated with the virulence phenotypes of B. glumae strains in rice. Some strains of B. glumae showed various levels of antifungal activity against Rhizoctonia solani, the causal agent of sheath blight, and pigmentation phenotypes on casamino acid-peptone-glucose (CPG) agar plates regardless of their virulence traits. Purple and yellow-green pigments were partially purified from a pigmenting strain of B. glumae, 411gr-6, and the purple pigment fraction showed a strong antifungal activity against Collectotrichum orbiculare. Genetic variations were detected among the B. glumae strains from DNA fingerprinting analyses by repetitive element sequence-based PCR (rep-PCR) for BOX-A1R-based repetitive extragenic palindromic (BOX) or enterobacterial repetitive intergenic consensus (ERIC) sequences of bacteria; and close genetic relatedness among virulent but pigment-deficient strains were revealed by clustering analyses of DNA fingerprints from BOX-and ERIC-PCR.

  10. Estimates of population genetic diversity in brown bullhead catfish by DNA fingerprinting

    Energy Technology Data Exchange (ETDEWEB)

    Roth, A.C.; Wessendarp, T.K.; Gordon, D.A.; Smith, M.K. [Environmental Protection Agency, Cincinnati, OH (United States); Lattier, D.L. [Oak Ridge Inst. for Science and Education, Cincinnati, OH (United States); Hertzberg, V.; Leonard, A. [Univ. of Cincinnati, OH (United States). Dept. of Environmental Health

    1994-12-31

    Estimates of population genetic diversity may be a sensitive indicator of environmental impact, since limiting the effective breeding population by any means will result in loss of some variant genotypes, as has been demonstrated by allozyme analysis. DNA fingerprinting techniques are also coming into use for population analyses, and the authors chose to apply fingerprinting analysis three populations of brown bullhead catfish collected in Northern Ohio. DNA was isolated from the red blood cells of individual fish. Purified DNAs were digested with EcoR1 restriction enzyme; the digests were then sized on a 1% agarose gel, transferred to nylon membranes and probed with a radiolabeled M13 probe using the Westneat hybridization protocol (Southern blotting). This method effects fragments containing VNTR (variable number of tandem repeat) sequences complementary to the M13, which are highly variable among individual catfish. Hybridized bands were visualized by a Molecular Dynamics phosphorimager and recorded and analyzed with its proprietary Imagequant image analysis program, Excel and SAS. A total of 10 variable bands were identified and their presence or absence scored in each individual. These data were analyzed to determine between and within-population similarity indices as well as population heterozygosity and genetic diversity measures.

  11. Tuberculosis outbreaks predicted by characteristics of first patients in a DNA fingerprint cluster.

    Science.gov (United States)

    Kik, Sandra V; Verver, Suzanne; van Soolingen, Dick; de Haas, Petra E W; Cobelens, Frank G; Kremer, Kristin; van Deutekom, Henk; Borgdorff, Martien W

    2008-07-01

    Some clusters of patients who have Mycobacterium tuberculosis isolates with identical DNA fingerprint patterns grow faster than others. It is unclear what predictors determine cluster growth. To assess whether the development of a tuberculosis (TB) outbreak can be predicted by the characteristics of its first two patients. Demographic and clinical data of all culture-confirmed patients with TB in the Netherlands from 1993 through 2004 were combined with DNA fingerprint data. Clusters were restricted to cluster episodes of 2 years to only detect newly arising clusters. Characteristics of the first two patients were compared between small (2-4 cases) and large (5 or more cases) cluster episodes. Of 5,454 clustered cases, 1,756 (32%) were part of a cluster episode of 2 years. Of 622 cluster episodes, 54 (9%) were large and 568 (91%) were small episodes. Independent predictors for large cluster episodes were as follows: less than 3 months' time between the diagnosis of the first two patients, one or both patients were young (<35 yr), both patients lived in an urban area, and both patients came from sub-Saharan Africa. In the Netherlands, patients in new cluster episodes should be screened for these risk factors. When the risk pattern applies, targeted interventions (e.g., intensified contact investigation) should be considered to prevent further cluster expansion.

  12. DNA fingerprint similarity between female and juvenile brown-headed cowbirds trapped together

    Science.gov (United States)

    Hahn, D.C.; Fleischer, R.C.

    1995-01-01

    This DNA fingerprinting study investigates whether females of the brood parasite brown-headed cowbird, Molothrus ater, associate with their own juvenile offspring at feeding sites more often than would be expected by chance. Cowbirds lay their eggs in the nests of a variety of host species and, as far as is known, leave them to the care of foster parents. Using baited walk-in funnel traps, 36 adult female-juvenile pairs (or trios) of cowbirds were trapped. Blood samples were collected from these individuals to conduct DNA fingerprinting analyses, calculate similarity indices, and to compare S-values for the 11 comparisons of juveniles and the females with which they were caught with S-values of random pairings of juveniles and the females in adjacent gel lanes with which they were not caught. Overall band-sharing was significantly higher for the individuals trapped together than for the random pairings. These associations between juvenile cowbirds and their mothers could occur as a result of female cowbirds monitoring the development of their young in the nests where they have laid. Alternatively, nestling cowbirds in the nest could become familiar visually and locally with a female parent that is frequently in their territory and could follow her when she departs for feeding grounds. In either case these data suggest that adult cowbirds associate with juveniles, in some cases their own offspring, and that offspring may learn to function as cowbirds in part from this association.

  13. DNA fingerprinting of some pakistani date palm (phoenix dactylifera L.) cultive ARS using issr markers

    International Nuclear Information System (INIS)

    Mirbahar, A.; Khan, S.; Markhand, G.S.

    2016-01-01

    Date palm is one of the oldest cultivated and economically important fruit trees. First time Inter Simple Sequence Repeats (ISSR) markers were used with twenty five economically important date palm cultivars of Pakistan for DNA fingerprinting analysis. Samples were collected from four provinces of Pakistan i.e., Sindh, Punjab, Khyber Pakhtoonkhwa and Balochistan. The study was carried out using seven ISSR markers. The twenty five date palm cultivars showed variation at the DNA level. The ISSR primers showed high polymorphism (84%) in the studied date palm cultivars. Dice similarity index was in range from 0.608 to 0.980 and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) divided twenty five date palm cultivars into two main clusters and sub-clusters. However ISSR markers efficiently discriminated for assessing genetic diversity among commercial Pakistani date palm cultivars. (author)

  14. Discrimination of Arcobacter butzleri isolates by polymerase chain reaction-mediated DNA fingerprinting

    DEFF Research Database (Denmark)

    Atabay, H. I.; Bang, Dang Duong; Aydin, F.

    2002-01-01

    Aims: The objective of this study was to subtype Arcobacter butzleri isolates using RAPD-PCR. Methods and Results: Thirty-five A. butzleri isolates obtained from chicken carcasses were examined. PCR-mediated DNA fingerprinting technique with primers of the variable sequence motifs was used...... to detect polymorphism within the isolates. Eleven distinct DNA profiles were obtained as follows: Of the 35 strains, 10 as profile 4; seven as profile 1; five as profile 3; three as profiles 2 and 9; two as profile 10; one as profiles 5, 6, 7, 8 and 11. Conclusions: Chicken carcasses sold in markets were...... found to be contaminated with several different strains of A. butzleri . RAPD-PCR technique was found to be a useful technique for distinguishing A. butzleri isolates. Significance and Impact of the Study: The presence of several different A. butzleri strains on chicken carcasses may indicate multiple...

  15. Examining the effects of a DNA fingerprinting workshop on science teachers' professional development and student learning

    Science.gov (United States)

    Sonmez, Duygu

    behavior. The goal is to understand what factors affect teachers' decision making to implement the new knowledge and skills in their classrooms. For this purpose, the study focuses on the effects of a DNA fingerprinting workshop, which has been developed and is regularly offered by a large Midwestern university in the United States for secondary science teachers and their students through cooperation between the university and a large Midwestern public school district. The workshop focuses on the biotechnology applications of genetics---specifically, use of DNA fingerprinting technology in different areas of social life---while forensic science is emphasized. Results indicate that the teachers' motivation to attend the DNA Fingerprinting professional development workshop was mainly influenced by two variables: (1) the need to improve content knowledge and skills, and (2) requirements associated with current educational policies. Level of content knowledge was also found to be a factor contributing to teachers' motivation to implement the workshop. Concerns related to student maturity and classroom management were also identified as factors influencing teachers' implementation behavior. Evidence that the DNA Fingerprinting workshop can be successfully implemented by classroom teachers was obtained. The DNA fingerprinting workshop was found to be a successful model for packaging professional development experiences for content intensive areas.

  16. Fingerprint enhancement revisited and the effects of blood enhancement chemicals on subsequent profiler Plus fluorescent short tandem repeat DNA analysis of fresh and aged bloody fingerprints.

    Science.gov (United States)

    Frégeau, C J; Germain, O; Fourney, R M

    2000-03-01

    This study was aimed at determining the effect of seven blood enhancement reagents on the subsequent Profiler Plus fluorescent STR DNA analysis of fresh or aged bloody fingerprints deposited on various porous and nonporous surfaces. Amido Black, Crowle's Double Stain. 1,8-diazafluoren-9-one (DFO), Hungarian Red, leucomalachite green, luminol and ninhydrin were tested on linoleum, glass, metal, wood (pine, painted white), clothing (85% polyester/15% cotton, 65% polyester/35% cotton, and blue denim) and paper (Scott 2-ply and Xerox-grade). Preliminary experiments were designed to determine the optimal blood dilutions to use to ensure a DNA typing result following chemical enhancement. A 1:200 blood dilution deposited on linoleum and enhanced with Crowle's Double Stain generated enough DNA for one to two rounds of Profiler Plus PCR amplification. A comparative study of the DNA yields before and after treatment indicated that the quantity of DNA recovered from bloody fingerprints following enhancement was reduced by a factor of 2 to 12. Such a reduction in the DNA yields could potentially compromise DNA typing analysis in the case of small stains. The blood enhancement chemicals selected were also evaluated for their capability to reveal bloodmarks on the various porous and nonporous surfaces chosen in this study. Luminol. Amido Black and Crowle's Double Stain showed the highest sensitivity of all seven chemicals tested and revealed highly diluted (1:200) bloody fingerprints. Both luminol and Amido Black produced excellent results on both porous and nonporous surfaces, but Crowle's Double Stain failed to produce any results on porous substrates. Hungarian Red, DFO, leucomalachite green and ninhydrin showed lower sensitivities. Enhancement of bloodmarks using any of the chemicals selected, and short-term exposure to these same chemicals (i.e., less than 54 days), had no adverse effects on the PCR amplification of the nine STR systems surveyed (D3S 1358, HumvWA, Hum

  17. Microbial DNA fingerprinting of human fingerprints: dynamic colonization of fingertip microflora challenges human host inferences for forensic purposes

    NARCIS (Netherlands)

    S. Tims (Sebastian); W.J.B. van Wamel (Willem); H.P. Endtz (Hubert); A.F. van Belkum (Alex); M.H. Kayser (Manfred)

    2009-01-01

    textabstractHuman fingertip microflora is transferred to touched objects and may provide forensically relevant information on individual hosts, such as on geographic origins, if endogenous microbial skin species/strains would be retrievable from physical fingerprints and would carry geographically

  18. Age Estimation with DNA: From Forensic DNA Fingerprinting to Forensic (Epi)Genomics: A Mini-Review.

    Science.gov (United States)

    Parson, Walther

    2018-01-23

    Forensic genetics developed from protein-based techniques a quarter of a century ago and became famous as "DNA fingerprinting," this being based on restriction fragment length polymorphisms (RFLPs) of high-molecular-weight DNA. The amplification of much smaller short tandem repeat (STR) sequences using the polymerase chain reaction soon replaced RFLP analysis and advanced to become the gold standard in genetic identification. Meanwhile, STR multiplexes have been developed and made commercially available which simultaneously amplify up to 30 STR loci from as little as 15 cells or fewer. The enormous information content that comes with the large variety of observed STR genotypes allows for genetic individualisation (with the exception of identical twins). Carefully selected core STR loci form the basis of intelligence-led DNA databases that provide investigative leads by linking unsolved crime scenes and criminals through their matched STR profiles. Nevertheless, the success of modern DNA fingerprinting depends on the availability of reference material from suspects. In order to provide new investigative leads in cases where such reference samples are absent, forensic scientists started to explore the prediction of phenotypic traits from the DNA of the evidentiary sample. This paradigm change now uses DNA and epigenetic markers to forecast characteristics that are useful to triage further investigative work. So far, the best investigated externally visible characteristics are eye, hair and skin colour, as well as geographic ancestry and age. Information on the chronological age of a stain donor (or any sample donor) is elemental for forensic investigations in a number of aspects and has, therefore, been explored by researchers in some detail. Among different methodological approaches tested to date, the methylation-sensitive analysis of carefully selected DNA markers (CpG sites) has brought the most promising results by providing prediction accuracies of ±3-4 years

  19. Comparison of Quantifiler(®) Trio and InnoQuant™ human DNA quantification kits for detection of DNA degradation in developed and aged fingerprints.

    Science.gov (United States)

    Goecker, Zachary C; Swiontek, Stephen E; Lakhtakia, Akhlesh; Roy, Reena

    2016-06-01

    The development techniques employed to visualize fingerprints collected from crime scenes as well as post-development ageing may result in the degradation of the DNA present in low quantities in such evidence samples. Amplification of the DNA samples with short tandem repeat (STR) amplification kits may result in partial DNA profiles. A comparative study of two commercially available quantification kits, Quantifiler(®) Trio and InnoQuant™, was performed on latent fingerprint samples that were either (i) developed using one of three different techniques and then aged in ambient conditions or (ii) undeveloped and then aged in ambient conditions. The three fingerprint development techniques used were: cyanoacrylate fuming, dusting with black powder, and the columnar-thin-film (CTF) technique. In order to determine the differences between the expected quantities and actual quantities of DNA, manually degraded samples generated by controlled exposure of DNA standards to ultraviolet radiation were also analyzed. A total of 144 fingerprint and 42 manually degraded DNA samples were processed in this study. The results indicate that the InnoQuant™ kit is capable of producing higher degradation ratios compared to the Quantifiler(®) Trio kit. This was an expected result since the degradation ratio is a relative value specific for a kit based on the length and extent of amplification of the two amplicons that vary from one kit to the other. Additionally, samples with lower concentrations of DNA yielded non-linear relationships of degradation ratio with the duration of aging, whereas samples with higher concentrations of DNA yielded quasi-linear relationships. None of the three development techniques produced a noticeably different degradation pattern when compared to undeveloped fingerprints, and therefore do not impede downstream DNA analysis. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  20. DNA-fingerprinting di stipiti di Chryseobacterium spp isolati da pazienti con Fibrosi Cistica

    Directory of Open Access Journals (Sweden)

    Antonietta Lambiase

    2007-03-01

    Full Text Available Objectives: Pulmonary infections by Gram-negative bacteria, as Pseudomonas aeruginosa, Burkholderia cepacia, Stenotrophomonas maltophilia, are the major cause of morbidity in Cystic Fibrosis patients. In the past decade, several pathogens as Alcaligenes spp and no tuberculosis mycobacteria have been recovered in these patients. Bacteria of genus Chryseobacterium are widespread Gram-negative microrganisms and involved in human infections. Aims of this study were to value the isolation frequency of Chryseobacterium strains in a cohort of Cystic Fibrosis patients, to investigate their antimicrobial sensibility and to establish possible clonal likeness between strains. Methods:A retrospective study was undertaken between January 2003 and December 2005 on 300 patients receiving care at the Regional Cystic Fibrosis Centre of Naples University “Federico II”. Sputum samples were checked: for bacterial identification, selective media and commercial identification systems were used.The activity of antimicrobial agents was determined using diffusion and microdiluthion methods. For DNA-fingerprinting, a genomic DNA macrorestriction followed by pulsed-field electrophoresis was carried out. Results:A total of 26 strains from 17 patients were isolated (7 C. meningosepticum, 14 C. indologenes, 5 C. gleum. Strains were resistant to cephalosporins and carbapenems; some were sensitive to ciprofloxacin, levofloxacin and trimethoprim-sulphamethoxazole. Macrorestriction analysis showed substantial heterogeneity among strains. Conclusions: Actually, the prognostic role of Chryseobacterium in Cystic Fibrosis is unclear and although the small number of isolations, it is need to be on the look out regard such microorganisms. The considerable resistance implies difficulties on therapeutic approach. Results of DNA-fingerprinting indicate no evidence of clonal likeness and then of patient-to-patient spread.

  1. Donor-derived metastatic melanoma in a liver transplant recipient established by DNA fingerprinting.

    Science.gov (United States)

    Bilal, Muhammad; Eason, James D; Das, Kanak; Sylvestre, Pamela B; Dean, Amanda G; Vanatta, Jason M

    2013-10-01

    Metastatic melanoma is a donor-derived malignancy that has rarely been reported in liver allograft recipients. We present a case of a transmitted donor-derived melanoma to a liver allograft recipient in whom the diagnosis was established by polymerase chain reaction-based DNA fingerprinting. A 52-year-old African-American man underwent a successful orthotropic liver transplant for alcohol-induced cirrhosis. One year after the orthotropic liver transplant, he presented at our institution with diffuse abdominal pain, and a computed tomography scan of the abdomen and chest showed innumerable masses diffusely involving the liver and multiple subcutaneous nodules in the abdominal and chest wall. A liver biopsy confirmed the diagnosis of metastatic melanoma. The origin of melanoma was traced to the donor by DNA fingerprinting of the native liver, the donor liver, and the donor gallbladder. Chemotherapy was initiated with temozolomide (75 mg/m² daily) and thalidomide (50 mg daily), to which he responded within 8 weeks with radiologic improvement in metastatic lesions. Tacrolimus was switched to sirolimus because of renal insufficiency as well as reported effectiveness against melanoma. Our patient survived for 9 months after the diagnosis of metastatic melanoma. He ultimately died of brain metastases. Donor-derived metastatic melanoma is a rare cancer with the highest transmission and mortality rates, which requires better recognition. Prompt diagnosis of donor-derived melanoma is critical and can be achieved reliably with polymerase chain reaction-based DNA analysis. Management options after diagnosis include de-escalation of immunosuppression, with or without urgent organ removal or retransplant. The roles of chemotherapy, immunotherapy, and radiotherapy require further study.

  2. Genetic relatedness of artichoke (Cynara scolymus L.) hybrids using random amplified polymorphic DNA (RAPD) fingerprinting.

    Science.gov (United States)

    Sharaf-Eldin, M A; Al-Tamimi, A; Alam, P; Elkholy, S F; Jordan, J R

    2015-12-28

    The artichoke (Cynara scolymus L.) is an important food and medicinal crop that is cultivated in Mediterranean countries. Morphological characteristics, such as head shape and diameter, leaf shape, and bract shape, are mainly affected by environmental conditions. A molecular marker approach was used to analyze the degree of polymorphism between artichoke hybrid lines. The degree of genetic difference among three artichoke hybrids was evaluated using random amplified polymorphic DNA-PCR (RAPD-PCR). In this study, the DNA fingerprints of three artichoke lines (A13-010, A11-018, and A12-179) were generated, and a total of 10 decamer primers were applied for RAPD-PCR analyses. Polymorphism  (16.66 to 62.50%) was identified using eight arbitrary decamers and total genomic DNA extracted from the hybrids. Of the 59 loci detected, there were 25 polymorphic and 34 monomorphic loci. Jaccard's similarity index (JSI) ranged between 1.0 and 0.84. Based on the unweighted pair group method with arithmetic mean (UPGMA) similarity matrix and dendrogram, the results indicated that two hybrids (A13-010 and A11-018) were closely related to each other, and the A12-179 line showed more divergence. When identifying correct accessions, consideration of the genetic variation and genetic relationships among the genotypes are required. The RAPD-PCR fingerprinting of artichoke lines clearly showed that it is possible to analyze the RAPD patterns for correlation between genetic means and differences or resemblance between close accessions (A13-010 and A11- 018) at the genomic level.

  3. DNA fingerprinting validates seed dispersal curves from observational studies in the neotropical legume parkia.

    Science.gov (United States)

    Heymann, Eckhard W; Lüttmann, Kathrin; Michalczyk, Inga M; Saboya, Pedro Pablo Pinedo; Ziegenhagen, Birgit; Bialozyt, Ronald

    2012-01-01

    Determining the distances over which seeds are dispersed is a crucial component for examining spatial patterns of seed dispersal and their consequences for plant reproductive success and population structure. However, following the fate of individual seeds after removal from the source tree till deposition at a distant place is generally extremely difficult. Here we provide a comparison of observationally and genetically determined seed dispersal distances and dispersal curves in a Neotropical animal-plant system. In a field study on the dispersal of seeds of three Parkia (Fabaceae) species by two Neotropical primate species, Saguinus fuscicollis and Saguinus mystax, in Peruvian Amazonia, we observationally determined dispersal distances. These dispersal distances were then validated through DNA fingerprinting, by matching DNA from the maternally derived seed coat to DNA from potential source trees. We found that dispersal distances are strongly right-skewed, and that distributions obtained through observational and genetic methods and fitted distributions do not differ significantly from each other. Our study showed that seed dispersal distances can be reliably estimated through observational methods when a strict criterion for inclusion of seeds is observed. Furthermore, dispersal distances produced by the two primate species indicated that these primates fulfil one of the criteria for efficient seed dispersers. Finally, our study demonstrated that DNA extraction methods so far employed for temperate plant species can be successfully used for hard-seeded tropical plants.

  4. DNA Fingerprinting Validates Seed Dispersal Curves from Observational Studies in the Neotropical Legume Parkia

    Science.gov (United States)

    Heymann, Eckhard W.; Lüttmann, Kathrin; Michalczyk, Inga M.; Saboya, Pedro Pablo Pinedo; Ziegenhagen, Birgit; Bialozyt, Ronald

    2012-01-01

    Background Determining the distances over which seeds are dispersed is a crucial component for examining spatial patterns of seed dispersal and their consequences for plant reproductive success and population structure. However, following the fate of individual seeds after removal from the source tree till deposition at a distant place is generally extremely difficult. Here we provide a comparison of observationally and genetically determined seed dispersal distances and dispersal curves in a Neotropical animal-plant system. Methodology/Principal Findings In a field study on the dispersal of seeds of three Parkia (Fabaceae) species by two Neotropical primate species, Saguinus fuscicollis and Saguinus mystax, in Peruvian Amazonia, we observationally determined dispersal distances. These dispersal distances were then validated through DNA fingerprinting, by matching DNA from the maternally derived seed coat to DNA from potential source trees. We found that dispersal distances are strongly right-skewed, and that distributions obtained through observational and genetic methods and fitted distributions do not differ significantly from each other. Conclusions/Significance Our study showed that seed dispersal distances can be reliably estimated through observational methods when a strict criterion for inclusion of seeds is observed. Furthermore, dispersal distances produced by the two primate species indicated that these primates fulfil one of the criteria for efficient seed dispersers. Finally, our study demonstrated that DNA extraction methods so far employed for temperate plant species can be successfully used for hard-seeded tropical plants. PMID:22514748

  5. New optimized DNA extraction protocol for fingerprints deposited on a special self-adhesive security seal and other latent samples used for human identification.

    Science.gov (United States)

    Kopka, Julieta; Leder, Monika; Jaureguiberry, Stella M; Brem, Gottfried; Boselli, Gabriel O

    2011-09-01

    Obtaining complete short tandem repeat (STR) profiles from fingerprints containing minimal amounts of DNA, using standard extraction techniques, can be difficult. The aim of this study was to evaluate a new kit, Fingerprint DNA Finder (FDF Kit), recently launched for the extraction of DNA and STR profiling from fingerprints placed on a special device known as Self-Adhesive Security Seal Sticker(®) and other latent fingerprints on forensic evidentiary material like metallic guns. The DNA extraction system is based on a reversal of the silica principle, and all the potential inhibiting substances are retained on the surface of a special adsorbent, while nucleic acids are not bound and remain in solution dramatically improving DNA recovery. DNA yield was quite variable among the samples tested, rendering in most of the cases (>90%) complete STR profiles, free of PCR inhibitors, and devoid of artifacts. Even samples with DNA amount below 100 pg could be successfully analyzed. © 2011 American Academy of Forensic Sciences.

  6. DNA-fingerprinting (AFLP and RFLP) for genotypic identification in species of the Pleurotus eryngii complex.

    Science.gov (United States)

    Urbanelli, S; Della Rosa, V; Punelli, F; Porretta, D; Reverberi, M; Fabbri, A A; Fanelli, C

    2007-03-01

    Wild populations of edible species are important source of genetic variability for cultivated lines that can undergo a drastic loss of diversity resulting from man's selection. The development of tools aimed at the clear-cut and safe identification and assessment of genetic variability of the wild and cultivated strains is thus a fundamental goal of molecular genetic research. In this study, we used two polymerase chain reaction (PCR)-based fingerprinting methods-amplified fragment length polymorphism (AFLP) and restriction fragment length polymorphism (RFLP) of laccase and manganese peroxidase genes-to assess genetic differences among strains and independently evolving lineages belonging to the Pleurotus eryngii complex. Both laccase RFLP and AFLP have been proved to distinguish unambiguously the three taxa studied: Pleurotus ferulae, P. eryngii, and P. eryngii var. nebrodensis. AFLP also showed enough sensitivity to detect polymorphisms among the strains, proving to be an efficient DNA fingerprinting tool in studies of strain assignment. The divergent RFLP laccase and manganese peroxidase patterns are also discussed in relation to the role played by these genes in the interaction between these fungi and their host plants.

  7. Fingerprinting of Peptides with a Large Channel of Bacteriophage Phi29 DNA Packaging Motor.

    Science.gov (United States)

    Ji, Zhouxiang; Wang, Shaoying; Zhao, Zhengyi; Zhou, Zhi; Haque, Farzin; Guo, Peixuan

    2016-09-01

    Nanopore technology has become a highly sensitive and powerful tool for single molecule sensing of chemicals and biopolymers. Protein pores have the advantages of size amenability, channel homogeneity, and fabrication reproducibility. But most well-studied protein pores for sensing are too small for passage of peptide analytes that are typically a few nanometers in dimension. The funnel-shaped channel of bacteriophage phi29 DNA packaging motor has previously been inserted into a lipid membrane to serve as a larger pore with a narrowest N-terminal constriction of 3.6 nm and a wider C-terminal end of 6 nm. Here, the utility of phi29 motor channel for fingerprinting of various peptides using single molecule electrophysiological assays is reported. The translocation of peptides is proved unequivocally by single molecule fluorescence imaging. Current blockage percentage and distinctive current signatures are used to distinguish peptides with high confidence. Each peptide generated one or two distinct current blockage peaks, serving as typical fingerprint for each peptide. The oligomeric states of peptides can also be studied in real time at single molecule level. The results demonstrate the potential for further development of phi29 motor channel for detection of disease-associated peptide biomarkers. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Low frequency of extra-pair fertilizations in the Great Tit Parus major revealed by DNA fingerprinting

    NARCIS (Netherlands)

    Verboven, N.; Mateman, A.C.

    1997-01-01

    Multilocus DNA fingerprinting was used to estimate the frequency of extra-pair fertilizations in a low density, island population of Great Tits Parus major. A total of 69 pairs and 516 offspring from 82 breeding attempts were examined. Only 18 offspring (3.5%) in seven different nests were not

  9. Investigating the Effects of a DNA Fingerprinting Workshop on 10th Grade Students' Self Efficacy and Attitudes toward Science.

    Science.gov (United States)

    Sonmez, Duygu; Simcox, Amanda

    The purpose of this study was investigate the effects of a DNA Fingerprinting Workshop on 10th grade students' self efficacy and attitudes toward science. The content of the workshop based on high school science curriculum and includes multimedia instruction, laboratory experiment and participation of undergraduate students as mentors. N=93…

  10. Use of LH-PCR as a DNA fingerprint technique to trace sediment-associated microbial communities from various land uses

    Science.gov (United States)

    Joe-Strack, J. A.; Petticrew, E. L.

    2012-04-01

    The search for new techniques to effectively and efficiently trace sediment from its source along catchment pathways continues, with a range of new methods being developed and tested annually. A relatively recent approach marries genetic techniques to sediment analysis in order to characterize and differentiate the bacterial populations associated with soil and/or sediment originating from specific locations. Here we present the preliminary results of DNA fingerprint profiles of soil and sediment-associated bacterial communities in and around two different industrial land uses in the central interior of British Columbia, a feedlot and a copper/gold mining site. We assessed the naturally varying 16S rDNA gene using amplicon length heterogeneity-polymerase chain reaction (LH-PCR). Statistical differences between bacterial community profiles were investigated using a suite of methods of which non-metric multidimensional scaling (NMS) and indicator species analysis (ISA) were the most useful. Stronger statistical results were observed for the feedlot data set with spatial differences observed from the source location and within the adjacent creek. Results from the mine site were more difficult to assess although responses were detected in downstream waterways. While bacterial DNA fingerprinting of soil and sediment appears to be a promising tracing technique issues of scale and transferability may limit its use. Lessons learned from this preliminary study will be presented.

  11. DNA fingerprinting of Mycobacterium tuberculosis: from phage typing to whole-genome sequencing.

    Science.gov (United States)

    Schürch, Anita C; van Soolingen, Dick

    2012-06-01

    Current typing methods for Mycobacterium tuberculosis complex evolved from simple phenotypic approaches like phage typing and drug susceptibility profiling to DNA-based strain typing methods, such as IS6110-restriction fragment length polymorphisms (RFLP) and variable number of tandem repeats (VNTR) typing. Examples of the usefulness of molecular typing are source case finding and epidemiological linkage of tuberculosis (TB) cases, international transmission of MDR/XDR-TB, the discrimination between endogenous reactivation and exogenous re-infection as a cause of relapses after curative treatment of tuberculosis, the evidence of multiple M. tuberculosis infections, and the disclosure of laboratory cross-contaminations. Simultaneously, phylogenetic analyses were developed based on single nucleotide polymorphisms (SNPs), genomic deletions usually referred to as regions of difference (RDs) and spoligotyping which served both strain typing and phylogenetic analysis. National and international initiatives that rely on the application of these typing methods have brought significant insight into the molecular epidemiology of tuberculosis. However, current DNA fingerprinting methods have important limitations. They can often not distinguish between genetically closely related strains and the turn-over of these markers is variable. Moreover, the suitability of most DNA typing methods for phylogenetic reconstruction is limited as they show a high propensity of convergent evolution or misinfer genetic distances. In order to fully explore the possibilities of genotyping in the molecular epidemiology of tuberculosis and to study the phylogeny of the causative bacteria reliably, the application of whole-genome sequencing (WGS) analysis for all M. tuberculosis isolates is the optimal, although currently still a costly solution. In the last years WGS for typing of pathogens has been explored and yielded important additional information on strain diversity in comparison to the

  12. A reliable and reproducible technique for DNA fingerprinting in biorepositories: a pilot study from BioBIM.

    Science.gov (United States)

    Palmirotta, Raffaele; De Marchis, Maria Laura; Ludovici, Giorgia; Ialongo, Cristiano; Leone, Barbara; Lopez, Nadia; Valente, Maria Giovanna; Spila, Antonella; Ferroni, Patrizia; Della-Morte, David; Guadagni, Fiorella

    2013-12-17

    Standard operating procedures (SOPs) optimization for nucleic acid extraction from stored samples is of crucial importance in a biological repository, considering the large number of collected samples and their future downstream molecular and biological applications. However, the validity of molecular studies using stored specimens depends not only on the integrity of the biological samples, but also on the procedures that ensure the traceability of the same sample, certifying its uniqueness, and ensuring the identification of potential sample contaminations. With this aim, we have developed a rapid, reliable, low-cost, and simple DNA fingerprinting tool for a routine use in quality control of biorepositories samples. The method consists of a double ALU insertion/deletion genotyping panel suitable for uniqueness, identification of sample contaminations, and gender validation. Preliminary data suggest that this easy-to-use DNA fingerprinting protocol could routinely provide assurances of DNA identity and quality in a biorepository setting.

  13. Assessing genetic diversity among Brettanomyces yeasts by DNA fingerprinting and whole-genome sequencing.

    Science.gov (United States)

    Crauwels, Sam; Zhu, Bo; Steensels, Jan; Busschaert, Pieter; De Samblanx, Gorik; Marchal, Kathleen; Willems, Kris A; Verstrepen, Kevin J; Lievens, Bart

    2014-07-01

    Brettanomyces yeasts, with the species Brettanomyces (Dekkera) bruxellensis being the most important one, are generally reported to be spoilage yeasts in the beer and wine industry due to the production of phenolic off flavors. However, B. bruxellensis is also known to be a beneficial contributor in certain fermentation processes, such as the production of certain specialty beers. Nevertheless, despite its economic importance, Brettanomyces yeasts remain poorly understood at the genetic and genomic levels. In this study, the genetic relationship between more than 50 Brettanomyces strains from all presently known species and from several sources was studied using a combination of DNA fingerprinting techniques. This revealed an intriguing correlation between the B. bruxellensis fingerprints and the respective isolation source. To further explore this relationship, we sequenced a (beneficial) beer isolate of B. bruxellensis (VIB X9085; ST05.12/22) and compared its genome sequence with the genome sequences of two wine spoilage strains (AWRI 1499 and CBS 2499). ST05.12/22 was found to be substantially different from both wine strains, especially at the level of single nucleotide polymorphisms (SNPs). In addition, there were major differences in the genome structures between the strains investigated, including the presence of large duplications and deletions. Gene content analysis revealed the presence of 20 genes which were present in both wine strains but absent in the beer strain, including many genes involved in carbon and nitrogen metabolism, and vice versa, no genes that were missing in both AWRI 1499 and CBS 2499 were found in ST05.12/22. Together, this study provides tools to discriminate Brettanomyces strains and provides a first glimpse at the genetic diversity and genome plasticity of B. bruxellensis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  14. Molecular characterisation of Colombian yam germplasm by "DNA amplification fingerprinting (DAF" in radioactivo conditions

    Directory of Open Access Journals (Sweden)

    Silvia L. Bustamante

    2003-07-01

    Full Text Available Samples from the Universidad de Córdoba's yam collection (Dioscorea spp. and others originating from IITA (International Institute of Tropical Agriculture, Ibadan, Nigeria were molecularly characterised to complement existing information about them. The yam (Diosocorea spp. represents a basic crop for small-scale farmers on the Colombian Atlantic Coast who sow around 20,000 hectares per year. Even though they are dioecious species, only one sex is represented in Colombia; it must also be stated that climatic conditions are not propitious for its flowering. This situation has caused difficulty for work in yam breeding. The yam species and varieties used in the Colombian ABP (Agricultural Biotechnology Programme have been molecularly characterised by AFLPs in a previous publication describing a preliminary study emerging from the need to broaden the characterisation of those accessions kept at the Universidad de Córdoba. Comparisons have also been done with some African accessions donated by IITA. In this article, samples were molecularly characterised by another fingerprinting technique, the DAF technique (DNA Amplification Fingerprinting based on PCR, using random oligonucleotides for generating characteristic band patterns from each individual. The results showed 0.0413 population diversity with 0.9587 average similarity, indicating that the yam collection studied had very little genetic diversity and, probably, this could be why the crop is vulnerable to plagues and diseases, as happened at the end of the 1980s when anthracnose practically devastated the crop on the Colombian Atlantic coast. Similarity was also found between those Colombian and African samples analysed, agreeing with low diversity and less distance between common ancestors. The molecular results suggest the need for using other molecular techniques having a greater power of discrimination and also the need to broaden the genetic diversity in yam crops for providing greater

  15. Limited variation of DNA fingerprints (IS6110 and IS1081) in Korean strains of Mycobacterium tuberculosis.

    Science.gov (United States)

    Huh, Y J; Ahn, D I; Kim, S J

    1995-08-01

    To establish the usefulness of DNA fingerprinting for the epidemiology of Mycobacterium tuberculosis isolated from Korean tuberculosis patients. Comparison of restriction fragment length polymorphism (RFLP) patterns produced by southern hybridization of PvuII-digested chromosomal DNA. IS6110-associated banding patterns of 41 isolates varied considerably, containing 1-13 copies. The RFLP pattern of the epidemiologically related M. tuberculosis isolates was identical in 8 of 10 groups of close contact patients. No noticeable differences in RFLP were observed between drug-sensitive and drug-resistant isolates. IS1081-containing restriction fragment analysis of 52 isolates showed 6 different banding patterns, and the C type was found dominant in Korea. Identification of G type M. tuberculosis, which has a 8.0 kb IS1081-containing PvuII fragment, is unusual because it has been observed only in M. bovis BCG so far. IS6110 was a very useful tool for tracing the transmission route of tuberculosis; IS1081 was also useful for subdividing M. tuberculosis into several groups.

  16. Application of DNA fingerprinting to the recovery program of the endangered Puerto Rican parrot

    Science.gov (United States)

    Brock, M.K.; White, B.N.

    1992-01-01

    The Puerto Rican parrot was reduced to 13 animals in 1975 and as a conservation measure, a captive population was established from a few founders taken from the wild between 1973 and 1983. The number of successful breeding pairs in captivity has been !ow, and the captive breeding program has not been as productive as that of the closely related Hispaniolan parrot. Therefore, a genetic study was initiated to examine the relative levels of relatedness of the captive founders using levels of bandsharing in DNA fingerprints. Unrelated captive founder Puerto Rican parrots had the same average level of bandsharing (0.41) as second-degree relatives of the Hispaniolan parrot (0.38, P > 0,05), with an inbreeding coefficient of 0.04. High levels of bandsharing (>40%) between pairs of males and females correlated with reproductive failure, suggesting that inbreeding depression is partly responsible for the !ow number of' breeding pairs. Consequently, DNA profiling can be used to guide the captive breeding program for the Puerto Rican parrot, and other endangered species, by identifying pairs of males and females with low levels of bandsharing.

  17. Development and Characterization of Complex DNA Fingerprinting Probes for the Infectious Yeast Candida dubliniensis

    Science.gov (United States)

    Joly, Sophie; Pujol, Claude; Rysz, Michal; Vargas, Kaaren; Soll, David R.

    1999-01-01

    Using a strategy to clone large genomic sequences containing repetitive elements from the infectious yeast Candida dubliniensis, the three unrelated sequences Cd1, Cd24, and Cd25, with respective molecular sizes of 15,500, 10,000, and 16,000 bp, were cloned and analyzed for their efficacy as DNA fingerprinting probes. Each generated a complex Southern blot hybridization pattern with endonuclease-digested genomic DNA. Cd1 generated an extremely variable pattern that contained all of the bands of the pattern generated by the repeat element RPS of Candida albicans. We demonstrated that Cd1 does not contain RPS but does contain a repeat element associated with RPS throughout the C. dubliniensis genome. The Cd1 pattern was the least stable over time both in vitro and in vivo and for that reason proved most effective in assessing microevolution. Cd24, which did not exhibit microevolution in vitro, was highly variable in vivo, suggesting in vivo-dependent microevolution. Cd25 was deemed the best probe for broad epidemiological studies, since it was the most stable over time, was the only truly C. dubliniensis-specific probe of the three, generated the most complex pattern, was distributed throughout all C. dubliniensis chromosomes, and separated a worldwide collection of 57 C. dubliniensis isolates into two distinct groups. The presence of a species-specific repetitive element in Cd25 adds weight to the already substantial evidence that C. dubliniensis represents a bona fide species. PMID:10074523

  18. Chemical elemental distribution and soil DNA fingerprints provide the critical evidence in murder case investigation.

    Directory of Open Access Journals (Sweden)

    Giuseppe Concheri

    Full Text Available BACKGROUND: The scientific contribution to the solution of crime cases, or throughout the consequent forensic trials, is a crucial aspect of the justice system. The possibility to extract meaningful information from trace amounts of samples, and to match and validate evidences with robust and unambiguous statistical tests, are the key points of such process. The present report is the authorized disclosure of an investigation, carried out by Attorney General appointment, on a murder case in northern Italy, which yielded the critical supporting evidence for the judicial trial. METHODOLOGY/PRINCIPAL FINDINGS: The proportional distribution of 54 chemical elements and the bacterial community DNA fingerprints were used as signature markers to prove the similarity of two soil samples. The first soil was collected on the crime scene, along a corn field, while the second was found in trace amounts on the carpet of a car impounded from the main suspect in a distant location. The matching similarity of the two soils was proven by crossing the results of two independent techniques: a elemental analysis via inductively coupled plasma mass spectrometry (ICP-MS and optical emission spectrometry (ICP-OES approaches, and b amplified ribosomal DNA restriction analysis by gel electrophoresis (ARDRA. CONCLUSIONS: Besides introducing the novel application of these methods to forensic disciplines, the highly accurate level of resolution observed, opens new possibilities also in the fields of soil typing and tracking, historical analyses, geochemical surveys and global land mapping.

  19. Forensic DNA Banding Patterns: How to Simulate & Explain DNA Fingerprinting in a Classroom with No Budget

    Science.gov (United States)

    Christensen, Doug

    2013-01-01

    Understanding how DNA banding patterns in a gel can aid in the conviction or exoneration of suspects and be utilized for positive identification of biological fathers in paternity cases can be intimidating. In reality, the logistics and technology used in such cases are rather straightforward. This exercise is designed for use in high school…

  20. Reconstruction of molecular phylogeny of closely related Amorphophallus species of India using plastid DNA marker and fingerprinting approaches.

    Science.gov (United States)

    Gholave, Avinash R; Pawar, Kiran D; Yadav, Shrirang R; Bapat, Vishwas A; Jadhav, Jyoti P

    2017-01-01

    Plastid DNA markers sequencing and DNA fingerprinting approaches were used and compared for resolving molecular phylogeny of closely related, previously unexplored Amorphophallus species of India. The utility of individual plastid markers namely rbcL , matK , trnH - psbA , trnLC - trnLD , their combined dataset and two fingerprinting techniques viz. RAPD and ISSR were tested for their efficacy to resolves Amorphophallus species into three sections specific clades namely Rhaphiophallus , Conophallus and Amorphophallus . In the present study, sequences of these four plastid DNA regions as well as RAPD and ISSR profiles of 16 Amorphophallus species together with six varieties of two species were generated and analyzed. Maximum likelihood and Bayesian Inference based construction of phylogenetic trees indicated that among the four plastid DNA regions tested individually and their combined dataset, rbcL was found best suited for resolving closely related Amorphophallus species into section specific clades. When analyzed individually, rbcL exhibited better discrimination ability than matK , trnH - psbA , trnLC - trnLD and combination of all four tested plastid markers. Among two fingerprinting techniques used, the resolution of Amorphophallus species using RAPD was better than ISSR and combination of RAPD +ISSR and in congruence with resolution based on rbcL .

  1. Integrated DNA and fingerprint analyses in the identification of 60-year-old mummified human remains discovered in an Alaskan glacier.

    Science.gov (United States)

    Loreille, Odile M; Parr, Ryan L; McGregor, Kevin A; Fitzpatrick, Colleen M; Lyon, Chriss; Yang, Dongya Y; Speller, Camilla F; Grimm, Michael R; Grimm, Michael J; Irwin, Jodi A; Robinson, Edward M

    2010-05-01

    This report describes the identification of a merchant mariner who perished in 1948 when Northwest Airlines Flight 4422, a DC-4 carrying 24 seamen and six crew members crashed into Mount Sanford, Alaska. Fifty-one years later, a human forearm and hand were found close by the wreckage of the plane, prompting identification efforts using DNA and fingerprints. There were significant challenges to both the fingerprint and DNA analyses. The hand was badly desiccated, making fingerprint friction-ridge detail almost invisible and the remains had been embalmed upon discovery, making DNA amplification difficult. We present the results of an interdisciplinary approach that successfully addressed these challenges and ultimately led to the identification of the remains. These efforts relied on efficient fingerprint rejuvenation and imaging techniques that improved print resolution, as well as new DNA extraction techniques optimized for aggressively embalmed remains.

  2. Identification of a new hominin bone from Denisova Cave, Siberia using collagen fingerprinting and mitochondrial DNA analysis

    Science.gov (United States)

    Brown, Samantha; Higham, Thomas; Slon, Viviane; Pääbo, Svante; Meyer, Matthias; Douka, Katerina; Brock, Fiona; Comeskey, Daniel; Procopio, Noemi; Shunkov, Michael; Derevianko, Anatoly; Buckley, Michael

    2016-03-01

    DNA sequencing has revolutionised our understanding of archaic humans during the Middle and Upper Palaeolithic. Unfortunately, while many Palaeolithic sites contain large numbers of bones, the majority of these lack the diagnostic features necessary for traditional morphological identification. As a result the recovery of Pleistocene-age human remains is extremely rare. To circumvent this problem we have applied a method of collagen fingerprinting to more than 2000 fragmented bones from the site of Denisova Cave, Russia, in order to facilitate the discovery of human remains. As a result of our analysis a single hominin bone (Denisova 11) was identified, supported through in-depth peptide sequencing analysis, and found to carry mitochondrial DNA of the Neandertal type. Subsequent radiocarbon dating revealed the bone to be >50,000 years old. Here we demonstrate the huge potential collagen fingerprinting has for identifying hominin remains in highly fragmentary archaeological assemblages, improving the resources available for wider studies into human evolution.

  3. Diversity of DNA fingerprints of Mycobacterium tuberculosis isolates in the United States.

    Science.gov (United States)

    Yang, Z; Barnes, P F; Chaves, F; Eisenach, K D; Weis, S E; Bates, J H; Cave, M D

    1998-04-01

    To investigate the diversity of IS6110 fingerprints of Mycobacterium tuberculosis isolates in the United States and to determine if matching IS6110 fingerprints represent recent interstate tuberculosis transmission, we performed restriction fragment length polymorphism analysis of M. tuberculosis isolates from 1,326 patients in three geographically separated states. Seven hundred ninety-five different IS6110 fingerprint patterns were generated, and pattern diversity was similar in each state. Ninety-six percent of the fingerprint patterns were observed in only one state, demonstrating that most IS6110 fingerprint patterns are confined to a single geographic location. Of the IS6110 fingerprint patterns that were shared by isolates from more than one state, most isolates with 1 to 5 IS6110 copies were separable by pTBN12 fingerprinting whereas those with > 15 copies were not. One high-copy-number M. tuberculosis strain had identical IS6110 and pTBN12 fingerprints and included 57 isolates from three states. Epidemiological data demonstrated significant recent transmission of tuberculosis within each city but not among the states. This suggests that identical fingerprints of isolates from geographically separate locations most likely reflect interstate tuberculosis transmission in the past, with subsequent intrastate spread of disease. Further evaluation of M. tuberculosis strains that cause outbreaks in different geographic locations will provide insight into the epidemiological and bacteriological factors that facilitate the spread of tuberculosis.

  4. DNA fingerprinting and diversity analysis in Aus genotypes using microsatellite markers

    Directory of Open Access Journals (Sweden)

    MD. MONIRUL ISLAM

    2015-08-01

    Full Text Available DNA fingerprinting and genetic diversity of 94 Aus (6 BRRI released Aus variety and 88 local Aus landraces genotypes were carried out to protect the Aus landraces from biopiracy. A total of 91 microsatellite markers were tested for screening the genotypes. Among 91 amplified products, 56% have polymorphic bands giving 195 alleles. The number of alleles per locus ranged from four (RM25 and RM147 to twenty seven (RM519, where average allele number was 9.76. The Polymorphism Information Contents (PIC lied between 0.455 (RM5 to 0.934 (RM519. Most robust marker was found RM519 since it provided the highest PIC value (0.934. Pair-wise genetic dissimilarity co-efficient showed the lowest genetic dissimilarity was found BRRI dhan42 and BRRI dhan43 and the highest genetic dissimilarity was found local landraces each other. Here it is shown that most Aus landraces is recognized to have broad genetic base. Thus it is recommended to use these landraces for future breeding program or include new and untouched local landraces to incorporate new genes and broaden genetic base.

  5. Diversity among Cynodon accessions and taxa based on DNA amplification fingerprinting.

    Science.gov (United States)

    Assefa, S; Taliaferro, C M; Anderson, M P; de los Reyes, B G; Edwards, R M

    1999-06-01

    The genus Cynodon (Gramineae), comprised of 9 species, is geographically widely distributed and genetically diverse. Information on the amounts of molecular genetic variation among and within Cynodon taxa is needed to enhance understanding of phylogenetic relations and facilitate germplasm management and breeding improvement efforts. Genetic relatedness among 62 Cynodon accessions, representing eight species, was assessed using DNA amplification fingerprinting (DAF). Ten 8-mer oligonucleotides were used to amplify specific Cynodon genomic sequences. The DNA amplification products of individual accessions were scored for presence (1) or absence (0) of bands. Similarity matrices were developed and the accessions were grouped by cluster (UPGMA) and principal coordinate analysis. Analyses were conducted within ploidy level (2x = 18 and 4x = 36) and over ploidy levels. Each primer revealed polymorphic loci among accessions within species. Of 539 loci (bands) scored, 496 (92%) were polymorphic. Cynodon arcuatus was clearly separated from other species by numerous monomorphic bands. The strongest species similarities were between C. aethiopicus and C. arcuatus, C. transvaalensis and C. plectostachyus, and C. incompletus and C. nlemfuensis. Intraspecific variation was least for C. aethiopicus, C. arcuatus, and C. transvaalensis, and greatest for C. dactylon. Accessions of like taxonomic classification were generally clustered, except the cosmopolitan C. dactylon var. dactylon and C. dactylon var. afganicus. Within taxa, accessions differing in chromosome number clustered in all instances indicating the 2x and 4x forms to be closely related. Little, if any, relationship was found between relatedness as indicated by the DAF profiles and previous estimates of hybridization potential between the different taxa.

  6. Using DNA fingerprints to infer familial relationships within NHANES III households.

    Science.gov (United States)

    Katki, Hormuzd A; Sanders, Christopher L; Graubard, Barry I; Bergen, Andrew W

    2010-06-01

    Developing, targeting, and evaluating genomic strategies for population-based disease prevention require population-based data. In response to this urgent need, genotyping has been conducted within the Third National Health and Nutrition Examination (NHANES III), the nationally-representative household-interview health survey in the U.S. However, before these genetic analyses can occur, family relationships within households must be accurately ascertained. Unfortunately, reported family relationships within NHANES III households based on questionnaire data are incomplete and inconclusive with regards to actual biological relatedness of family members. We inferred family relationships within households using DNA fingerprints (Identifiler(R)) that contain the DNA loci used by law enforcement agencies for forensic identification of individuals. However, performance of these loci for relationship inference is not well understood. We evaluated two competing statistical methods for relationship inference on pairs of household members: an exact likelihood ratio relying on allele frequencies to an Identical By State (IBS) likelihood ratio that only requires matching alleles. We modified these methods to account for genotyping errors and population substructure. The two methods usually agree on the rankings of the most likely relationships. However, the IBS method underestimates the likelihood ratio by not accounting for the informativeness of matching rare alleles. The likelihood ratio is sensitive to estimates of population substructure, and parent-child relationships are sensitive to the specified genotyping error rate. These loci were unable to distinguish second-degree relationships and cousins from being unrelated. The genetic data is also useful for verifying reported relationships and identifying data quality issues. An important by-product is the first explicitly nationally-representative estimates of allele frequencies at these ubiquitous forensic loci.

  7. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  8. Rapid discrimination and classification of the Lactobacillus plantarum group based on a partial dnaK sequence and DNA fingerprinting techniques.

    Science.gov (United States)

    Huang, Chien-Hsun; Lee, Fwu-Ling; Liou, Jong-Shian

    2010-03-01

    The Lactobacillus plantarum group comprises five very closely related species. Some species of this group are considered to be probiotic and widely applied in the food industry. In this study, we compared the use of two different molecular markers, the 16S rRNA and dnaK gene, for discriminating phylogenetic relationships amongst L. plantarum strains using sequencing and DNA fingerprinting. The average sequence similarity for the dnaK gene (89.2%) among five type strains was significantly less than that for the 16S rRNA (99.4%). This result demonstrates that the dnaK gene sequence provided higher resolution than the 16S rRNA and suggests that the dnaK could be used as an additional phylogenetic marker for L. plantarum. Species-specific profiles of the Lactobacillus strains were obtained with RAPD and RFLP methods. Our data indicate that phylogenetic relationships between these strains are easily resolved using sequencing of the dnaK gene or DNA fingerprinting assays.

  9. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

    Science.gov (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

    2001-04-01

    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  10. Fingerprints for main varieties of argentinean wines: terroir differentiation by inorganic, organic, and stable isotopic analyses coupled to chemometrics.

    Science.gov (United States)

    Di Paola-Naranjo, Romina D; Baroni, Maria V; Podio, Natalia S; Rubinstein, Hector R; Fabani, Maria P; Badini, Raul G; Inga, Marcela; Ostera, Hector A; Cagnoni, Mariana; Gallegos, Ernesto; Gautier, Eduardo; Peral-Garcia, Pilar; Hoogewerff, Jurian; Wunderlin, Daniel A

    2011-07-27

    Our main goal was to investigate if robust chemical fingerprints could be developed for three Argentinean red wines based on organic, inorganic, and isotopic patterns, in relation to the regional soil composition. Soils and wines from three regions (Mendoza, San Juan, and Córdoba) and three varieties (Cabernet Sauvignon, Malbec, and Syrah) were collected. The phenolic profile was determined by HPLC-MS/MS and multielemental composition by ICP-MS; (87)Sr/(86)Sr and δ(13)C were determined by TIMS and IRMS, respectively. Chemometrics allowed robust differentiation between regions, wine varieties, and the same variety from different regions. Among phenolic compounds, resveratrol concentration was the most useful marker for wine differentiation, whereas Mg, K/Rb, Ca/Sr, and (87)Sr/(86)Sr were the main inorganic and isotopic parameters selected. Generalized Procrustes analysis (GPA) using two studied matrices (wine and soil) shows consensus between them and clear differences between studied areas. Finally, we applied a canonical correlation analysis, demonstrating significant correlation (r = 0.99; p wine composition. To our knowledge this is the first report combining independent variables, constructing a fingerprint including elemental composition, isotopic, and polyphenol patterns to differentiate wines, matching part of this fingerprint with the soil provenance.

  11. Molecular Typing of Borrelia burgdorferi Sensu Lato by Randomly Amplified Polymorphic DNA Fingerprinting Analysis

    Science.gov (United States)

    Wang, Guiqing; van Dam, Alje P.; Spanjaard, Lodewijk; Dankert, Jacob

    1998-01-01

    To study whether pathogenic clusters of Borrelia burgdorferi sensu lato strains occur, we typed 136 isolates, cultured from specimens from patients (n = 49) with various clinical entities and from ticks (n = 83) or dogs (n = 4) from different geographic regions, by randomly amplified polymorphic DNA (RAPD) fingerprinting with four arbitrary primers. The RAPD patterns were reproducible up to the 95% similarity level as shown in duplicate experiments. In these experiments the purified DNAs prepared on different days, from different colonies, and after various passages were used as templates. With an intergroup difference of 55%, the 136 strains could be divided into seven genetic clusters. Six clusters comprised and corresponded to the established species B. burgdorferi sensu stricto (n = 23), Borrelia garinii (n = 39), Borrelia afzelii (n = 59), Borrelia japonica (n = 1), Borrelia valaisiana (n = 12), and genomic group DN127 (n = 1). One strain from a patient with erythema migrans (EM) did not belong to any of the species or genomic groups known up to now. The RAPD types of B. burgdorferi sensu stricto, B. garinii, and B. afzelii isolates, which may give rise to human Lyme borreliosis (LB), were associated with their geographic origins. A high degree of genetic diversity was observed among the 39 B. garinii strains, and six subgroups could be recognized. One of these comprised eight isolates from patients with disseminated LB only and no tick isolates. B. afzelii strains from patients with EM or acrodermatitis chronica atrophicans were not clustered in particular branches. Our study showed that RAPD analysis is a powerful tool for discriminating different Borrelia species as well as Borrelia isolates within species. PMID:9508310

  12. iPBS: a universal method for DNA fingerprinting and retrotransposon isolation.

    Science.gov (United States)

    Kalendar, Ruslan; Antonius, Kristiina; Smýkal, Petr; Schulman, Alan H

    2010-11-01

    Molecular markers are essential in plant and animal breeding and biodiversity applications, in human forensics, and for map-based cloning of genes. The long terminal repeat (LTR) retrotransposons are well suited as molecular markers. As dispersed and ubiquitous transposable elements, their "copy and paste" life cycle of replicative transposition leads to new genome insertions without excision of the original element. Both the overall structure of retrotransposons and the domains responsible for the various phases of their replication are highly conserved in all eukaryotes. Nevertheless, up to a year has been required to develop a retrotransposon marker system in a new species, involving cloning and sequencing steps as well as the development of custom primers. Here, we describe a novel PCR-based method useful both as a marker system in its own right and for the rapid isolation of retrotransposon termini and full-length elements, making it ideal for "orphan crops" and other species with underdeveloped marker systems. The method, iPBS amplification, is based on the virtually universal presence of a tRNA complement as a reverse transcriptase primer binding site (PBS) in LTR retrotransposons. The method differs from earlier retrotransposon isolation methods because it is applicable not only to endogenous retroviruses and retroviruses, but also to both Gypsy and Copia LTR retrotransposons, as well as to non-autonomous LARD and TRIM elements, throughout the plant kingdom and to animals. Furthermore, the inter-PBS amplification technique as such has proved to be a powerful DNA fingerprinting technology without the need for prior sequence knowledge.

  13. Detection of γ-ray-induced DNA damages in malformed dominant lethal embryos of the Japanese medaka (Oryzias latipes) using AP-PCR fingerprinting

    International Nuclear Information System (INIS)

    Kubota, Yoshiko; Shimada, Atsuko; Shima, Akihiro

    1992-01-01

    Adult male fish of the medaka HNI strain exposed to 9.5 Gy or 19 Gy (0.95 Gy/min) of γ-rays were mated with non-irradiated female fish of the Hd-rR strain. Genomic DNA was prepared from malformed individual embryos which were expected to be dominant lethal and used for AP-PCR fingerprinting. By the use of a part of the T3 promoter sequence (20 mer), which is not found in the medaka genome as an arbitrary primer, polymorphisms were found in genomic fingerprints which could distinguish the parental strains. On the other hand, fingerprints of F1 hybrids were found to be the sum of those of their parents. Based on these findings, the fingerprints of genomic DNA of each severely malformed embryo were analyzed, because it was expected that radiation-induced genomic damages resulting in severe malformation and eventually in dominant lethals should be detected as changes in paternal fingerprints of F1 hybrids. Indeed, changes were found in genomic DNA as loss of some paternal bands in fingerprints of malformed embryos. One of 10 malformed embryos obtained from 9.5 Gy γ-irradiated males had lost 5 bands. These results indicated a possibility that quantitative as well as qualitative estimation of γ-ray-induced DNA damages can be made by this method which does not require the functional selection based on a specific target gene. (author). 16 refs., 3 figs., 1 tab

  14. Development of an efficient fungal DNA extraction method to be used in random amplified polymorphic DNA-PCR analysis to differentiate cyclopiazonic acid mold producers.

    Science.gov (United States)

    Sánchez, Beatriz; Rodríguez, Mar; Casado, Eva M; Martín, Alberto; Córdoba, Juan J

    2008-12-01

    A variety of previously established mechanical and chemical treatments to achieve fungal cell lysis combined with a semiautomatic system operated by a vacuum pump were tested to obtain DNA extract to be directly used in randomly amplified polymorphic DNA (RAPD)-PCR to differentiate cyclopiazonic acid-producing and -nonproducing mold strains. A DNA extraction method that includes digestion with proteinase K and lyticase prior to using a mortar and pestle grinding and a semiautomatic vacuum system yielded DNA of high quality in all the fungal strains and species tested, at concentrations ranging from 17 to 89 ng/microl in 150 microl of the final DNA extract. Two microliters of DNA extracted with this method was directly used for RAPD-PCR using primer (GACA)4. Reproducible RAPD fingerprints showing high differences between producer and nonproducer strains were observed. These differences in the RAPD patterns did not differentiate all the strains tested in clusters by cyclopiazonic acid production but may be very useful to distinguish cyclopiazonic acid producer strains from nonproducer strains by a simple RAPD analysis. Thus, the DNA extracts obtained could be used directly without previous purification and quantification for RAPD analysis to differentiate cyclopiazonic acid producer from nonproducer mold strains. This combined analysis could be adaptable to other toxigenic fungal species to enable differentiation of toxigenic and non-toxigenic molds, a procedure of great interest in food safety.

  15. Genomic DNA fingerprinting of clinical Haemophilus influenzae isolates by polymerase chain reaction amplification: comparison with major outer-membrane protein and restriction fragment length polymorphism analysis

    NARCIS (Netherlands)

    van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.

    1994-01-01

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  16. [Study of genome instability using DNA fingerprinting of the offspring of male mice subjected to chronic low dose gamma irradiation].

    Science.gov (United States)

    Bezlepkin, V G; Vasil'eva, G V; Lomaeva, M G; Sirota, N P; Gaziev, A I

    2000-01-01

    By a polymerase chain reaction with an arbitrary primer (AP-PCR), the possibility of transmission of genome instability to somatic cells of the offspring (F1 generation) from male parents of mice exposed to chronic low-level gamma-radiation was studied. Male BALB/c mice 15 days after exposure to 10-50 cGy were mated with unirradiated females. Biopsies were taken from tale tips of two month-old offspring mice and DNA was isolated. The primer in the AP-PCR was a 20-mer oligonucleotide flanking the microsatellite locus Atp1b2 on chromosome 11 of the mouse. A comparative analysis of individual fingerprints of AP-PCR products on DNA-templates from the offspring of irradiated and unirradiated male mice revealed an increased variability of microsatellite-associated sequences in the genome of the offspring of the males exposed to 25 and 50 cGy. The DNA-fingerprints of the offspring of male mice exposed to chronic irradiation with the doses 10 and 25 cGy 15 days before fertilization (at the post-meiotic stage of spermatogenesis) showed an increased frequency of "non-parent bands". The results of the study point to the possibility of transmission to the offspring somatic cells of changes increasing genome instability from male parents exposed to chronic low-level radiation prior to fertilization.

  17. Rapid differentiation of Chinese hop varieties (Humulus lupulus) using volatile fingerprinting by HS-SPME-GC-MS combined with multivariate statistical analysis.

    Science.gov (United States)

    Liu, Zechang; Wang, Liping; Liu, Yumei

    2018-01-18

    Hops impart flavor to beer, with the volatile components characterizing the various hop varieties and qualities. Fingerprinting, especially flavor fingerprinting, is often used to identify 'flavor products' because inconsistencies in the description of flavor may lead to an incorrect definition of beer quality. Compared to flavor fingerprinting, volatile fingerprinting is simpler and easier. We performed volatile fingerprinting using head space-solid phase micro-extraction gas chromatography-mass spectrometry combined with similarity analysis and principal component analysis (PCA) for evaluating and distinguishing between three major Chinese hops. Eighty-four volatiles were identified, which were classified into seven categories. Volatile fingerprinting based on similarity analysis did not yield any obvious result. By contrast, hop varieties and qualities were identified using volatile fingerprinting based on PCA. The potential variables explained the variance in the three hop varieties. In addition, the dendrogram and principal component score plot described the differences and classifications of hops. Volatile fingerprinting plus multivariate statistical analysis can rapidly differentiate between the different varieties and qualities of the three major Chinese hops. Furthermore, this method can be used as a reference in other fields. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  18. Reliable differentiation of Meyerozyma guilliermondii from Meyerozyma caribbica by internal transcribed spacer restriction fingerprinting.

    Science.gov (United States)

    Romi, Wahengbam; Keisam, Santosh; Ahmed, Giasuddin; Jeyaram, Kumaraswamy

    2014-02-28

    Meyerozyma guilliermondii (anamorph Candida guilliermondii) and Meyerozyma caribbica (anamorph Candida fermentati) are closely related species of the genetically heterogenous M. guilliermondii complex. Conventional phenotypic methods frequently misidentify the species within this complex and also with other species of the Saccharomycotina CTG clade. Even the long-established sequencing of large subunit (LSU) rRNA gene remains ambiguous. We also faced similar problem during identification of yeast isolates of M. guilliermondii complex from indigenous bamboo shoot fermentation in North East India. There is a need for development of reliable and accurate identification methods for these closely related species because of their increasing importance as emerging infectious yeasts and associated biotechnological attributes. We targeted the highly variable internal transcribed spacer (ITS) region (ITS1-5.8S-ITS2) and identified seven restriction enzymes through in silico analysis for differentiating M. guilliermondii from M. caribbica. Fifty five isolates of M. guilliermondii complex which could not be delineated into species-specific taxonomic ranks by API 20 C AUX and LSU rRNA gene D1/D2 sequencing were subjected to ITS-restriction fragment length polymorphism (ITS-RFLP) analysis. TaqI ITS-RFLP distinctly differentiated the isolates into M. guilliermondii (47 isolates) and M. caribbica (08 isolates) with reproducible species-specific patterns similar to the in silico prediction. The reliability of this method was validated by ITS1-5.8S-ITS2 sequencing, mitochondrial DNA RFLP and electrophoretic karyotyping. We herein described a reliable ITS-RFLP method for distinct differentiation of frequently misidentified M. guilliermondii from M. caribbica. Even though in silico analysis differentiated other closely related species of M. guilliermondii complex from the above two species, it is yet to be confirmed by in vitro analysis using reference strains. This method can be used

  19. Modulation of DNA base excision repair during neuronal differentiation

    DEFF Research Database (Denmark)

    Sykora, Peter; Yang, Jenq-Lin; Ferrarelli, Leslie K

    2013-01-01

    DNA damage susceptibility and base excision DNA repair (BER) capacity in undifferentiated and differentiated human neural cells. The results show that undifferentiated human SH-SY5Y neuroblastoma cells are less sensitive to oxidative damage than their differentiated counterparts, in part because...

  20. Study on detection of mutation DNA fragment in gastric cancer by restriction endonuclease fingerprinting with capillary electrophoresis.

    Science.gov (United States)

    Wang, Rong; Xie, Hua; Xu, Yue-Bing; Jia, Zheng-Ping; Meng, Xian-Dong; Zhang, Juan-Hong; Ma, Jun; Wang, Juan; Wang, Xian-Hua

    2012-03-01

    The DNA fragment detection focusing technique has further enhanced the sensitivity and information of DNA targets. The DNA fragment detection method was established by capillary electrophoresis with laser-induced fluorescence detection and restriction endonuclease chromatographic fingerprinting (CE-LIF-REF) in our experiment. The silica capillary column was coated with short linear polyarclarylamide (SLPA) using nongel sieving technology. The excision product of various restricted enzymes of DNA fragments was obtained by REF with the molecular biology software Primer Premier 5. The PBR322/BsuRI DNA marker was used to establish the optimization method. The markers were focused electrophoretically and detected by CE-LIF. The results demonstrate that the CE-LIF-REF with SLPA can improve separation, sensitivity and speed of analysis. This technique may be applied to analysis of the excision product of various restricted enzymes of prokaryotic plasmid (pIRES2), eukaryote plasmid (pcDNA3.1) and the PCR product of codon 248 region of gastric cancer tissue. The results suggest that this method could very sensitively separate the excision products of various restricted enzymes at a much better resolution than the traditional agarose electrophoresis. Copyright © 2011 John Wiley & Sons, Ltd.

  1. Genetic diversity of Clavispora lusitaniae isolated from Agave fourcroydes Lem, as revealed by DNA fingerprinting.

    Science.gov (United States)

    Pérez-Brito, Daisy; Magaña-Alvarez, Anuar; Lappe-Oliveras, Patricia; Cortes-Velazquez, Alberto; Torres-Calzada, Claudia; Herrera-Suarez, Teófilo; Larqué-Saavedra, Alfonso; Tapia-Tussell, Raul

    2015-01-01

    This study characterized Clavispora lusitaniae strains isolated from different stages of the processing and early fermentation of a henequen (Agave fourcroydes) spirit produced in Yucatan, Mexico using a molecular technique. Sixteen strains identified based on morphological features, obtained from different substrates, were typed molecularly. Nine different versions of the divergent D1/D2 domain of the large-subunit ribosomal DNA sequence were identified among the C. lusitaniae strains. The greatest degree of polymorphism was found in the 90-bp structural motif of the D2 domain. The MSP-PCR technique was able to differentiate 100% of the isolates. This study provides significant insight into the genetic diversity of the mycobiota present during the henequen fermentation process, especially that of C. lusitaniae, for which only a few studies in plants have been published. The applied MSP-PCR markers were very efficient in revealing olymorphisms between isolates of this species.

  2. The examination of Hevea brasiliensis plants produced by in vitro culture and mutagenesis by DNA fingerprinting techniques

    International Nuclear Information System (INIS)

    Low, F.C.; Atan, S.; Jaafar, H.

    1998-01-01

    Rubber (Hevea brasiliensis) plants derived from anther and ovule culture as well as gamma-irradiated plants were examined by several DNA marker techniques. These include restriction fragment length polymorphisms (RFLPs), random amplified polymorphic DNA (RAPD), sequence tagged microsatellite sites (STMS), DNA amplification fingerprinting (DAF) and amplified fragment length polymorphisms (AFLPs). Compared to control plants produced by vegetative propagation (cutting and budding), plants produced by in vitro culture appeared to have a reduction in the number of rDNA loci. Two RAPD protocols were compared and found to be similar in amplification of the major DNA bands. After confirmation that the RAPD method adopted was reproducible, the technique was applied to the present studies. Eight out of the 60 primers screened were able to elicit polymorphisms between pooled DNA from in vitro culture plants. Variations in DNA patterns were observed between pooled DNA samples of anther-derived plants as well as between anther-derived and ovule-derived plants. Comparisons of RAPD patterns obtained between anther-derived plants exposed to increasing dosages of gamma-irradiation with non irradiated anther-derived plants revealed distinct DNA polymorphisms. The changes in DNA profiles did not appear to be correlated to the dosage of irradiation. Since somaclonal variation was detected, it was difficult to identify changes which were specifically caused by irradiation. Application of the STMS technique to tag micro satellite sequences (GA) n , (TA) n and (TTA) n in the hydroxymethylglutaryl coenzyme A reductase-1 (hmgr-1) gene failed to detect differences between plants derived from anther and ovule culture. Although restriction endonuclease digestions with methylation sensitive enzymes suggested that four in vitro culture plants examined exhibited similar digestion patterns as the controls, a change in cytosine methylation in one anther-derived plant was detected. Examination of

  3. Differentiation of strains from the Bacillus cereus group by RFLP-PFGE genomic fingerprinting.

    Science.gov (United States)

    Otlewska, Anna; Oltuszak-Walczak, Elzbieta; Walczak, Piotr

    2013-11-01

    Bacillus mycoides, Bacillus pseudomycoides, Bacillus weihenstephanensis, Bacillus anthracis, Bacillus thuringiensis, and Bacillus cereus belong to the B. cereus group. The last three species are characterized by different phenotype features and pathogenicity spectrum, but it has been shown that these species are genetically closely related. The macrorestriction analysis of the genomic DNA with the NotI enzyme was used to generate polymorphism of restriction profiles for 39 food-borne isolates (B. cereus, B. mycoides) and seven reference strains (B. mycoides, B. thuringiensis, B. weihenstephanensis, and B. cereus). The PFGE method was applied to differentiate the examined strains of the B. cereus group. On the basis of the unweighted pair group method with the arithmetic mean method and Dice coefficient, the strains were divided into five clusters (types A-E), and the most numerous group was group A (25 strains). A total of 21 distinct pulsotypes were observed. The RFLP-PFGE analysis was successfully used for the differentiation and characterization of B. cereus and B. mycoides strains isolated from different food products. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Analysis of bacterial core communities in the central Baltic by comparative RNA-DNA-based fingerprinting provides links to structure-function relationships.

    Science.gov (United States)

    Brettar, Ingrid; Christen, Richard; Höfle, Manfred G

    2012-01-01

    Understanding structure-function links of microbial communities is a central theme of microbial ecology since its beginning. To this end, we studied the spatial variability of the bacterioplankton community structure and composition across the central Baltic Sea at four stations, which were up to 450 km apart and at a depth profile representative for the central part (Gotland Deep, 235 m). Bacterial community structure was followed by 16S ribosomal RNA (rRNA)- and 16S rRNA gene-based fingerprints using single-strand conformation polymorphism (SSCP) electrophoresis. Species composition was determined by sequence analysis of SSCP bands. High similarities of the bacterioplankton communities across several hundred kilometers were observed in the surface water using RNA- and DNA-based fingerprints. In these surface communities, the RNA- and DNA-based fingerprints resulted in very different pattern, presumably indicating large difference between the active members of the community as represented by RNA-based fingerprints and the present members represented by the DNA-based fingerprints. This large discrepancy changed gradually over depth, resulting in highly similar RNA- and DNA-based fingerprints in the anoxic part of the water column below 130 m depth. A conceivable mechanism explaining this high similarity could be the reduced oxidative stress in the anoxic zone. The stable communities on the surface and in the anoxic zone indicate the strong influence of the hydrography on the bacterioplankton community structure. Comparative analysis of RNA- and DNA-based community structure provided criteria for the identification of the core community, its key members and their links to biogeochemical functions.

  5. Pasteurella multocida isolated from wild birds of North America: a serotype and DNA fingerprint study of isolates from 1978 to 1993

    Science.gov (United States)

    Wilson, M.A.; Duncan, R.M.; Nordholm, G.E.; Berlowski, B.M.

    1995-01-01

    Serotype and DNA fingerprint methods were used to study Pasteurella multocida isolated from 320 wild birds of North America. Isolates were collected during 1978-93. The HhaI profiles of 314 isolates matched the HhaI profile of somatic reference type 1, strain X-73; somatic type 1 antigen was expressed by 310 isolates, and the serotype of four isolates was undetected. Differentiation of the 314 isolates was observed by digestion of DNA with HpaII. None of the HpaII profiles matched the HpaII profile of X-73 (designated HhaI 001/HpaII 001). Three HpaII profiles were recognized among the somatic type 1 isolates: HpaII 002 (n = 18), HpaII 003 (n = 122), and HpaII 004 (n = 174). Profile HpaII 002 was found among isolates collected during 1979-83. Profile HpaII 003 was identified from isolates collected during 1979-89, with the exception of two isolates in 1992. The HpaII 004 profile was identified from isolates collected during 1983-93. Of the six remaining isolates, four expressed somatic type 4 and had HhaI profiles identical to the somatic type 4 reference strain P-1662 profile (designated HhaI 004); these isolates were differentiated by digestion of DNA with HpaII. One isolate was identified as serotype F:11, and another was serotype A:3,4. In the present study, 314 of 316 (99.4%) isolates from wild birds in the Central, Mississippi, and Pacific flyways during 1978-93, were P. multocida somatic type 1.

  6. Efficient DNA fingerprinting based on the targeted sequencing of active retrotransposon insertion sites using a bench-top high-throughput sequencing platform.

    Science.gov (United States)

    Monden, Yuki; Yamamoto, Ayaka; Shindo, Akiko; Tahara, Makoto

    2014-10-01

    In many crop species, DNA fingerprinting is required for the precise identification of cultivars to protect the rights of breeders. Many families of retrotransposons have multiple copies throughout the eukaryotic genome and their integrated copies are inherited genetically. Thus, their insertion polymorphisms among cultivars are useful for DNA fingerprinting. In this study, we conducted a DNA fingerprinting based on the insertion polymorphisms of active retrotransposon families (Rtsp-1 and LIb) in sweet potato. Using 38 cultivars, we identified 2,024 insertion sites in the two families with an Illumina MiSeq sequencing platform. Of these insertion sites, 91.4% appeared to be polymorphic among the cultivars and 376 cultivar-specific insertion sites were identified, which were converted directly into cultivar-specific sequence-characterized amplified region (SCAR) markers. A phylogenetic tree was constructed using these insertion sites, which corresponded well with known pedigree information, thereby indicating their suitability for genetic diversity studies. Thus, the genome-wide comparative analysis of active retrotransposon insertion sites using the bench-top MiSeq sequencing platform is highly effective for DNA fingerprinting without any requirement for whole genome sequence information. This approach may facilitate the development of practical polymerase chain reaction-based cultivar diagnostic system and could also be applied to the determination of genetic relationships. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  7. Preliminary evaluation of the use of soil bacterial 16S rDNA DNA markers in sediment fingerprinting in two small endorheic lagoons in southern Spain

    Science.gov (United States)

    Gomez, Jose Alfonso; Landa del Castillo, Blanca; Guzman, Gema; Petticrew, Ellen L.; Owens, Phillip N.

    2016-04-01

    Recently, several studies have shown the effect of soil management on the soil microbial community in olive orchards, how this might differ due to a combination of management and soil type, and how these can be identified using DNA markers (Landa et al., 2014). Using DNA markers of soil bacteria seems to have the potential to detect differences in soil properties between different areas (Joe-Strack and Petticrew, 2012), particularly in those that by their location and characteristics might not present differences in other chemical or geochemical soil properties. This presentation describes the preliminary results of an exploratory survey to evaluate the potential of soil bacteria community composition in determining the origin of the sediment in two small endorheic lagoons in southern Spain. Two lagoons (Zoñar and Dulce) in southern Spain with a small contributing area (877 and 263 ha respectively) were selected for this study. These lagoons were chosen because of their environmental relevance and increasing siltation problems. The dominant land use in most of their contributing catchments is rain-fed olive tree cultivation. In May 2015, two small subcatchments within each of the lagoon's contributing area were sampled. At each sampling point, a composite sample was collected of three subsamples taken within a 5 m radiusa. We differentiated between 0-20 and 20-40 cm soil depth. Additionally, in both lagoons samples were taken from the sedimentation of the stream draining the subcatchment into the lagoon shores, at 0-20 -cm depth. Prior to each sampling each of the the two subcatchments were explored for indications of different properties or management that could help divide it into different "homogeneous" units, including: soil management, visual indications of erosion symptoms (e.g. rills, soil mounds around olive trees), colour, and landscape position. As a result, the subcatchment in each lagoon was divided into three areas (referred to as 1, 2 and 3). The

  8. Optimization of ISSR Markers for Molecular DNA Fingerprinting in Aquilaria sp

    International Nuclear Information System (INIS)

    Azhar Mohamad; Muhammad Hanif Azhari; Siti Norhayati Ismail; Parween, K.S.A.S.

    2013-01-01

    Aquilaria sp. belongs to the Thymelaeaceae family and well distributed to Asia region. The species is a multipurpose use from root to shoot and becoming an economic important crop, which generates wide interest in understanding the genetic diversity of the species. Understanding of the effectiveness in differentiating DNA-based markers is an important step towards plant germplasm characterization and evaluation. It is becoming a prerequisite for more effective application of molecular marker techniques in breeding and mapping programs. Polymerase Chain Reaction (PCR)-based approaches are in demanding as its simplicity and requirement for only small quantities of sample genomic DNA. Inter-simple sequence repeats (ISRR) requires no prior genomic information as anchor template in producing multi-loci markers of tandem repeats for polymorphic patterns by PCR amplification which becoming a key of advantageous of ISSR primers. ISSR markers have shown rapid, simple, reproducible and inexpensive means in molecular taxonomy, conservation breeding and genetic diversity analysis. The ISSR for marker applications are essential to facilitate management, conservation and genetic improvement programs towards improvement of standard resin quality for perfume and or pharmaceutical industries. In this paper, a total of 100 ISSR primers were optimized by using Aquilaria malaccensis. Primers optimization resulted, 38 ISSR primers affirmative for the polymorphism evaluation study, which encountered both from specific and degenerate ISSR primers. Marker derived from ISSR profiling is a powerful method for identification and molecular classification of Aquilaria sp from species to accessions and further will useful in identifying any mutant lines derived from nature and/or mutagenesis activities. (author)

  9. Genetic variations of Lansium domesticum Corr. accessions from Java, Sumatra and Ceram based on Random Amplified Polymorphic DNA fingerprints

    Directory of Open Access Journals (Sweden)

    KUSUMADEWI SRI YULITA

    2011-07-01

    Full Text Available Yulita KS (2011 Genetic variations of Lansium domesticum Corr. accessions from Java, Bengkulu and Ceram based on Random Amplified Polymorphic DNA fingerprints. Biodiversitas 12: 125-130. Duku (Lansium domesticum Corr. is one of popular tropical fruits in SE Asia. The spesies has three varieties, known as duku, langsat and kokosan; and duku is the most popular one for being the sweetiest fruit. Indonesia has several local varieties of duku, such as duku Condet, duku Sumber and duku Palembang. This present study aimed to assess genetic diversity of 47 accessions of duku from Java, Sumatra, and Ceram based on RAPD fingerprints. Ten RAPD’s primers were initially screened and five were selected for the analysis. These five primers (OPA 7, 13, 18, OPB 7, and OPN 12 generated 53 scorable bands with an average of 10.6 polymorphic fragment per primer. Percentage of polymorphism ranged from 16.89% (OPA 7 and OPN 12 to 24.54% (OPB 7 with an average of 20.16% polymorphism. OPB 7 at 450 bp was exclusively possessed by accession 20 (Java, OPA 18 at 500 bp was by accession 6 (Java, 550 bp by 3 clones from Bengkulu. While OPN 12 at 300 bp and OPA 13 at 450 bp were shared among the accessions. Clustering analysis was performed based on RAPD profiles using the UPGMA method. The range of genetic similarity value among accessions was 0.02-0.65 suggesting high variation of gene pool existed among accessions.

  10. Reduction in DNA repair capacity following differentiation of murine proadipocytes

    International Nuclear Information System (INIS)

    Tofilon, P.J.; Meyn, R.E.

    1988-01-01

    It has been suggested that terminally differentiated mammalian cells have a decreased DNA repair capacity, compared with proliferating stem cells. To investigate this hypothesis, we have examined γ-ray-induced DNA strand breaks and their repair in the murine proadipocyte stem cell line 3T3-T. By exposure to human plasma, 3T3-T cells can be induced to undergo nonterminal and then terminal differentiation. DNA strand breaks were evaluated using the technique of alkaline elution. No difference was detected among stem, nonterminally differentiated, and terminally differentiated cells in the initial levels of radiation-induced DNA strand breaks. Each of the strand break dose responses increased as a linear function of γ-ray dose. The strand breaks induced by 4 Gy rejoined following biphasic kinetics for each cell type. At each time point examined after irradiation, however, the percentage of strand breaks that had not rejoined in terminally differentiated cells was three to six times greater than in stem cells. The rate of strand break rejoining in nonterminally differentiated cells was of an intermediate value between that of the stem and of the terminally differentiated cells. These results indicate that, at least for 3T3-T cells, differentiated cells have a reduced capacity for DNA repair

  11. DNA repair in murine embryonic stem cells and differentiated cells

    International Nuclear Information System (INIS)

    Tichy, Elisia D.; Stambrook, Peter J.

    2008-01-01

    Embryonic stem (ES) cells are rapidly proliferating, self-renewing cells that have the capacity to differentiate into all three germ layers to form the embryo proper. Since these cells are critical for embryo formation, they must have robust prophylactic mechanisms to ensure that their genomic integrity is preserved. Indeed, several studies have suggested that ES cells are hypersensitive to DNA damaging agents and readily undergo apoptosis to eliminate damaged cells from the population. Other evidence suggests that DNA damage can cause premature differentiation in these cells. Several laboratories have also begun to investigate the role of DNA repair in the maintenance of ES cell genomic integrity. It does appear that ES cells differ in their capacity to repair damaged DNA compared to differentiated cells. This minireview focuses on repair mechanisms ES cells may use to help preserve genomic integrity and compares available data regarding these mechanisms with those utilized by differentiated cells

  12. Mechanisms of dealing with DNA damage in terminally differentiated cells

    Energy Technology Data Exchange (ETDEWEB)

    Fortini, P. [Department of Environment and Primary Prevention, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy); Dogliotti, E., E-mail: eugenia.dogliotti@iss.it [Department of Environment and Primary Prevention, Istituto Superiore di Sanita, Viale Regina Elena 299, 00161 Rome (Italy)

    2010-03-01

    To protect genomic integrity living cells that are continuously exposed to DNA-damaging insults are equipped with an efficient defence mechanism termed the DNA damage response. Its function is to eliminate DNA damage through DNA repair and to remove damaged cells by apoptosis. The DNA damage response has been investigated mainly in proliferating cells, in which the cell cycle machinery is integrated with the DNA damage signalling. The current knowledge of the mechanisms of DNA repair, DNA damage signalling and cell death of post-mitotic cells that have undergone irreversible cell cycle withdrawal will be reviewed. Evidence will be provided that the protection of the genome integrity in terminally differentiated cells is achieved by different strategies than in proliferating cells.

  13. Mechanisms of dealing with DNA damage in terminally differentiated cells

    International Nuclear Information System (INIS)

    Fortini, P.; Dogliotti, E.

    2010-01-01

    To protect genomic integrity living cells that are continuously exposed to DNA-damaging insults are equipped with an efficient defence mechanism termed the DNA damage response. Its function is to eliminate DNA damage through DNA repair and to remove damaged cells by apoptosis. The DNA damage response has been investigated mainly in proliferating cells, in which the cell cycle machinery is integrated with the DNA damage signalling. The current knowledge of the mechanisms of DNA repair, DNA damage signalling and cell death of post-mitotic cells that have undergone irreversible cell cycle withdrawal will be reviewed. Evidence will be provided that the protection of the genome integrity in terminally differentiated cells is achieved by different strategies than in proliferating cells.

  14. Comparison of DNA-based techniques for differentiation of production strains of ale and lager brewing yeast.

    Science.gov (United States)

    Kopecká, J; Němec, M; Matoulková, D

    2016-06-01

    Brewing yeasts are classified into two species-Saccharomyces pastorianus and Saccharomyces cerevisiae. Most of the brewing yeast strains are natural interspecies hybrids typically polyploids and their identification is thus often difficult giving heterogenous results according to the method used. We performed genetic characterization of a set of the brewing yeast strains coming from several yeast culture collections by combination of various DNA-based techniques. The aim of this study was to select a method for species-specific identification of yeast and discrimination of yeast strains according to their technological classification. A group of 40 yeast strains were characterized using PCR-RFLP analysis of ITS-5·8S, NTS, HIS4 and COX2 genes, multiplex PCR, RAPD-PCR of genomic DNA, mtDNA-RFLP and electrophoretic karyotyping. Reliable differentiation of yeast to the species level was achieved by PCR-RFLP of HIS4 gene. Numerical analysis of the obtained RAPD-fingerprints and karyotype revealed species-specific clustering corresponding with the technological classification of the strains. Taxonomic position and partial hybrid nature of strains were verified by multiplex PCR. Differentiation among species using the PCR-RFLP of ITS-5·8S and NTS region was shown to be unreliable. Karyotyping and RFLP of mitochondrial DNA evinced small inaccuracies in strain categorization. PCR-RFLP of HIS4 gene and RAPD-PCR of genomic DNA are reliable and suitable methods for fast identification of yeast strains. RAPD-PCR with primer 21 is a fast and reliable method applicable for differentiation of brewing yeasts with only 35% similarity of fingerprint profile between the two main technological groups (ale and lager) of brewing strains. It was proved that PCR-RFLP method of HIS4 gene enables precise discrimination among three technologically important Saccharomyces species. Differentiation of brewing yeast to the strain level can be achieved using the RAPD-PCR technique. © 2016 The

  15. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  16. Genetic polymorphism of Malassezia furfur isolates from Han and Tibetan ethnic groups in China using DNA fingerprinting.

    Science.gov (United States)

    Zhang, Hao; Zhang, Ruifeng; Ran, Yuping; Dai, Yaling; Lu, Yao; Wang, Peng

    2010-12-01

    Reported isolation rates of Malassezia yeast from human skin show geographic variations. In China, the populations of the Han (1,182.95 million) and Tibetan (5.41 million) ethnic groups are distributed over 9.6 and 3.27 million square kilometers respectively, making biodiversity research feasible and convenient. Malassezia furfur clinical strains (n = 29) isolated from different individuals, with or without associated dermatoses, of these two ethnic groups (15 Han and 12 Tibetan) were identified and analyzed with DNA fingerprinting using single primers specific to minisatellites. Using the Bionumerics software, we found that almost all M. furfur clinical isolates and type strains formed five distinct group clusters according to their associated skin diseases and the ethnic groups of the patients. These findings are the first to focus on the genetic diversity and relatedness of M. furfur in the Tibetan and Han ethnic groups in China and reveal genetic variation associated with related diseases, host ethnicity and geographic origin.

  17. DNA fingerprinting tags novel altered chromosomal regions and identifies the involvement of SOX5 in the progression of prostate cancer.

    Science.gov (United States)

    Ma, Stephanie; Chan, Yuen Piu; Woolcock, Bruce; Hu, Liang; Wong, Kai Yau; Ling, Ming Tat; Bainbridge, Terry; Webber, Douglas; Chan, Tim Hon Man; Guan, Xin-Yuan; Lam, Wan; Vielkind, Juergen; Chan, Kwok Wah

    2009-05-15

    Identification of genomic alterations associated with the progression of prostate cancer may facilitate the better understanding of the development of this highly variable disease. Matched normal, premalignant high-grade prostatic intraepithelial neoplasia and invasive prostate carcinoma cells were procured by laser capture microdissection (LCM) from human radical prostatectomy specimens. From these cells, comparative DNA fingerprints were generated by a modified PCR-based technique called scanning of microdissected archival lesion (SMAL)-PCR. Recurrent polymorphic fingerprint fragments were used in tagging altered chromosomal regions. Altered regions were found at cytobands 1p31.3, 1q44, 2p23.1, 3p26.3, 3q22.3, 4q22.3, 4q35.2, 5q23.2, 8q22.3, 8q24.13, 9q21.3, 9q22.32, 10q11.21, 11p13, 12p12.1, 13q12.1, 16q12.2 and 18q21.31. Candidate genes in the surrounding area that may possibly harbor mutations that change normal prostatic cells to progress into their tumor stages were proposed. Of these fragments, a 420 bp alteration, absent in all 26 normal samples screened, was observed in 2 tumors. This fragment was cloned, sequenced and localized to chromosome 12p12.1. Within this region, candidate gene sex determining region Y-box 5 (SOX5) was proposed. Further studies of SOX5 in cell lines, xenografts and human prostate specimens, at both the RNA and protein levels, found overexpression of the gene in tumors. This overexpression was then subsequently found by fluorescent in situ hybridization to be caused by amplification of the region. In conclusion, our results suggest LCM coupled with SMAL-PCR DNA fingerprinting is a useful method for the screening and identification of chromosomal regions and genes associated with cancer development. Further, overexpression of SOX5 is associated with prostate tumor progression and early development of distant metastasis. (c) 2008 Wiley-Liss, Inc.

  18. Persistent organic pollutants alter DNA methylation during human adipocyte differentiation

    NARCIS (Netherlands)

    Dungen, van den Myrthe W.; Murk, Albertinka J.; Gils-Kok, van Dieuwertje; Steegenga, Wilma T.

    2017-01-01

    Ubiquitous persistent organic pollutants (POPs) can accumulate in humans where they might influence differentiation of adipocytes. The aim of this study was to investigate whether DNA methylation is one of the underlying mechanisms by which POPs affect adipocyte differentiation, and to what

  19. Single-strand conformation polymorphism (SSCP)-based mutation scanning approaches to fingerprint sequence variation in ribosomal DNA of ascaridoid nematodes.

    Science.gov (United States)

    Zhu, X Q; Gasser, R B

    1998-06-01

    In this study, we assessed single-strand conformation polymorphism (SSCP)-based approaches for their capacity to fingerprint sequence variation in ribosomal DNA (rDNA) of ascaridoid nematodes of veterinary and/or human health significance. The second internal transcribed spacer region (ITS-2) of rDNA was utilised as the target region because it is known to provide species-specific markers for this group of parasites. ITS-2 was amplified by PCR from genomic DNA derived from individual parasites and subjected to analysis. Direct SSCP analysis of amplicons from seven taxa (Toxocara vitulorum, Toxocara cati, Toxocara canis, Toxascaris leonina, Baylisascaris procyonis, Ascaris suum and Parascaris equorum) showed that the single-strand (ss) ITS-2 patterns produced allowed their unequivocal identification to species. While no variation in SSCP patterns was detected in the ITS-2 within four species for which multiple samples were available, the method allowed the direct display of four distinct sequence types of ITS-2 among individual worms of T. cati. Comparison of SSCP/sequencing with the methods of dideoxy fingerprinting (ddF) and restriction endonuclease fingerprinting (REF) revealed that also ddF allowed the definition of the four sequence types, whereas REF displayed three of four. The findings indicate the usefulness of the SSCP-based approaches for the identification of ascaridoid nematodes to species, the direct display of sequence variation in rDNA and the detection of population variation. The ability to fingerprint microheterogeneity in ITS-2 rDNA using such approaches also has implications for studying fundamental aspects relating to mutational change in rDNA.

  20. Differentiation of Palaeogene sand by glauconitic and geochemical fingerprinting, Siri Canyon, Danish North Sea

    Energy Technology Data Exchange (ETDEWEB)

    Olivarius, M.; Knudsen, Christian; Svendsen, Johan B.

    2011-07-01

    The submarine Siri Canyon is NE-SW-oriented and located in the Danish North Sea. It contains a number of oil reservoirs with glauconite-rich sand. The reservoirs of interest in the Nini oil field are the Late Paleocene Tyr Member of the Lista Formation and the Kolga Member of the Sele Formation, presumably of Early Eocene age. These members have previously been known as the Ty and Hermod members. The sand shows signs of injection, both in cores and in seismic data. The aim of this work is to chemically characterise and fingerprint the sand in order to reveal the origin of the sand found in three horizontal wells, which could have been injected from one or both of the Tyr and Kolga members. Core samples were collected from two vertical wells of known stratigraphy to make a basis of comparison, whereas samples of the cuttings were collected from the three horizontal wells with ages primarily corresponding to the Kolga Member. The purpose was moreover to evaluate whether cuttings samples can be used for fingerprinting as an alternative to core samples. The interest in discriminating between the ages of the injected sand is the fact that the reservoir properties (porosity and permeability) are largely controlled by the original composition of the sand. Consequently, results from this study could affect the property modelling of the field. (LN)

  1. Assessing the bias linked to DNA recovery from biofiltration woodchips for microbial community investigation by fingerprinting.

    Science.gov (United States)

    Cabrol, Léa; Malhautier, Luc; Poly, Franck; Lepeuple, Anne-Sophie; Fanlo, Jean-Louis

    2010-01-01

    In this study, we explored methodological aspects of nucleic acid recovery from microbial communities involved in a gas biofilter filled with pine bark woodchips. DNA was recovered indirectly in two steps, comparing different methods: cell dispersion (crushing, shaking, and sonication) and DNA extraction (three commercial kits and a laboratory protocol). The objectives were (a) to optimize cell desorption from the packing material and (b) to compare the 12 combinations of desorption and extraction methods, according to three relevant criteria: DNA yield, DNA purity, and community structure representation by denaturing gradient gel electrophoresis (DGGE). Cell dispersion was not influenced by the operational parameters tested for shaking and blending, while it increased with time for sonication. DNA extraction by the laboratory protocol provided the highest DNA yields, whereas the best DNA purity was obtained by a commercial kit designed for DNA extraction from soil. After successful PCR amplification, the 12 methods did not generate the same bias in microbial community representation. Eight combinations led to high diversity estimation, independently of the experimental procedure. Among them, six provided highly similar DGGE profiles. Two protocols generated a significantly dissimilar community profile, with less diversity. This study highlighted the crucial importance of DNA recovery bias evaluation.

  2. DNA type analysis to differentiate strains of Xylophilus ampelinus from Europe and Hokkaido, Japan

    OpenAIRE

    Komatsu, Tsutomu; Shinmura, Akinori; Kondo, Norio

    2016-01-01

    Strains of the bacterium Xylophilus ampelinus were collected from Europe and Hokkaido, Japan. Genomic fingerprints generated from 43 strains revealed four DNA types (A-D) using the combined results of Rep-, ERIC-, and Box-PCR. Genetic variation was found among the strains examined; strains collected from Europe belonged to DNA types A or B, and strains collected from Hokkaido belonged to DNA types C or D. However, strains belonging to each DNA type showed the same pathogenicity to grapevines ...

  3. Characterization of Pediococcus acidilactici strains isolated from rainbow trout (Oncorhynchus mykiss) feed and larvae: safety, DNA fingerprinting, and bacteriocinogenicity.

    Science.gov (United States)

    Araújo, Carlos; Muñoz-Atienza, Estefanía; Poeta, Patrícia; Igrejas, Gilberto; Hernández, Pablo E; Herranz, Carmen; Cintas, Luis M

    2016-05-03

    The use of lactic acid bacteria (LAB) as probiotics constitutes an alternative or complementary strategy to chemotherapy and vaccination for disease control in aquaculture. The objectives of this work were (1) the in vitro safety assessment of 8 Pediococcus acidilactici strains isolated from rainbow trout (Oncorhynchus mykiss, Walbaum) feed and larvae; (2) the evaluation of their genetic relatedness; (3) the study of their antimicrobial/bacteriocin activity against fish pathogens; and (4) the biochemical and genetic characterization of the bacteriocin produced by the strain displaying the greatest antimicrobial activity. Concerning the safety assessment, none of the pediococci showed antibiotic resistance nor produced hemolysin or gelatinase, degraded gastric mucin, or deconjugated bile salts. Four strains (50%) produced tyramine or putrescine, but the corresponding genes were not amplified by PCR. Enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR) fingerprinting allowed clustering of the pediococci into 2 well-defined groups (68% similarity). From the 8 pediococci displaying direct antimicrobial activity against at least 3 out of 9 fish pathogens, 6 strains (75%) were identified as bacteriocin producers. The bacteriocin produced by P. acidilactici L-14 was purified, and mass spectrometry and DNA sequencing revealed its identity to pediocin PA-1 (PedPA-1). Altogether, our results allowed the identification of 4 (50%) putatively safe pediococci, including 2 bacteriocinogenic strains. ERIC-PCR fingerprinting was a valuable tool for genetic profiling of P. acidilactici strains. This work reports for the first time the characterization of a PedPA-1-producing P. acidilactici strain isolated from an aquatic environment (rainbow trout larvae), which shows interesting properties related to its potential use as a probiotic in aquaculture.

  4. DNA Fingerprinting Abnormalities Can Distinguish Ulcerative Colitis Patients with Dysplasia and Cancer from Those Who Are Dysplasia/Cancer-Free

    Science.gov (United States)

    Chen, Ru; Rabinovitch, Peter S.; Crispin, David A.; Emond, Mary J.; Koprowicz, Kent M.; Bronner, Mary P.; Brentnall, Teresa A.

    2003-01-01

    Patients with extensive ulcerative colitis (UC) of longer than 8 years duration are at high risk for the development of colorectal cancer. The cancers in these patients appear to develop in a stepwise manner with progressive histological changes from negative for dysplasia → indefinite for dysplasia → dysplasia → cancer. The aim of this study was to determine the timing and extent of genomic instability in the progression of UC dysplasia and cancer. Using two polymerase chain reaction (PCR)-based DNA fingerprinting methods, arbitrarily primed PCR and intersimple sequence repeat PCR, we assessed DNA sequence variation in biopsies across the spectrum of cancerous, dysplastic, and nondysplastic mucosa. UC patients with dysplasia/cancer had substantial genomic instability in both their dysplastic and nondysplastic colonic mucosa, whereas instability was not present in the majority of UC patients without dysplasia/cancer. The degree of instability in nondysplastic tissue was similar to that of dysplastic/cancerous mucosa from the same patient, suggesting that this instability was widespread and reached the maximum level early in neoplastic progression. These results suggest that UC patients who develop dysplasia or cancer have an underlying process of genomic instability in their colonic mucosa whereas UC patients who are dysplasia-free do not. PMID:12547724

  5. Comparison of chickpea rhizobia isolates from diverse Portuguese natural populations based on symbiotic effectiveness and DNA fingerprint.

    Science.gov (United States)

    Laranjo, M; Branco, C; Soares, R; Alho, L; Carvalho, M D E; Oliveira, S

    2002-01-01

    To test the hypothesis that differences in chickpea yields obtained in four distinct Portuguese regions (Beja, Elvas-Casas Velhas, Elvas-Estação Nacional de Melhoramento de Plantas (ENMP) and Evora) could be due to variation between the natural rhizobia populations. Estimation of the size of the different rhizobial populations showed that Elvas-ENMP population was the largest one. Elvas-ENMP population also revealed a higher proportion of isolates carrying more than one plasmid. Assessment of genetic diversity of the native rhizobia populations by a DNA fingerprinting PCR method, here designated as DAPD (Direct Amplified Polymorphic DNA), showed a higher degree of variation in Elvas-ENMP and Beja populations. The symbiotic effectiveness (SE) of 39 isolates was determined and ranged 13-34%. Statistical analysis showed that SE was negatively correlated with plasmid number of the isolate. The largest indigenous rhizobia population was found in Elvas-ENMP. DAPD pattern and plasmid profile analysis both suggested a higher genetic diversity among the populations of Elvas-ENMP and Beja. No relationship was found between SE of the isolates and their origin site. The large native population, rather than the symbiotic performance of individual rhizobia, could contribute to the higher chickpea yields obtained in Elvas-ENMP.

  6. Social Fingerprinting: detection of spambot groups through DNA-inspired behavioral modeling

    DEFF Research Database (Denmark)

    Cresci, Stefano; Di Pietro, Roberto; Petrocchi, Marinella

    2017-01-01

    Spambot detection in online social networks is a long-lasting challenge involving the study and design of detection techniques capable of efficiently identifying ever-evolving spammers. Recently, a new wave of social spambots has emerged, with advanced human-like characteristics that allow them...... to go undetected even by current state-of-the-art algorithms. In this paper, we show that efficient spambots detection can be achieved via an in-depth analysis of their collective behaviors exploiting the digital DNA technique for modeling the behaviors of social network users. Inspired by its...... biological counterpart, in the digital DNA representation the behavioral lifetime of a digital account is encoded in a sequence of characters. Then, we define a similarity measure for such digital DNA sequences. We build upon digital DNA and the similarity between groups of users to characterize both genuine...

  7. Development of Gene Expression Fingerprints for Identification of Environmental Contaminants Using cDNA Arrays

    National Research Council Canada - National Science Library

    Inouye, L

    2004-01-01

    ...) to develop cDNA array-based assays that map gene expression from contaminant exposures. Results substantiate that distinct gene expression profiles exist for major contaminant classes such as PARs, PCBs, and PCDD/Fs...

  8. Anonymous letters? DNA and fingerprints technologies combined to solve a case.

    Science.gov (United States)

    Barbaro, A; Cormaci, P; Teatino, A; La Marca, A; Barbaro, A

    2004-12-02

    Two brothers, living in two different cities, received two different anonymous letters. We performed latent prints development and DNA research on the letters and also on a glass used by a cousin suspected to be the letters' sender.

  9. Molecular characterisation of Colombian yam germplasm by "DNA amplification fingerprinting (DAF" in radioactivo conditions Caracterización molecular del germoplasma de ñame colombiano utilizando "DNA Amplificaron Fingerprinting (DAF" en condiciones radiactivas

    Directory of Open Access Journals (Sweden)

    Bustamante Silvia L.

    2003-12-01

    Full Text Available Samples from the Universidad de Córdoba's yam collection (Dioscorea spp. and others originating from IITA (International Institute of Tropical Agriculture, Ibadan, Nigeria were molecularly characterised to complement existing information about them. The yam (Diosocorea spp. represents a basic crop for small-scale farmers on the Colombian Atlantic Coast who sow around 20,000 hectares per year. Even though they are dioecious species, only one sex is represented in Colombia; it must also be stated that climatic conditions are not propitious for its flowering. This situation has caused difficulty for work in yam breeding. The yam species and varieties used in the Colombian ABP (Agricultural Biotechnology Programme have been molecularly characterised by AFLPs in a previous publication describing a preliminary study emerging from the need to broaden the characterisation of those accessions kept at the Universidad de Córdoba. Comparisons have also been done with some African accessions donated by IITA. In this article, samples were molecularly characterised by another fingerprinting technique, the DAF technique (DNA Amplification Fingerprinting based on PCR, using random oligonucleotides for generating characteristic band patterns from each individual. The results showed 0.0413 population diversity with 0.9587 average similarity, indicating that the yam collection studied had very little genetic diversity and, probably, this could be why the crop is vulnerable to plagues and diseases, as happened at the end of the 1980s when anthracnose practically devastated the crop on the Colombian Atlantic coast. Similarity was also found between those Colombian and African samples analysed, agreeing with low diversity and less distance between common ancestors. The molecular results suggest the need for using other molecular techniques having a greater power of discrimination and also the need to broaden the genetic diversity in yam crops for providing greater

  10. DNA fingerprinting and new tools for fine-scale discrimination of Arabidopsis thaliana accessions.

    Science.gov (United States)

    Simon, Matthieu; Simon, Adeline; Martins, Fréderic; Botran, Lucy; Tisné, Sébastien; Granier, Fabienne; Loudet, Olivier; Camilleri, Christine

    2012-03-01

    One of the main strengths of Arabidopsis thaliana as a model species is the impressive number of public resources available to the scientific community. Exploring species genetic diversity--and therefore adaptation--relies on collections of individuals from natural populations taken from diverse environments. Nevertheless, due to a few mislabeling events or genotype mixtures, some variants available in stock centers have been misidentified, causing inconsistencies and limiting the potential of genetic analyses. To improve the identification of natural accessions, we genotyped 1311 seed stocks from our Versailles Arabidopsis Stock Center and from other collections to determine their molecular profiles at 341 single nucleotide polymorphism markers. These profiles were used to compare genotypes at both the intra- and inter-accession levels. We confirmed previously described inconsistencies and revealed new ones, and suggest likely identities for accessions whose lineage had been lost. We also developed two new tools: a minimal fingerprint computation to quickly verify the identity of an accession, and an optimized marker set to assist in the identification of unknown or mixed accessions. These tools are available on a dedicated web interface called ANATool (https://www.versailles.inra.fr/ijpb/crb/anatool) that provides a simple and efficient means to verify or determine the identity of A. thaliana accessions in any laboratory, without the need for any specific or expensive technology. © 2011 The Authors. The Plant Journal © 2011 Blackwell Publishing Ltd.

  11. VNTR fingerprinting of Kluyveromyces marxianus strains WT, 7-1, and 8-1 by using different primer types to give best results in PCR and on electrophorese gel in order to find differentiation of the DNA of the yeast strains.

    Science.gov (United States)

    Using mutagenized Kluyveromyces marxianus strains (WT, 7-1, 8-1) we wish to find out the variable numbered tandem repeats (VNTR) of each of the DNA strains from the different mutagenized K. marxianus strains. To do this we used Phusion HF Buffer Pack to try and give a clear picture of the VNTR by u...

  12. DNA fingerprinting secondary transfer from different skin areas: Morphological and genetic studies.

    Science.gov (United States)

    Zoppis, Silvia; Muciaccia, Barbara; D'Alessio, Alessio; Ziparo, Elio; Vecchiotti, Carla; Filippini, Antonio

    2014-07-01

    The correct identification of the biological samples under analysis is crucial in forensic investigation in that it represents the pivotal issue attesting that the resulting genetic profiles are fully reliable in terms of weight of the evidence. The study reported herein shows that "touch DNA" secondary transfer is indeed possible from person to person and, in turn, from person to object depending on the specific sebaceous or non-sebaceous skin area previously touched. In addition, we demonstrate the presence of fragmented single stranded DNA specifically immunodetected in the vast majority of cells forming the sebaceous gland but not in the epidermis layers, strongly indicating that sebaceous fluid represents an important vector responsible for DNA transfer. In view of our results, forensic investigations need to take into account that the propensity to leave behind genetic material through contact could depend from the individual ability to shed sebaceous fluid on the skin surface. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  13. Characterization and Differentiation of Petroleum-Derived Products by E-Nose Fingerprints

    Directory of Open Access Journals (Sweden)

    Marta Ferreiro-González

    2017-11-01

    Full Text Available Characterization of petroleum-derived products is an area of continuing importance in environmental science, mainly related to fuel spills. In this study, a non-separative analytical method based on E-Nose (Electronic Nose is presented as a rapid alternative for the characterization of several different petroleum-derived products including gasoline, diesel, aromatic solvents, and ethanol samples, which were poured onto different surfaces (wood, cork, and cotton. The working conditions about the headspace generation were 145 °C and 10 min. Mass spectroscopic data (45–200 m/z combined with chemometric tools such as hierarchical cluster analysis (HCA, later principal component analysis (PCA, and finally linear discriminant analysis (LDA allowed for a full discrimination of the samples. A characteristic fingerprint for each product can be used for discrimination or identification. The E-Nose can be considered as a green technique, and it is rapid and easy to use in routine analysis, thus providing a good alternative to currently used methods.

  14. Differentiation of Chinese rice wines from different wineries based on mineral elemental fingerprinting.

    Science.gov (United States)

    Shen, Fei; Wu, Jian; Ying, Yibin; Li, Bobin; Jiang, Tao

    2013-12-15

    Discrimination of Chinese rice wines from three well-known wineries ("Guyuelongshan", "Kuaijishan", and "Pagoda") in China has been carried out according to mineral element contents in this study. Nineteen macro and trace mineral elements (Na, Mg, Al, K, Ca, Mn, Fe, Cu, Zn, V, Cr, Co, Ni, As, Se, Mo, Cd, Ba and Pb) were determined by inductively coupled plasma mass spectrometry (ICP-MS) in 117 samples. Then the experimental data were subjected to analysis of variance (ANOVA) and principal component analysis (PCA) to reveal significant differences and potential patterns between samples. Stepwise linear discriminant analysis (LDA) and partial least square discriminant analysis (PLS-DA) were applied to develop classification models and achieved correct classified rates of 100% and 97.4% for the prediction sample set, respectively. The discrimination could be attributed to different raw materials (mainly water) and elaboration processes employed. The results indicate that the element compositions combined with multivariate analysis can be used as fingerprinting techniques to protect prestigious wineries and enable the authenticity of Chinese rice wine. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. Fingerprinting of near-homogeneous DNA ligase I and II from human cells. Similarity of their AMP-binding domains.

    Science.gov (United States)

    Yang, S W; Becker, F F; Chan, J Y

    1990-10-25

    DNA ligases play obligatory roles during replication, repair, and recombination. Multiple forms of DNA ligase have been reported in mammalian cells including DNA ligase I, the high molecular mass species which functions during replication, and DNA ligase II, the low molecular mass species which is associated with repair. In addition, alterations in DNA ligase activities have been reported in acute lymphocytic leukemia cells, Bloom's syndrome cells, and cells undergoing differentiation and development. To better distinguish the biochemical and molecular properties of the various DNA ligases from human cells, we have developed a method of purifying multiple species of DNA ligase from HeLa cells by chromatography through DEAE-Bio-Gel, CM-Bio-Gel, hydroxylapatite, Sephacryl S-300, Mono P, and DNA-cellulose. DNA-cellulose chromatography of the partially purified enzymes resolved multiple species of DNA ligase after labeling the enzyme with [alpha-32P]ATP to form the ligase-[32P]AMP adduct. The early eluting enzyme activity (0.25 M NaCl) contained a major 67-kDa-labeled protein, while the late eluting activity (0.48 M NaCl) contained two major labeled proteins of 90 and 78 kDa. Neutralization experiments with antiligase I antibodies indicated that the early and late eluting activity peaks were DNA ligase II and I, respectively. The three major ligase-[32P]AMP polypeptides (90, 78, and 67 kDa) were subsequently purified to near homogeneity by elution from preparative sodium dodecyl sulfate-polyacrylamide gels. All three polypeptides retained DNA ligase activities after gel elution and renaturation. To further reveal the relationship between these enzymes, partial digestion by V8-protease was performed. All three purified polypeptides gave rise to a common 22-kDa-labeled fragment for their AMP-binding domains, indicating that the catalytic sites of ligase I and II are quite similar, if not identical. Similar findings were obtained from the two-dimensional gel

  16. DNA Fingerprinting of Lactobacillus crispatus Strain CTV-05 by Repetitive Element Sequence-Based PCR Analysis in a Pilot Study of Vaginal Colonization

    OpenAIRE

    Antonio, May A. D.; Hillier, Sharon L.

    2003-01-01

    Lactobacillus crispatus is one of the predominant hydrogen peroxide (H2O2)-producing species found in the vagina and is under development as a probiotic for the treatment of bacterial vaginosis. In this study, we assessed whether DNA fingerprinting by repetitive element sequence-based PCR (rep-PCR) can be used to distinguish the capsule strain of L. crispatus (CTV-05) from other endogenous strains as well as other species of vaginal lactobacilli. Vaginal and rectal lactobacilli were identifie...

  17. Molecular typing of Borrelia burgdorferi sensu lato by randomly amplified polymorphic DNA fingerprinting analysis

    NARCIS (Netherlands)

    Wang, G.; van Dam, A. P.; Spanjaard, L.; Dankert, J.

    1998-01-01

    To study whether pathogenic clusters of Borrelia burgdorferi sensu lato strains occur, we typed 136 isolates, cultured from specimens from patients (n = 49) with various clinical entities and from ticks (n = 83) or dogs (n = 4) from different geographic regions, by randomly amplified polymorphic DNA

  18. Epidemiologic Investigation of Riemerella anatipestifer in a Commercial Duck Company by Serotyping and DNA Fingerprinting

    Science.gov (United States)

    A commercial duck company that raises approximately two million Pekin ducks per year experienced an outbreak of Riemerella anatipestifer(RA)on nine farms over a one year period. Due to concerns that the bacteria was being spread from farm to farm, an investigation using serotyping and DNA fingerprin...

  19. Evidence of transmission of Mycobacterium tuberculosis by random amplified polymorphic DNA (RAPD) fingerprinting in Taipei City, Taiwan.

    Science.gov (United States)

    Harn, H J; Shen, K L; Ho, L I; Yu, K W; Liu, G C; Yueh, K C; Lee, J H

    1997-01-01

    AIMS: To determine, by strain identification of Mycobacterium tuberculosis, whether transmission has occurred between individuals or whether new strains are present. METHODS: A rapid protocol for random amplified polymorphic DNA (RAPD) analysis was developed. This protocol was applied to 64 strains of M tuberculosis that had been confirmed by culture and microbiological methods. RESULTS: There are five groups of M tuberculosis prevalent in Taipei city, Taiwan. The major types are groups I and III. Groups I and II had been prevalent until the end of last year when, according to our group analysis, they had been eradicated. However, group III was continuously present from the middle of 1995 to the middle of 1996, and group IV was present at the end of both years, which indicated that both groups were transmitted continuously. These clustered strains had demographic characteristics consistent with a finding of transmission tuberculosis. Also, there were 13 of 64 strains with unique RAPD fingerprints that were inferred to be due primarily to the reactivation of infection. In the drug resistance analysis, the major type represented included group III and part of group IV. CONCLUSIONS: Our preliminary data imply, not only that the prevalence of M tuberculosis in Taipei city is due to transmission rather than reactivation, but that drug resistance also may play a role in tuberculosis transmission. Images PMID:9378819

  20. Potential of Start Codon Targeted (SCoT) markers for DNA fingerprinting of newly synthesized tritordeums and their respective parents.

    Science.gov (United States)

    Cabo, Sandra; Ferreira, Luciana; Carvalho, Ana; Martins-Lopes, Paula; Martín, António; Lima-Brito, José Eduardo

    2014-08-01

    Hexaploid tritordeum (H(ch)H(ch)AABB; 2n = 42) results from the cross between Hordeum chilense (H(ch)H(ch); 2n = 14) and cultivated durum wheat (Triticum turgidum ssp. durum (AABB; 2n = 28). Morphologically, tritordeum resembles the wheat parent, showing promise for agriculture and wheat breeding. Start Codon Targeted (SCoT) polymorphism is a recently developed technique that generates gene-targeted markers. Thus, we considered it interesting to evaluate its potential for the DNA fingerprinting of newly synthesized hexaploid tritordeums and their respective parents. In this study, 60 SCoT primers were tested, and 18 and 19 of them revealed SCoT polymorphisms in the newly synthesized tritordeum lines HT27 and HT22, respectively, and their parents. An analysis of the presence/absence of bands among tritordeums and their parents revealed three types of polymorphic markers: (i) shared by tritordeums and one of their parents, (ii) exclusively amplified in tritordeums, and (iii) exclusively amplified in the parents. No polymorphism was detected among individuals of each parental species. Three SCoT markers were exclusively amplified in tritordeums of lines HT22 and HT27, being considered as polyploidization-induced rearrangements. About 70% of the SCoT markers of H. chilense origin were not transmitted to the allopolyploids of both lines, and most of the SCoTs scored in the newly synthesized allopolyploids originated from wheat, reinforcing the potential use of tritordeum as an alternative crop.

  1. DNA methylation fingerprint of neuroblastoma reveals new biological and clinical insights

    Directory of Open Access Journals (Sweden)

    Soledad Gómez

    2015-09-01

    We have analyzed the DNA methylome of neuroblastoma using high-density microarrays (Infinium Human Methylation 450k BeadChip to define the epigenetic landscape of this pediatric tumor and its potential clinicopathological impact. Here, we provide the detail of methods and quality control parameters of the microarray data used for the study. Methylation data has been deposited at NCBI Gene Expression Omnibus data repository, accession number GSE54719; superseries record GSE54721.

  2. Detecting differential DNA methylation from sequencing of bisulfite converted DNA of diverse species.

    Science.gov (United States)

    Huh, Iksoo; Wu, Xin; Park, Taesung; Yi, Soojin V

    2017-07-21

    DNA methylation is one of the most extensively studied epigenetic modifications of genomic DNA. In recent years, sequencing of bisulfite-converted DNA, particularly via next-generation sequencing technologies, has become a widely popular method to study DNA methylation. This method can be readily applied to a variety of species, dramatically expanding the scope of DNA methylation studies beyond the traditionally studied human and mouse systems. In parallel to the increasing wealth of genomic methylation profiles, many statistical tools have been developed to detect differentially methylated loci (DMLs) or differentially methylated regions (DMRs) between biological conditions. We discuss and summarize several key properties of currently available tools to detect DMLs and DMRs from sequencing of bisulfite-converted DNA. However, the majority of the statistical tools developed for DML/DMR analyses have been validated using only mammalian data sets, and less priority has been placed on the analyses of invertebrate or plant DNA methylation data. We demonstrate that genomic methylation profiles of non-mammalian species are often highly distinct from those of mammalian species using examples of honey bees and humans. We then discuss how such differences in data properties may affect statistical analyses. Based on these differences, we provide three specific recommendations to improve the power and accuracy of DML and DMR analyses of invertebrate data when using currently available statistical tools. These considerations should facilitate systematic and robust analyses of DNA methylation from diverse species, thus advancing our understanding of DNA methylation. © The Author 2017. Published by Oxford University Press.

  3. DNA fingerprinting and anastomosis grouping reveal similar genetic diversity in Rhizoctonia species infecting turfgrasses in the transition zone of USA.

    Science.gov (United States)

    Amaradasa, B S; Horvath, B J; Lakshman, D K; Warnke, S E

    2013-01-01

    Rhizoctonia blight is a common and serious disease of many turfgrass species. The most widespread causal agent, Thanatephorus cucumeris (anamorph: R. solani), consists of several genetically different subpopulations. In addition, Waitea circinata varieties zeae, oryzae and circinata (anamorph: Rhizoctonia spp.) also can cause the disease. Accurate identification of the causal pathogen is important for effective management of the disease. It is challenging to distinguish the specific causal pathogen based on disease symptoms or macroscopic and microscopic morphology. Traditional methods such as anastomosis reactions with tester isolates are time consuming and sometimes difficult to interpret. In the present study universally primed PCR (UP-PCR) fingerprinting was used to assess genetic diversity of Rhizoctonia spp. infecting turfgrasses. Eighty-four Rhizoctonia isolates were sampled from diseased turfgrass leaves from seven distinct geographic areas in Virginia and Maryland. Rhizoctonia isolates were characterized by ribosomal DNA internal transcribed spacer (rDNA-ITS) region and UP-PCR. The isolates formed seven clusters based on ITS sequences analysis and unweighted pair group method with arithmetic mean (UPGMA) clustering of UP-PCR markers, which corresponded well with anastomosis groups (AGs) of the isolates. Isolates of R. solani AG 1-IB (n = 18), AG 2-2IIIB (n = 30) and AG 5 (n = 1) clustered separately. Waitea circinata var. zeae (n = 9) and var. circinata (n = 4) grouped separately. A cluster of six isolates of Waitea (UWC) did not fall into any known Waitea variety. The binucleate Rhizoctonia-like fungi (BNR) (n = 16) clustered into two groups. Rhizoctonia solani AG 2-2IIIB was the most dominant pathogen in this study, followed by AG 1-IB. There was no relationship between the geographic origin of the isolates and clustering of isolates based on the genetic associations. To our knowledge this is the first time UP-PCR was used to characterize Rhizoctonia

  4. DNA fingerprinting of Mycobacterium leprae strains using variable number tandem repeat (VNTR) - fragment length analysis (FLA).

    Science.gov (United States)

    Jensen, Ronald W; Rivest, Jason; Li, Wei; Vissa, Varalakshmi

    2011-07-15

    The study of the transmission of leprosy is particularly difficult since the causative agent, Mycobacterium leprae, cannot be cultured in the laboratory. The only sources of the bacteria are leprosy patients, and experimentally infected armadillos and nude mice. Thus, many of the methods used in modern epidemiology are not available for the study of leprosy. Despite an extensive global drug treatment program for leprosy implemented by the WHO, leprosy remains endemic in many countries with approximately 250,000 new cases each year. The entire M. leprae genome has been mapped and many loci have been identified that have repeated segments of 2 or more base pairs (called micro- and minisatellites). Clinical strains of M. leprae may vary in the number of tandem repeated segments (short tandem repeats, STR) at many of these loci. Variable number tandem repeat (VNTR) analysis has been used to distinguish different strains of the leprosy bacilli. Some of the loci appear to be more stable than others, showing less variation in repeat numbers, while others seem to change more rapidly, sometimes in the same patient. While the variability of certain VNTRs has brought up questions regarding their suitability for strain typing, the emerging data suggest that analyzing multiple loci, which are diverse in their stability, can be used as a valuable epidemiological tool. Multiple locus VNTR analysis (MLVA) has been used to study leprosy evolution and transmission in several countries including China, Malawi, the Philippines, and Brazil. MLVA involves multiple steps. First, bacterial DNA is extracted along with host tissue DNA from clinical biopsies or slit skin smears (SSS). The desired loci are then amplified from the extracted DNA via polymerase chain reaction (PCR). Fluorescently-labeled primers for 4-5 different loci are used per reaction, with 18 loci being amplified in a total of four reactions. The PCR products may be subjected to agarose gel electrophoresis to verify the

  5. Fingerprinting DNA oxidation processes: IR characterization of the 5-methyl-2'-deoxycytidine radical cation.

    Science.gov (United States)

    Bucher, Dominik B; Pilles, Bert M; Pfaffeneder, Toni; Carell, Thomas; Zinth, Wolfgang

    2014-02-24

    Methylated cytidine plays an important role as an epigenetic signal in gene regulation. Its oxidation products are assumed to be involved in active demethylation processes but also in damaging DNA. Here, we report the photochemical production of the 5-methyl-2'-deoxycytidine radical cation via a two-photon ionization process. The radical cation is detected by time-resolved IR spectroscopy and identified by band assignment using density functional theory calculations. Two final oxidation products are characterized with liquid chromatography coupled to mass spectrometry. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Molecular characterization of Anthurium genotypes by using DNA fingerprinting and SPAR markers.

    Science.gov (United States)

    Souza Neto, J D; Soares, T C B; Motta, L B; Cabral, P D S; Silva, J A

    2014-07-02

    We characterized single primer amplification reaction (SPAR) molecular markers from 20 genotypes of Anthurium andraeanum Lind., including 3 from commercial varieties and 17 from 2 communities in the State of Espírito Santo, Brazil. Twenty-four SPAR, consisting of 7 random amplified polymorphic DNA and 17 inter-simple sequence repeat markers were used to estimate the genetic diversity of 20 Anthurium accessions. The set of SPAR markers generated 288 bands and showed an average polymorphism percentage of 93.39%, ranging from 71.43 to 100%. The polymorphism information content (PIC) of the random amplified polymorphic DNA primers averaged 0.364 and ranged from 0.258 to 0.490. Primer OPF 06 showed the lowest PIC, while OPAM 14 was the highest. The average PIC of the inter-simple sequence repeat primers was 0.299, with values ranging from 0.196 to 0.401. Primer UBC 845 had the lowest PIC (0.196), while primer UCB 810 had the highest (0.401). By using the complement of Jaccard's similarity index and unweighted pair group method with arithmetic mean clustering, 5 clusters were formed with a cophenetic correlation coefficient of 0.8093, indicating an acceptable clustering consistency. However, no genotype clustering patterns agreed with the morphological data. The Anthurium genotypes investigated in this study are a germplasm source for conservational research and may be used in improvement programs for this species.

  7. Stock characterization and improvement: DNA fingerprinting and cold tolerance of Populus and Salix clones

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Dolly; Hubbes, M.; Zsuffa, L. [Toronto Univ., ON (Canada). Faculty of Forestry; Tsarouhas, V.; Gullberg, U. [Swedish Univ. of Agricultural Sciences, Uppsala (Sweden). Dept. of Forest Genetics; Howe, G.; Hackett, W.; Gardner, G.; Furnier, G. [Minnesota Univ., St. Paul, MN (United States). Dept. of Forest Resources; Tuskan, G. [Oak Ridge National Lab., TN (United States)

    1998-12-31

    Molecular characterization of advanced-generation pedigrees and evaluation of cold tolerance are two aspects of Populus and Salix genetic improvement programmes worldwide that have traditionally received little emphasis. As such, chloroplast DNA markers were tested as a means of determining multi-generation parental contributions to hybrid progeny. Likewise, greenhouse, growth chamber and field studies were used to assess cold tolerance in Populus and Salix. Chloroplast DNA markers did not reveal size polymorphisms among four tested Populus species, but did produce sequence polymorphisms between P. maximowiczii and P. trichocarpa. Additional crosses between multiple genotypes from each species are being used to evaluate the utility of the detected polymorphism for ascertaining parentage within interspecific crosses. Short-day, cold tolerance greenhouse studies revealed that bud set date and frost damage are moderately heritable and genetically correlated in Populus. The relationship between greenhouse and field studies suggests that factors other than short days contribute to cold tolerance in Populus. In Salix, response to artificial fall conditioning varied among full-sibling families, with the fastest growing family displaying the greatest amount of cold tolerance 26 refs, 3 tabs

  8. 45,X product of conception after preimplantation genetic diagnosis and euploid embryo transfer: evidence of a spontaneous conception confirmed by DNA fingerprinting.

    Science.gov (United States)

    Bettio, Daniela; Capalbo, Antonio; Albani, Elena; Rienzi, Laura; Achille, Valentina; Venci, Anna; Ubaldi, Filippo Maria; Levi Setti, Paolo Emanuele

    2016-09-06

    Preimplantation genetic screening (PGS) provides an opportunity to eliminate a potential implantation failure due to aneuploidy in infertile couples. Some studies clearly show that twins following single embryo transfer (SET) can be the result of a concurrent natural conception and an incidence as high as 1 in 5 twins has been reported. In our case PGS was performed on trophectoderm (TE) biopsies by quantitative polymerase chain reaction (qPCR). The product of conception (POC) was cytogenetically investigated after selection of the placental villi by means of the direct method. Molecular cytogenetic characterization of the POC was performed by fluorescence in situ hybridization (FISH) and array-comparative genomic hybridization (a-CGH) analyses. To investigate the possibility of a spontaneous conception, a panel of 40 single nucleotide polymorphisms (SNPs) was used to compare genetic similarity between the DNA of the POC and the DNA leftover of the TE biopsy. We describe a 36-year old infertile woman undergoing PGS who had a spontaneous abortion after a single euploid embryo transfer on a spontaneous cycle. The POC showed a 45,X karyotype confirmed by FISH and a-CGH. DNA fingerprinting demonstrated a genetic similarity of 75 % between the DNA of the POC and TE biopsy, consistent with a sibling status. All supernumerary euploid embryos were also tested showing a non-self relationship with the POC, excluding a mix-up event at the time of fetal embryo transfer. DNA fingerprinting of the transferred blastocyst and POC, confirmed the occurrence of a spontaneous conception. This case challenges the assumption that a pregnancy after assisted reproductive technology (ART) is always a result of ART, and strengthens the importance to avoid intercourses during PGS and natural transfer cycles. Moreover, cytogenetic analysis of the POCs is strongly recommended along with fingerprinting children born after PGS to see what the concordance is between the embryo transferred and

  9. DNA Fingerprinting to monitor grizzly bear populations in the Greater Glacier Area

    Science.gov (United States)

    Kendall, Katherine; Dave, Schirokauer; Peterson, Kris; Waits, Lisette P.

    2001-01-01

    A study area of 8,100 km² (2 million acres) was established where 126 8 x 8 km (64 km²) grid cells were identified for placement of traps. Trapping was carried out during five 2- week trap sessions. Some 620 hair traps were placed in the field; samples were retrieved between May 19th and August 12th, 1998. Approximately 7,200 hair samples were collected that year. Hair was found at 80% of the traps where the average number of hair samples per trap site was 14. Forty percent of the samples had 5 or more hair follicles. Preliminary results of sampling indicate that DNA was extracted from 90-100% of the hair samples (N=300). Eight hundred miles of trail were surveyed between June 1 and October 9. Thirteen hundred hair samples were collected from rub trees along trails. Seven hundred scat samples were collected from trails.

  10. Olive oil DNA fingerprinting by multiplex SNP genotyping on fluorescent microspheres.

    Science.gov (United States)

    Kalogianni, Despina P; Bazakos, Christos; Boutsika, Lemonia M; Targem, Mehdi Ben; Christopoulos, Theodore K; Kalaitzis, Panagiotis; Ioannou, Penelope C

    2015-04-01

    Olive oil cultivar verification is of primary importance for the competitiveness of the product and the protection of consumers and producers from fraudulence. Single-nucleotide polymorphisms (SNPs) have emerged as excellent DNA markers for authenticity testing. This paper reports the first multiplex SNP genotyping assay for olive oil cultivar identification that is performed on a suspension of fluorescence-encoded microspheres. Up to 100 sets of microspheres, with unique "fluorescence signatures", are available. Allele discrimination was accomplished by primer extension reaction. The reaction products were captured via hybridization on the microspheres and analyzed, within seconds, by a flow cytometer. The "fluorescence signature" of each microsphere is assigned to a specific allele, whereas the signal from a reporter fluorophore denotes the presence of the allele. As a model, a panel of three SNPs was chosen that enabled identification of five common Greek olive cultivars (Adramytini, Chondrolia Chalkidikis, Kalamon, Koroneiki, and Valanolia).

  11. Optimization Of ISSR Markers For DNA Fingerprinting In Stevia Rebaudiana Bertoni

    International Nuclear Information System (INIS)

    Lyena Watty Zuraine Ahmad; Lyena Watty Zuraine Ahmad; Azhar Mohamad; Mohamad Osman; Zarina Zainuddin; Fatin Izzati Mohd Khari

    2014-01-01

    ISSR or inter-simple sequence repeat is PCR based markers which required no prior DNA sequence knowledge of the studied organism. It has been proved to overcome limitations in other genetic marker techniques. In this study, 100 ISSR primers which comprised of 80 specific primers and 20 degenerate primers were used. All of the primers were tested on gradient temperatures from 45-55 degree Celsius. For positive amplification, 62 specific primers (77.5 %) and 18 degenerate primers (90.0 %) were recorded as working primers. The most efficient temperature for 25 primers was 55 degree Celsius. Marker derived from ISSR profiling is a powerful approach for identification and molecular classification of Stevia rebaudiana bertoni. (author)

  12. Agro-ecological variations of sheath rot disease of rice caused by Sarocladium oryzae and DNA fingerprinting of the pathogen's population structure.

    Science.gov (United States)

    Tajul Islam Chowdhury, M; Salim Mian, M; Taher Mia, M A; Rafii, M Y; Latif, M A

    2015-12-28

    To examine the impact of regional and seasonal variations on the incidence and severity of sheath rot, a major seed-borne disease of rice caused by Sarocladium oryzae, data on incidence and severity were collected from 27 selected fields in the Gazipur, Rangpur, Bogra, Chittagong, Comilla, Gopalgonj, Jessore, Manikgonj, and Bhola districts of Bangladesh in rain-fed and irrigated conditions. Cultural variability of 29 pathogen isolates obtained from 8 different locations was studied on potato dextrose agar (PDA) and genetic variability was determined by DNA fingerprinting using variable number tandem repeat-polymerase chain reaction markers. Overall, disease incidence and severity were higher in irrigated rice. Disease incidence and severity were highest in the Bhola district in rain-fed rice and lowest in irrigated rice. Mycelial growth of 29 representative isolates was found to vary on PDA and the isolates were divided into 6 groups. The range of the overall size of conidia of the selected isolates was 2.40-7.20 x 1.20-2.40 μm. Analysis of the DNA fingerprint types of the 29 isolates of S. oryzae, obtained from the amplification reactions, revealed 10 fingerprinting types (FPTs) that were 80% similar. FPT-1 was the largest group and included 13 isolates (44.8%), while FPT-2 was the third largest group and included 3 isolates. Each of FPT-3, 4, 5, and 6 included only 1 isolate. We observed no relationship between cultural and genetic groupings.

  13. [Analysis of diversity of vaginal microbiota in healthy Chinese women by using DNA-fingerprinting].

    Science.gov (United States)

    Xiao, Bing-bing; Liao, Qin-ping

    2012-04-18

    To analyze the diversity of healthy women's vaginal dominant flora in different physiological states with PCR-denaturing gradient gel electrophoresis (PCR-DGGE), to establish the basis for the future study of lower genital tract infections, and to provide a theoretical basis for the development of vaginal probiotics adapted to Chinese females. Women who underwent routine gynecologic examinations in Peking University First Hospital from October 2009 to January 2010 were enrolled, including 30 at reproductive age and 30 at post menopause age. Vaginal samples were collected and then total bacterial DNA was extracted. Universal bacterial primers were used to amplify the V3 region of 16S rDNA gene. PCR products were analyzed by denatured gradient gel electrophoresis (DGGE). Featured bands on DGGE were recovered, cloned and sequenced. Alignment with known sequence was made by using Blast on GenBank to identify bacterial strains so as to analyze the diversity of healthy women's vaginal dominant flora in different physiological states. (1) Vaginal flora in healthy Chinese women at their reproductive age were relatively simple, Lactobacillus were the dominant bacteria. Common bacteria included: Lactobacillus crispatus, Lactobacillus iners,and Lactobacillus gasseri. While L. iners were the dominant vaginal bacteria that could not be recognized by traditional method. (2) Vaginal bacteria in the women at post menopause age were more complex than in those at reproductive age. Common bacteria included: Lactobacillus iners, Lactobacillus crispatus, Escherichia coli, Streptococcus agalactiae, Streptococcus gallolyticus, Veillonella sp., Streptococcus intermedius, Streptococcus anginosus, Prevotella sp., Anaerococcus lactolyticus and Bacteroides fragilis. Based on the DGGE analysis, the most common vaginal bacteria in Chinese healthy women at reproductive age are Lactobacillus crispatus, Lactobacillus iners,and Lactobacillus gasseri. the most common vaginal bacteria in healthy post

  14. A clinical and bacteriologic investigation of invasive streptococcal infections in Japan on the basis of serotypes, toxin production, and genomic DNA fingerprints.

    Science.gov (United States)

    Nakashima, K; Ichiyama, S; Iinuma, Y; Hasegawa, Y; Ohta, M; Ooe, K; Shimizu, Y; Igarashi, H; Murai, T; Shimokata, K

    1997-08-01

    In a survey of invasive streptococcal infections in Japan, we analyzed isolates of Streptococcus pyogenes collected between 1992 and 1994. Genomic DNA fingerprints produced by pulsed-field gel electrophoresis (PFGE) were compared by computer-assisted analysis. Conventional serologic M types were subdivided into PFGE types showing close genetic similarity. Among the 42 isolates from patients with invasive diseases, 16 PFGE types were identified and genetic diversity was clearly demonstrated. Identical fingerprints were observed in both invasive and noninvasive isolates. Only 43% of invasive isolates produced streptococcal pyrogenic exotoxin A (SPE A), and 31% did not contain the speA gene. These findings suggest that the dissemination of a specific clone is not sufficient to explain all cases of these diseases in Japan and pose a question as to the role of SPE A as a major virulent factor. Bacterial factors other than SPE A and host factors should be considered in evaluation of the pathogenesis of the diseases.

  15. Clonality Analysis of Helicobacter pylori in Patients Isolated from Several Biopsy Specimens and Gastric Juice in a Japanese Urban Population by Random Amplified Polymorphic DNA Fingerprinting

    Directory of Open Access Journals (Sweden)

    Nariaki Toita

    2013-01-01

    Full Text Available Background. The number of Helicobacter pylori clones infecting a single host has been discussed in numerous reports. The number has been suggested to vary depending on the regions in the world. Aim. The purpose of this study was to examine the number of clones infecting a single host in a Japanese urban population. Materials and Methods. Thirty-one Japanese patients undergoing upper gastrointestinal endoscopy were enrolled in this study. H. pylori isolates (total 104 strains were obtained from biopsy specimens (antrum, corpus, and duodenum and gastric juice. Clonal diversity was examined by the random amplified polymorphic DNA (RAPD fingerprinting method. Results. The RAPD fingerprinting patterns of isolates from each patient were identical or very similar. And the isolates obtained from several patients with 5- to 9-year intervals showed identical or very similar RAPD patterns. Conclusion. Each Japanese individual of an urban population is predominantly infected with a single H. pylori clone.

  16. Genetic diversity of edible mushroom pleurotus spp. revealed by randomly amplified polymorphic dna fingerprinting

    International Nuclear Information System (INIS)

    Khan, N. A.; Awan, F. S.; Khan, A. I.; Waseem, M.

    2017-01-01

    The Oyster mushroom (Pleurotus) cultivation is a profitable agribusiness and having high significance due its nutritive and therapeutic value. Due to deficient knowledge on Pleurotus mushroom genetics seven strains of Oyster mushroom, two local and five exotic were studied for their genetic diversity through RAPD markers. It was clear from similarity matrix that similarity index ranges from 45 to 72%. The cluster analysis of combined data set of all the markers resulted in three major clades, while isolate P-17 remains ungrouped and shown to be the most diverse strain of the seven. During amplification of genomic DNA yielded 70 fragments that could be scored, of which 41 were polymorphic, with an average of 2.73 polymorphic fragments per primer. Number of amplified fragments with random primers ranged from three to six. Polymorphism ranged from 0% to 83.33%, with an overall 58% polymorphism. The allele frequency of RAPD primers ranged from 0.71 to 1.00 while the polymorphic information content highest for the primer GL-C-20 (0.29) followed by the primers GL A-20 and GL C-16 that is zero, indicating medium level of polymorphism among the strains of Oyster mushroom. The objective of the study was to characterize Pleurotus strains collected from different origins and to find out the variability at molecular level. (author)

  17. Development of species-specific DNA probes for Campylobacter jejuni, Campylobacter coli, and Campylobacter lari by polymerase chain reaction fingerprinting

    NARCIS (Netherlands)

    Giesendorf, B A; van Belkum, A; Koeken, A; Stegeman, H; Henkens, M H; van der Plas, J; Goossens, H; Niesters, H G; Quint, W G

    The application of polymerase chain reaction (PCR) fingerprinting assays enables discrimination between species and strains of microorganisms. PCR primers aiming at arbitrary sequences in combination with primers directed against the repetitive extragenic palindrome (REP) or enterobacterial

  18. Integration of HPLC-based fingerprint and quantitative analyses for differentiating botanical species and geographical growing origins of Rhizoma coptidis.

    Science.gov (United States)

    Lv, Xiumei; Li, Yan; Tang, Ce; Zhang, Yi; Zhang, Jing; Fan, Gang

    2016-12-01

    Rhizoma coptidis is a broadly used traditional Chinese medicine (TCM). The investigation of the influence of species and geographical origins on the phytochemicals of R. coptidis is crucial for its reasonable application and quality control. Development of an effective method to systematically study the phytochemical variations of the rhizomes of three Coptis species (Ranunculaceae) (Coptis chinensis Franch, Coptis deltoidea C.Y. Cheng et Hsiao and Coptis teeta Wall.) and a species (i.e., C. chinensis) obtained from both Daodi and non-Daodi production regions. The three species had significant differences in their phytochemicals. The rhizome of C. chinensis contained more epiberberine (13.52 ± 2.65 mg/g), palmatine (18.20 ± 2.89 mg/g), coptisine (23.32 ± 4.27 mg/g) and columbamine (4.89 ± 1.16 mg/g), whereas the rhizomes of C. deltoidea and C. teeta showed the highest level of jatrorrhizine (8.52 ± 1.36 mg/g) and berberine (81.06 ± 4.83 mg/g), respectively. Moreover, the rhizome of C. chinensis from three Daodi production regions (Shizhu, Lichuan and Emeishan) contained more alkaloids than those from three non-Daodi production regions (Mianyang, Shifang and Zhenping). It is necessary to use the three R. coptidis species differentially in TCM clinical practice. Daodi C. chinensis medicinal materials have better quality than most non-Daodi ones, and so they should be preferred for TCM prescription. The combination of HPLC-based fingerprint analysis and quantification of multi-ingredients with statistical analysis provided an effective approach for species discrimination and quality evaluation of R. coptidis.

  19. GENOMIC DNA-FINGERPRINTING OF CLINICAL HAEMOPHILUS-INFLUENZAE ISOLATES BY POLYMERASE CHAIN-REACTION AMPLIFICATION - COMPARISON WITH MAJOR OUTER-MEMBRANE PROTEIN AND RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISM ANALYSIS

    NARCIS (Netherlands)

    VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L

    Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by

  20. DNA methyltransferase inhibitor CDA-II inhibits myogenic differentiation

    International Nuclear Information System (INIS)

    Chen, Zirong; Jin, Guorong; Lin, Shuibin; Lin, Xiumei; Gu, Yumei; Zhu, Yujuan; Hu, Chengbin; Zhang, Qingjiong; Wu, Lizi; Shen, Huangxuan

    2012-01-01

    Highlights: ► CDA-II inhibits myogenic differentiation in a dose-dependent manner. ► CDA-II repressed expression of muscle transcription factors and structural proteins. ► CDA-II inhibited proliferation and migration of C2C12 myoblasts. -- Abstract: CDA-II (cell differentiation agent II), isolated from healthy human urine, is a DNA methyltransferase inhibitor. Previous studies indicated that CDA-II played important roles in the regulation of cell growth and certain differentiation processes. However, it has not been determined whether CDA-II affects skeletal myogenesis. In this study, we investigated effects of CDA-II treatment on skeletal muscle progenitor cell differentiation, migration and proliferation. We found that CDA-II blocked differentiation of murine myoblasts C2C12 in a dose-dependent manner. CDA-II repressed expression of muscle transcription factors, such as Myogenin and Mef2c, and structural proteins, such as myosin heavy chain (Myh3), light chain (Mylpf) and MCK. Moreover, CDA-II inhibited C1C12 cell migration and proliferation. Thus, our data provide the first evidence that CDA-II inhibits growth and differentiation of muscle progenitor cells, suggesting that the use of CDA-II might affect skeletal muscle functions.

  1. Differential DNA methylation patterns define status epilepticus and epileptic tolerance.

    Science.gov (United States)

    Miller-Delaney, Suzanne F C; Das, Sudipto; Sano, Takanori; Jimenez-Mateos, Eva M; Bryan, Kenneth; Buckley, Patrick G; Stallings, Raymond L; Henshall, David C

    2012-02-01

    Prolonged seizures (status epilepticus) produce pathophysiological changes in the hippocampus that are associated with large-scale, wide-ranging changes in gene expression. Epileptic tolerance is an endogenous program of cell protection that can be activated in the brain by previous exposure to a non-harmful seizure episode before status epilepticus. A major transcriptional feature of tolerance is gene downregulation. Here, through methylation analysis of 34,143 discrete loci representing all annotated CpG islands and promoter regions in the mouse genome, we report the genome-wide DNA methylation changes in the hippocampus after status epilepticus and epileptic tolerance in adult mice. A total of 321 genes showed altered DNA methylation after status epilepticus alone or status epilepticus that followed seizure preconditioning, with >90% of the promoters of these genes undergoing hypomethylation. These profiles included genes not previously associated with epilepsy, such as the polycomb gene Phc2. Differential methylation events generally occurred throughout the genome without bias for a particular chromosomal region, with the exception of a small region of chromosome 4, which was significantly overrepresented with genes hypomethylated after status epilepticus. Surprisingly, only few genes displayed differential hypermethylation in epileptic tolerance. Nevertheless, gene ontology analysis emphasized the majority of differential methylation events between the groups occurred in genes associated with nuclear functions, such as DNA binding and transcriptional regulation. The present study reports select, genome-wide DNA methylation changes after status epilepticus and in epileptic tolerance, which may contribute to regulating the gene expression environment of the seizure-damaged hippocampus.

  2. Investigation of genomic instability by assay of DNA fingerprint from the offspring of male mice exposed to chronic low-level γ-radiation

    International Nuclear Information System (INIS)

    Bezlepkin, V.G.; Vasil'eva, G.V.; Lomaeva, M.G.; Sirota, N.P.; Gaziev, A.I.

    2000-01-01

    By polymerase chain reaction with arbitrary primer (AP-PCR), the possibility of transmission of genome instability to somatic cells of the offspring (F 1 generation) from male parents of mice exposed to chronic low-dose γ-radiation was studied. Male mice 15 days after exposure to 10-50 cGy were mated with unirradiated females. Biopsies were taken from tale tips of two month-old mice progeny for DNA separation. Primer in the AP-PCR was 20-mer oligonucleotide flanking the micro-satellite locus Atplb2 on chromosome 11 of the mouse. Comparative analysis of individual fingerprints of AP-PCR products on DNA-templates from the offspring of irradiated and unirradiated male mice revealed an increased variability of micro-satellite-associated sequences in the genome of the offspring of males exposed to 25 and 50 cGy. DNA-fingerprints of the offspring of male mice exposed to chronic irradiation doses 10 and 25 cGy. 15 days before fertilization (at the post-meiotic stage of spermatogenesis) showed an increased frequency of non-parent bands. Result of the study point to the possibility of transmission to the offspring somatic cells of changes increasing genome instability from male parents exposed to chronic low-dose radiation prior to fertilization [ru

  3. In Vitro and In Vivo Plant Growth Promoting Activities and DNA Fingerprinting of Antagonistic Endophytic Actinomycetes Associates with Medicinal Plants.

    Science.gov (United States)

    Passari, Ajit Kumar; Mishra, Vineet Kumar; Gupta, Vijai Kumar; Yadav, Mukesh Kumar; Saikia, Ratul; Singh, Bhim Pratap

    2015-01-01

    Endophytic actinomycetes have shown unique plant growth promoting as well as antagonistic activity against fungal phytopathogens. In the present study forty-two endophytic actinomycetes recovered from medicinal plants were evaluated for their antagonistic potential and plant growth-promoting abilities. Twenty-two isolates which showed the inhibitory activity against at least one pathogen were subsequently tested for their plant-growth promoting activities and were compared genotypically using DNA based fingerprinting, including enterobacterial repetitive intergenic consensus (ERIC) and BOX repetitive elements. Genetic relatedness based on both ERIC and BOX-PCR generates specific patterns corresponding to particular genotypes. Exponentially grown antagonistic isolates were used to evaluate phosphate solubilization, siderophores, HCN, ammonia, chitinase, indole-3-acetic acid production, as well as antifungal activities. Out of 22 isolates, the amount of indole-3-acetic acid (IAA) ranging between 10-32 μg/ml was produced by 20 isolates and all isolates were positive for ammonia production ranging between 5.2 to 54 mg/ml. Among 22 isolates tested, the amount of hydroxamate-type siderophores were produced by 16 isolates ranging between 5.2 to 36.4 μg/ml, while catechols-type siderophores produced by 5 isolates ranging from 3.2 to 5.4 μg/ml. Fourteen isolates showed the solubilisation of inorganic phosphorous ranging from 3.2 to 32.6 mg/100ml. Chitinase and HCN production was shown by 19 and 15 different isolates, respectively. In addition, genes of indole acetic acid (iaaM) and chitinase (chiC) were successively amplified from 20 and 19 isolates respectively. The two potential strains Streptomyces sp. (BPSAC34) and Leifsonia xyli (BPSAC24) were tested in vivo and improved a range of growth parameters in chilli (Capsicum annuum L.) under greenhouse conditions. This study is the first published report that actinomycetes can be isolated as endophytes from within these

  4. Differential DNA Methylation Analysis without a Reference Genome

    Directory of Open Access Journals (Sweden)

    Johanna Klughammer

    2015-12-01

    Full Text Available Genome-wide DNA methylation mapping uncovers epigenetic changes associated with animal development, environmental adaptation, and species evolution. To address the lack of high-throughput methods for DNA methylation analysis in non-model organisms, we developed an integrated approach for studying DNA methylation differences independent of a reference genome. Experimentally, our method relies on an optimized 96-well protocol for reduced representation bisulfite sequencing (RRBS, which we have validated in nine species (human, mouse, rat, cow, dog, chicken, carp, sea bass, and zebrafish. Bioinformatically, we developed the RefFreeDMA software to deduce ad hoc genomes directly from RRBS reads and to pinpoint differentially methylated regions between samples or groups of individuals (http://RefFreeDMA.computational-epigenetics.org. The identified regions are interpreted using motif enrichment analysis and/or cross-mapping to annotated genomes. We validated our method by reference-free analysis of cell-type-specific DNA methylation in the blood of human, cow, and carp. In summary, we present a cost-effective method for epigenome analysis in ecology and evolution, which enables epigenome-wide association studies in natural populations and species without a reference genome.

  5. Use of SSR markers for DNA fingerprinting and diversity analysis of Pakistani sugarcane (Saccharum spp. hybrids) cultivars

    Science.gov (United States)

    In recent years SSR markers have been used widely for genetic analysis. The objective of this study was to use an SSR-based marker system to develop the molecular fingerprints and analyze the genetic relationship of sugarcane cultivars grown in Pakistan. Twenty-one highly polymorphic SSR markers wer...

  6. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  7. Differentiation of Herba Cistanches by fingerprint with high-performance liquid chromatography-diode array detection-mass spectrometry.

    Science.gov (United States)

    Jiang, Y; Li, S P; Wang, Y T; Chen, X J; Tu, P F

    2009-03-13

    Herba Cistanche (Rou Cong Rong in Chinese), dried succulent stems of Cistanche deserticola or C. tubulosa, is a famous Chinese herbal medicine and has been recorded in the Chinese Pharmacopoeia. In recent years, another two non-official species, C. salsa and C. sinensis have also been used as Herba Cistanche in some regions of China. To investigate the possibility of using these two non-official species as alternatives to the official species, a high-performance liquid chromatography-diode array detection-mass spectrometry (HPLC-DAD-MS) fingerprint method was developed to comparatively analyze the crude herbs of these four species. The fingerprint of C. deserticola, a historically certified species of Herba Cistanche, serves as 'standard pattern' for comparing the similarities with the other species by means of similarity and Principle Component Analysis. Additionally, 18 characteristic peaks in the fingerprints were identified by comparing their retention times, UV spectra and ESI-MS data with those of the reference substances and/or the data in the literatures. The comparative results demonstrate that the fingerprints of C. tubulosa and C. salsa possess high similarity to the standard pattern, suggesting that these two species may be used as alternative species; while that of C. sinensis has low similarity (0.053 correlation coefficient) to the standard pattern, indicating that it cannot be used as the substitute of the official herb. However, the varying fingerprint patterns among the samples of C. deserticola collected from various habitats illustrate that the quality consistency of crude herbs is still a problem worthy of serious concern.

  8. Amplified fragment length polymorphism fingerprints support limited gene flow among social spider populations

    NARCIS (Netherlands)

    Smith, Deborah; van Rijn, Sander; Henschel, Joh; Bilde, Trine; Lubin, Yael

    We used DNA fingerprints to determine whether the population structure and colony composition of the cooperative social spider Stegodyphus dumicola are compatible with requirements of interdemic ('group') selection: differential proliferation of demes or groups and limited gene flow among groups. To

  9. Genetic relationships among wild and cultivated accessions of curry leaf plant (Murraya koenigii (L.) Spreng.), as revealed by DNA fingerprinting methods.

    Science.gov (United States)

    Verma, Sushma; Rana, T S

    2013-02-01

    Murraya koenigii (L.) Spreng. (Rutaceae), is an aromatic plant and much valued for its flavor, nutritive and medicinal properties. In this study, three DNA fingerprinting methods viz., random amplification of polymorphic DNA (RAPD), directed amplification of minisatellite DNA (DAMD), and inter-simple sequence repeat (ISSR), were used to unravel the genetic variability and relationships across 92 wild and cultivated M. koenigii accessions. A total of 310, 102, and 184, DNA fragments were amplified using 20 RAPD, 5 DAMD, and 13 ISSR primers, revealing 95.80, 96.07, and 96.73% polymorphism, respectively, across all accessions. The average polymorphic information content value obtained with RAPD, DAMD, and ISSR markers was 0.244, 0.250, and 0.281, respectively. The UPGMA tree, based on Jaccard's similarity coefficient generated from the cumulative (RAPD, DAMD, and ISSR) band data showed two distinct clusters, clearly separating wild and cultivated accessions in the dendrogram. Percentage polymorphism, gene diversity (H), and Shannon information index (I) estimates were higher in cultivated accessions compared to wild accessions. The overall high level of polymorphism and varied range of genetic distances revealed a wide genetic base in M. koenigii accessions. The study suggests that RAPD, DAMD, and ISSR markers are highly useful to unravel the genetic variability in wild and cultivated accessions of M. koenigii.

  10. Changes in DNA methylation fingerprint of Quercus ilex trees in response to experimental field drought simulating projected climate change.

    Science.gov (United States)

    Rico, L; Ogaya, R; Barbeta, A; Peñuelas, J

    2014-03-01

    Rapid genetic changes in plants have been reported in response to current climate change. We assessed the capacity of trees in a natural forest to produce rapid acclimation responses based on epigenetic modifications. We analysed natural populations of Quercus ilex, the dominant tree species of Mediterranean forests, using the methylation-sensitive amplified polymorphism (MSAP) technique to assess patterns and levels of methylation in individuals from unstressed forest plots and from plots experimentally exposed to drought for 12 years at levels projected for the coming decades. The percentage of hypermethylated loci increased, and the percentage of fully methylated loci clearly decreased in plants exposed to drought. Multivariate analyses exploring the status of methylation at MSAP loci also showed clear differentiation depending on stress. The PCA scores for the MSAP profiles clearly separated the genetic from the epigenetic structure, and also significantly separated the samples within each group in response to drought. Changes in DNA methylation highlight the large capacity of plants to rapidly acclimate to changing environmental conditions, including trees with long life spans, and our results demonstrate those changes. These changes, although unable to prevent the decreased growth and higher mortality associated with this experimental drought, occurred together with a dampening in such decreases as the long-term treatment progressed. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

  11. Antimicrobial susceptibilities and random amplified polymorphic DNA-PCR fingerprint characterization of Lactococcus lactis ssp. lactis and Lactococcus garvieae isolated from bovine intramammary infections.

    Science.gov (United States)

    Plumed-Ferrer, C; Barberio, A; Franklin-Guild, R; Werner, B; McDonough, P; Bennett, J; Gioia, G; Rota, N; Welcome, F; Nydam, D V; Moroni, P

    2015-09-01

    In total, 181 streptococci-like bacteria isolated from intramammary infections (IMI) were submitted by a veterinary clinic to Quality Milk Production Services (QMPS, Cornell University, Ithaca, NY). The isolates were characterized by sequence analysis, and 46 Lactococcus lactis ssp. lactis and 47 Lactococcus garvieae were tested for susceptibility to 17 antibiotics. No resistant strains were found for β-lactam antibiotics widely used in clinical practice (penicillin, ampicillin, and amoxicillin), and all minimum inhibitory concentrations (MIC) were far from the resistance breakpoints. Eight strains had MIC intermediate to cefazolin. The random amplification of polymorphic DNA (RAPD)-PCR fingerprint patterns showed a slightly higher heterogeneity for Lc. lactis ssp. lactis isolates than for Lc. garvieae isolates. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  12. Modulation of Mitochondrial DNA Copy Number to Induce Hepatocytic Differentiation of Human Amniotic Epithelial Cells.

    Science.gov (United States)

    Vaghjiani, Vijesh; Cain, Jason E; Lee, William; Vaithilingam, Vijayaganapathy; Tuch, Bernard E; St John, Justin C

    2017-10-15

    Mitochondrial deoxyribonucleic acid (mtDNA) copy number is tightly regulated during pluripotency and differentiation. There is increased demand of cellular adenosine triphosphate (ATP) during differentiation for energy-intensive cell types such as hepatocytes and neurons to meet the cell's functional requirements. During hepatocyte differentiation, mtDNA copy number should be synchronously increased to generate sufficient ATP through oxidative phosphorylation. Unlike bone marrow mesenchymal cells, mtDNA copy number failed to increase by 28 days of differentiation of human amniotic epithelial cells (hAEC) into hepatocyte-like cells (HLC) despite their expression of some end-stage hepatic markers. This was due to higher levels of DNA methylation at exon 2 of POLGA, the mtDNA-specific replication factor. Treatment with a DNA demethylation agent, 5-azacytidine, resulted in increased mtDNA copy number, reduced DNA methylation at exon 2 of POLGA, and reduced hepatic gene expression. Depletion of mtDNA followed by subsequent differentiation did not increase mtDNA copy number, but reduced DNA methylation at exon 2 of POLGA and increased expression of hepatic and pluripotency genes. We encapsulated hAEC in barium alginate microcapsules and subsequently differentiated them into HLC. Encapsulation resulted in no net increase of mtDNA copy number but a significant reduction in DNA methylation of POLGA. RNAseq analysis showed that differentiated HLC express hepatocyte-specific genes but also increased expression of inflammatory interferon genes. Differentiation in encapsulated cells showed suppression of inflammatory genes as well as increased expression of genes associated with hepatocyte function pathways and networks. This study demonstrates that an increase in classical hepatic gene expression can be achieved in HLC through encapsulation, although they fail to effectively regulate mtDNA copy number.

  13. Development of maizeSNP3072, a high-throughput compatible SNP array, for DNA fingerprinting identification of Chinese maize varieties.

    Science.gov (United States)

    Tian, Hong-Li; Wang, Feng-Ge; Zhao, Jiu-Ran; Yi, Hong-Mei; Wang, Lu; Wang, Rui; Yang, Yang; Song, Wei

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are abundant and evenly distributed throughout the maize ( Zea mays L.) genome. SNPs have several advantages over simple sequence repeats, such as ease of data comparison and integration, high-throughput processing of loci, and identification of associated phenotypes. SNPs are thus ideal for DNA fingerprinting, genetic diversity analysis, and marker-assisted breeding. Here, we developed a high-throughput and compatible SNP array, maizeSNP3072, containing 3072 SNPs developed from the maizeSNP50 array. To improve genotyping efficiency, a high-quality cluster file, maizeSNP3072_GT.egt, was constructed. All 3072 SNP loci were localized within different genes, where they were distributed in exons (43 %), promoters (21 %), 3' untranslated regions (UTRs; 22 %), 5' UTRs (9 %), and introns (5 %). The average genotyping failure rate using these SNPs was only 6 %, or 3 % using the cluster file to call genotypes. The genotype consistency of repeat sample analysis on Illumina GoldenGate versus Infinium platforms exceeded 96.4 %. The minor allele frequency (MAF) of the SNPs averaged 0.37 based on data from 309 inbred lines. The 3072 SNPs were highly effective for distinguishing among 276 examined hybrids. Comparative analysis using Chinese varieties revealed that the 3072SNP array showed a better marker success rate and higher average MAF values, evaluation scores, and variety-distinguishing efficiency than the maizeSNP50K array. The maizeSNP3072 array thus can be successfully used in DNA fingerprinting identification of Chinese maize varieties and shows potential as a useful tool for germplasm resource evaluation and molecular marker-assisted breeding.

  14. ERIC-PCR fingerprinting-based community DNA hybridization to pinpoint genome-specific fragments as molecular markers to identify and track populations common to healthy human guts.

    Science.gov (United States)

    Wei, Guifang; Pan, Li; Du, Huimin; Chen, Junyi; Zhao, Liping

    2004-10-01

    Bacterial populations common to healthy human guts may play important roles in human health. A new strategy for discovering genomic sequences as markers for these bacteria was developed using Enterobacterial Repetitive Intergenic Consensus (ERIC)-PCR fingerprinting. Structural features within microbial communities are compared with ERIC-PCR followed by DNA hybridization to identify genomic fragments shared by samples from healthy human individuals. ERIC-PCR profiles of fecal samples from 12 diseased or healthy human and piglet subjects demonstrated stable, unique banding patterns for each individual tested. Sequence homology of DNA fragments in bands of identical size was examined between samples by hybridization under high stringency conditions with DIG-labeled ERIC-PCR products derived from the fecal sample of one healthy child. Comparative analysis of the hybridization profiles with the original agarose fingerprints identified three predominant bands as signatures for populations associated with healthy human guts with sizes of 500, 800 and 1000 bp. Clone library profiling of the three bands produced 17 genome fragments, three of which showed high similarity only with regions of the Bacteroides thetaiotaomicron genome, while the remainder were orphan sequences. Association of these sequences with healthy guts was validated by sequence-selective PCR experiments, which showed that a single fragment was present in all 32 healthy humans and 13 healthy piglets tested. Two fragments were present in the healthy human group and in 18 children with non-infectious diarrhea but not in eight children with infectious diarrhea. Genome fragments identified with this novel strategy may be used as genome-specific markers for dynamic monitoring and sequence-guided isolation of functionally important bacterial populations in complex communities such as human gut microflora.

  15. Maintenance of DNA repair capacity in differentiating rat muscle cells in vitro

    International Nuclear Information System (INIS)

    Koval, T.M.; Kaufman, S.J.

    1981-01-01

    Unscheduled DNA synthesis was measured at several times during the differentiation of cultured rat skeletal muscle cells in response to exposures to 254 nm UV light. There was no change in the amount of repair DNA synthesis as the cells fuse and differentiate from postmitotic prefusion myoblasts to multinucleated contracting myotubes. (author)

  16. D1/D2 domain of large-subunit ribosomal DNA for differentiation of Orpinomyces spp.

    Science.gov (United States)

    Dagar, Sumit S; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K

    2011-09-01

    This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation.

  17. Fingerprint fake detection by optical coherence tomography

    Science.gov (United States)

    Meissner, Sven; Breithaupt, Ralph; Koch, Edmund

    2013-03-01

    The most established technique for the identification at biometric access control systems is the human fingerprint. While every human fingerprint is unique, fingerprints can be faked very easily by using thin layer fakes. Because commercial fingerprint scanners use only a two-dimensional image acquisition of the finger surface, they can only hardly differentiate between real fingerprints and fingerprint fakes applied on thin layer materials. A Swept Source OCT system with an A-line rate of 20 kHz and a lateral and axial resolution of approximately 13 μm, a centre wavelength of 1320 nm and a band width of 120 nm (FWHM) was used to acquire fingerprints and finger tips with overlying fakes. Three-dimensional volume stacks with dimensions of 4.5 mm x 4 mm x 2 mm were acquired. The layering arrangement of the imaged finger tips and faked finger tips was analyzed and subsequently classified into real and faked fingerprints. Additionally, sweat gland ducts were detected and consulted for the classification. The manual classification between real fingerprints and faked fingerprints results in almost 100 % correctness. The outer as well as the internal fingerprint can be recognized in all real human fingers, whereby this was not possible in the image stacks of the faked fingerprints. Furthermore, in all image stacks of real human fingers the sweat gland ducts were detected. The number of sweat gland ducts differs between the test persons. The typical helix shape of the ducts was observed. In contrast, in images of faked fingerprints we observe abnormal layer arrangements and no sweat gland ducts connecting the papillae of the outer fingerprint and the internal fingerprint. We demonstrated that OCT is a very useful tool to enhance the performance of biometric control systems concerning attacks by thin layer fingerprint fakes.

  18. Determination of antimicrobial resistance of Enterococcus strains isolated from pigs and their genotypic characterization by method of amplification of DNA fragments surrounding rare restriction sites (ADSRRS fingerprinting).

    Science.gov (United States)

    Nowakiewicz, Aneta; Ziółkowska, Grażyna; Trościańczyk, Aleksandra; Zięba, Przemysław; Gnat, Sebastian

    2017-03-01

    In this study, we analysed phenotypic resistance profiles and their reflection in the genomic profiles of Enterococcus spp. strains isolated from pigs raised on different farms. Samples were collected from five pig farms (n=90 animals) and tested for Enterococcus. MICs of 12 antimicrobials were determined using the broth microdilution method, and epidemiological molecular analysis of strains belonging to selected species (faecalis, faecium and hirae) was performed using the ADSRRS-fingerprinting (amplification of DNA fragments surrounding rare restriction sites) method with a few modifications. The highest percentage of strains was resistant to tetracycline (73.4 %), erythromycin and tylosin (42.5 %) and rifampin (25.2 %), and a large number of strains exhibited high-level resistance to both kanamycin (25.2 %) and streptomycin (27.6 %). The strains of E. faecalis, E. faecium and E. hirae (n=184) revealed varied phenotypic resistance profiles, among which as many as seven met the criteria for multidrug resistance (30.4 % of strains tested). ADSRRS-fingerprinting analysis produced 17 genotypic profiles of individual strains which were correlated with their phenotypic resistance profiles. Only E. hirae strains susceptible to all of the chemotherapeutics tested had two different ADSRRS profiles. Moreover, eight animals were carriers of more than one genotype belonging to the same Enterococcus spp., mainly E. faecalis. Given the possibility of transmission to humans of the high-resistance/multidrug resistance enterococci and the significant role of pigs as food animals in this process, it is necessary to introduce a multilevel control strategy by carrying out research on the resistance and molecular characteristics of indicator bacterial strains isolated from animals on individual farms.

  19. Cognitive Fingerprints

    Science.gov (United States)

    2015-03-25

    is another cognitive fingerprint that has been used extensively for authorship . This work has been ex- tended to authentication by relating keyboard...this work is the inference of high-level features such as personality, gender , and dominant hand but those features have not been integrated to date

  20. Comparison between the DNA Fingerprints Obtained from the Yellow Vein Mosaic Disease Tolerant Okra Mutants and Their Parental Variety

    International Nuclear Information System (INIS)

    Boonsirichai, Kanokporn; Puripunyavanich, Vichai; Phadvibulya, Valailak; Adthalungrong, Amnuai; Srithongchai, Wanphen

    2006-01-01

    The yellow vein mosaic disease (YVMD) is a widespread disease that is found among export orchards of okra. In this report, we studied gamma radiation-induced YVMD tolerant okra mutants and other commercial okra varieties at DNA level. We found that DNA extraction method that utilized sodium dodecyl sulfate and potassium acetate to precipitate other biomolecules was a suitable method to use for DNA finger printing of okra. The MFLP finger printing technique was superior to the AFLP technique in finding polymorphisms among different okra varieties. Also polymorphisms between the YVMD-tolerant mutant lines and their parental variety could be detected, indicating that gamma radiation could induce some changes at DNA level in these plants

  1. Differential Nuclear and Mitochondrial DNA Preservation in Post-Mortem Teeth with Implications for Forensic and Ancient DNA Studies

    Science.gov (United States)

    Higgins, Denice; Rohrlach, Adam B.; Kaidonis, John; Townsend, Grant; Austin, Jeremy J.

    2015-01-01

    Major advances in genetic analysis of skeletal remains have been made over the last decade, primarily due to improvements in post-DNA-extraction techniques. Despite this, a key challenge for DNA analysis of skeletal remains is the limited yield of DNA recovered from these poorly preserved samples. Enhanced DNA recovery by improved sampling and extraction techniques would allow further advancements. However, little is known about the post-mortem kinetics of DNA degradation and whether the rate of degradation varies between nuclear and mitochondrial DNA or across different skeletal tissues. This knowledge, along with information regarding ante-mortem DNA distribution within skeletal elements, would inform sampling protocols facilitating development of improved extraction processes. Here we present a combined genetic and histological examination of DNA content and rates of DNA degradation in the different tooth tissues of 150 human molars over short-medium post-mortem intervals. DNA was extracted from coronal dentine, root dentine, cementum and pulp of 114 teeth via a silica column method and the remaining 36 teeth were examined histologically. Real time quantification assays based on two nuclear DNA fragments (67 bp and 156 bp) and one mitochondrial DNA fragment (77 bp) showed nuclear and mitochondrial DNA degraded exponentially, but at different rates, depending on post-mortem interval and soil temperature. In contrast to previous studies, we identified differential survival of nuclear and mtDNA in different tooth tissues. Futhermore histological examination showed pulp and dentine were rapidly affected by loss of structural integrity, and pulp was completely destroyed in a relatively short time period. Conversely, cementum showed little structural change over the same time period. Finally, we confirm that targeted sampling of cementum from teeth buried for up to 16 months can provide a reliable source of nuclear DNA for STR-based genotyping using standard

  2. Towards secondary fingerprint classification

    CSIR Research Space (South Africa)

    Msiza, IS

    2011-07-01

    Full Text Available an accuracy figure of 76.8%. This small difference between the two figures is indicative of the validity of the proposed secondary classification module. Keywords?fingerprint core; fingerprint delta; primary classifi- cation; secondary classification I..., namely, the fingerprint core and the fingerprint delta. Forensically, a fingerprint core is defined as the innermost turning point where the fingerprint ridges form a loop, while the fingerprint delta is defined as the point where these ridges form a...

  3. Differential recruitment of DNA Ligase I and III to DNA repair sites

    Science.gov (United States)

    Mortusewicz, Oliver; Rothbauer, Ulrich; Cardoso, M. Cristina; Leonhardt, Heinrich

    2006-01-01

    DNA ligation is an essential step in DNA replication, repair and recombination. Mammalian cells contain three DNA Ligases that are not interchangeable although they use the same catalytic reaction mechanism. To compare the recruitment of the three eukaryotic DNA Ligases to repair sites in vivo we introduced DNA lesions in human cells by laser microirradiation. Time lapse microscopy of fluorescently tagged proteins showed that DNA Ligase III accumulated at microirradiated sites before DNA Ligase I, whereas we could detect only a faint accumulation of DNA Ligase IV. Recruitment of DNA Ligase I and III to repair sites was cell cycle independent. Mutational analysis and binding studies revealed that DNA Ligase I was recruited to DNA repair sites by interaction with PCNA while DNA Ligase III was recruited via its BRCT domain mediated interaction with XRCC1. Selective recruitment of specialized DNA Ligases may have evolved to accommodate the particular requirements of different repair pathways and may thus enhance efficiency of DNA repair. PMID:16855289

  4. DNA-based molecular fingerprinting of eukaryotic protists and cyanobacteria contributing to sinking particle flux at the Bermuda Atlantic time-series study

    Science.gov (United States)

    Amacher, Jessica; Neuer, Susanne; Lomas, Michael

    2013-09-01

    We used denaturing gradient gel electrophoresis (DGGE) to examine the protist and cyanobacterial communities in the euphotic zone (0-120 m) and in corresponding 150 m particle interceptor traps at the Bermuda Atlantic Time-series Study (BATS) in a two-year monthly time-series from May 2008 to April 2010. Dinoflagellates were the most commonly detected taxa in both water column and trap samples throughout the time series. Diatom sequences were found only eight times in the water column, and only four times in trap material. Small-sized eukaryotic taxa, including the prasinophyte genera Ostreococcus, Micromonas, and Bathycoccus, were present in trap samples, as were the cyanobacteria Prochlorococcus and Synechococcus. Synechococcus was usually overrepresented in trap material, whereas Prochlorococcus was underrepresented compared to the water column. Both seasonal and temporal variability affected patterns of ribosomal DNA found in sediment traps. The two years of this study were quite different hydrographically, with higher storm activity and the passing of a cyclonic eddy causing unusually deep mixing in winter 2010. This was reflected in the DGGE fingerprints of the water column, which showed greater phylotype richness of eukaryotes and a lesser richness of cyanobacteria in winter of 2010 compared with the winter of 2009. Increases in eukaryotic richness could be traced to increased diversity of prasinophytes and prymnesiophytes. The decrease in cyanobacterial richness was in turn reflected in the trap composition, but the increase in eukaryotes was not, indicating a disproportionate contribution of certain taxa to sinking particle flux.

  5. SSR-Based DNA Fingerprinting and Diversity Assessment Among Indian Germplasm of Euryale ferox: an Aquatic Underutilized and Neglected Food Crop.

    Science.gov (United States)

    Kumar, Nitish; Shikha, Divya; Kumari, Swati; Choudhary, Binod Kumar; Kumar, Lokendra; Singh, Indu Shekhar

    2017-10-30

    Euryale ferox is native to Southeast Asia and China, and it is one of the important aquatic food crops propagated mostly in eastern part of India. The aim of the present study was to characterize and evaluate the genetic diversity of ex situ collections of E. ferox germplasm from different geographical states of India using microsatellite (simple sequence repeats (SSRs)) markers. Ten SSR markers were analyzed to assess DNA fingerprinting and genetic diversity of 16 cultivated germplasm of E. ferox. Total 37 polymorphic alleles were recorded with an average of 3.7 allele frequency per primer. The polymorphic information content value varied from 0.204 to 0.735 with mean of 0.448. A high range of heterozygosity (Ho 0.228; He 0.512) was detected in the present study. The neighbor-joining (N-J) tree and the principle coordinate analysis showed that the germplasm divided in to three main clusters. The results of the present investigation comply that SSR markers are effective for computing genetic assessment of genetic diversity and similarity with classifying cultivated varieties of E. ferox. Evaluation of genetic diversity among Indian E. ferox germplasm could provide useful information for genetic improvement.

  6. Intrafamilial, Preferentially Mother-to-Child and Intraspousal, Helicobacter pylori Infection in Japan Determined by Mutilocus Sequence Typing and Random Amplified Polymorphic DNA Fingerprinting.

    Science.gov (United States)

    Yokota, Shin-ichi; Konno, Mutsuko; Fujiwara, Shin-ichi; Toita, Nariaki; Takahashi, Michiko; Yamamoto, Soh; Ogasawara, Noriko; Shiraishi, Tsukasa

    2015-10-01

    The infection route of Helicobacter pylori has been recognized to be mainly intrafamilial, preferentially mother-to-child, especially in developed countries. To determine the transmission route, we examined whether multilocus sequence typing (MLST) was useful for analysis of intrafamilial infection. The possibility of intraspousal infection was also evaluated. Clonal relationships between strains derived from 35 index Japanese pediatric patients, and their family members were analyzed by two genetic typing procedures, MLST and random amplified polymorphic DNA (RAPD) fingerprinting. Mostly coincident results were obtained by MLST and RAPD. By MLST, the allele of loci in the isolates mostly matched between the index child and both the father and mother for 9 (25.7%) of the 35 patients, between the index child and the mother for 25 (60.0%) of the 35 patients. MLST is useful for analyzing the infection route of H. pylori as a highly reproducible method. Intrafamilial, especially mother-to-children and sibling, infection is the dominant transmission route. Intraspousal infection is also thought to occur in about a quarter in the Japanese families. © 2015 John Wiley & Sons Ltd.

  7. Evaluating the efficacy of DNA differential extraction methods for sexual assault evidence.

    Science.gov (United States)

    Klein, Sonja B; Buoncristiani, Martin R

    2017-07-01

    Analysis of sexual assault evidence, often a mixture of spermatozoa and victim epithelial cells, represents a significant portion of a forensic DNA laboratory's case load. Successful genotyping of sperm DNA from these mixed cell samples, particularly with low amounts of sperm, depends on maximizing sperm DNA recovery and minimizing non-sperm DNA carryover. For evaluating the efficacy of the differential extraction, we present a method which uses a Separation Potential Ratio (SPRED) to consider both sperm DNA recovery and non-sperm DNA removal as variables for determining separation efficiency. In addition, we describe how the ratio of male-to-female DNA in the sperm fraction may be estimated by using the SPRED of the differential extraction method in conjunction with the estimated ratio of male-to-female DNA initially present on the mixed swab. This approach may be useful for evaluating or modifying differential extraction methods, as we demonstrate by comparing experimental results obtained from the traditional differential extraction and the Erase Sperm Isolation Kit (PTC © ) procedures. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Investigating Intraspecific Variation of Acidovorax avenae subsp. citrulli Using DNA Fingerprinting and Whole Cell Fatty Acid Analysis.

    Science.gov (United States)

    Walcott, R R; Langston, D B; Sanders, F H; Gitaitis, R D

    2000-02-01

    ABSTRACT To assess the diversity of Acidovorax avenae subsp. citrulli, 121 strains from watermelon, cantaloupe, and pumpkin were compared using pulse field gel electrophoresis of SpeI-digested DNA and gas chromatographic analysis of fatty acid methyl esters. Twenty-nine unique DNA fragments resulted from DNA digestion, and 14 distinct haplotypes were observed. Based on cluster analysis, two subgroups, I and II, were recognized, which accounted for 84.8% (eight haplotypes) and 15.2% (six haplotypes) of the strains, respectively. Results of cellular fatty acid analysis varied quantitatively and qualitatively for the A. avenae subsp. citrulli strains and supported the existence of the two subgroups. Group I includes strains from cantaloupe and pumpkin as well as the ATCC type strain, which was first described in the United States in 1978, whereas group II represents the typical watermelon fruit blotch-causing strains that appeared in the mainland United States in 1989. Knowledge of the two A. avenae subsp. citrulli groups may be useful in screening for watermelon fruit blotch resistance.

  9. DNA supercoiling: changes during cellular differentiation and activation of chromatin transcription

    International Nuclear Information System (INIS)

    Luchnik, A.N.; Bakayev, V.V.; Glaser, V.M.; Moscow State Univ., USSR)

    1983-01-01

    In this paper it is reported that elastic DNA torsional tension has been observed in a fraction of isolated SV40 minichromosomes, which are shown to be transcriptionally active, and that the number of DNA topological (titratable superhelical) turns in closed superhelical loops of nuclear DNA decreases during cellular differentiation, which, we propose, may be responsible for the coordinate switch in transcription of genes controlling cellular proliferation. 37 references, 6 figures, 2 tables

  10. Fissile fingerprints

    International Nuclear Information System (INIS)

    Edwards, R.

    1995-01-01

    This article looks at recent research which may allow police and customs officers to detect smuggled weapons-grade plutonium and uranium. Contrary to popular opinion, nuclear materials do not have a nuclear ''fingerprint'' but enough information can be gleaned from sources to confirm what has been learnt from other data. Indeed, two leading nuclear laboratories can look at the same analytical results and draw different conclusions. The case of a lead cylinder seized from a German garage is examined to illustrate the confusion. (UK)

  11. Differentiation of Three Centella Species in Australia as Inferred from Morphological Characteristics, ISSR Molecular Fingerprinting and Phytochemical Composition.

    Science.gov (United States)

    Alqahtani, Ali; Cho, Jun-Lae; Wong, Ka Ho; Li, Kong M; Razmovski-Naumovski, Valentina; Li, George Q

    2017-01-01

    Centella asiatica is one of the popular herbs used for inflammatory and neural conditions. Its differentiation from similar species is currently lacking. The aims of this study were to differentiate the three closely related Centella species using methods based on morphological characters, genetic biodiversity, phytochemical compositions and antioxidant activities. According to the morphological characteristics, the collected samples were identified as three species: C. asiatica, Centella cordifolia and Centella erecta and clustered into three groups based on their morphometric variability. Dendogram constructed on the basis of the intersimple sequence repeats (ISSR) analyses were consistent with the morphological grouping. Centella cordifolia had the highest triterpene glycosides, phenolics and antioxidant capacity, followed by C. asiatica , then C. erecta , therefore, was genetically and chemically closer to C. asiatica , while C. erecta was distinctively different from them. The results confirm the occurrence of the closely related three species of Centella in Australia, and the differentiation among them can be achieved via the combination of morphometric, molecular and phytochemical methods. This first comparative botanical study on Centella species provides a foundation for further systematic study and medicinal development of Centella .

  12. Differentiation of Three Centella Species in Australia as Inferred from Morphological Characteristics, ISSR Molecular Fingerprinting and Phytochemical Composition

    Directory of Open Access Journals (Sweden)

    Ali Alqahtani

    2017-11-01

    Full Text Available Centella asiatica is one of the popular herbs used for inflammatory and neural conditions. Its differentiation from similar species is currently lacking. The aims of this study were to differentiate the three closely related Centella species using methods based on morphological characters, genetic biodiversity, phytochemical compositions and antioxidant activities. According to the morphological characteristics, the collected samples were identified as three species: C. asiatica, Centella cordifolia and Centella erecta and clustered into three groups based on their morphometric variability. Dendogram constructed on the basis of the intersimple sequence repeats (ISSR analyses were consistent with the morphological grouping. Centella cordifolia had the highest triterpene glycosides, phenolics and antioxidant capacity, followed by C. asiatica, then C. erecta, therefore, was genetically and chemically closer to C. asiatica, while C. erecta was distinctively different from them. The results confirm the occurrence of the closely related three species of Centella in Australia, and the differentiation among them can be achieved via the combination of morphometric, molecular and phytochemical methods. This first comparative botanical study on Centella species provides a foundation for further systematic study and medicinal development of Centella.

  13. Comparison of mutans streptococcal strains of father, mother, and child in indian families using chromosomal DNA fingerprinting.

    Science.gov (United States)

    Katre, Amar N; Damle, Sg

    2013-09-01

    It is now understood and accepted that there is a direct transmission of mutans streptococci (MS) from the mother to the child. There is also a direct correlation between the levels of MS in the mother and the caries status of the child. Advanced technologies in molecular biology like chromosomal DNA fngerprinting have established beyond doubt that the mother and the child bear similar strains of MS. A study was designed with the aim of comparing the MS strains between the father, mother and the child in Indian families. A group of 20 Indian families comprising of the father, mother and child were selected and divided into caries free and caries active groups. Mixed salivary samples were collected from the individuals and were cultured for the growth of Mutans streptococci. The colonies were counted on a colony counter and a comparison was made between the mutans streptococcal counts of the mother and the caries status of the child. Further, the genotypes of the father, mother and the child were isolated and compared using the technique of chromosomal DNA fngerprinting. Following electrophoresis, the band pattern obtained was compared for similarities or differences. The results of the same were tabulated and evaluated statistically. When the colony counts of the mother (in CFU/ml) were compared with the 'dft' status of the child, a positive correlation was seen in group II. Intergroup comparison using the unpaired T test was statistically signifcant. Electrophoretic analysis of the chromosomal DNA on the agarose gels revealed identical band patterns in 13 mother-child pairs, which was statistically signifcant. Three of the father-child pairs showed identical band patterns, which was statistically signifcant. Intergroup comparison using Chi-square test was not statistically signifcant. One may conclude that irrespective of the caries status of the child, majority of the mother child pairs share identical strains of MS and hence the mother is the primary source of

  14. Conformational changes in DNA caused by DNA-ase I, gamma and ultraviolet radiation as revealed by differential pulse polarography

    International Nuclear Information System (INIS)

    Vorlickova, M.

    1979-01-01

    The height, potential and half width of differential pulse-polarographic peaks of DNA were investigated in dependence on degradation by DNA-ase I and gamma and UV radiation. It was found that in all cases studied growth of peak II (reflecting conformational changes in the DNA double helix) was limited, and only after it reached a certain height further degradation induced the appearance of peak III of single-stranded DNA. This course is explained as reflecting the limited extent of conformational changes in the framework of the double helix, which probably follows from a limited number of sites that can undergo certain types of conformational changes. The character of the conformational changes is dependent on the chemical nature of the damage. (author)

  15. Differential expression analysis of genic male sterility by cDNA-AFLP in maize

    International Nuclear Information System (INIS)

    Zhang Linbi; Rong Tingzhao; Pan Guangtang; Cao Moju

    2009-01-01

    The differential expression of male sterility induced by space flight with male fertility was studied using cDNA-AFLP technology. Total RNA was isolated from anther of male sterility and male fertility. Nine differential expression cDNA fragments were obtained with 16 primer combinations. The differential cDNA fragments were eluted, cloned and sequenced. Then half-quantitative RT-PCR was used to stuy the differential expressions of 4 development stages between sterility and fertility. Sequencing analysis shown 2 fragments from male sterility might be novel genes. Four fragments from male fertility were homology as chalcone and stilbene synthases, putative acyl CoA dehydrogenase, putative protein kinases and putative glycine decarboxylase. All these proteins might participate in the energy metabolisms, substance metabolisms or signal pollen development, Z8 took on increasing expression during the middle period of pollen development. These results just met the demand of more energy and more substance during the pollen development. (authors)

  16. Use of novel DNA fingerprinting techniques for the detection and characterization of genetic variation in vegetatively propagated crops. Proceedings of a final research co-ordination meeting

    International Nuclear Information System (INIS)

    1998-10-01

    Vegetative propagated crops, such as banana and platain, sweet potato, yam, sugarcane and cassava, represent important sources of food in the developing countries. Although some of these crops may produce seeds, they must for practical purposes be propagated vegetatively. As normal plant breeding strategies based on genetic hybridization are of limited value or not applicable to such crops, it is necessary to assess the genetic diversity already existing in these crops and to design breeding strategies accordingly. If the existing genetic variation is shown to be too narrow for breeding purposes, one promising possibility for the introduction of genetic variability is the use of mutations induced by radiation or chemical mutagens. This CRP focused on: the detection of genetic diversity induced by mutagenic treatment or in vitro culture; the development of crop-specific markers; and increasing co-operation between molecular biologists in advanced laboratories and plant breeders and molecular biologists in the developing countries. The success of this CRP is evidenced by the introduction and application of new molecular methods by laboratories in developing countries, specially for the analysis of local crop genetic diversity. These exciting preliminary results show the potential for applications in crop improvement but much work remains to be done. Many of the vegetatively propagated species are ''orphan crops'', under-investigated on the international level. The development of new uses of transgenesis for the development of edible vaccines should not be overlooked. The challenge that remains is in the application of these new tools for practical end-user oriented improvements in vegetatively propagated crops. The present publication summarizes the third and final Research Co-ordination Meeting on the Use of Novel DNA Fingerprinting Techniques for the Detection and Characterization of Genetic Variation in Vegetatively Propagated Crops

  17. Use of novel DNA fingerprinting techniques for the detection and characterization of genetic variation in vegetatively propagated crops. Proceedings of a final research co-ordination meeting

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-10-01

    Vegetative propagated crops, such as banana and platain, sweet potato, yam, sugarcane and cassava, represent important sources of food in the developing countries. Although some of these crops may produce seeds, they must for practical purposes be propagated vegetatively. As normal plant breeding strategies based on genetic hybridization are of limited value or not applicable to such crops, it is necessary to assess the genetic diversity already existing in these crops and to design breeding strategies accordingly. If the existing genetic variation is shown to be too narrow for breeding purposes, one promising possibility for the introduction of genetic variability is the use of mutations induced by radiation or chemical mutagens. This CRP focused on: the detection of genetic diversity induced by mutagenic treatment or in vitro culture; the development of crop-specific markers; and increasing co-operation between molecular biologists in advanced laboratories and plant breeders and molecular biologists in the developing countries. The success of this CRP is evidenced by the introduction and application of new molecular methods by laboratories in developing countries, specially for the analysis of local crop genetic diversity. These exciting preliminary results show the potential for applications in crop improvement but much work remains to be done. Many of the vegetatively propagated species are ``orphan crops``, under-investigated on the international level. The development of new uses of transgenesis for the development of edible vaccines should not be overlooked. The challenge that remains is in the application of these new tools for practical end-user oriented improvements in vegetatively propagated crops. The present publication summarizes the third and final Research Co-ordination Meeting on the Use of Novel DNA Fingerprinting Techniques for the Detection and Characterization of Genetic Variation in Vegetatively Propagated Crops Refs, figs, tabs

  18. New STS molecular markers for assessment of genetic diversity and DNA fingerprinting in hop (Humulus lupulus L.).

    Science.gov (United States)

    Patzak, Josef; Vrba, Lukás; Matousek, Jaroslav

    2007-01-01

    Molecular markers have been increasingly used in genetic studies of crop species for their applicability in breeding programs. In this work, we report on the development of new sequence-tagged site (STS) markers based on sequence information from several identified hop (Humulus lupulus L.) genes. We demonstrate the usefulness of these STS markers and compare them to SSRs for identifying hop genotypes and estimating genetic diversity in a collection of 68 hop cultivars from around the world. We found 3 individual gene variants (A, B, C) of the chs_H1 gene in this collection. The most frequent gene variant, B (AJ304877), was not detected in Mt. Hood, Glacier, and Horizon (US) cultivars. Gene variant A came from an American germplasm through wild hops. We found length polymorphism in intron 1 of the chs2 gene, and 4 different amplified markers were detected in PCRs. The chs3 gene was found in only one third of the cultivars. None of the variants of the studied CHS genes were found in Humulus japonicus. We detected 5 major gene variants of DNA-binding protein in the collection of H. lupulus cultivars and 2 others in H. japonicus. We also found 3 individual gene variants of an endochitinase gene. The distribution of gene variants did not correlate with any resistance. We proved that developed STS markers can be successfully used for the analysis of genetic diversity and can substitute and supplement SSR markers in hop.

  19. Fingerprint recognition with identical twin fingerprints.

    Science.gov (United States)

    Tao, Xunqiang; Chen, Xinjian; Yang, Xin; Tian, Jie

    2012-01-01

    Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6) images. Compared to the previous work, our contributions are summarized as follows: (1) Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2) Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3) A larger sample (83 pairs) was collected. (4) A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5) A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a) A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b) The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c) For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d) For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

  20. Fingerprint recognition with identical twin fingerprints.

    Directory of Open Access Journals (Sweden)

    Xunqiang Tao

    Full Text Available Fingerprint recognition with identical twins is a challenging task due to the closest genetics-based relationship existing in the identical twins. Several pioneers have analyzed the similarity between twins' fingerprints. In this work we continue to investigate the topic of the similarity of identical twin fingerprints. Our study was tested based on a large identical twin fingerprint database that contains 83 twin pairs, 4 fingers per individual and six impressions per finger: 3984 (83*2*4*6 images. Compared to the previous work, our contributions are summarized as follows: (1 Two state-of-the-art fingerprint identification methods: P071 and VeriFinger 6.1 were used, rather than one fingerprint identification method in previous studies. (2 Six impressions per finger were captured, rather than just one impression, which makes the genuine distribution of matching scores more realistic. (3 A larger sample (83 pairs was collected. (4 A novel statistical analysis, which aims at showing the probability distribution of the fingerprint types for the corresponding fingers of identical twins which have same fingerprint type, has been conducted. (5 A novel analysis, which aims at showing which finger from identical twins has higher probability of having same fingerprint type, has been conducted. Our results showed that: (a A state-of-the-art automatic fingerprint verification system can distinguish identical twins without drastic degradation in performance. (b The chance that the fingerprints have the same type from identical twins is 0.7440, comparing to 0.3215 from non-identical twins. (c For the corresponding fingers of identical twins which have same fingerprint type, the probability distribution of five major fingerprint types is similar to the probability distribution for all the fingers' fingerprint type. (d For each of four fingers of identical twins, the probability of having same fingerprint type is similar.

  1. Revisiting AFLP fingerprinting for an unbiased assessment of genetic structure and differentiation of taurine and zebu cattle

    Science.gov (United States)

    2014-01-01

    Background Descendants from the extinct aurochs (Bos primigenius), taurine (Bos taurus) and zebu cattle (Bos indicus) were domesticated 10,000 years ago in Southwestern and Southern Asia, respectively, and colonized the world undergoing complex events of admixture and selection. Molecular data, in particular genome-wide single nucleotide polymorphism (SNP) markers, can complement historic and archaeological records to elucidate these past events. However, SNP ascertainment in cattle has been optimized for taurine breeds, imposing limitations to the study of diversity in zebu cattle. As amplified fragment length polymorphism (AFLP) markers are discovered and genotyped as the samples are assayed, this type of marker is free of ascertainment bias. In order to obtain unbiased assessments of genetic differentiation and structure in taurine and zebu cattle, we analyzed a dataset of 135 AFLP markers in 1,593 samples from 13 zebu and 58 taurine breeds, representing nine continental areas. Results We found a geographical pattern of expected heterozygosity in European taurine breeds decreasing with the distance from the domestication centre, arguing against a large-scale introgression from European or African aurochs. Zebu cattle were found to be at least as diverse as taurine cattle. Western African zebu cattle were found to have diverged more from Indian zebu than South American zebu. Model-based clustering and ancestry informative markers analyses suggested that this is due to taurine introgression. Although a large part of South American zebu cattle also descend from taurine cows, we did not detect significant levels of taurine ancestry in these breeds, probably because of systematic backcrossing with zebu bulls. Furthermore, limited zebu introgression was found in Podolian taurine breeds in Italy. Conclusions The assessment of cattle diversity reported here contributes an unbiased global view to genetic differentiation and structure of taurine and zebu cattle

  2. Chemical Differentiation of Dendrobium officinale and Dendrobium devonianum by Using HPLC Fingerprints, HPLC-ESI-MS, and HPTLC Analyses

    Science.gov (United States)

    Ye, Zi; Dai, Jia-Rong; Zhang, Cheng-Gang; Lu, Ye; Wu, Lei-Lei; Gong, Amy G. W.; Wang, Zheng-Tao

    2017-01-01

    The stems of Dendrobium officinale Kimura et Migo (Dendrobii Officinalis Caulis) have a high medicinal value as a traditional Chinese medicine (TCM). Because of the limited supply, D. officinale is a high priced TCM, and therefore adulterants are commonly found in the herbal market. The dried stems of a closely related Dendrobium species, Dendrobium devonianum Paxt., are commonly used as the substitute; however, there is no effective method to distinguish the two Dendrobium species. Here, a high performance liquid chromatography (HPLC) method was successfully developed and applied to differentiate D. officinale and D. devonianum by comparing the chromatograms according to the characteristic peaks. A HPLC coupled with electrospray ionization multistage mass spectrometry (HPLC-ESI-MS) method was further applied for structural elucidation of 15 flavonoids, 5 phenolic acids, and 1 lignan in D. officinale. Among these flavonoids, 4 flavonoid C-glycosides were firstly reported in D. officinale, and violanthin and isoviolanthin were identified to be specific for D. officinale compared with D. devonianum. Then, two representative components were used as chemical markers. A rapid and reliable high performance thin layer chromatography (HPTLC) method was applied in distinguishing D. officinale from D. devonianum. The results of this work have demonstrated that these developed analytical methods can be used to discriminate D. officinale and D. devonianum effectively and conveniently. PMID:28769988

  3. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.

    Science.gov (United States)

    Ririe, K M; Rasmussen, R P; Wittwer, C T

    1997-02-15

    A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.

  4. DNA methylation profiling of embryonic stem cell differentiation into the three germ layers.

    Science.gov (United States)

    Isagawa, Takayuki; Nagae, Genta; Shiraki, Nobuaki; Fujita, Takanori; Sato, Noriko; Ishikawa, Shumpei; Kume, Shoen; Aburatani, Hiroyuki

    2011-01-01

    Embryogenesis is tightly regulated by multiple levels of epigenetic regulation such as DNA methylation, histone modification, and chromatin remodeling. DNA methylation patterns are erased in primordial germ cells and in the interval immediately following fertilization. Subsequent developmental reprogramming occurs by de novo methylation and demethylation. Variance in DNA methylation patterns between different cell types is not well understood. Here, using methylated DNA immunoprecipitation and tiling array technology, we have comprehensively analyzed DNA methylation patterns at proximal promoter regions in mouse embryonic stem (ES) cells, ES cell-derived early germ layers (ectoderm, endoderm and mesoderm) and four adult tissues (brain, liver, skeletal muscle and sperm). Most of the methylated regions are methylated across all three germ layers and in the three adult somatic tissues. This commonly methylated gene set is enriched in germ cell-associated genes that are generally transcriptionally inactive in somatic cells. We also compared DNA methylation patterns by global mapping of histone H3 lysine 4/27 trimethylation, and found that gain of DNA methylation correlates with loss of histone H3 lysine 4 trimethylation. Our combined findings indicate that differentiation of ES cells into the three germ layers is accompanied by an increased number of commonly methylated DNA regions and that these tissue-specific alterations in methylation occur for only a small number of genes. DNA methylation at the proximal promoter regions of commonly methylated genes thus appears to be an irreversible mark which functions to fix somatic lineage by repressing the transcription of germ cell-specific genes.

  5. DNA Differential Diagnosis of Taeniasis and Cysticercosis by Multiplex PCR

    Science.gov (United States)

    Yamasaki, Hiroshi; Allan, James C.; Sato, Marcello Otake; Nakao, Minoru; Sako, Yasuhito; Nakaya, Kazuhiro; Qiu, Dongchuan; Mamuti, Wulamu; Craig, Philip S.; Ito, Akira

    2004-01-01

    Multiplex PCR was established for differential diagnosis of taeniasis and cysticercosis, including their causative agents. For identification of the parasites, multiplex PCR with cytochrome c oxidase subunit 1 gene yielded evident differential products unique for Taenia saginata and Taenia asiatica and for American/African and Asian genotypes of Taenia solium with molecular sizes of 827, 269, 720, and 984 bp, respectively. In the PCR-based detection of tapeworm carriers using fecal samples, the diagnostic markers were detected from 7 of 14 and 4 of 9 T. solium carriers from Guatemala and Indonesia, respectively. Test sensitivity may have been reduced by the length of time (up to 12 years) that samples were stored and/or small sample volumes (ca. 30 to 50 mg). However, the diagnostic markers were detected by nested PCR in five worm carriers from Guatemalan cases that were found to be negative by multiplex PCR. It was noteworthy that a 720 bp-diagnostic marker was detected from a T. solium carrier who was egg-free, implying that it is possible to detect worm carriers and treat before mature gravid proglottids are discharged. In contrast to T. solium carriers, 827-bp markers were detected by multiplex PCR in all T. saginata carriers. The application of the multiplex PCR would be useful not only for surveillance of taeniasis and cysticercosis control but also for the molecular epidemiological survey of these cestode infections. PMID:14766815

  6. Differential Immuno-Reactivity to Genomic DNA, RNA and Mitochondrial DNA is Associated with Auto-Immunity

    Directory of Open Access Journals (Sweden)

    Vilena V. Ivanova

    2014-12-01

    Full Text Available Background: Circulating auto-reactive antibodies are hallmark features of auto-immune diseases, however little is known with respect to the specificity of such bio-markers. In the present study, we investigated the specificity of anti-nucleic acid antibodies in the blood of subjects with systemic lupus erythematosus (SLE and healthy controls. Methods: Sera from 12 SLE cases and 8 controls were evaluated for immuno-reactivity to purified RNA, DNA and mitochondrial DNA (mtDNA by enzyme-linked immuno-sorbent assay (ELISA. Results: As expected, immuno-reactivity to total nucleic acids was significantly higher in subjects with SLE when compared to healthy controls, however a clear distinction was observed among the various nucleic acid sub-types, with sera from SLE subjects displaying the greatest immuno-reactivity to RNA followed by mtDNA and then total DNA. Conclusion: The identification of auto-reactive antibodies can serve as highly sensitive biomarkers, although their specificity may not always allow diagnostic certainty. The knowledge that auto-antibodies in subjects with SLE display differential immuno-reactivity may help to improve existing diagnostics and may lead to a better understanding of the pathogenesis of auto-immune disorders.

  7. [Preparation of the cDNA microarray on the differential expressed cDNA of senescence-accelerated mouse's hippocampus].

    Science.gov (United States)

    Cheng, Xiao-Rui; Zhou, Wen-Xia; Zhang, Yong-Xiang

    2006-05-01

    Alzheimer' s disease (AD) is the most common form of dementia in the elderly. AD is an invariably fatal neurodegenerative disorder with no effective treatment. Senescence-accelerated mouse prone 8 (SAMP8) is a model for studying age-related cognitive impairments and also is a good model to study brain aging and one of mouse model of AD. The technique of cDNA microarray can monitor the expression levels of thousands of genes simultaneously and can be used to study AD with the character of multi-mechanism, multi-targets and multi-pathway. In order to disclose the mechanism of AD and find the drug targets of AD, cDNA microarray containing 3136 cDNAs amplified from the suppression subtracted cDNA library of hippocampus of SAMP8 and SAMR1 was prepared with 16 blocks and 14 x 14 pins, the housekeeping gene beta-actin and G3PDH as inner conference. The background of this microarray was low and unanimous, and dots divided evenly. The conditions of hybridization and washing were optimized during the hybridization of probe and target molecule. After the data of hybridization analysis, the differential expressed cDNAs were sequenced and analyzed by the bioinformatics, and some of genes were quantified by the real time RT-PCR and the reliability of this cDNA microarray were validated. This cDNA microarray may be the good means to select the differential expressed genes and disclose the molecular mechanism of SAMP8's brain aging and AD.

  8. Advanced Fingerprint Analysis Project Fingerprint Constituents

    Energy Technology Data Exchange (ETDEWEB)

    GM Mong; CE Petersen; TRW Clauss

    1999-10-29

    The work described in this report was focused on generating fundamental data on fingerprint components which will be used to develop advanced forensic techniques to enhance fluorescent detection, and visualization of latent fingerprints. Chemical components of sweat gland secretions are well documented in the medical literature and many chemical techniques are available to develop latent prints, but there have been no systematic forensic studies of fingerprint sweat components or of the chemical and physical changes these substances undergo over time.

  9. Integrating prior knowledge in multiple testing under dependence with applications to detecting differential DNA methylation.

    Science.gov (United States)

    Kuan, Pei Fen; Chiang, Derek Y

    2012-09-01

    DNA methylation has emerged as an important hallmark of epigenetics. Numerous platforms including tiling arrays and next generation sequencing, and experimental protocols are available for profiling DNA methylation. Similar to other tiling array data, DNA methylation data shares the characteristics of inherent correlation structure among nearby probes. However, unlike gene expression or protein DNA binding data, the varying CpG density which gives rise to CpG island, shore and shelf definition provides exogenous information in detecting differential methylation. This article aims to introduce a robust testing and probe ranking procedure based on a nonhomogeneous hidden Markov model that incorporates the above-mentioned features for detecting differential methylation. We revisit the seminal work of Sun and Cai (2009, Journal of the Royal Statistical Society: Series B (Statistical Methodology)71, 393-424) and propose modeling the nonnull using a nonparametric symmetric distribution in two-sided hypothesis testing. We show that this model improves probe ranking and is robust to model misspecification based on extensive simulation studies. We further illustrate that our proposed framework achieves good operating characteristics as compared to commonly used methods in real DNA methylation data that aims to detect differential methylation sites. © 2012, The International Biometric Society.

  10. Tools for quality control of fingerprint databases

    Science.gov (United States)

    Swann, B. Scott; Libert, John M.; Lepley, Margaret A.

    2010-04-01

    Integrity of fingerprint data is essential to biometric and forensic applications. Accordingly, the FBI's Criminal Justice Information Services (CJIS) Division has sponsored development of software tools to facilitate quality control functions relative to maintaining its fingerprint data assets inherent to the Integrated Automated Fingerprint Identification System (IAFIS) and Next Generation Identification (NGI). This paper provides an introduction of two such tools. The first FBI-sponsored tool was developed by the National Institute of Standards and Technology (NIST) and examines and detects the spectral signature of the ridge-flow structure characteristic of friction ridge skin. The Spectral Image Validation/Verification (SIVV) utility differentiates fingerprints from non-fingerprints, including blank frames or segmentation failures erroneously included in data; provides a "first look" at image quality; and can identify anomalies in sample rates of scanned images. The SIVV utility might detect errors in individual 10-print fingerprints inaccurately segmented from the flat, multi-finger image acquired by one of the automated collection systems increasing in availability and usage. In such cases, the lost fingerprint can be recovered by re-segmentation from the now compressed multi-finger image record. The second FBI-sponsored tool, CropCoeff was developed by MITRE and thoroughly tested via NIST. CropCoeff enables cropping of the replacement single print directly from the compressed data file, thus avoiding decompression and recompression of images that might degrade fingerprint features necessary for matching.

  11. Prognostic Classifier Based on Genome-Wide DNA Methylation Profiling in Well-Differentiated Thyroid Tumors

    DEFF Research Database (Denmark)

    Bisarro Dos Reis, Mariana; Barros-Filho, Mateus Camargo; Marchi, Fábio Albuquerque

    2017-01-01

    Context: Even though the majority of well-differentiated thyroid carcinoma (WDTC) is indolent, a number of cases display an aggressive behavior. Cumulative evidence suggests that the deregulation of DNA methylation has the potential to point out molecular markers associated with worse prognosis. ...

  12. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  13. Mitochondrial DNA differentiates Alzheimer's disease from Creutzfeldt-Jakob disease.

    Science.gov (United States)

    Podlesniy, Petar; Llorens, Franc; Golanska, Ewa; Sikorska, Beata; Liberski, Pawel; Zerr, Inga; Trullas, Ramon

    2016-05-01

    Low content of cell-free mitochondrial DNA (mtDNA) in cerebrospinal fluid (CSF) is a biomarker of early stage Alzheimer's disease (AD), but whether mtDNA is altered in a rapid neurodegenerative dementia such as Creutzfeldt-Jakob disease is unknown. CSF mtDNA was measured using digital polymerase chain reaction (dPCR) in two independent cohorts comprising a total of 112 patients diagnosed with sporadic Creutzfeldt-Jakob disease (sCJD), probable AD, or non-Alzheimer's type dementia. Patients with AD exhibit low mtDNA content in CSF compared with patients diagnosed with sCJD or with non-Alzheimer's type dementias. The CSF concentration of mtDNA does not correlate with Aβ, t-tau, p-tau, and 14-3-3 protein levels in CSF. Low-CSF mtDNA is not a consequence of brain damage and allows the differential diagnosis of AD from sCJD and other dementias. These results support the hypothesis that mtDNA in CSF is a pathophysiological biomarker of AD. Copyright © 2015 Alzheimer's Association. Published by Elsevier Inc. All rights reserved.

  14. Genome-wide signatures of differential DNA methylation in pediatric acute lymphoblastic leukemia

    DEFF Research Database (Denmark)

    Nordlund, Jessica; Bäcklin, Christofer L; Wahlberg, Per

    2013-01-01

    BACKGROUND: Although aberrant DNA methylation has been observed previously in acute lymphoblastic leukemia (ALL), the patterns of differential methylation have not been comprehensively determined in all subtypes of ALL on a genome-wide scale. The relationship between DNA methylation, cytogenetic...... background, drug resistance and relapse in ALL is poorly understood. RESULTS: We surveyed the DNA methylation levels of 435,941 CpG sites in samples from 764 children at diagnosis of ALL and from 27 children at relapse. This survey uncovered four characteristic methylation signatures. First, compared...... cells at relapse, compared with matched samples at diagnosis. Analysis of relapse-free survival identified CpG sites with subtype-specific differential methylation that divided the patients into different risk groups, depending on their methylation status. CONCLUSIONS: Our results suggest an important...

  15. DNA-damage-induced differentiation of leukaemic cells as an anti-cancer barrier.

    Science.gov (United States)

    Santos, Margarida A; Faryabi, Robert B; Ergen, Aysegul V; Day, Amanda M; Malhowski, Amy; Canela, Andres; Onozawa, Masahiro; Lee, Ji-Eun; Callen, Elsa; Gutierrez-Martinez, Paula; Chen, Hua-Tang; Wong, Nancy; Finkel, Nadia; Deshpande, Aniruddha; Sharrow, Susan; Rossi, Derrick J; Ito, Keisuke; Ge, Kai; Aplan, Peter D; Armstrong, Scott A; Nussenzweig, André

    2014-10-02

    Self-renewal is the hallmark feature both of normal stem cells and cancer stem cells. Since the regenerative capacity of normal haematopoietic stem cells is limited by the accumulation of reactive oxygen species and DNA double-strand breaks, we speculated that DNA damage might also constrain leukaemic self-renewal and malignant haematopoiesis. Here we show that the histone methyl-transferase MLL4, a suppressor of B-cell lymphoma, is required for stem-cell activity and an aggressive form of acute myeloid leukaemia harbouring the MLL-AF9 oncogene. Deletion of MLL4 enhances myelopoiesis and myeloid differentiation of leukaemic blasts, which protects mice from death related to acute myeloid leukaemia. MLL4 exerts its function by regulating transcriptional programs associated with the antioxidant response. Addition of reactive oxygen species scavengers or ectopic expression of FOXO3 protects MLL4(-/-) MLL-AF9 cells from DNA damage and inhibits myeloid maturation. Similar to MLL4 deficiency, loss of ATM or BRCA1 sensitizes transformed cells to differentiation, suggesting that myeloid differentiation is promoted by loss of genome integrity. Indeed, we show that restriction-enzyme-induced double-strand breaks are sufficient to induce differentiation of MLL-AF9 blasts, which requires cyclin-dependent kinase inhibitor p21(Cip1) (Cdkn1a) activity. In summary, we have uncovered an unexpected tumour-promoting role of genome guardians in enforcing the oncogene-induced differentiation blockade in acute myeloid leukaemia.

  16. Discrimination of Single-Copy IS6110 DNA Fingerprints of Mycobacterium tuberculosis Isolates by High-Resolution Minisatellite-Based Typing

    OpenAIRE

    Lee, Ann S. G.; Tang, Lynn L. H.; Lim, Irene H. K.; Bellamy, Richard; Wong, Sin-Yew

    2002-01-01

    Seven isoniazid-resistant isolates with mutations in the NADH dehydrogenase (ndh) gene were molecularly typed by IS6110-based restriction fragment length polymorphism analysis. All seven isolates with the R268H mutation had identical 1.4-kb IS6110 fingerprints. High-resolution minisatellite-based typing discriminated five of these isolates; two isolates were identical.

  17. Discrimination of single-copy IS6110 DNA fingerprints of Mycobacterium tuberculosis isolates by high-resolution minisatellite-based typing.

    Science.gov (United States)

    Lee, Ann S G; Tang, Lynn L H; Lim, Irene H K; Bellamy, Richard; Wong, Sin-Yew

    2002-02-01

    Seven isoniazid-resistant isolates with mutations in the NADH dehydrogenase (ndh) gene were molecularly typed by IS6110-based restriction fragment length polymorphism analysis. All seven isolates with the R268H mutation had identical 1.4-kb IS6110 fingerprints. High-resolution minisatellite-based typing discriminated five of these isolates; two isolates were identical.

  18. Construction and bootstrap analysis of DNA fingerprinting-based phylogenetic trees with the freeware program FreeTree: application to trichomonad parasites

    Czech Academy of Sciences Publication Activity Database

    Hampl, V.; Pavlíček, Adam; Flegr, J.

    2001-01-01

    Roč. 51, - (2001), s. 731-735 ISSN 1466-5026 R&D Projects: GA MŠk VS96142 Grant - others:GA UK(XC) 107/1998 Keywords : FreeTree software * fingerprinting * Trichomonas Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.004, year: 2001

  19. Development of taxon-specific sequence characterized amplified region (SCAR) markers based on actin sequences and DNA amplification fingerprinting (DAF): a case study in the Phoma exigua species complex.

    Science.gov (United States)

    Aveskamp, Maikel M; Woudenberg, Joyce H C; de Gruyter, Johannes; Turco, Elena; Groenewald, Johannes Z; Crous, Pedro W

    2009-05-01

    Phoma exigua is considered to be an assemblage of at least nine varieties that are mainly distinguished on the basis of host specificity and pathogenicity. However, these varieties are also reported to be weak pathogens and secondary invaders on non-host tissue. In practice, it is difficult to distinguish P. exigua from its close relatives and to correctly identify isolates up to the variety level, because of their low genetic variation and high morphological similarity. Because of quarantine issues and phytosanitary measures, a robust DNA-based tool is required for accurate and rapid identification of the separate taxa in this species complex. The present study therefore aims to develop such a tool based on unique nucleotide sequence identifiers. More than 60 strains of P. exigua and related species were compared in terms of partial actin gene sequences, or analysed using DNA amplification fingerprinting (DAF) with short, arbitrary, mini-hairpin primers. Fragments in the fingerprint unique to a single taxon were identified, purified and sequenced. Alignment of the sequence data and subsequent primer trials led to the identification of taxon-specific sequence characterized amplified regions (SCARs), and to a set of specific oligonucleotide combinations that can be used to identify these organisms in plant quarantine inspections.

  20. Distorted Fingerprint Verification System

    Directory of Open Access Journals (Sweden)

    Divya KARTHIKAESHWARAN

    2011-01-01

    Full Text Available Fingerprint verification is one of the most reliable personal identification methods. Fingerprint matching is affected by non-linear distortion introduced in fingerprint impression during the image acquisition process. This non-linear deformation changes both the position and orientation of minutiae. The proposed system operates in three stages: alignment based fingerprint matching, fuzzy clustering and classifier framework. First, an enhanced input fingerprint image has been aligned with the template fingerprint image and matching score is computed. To improve the performance of the system, a fuzzy clustering based on distance and density has been used to cluster the feature set obtained from the fingerprint matcher. Finally a classifier framework has been developed and found that cost sensitive classifier produces better results. The system has been evaluated on fingerprint database and the experimental result shows that system produces a verification rate of 96%. This system plays an important role in forensic and civilian applications.

  1. Differentiation of Bread Made with Whole Grain and Refined Wheat (T. aestivum) Flour Using LC/MS-based chromatographic Fingerprinting and Chemometric Approaches

    Science.gov (United States)

    A fuzzy chromatography mass spectrometric (FCMS) fingerprinting method combined with chemometric analysis was established to diffrentiate between whole wheat (WW) flours and refined wheat (RW) flour, and the breads made from them. The chemical compositions of the bread samples were profiled using h...

  2. Touchless fingerprint biometrics

    CERN Document Server

    Labati, Ruggero Donida; Scotti, Fabio

    2015-01-01

    Offering the first comprehensive analysis of touchless fingerprint-recognition technologies, Touchless Fingerprint Biometrics gives an overview of the state of the art and describes relevant industrial applications. It also presents new techniques to efficiently and effectively implement advanced solutions based on touchless fingerprinting.The most accurate current biometric technologies in touch-based fingerprint-recognition systems require a relatively high level of user cooperation to acquire samples of the concerned biometric trait. With the potential for reduced constraints, reduced hardw

  3. D1/D2 Domain of Large-Subunit Ribosomal DNA for Differentiation of Orpinomyces spp.▿

    Science.gov (United States)

    Dagar, Sumit S.; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K.

    2011-01-01

    This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation. PMID:21784906

  4. Fingerprint pores extractor

    CSIR Research Space (South Africa)

    Mngenge, NA

    2012-11-01

    Full Text Available , this is not always the case because of diseases and hash working conditions that affect fingerprints. In order to maintain high level of security independent of varying fingerprint image quality research suggests the use of other fingerprint features to compliment...

  5. Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

    Science.gov (United States)

    Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

    2017-01-01

    Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

  6. A colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA based on silver nanoclusters and unmodified gold nanoparticles

    Science.gov (United States)

    Qu, Fei; Chen, Zeqiu; You, Jinmao; Song, Cuihua

    2018-05-01

    Human telomere DNA plays a vital role in genome integrity control and carcinogenesis as an indication for extensive cell proliferation. Herein, silver nanoclusters (Ag NCs) templated by polymer and unmodified gold nanoparticles (Au NPs) are designed as a new colorimetric platform for sensitively differentiating telomere DNA with different lengths, monitoring G-quadruplex and dsDNA. Ag NCs can produce the aggregation of Au NPs, so the color of Au NPs changes to blue and the absorption peak moves to 700 nm. While the telomere DNA can protect Au NPs from aggregation, the color turns to red again and the absorption band blue shift. Benefiting from the obvious color change, we can differentiate the length of telomere DNA by naked eyes. As the length of telomere DNA is longer, the variation of color becomes more noticeable. The detection limits of telomere DNA containing 10, 22, 40, 64 bases are estimated to be 1.41, 1.21, 0.23 and 0.22 nM, respectively. On the other hand, when telomere DNA forms G-quadruplex in the presence of K+, or dsDNA with complementary sequence, both G-quadruplex and dsDNA can protect Au NPs better than the unfolded telomere DNA. Hence, a new colorimetric platform for monitoring structure conversion of DNA is established by Ag NCs-Au NPs system, and to prove this type of application, a selective K+ sensor is developed.

  7. Using DNA barcoding to differentiate invasive Dreissena species (Mollusca, Bivalvia).

    Science.gov (United States)

    Marescaux, Jonathan; Van Doninck, Karine

    2013-12-30

    The zebra mussel (Dreissena polymorpha) and the quagga mussel (Dreissena rostriformis bugensis) are considered as the most competitive invaders in freshwaters of Europe and North America. Although shell characteristics exist to differentiate both species, phenotypic plasticity in the genus Dreissena does not always allow a clear identification. Therefore, the need to find an accurate identification method is essential. DNA barcoding has been proven to be an adequate procedure to discriminate species. The cytochrome c oxidase subunit I mitochondrial gene (COI) is considered as the standard barcode for animals. We tested the use of this gene as an efficient DNA barcode and found that it allow rapid and accurate identification of adult Dreissena individuals.

  8. Evaluation of errors in determination of DNA melting curve registered with differential scanning calorimetry

    International Nuclear Information System (INIS)

    Lando, D.Y.; Fridman, A.S.; Galyuk, E.N.; Dalyan, Y.B.; Grigoryan, I.E.; Haroutiunian, S.G.

    2013-01-01

    The differential scanning calorimetry (DSC) is more sensitive than UV absorption spectrophotometry as a tool for the measurement of DNA melting curves. The advantage of DSC is a direct determination of differential melting curves (DMC) obtained without numerical differentiation. However, the difference between the helix-coil transition enthalpies of AT and GC base pairs can cause distortions in the shape of melting curve. Up to date, the errors caused by those distortions were not evaluated. In this study, a simple procedure of recalculation of a calorimetric DMC into a real DMC is developed. It demonstrates that the 'real' melting curve and differential melting curve deviate very slightly from the same two curves calculated from DSC data. The melting temperature and the temperature melting range are usually the same even if the difference in the enthalpies is several times higher than a real one

  9. Fingerprints in cancer cells

    International Nuclear Information System (INIS)

    Servomaa, K.

    1994-01-01

    Gene research has shown that factors causing cancer, or carcinogens, may leave marks typical of each particular carcinogen (fingerprints) in the genotype of the cell. Radiation, for instance, may leave such fingerprints in a cancer cell. In particular, the discovery of a gene called p53 has yielded much new information on fingerprints. It has been discovered, for example, that toxic fungus and UV-radiation each leave fingerprints in the p53 gene. Based on the detection of fingerprints, it may be possible in the future to tell a cancer patient what factor had trigged the maglinancy

  10. Differential Genetic Associations for Systemic Lupus Erythematosus Based on Anti–dsDNA Autoantibody Production

    Science.gov (United States)

    Chung, Sharon A.; Taylor, Kimberly E.; Graham, Robert R.; Nititham, Joanne; Lee, Annette T.; Ortmann, Ward A.; Jacob, Chaim O.; Alarcón-Riquelme, Marta E.; Tsao, Betty P.; Harley, John B.; Gaffney, Patrick M.; Moser, Kathy L.; Petri, Michelle; Demirci, F. Yesim; Kamboh, M. Ilyas; Manzi, Susan; Gregersen, Peter K.; Langefeld, Carl D.; Behrens, Timothy W.; Criswell, Lindsey A.

    2011-01-01

    Systemic lupus erythematosus (SLE) is a clinically heterogeneous, systemic autoimmune disease characterized by autoantibody formation. Previously published genome-wide association studies (GWAS) have investigated SLE as a single phenotype. Therefore, we conducted a GWAS to identify genetic factors associated with anti–dsDNA autoantibody production, a SLE–related autoantibody with diagnostic and clinical importance. Using two independent datasets, over 400,000 single nucleotide polymorphisms (SNPs) were studied in a total of 1,717 SLE cases and 4,813 healthy controls. Anti–dsDNA autoantibody positive (anti–dsDNA +, n = 811) and anti–dsDNA autoantibody negative (anti–dsDNA –, n = 906) SLE cases were compared to healthy controls and to each other to identify SNPs associated specifically with these SLE subtypes. SNPs in the previously identified SLE susceptibility loci STAT4, IRF5, ITGAM, and the major histocompatibility complex were strongly associated with anti–dsDNA + SLE. Far fewer and weaker associations were observed for anti–dsDNA – SLE. For example, rs7574865 in STAT4 had an OR for anti–dsDNA + SLE of 1.77 (95% CI 1.57–1.99, p = 2.0E-20) compared to an OR for anti–dsDNA – SLE of 1.26 (95% CI 1.12–1.41, p = 2.4E-04), with pheterogeneity<0.0005. SNPs in the SLE susceptibility loci BANK1, KIAA1542, and UBE2L3 showed evidence of association with anti–dsDNA + SLE and were not associated with anti–dsDNA – SLE. In conclusion, we identified differential genetic associations with SLE based on anti–dsDNA autoantibody production. Many previously identified SLE susceptibility loci may confer disease risk through their role in autoantibody production and be more accurately described as autoantibody propensity loci. Lack of strong SNP associations may suggest that other types of genetic variation or non-genetic factors such as environmental exposures have a greater impact on susceptibility to anti–dsDNA – SLE. PMID

  11. Differential genetic associations for systemic lupus erythematosus based on anti-dsDNA autoantibody production.

    Directory of Open Access Journals (Sweden)

    Sharon A Chung

    2011-03-01

    Full Text Available Systemic lupus erythematosus (SLE is a clinically heterogeneous, systemic autoimmune disease characterized by autoantibody formation. Previously published genome-wide association studies (GWAS have investigated SLE as a single phenotype. Therefore, we conducted a GWAS to identify genetic factors associated with anti-dsDNA autoantibody production, a SLE-related autoantibody with diagnostic and clinical importance. Using two independent datasets, over 400,000 single nucleotide polymorphisms (SNPs were studied in a total of 1,717 SLE cases and 4,813 healthy controls. Anti-dsDNA autoantibody positive (anti-dsDNA +, n = 811 and anti-dsDNA autoantibody negative (anti-dsDNA -, n = 906 SLE cases were compared to healthy controls and to each other to identify SNPs associated specifically with these SLE subtypes. SNPs in the previously identified SLE susceptibility loci STAT4, IRF5, ITGAM, and the major histocompatibility complex were strongly associated with anti-dsDNA + SLE. Far fewer and weaker associations were observed for anti-dsDNA - SLE. For example, rs7574865 in STAT4 had an OR for anti-dsDNA + SLE of 1.77 (95% CI 1.57-1.99, p = 2.0E-20 compared to an OR for anti-dsDNA - SLE of 1.26 (95% CI 1.12-1.41, p = 2.4E-04, with p(heterogeneity<0.0005. SNPs in the SLE susceptibility loci BANK1, KIAA1542, and UBE2L3 showed evidence of association with anti-dsDNA + SLE and were not associated with anti-dsDNA - SLE. In conclusion, we identified differential genetic associations with SLE based on anti-dsDNA autoantibody production. Many previously identified SLE susceptibility loci may confer disease risk through their role in autoantibody production and be more accurately described as autoantibody propensity loci. Lack of strong SNP associations may suggest that other types of genetic variation or non-genetic factors such as environmental exposures have a greater impact on susceptibility to anti-dsDNA - SLE.

  12. Differentially Methylated DNA Regions in Monozygotic Twin Pairs Discordant for Rheumatoid Arthritis

    DEFF Research Database (Denmark)

    Svendsen, Anders J; Gervin, Kristina; Lyle, Robert

    2016-01-01

    : Smoking was significantly associated with hypomethylation of a DMR overlapping the promoter region of the RNF5 and the AGPAT1, which are implicated in inflammation and autoimmunity, whereas DMARD treatment induced hypermethylation of the same region. Additionally, the promotor region of both S100A6......OBJECTIVES: In an explorative epigenome-wide association study (EWAS) to search for gene independent, differentially methylated DNA positions and regions (DMRs) associated with rheumatoid arthritis (RA) by studying monozygotic (MZ) twin pairs discordant for RA. METHODS: Genomic DNA was isolated......: We identified several differentially methylated regions associated with RA, which may represent environmental effects or consequences of the disease and plausible biological pathways pertinent to the pathogenesis of RA....

  13. H3K4me1 marks DNA regions hypomethylated during aging in human stem and differentiated cells.

    Science.gov (United States)

    Fernández, Agustín F; Bayón, Gustavo F; Urdinguio, Rocío G; Toraño, Estela G; García, María G; Carella, Antonella; Petrus-Reurer, Sandra; Ferrero, Cecilia; Martinez-Camblor, Pablo; Cubillo, Isabel; García-Castro, Javier; Delgado-Calle, Jesús; Pérez-Campo, Flor M; Riancho, José A; Bueno, Clara; Menéndez, Pablo; Mentink, Anouk; Mareschi, Katia; Claire, Fabian; Fagnani, Corrado; Medda, Emanuela; Toccaceli, Virgilia; Brescianini, Sonia; Moran, Sebastián; Esteller, Manel; Stolzing, Alexandra; de Boer, Jan; Nisticò, Lorenza; Stazi, Maria A; Fraga, Mario F

    2015-01-01

    In differentiated cells, aging is associated with hypermethylation of DNA regions enriched in repressive histone post-translational modifications. However, the chromatin marks associated with changes in DNA methylation in adult stem cells during lifetime are still largely unknown. Here, DNA methylation profiling of mesenchymal stem cells (MSCs) obtained from individuals aged 2 to 92 yr identified 18,735 hypermethylated and 45,407 hypomethylated CpG sites associated with aging. As in differentiated cells, hypermethylated sequences were enriched in chromatin repressive marks. Most importantly, hypomethylated CpG sites were strongly enriched in the active chromatin mark H3K4me1 in stem and differentiated cells, suggesting this is a cell type-independent chromatin signature of DNA hypomethylation during aging. Analysis of scedasticity showed that interindividual variability of DNA methylation increased during aging in MSCs and differentiated cells, providing a new avenue for the identification of DNA methylation changes over time. DNA methylation profiling of genetically identical individuals showed that both the tendency of DNA methylation changes and scedasticity depended on nongenetic as well as genetic factors. Our results indicate that the dynamics of DNA methylation during aging depend on a complex mixture of factors that include the DNA sequence, cell type, and chromatin context involved and that, depending on the locus, the changes can be modulated by genetic and/or external factors. © 2015 Fernández et al.; Published by Cold Spring Harbor Laboratory Press.

  14. Differential DNA methylation patterns of polycystic ovarian syndrome in whole blood of Chinese women

    DEFF Research Database (Denmark)

    Li, Shuxia; Zhu, Dongyi; Duan, Hongmei

    2017-01-01

    As a universally common endocrinopathy in women of reproductive age, the polycystic ovarian syndrome is characterized by composite clinical phenotypes reflecting the contributions of reproductive impact of ovarian dysfunction and metabolic abnormalities with widely varying symptoms resulting from...... interference of the genome with the environment through integrative biological mechanisms including epigenetics. We have performed a genome-wide DNA methylation analysis on polycystic ovarian syndrome and identified a substantial number of genomic sites differentially methylated in the whole blood of PCOS...... in the DNA methylome from ovarian tissue under PCOS condition. Most importantly, our genome-wide profiling focusing on PCOS patients revealed a large number of DNA methylation sites and their enriched functional pathways significantly associated with diverse clinical features (levels of prolactin, estradiol...

  15. Differentiation of the guinea pig eye: nuclear ultrastructure, template activity and DNA content

    International Nuclear Information System (INIS)

    Schmalenberger, B.

    1980-01-01

    Nuclei of various cell types in the eye of embryonal and adult Guinea pigs were studied by means of electron microscopy, cytophotometry and autoradiography. Striking differences in condensation and arrangement of chromatin were found between the different tissues and cells. Several nuclear types were analyzed quantitatively with regard to their content of condensed and decondensed chromatin by means of electron microscopic morphometry. Structural differences in chromatin organization coincided with different nuclear DNA contents in various cell types of the retina, such as bipolar cells, Mueller cells, rods and cones, and the pigmented epithelium. The differences between DNA-Feulgen means obtained by cytophotometric analysis were highly significant. Template activity as shown by 3 H-uridine incorporation made evident than the rate of RNA synthesis is positively correlated with the quantity of decondensed chromatin. It is speculated that differentiation of the Guinea pig eye involves differential DNA synthesis, and that the extra-DNA could have some ''trigger'' function for the pattern of chromatin condensation and thus the pattern of gene expression. (author)

  16. Differential DNA Methylation Patterns Are Related to Phellogen Origin and Quality of Quercus suber Cork.

    Science.gov (United States)

    Inácio, Vera; Barros, Pedro M; Costa, Augusta; Roussado, Cristóvão; Gonçalves, Elsa; Costa, Rita; Graça, José; Oliveira, M Margarida; Morais-Cecílio, Leonor

    2017-01-01

    DNA methylation is thought to influence Quercus suber cork quality, which is the main constraint for its economic valorisation. However, a deep knowledge of the cytosine methylation patterns disclosing the epigenetic variability of trees with different cork quality types is totally missing. This study investigates the hypothesis that variations in DNA methylation contribute to differences in cork cellular characteristics directly related to original or traumatic phellogen activity. We used MSAPs (Methylation Sensitive Amplified Polymorphism) to assess DNA methylation patterns of cork and leaf tissues of Q. suber adult trees growing in three cork oak stands. The relationship between the detected polymorphisms and the diversity of cork quality traits was explored by a marker-trait analysis focusing on the most relevant quality characteristics. Populations differed widely in cork quality, but only slightly in degree of epigenetic differentiation. Four MSAP markers (1.3% of the total) were significantly associated with the most noteworthy quality traits: wood inclusions (nails) and porosity. This evidence supports the potential role of cytosine methylation in the modulation of differential phellogen activity either involved in localized cell death or in pore production, resulting in different cork qualities. Although, the underlying basis of the methylation polymorphism of loci affecting cork quality traits remain unclear, the disclosure of markers statistically associated with cork quality strengthens the potential role of DNA methylation in the regulation of these traits, namely at the phellogen level.

  17. DNA microarrays of baculovirus genomes: differential expression of viral genes in two susceptible insect cell lines.

    Science.gov (United States)

    Yamagishi, J; Isobe, R; Takebuchi, T; Bando, H

    2003-03-01

    We describe, for the first time, the generation of a viral DNA chip for simultaneous expression measurements of nearly all known open reading frames (ORFs) in the best-studied members of the family Baculoviridae, Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Bombyx mori nucleopolyhedrovirus (BmNPV). In this study, a viral DNA chip (Ac-BmNPV chip) was fabricated and used to characterize the viral gene expression profile for AcMNPV in different cell types. The viral chip is composed of microarrays of viral DNA prepared by robotic deposition of PCR-amplified viral DNA fragments on glass for ORFs in the NPV genome. Viral gene expression was monitored by hybridization to the DNA fragment microarrays with fluorescently labeled cDNAs prepared from infected Spodoptera frugiperda, Sf9 cells and Trichoplusia ni, TnHigh-Five cells, the latter a major producer of baculovirus and recombinant proteins. A comparison of expression profiles of known ORFs in AcMNPV elucidated six genes (ORF150, p10, pk2, and three late gene expression factor genes lef-3, p35 and lef- 6) the expression of each of which was regulated differently in the two cell lines. Most of these genes are known to be closely involved in the viral life cycle such as in DNA replication, late gene expression and the release of polyhedra from infected cells. These results imply that the differential expression of these viral genes accounts for the differences in viral replication between these two cell lines. Thus, these fabricated microarrays of NPV DNA which allow a rapid analysis of gene expression at the viral genome level should greatly speed the functional analysis of large genomes of NPV.

  18. Is mitochondrial DNA divergence of near easter crested newts, Triturus karelinii group, reflected by differentiation of skull shape

    NARCIS (Netherlands)

    Ivanovic, A.; Uzum, N.; Wielstra, B.M.; Olgun, K.; Litvinchuk, S.N.; Kalezic, M.L.; Arntzen, J.W.

    2013-01-01

    The Eurasian Triturus karelinii group of crested newts comprises three distinct, geographically coherent mitochondrial DNA lineages, designated as the eastern, central and western lineage. These three lineages are genetically as diverged as other, morphologically well-differentiated crested newt

  19. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  20. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  1. Accommodating error analysis in comparison and clustering of molecular fingerprints.

    OpenAIRE

    Salamon, H.; Segal, M. R.; Ponce de Leon, A.; Small, P. M.

    1998-01-01

    Molecular epidemiologic studies of infectious diseases rely on pathogen genotype comparisons, which usually yield patterns comprising sets of DNA fragments (DNA fingerprints). We use a highly developed genotyping system, IS6110-based restriction fragment length polymorphism analysis of Mycobacterium tuberculosis, to develop a computational method that automates comparison of large numbers of fingerprints. Because error in fragment length measurements is proportional to fragment length and is ...

  2. Genetic fingerprinting and phylogenetic diversity of Staphylococcus ...

    African Journals Online (AJOL)

    Genetic fingerprinting of 18 different isolates of Staphylococcus aureus from Nigeria using random amplified polymorphic DNA (RAPD) was carried out. Ten out of 100 Operon primers showed polymorphism among the isolates tested generating 88 bands, 51 of which were polymorphic with sizes ranging between 200 and ...

  3. Differentiation of Human Induced Pluripotent or Embryonic Stem Cells Decreases the DNA Damage Repair by Homologous Recombination

    Directory of Open Access Journals (Sweden)

    Kalpana Mujoo

    2017-11-01

    Full Text Available The nitric oxide (NO-cyclic GMP pathway contributes to human stem cell differentiation, but NO free radical production can also damage DNA, necessitating a robust DNA damage response (DDR to ensure cell survival. How the DDR is affected by differentiation is unclear. Differentiation of stem cells, either inducible pluripotent or embryonic derived, increased residual DNA damage as determined by γ-H2AX and 53BP1 foci, with increased S-phase-specific chromosomal aberration after exposure to DNA-damaging agents, suggesting reduced homologous recombination (HR repair as supported by the observation of decreased HR-related repair factor foci formation (RAD51 and BRCA1. Differentiated cells also had relatively increased fork stalling and R-loop formation after DNA replication stress. Treatment with NO donor (NOC-18, which causes stem cell differentiation has no effect on double-strand break (DSB repair by non-homologous end-joining but reduced DSB repair by HR. Present studies suggest that DNA repair by HR is impaired in differentiated cells.

  4. Differential scanning calorimetric study of the binding between native DNA and its primary water of hydration.

    Science.gov (United States)

    Marlowe, R. L.; Lukan, A. M.; Lee, S. A.; Anthony, L.; Rupprecht, A.

    1996-03-01

    Differential scanning calorimetry was used to measure the binding strength between calf-thymus DNA and its primary water of hydration. The specific heat of wet-spun films was found to have a broad endothermic transition near 80 ^oC and a sharp exothermic transition near 250 ^oC. The broad transition is believed to be mainly due to the breaking of the bonds of the strongly bound water of hydration. This transition was found to be reversible, as expected. Kissinger analysis indicates that the activation barrier for breaking the bonds of these water molecules is about 0.6 eV. The sharp transition appeared to be an indication of a thermal decomposition of the DNA. Samples taken above this transition lost mass, showed evidence of having melted, and had turned black in color. This transition is irreversible.

  5. Differential DNA methylation patterns of polycystic ovarian syndrome in whole blood of Chinese women.

    Science.gov (United States)

    Li, Shuxia; Zhu, Dongyi; Duan, Hongmei; Ren, Anran; Glintborg, Dorte; Andersen, Marianne; Skov, Vibe; Thomassen, Mads; Kruse, Torben; Tan, Qihua

    2017-03-28

    As a universally common endocrinopathy in women of reproductive age, the polycystic ovarian syndrome is characterized by composite clinical phenotypes reflecting the contributions of reproductive impact of ovarian dysfunction and metabolic abnormalities with widely varying symptoms resulting from interference of the genome with the environment through integrative biological mechanisms including epigenetics. We have performed a genome-wide DNA methylation analysis on polycystic ovarian syndrome and identified a substantial number of genomic sites differentially methylated in the whole blood of PCOS patients and healthy controls (52 sites, false discovery rate ovarian tissue under PCOS condition. Most importantly, our genome-wide profiling focusing on PCOS patients revealed a large number of DNA methylation sites and their enriched functional pathways significantly associated with diverse clinical features (levels of prolactin, estradiol, progesterone and menstrual cycle) that could serve as novel molecular basis of the clinical heterogeneity observed in PCOS women.

  6. Using DNA barcoding to differentiate invasive Dreissena species (Mollusca, Bivalvia

    Directory of Open Access Journals (Sweden)

    Jonathan Marescaux

    2013-12-01

    Full Text Available The zebra mussel (Dreissena polymorpha and the quagga mussel (Dreissena rostriformis bugensis are considered as the most competitive invaders in freshwaters of Europe and North America. Although shell characteristics exist to differentiate both species, phenotypic plasticity in the genus Dreissena does not always allow a clear identification. Therefore, the need to find an accurate identification method is essential. DNA barcoding has been proven to be an adequate procedure to discriminate species. The cytochrome c oxidase subunit 1 mitochondrial gene (COI is considered as the standard barcode for animals. We tested the use of this gene as an efficient DNA barcode and found that it allow rapid and accurate identification of adult Dreissena individuals.

  7. Recombination at DNA replication fork barriers is not universal and is differentially regulated by Swi1.

    Science.gov (United States)

    Pryce, David W; Ramayah, Soshila; Jaendling, Alessa; McFarlane, Ramsay J

    2009-03-24

    DNA replication stress has been implicated in the etiology of genetic diseases, including cancers. It has been proposed that genomic sites that inhibit or slow DNA replication fork progression possess recombination hotspot activity and can form potential fragile sites. Here we used the fission yeast, Schizosaccharomyces pombe, to demonstrate that hotspot activity is not a universal feature of replication fork barriers (RFBs), and we propose that most sites within the genome that form RFBs do not have recombination hotspot activity under nonstressed conditions. We further demonstrate that Swi1, the TIMELESS homologue, differentially controls the recombination potential of RFBs, switching between being a suppressor and an activator of recombination in a site-specific fashion.

  8. One input-class and two input-class classifications for differentiating olive oil from other edible vegetable oils by use of the normal-phase liquid chromatography fingerprint of the methyl-transesterified fraction.

    Science.gov (United States)

    Jiménez-Carvelo, Ana M; Pérez-Castaño, Estefanía; González-Casado, Antonio; Cuadros-Rodríguez, Luis

    2017-04-15

    A new method for differentiation of olive oil (independently of the quality category) from other vegetable oils (canola, safflower, corn, peanut, seeds, grapeseed, palm, linseed, sesame and soybean) has been developed. The analytical procedure for chromatographic fingerprinting of the methyl-transesterified fraction of each vegetable oil, using normal-phase liquid chromatography, is described and the chemometric strategies applied and discussed. Some chemometric methods, such as k-nearest neighbours (kNN), partial least squared-discriminant analysis (PLS-DA), support vector machine classification analysis (SVM-C), and soft independent modelling of class analogies (SIMCA), were applied to build classification models. Performance of the classification was evaluated and ranked using several classification quality metrics. The discriminant analysis, based on the use of one input-class, (plus a dummy class) was applied for the first time in this study. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Differential affinity of mammalian histone H1 somatic subtypes for DNA and chromatin

    Directory of Open Access Journals (Sweden)

    Mora Xavier

    2007-05-01

    chromatin suggest that differential affinity could be functionally relevant and thus contribute to the functional differentiation of the subtypes. The conservation of the relative affinities for SAR and non-SAR DNA, in spite of a strong preference for SAR sequences, indicates that differential affinity alone cannot be responsible for the heterogeneous distribution of some subtypes in cell nuclei.

  10. Photogrammetric fingerprint unwrapping

    Science.gov (United States)

    Paar, Gerhard; del Pilar Caballo Perucha, Maria; Bauer, Arnold; Nauschnegg, Bernhard

    2008-04-01

    Fingerprints are important biometric cues. Compared to conventional fingerprint sensors the use of contact-free stereoscopic image acquisition of the front-most finger segment has a set of advantages: Finger deformation is avoided, the entire relevant area for biometric use is covered, some technical aspects like sensor maintenance and cleaning are facilitated, and access to a three-dimensional reconstruction of the covered area is possible. We describe a photogrammetric workflow for nail-to-nail fingerprint reconstruction: A calibrated sensor setup with typically 5 cameras and dedicated illumination acquires adjacent stereo pairs. Using the silhouettes of the segmented finger a raw cylindrical model is generated. After preprocessing (shading correction, dust removal, lens distortion correction), each individual camera texture is projected onto the model. Image-to-image matching on these pseudo ortho images and dense 3D reconstruction obtains a textured cylindrical digital surface model with radial distances around the major axis and a grid size in the range of 25-50 µm. The model allows for objective fingerprint unwrapping and novel fingerprint matching algorithms since 3D relations between fingerprint features are available as additional cues. Moreover, covering the entire region with relevant fingerprint texture is particularly important for establishing a comprehensive forensic database. The workflow has been implemented in portable C and is ready for industrial exploitation. Further improvement issues are code optimization, unwrapping method, illumination strategy to avoid highlights and to improve the initial segmentation, and the comparison of the unwrapping result to conventional fingerprint acquisition technology.

  11. Physics and fingerprints

    Science.gov (United States)

    Voss-de Haan, Patrick

    2006-08-01

    This article discusses a variety of aspects in the detection and development of fingerprints and the physics involved in it. It gives an introduction to some basic issues like composition and properties of fingerprint deposits and a rudimentary framework of dactyloscopy; it covers various techniques for the visualization of latent fingerprints; and it concludes with a view of current research topics. The techniques range from very common procedures, such as powdering and cyanoacrylate fuming, to more demanding methods, for example luminescence and vacuum metal deposition, to fairly unusual approaches like autoradiography. The emphasis is placed on the physical rather than the forensic aspects of these topics while trying to give the physicist—who is not dealing with fingerprinting and forensic science on a daily basis—a feeling for the problems and solutions in the visualization of latent fingerprints.

  12. Differential DNA Methylation in Relation to Age and Health Risks of Obesity

    Directory of Open Access Journals (Sweden)

    María Luisa Mansego

    2015-07-01

    Full Text Available The aim of this study was to evaluate whether genome-wide levels of DNA methylation are associated with age and the health risks of obesity (HRO; defined according to BMI categories as “Low HRO” (overweight and class 1 obesity versus “High HRO” (class 2 and class 3 obesity. Anthropometric measurements were assessed in a subsample of 48 volunteers from the Metabolic Syndrome Reduction in Navarra (RESMENA study and 24 women from another independent study, Effects of Lipoic Acid and Eicosapentaenoic Acid in Human Obesity (OBEPALIP study. In the pooled population; the methylation levels of 55 CpG sites were significantly associated with age after Benjamini-Hochberg correction. In addition, DNA methylation of three CpG sites located in ELOVL2; HOXC4 and PI4KB were further negatively associated with their mRNA levels. Although no differentially methylated CpG sites were identified in relation to HRO after multiple testing correction; several nominally significant CpG sites were identified in genes related to insulin signaling; energy and lipid metabolism. Moreover, statistically significant associations between BMI or mRNA levels and two HRO-related CpG sites located in GPR133 and ITGB5 are reported. As a conclusion, these findings from two Spanish cohorts add knowledge about the important role of DNA methylation in the age-related regulation of gene expression. In addition; a relevant influence of age on DNA methylation in white blood cells was found, as well as, on a trend level, novel associations between DNA methylation and obesity.

  13. Normal uniform mixture differential gene expression detection for cDNA microarrays

    Directory of Open Access Journals (Sweden)

    Raftery Adrian E

    2005-07-01

    Full Text Available Abstract Background One of the primary tasks in analysing gene expression data is finding genes that are differentially expressed in different samples. Multiple testing issues due to the thousands of tests run make some of the more popular methods for doing this problematic. Results We propose a simple method, Normal Uniform Differential Gene Expression (NUDGE detection for finding differentially expressed genes in cDNA microarrays. The method uses a simple univariate normal-uniform mixture model, in combination with new normalization methods for spread as well as mean that extend the lowess normalization of Dudoit, Yang, Callow and Speed (2002 1. It takes account of multiple testing, and gives probabilities of differential expression as part of its output. It can be applied to either single-slide or replicated experiments, and it is very fast. Three datasets are analyzed using NUDGE, and the results are compared to those given by other popular methods: unadjusted and Bonferroni-adjusted t tests, Significance Analysis of Microarrays (SAM, and Empirical Bayes for microarrays (EBarrays with both Gamma-Gamma and Lognormal-Normal models. Conclusion The method gives a high probability of differential expression to genes known/suspected a priori to be differentially expressed and a low probability to the others. In terms of known false positives and false negatives, the method outperforms all multiple-replicate methods except for the Gamma-Gamma EBarrays method to which it offers comparable results with the added advantages of greater simplicity, speed, fewer assumptions and applicability to the single replicate case. An R package called nudge to implement the methods in this paper will be made available soon at http://www.bioconductor.org.

  14. DNA methylation polymorphism in a set of elite rice cultivars and its possible contribution to inter-cultivar differential gene expression.

    Science.gov (United States)

    Wang, Yongming; Lin, Xiuyun; Dong, Bo; Wang, Yingdian; Liu, Bao

    2004-01-01

    RAPD (randomly amplified polymorphic DNA) and ISSR (inter-simple sequence repeat) fingerprinting on HpaII/MspI-digested genomic DNA of nine elite japonica rice cultivars implies inter-cultivar DNA methylation polymorphism. Using both DNA fragments isolated from RAPD or ISSR gels and selected low-copy sequences as probes, methylation-sensitive Southern blot analysis confirms the existence of extensive DNA methylation polymorphism in both genes and DNA repeats among the rice cultivars. The cultivar-specific methylation patterns are stably maintained, and can be used as reliable molecular markers. Transcriptional analysis of four selected sequences (RdRP, AC9, HSP90 and MMR) on leaves and roots from normal and 5-azacytidine-treated seedlings of three representative cultivars shows an association between the transcriptional activity of one of the genes, the mismatch repair (MMR) gene, and its CG methylation patterns.

  15. Generalized query-based active learning to identify differentially methylated regions in DNA.

    Science.gov (United States)

    Haque, Md Muksitul; Holder, Lawrence B; Skinner, Michael K; Cook, Diane J

    2013-01-01

    Active learning is a supervised learning technique that reduces the number of examples required for building a successful classifier, because it can choose the data it learns from. This technique holds promise for many biological domains in which classified examples are expensive and time-consuming to obtain. Most traditional active learning methods ask very specific queries to the Oracle (e.g., a human expert) to label an unlabeled example. The example may consist of numerous features, many of which are irrelevant. Removing such features will create a shorter query with only relevant features, and it will be easier for the Oracle to answer. We propose a generalized query-based active learning (GQAL) approach that constructs generalized queries based on multiple instances. By constructing appropriately generalized queries, we can achieve higher accuracy compared to traditional active learning methods. We apply our active learning method to find differentially DNA methylated regions (DMRs). DMRs are DNA locations in the genome that are known to be involved in tissue differentiation, epigenetic regulation, and disease. We also apply our method on 13 other data sets and show that our method is better than another popular active learning technique.

  16. DNA Damage: A Sensible Mediator of the Differentiation Decision in Hematopoietic Stem Cells and in Leukemia

    Directory of Open Access Journals (Sweden)

    Cary N. Weiss

    2015-03-01

    Full Text Available In the adult, the source of functionally diverse, mature blood cells are hematopoietic stem cells, a rare population of quiescent cells that reside in the bone marrow niche. Like stem cells in other tissues, hematopoietic stem cells are defined by their ability to self-renew, in order to maintain the stem cell population for the lifetime of the organism, and to differentiate, in order to give rise to the multiple lineages of the hematopoietic system. In recent years, increasing evidence has suggested a role for the accumulation of reactive oxygen species and DNA damage in the decision for hematopoietic stem cells to exit quiescence and to differentiate. In this review, we will examine recent work supporting the idea that detection of cell stressors, such as oxidative and genetic damage, is an important mediator of cell fate decisions in hematopoietic stem cells. We will explore the benefits of such a system in avoiding the development and progression of malignancies, and in avoiding tissue exhaustion and failure. Additionally, we will discuss new work that examines the accumulation of DNA damage and replication stress in aging hematopoietic stem cells and causes us to rethink ideas of genoprotection in the bone marrow niche.

  17. DNA methylation differentially regulates cytokine secretion in gingival epithelia in response to bacterial challenges.

    Science.gov (United States)

    Drury, Jeanie L; Chung, Whasun Oh

    2015-03-01

    Epigenetic modifications are changes in gene expression without altering DNA sequence. We previously reported that bacteria-specific innate immune responses are regulated by epigenetic modifications. Our hypothesis is that DNA methylation affects gingival cytokine secretion in response to bacterial stimulation. Gingival epithelial cells (GECs) were treated with DNMT-1 inhibitors prior to Porphyromonas gingivalis (Pg) or Fusobacterium nucleatum (Fn) exposure. Protein secretion was assessed using ELISA. Gene expression was quantified using qRT-PCR. The ability of bacteria to invade inhibitor pretreated GECs was assessed utilizing flow cytometry. Changes were compared to unstimulated GECs. GEC upregulation of IL-6 and CXCL1 by Pg or Fn stimulation was significantly diminished by inhibitor pretreatment. Pg stimulated IL-1α secretion and inhibitor pretreatment significantly enhanced this upregulation, while Fn alone or with inhibitor pretreatment had no effect on IL-1α expression. GEC upregulation of human beta-definsin-2 in response to Pg and Fn exposure was enhanced following the inhibitor pretreatment. GEC susceptibility to bacterial invasion was unaltered. These results suggest that DNA methylation differentially affects gingival cytokine secretion in response to Pg or Fn. Our data provide basis for better understanding of how epigenetic modifications, brought on by exposure to oral bacteria, will subsequently affect host susceptibility to oral diseases. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. A Flexible, Efficient Binomial Mixed Model for Identifying Differential DNA Methylation in Bisulfite Sequencing Data

    Science.gov (United States)

    Lea, Amanda J.

    2015-01-01

    Identifying sources of variation in DNA methylation levels is important for understanding gene regulation. Recently, bisulfite sequencing has become a popular tool for investigating DNA methylation levels. However, modeling bisulfite sequencing data is complicated by dramatic variation in coverage across sites and individual samples, and because of the computational challenges of controlling for genetic covariance in count data. To address these challenges, we present a binomial mixed model and an efficient, sampling-based algorithm (MACAU: Mixed model association for count data via data augmentation) for approximate parameter estimation and p-value computation. This framework allows us to simultaneously account for both the over-dispersed, count-based nature of bisulfite sequencing data, as well as genetic relatedness among individuals. Using simulations and two real data sets (whole genome bisulfite sequencing (WGBS) data from Arabidopsis thaliana and reduced representation bisulfite sequencing (RRBS) data from baboons), we show that our method provides well-calibrated test statistics in the presence of population structure. Further, it improves power to detect differentially methylated sites: in the RRBS data set, MACAU detected 1.6-fold more age-associated CpG sites than a beta-binomial model (the next best approach). Changes in these sites are consistent with known age-related shifts in DNA methylation levels, and are enriched near genes that are differentially expressed with age in the same population. Taken together, our results indicate that MACAU is an efficient, effective tool for analyzing bisulfite sequencing data, with particular salience to analyses of structured populations. MACAU is freely available at www.xzlab.org/software.html. PMID:26599596

  19. Hydroxylation of methylated DNA by TET1 in chondrocyte differentiation of C3H10T1/2 cells

    Directory of Open Access Journals (Sweden)

    Ryo Ito

    2016-03-01

    Full Text Available DNA methylation is closely involved in the regulation of cellular differentiation, including chondrogenic differentiation of mesenchymal stem cells. Recent studies showed that Ten–eleven translocation (TET family proteins converted 5-methylcytosine (5mC to 5-hydroxymethylcytosine, 5-formylcytosine and 5carboxylcytosine by oxidation. These reactions constitute potential mechanisms for active demethylation of methylated DNA. However, the relationship between the DNA methylation patterns and the effects of TET family proteins in chondrocyte differentiation is still unclear. In this study, we showed that DNA hydroxylation of 5mC was increased during chondrocytic differentiation of C3H10T1/2 cells and that the expression of Tet1 was particularly enhanced. Moreover, knockdown experiments revealed that the downregulation of Tet1 expression caused decreases in chondrogenesis markers such as type 2 and type 10 collagens. Furthermore, we found that TET proteins had a site preference for hydroxylation of 5mC on the Insulin-like growth factor 1 (Igf1 promoter in chondrocytes. Taken together, we showed that the expression of Tet1 was specifically facilitated in chondrocyte differentiation and Tet1 can regulate chondrocyte marker gene expression presumably through its hydroxylation activity for DNA.

  20. miR-24-mediated down-regulation of H2AX suppresses DNA repair in terminally differentiated blood cells

    Science.gov (United States)

    Lal, Ashish; Pan, Yunfeng; Navarro, Francisco; Dykxhoorn, Derek M.; Moreau, Lisa; Meire, Eti; Bentwich, Zvi; Lieberman, Judy; Chowdhury, Dipanjan

    2010-01-01

    Terminally differentiated cells have reduced capacity to repair double strand breaks (DSB), but the molecular mechanism behind this down-regulation is unclear. Here we find that miR-24 is consistently up-regulated during post-mitotic differentiation of hematopoietic cell lines and regulates the histone variant H2AX, a key DSB repair protein that activates cell cycle checkpoint proteins and retains DSB repair factors at DSB foci. The H2AX 3’UTR contains conserved miR-24 binding sites regulated by miR-24. Both H2AX mRNA and protein are substantially reduced during hematopoietic cell terminal differentiation by miR-24 up-regulation both in in vitro differentiated cells and primary human blood cells. miR-24 suppression of H2AX renders cells hypersensitive to γ-irradiation and genotoxic drugs. Antagonizing miR-24 in differentiating cells protects them from DNA damage-induced cell death, while transfecting miR-24 mimics in dividing cells increases chromosomal breaks and unrepaired DNA damage and reduces viability in response to DNA damage. This DNA repair phenotype can be fully rescued by over-expressing miR-24-insensitive H2AX. Therefore, miR-24 up-regulation in post-replicative cells reduces H2AX and thereby renders them highly vulnerable to DNA damage. PMID:19377482

  1. Advances in fingerprint analysis.

    Science.gov (United States)

    Hazarika, Pompi; Russell, David A

    2012-04-10

    Fingerprints have been used in forensic investigations for the identification of individuals since the late 19th century. However, it is now clear that fingerprints can provide significantly more information about an individual. Here, we highlight the considerable advances in fingerprinting technology that can simultaneously provide chemical information regarding the drugs ingested and the explosives and drugs handled by a person as well as the identity of that individual. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Differential sensitivity to aphidicolin of replicative DNA synthesis and ultraviolet-induced unscheduled DNA synthesis in vivo in mammalian cells

    International Nuclear Information System (INIS)

    Seki, Shuji; Hosogi, Nobuo; Oda, Takuzo

    1984-01-01

    In vivo in mammalian cells, ultraviolet-induced unscheduled DNA synthesis was less sensitive to aphidicolin than was replicative DNA synthesis. Replicative DNA synthesis in HeLa, HEp-2, WI-38 VA-13 and CV-1 cells was inhibited more than 97 % by aphidicolin at 10 μg/ml, whereas aphidicolin inhibition of DNA synthesis in ultraviolet-irradiated cells varied between 30 % and 90 % depending on cell types and assay conditions. Aphidicolin inhibition of unscheduled DNA synthesis (UDS) in HeLa cells increased gradually with increasing aphidicolin concentration and reached approximately 90 % at 100 μg/ml aphidicolin. A significant fraction of UDS in ultraviolet-irradiated HEp-2 cells was resistant to aphidicolin even at 300 μg/ml. Considered along with related information reported previously, the present results suggest that both aphidicolin-sensitive and insensitive DNA polymerases, DNA polymerase α and a non-α DNA polymerase (possibly DNA polymerase β), are involved in in situ UDS in these ultraviolet-irradiated cells. Comparison of staphylococcal nuclease sensitivity between DNAs repaired in the presence and in the absence of aphidicolin in HEp-2 cells suggested that the involvement of DNA polymerase α in UDS favored DNA synthesis in the intranucleosomal region. (author)

  3. Longitudinal study of fingerprint recognition.

    Science.gov (United States)

    Yoon, Soweon; Jain, Anil K

    2015-07-14

    Human identification by fingerprints is based on the fundamental premise that ridge patterns from distinct fingers are different (uniqueness) and a fingerprint pattern does not change over time (persistence). Although the uniqueness of fingerprints has been investigated by developing statistical models to estimate the probability of error in comparing two random samples of fingerprints, the persistence of fingerprints has remained a general belief based on only a few case studies. In this study, fingerprint match (similarity) scores are analyzed by multilevel statistical models with covariates such as time interval between two fingerprints in comparison, subject's age, and fingerprint image quality. Longitudinal fingerprint records of 15,597 subjects are sampled from an operational fingerprint database such that each individual has at least five 10-print records over a minimum time span of 5 y. In regard to the persistence of fingerprints, the longitudinal analysis on a single (right index) finger demonstrates that (i) genuine match scores tend to significantly decrease when time interval between two fingerprints in comparison increases, whereas the change in impostor match scores is negligible; and (ii) fingerprint recognition accuracy at operational settings, nevertheless, tends to be stable as the time interval increases up to 12 y, the maximum time span in the dataset. However, the uncertainty of temporal stability of fingerprint recognition accuracy becomes substantially large if either of the two fingerprints being compared is of poor quality. The conclusions drawn from 10-finger fusion analysis coincide with the conclusions from single-finger analysis.

  4. Online fingerprint verification.

    Science.gov (United States)

    Upendra, K; Singh, S; Kumar, V; Verma, H K

    2007-01-01

    As organizations search for more secure authentication methods for user access, e-commerce, and other security applications, biometrics is gaining increasing attention. With an increasing emphasis on the emerging automatic personal identification applications, fingerprint based identification is becoming more popular. The most widely used fingerprint representation is the minutiae based representation. The main drawback with this representation is that it does not utilize a significant component of the rich discriminatory information available in the fingerprints. Local ridge structures cannot be completely characterized by minutiae. Also, it is difficult quickly to match two fingerprint images containing different number of unregistered minutiae points. In this study filter bank based representation, which eliminates these weakness, is implemented and the overall performance of the developed system is tested. The results have shown that this system can be used effectively for secure online verification applications.

  5. Aging-dependent DNA hypermethylation and gene expression of GSTM1 involved in T cell differentiation.

    Science.gov (United States)

    Yeh, Shu-Hui; Liu, Cheng-Ling; Chang, Ren-Chieh; Wu, Chih-Chiang; Lin, Chia-Hsueh; Yang, Kuender D

    2017-07-25

    This study investigated whether aging was associated with epigenetic changes of DNA hypermethylation on immune gene expression and lymphocyte differentiation. We screened CG sites of methylation in blood leukocytes from different age populations, picked up genes with age-related increase of CG methylation content more than 15%, and validated immune related genes with CG hypermethylation involved in lymphocyte differentiation in the aged population. We found that 12 genes (EXHX1、 IL-10、 TSP50、 GSTM1、SLC5A5、SPI1、F2R、LMO2、PTPN6、FGFR2、MMP9、MET) were associated with promoter or exon one DNA hypermethylation in the aged group. Two immune related genes, GSTM1 and LMO2, were chosen to validate its aging-related CG hypermethylation in different leukocytes. We are the first to validate that GSTM1_P266 and LMO2_E128 CG methylation contents in T lymphocytes but not polymorphonuclear cells (PMNs) or mononuclear cells (MNCs) were significantly increased in the aged population. The GSTM1 mRNA expression in T lymphocytes but not PMNs or MNCs was inversely associated with the GSTM1 CG hypermethylation levels in the aged population studied. Further studies showed that lower GSTM1 CG methylation content led to the higher GSTM1 mRNA expression in T cells and knockdown of GSTM1 mRNA expression decreased type 1 T helper cell (Th1) differentiation in Jurkat T cells and normal adult CD4 T cells. The GSTM1_P266 hypermethylation in the aged population associated with lower GSTM1 mRNA expression was involved in Th1 differentiation, highlighting that modulation of aging-associated GSTM1 methylation may be able to enhance T helper cell immunity in the elders.

  6. Accommodating error analysis in comparison and clustering of molecular fingerprints.

    Science.gov (United States)

    Salamon, H; Segal, M R; Ponce de Leon, A; Small, P M

    1998-01-01

    Molecular epidemiologic studies of infectious diseases rely on pathogen genotype comparisons, which usually yield patterns comprising sets of DNA fragments (DNA fingerprints). We use a highly developed genotyping system, IS6110-based restriction fragment length polymorphism analysis of Mycobacterium tuberculosis, to develop a computational method that automates comparison of large numbers of fingerprints. Because error in fragment length measurements is proportional to fragment length and is positively correlated for fragments within a lane, an align-and-count method that compensates for relative scaling of lanes reliably counts matching fragments between lanes. Results of a two-step method we developed to cluster identical fingerprints agree closely with 5 years of computer-assisted visual matching among 1,335 M. tuberculosis fingerprints. Fully documented and validated methods of automated comparison and clustering will greatly expand the scope of molecular epidemiology.

  7. Differential DNA methylation profiles in gynecological cancers and correlation with clinico-pathological data

    Directory of Open Access Journals (Sweden)

    Tsang Percy CK

    2006-08-01

    .7% (DAPK in cervical cancer. Aberrant methylation for some genes (BRCA1, DAPK, hMLH1, MGMT, p14, p16, and PTEN was also associated with clinico-pathological data. Conclusion Thus, differential methylation profiles occur in the three types of gynecologic cancer. Detection of methylation for critical loci is potentially useful as epigenetic markers in tumor classification. More studies using a much larger sample size are needed to define the potential role of DNA methylation as marker for cancer management.

  8. Differential DNA methylation profiles in gynecological cancers and correlation with clinico-pathological data

    International Nuclear Information System (INIS)

    Yang, Hui-Juan; Liu, Vincent WS; Wang, Yue; Tsang, Percy CK; Ngan, Hextan YS

    2006-01-01

    for some genes (BRCA1, DAPK, hMLH1, MGMT, p14, p16, and PTEN) was also associated with clinico-pathological data. Thus, differential methylation profiles occur in the three types of gynecologic cancer. Detection of methylation for critical loci is potentially useful as epigenetic markers in tumor classification. More studies using a much larger sample size are needed to define the potential role of DNA methylation as marker for cancer management

  9. Use of Simple Sequence Repeat (SSR) markers for DNA fingerprinting and diversity analysis of sugarcane (Saccharum spp.) cultivars resistant and susceptible to red rot

    Science.gov (United States)

    In recent years SSR markers have been used widely for the genetic analysis. The objective of present research was to use SSR markers to develop DNA-based genetic identification and analyze genetic relationship of sugarcane cultivars grown in Pakistan either resistant or susceptible to red rot. Twent...

  10. Uterine bacterial flora in postpartum Danish Holstein dairy cows determined using DNA-based fingerprinting: correlation to uterine condition and calving management.

    Science.gov (United States)

    Elkjær, K; Ancker, M-L; Gustafsson, H; Friggens, N C; Waldmann, A; Mølbak, L; Callesen, H

    2013-04-01

    The overall aim of this study was to describe uterine bacterial flora during the postpartum period in Danish Holstein cows using the Terminal Restriction Fragment Length Polymorphism (T-RFLP) method. This method produces a pattern of nucleic acid fragments from the microorganisms present, reflecting the "fingerprint" of the actual microbial flora. As well as characterizing changes in flora with time from calving and between herds, data were examined for strong relations between uterine bacterial flora, calving management and uterine condition. In total 125 Holstein cows from five herds were included, and for each cow calving management was recorded. Cows were clinically examined on average 8 (range 0-19) and 28 (range 22-38) days after calving, and a uterine sample was taken for bacterial identification using T-RFLP. Milk samples were taken weekly for progesterone analysis. Bacteria were found in all cows at both examinations, and the flora was composed of many species, including species not traditionally reported to be present in the bovine uterus. The bacterial composition differed according to days from calving and herd. In all five herds Fusobacterium necrophorum, Pseudomonas/Acinetobacter and Bacteroides/Sphingobacterium/Prevotellaceae were among the most common at both examinations. In four herds there was a percentage decrease of F. necrophorum from first to second examination, and in all herds there was a percentage increase of Pseudomonas/Acinetobacter from first to second examination. No differences in bacterial flora were found between cows with different uterine scores, which were influenced by herd, calving difficulty and retained placenta. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Sensitivity and fidelity of DNA microarray improved with integration of Amplified Differential Gene Expression (ADGE

    Directory of Open Access Journals (Sweden)

    Ile Kristina E

    2003-07-01

    Full Text Available Abstract Background The ADGE technique is a method designed to magnify the ratios of gene expression before detection. It improves the detection sensitivity to small change of gene expression and requires small amount of starting material. However, the throughput of ADGE is low. We integrated ADGE with DNA microarray (ADGE microarray and compared it with regular microarray. Results When ADGE was integrated with DNA microarray, a quantitative relationship of a power function between detected and input ratios was found. Because of ratio magnification, ADGE microarray was better able to detect small changes in gene expression in a drug resistant model cell line system. The PCR amplification of templates and efficient labeling reduced the requirement of starting material to as little as 125 ng of total RNA for one slide hybridization and enhanced the signal intensity. Integration of ratio magnification, template amplification and efficient labeling in ADGE microarray reduced artifacts in microarray data and improved detection fidelity. The results of ADGE microarray were less variable and more reproducible than those of regular microarray. A gene expression profile generated with ADGE microarray characterized the drug resistant phenotype, particularly with reference to glutathione, proliferation and kinase pathways. Conclusion ADGE microarray magnified the ratios of differential gene expression in a power function, improved the detection sensitivity and fidelity and reduced the requirement for starting material while maintaining high throughput. ADGE microarray generated a more informative expression pattern than regular microarray.

  12. HBV core protein allosteric modulators differentially alter cccDNA biosynthesis from de novo infection and intracellular amplification pathways

    Science.gov (United States)

    Guo, Fang; Zhao, Qiong; Cheng, Junjun; Qi, Yonghe; Su, Qing; Wei, Lai; Li, Wenhui; Chang, Jinhong

    2017-01-01

    Hepatitis B virus (HBV) core protein assembles viral pre-genomic (pg) RNA and DNA polymerase into nucleocapsids for reverse transcriptional DNA replication to take place. Several chemotypes of small molecules, including heteroaryldihydropyrimidines (HAPs) and sulfamoylbenzamides (SBAs), have been discovered to allosterically modulate core protein structure and consequentially alter the kinetics and pathway of core protein assembly, resulting in formation of irregularly-shaped core protein aggregates or “empty” capsids devoid of pre-genomic RNA and viral DNA polymerase. Interestingly, in addition to inhibiting nucleocapsid assembly and subsequent viral genome replication, we have now demonstrated that HAPs and SBAs differentially modulate the biosynthesis of covalently closed circular (ccc) DNA from de novo infection and intracellular amplification pathways by inducing disassembly of nucleocapsids derived from virions as well as double-stranded DNA-containing progeny nucleocapsids in the cytoplasm. Specifically, the mistimed cuing of nucleocapsid uncoating prevents cccDNA formation during de novo infection of hepatocytes, while transiently accelerating cccDNA synthesis from cytoplasmic progeny nucleocapsids. Our studies indicate that elongation of positive-stranded DNA induces structural changes of nucleocapsids, which confers ability of mature nucleocapsids to bind CpAMs and triggers its disassembly. Understanding the molecular mechanism underlying the dual effects of the core protein allosteric modulators on nucleocapsid assembly and disassembly will facilitate the discovery of novel core protein-targeting antiviral agents that can more efficiently suppress cccDNA synthesis and cure chronic hepatitis B. PMID:28945802

  13. HBV core protein allosteric modulators differentially alter cccDNA biosynthesis from de novo infection and intracellular amplification pathways.

    Science.gov (United States)

    Guo, Fang; Zhao, Qiong; Sheraz, Muhammad; Cheng, Junjun; Qi, Yonghe; Su, Qing; Cuconati, Andrea; Wei, Lai; Du, Yanming; Li, Wenhui; Chang, Jinhong; Guo, Ju-Tao

    2017-09-01

    Hepatitis B virus (HBV) core protein assembles viral pre-genomic (pg) RNA and DNA polymerase into nucleocapsids for reverse transcriptional DNA replication to take place. Several chemotypes of small molecules, including heteroaryldihydropyrimidines (HAPs) and sulfamoylbenzamides (SBAs), have been discovered to allosterically modulate core protein structure and consequentially alter the kinetics and pathway of core protein assembly, resulting in formation of irregularly-shaped core protein aggregates or "empty" capsids devoid of pre-genomic RNA and viral DNA polymerase. Interestingly, in addition to inhibiting nucleocapsid assembly and subsequent viral genome replication, we have now demonstrated that HAPs and SBAs differentially modulate the biosynthesis of covalently closed circular (ccc) DNA from de novo infection and intracellular amplification pathways by inducing disassembly of nucleocapsids derived from virions as well as double-stranded DNA-containing progeny nucleocapsids in the cytoplasm. Specifically, the mistimed cuing of nucleocapsid uncoating prevents cccDNA formation during de novo infection of hepatocytes, while transiently accelerating cccDNA synthesis from cytoplasmic progeny nucleocapsids. Our studies indicate that elongation of positive-stranded DNA induces structural changes of nucleocapsids, which confers ability of mature nucleocapsids to bind CpAMs and triggers its disassembly. Understanding the molecular mechanism underlying the dual effects of the core protein allosteric modulators on nucleocapsid assembly and disassembly will facilitate the discovery of novel core protein-targeting antiviral agents that can more efficiently suppress cccDNA synthesis and cure chronic hepatitis B.

  14. HBV core protein allosteric modulators differentially alter cccDNA biosynthesis from de novo infection and intracellular amplification pathways.

    Directory of Open Access Journals (Sweden)

    Fang Guo

    2017-09-01

    Full Text Available Hepatitis B virus (HBV core protein assembles viral pre-genomic (pg RNA and DNA polymerase into nucleocapsids for reverse transcriptional DNA replication to take place. Several chemotypes of small molecules, including heteroaryldihydropyrimidines (HAPs and sulfamoylbenzamides (SBAs, have been discovered to allosterically modulate core protein structure and consequentially alter the kinetics and pathway of core protein assembly, resulting in formation of irregularly-shaped core protein aggregates or "empty" capsids devoid of pre-genomic RNA and viral DNA polymerase. Interestingly, in addition to inhibiting nucleocapsid assembly and subsequent viral genome replication, we have now demonstrated that HAPs and SBAs differentially modulate the biosynthesis of covalently closed circular (ccc DNA from de novo infection and intracellular amplification pathways by inducing disassembly of nucleocapsids derived from virions as well as double-stranded DNA-containing progeny nucleocapsids in the cytoplasm. Specifically, the mistimed cuing of nucleocapsid uncoating prevents cccDNA formation during de novo infection of hepatocytes, while transiently accelerating cccDNA synthesis from cytoplasmic progeny nucleocapsids. Our studies indicate that elongation of positive-stranded DNA induces structural changes of nucleocapsids, which confers ability of mature nucleocapsids to bind CpAMs and triggers its disassembly. Understanding the molecular mechanism underlying the dual effects of the core protein allosteric modulators on nucleocapsid assembly and disassembly will facilitate the discovery of novel core protein-targeting antiviral agents that can more efficiently suppress cccDNA synthesis and cure chronic hepatitis B.

  15. Fingerprints in Compressed Strings

    DEFF Research Database (Denmark)

    Bille, Philip; Cording, Patrick Hagge; Gørtz, Inge Li

    2013-01-01

    The Karp-Rabin fingerprint of a string is a type of hash value that due to its strong properties has been used in many string algorithms. In this paper we show how to construct a data structure for a string S of size N compressed by a context-free grammar of size n that answers fingerprint queries...... derivative that captures LZ78 compression and its variations) we get O(loglogN) query time. Hence, our data structures has the same time and space complexity as for random access in SLPs. We utilize the fingerprint data structures to solve the longest common extension problem in query time O(logNlogℓ) and O....... That is, given indices i and j, the answer to a query is the fingerprint of the substring S[i,j]. We present the first O(n) space data structures that answer fingerprint queries without decompressing any characters. For Straight Line Programs (SLP) we get O(logN) query time, and for Linear SLPs (an SLP...

  16. The Fingerprint of Anti-Bromodeoxyuridine Antibodies and Its Use for the Assessment of Their Affinity to 5-Bromo-2 '-Deoxyuridine in Cellular DNA under Various Conditions

    Czech Academy of Sciences Publication Activity Database

    Ligasová, A.; Liboska, Radek; Rosenberg, Ivan; Koberna, K.

    2015-01-01

    Roč. 10, č. 7 (2015), e0132393/1-e0132393/16 E-ISSN 1932-6203 R&D Projects: GA TA ČR TA03010598; GA TA ČR TA03010719; GA MŠk(CZ) LO1304; GA MZd NV15-31604A Grant - others:GA TA ČR(CZ) TE02000058 Program:TE Institutional support: RVO:61388963 Keywords : anti-halodeoxyuridine antibodies * affinity assay * DNA Subject RIV: CE - Biochemistry Impact factor: 3.057, year: 2015 http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0132393

  17. CCR6+ Th cell distribution differentiates systemic lupus erythematosus patients based on anti-dsDNA antibody status.

    Science.gov (United States)

    Zhong, Wei; Jiang, Zhenyu; Wu, Jiang; Jiang, Yanfang; Zhao, Ling

    2018-01-01

    Systemic lupus erythematosus (SLE) disease has been shown to be associated with the generation of multiple auto-antibodies. Among these, anti-dsDNA antibodies (anti-DNAs) are specific and play a pathogenic role in SLE. Indeed, anti-DNA + SLE patients display a worse disease course. The generation of these pathogenic anti-DNAs has been attributed to the interaction between aberrant T helper (Th) cells and autoimmune B cells. Thus, in this study we have investigated whether CCR6 + Th cells have the ability to differentiate SLE patients based on anti-DNA status, and if their distribution has any correlation with disease activity. We recruited 25 anti-DNA + and 25 anti-DNA - treatment-naive onset SLE patients, matched for various clinical characteristics in our nested matched case-control study. CCR6 + Th cells and their additional subsets were analyzed in each patient by flow cytometry. Anti-DNA + SLE patients specifically had a higher percentage of Th cells expressing CCR6 and CXCR3. Further analysis of CCR6 + Th cell subsets showed that anti-DNA + SLE patients had elevated proportions of Th9, Th17, Th17.1 and CCR4/CXCR3 double-negative (DN) cells. However, the proportions of CCR6 - Th subsets, including Th1 and Th2 cells, did not show any association with anti-DNA status. Finally, we identified a correlation between CCR6 + Th subsets and clinical indicators, specifically in anti-DNA + SLE patients. Our data indicated that CCR6 + Th cells and their subsets were elevated and correlated with disease activity in anti-DNA + SLE patients. We speculated that CCR6 + Th cells may contribute to distinct disease severity in anti-DNA + SLE patients.

  18. Defense of fake fingerprint attacks using a swept source laser optical coherence tomography setup

    Science.gov (United States)

    Meissner, Sven; Breithaupt, Ralph; Koch, Edmund

    2013-03-01

    The most established technique for the identification at biometric access control systems is the human fingerprint. While every human fingerprint is unique, fingerprints can be faked very easily by using thin layer fakes. Because commercial fingerprint scanners use only a two-dimensional image acquisition of the finger surface, they can only hardly differentiate between real fingerprints and fingerprint fakes applied on thin layer materials. A Swept Source OCT system with an A-line rate of 20 kHz and a lateral and axial resolution of approximately 13 μm, a centre wavelength of 1320 nm and a band width of 120 nm (FWHM) was used to acquire fingerprints and finger tips with overlying fakes. Three-dimensional volume stacks with dimensions of 4.5 mm x 4 mm x 2 mm were acquired. The layering arrangement of the imaged finger tips and faked finger tips was analyzed and subsequently classified into real and faked fingerprints. Additionally, sweat gland ducts were detected and consulted for the classification. The manual classification between real fingerprints and faked fingerprints results in almost 100 % correctness. The outer as well as the internal fingerprint can be recognized in all real human fingers, whereby this was not possible in the image stacks of the faked fingerprints. Furthermore, in all image stacks of real human fingers the sweat gland ducts were detected. The number of sweat gland ducts differs between the test persons. The typical helix shape of the ducts was observed. In contrast, in images of faked fingerprints we observe abnormal layer arrangements and no sweat gland ducts connecting the papillae of the outer fingerprint and the internal fingerprint. We demonstrated that OCT is a very useful tool to enhance the performance of biometric control systems concerning attacks by thin layer fingerprint fakes.

  19. Induction of DNA damage in γ-irradiated nuclei stripped of nuclear protein classes: differential modulation of double-strand break and DNA-protein crosslink formation

    International Nuclear Information System (INIS)

    Xue, L.-Y.; Friedman, L.R.; Oleinick, N.L.; Chiu, S.-M.

    1994-01-01

    The influence of chromatin proteins on the induction of DNA double-strand breaks (dsb) and DNA-protein crosslinks (dpc) by γ-radiation was investigated. Low molecular weight non-histone proteins and classes of histones were extracted with increasing concentrations of NaC1, whereas nuclear matrix proteins were not extractable even by 2.0 M NACl. The yield of dsb increased with progressive removal of proteins from chromatin. The data support our previous conclusion that nuclear matrix protein rather than the majority of the histones are the predominant substrates for dpc production, although the involvement of a subset of tightly bound histones (H3 and H4) has not been excluded. This finding demonstrates that chromatin proteins can differentially modify the yield of two types of radiation-induced DNA lesions. (author)

  20. Differential gene expression in a DNA double-strand-break repair mutant XRS-5 defective in Ku80. Analysis by cDNA microarray

    Energy Technology Data Exchange (ETDEWEB)

    Chan, John Y.H.; Chen, Lung-Kun; Chang, Jui-Feng [National Yang Ming Univ., Taipei, Taiwan (China). Inst. of Radiological Sciences] (and others)

    2001-12-01

    The ability of cells to rejoin DNA double-strand breaks (DSBs) usually correlates with their radiosensitivity. This correlation has been demonstrated in radiosensitive cells, including the Chinese hamster ovary mutant XRS-5. XRS-5 is defective in a DNA end-binding protein, Ku80, which is a component of a DNA-dependent protein kinase complex used for joining strand breaks. However, Ku80-deficient cells are known to be retarded in cell proliferation and growth as well as other yet to be identified defects. Using custom-made 600-gene cDNA microarray filters, we found differential gene expressions between the wild-type and XRS-5 cells. Defective Ku80 apparently affects the expression of several repair genes, including topoisomerase-I and -IIA, ERCC5, MLH1, and ATM. In contrast, other DNA repair-associated genes, such as GADD45A, EGR1 MDM2 and p53, were not affected. In addition, for large numbers of growth-associated genes, such as cyclins and clks, the growth factors and cytokines were also affected. Down-regulated expression was also found in several categories of seemingly unrelated genes, including apoptosis, angiogenesis, kinase and signaling, phosphatase, stress protein, proto-oncogenes and tumor suppressors, transcription and translation factors. A RT-PCR analysis confirmed that the XRS-5 cells used were defective in Ku80 expression. The diversified groups of genes being affected could mean that Ku80, a multi-functional DNA-binding protein, not only affects DNA repair, but is also involved in transcription regulation. Our data, taken together, indicate that there are specific genes being modulated in Ku80- deficient cells, and that some of the DNA repair pathways and other biological functions are apparently linked, suggesting that a defect in one gene could have global effects on many other processes. (author)

  1. Differential gene expression in a DNA double-strand-break repair mutant XRS-5 defective in Ku80. Analysis by cDNA microarray

    International Nuclear Information System (INIS)

    Chan, John Y.H.; Chen, Lung-Kun; Chang, Jui-Feng

    2001-01-01

    The ability of cells to rejoin DNA double-strand breaks (DSBs) usually correlates with their radiosensitivity. This correlation has been demonstrated in radiosensitive cells, including the Chinese hamster ovary mutant XRS-5. XRS-5 is defective in a DNA end-binding protein, Ku80, which is a component of a DNA-dependent protein kinase complex used for joining strand breaks. However, Ku80-deficient cells are known to be retarded in cell proliferation and growth as well as other yet to be identified defects. Using custom-made 600-gene cDNA microarray filters, we found differential gene expressions between the wild-type and XRS-5 cells. Defective Ku80 apparently affects the expression of several repair genes, including topoisomerase-I and -IIA, ERCC5, MLH1, and ATM. In contrast, other DNA repair-associated genes, such as GADD45A, EGR1 MDM2 and p53, were not affected. In addition, for large numbers of growth-associated genes, such as cyclins and clks, the growth factors and cytokines were also affected. Down-regulated expression was also found in several categories of seemingly unrelated genes, including apoptosis, angiogenesis, kinase and signaling, phosphatase, stress protein, proto-oncogenes and tumor suppressors, transcription and translation factors. A RT-PCR analysis confirmed that the XRS-5 cells used were defective in Ku80 expression. The diversified groups of genes being affected could mean that Ku80, a multi-functional DNA-binding protein, not only affects DNA repair, but is also involved in transcription regulation. Our data, taken together, indicate that there are specific genes being modulated in Ku80- deficient cells, and that some of the DNA repair pathways and other biological functions are apparently linked, suggesting that a defect in one gene could have global effects on many other processes. (author)

  2. Fingerprinting with Wow

    Science.gov (United States)

    Yu, Eugene; Craver, Scott

    2006-02-01

    Wow, or time warping caused by speed fluctuations in analog audio equipment, provides a wealth of applications in watermarking. Very subtle temporal distortion has been used to defeat watermarks, and as components in watermarking systems. In the image domain, the analogous warping of an image's canvas has been used both to defeat watermarks and also proposed to prevent collusion attacks on fingerprinting systems. In this paper, we explore how subliminal levels of wow can be used for steganography and fingerprinting. We present both a low-bitrate robust solution and a higher-bitrate solution intended for steganographic communication. As already observed, such a fingerprinting algorithm naturally discourages collusion by averaging, owing to flanging effects when misaligned audio is averaged. Another advantage of warping is that even when imperceptible, it can be beyond the reach of compression algorithms. We use this opportunity to debunk the common misconception that steganography is impossible under "perfect compression."

  3. Fingerprints in compressed strings

    DEFF Research Database (Denmark)

    Bille, Philip; Gørtz, Inge Li; Cording, Patrick Hagge

    2017-01-01

    In this paper we show how to construct a data structure for a string S of size N compressed into a context-free grammar of size n that supports efficient Karp–Rabin fingerprint queries to any substring of S. That is, given indices i and j, the answer to a query is the fingerprint of the substring S......[i,j]. We present the first O(n) space data structures that answer fingerprint queries without decompressing any characters. For Straight Line Programs (SLP) we get O(log⁡N) query time, and for Linear SLPs (an SLP derivative that captures LZ78 compression and its variations) we get O(log⁡log⁡N) query time...

  4. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Science.gov (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  5. Polynucleotide probes that target a hypervariable region of 16S rRNA genes to identify bacterial isolates corresponding to bands of community fingerprints.

    Science.gov (United States)

    Heuer, H; Hartung, K; Wieland, G; Kramer, I; Smalla, K

    1999-03-01

    Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in hybridizations with dot blotted 16S rDNA amplified from bacterial isolates. Within 16S rDNA, the hypervariable V6 region, corresponding to positions 984 to 1047 (Escherichia coli 16S rDNA sequence), which is a subset of the region used for TGGE (positions 968 to 1401), best met the criteria of high phylogenetic variability, required for sufficient probe specificity, and closely flanking conserved priming sites for amplification. Removal of flanking conserved bases was necessary to enable the differentiation of closely related species. This was achieved by 5' exonuclease digestion, terminated by phosphorothioate bonds which were synthesized into the primers. The remaining complementary strand was removed by single-strand-specific digestion. Standard hybridization with truncated probes allowed differentiation of bacteria which differed by only two bases within the probe target site and 1.2% within the complete 16S rDNA. However, a truncated probe, derived from an excised TGGE band of a rhizosphere community, hybridized with three phylogenetically related isolates with identical V6 sequences. Only one of the isolates comigrated with the excised band in TGGE, which was shown to be due to identical sequences, demonstrating the utility of a combined TGGE and V6 probe approach.

  6. Using high-throughput DNA sequencing, genetic fingerprinting, and quantitative PCR as tools for monitoring bloom-forming and toxigenic cyanobacteria in Upper Klamath Lake, Oregon, 2013 and 2014

    Science.gov (United States)

    Caldwell Eldridge, Sara L.; Driscoll, Conner; Dreher, Theo W.

    2017-06-05

    Monitoring the community structure and metabolic activities of cyanobacterial blooms in Upper Klamath Lake, Oregon, is critical to lake management because these blooms degrade water quality and produce toxic microcystins that are harmful to humans, domestic animals, and wildlife. Genetic tools, such as DNA fingerprinting by terminal restriction fragment length polymorphism (T-RFLP) analysis, high-throughput DNA sequencing (HTS), and real-time, quantitative polymerase chain reaction (qPCR), provide more sensitive and rapid assessments of bloom ecology than traditional techniques. The objectives of this study were (1) to characterize the microbial community at one site in Upper Klamath Lake and determine changes in the cyanobacterial community through time using T-RFLP and HTS in comparison with traditional light microscopy; (2) to determine relative abundances and changes in abundance over time of toxigenic Microcystis using qPCR; and (3) to determine relative abundances and changes in abundance over time of Aphanizomenon, Microcystis, and total cyanobacteria using qPCR. T-RFLP analysis of total cyanobacteria showed a dominance of only one or two distinct genotypes in samples from 2013, but results of HTS in 2013 and 2014 showed more variations in the bloom cycle that fit with the previous understanding of bloom dynamics in Upper Klamath Lake and indicated that potentially toxigenic Microcystis was more prevalent in 2014 than in years prior. The qPCR-estimated copy numbers of all target genes were higher in 2014 than in 2013, when microcystin concentrations also were higher. Total Microcystis density was shown with qPCR to be a better predictor of late-season increases in microcystin concentrations than the relative proportions of potentially toxigenic cells. In addition, qPCR targeting Aphanizomenon at one site in Upper Klamath Lake indicated a moderate bloom of this species (corresponding to chlorophyll a concentrations between approximately 75 and 200 micrograms

  7. Evaluation of the impact of chitosan/DNA nanoparticles on the differentiation of human naive CD4{sup +} T cells

    Energy Technology Data Exchange (ETDEWEB)

    Liu Lanxia; Bai Yuanyuan; Zhu Dunwan; Song Liping; Wang Hai; Dong Xia; Zhang Hailing; Leng Xigang, E-mail: lengxg@bme.org.cn [Chinese Academy of Medical Sciences and Peking Union Medical College, Tianjin Key Laboratory of Biomedical Materials, Lab of Bioengineering, Institute of Biomedical Engineering (China)

    2011-06-15

    Chitosan (CS) is one of the most widely studied polymers in non-viral gene delivery since it is a cationic polysaccharide that forms nanoparticles with DNA and hence protects the DNA against digestion by DNase. However, the impact of CS/DNA nanoparticle on the immune system still remains poorly understood. Previous investigations did not found CS/DNA nanoparticles had any significant impact on the function of human and murine macrophages. To date, little is known about the interaction between CS/DNA nanoparticles and naive CD4{sup +} T cells. This study was designed to investigate whether CS/DNA nanoparticles affect the initial differentiation direction of human naive CD4{sup +} T cells. The indirect impact of CS/DNA nanoparticles on naive CD4{sup +} T cell differentiation was investigated by incubating the nanoparticles with human macrophage THP-1 cells in one chamber of a transwell co-incubation system, with the enriched human naive CD4{sup +} T cells being placed in the other chamber of the transwell. The nanoparticles were also co-incubated with the naive CD4{sup +} T cells to explore their direct impact on naive CD4{sup +} T cell differentiation by measuring the release of IL-4 and IFN-{gamma} from the cells. It was demonstrated that CS/DNA nanoparticles induced slightly elevated production of IL-12 by THP-1 cells, possibly owing to the presence of CpG motifs in the plasmid. However, this macrophage stimulating activity was much less significant as compared with lipopolysaccharide and did not impact on the differentiation of the naive CD4{sup +} T cells. It was also demonstrated that, when directly exposed to the naive CD4{sup +} T cells, the nanoparticles induced neither the activation of the naive CD4{sup +} T cells in the absence of recombinant cytokines (recombinant human IL-4 or IFN-{gamma}) that induce naive CD4{sup +} T cell polarization, nor any changes in the differentiation direction of naive CD4{sup +} T cells in the presence of the corresponding

  8. Evaluation of the impact of chitosan/DNA nanoparticles on the differentiation of human naive CD4+ T cells

    Science.gov (United States)

    Liu, Lanxia; Bai, Yuanyuan; Zhu, Dunwan; Song, Liping; Wang, Hai; Dong, Xia; Zhang, Hailing; Leng, Xigang

    2011-06-01

    Chitosan (CS) is one of the most widely studied polymers in non-viral gene delivery since it is a cationic polysaccharide that forms nanoparticles with DNA and hence protects the DNA against digestion by DNase. However, the impact of CS/DNA nanoparticle on the immune system still remains poorly understood. Previous investigations did not found CS/DNA nanoparticles had any significant impact on the function of human and murine macrophages. To date, little is known about the interaction between CS/DNA nanoparticles and naive CD4+ T cells. This study was designed to investigate whether CS/DNA nanoparticles affect the initial differentiation direction of human naive CD4+ T cells. The indirect impact of CS/DNA nanoparticles on naive CD4+ T cell differentiation was investigated by incubating the nanoparticles with human macrophage THP-1 cells in one chamber of a transwell co-incubation system, with the enriched human naive CD4+ T cells being placed in the other chamber of the transwell. The nanoparticles were also co-incubated with the naive CD4+ T cells to explore their direct impact on naive CD4+ T cell differentiation by measuring the release of IL-4 and IFN-γ from the cells. It was demonstrated that CS/DNA nanoparticles induced slightly elevated production of IL-12 by THP-1 cells, possibly owing to the presence of CpG motifs in the plasmid. However, this macrophage stimulating activity was much less significant as compared with lipopolysaccharide and did not impact on the differentiation of the naive CD4+ T cells. It was also demonstrated that, when directly exposed to the naive CD4+ T cells, the nanoparticles induced neither the activation of the naive CD4+ T cells in the absence of recombinant cytokines (recombinant human IL-4 or IFN-γ) that induce naive CD4+ T cell polarization, nor any changes in the differentiation direction of naive CD4+ T cells in the presence of the corresponding cytokines.

  9. Evaluation of the impact of chitosan/DNA nanoparticles on the differentiation of human naive CD4+ T cells

    International Nuclear Information System (INIS)

    Liu Lanxia; Bai Yuanyuan; Zhu Dunwan; Song Liping; Wang Hai; Dong Xia; Zhang Hailing; Leng Xigang

    2011-01-01

    Chitosan (CS) is one of the most widely studied polymers in non-viral gene delivery since it is a cationic polysaccharide that forms nanoparticles with DNA and hence protects the DNA against digestion by DNase. However, the impact of CS/DNA nanoparticle on the immune system still remains poorly understood. Previous investigations did not found CS/DNA nanoparticles had any significant impact on the function of human and murine macrophages. To date, little is known about the interaction between CS/DNA nanoparticles and naive CD4 + T cells. This study was designed to investigate whether CS/DNA nanoparticles affect the initial differentiation direction of human naive CD4 + T cells. The indirect impact of CS/DNA nanoparticles on naive CD4 + T cell differentiation was investigated by incubating the nanoparticles with human macrophage THP-1 cells in one chamber of a transwell co-incubation system, with the enriched human naive CD4 + T cells being placed in the other chamber of the transwell. The nanoparticles were also co-incubated with the naive CD4 + T cells to explore their direct impact on naive CD4 + T cell differentiation by measuring the release of IL-4 and IFN-γ from the cells. It was demonstrated that CS/DNA nanoparticles induced slightly elevated production of IL-12 by THP-1 cells, possibly owing to the presence of CpG motifs in the plasmid. However, this macrophage stimulating activity was much less significant as compared with lipopolysaccharide and did not impact on the differentiation of the naive CD4 + T cells. It was also demonstrated that, when directly exposed to the naive CD4 + T cells, the nanoparticles induced neither the activation of the naive CD4 + T cells in the absence of recombinant cytokines (recombinant human IL-4 or IFN-γ) that induce naive CD4 + T cell polarization, nor any changes in the differentiation direction of naive CD4 + T cells in the presence of the corresponding cytokines.

  10. Effects of DNA Extraction Procedures on Bacteroides Profiles in Fecal Samples From Various Animals Determined by Terminal Restriction Fragment Length Polymorphism Analysis

    Science.gov (United States)

    A major assumption in microbial source tracking is that some fecal bacteria are specific to a host animal, and thus provide unique microbial fingerprints that can be used to differentiate hosts. However, the DNA information obtained from a particular sample may be biased dependi...

  11. Genetic diversity and substantial population differentiation in Crassostrea hongkongensis revealed by mitochondrial DNA.

    Science.gov (United States)

    Li, Lu; Wu, Xiangyun; Yu, Ziniu

    2013-09-01

    The Hong Kong oyster, Crassostrea hongkongensis, is an important fisheries resource that is cultivated in the coastal waters of the South China Sea. Despite significant advances in understanding biological and taxonomic aspects of this species, no detailed study of its population genetic diversity in regions of extensive cultivation are available. Direct sequencing of the mtDNA cox1 gene region was used to investigate genetic variation within and between eleven C. hongkongensis populations collected from typical habitats. Sixty-two haplotypes were identified; only haplotype 2 (21.74% of total haplotypes) was shared among all the eleven populations, and most of the observed haplotypes were restricted to individual populations. Both AMOVA and FST analyses revealed significant population structure, and the isolation by distance (IBD) was confirmed. The highest local differentiation was observed between the sample pools from Guangxi versus Guangdong and Fujian, which are separated by a geographic barrier, the Leizhou Peninsula. Current knowledge from seed management suggests that seed transfer from Guangxi province has likely reduced the divergence that somewhat naturally exists between these pools. The findings from the present study could be useful for genetic management and may serve as a baseline by which to monitor future changes in genetic diversity, either due to natural or anthropogenic impacts. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Distinct kinetics of human DNA ligases I, IIIalpha, IIIbeta, and IV reveal direct DNA sensing ability and differential physiological functions in DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xi; Ballin, Jeff D.; Della-Maria, Julie; Tsai, Miaw-Sheue; White, Elizabeth J.; Tomkinson, Alan E.; Wilson, Gerald M.

    2009-05-11

    The three human LIG genes encode polypeptides that catalyze phosphodiester bond formation during DNA replication, recombination and repair. While numerous studies have identified protein partners of the human DNA ligases (hLigs), there has been little characterization of the catalytic properties of these enzymes. In this study, we developed and optimized a fluorescence-based DNA ligation assay to characterize the activities of purified hLigs. Although hLigI joins DNA nicks, it has no detectable activity on linear duplex DNA substrates with short, cohesive single-strand ends. By contrast, hLigIII{beta} and the hLigIII{alpha}/XRCC1 and hLigIV/XRCC4 complexes are active on both nicked and linear duplex DNA substrates. Surprisingly, hLigIV/XRCC4, which is a key component of the major non-homologous end joining (NHEJ) pathway, is significantly less active than hLigIII on a linear duplex DNA substrate. Notably, hLigIV/XRCC4 molecules only catalyze a single ligation event in the absence or presence of ATP. The failure to catalyze subsequent ligation events reflects a defect in the enzyme-adenylation step of the next ligation reaction and suggests that, unless there is an in vivo mechanism to reactivate DNA ligase IV/XRCC4 following phosphodiester bond formation, the cellular NHEJ capacity will be determined by the number of adenylated DNA ligaseIV/XRCC4 molecules.

  13. Genetic and chemical diversity of high mucilaginous plants of Sida complex by ISSR markers and chemical fingerprinting.

    Science.gov (United States)

    Thul, Sanjog T; Srivastava, Ankit K; Singh, Subhash C; Shanker, Karuna

    2011-09-01

    A method was developed based on multiple approaches wherein DNA and chemical analysis was carried out toward differentiation of important species of Sida complex that is being used for commercial preparation. Isolated DNA samples were successfully performed through PCR amplification using ISSR markers and degree of genetic diversity among the different species of Sida is compared with that of chemical diversity. For genetic fingerprint investigation, selected 10 ISSR primers generating reproducible banding patterns were used. Among the total of 63 amplicons, 62 were recorded as polymorphic, genetic similarity index deduced from ISSR profiles ranged from 12 to 51%. Based on similarity index, S. acuta and S. rhombifolia found to be most similar (51%). High number of species-specific bands played pivotal role to delineate species at genetic level. Investigation based on HPTLC fingerprints analysis revealed 23 bands representing to characteristic chemicals and similarity index ranged from 73 to 91%. Prominent distinguishable bands were observed only in S. acuta, while S. cordifolia and S. rhombifolia shared most bands making them difficult to identify on chemical fingerprint basis. This report summarizes the genotypic and chemotypic diversity and the use of profiles for authentication of species of Sida complex.

  14. cDNA-SRAP and Its Application in Differential Gene Expression Analysis: A Case Study in Erianthus arundinaceum

    Directory of Open Access Journals (Sweden)

    Youxiong Que

    2012-01-01

    Full Text Available Erianthus arundinaceum is a wild relative species of sugarcane. The aim of this research was to demonstrate the feasibility of cDNA-SRAP for differential gene expression and to explore the molecular mechanism of drought resistance in E. arundinaceum. cDNA-SRAP technique, for the first time, was applied in the analysis of differential gene expression in E. arundinaceum under drought stress. In total, eight differentially expressed genes with length of 185–427 bp were successfully isolated (GenBank Accession numbers: EU071770, EU071772, EU071774, EU071776, EU071777, EU071779, EU071780, and EU071781. Based on their homologies with genes in GenBank, these genes were assumed to encode ribonuclease III, vacuolar protein, ethylene insensitive protein, aerobactin biosynthesis protein, photosystem II protein, glucose transporter, leucine-rich repeat protein, and ammonia monooxygenase. Real-time PCR analysis on the expression profiling of gene (EU071774 encoding ethylene-insensitive protein and gene (EU071781 encoding ammonia monooxygenase revealed that the expression of these two genes was upregulated both by PEG and ABA treatments, suggesting that they may involve in the drought resistance of E. arundinaceum. This study constitutes the first report of genes activated in E. arundinaceum by drought stress and opens up the application of cDNA-SRAP in differential gene expression analysis in E. arundinaceum under certain stress conditions.

  15. Partial Device Fingerprints

    NARCIS (Netherlands)

    Ciere, M.; Hernandez Ganan, C.; van Eeten, M.J.G.

    2017-01-01

    In computing, remote devices may be identified by means of device fingerprinting, which works by collecting a myriad of clientside attributes such as the device’s browser and operating system version, installed plugins, screen resolution, hardware artifacts, Wi-Fi settings, and anything else

  16. DNA fingerprinting of Shiga-toxin producing Escherichia coli O157 based on Multiple-Locus Variable-Number Tandem-Repeats Analysis (MLVA

    Directory of Open Access Journals (Sweden)

    Vardund Traute

    2003-12-01

    Full Text Available Abstract Background The ability to react early to possible outbreaks of Escherichia coli O157:H7 and to trace possible sources relies on the availability of highly discriminatory and reliable techniques. The development of methods that are fast and has the potential for complete automation is needed for this important pathogen. Methods In all 73 isolates of shiga-toxin producing E. coli O157 (STEC were used in this study. The two available fully sequenced STEC genomes were scanned for tandem repeated stretches of DNA, which were evaluated as polymorphic markers for isolate identification. Results The 73 E. coli isolates displayed 47 distinct patterns and the MLVA assay was capable of high discrimination between the E. coli O157 strains. The assay was fast and all the steps can be automated. Conclusion The findings demonstrate a novel high discriminatory molecular typing method for the important pathogen E. coli O157 that is fast, robust and offers many advantages compared to current methods.

  17. Rapid classification of turmeric based on DNA fingerprint by near-infrared spectroscopy combined with moving window partial least squares-discrimination analysis

    International Nuclear Information System (INIS)

    Kasemsumran, Sumaporn; Suttiwijitpukdee, Nattaporn; Keeratinijakal, Vichein

    2017-01-01

    In this research, near-infrared (NIR) spectroscopy in combination with moving window partial least squares-discrimination analysis (MWPLS-DA) was utilized to discriminate the variety of turmeric based on DNA markers, which correlated to the quantity of curcuminoid. Curcuminoid was used as a marker compound in variety identification due to the most pharmacological properties of turmeric possessed from it. MWPLS-DA optimized informative NIR spectral regions for the fitting and prediction to {-1/1}-coded turmeric varieties, indicating variables in the development of latent variables in discrimination analysis. Consequently, MWPLS-DA benefited in the selection of combined informative NIR spectral regions of 1100 – 1260, 1300 – 1500 and 1880 – 2500 nm for classification modeling of turmeric variety with 148 calibration samples, and yielded the results better than that obtained from a partial least squares-discrimination analysis (PLS-DA) model built by using the whole NIR spectral region. An effective and rapid strategy of using NIR in combination with MWPLS-DA provided the best variety identification results of 100% in both specificity and total accuracy for 48 test samples. (author)

  18. Chromatin condensation and differential sensitivity of mammalian and insect cells to DNA strand breaks induced by bleomycin

    Energy Technology Data Exchange (ETDEWEB)

    Lopez-Larraza, Daniel M. [IMBICE, C.C. 403, 1900 La Plata (Argentina)]. E-mail: danielop@imbice.org.ar; Padron, Juan [IMBICE, C.C. 403, 1900 La Plata (Argentina); Ronci, Natalia E. [IMBICE, C.C. 403, 1900 La Plata (Argentina); Vidal Rioja, Lidia A. [IMBICE, C.C. 403, 1900 La Plata (Argentina)

    2006-08-30

    Bleomycin (BLM) induces DNA damage in living cells. In this report we analyzed the role of chromatin compactness in the differential response of mosquito (ATC-15) and mammalian (CHO) cells to DNA strand breaks induced by BLM. We used cells unexposed and exposed to sodium butyrate (NaB), which induces chromatin decondensation. By nucleoid sedimentation assay and digestions of nuclei with DNAse I, untreated mosquito cells (no BLM; no NaB) were shown to have more chromatin condensation than untreated CHO cells. By alkaline unwinding ATC-15 cells treated with NaB showed more BLM-induced DNA strand breaks than NaB-untreated CHO cells. The time-course of BLM-induced DNA damage to nuclear DNA was similar for NaB-untreated mammalian and insect cells, but with mosquito cells showing less DNA strand breaks, both at physiological temperatures and at 4 {sup o}C. However, when DNA repair was inhibited by low temperatures and chromatin was decondensed by NaB treatments, differences in BLM-induced DNA damage between these cells lines were no longer observed. In both cell lines, NaB did not affect BLM action on cell growth and viability. On the other hand, the low sensitivity of ATC-15 cells to BLM was reflected in their better growth efficiency. These cells exhibited a satisfactory growth at BLM doses that produced a permanent arrest of growth in CHO cells. The data suggest that mosquito cells might have linker DNAs shorter than those of mammalian cells, which would result in the observed both greater chromatin condensation and greater resistance to DNA damage induced by BLM as compared to CHO cells.

  19. Chromatin condensation and differential sensitivity of mammalian and insect cells to DNA strand breaks induced by bleomycin

    International Nuclear Information System (INIS)

    Lopez-Larraza, Daniel M.; Padron, Juan; Ronci, Natalia E.; Vidal Rioja, Lidia A.

    2006-01-01

    Bleomycin (BLM) induces DNA damage in living cells. In this report we analyzed the role of chromatin compactness in the differential response of mosquito (ATC-15) and mammalian (CHO) cells to DNA strand breaks induced by BLM. We used cells unexposed and exposed to sodium butyrate (NaB), which induces chromatin decondensation. By nucleoid sedimentation assay and digestions of nuclei with DNAse I, untreated mosquito cells (no BLM; no NaB) were shown to have more chromatin condensation than untreated CHO cells. By alkaline unwinding ATC-15 cells treated with NaB showed more BLM-induced DNA strand breaks than NaB-untreated CHO cells. The time-course of BLM-induced DNA damage to nuclear DNA was similar for NaB-untreated mammalian and insect cells, but with mosquito cells showing less DNA strand breaks, both at physiological temperatures and at 4 o C. However, when DNA repair was inhibited by low temperatures and chromatin was decondensed by NaB treatments, differences in BLM-induced DNA damage between these cells lines were no longer observed. In both cell lines, NaB did not affect BLM action on cell growth and viability. On the other hand, the low sensitivity of ATC-15 cells to BLM was reflected in their better growth efficiency. These cells exhibited a satisfactory growth at BLM doses that produced a permanent arrest of growth in CHO cells. The data suggest that mosquito cells might have linker DNAs shorter than those of mammalian cells, which would result in the observed both greater chromatin condensation and greater resistance to DNA damage induced by BLM as compared to CHO cells

  20. A Novel Open Tubular Capillary Electrochromatographic Method for Differentiating the DNA Interaction Affinity of Environmental Contaminants.

    Directory of Open Access Journals (Sweden)

    Lucia D'Ulivo

    Full Text Available The interaction of chemicals with DNA may lead to genotoxicity, mutation or carcinogenicity. A simple open tubular capillary electrochromatographic method is proposed to rapidly assess the interaction affinity of three environmental contaminants (1,4-phenylenediamine, pyridine and 2,4-diaminotoluene to DNA by measuring their retention in the capillaries coated with DNA probes. DNA oligonucleotide probes were immobilized on the inner wall of a fused silica capillary that was first derivatized with 3-(aminopropyl-triethoxysilane (APTES. The difference in retention times and factors was considered as the difference in interaction affinity of the contaminants to the DNA probes. The interaction of the contaminants with both double-stranded (dsDNA and single-stranded DNA (ssDNA coatings was compared. Retention factors of 1,4-phenylenediamine, pyridine and 2,4-diaminotoluene in the capillary coated with ssDNA probe were 0.29, 0.42, and 0.44, respectively. A similar trend was observed in the capillary coated with dsDNA, indicating that 2,4-diaminotoluene has the highest affinity among the three contaminants. The relative standard deviation (RSD for the retention factors was in the range of 0.05-0.69% (n = 3. The results demonstrated that the developed technique could be applied for preliminary screening purpose to provide DNA interaction affinity information of various environmental contaminants.

  1. Differential association with cellular substructures of pseudorabies virus DNA during early and late phases of replication

    International Nuclear Information System (INIS)

    Ben-Porat, T.; Veach, R.A.; Blankenship, M.L.; Kaplan, A.S.

    1984-01-01

    Pseudorabies virus DNA synthesis can be divided into two phases, early and late, which can be distinguished from each other on the basis of the structures of the replicating DNA. The two types of replicating virus DNA can also be distinguished from each other on the basis of the cellular substructures with which each is associated. Analysis by electron microscopic autoradiography showed that during the first round of replication, nascent virus DNA was found in the vicinity of the nuclear membrane; during later rounds of replication the nascent virus DNA was located centrally within the nucleus. The degree of association of virus DNA synthesized at early and late phases with the nuclear matrix fractions also differed; a larger proportion of late than of early nascent virus DNA was associated with this fraction. While nascent cellular DNA only was associated in significant amounts with the nuclear matrix fraction, a large part (up to 40%) of all the virus DNA remained associated with this fraction. However, no retention of specific virus proteins in this fraction was observed. Except for two virus proteins, which were preferentially extracted from the nuclear matrix, approximately 20% of all virus proteins remained in the nuclear matrix fraction. The large proportion of virus DNA associated with the nuclear fraction indicated that virus DNA may be intimately associated with some proteins

  2. Differential representation of sunflower ESTs in enriched organ-specific cDNA libraries in a small scale sequencing project

    Directory of Open Access Journals (Sweden)

    Heinz Ruth A

    2003-09-01

    Full Text Available Abstract Background Subtractive hybridization methods are valuable tools for identifying differentially regulated genes in a given tissue avoiding redundant sequencing of clones representing the same expressed genes, maximizing detection of low abundant transcripts and thus, affecting the efficiency and cost effectiveness of small scale cDNA sequencing projects aimed to the specific identification of useful genes for breeding purposes. The objective of this work is to evaluate alternative strategies to high-throughput sequencing projects for the identification of novel genes differentially expressed in sunflower as a source of organ-specific genetic markers that can be functionally associated to important traits. Results Differential organ-specific ESTs were generated from leaf, stem, root and flower bud at two developmental stages (R1 and R4. The use of different sources of RNA as tester and driver cDNA for the construction of differential libraries was evaluated as a tool for detection of rare or low abundant transcripts. Organ-specificity ranged from 75 to 100% of non-redundant sequences in the different cDNA libraries. Sequence redundancy varied according to the target and driver cDNA used in each case. The R4 flower cDNA library was the less redundant library with 62% of unique sequences. Out of a total of 919 sequences that were edited and annotated, 318 were non-redundant sequences. Comparison against sequences in public databases showed that 60% of non-redundant sequences showed significant similarity to known sequences. The number of predicted novel genes varied among the different cDNA libraries, ranging from 56% in the R4 flower to 16 % in the R1 flower bud library. Comparison with sunflower ESTs on public databases showed that 197 of non-redundant sequences (60% did not exhibit significant similarity to previously reported sunflower ESTs. This approach helped to successfully isolate a significant number of new reported sequences

  3. Localization of DNA methyltransferase-1 during oocyte differentiation, in vitro maturation and early embryonic development in cow

    Directory of Open Access Journals (Sweden)

    A. M. Luciano

    2009-12-01

    Full Text Available DNA methyltransferase-1 (Dnmt1 is involved in the maintenance of DNA methylation patterns and is crucial for normal mammalian development. The aim of the present study was to assess the localization of Dnmt1 in cow, during the latest phases of oocyte differentiation and during the early stages of segmentation. Dnmt1 expression and localization were assessed in oocytes according to the chromatin configuration, which in turn provides an important epigenetic mechanism for the control of global gene expression and represents a morphological marker of oocyte differentiation.We found that the initial chromatin condensation was accompanied by a slight increase in the level of global DNA methylation, as assessed by 5-methyl-cytosine immunostaining followed by laser scanning confocal microscopy analysis (LSCM. RT-PCR confirmed the presence of Dnmt1 transcripts throughout this phase of oocyte differentiation. Analogously, Dnmt1 immunodetection and LSCM indicated that the protein was always present and localized in the cytoplasm, regardless the chromatin configuration and the level of global DNA methylation. Moreover, our data indicate that while Dnmt1 is retained in the cytoplasm in metaphase II stage oocytes and zygotes, it enters the nuclei of 8-16 cell stage embryos. As suggested in mouse, the functional meaning of the presence of Dnmt1 in the bovine embryo nuclei could be the maintainement of the methylation pattern of imprinted genes. In conclusion, the present work provides useful elements for the study of Dnmt1 function during the late stage of oocyte differentiation, maturation and early embryonic development in mammals.

  4. Y-chromosomal DNA markers for discrimination of chemical substance and effluent effects on sexual differentiation in salmon.

    OpenAIRE

    Afonso, Luis O B; Smith, Jack L; Ikonomou, Michael G; Devlin, Robert H

    2002-01-01

    Chinook salmon alevins were exposed during their labile period for sex differentiation to different concentrations of bleached kraft mill effluent (BKME), primary sewage effluent, secondary sewage effluent (SE), 17ss-estradiol, testosterone, and nonylphenol. After exposure for 29 days post hatching (DPH), fish were allowed to grow until 103 and 179 DPH, at which time their genetic sex was determined using Y-chromosomal DNA markers and their gonadal sex was determined by histology. Independent...

  5. Spermatogenesis, sperm DNA integrity, and testicular hormonal function are differentially affected following cytotoxic therapy

    International Nuclear Information System (INIS)

    Constine, L.S.; Schwartz, C.; Hobbie, W.; Evenson, D.; Hinkle, A.; Palisca, M.; Smudzin, T.; Centola, G.

    1997-01-01

    former also had defective morphology (primarily head defects). Ten of the 15 patients (67%) had < 1 million/ml sperm, all but 1 of whom had received CT. Sperm chromatin FC examination was performed on 8 patients treated with RT or 3.6 - 22 gm cyclophosphamide. Two patients with zero sperm were unevaluable, although the technique could analyze a patient with 0.3 million/ml sperm. Six patients demonstrated varying degrees of chromatin structural abnormalities or immature chromatin condensation, including the 2 patients treated with RT alone who had normal sperm counts (81 and 24 million/ml sperm), and the 2 patients receiving < 10 gm cyclophosphamide (one with normal sperm count of 40 million/ml). Additional patients are being analyzed. Nine of 12 patients treated with an alkylating agent were hormonally evaluated. All had normal luteinizing hormone (LH) and 8 had normal testosterone, despite low sperm counts in all but 1. Six had elevated follicle-stimulating hormone (FSH), all of whom had low sperm counts. Of the 3 patients with normal FSH levels, the sperm counts were 0, 19, and 40 million/ml. In the cyclophosphamide treated patients, the relationship between dose and sperm count/motility is depicted. Conclusions: We conclude: (1) Patients treated with CT and/or RT may sustain sperm DNA damage; this can be detected even in patients with normal sperm numbers, affirming the sensitivity of FC. Clinical correlations and additional patients are currently under investigation. (2) CT with an alkylating agent can impair spermatogenesis without disturbing testicular hormonal production. FSH is more likely to reflect abnormal sperm production than testosterone or LH, presumably due to differential effects of therapy on leydig and sertoli cells

  6. Phenomenological Fingerprints of Four Meditations: Differential State Changes in Affect, Mind-Wandering, Meta-Cognition, and Interoception Before and After Daily Practice Across 9 Months of Training.

    Science.gov (United States)

    Kok, Bethany E; Singer, Tania

    2017-01-01

    Despite increasing interest in the effects of mental training practices such as meditation, there is much ambiguity regarding whether and to what extent the various types of mental practice have differential effects on psychological change. To address this gap, we compare the effects of four common meditation practices on measures of state change in affect, mind-wandering, meta-cognition, and interoception. In the context of a 9-month mental training program called the ReSource Project, 229 mid-life adults (mean age 41) provided daily reports before and after meditation practice. Participants received training in the following three successive modules: the first module (presence) included breathing meditation and body scan, the second (affect) included loving-kindness meditation, and the third (perspective) included observing-thought meditation. Using multilevel modeling, we found that body scan led to the greatest state increase in interoceptive awareness and the greatest decrease in thought content, loving-kindness meditation led to the greatest increase in feelings of warmth and positive thoughts about others, and observing-thought meditation led to the greatest increase in meta-cognitive awareness. All practices, including breathing meditation, increased positivity of affect, energy, and present focus and decreased thought distraction. Complementary network analysis of intervariate relationships revealed distinct phenomenological clusters of psychological change congruent with the content of each practice. These findings together suggest that although different meditation practices may have common beneficial effects, each practice can also be characterized by a distinct short-term psychological fingerprint, the latter having important implications for the use of meditative practices in different intervention contexts and with different populations.

  7. Epigenetic subgroups of esophageal and gastric adenocarcinoma with differential GATA5 DNA methylation associated with clinical and lifestyle factors.

    Directory of Open Access Journals (Sweden)

    Xinhui Wang

    Full Text Available BACKGROUND: Adenocarcinomas located near the gastroesophageal junction have unclear etiology and are difficult to classify. We used DNA methylation analysis to identify subtype-specific markers and new subgroups of gastroesophageal adenocarcinomas, and studied their association with epidemiological risk factors and clinical outcomes. METHODOLOGY/PRINCIPAL FINDINGS: We used logistic regression models and unsupervised hierarchical cluster analysis of 74 DNA methylation markers on 45 tumor samples (44 patients of esophageal and gastric adenocarcinomas obtained from a population-based case-control study to uncover epigenetic markers and cluster groups of gastroesophageal adenocarcinomas. No distinct epigenetic differences were evident between subtypes of gastric and esophageal cancers. However, we identified two gastroesophageal adenocarcinoma subclusters based on DNA methylation profiles. Group membership was best predicted by GATA5 DNA methylation status. We analyzed the associations between these two epigenetic groups and exposure using logistic regression, and the associations with survival time using Cox regression in a larger set of 317 tumor samples (278 patients. There were more males with esophageal and gastric cardia cancers in Cluster Group 1 characterized by higher GATA5 DNA methylation values (all p<0.05. This group also showed associations of borderline statistical significance with having ever smoked (p-value = 0.07, high body mass index (p-value = 0.06, and symptoms of gastroesophageal reflux (p-value = 0.07. Subjects in cluster Group 1 showed better survival than those in Group 2 after adjusting for tumor differentiation grade, but this was not found to be independent of tumor stage. CONCLUSIONS/SIGNIFICANCE: DNA methylation profiling can be used in population-based studies to identify epigenetic subclasses of gastroesophageal adenocarcinomas and class-specific DNA methylation markers that can be linked to

  8. Development of a porcine skeletal muscle cDNA microarray: analysis of differential transcript expression in phenotypically distinct muscles

    Directory of Open Access Journals (Sweden)

    Stear Michael

    2003-03-01

    Full Text Available Abstract Background Microarray profiling has the potential to illuminate the molecular processes that govern the phenotypic characteristics of porcine skeletal muscles, such as hypertrophy or atrophy, and the expression of specific fibre types. This information is not only important for understanding basic muscle biology but also provides underpinning knowledge for enhancing the efficiency of livestock production. Results We report on the de novo development of a composite skeletal muscle cDNA microarray, comprising 5500 clones from two developmentally distinct cDNA libraries (longissimus dorsi of a 50-day porcine foetus and the gastrocnemius of a 3-day-old pig. Clones selected for the microarray assembly were of low to moderate abundance, as indicated by colony hybridisation. We profiled the differential expression of genes between the psoas (red muscle and the longissimus dorsi (white muscle, by co-hybridisation of Cy3 and Cy5 labelled cDNA derived from these two muscles. Results from seven microarray slides (replicates correctly identified genes that were expected to be differentially expressed, as well as a number of novel candidate regulatory genes. Quantitative real-time RT-PCR on selected genes was used to confirm the results from the microarray. Conclusion We have developed a porcine skeletal muscle cDNA microarray and have identified a number of candidate genes that could be involved in muscle phenotype determination, including several members of the casein kinase 2 signalling pathway.

  9. Development of simple and rapid PCR-fingerprinting methods for Vibrio cholerae on the basis of genetic diversity of the superintegron.

    Science.gov (United States)

    Chowdhury, N; Asakura, M; Neogi, S B; Hinenoya, A; Haldar, S; Ramamurthy, T; Sarkar, B L; Faruque, S M; Yamasaki, S

    2010-07-01

    To develop simple and rapid PCR-fingerprinting methods for Vibrio cholerae O1 (El Tor and classical biotypes) and O139 serogroup strains which cause major cholera epidemics, on the basis of the diversity of superintegron (SI) carried by these strains. PCR-restriction fragment length polymorphism (PCR-RFLP) assay was developed targeting region between integrase gene in the SI and its nearby ORF, followed by BglI digestion. Besides, a V. cholerae repeat-amplified fragment length polymorphism (VCR-AFLP) assay was also developed. In the PCR-RFLP, 94 El Tor, 29 classical and 54 O139 strains produced nine, three and six different DNA fingerprints, respectively. On the other hand, VCR-AFLP distinguished these El Tor, classical and O139 strains into five, nine and two DNA fingerprints, respectively. Combining both assays the El Tor, classical and O139 strains could be differentiated into 11, 10 and seven different types, respectively. In a comparative study, pulsed-field gel electrophoresis (PFGE) showed similar differentiation for El Tor (11 types), but lower discrimination for O139 (two types) and classical strains (five types). The PCR assays based on SI diversity can be used as a useful typing tool for epidemiological studies of V. cholerae. This newly developed method is more discriminatory, simple, rapid and cost-effective in comparison with PFGE, and thus can be widely applicable. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

  10. Gabor filter based fingerprint image enhancement

    Science.gov (United States)

    Wang, Jin-Xiang

    2013-03-01

    Fingerprint recognition technology has become the most reliable biometric technology due to its uniqueness and invariance, which has been most convenient and most reliable technique for personal authentication. The development of Automated Fingerprint Identification System is an urgent need for modern information security. Meanwhile, fingerprint preprocessing algorithm of fingerprint recognition technology has played an important part in Automatic Fingerprint Identification System. This article introduces the general steps in the fingerprint recognition technology, namely the image input, preprocessing, feature recognition, and fingerprint image enhancement. As the key to fingerprint identification technology, fingerprint image enhancement affects the accuracy of the system. It focuses on the characteristics of the fingerprint image, Gabor filters algorithm for fingerprint image enhancement, the theoretical basis of Gabor filters, and demonstration of the filter. The enhancement algorithm for fingerprint image is in the windows XP platform with matlab.65 as a development tool for the demonstration. The result shows that the Gabor filter is effective in fingerprint image enhancement technology.

  11. Differential Impact of the Monovalent Ions Li+, Na+, K+, and Rb+ on DNA Conformational Properties

    OpenAIRE

    Savelyev, Alexey; MacKerell, Alexander D.

    2014-01-01

    The present report demonstrates that the conformational properties of DNA in solution are sensitive to the type of monovalent ion. Results are based on the ability of a polarizable force field using the classical Drude oscillator to reproduce experimental solution X-ray scattering data more accurately than two nonpolarizable DNA models, AMBER Parmbsc0 and CHARMM36. The polarizable model is then used to calculate scattering profiles of DNA in the presence of four different monovalent salts, Li...

  12. Genetic diversity and differentiation in Prunus species (Rosaceae) using chloroplast and mitochondrial DNA CAPS markers.

    Science.gov (United States)

    Ben Mustapha, S; Ben Tamarzizt, H; Baraket, G; Abdallah, D; Salhi Hannachi, A

    2015-04-27

    Chloroplast (cpDNA) and mitochondrial DNA (mtDNA) were analyzed to establish genetic relationships among Tunisian plum cultivars using the polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) technique. Two mtDNA regions (nad 1 b/c and nad 4 1/2) and a cpDNA region (trnL-trnF) were amplified and digested using restriction enzymes. Seventy and six polymorphic sites were revealed in cpDNA and mtDNA, respectively. As a consequence, cpDNA appears to be more polymorphic than mtDNA. The unweighted pair group method with arithmetic mean (UPGMA) dendrogram showed that accessions were distributed independently of their geographical origin, and introduced and local cultivars appear to be closely related. Both UPGMA and principal component analysis grouped Tunisian plum accessions into similar clusters. The analysis of the pooled sequences allowed the detection of 17 chlorotypes and 12 mitotypes. The unique haplotypes detected for cultivars are valuable for management and preservation of the plum local resources. From this study, PCR-RFLP analysis appears to be a useful approach to detect and identify cytoplasmic variation in plum trees. Our results also provide useful information for the management of genetic resources and to establish a program to improve the genetic resources available for plums.

  13. Reference Device-Assisted Adaptive Location Fingerprinting

    Directory of Open Access Journals (Sweden)

    Dongjin Wu

    2016-06-01

    Full Text Available Location fingerprinting suffers in dynamic environments and needs recalibration from time to time to maintain system performance. This paper proposes an adaptive approach for location fingerprinting. Based on real-time received signal strength indicator (RSSI samples measured by a group of reference devices, the approach applies a modified Universal Kriging (UK interpolant to estimate adaptive temporal and environmental radio maps. The modified UK can take the spatial distribution characteristics of RSSI into account. In addition, the issue of device heterogeneity caused by multiple reference devices is further addressed. To compensate the measuring differences of heterogeneous reference devices, differential RSSI metric is employed. Extensive experiments were conducted in an indoor field and the results demonstrate that the proposed approach not only adapts to dynamic environments and the situation of changing APs’ positions, but it is also robust toward measuring differences of heterogeneous reference devices.

  14. Differentiation and diagnosis of Pseudocercosporella herpotrichoides (Fron) Deighton with genomic DNA probes

    DEFF Research Database (Denmark)

    Frei, U; Wenzel, G.

    1993-01-01

    Repetitive genomic clones were used to differentiate between varieties within the species Pseudocercosporella herpotrichoides. From 21 clones tested 13 revealed restriction fragment length polymorphisms among isolates. Cluster analysis was performed based on these data. Differentiation of isolate...

  15. Intraspecific differentiation of Paramecium novaurelia strains (Ciliophora, Protozoa) inferred from phylogenetic analysis of ribosomal and mitochondrial DNA variation.

    Science.gov (United States)

    Tarcz, Sebastian

    2013-01-01

    Paramecium novaurelia Beale and Schneller, 1954, was first found in Scotland and is known to occur mainly in Europe, where it is the most common species of the P. aurelia complex. In recent years, two non-European localities have been described: Turkey and the United States of America. This article presents the analysis of intraspecific variability among 25 strains of P. novaurelia with the application of ribosomal and mitochondrial loci (ITS1-5.8S-ITS2, 5' large subunit rDNA (5'LSU rDNA) and cytochrome c oxidase subunit 1 (COI) mtDNA). The mean distance observed for all of the studied P. novaurelia sequence pairs was p=0.008/0.016/0.092 (ITS1-5.8S-ITS2/5'LSU rDNA/COI). Phylogenetic trees (NJ/MP/BI) based on a comparison of all of the analysed sequences show that the studied strains of P. novaurelia form a distinct clade, separate from the P. caudatum outgroup, and are divided into two clusters (A and B) and two branches (C and D). The occurrence of substantial genetic differentiation within P. novaurelia, confirmed by the analysed DNA fragments, indicates a rapid evolution of particular species within the Paramecium genus. Copyright © 2012 Elsevier GmbH. All rights reserved.

  16. Fingerprint: A Unique and Reliable Method for Identification

    Directory of Open Access Journals (Sweden)

    Palash Kumar Bose

    2017-01-01

    Full Text Available Fingerprints have been the gold standard for personal identification within the forensic community for more than one hundred years. It is still universal in spite of discovery of DNA fingerprint. The science of fingerprint identification has evolved over time from the early use of finger prints to mark business transactions in ancient Babylonia to their use today as core technology in biometric security devices and as scientific evidence in courts of law throughout the world. The science of fingerprints, dactylography or dermatoglyphics, had long been widely accepted, and well acclaimed and reputed as panacea for individualization, particularly in forensic investigations. Human fingerprints are detailed, unique, difficult to alter, and durable over the life of an individual, making them suitable as lifelong markers of human identity. Fingerprints can be readily used by police or other authorities to identify individuals who wish to conceal their identity, or to identify people who are incapacitated or deceased, as in the aftermath of a natural disaster

  17. Data Compression of Fingerprint Minutiae

    OpenAIRE

    VISHAL SHRIVASTAVA; SUMIT SHARMA

    2012-01-01

    Biometric techniques have usual advantages over conventional personal identification technique. Among various commercially available biometric techniques such as face, fingerprint, Iris etc., fingerprint-based techniques are the most accepted recognition system. Fingerprints are trace or impression of patterns created byfriction ridges of the skin in the fingers and thumbs. Steganography usually used in smart card is a safe technique for authenticating a person. In steganography, biometric ch...

  18. Nonparametric testing for DNA copy number induced differential mRNA gene expression

    NARCIS (Netherlands)

    van Wieringen, W.N.; van de Wiel, M.A.

    2009-01-01

    The central dogma of molecular biology relates DNA with mRNA. Array CGH measures DNA copy number and gene expression microarrays measure the amount of mRNA. Methods that integrate data from these two platforms may uncover meaningful biological relationships that further our understanding of cancer.

  19. Novel and differential accumulation of mitochondrial DNA deletions in Swedish and vietnamese patients with colorectal cancer.

    Science.gov (United States)

    Dimberg, Jan; Hong, Thai Trinh; Skarstedt, Marita; Löfgren, Sture; Zar, Niklas; Matussek, Andreas

    2014-01-01

    Mitochondrial DNA (mtDNA) has been proposed to be involved in carcinogenesis and aging. The mtDNA 4977 bp deletion is one of the most frequently observed mtDNA mutations in human tissues and may play a role in colorectal cancer (CRC). In the present study, we aimed to evaluate the frequency of mtDNA 4977 bp deletion in CRC tissues and its association with clinical factors. We determined the presence of the 4977 bp common deletion in cancer and normal paired tissue samples from 105 Swedish and 88 Vietnamese patients with CRC using polymerase chain reaction (PCR) assays. The mtDNA 4977 bp deletion was shown to be significantly more frequent in normal tissues in comparison with paired cancer tissues in both Swedish and Vietnamese patients. The 4977 bp common deletion was significantly more frequent in cancer tissues of the Vietnamese patients compared to the Swedish patients, and in Vietnamese cancer tissues, the 4977 bp deletion was significantly over represented in those with localized disease compared to those with disseminated disease. Moreover, we detected nine novel mtDNA deletions and found a significantly higher rate of these in CRC tissues in Swedish in comparison to Vietnamese patients. The mtDNA 4977 bp deletion seems to have an impact on the clinical outcome of CRC in Vietnamese patients, that the Swedish patients accumulate more of the detected novel deletions in CRC tissue compared to Vietnamese patients probably indicates divergent mechanisms in colorectal carcinogenesis.

  20. Molecular fingerprinting of the Egyptian medicinal plant Cocculus ...

    African Journals Online (AJOL)

    Since no information about the genome of C. pendulus is available, the current study deals with molecular investigation of C. pendulus expressed by DNA fingerprinting of the young leaves of this plant using amplified fragment length polymorphism (AFLP) technique with four primer combinations. The obtained results ...

  1. Differential DNA methylation profile of key genes in malignant prostate epithelial cells transformed by inorganic arsenic or cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Pelch, Katherine E.; Tokar, Erik J. [National Toxicology Program Laboratory, Division of the National Toxicology Program, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 (United States); Merrick, B. Alex [Molecular Toxicology and Informatics Group, Biomolecular Screening Branch, Division of the National Toxicology Program, National Institute of Environmental Health Sciences, Morrisville, NC 27560 (United States); Waalkes, Michael P., E-mail: waalkes@niehs.nih.gov [National Toxicology Program Laboratory, Division of the National Toxicology Program, National Institute of Environmental Health Sciences, Research Triangle Park, NC 27709 (United States)

    2015-08-01

    Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10 μM Cd for 11 weeks (CTPE) or 5 μM iAs for 29 weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1) were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (> 25-fold) and S100P (> 40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (> 15-fold) and NTM (> 1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. - Highlights: • Cd and iAs are known human carcinogens, yet neither appears directly mutagenic. • Prior data suggest epigenetic modification plays a role in Cd or iAs induced cancer. • Altered methylation of four misregulated genes was found in Cd or iAs transformants. • The resulting altered gene expression may be relevant to cellular

  2. Differential DNA methylation profile of key genes in malignant prostate epithelial cells transformed by inorganic arsenic or cadmium

    International Nuclear Information System (INIS)

    Pelch, Katherine E.; Tokar, Erik J.; Merrick, B. Alex; Waalkes, Michael P.

    2015-01-01

    Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10 μM Cd for 11 weeks (CTPE) or 5 μM iAs for 29 weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1) were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (> 25-fold) and S100P (> 40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (> 15-fold) and NTM (> 1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. - Highlights: • Cd and iAs are known human carcinogens, yet neither appears directly mutagenic. • Prior data suggest epigenetic modification plays a role in Cd or iAs induced cancer. • Altered methylation of four misregulated genes was found in Cd or iAs transformants. • The resulting altered gene expression may be relevant to cellular

  3. Differential DNA methylation profile of key genes in malignant prostate epithelial cells transformed by inorganic arsenic or cadmium.

    Science.gov (United States)

    Pelch, Katherine E; Tokar, Erik J; Merrick, B Alex; Waalkes, Michael P

    2015-08-01

    Previous work shows altered methylation patterns in inorganic arsenic (iAs)- or cadmium (Cd)-transformed epithelial cells. Here, the methylation status near the transcriptional start site was assessed in the normal human prostate epithelial cell line (RWPE-1) that was malignantly transformed by 10μM Cd for 11weeks (CTPE) or 5μM iAs for 29weeks (CAsE-PE), at which time cells showed multiple markers of acquired cancer phenotype. Next generation sequencing of the transcriptome of CAsE-PE cells identified multiple dysregulated genes. Of the most highly dysregulated genes, five genes that can be relevant to the carcinogenic process (S100P, HYAL1, NTM, NES, ALDH1A1) were chosen for an in-depth analysis of the DNA methylation profile. DNA was isolated, bisulfite converted, and combined bisulfite restriction analysis was used to identify differentially methylated CpG sites, which was confirmed with bisulfite sequencing. Four of the five genes showed differential methylation in transformants relative to control cells that was inversely related to altered gene expression. Increased expression of HYAL1 (>25-fold) and S100P (>40-fold) in transformants was correlated with hypomethylation near the transcriptional start site. Decreased expression of NES (>15-fold) and NTM (>1000-fold) in transformants was correlated with hypermethylation near the transcriptional start site. ALDH1A1 expression was differentially expressed in transformed cells but was not differentially methylated relative to control. In conclusion, altered gene expression observed in Cd and iAs transformed cells may result from altered DNA methylation status. Published by Elsevier Inc.

  4. Caracterización molecular de Colletotrichum gloeosporioides aislado de plantas de ñame de la Costa Atlántica Colombiana utilizando la técnica “DNA Amplification Fingerprinting (DAF”

    Directory of Open Access Journals (Sweden)

    Natalia Giraldo Marroquín

    2016-01-01

    Full Text Available La antracnosis en ñame, causada por el hongo Colletotrichum gloeosporioides, es una enfermedad relevante que posee el potencial de destruir el 100% de la cosecha, convirtiéndose en la principal limitante fitosanitaria para el rendimiento del cultivo en el país. Esta es una situación preocupante considerando que aproximadamente 35.000 familias de pequeños y medianos agricultores de la Costa Atlántica Colombiana subsisten de este cultivo; es por esto que el objetivo de este trabajo fue caracterizar molecularmente 42 aislamientos del hongo procedentes de plantas de ñame con síntomas de la enfermedad, utilizando la técnica molecular “DNA Amplification Fingerprinting (DAF”, caracterizada por su resolución en la determinación de la variabilidad genética de diferentes organismos. Para la determinación de polimorfismos, se amplificaron 16 marcadores DAF implementando iniciadores tipo decámero, los cuales fueron visualizados por electroforesis en microchip con el equipo MCE-202 MultiNA. Se evaluó la reproducibilidad de la técnica DAF. La amplificación arrojó 391 bandas inequívocamente polimórficas en todas las muestras, el coeficiente de Dice identificó cinco grupos con 0.30% de similaridad y el índice de diversidad genética fue de 0.28; datos que reflejan un alto grado de variabilidad en la colección estudiada de C. gloeosporioides. Ésta puede deberse, al intercambio de germoplasma, a su condición heterotálica, a las mutaciones y al alto potencial de dispersión de las conidias que le permiten mantener la viabilidad bajo condiciones adversas. Por último, se encontró que DAF es una técnica reproducible, confirmando que es una metodología fiable para la caracterización molecular de hongos.

  5. 16S partial gene mitochondrial DNA and internal transcribed spacers ribosomal DNA as differential markers of Trichuris discolor populations.

    Science.gov (United States)

    Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C

    2012-05-25

    Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis). Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Differential chromosomal and mitochondrial DNA synthesis in temperature-sensitive mutants of Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Unrau, P.

    1977-01-01

    The amount and type of residual DNA synthesis was determined in eight temperature-sensitive mutants of the smut fungus Ustilago maydis after incubation at the restrictive temperature (32/sup 0/C) for eight hours. Mutants ts-220, ts-207, ts-432 and ts-346 were found to have an overall reduction in the synthesis of both nuclear and mitochondrial DNA in comparison to the wild-type. In mutants ts-20, tsd 1-1, ts-84 and pol 1-1 nuclear DNA synthesis was depressed relative to mitochondrial synthesis. The DNA-polymerase mutant pol 1-1 had persistent nuclear synthesis at about 50% of the rate of synthesis of mitochondrial DNA and similar behavior was observed in a diploid homozygous strain. Mutant ts-84 had an initial burst of DNA synthesis which was reduced for nuclear but not mitochondrial synthesis after three hours preincubation at 32/sup 0/C. tsd 1-1 and ts-20 had nuclear residual synthesis amounting to about 25% of the relative rate of mitochondrial synthesis which correlates to increasing UV sensitivity of these strains on incubation at 32/sup 0/C. A pol 1-1 ts-84 double mutant had an additive loss of nuclear DNA synthesis which indicates that the steps of replication involved may be sequential.

  7. Chemical form of selenium differentially influences DNA repair pathways following exposure to lead nitrate.

    Science.gov (United States)

    McKelvey, Shauna M; Horgan, Karina A; Murphy, Richard A

    2015-01-01

    Lead, an environmental toxin is known to induce a broad range of physiological and biochemical dysfunctions in humans through a number of mechanisms including the deactivation of antioxidants thus leading to generation of reactive oxygen species (ROS) and subsequent DNA damage. Selenium on the other hand has been proven to play an important role in the protection of cells from free radical damage and oxidative stress, though its effects are thought to be form and dose dependent. As the liver is the primary organ required for metabolite detoxification, HepG2 cells were chosen to assess the protective effects of various selenium compounds following exposure to the genotoxic agent lead nitrate. Initially DNA damage was quantified using a comet assay, gene expression patterns associated with DNA damage and signalling were also examined using PCR arrays and the biological pathways which were most significantly affected by selenium were identified. Interestingly, the organic type selenium compounds (selenium yeast and selenomethionine) conferred protection against lead induced DNA damage in HepG2 cells; this is evident by reduction in the quantity of DNA present in the comet tail of cells cultured in their presence with lead. This trend also followed through the gene expression changes noted in DNA damage pathways analysed. These results were in contrast with those of inorganic sodium selenite which promoted lead induced DNA damage evident in both the comet assay results and the gene expression analysis. Over all this study provided valuable insights into the effects which various selenium compounds had on the DNA damage and signalling pathway indicating the potential for using organic forms of selenium such as selenium enriched yeast to protect against DNA damaging agents. Copyright © 2014 Elsevier GmbH. All rights reserved.

  8. Molecular diversity of leuconostoc mesenteroides and leuconostoc citreum isolated from traditional french cheeses as revealed by RAPD fingerprinting, 16S rDNA sequencing and 16S rDNA fragment amplification.

    Science.gov (United States)

    Cibik, R; Lepage, E; Talliez, P

    2000-06-01

    For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.

  9. DNA methylation in the human cerebral cortex is dynamically regulated throughout the life span and involves differentiated neurons.

    Directory of Open Access Journals (Sweden)

    Kimberly D Siegmund

    Full Text Available The role of DNA cytosine methylation, an epigenetic regulator of chromatin structure and function, during normal and pathological brain development and aging remains unclear. Here, we examined by MethyLight PCR the DNA methylation status at 50 loci, encompassing primarily 5' CpG islands of genes related to CNS growth and development, in temporal neocortex of 125 subjects ranging in age from 17 weeks of gestation to 104 years old. Two psychiatric disease cohorts--defined by chronic neurodegeneration (Alzheimer's or lack thereof (schizophrenia--were included. A robust and progressive rise in DNA methylation levels across the lifespan was observed for 8/50 loci (GABRA2, GAD1, HOXA1, NEUROD1, NEUROD2, PGR, STK11, SYK typically in conjunction with declining levels of the corresponding mRNAs. Another 16 loci were defined by a sharp rise in DNA methylation levels within the first few months or years after birth. Disease-associated changes were limited to 2/50 loci in the Alzheimer's cohort, which appeared to reflect an acceleration of the age-related change in normal brain. Additionally, methylation studies on sorted nuclei provided evidence for bidirectional methylation events in cortical neurons during the transition from childhood to advanced age, as reflected by significant increases at 3, and a decrease at 1 of 10 loci. Furthermore, the DNMT3a de novo DNA methyl-transferase was expressed across all ages, including a subset of neurons residing in layers III and V of the mature cortex. Therefore, DNA methylation is dynamically regulated in the human cerebral cortex throughout the lifespan, involves differentiated neurons, and affects a substantial portion of genes predominantly by an age-related increase.

  10. Small molecule probes finely differentiate between various ds- and ss-DNA and RNA by fluorescence, CD and NMR response

    Energy Technology Data Exchange (ETDEWEB)

    Crnolatac, Ivo; Rogan, Iva; Majić, Boris; Tomić, Sanja [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia); Deligeorgiev, Todor [Faculty of Chemistry and Pharmacy, University of Sofia (Bulgaria); Horvat, Gordan [Department of Physical Chemistry, Faculty of Science/Chemistry, Horvatovac 102A, HR-10000 Zagreb (Croatia); Makuc, Damjan; Plavec, Janez [Slovenian NMR Centre, National Institute of Chemistry, Hajdrihova 19, Ljubljana (Slovenia); EN-FIST Centre of Excellence, Trg Osvobodilne Fronte 13, Ljubljana (Slovenia); Pescitelli, Gennaro [Department of Chemistry, University of Pisa, Via Moruzzi 13, Pisa (Italy); Piantanida, Ivo, E-mail: pianta@irb.hr [Division of Organic Chemistry and Biochemistry, Division of Physical Chemistry, Ruđer Bošković Institute, P.O. Box 180, 10002 Zagreb (Croatia)

    2016-10-12

    Two small molecules showed intriguing properties of analytical multipurpose probes, whereby one chromophore gives different signal for many different DNA/RNA by application of several highly sensitive spectroscopic methods. Dyes revealed pronounced fluorescence ratiomeric differentiation between ds-AU-RNA, AT-DNA and GC-DNA in approximate order 10:8:1. Particularly interesting, dyes showed specific fluorimetric response for poly rA even at 10-fold excess of any other ss-RNA, and moreover such emission selectivity is preserved in multicomponent ss-RNA mixtures. The dyes also showed specific chiral recognition of poly rU in respect to the other ss-RNA by induced CD (ICD) pattern in visible range (400–500 nm), which was attributed to the dye-side-chain contribution to binding (confirmed by absence of any ICD band for reference compound lacking side-chain). Most intriguingly, minor difference in the side-chain attached to dye chromophore resulted in opposite sign of dye-ICD pattern, whereby differences in NMR NOESY contacts and proton chemical shifts between two dye/oligo rU complexes combined with MD simulations and CD calculations attributed observed bisignate ICD to the dimeric dye aggregate within oligo rU. - Highlights: • Novel dyes emit fluorescence only for poly rA even at high excess of all other ss-RNA. • Fluorescence response for AT-DNA is 8 times stronger than for GC-DNA. • Florescence induced by ds-RNA is 20% stronger that emission induced by ds-DNA. • Intrinsically non-chiral, dyes show strong and characteristic ICD response for poly rU.

  11. High variation and very low differentiation in wide ranging plains zebra (Equus quagga): insights from mtDNA and microsatellites.

    Science.gov (United States)

    Lorenzen, Eline D; Arctander, Peter; Siegismund, Hans R

    2008-06-01

    Patterns of genetic differentiation in the plains zebra (Equus quagga) were analysed using mitochondrial DNA control region variation and seven microsatellites. The six morphologically defined subspecies of plains zebra lacked the population genetic structure indicative of distinct evolutionary units. Both marker sets showed high levels of genetic variation and very low levels of differentiation. There was no geographical structuring of mitochondrial DNA haplotypes in the phylogenetic tree, and the plains zebra showed the lowest overall differentiation recorded in any African ungulate studied so far. Arid-adapted African ungulates have shown significant regional genetic structuring in support of the Pleistocene refuge theory. This was not the case in the zebra, and the data are discussed in relation to the impact of Pleistocene climate change on a nonbovid member of the savannah ungulate community. The only other species showing a similar absence of genetic structuring is the African buffalo (Syncerus caffer), but this taxon lacks the high levels of morphological variation present in the plains zebra.

  12. diffloop: a computational framework for identifying and analyzing differential DNA loops from sequencing data.

    Science.gov (United States)

    Lareau, Caleb A; Aryee, Martin J; Berger, Bonnie

    2018-02-15

    The 3D architecture of DNA within the nucleus is a key determinant of interactions between genes, regulatory elements, and transcriptional machinery. As a result, differences in DNA looping structure are associated with variation in gene expression and cell state. To systematically assess changes in DNA looping architecture between samples, we introduce diffloop, an R/Bioconductor package that provides a suite of functions for the quality control, statistical testing, annotation, and visualization of DNA loops. We demonstrate this functionality by detecting differences between ENCODE ChIA-PET samples and relate looping to variability in epigenetic state. Diffloop is implemented as an R/Bioconductor package available at https://bioconductor.org/packages/release/bioc/html/diffloop.html. aryee.martin@mgh.harvard.edu. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  13. Homologous and non-homologous recombination differentially affect DNA damage repair in mice.

    NARCIS (Netherlands)

    J. Essers (Jeroen); H. van Steeg (Harry); J. de Wit (Jan); M. Vermeij (Marcel); J.H.J. Hoeijmakers (Jan); R. Kanaar (Roland); S.M.A. Swagemakers (Sigrid)

    2000-01-01

    textabstractIonizing radiation and interstrand DNA crosslinking compounds provide important treatments against cancer due to their extreme genotoxicity for proliferating cells. Both the efficacies of such treatments and the mutagenic potential of these agents are modulated by

  14. Differential regulation of the cellular response to DNA double-strand breaks in G1

    DEFF Research Database (Denmark)

    Barlow, Jacqueline H; Lisby, Michael; Rothstein, Rodney

    2008-01-01

    -induced breaks are recognized by Rfa1 only after the cell enters S phase. This difference is dependent on the DNA end-binding Yku70/Yku80 complex. Cell-cycle regulation is also observed in the DNA damage checkpoint response. Specifically, the 9-1-1 complex is required in G1 cells to recruit the Ddc2 checkpoint...... protein to damaged DNA, while, upon entry into S phase, the cyclin-dependent kinase Cdc28 and the 9-1-1 complex both serve to recruit Ddc2 to foci. Together, these results demonstrate that the DNA repair machinery distinguishes between different types of damage in G1, which translates into different modes...

  15. Differential repair of etheno-DNA adducts by bacterial and human AlkB proteins.

    Science.gov (United States)

    Zdżalik, Daria; Domańska, Anna; Prorok, Paulina; Kosicki, Konrad; van den Born, Erwin; Falnes, Pål Ø; Rizzo, Carmelo J; Guengerich, F Peter; Tudek, Barbara

    2015-06-01

    AlkB proteins are evolutionary conserved Fe(II)/2-oxoglutarate-dependent dioxygenases, which remove alkyl and highly promutagenic etheno(ɛ)-DNA adducts, but their substrate specificity has not been fully determined. We developed a novel assay for the repair of ɛ-adducts by AlkB enzymes using oligodeoxynucleotides with a single lesion and specific DNA glycosylases and AP-endonuclease for identification of the repair products. We compared the repair of three ɛ-adducts, 1,N(6)-ethenoadenine (ɛA), 3,N(4)-ethenocytosine (ɛC) and 1,N(2)-ethenoguanine (1,N(2)-ɛG) by nine bacterial and two human AlkBs, representing four different structural groups defined on the basis of conserved amino acids in the nucleotide recognition lid, engaged in the enzyme binding to the substrate. Two bacterial AlkB proteins, MT-2B (from Mycobacterium tuberculosis) and SC-2B (Streptomyces coelicolor) did not repair these lesions in either double-stranded (ds) or single-stranded (ss) DNA. Three proteins, RE-2A (Rhizobium etli), SA-2B (Streptomyces avermitilis), and XC-2B (Xanthomonas campestris) efficiently removed all three lesions from the DNA substrates. Interestingly, XC-2B and RE-2A are the first AlkB proteins shown to be specialized for ɛ-adducts, since they do not repair methylated bases. Three other proteins, EcAlkB (Escherichia coli), SA-1A, and XC-1B removed ɛA and ɛC from ds and ssDNA but were inactive toward 1,N(2)-ɛG. SC-1A repaired only ɛA with the preference for dsDNA. The human enzyme ALKBH2 repaired all three ɛ-adducts in dsDNA, while only ɛA and ɛC in ssDNA and repair was less efficient in ssDNA. ALKBH3 repaired only ɛC in ssDNA. Altogether, we have shown for the first time that some AlkB proteins, namely ALKBH2, RE-2A, SA-2B and XC-2B can repair 1,N(2)-ɛG and that ALKBH3 removes only ɛC from ssDNA. Our results also suggest that the nucleotide recognition lid is not the sole determinant of the substrate specificity of AlkB proteins. Copyright © 2015 Elsevier B

  16. Binding of histone H1 to DNA is differentially modulated by redox state of HMGB1.

    Directory of Open Access Journals (Sweden)

    Eva Polanská

    Full Text Available HMGB1 is an architectural protein in chromatin, acting also as a signaling molecule outside the cell. Recent reports from several laboratories provided evidence that a number of both the intracellular and extracellular functions of HMGB1 may depend on redox-sensitive cysteine residues of the protein. In this study we demonstrate that redox state of HMGB1 can significantly modulate the ability of the protein to bind and bend DNA, as well as to promote DNA end-joining. We also report a high affinity binding of histone H1 to hemicatenated DNA loops and DNA minicircles. Finally, we show that reduced HMGB1 can readily displace histone H1 from DNA, while oxidized HMGB1 has limited capacity for H1 displacement. Our results suggested a novel mechanism for the HMGB1-mediated modulation of histone H1 binding to DNA. Possible biological consequences of linker histones H1 replacement by HMGB1 for the functioning of chromatin are discussed.

  17. Differential repair of platinum-DNA adducts in human bladder and testicular tumor continuous cell lines

    International Nuclear Information System (INIS)

    Bedford, P.; Fichtinger-Schepman, A.M.; Shellard, S.A.; Walker, M.C.; Masters, J.R.; Hill, B.T.

    1988-01-01

    The formation and removal of four platinum-DNA adducts were immunochemically quantitated in cultured cells derived from a human bladder carcinoma cell line (RT112) and from two lines derived from germ cell tumors of the testis (833K and SUSA), following exposure in vitro to 16.7 microM (5 micrograms/ml) cisplatin. RT112 cells were least sensitive to the drug and were proficient in the repair of all four adducts, whereas SUSA cells, which were 5-fold more sensitive, were deficient in the repair of DNA-DNA intrastrand cross-links in the sequences pApG and pGpG. Despite expressing a similar sensitivity to SUSA cells, 833K cells were proficient in the repair of all four adducts, although less so than the RT112 bladder tumor cells. In addition, SUSA cells were unable to repair DNA-DNA interstrand cross-links whereas 50-85% of these lesions were removed in RT112 and 833K cells 24 h following drug exposure. It is possible that the inability of SuSa cells to repair platinated DNA may account for their hypersensitivity to cisplatin

  18. Circumpolar diversity and geographic differentiation of mtDNA in the critically endangered Antarctic blue whale (Balaenoptera musculus intermedia.

    Directory of Open Access Journals (Sweden)

    Angela L Sremba

    Full Text Available The Antarctic blue whale (Balaenoptera musculus intermedia was hunted to near extinction between 1904 and 1972, declining from an estimated initial abundance of more than 250,000 to fewer than 400. Here, we describe mtDNA control region diversity and geographic differentiation in the surviving population of the Antarctic blue whale, using 218 biopsy samples collected under the auspices of the International Whaling Commission (IWC during research cruises from 1990-2009. Microsatellite genotypes and mtDNA sequences identified 166 individuals among the 218 samples and documented movement of a small number of individuals, including a female that traveled at least 6,650 km or 131° longitude over four years. mtDNA sequences from the 166 individuals were aligned with published sequences from 17 additional individuals, resolving 52 unique haplotypes from a consensus length of 410 bp. From this minimum census, a rarefaction analysis predicted that only 72 haplotypes (95% CL, 64, 86 have survived in the contemporary population of Antarctic blue whales. However, haplotype diversity was relatively high (0.968±0.004, perhaps as a result of the longevity of blue whales and the relatively recent timing of the bottleneck. Despite the potential for circumpolar dispersal, we found significant differentiation in mtDNA diversity (F(ST = 0.032, p<0.005 and microsatellite alleles (F(ST = 0.005, p<0.05 among the six Antarctic Areas historically used by the IWC for management of blue whales.

  19. Differential DNA methylation profiles of coding and non-coding genes define hippocampal sclerosis in human temporal lobe epilepsy

    Science.gov (United States)

    Miller-Delaney, Suzanne F.C.; Bryan, Kenneth; Das, Sudipto; McKiernan, Ross C.; Bray, Isabella M.; Reynolds, James P.; Gwinn, Ryder; Stallings, Raymond L.

    2015-01-01

    Temporal lobe epilepsy is associated with large-scale, wide-ranging changes in gene expression in the hippocampus. Epigenetic changes to DNA are attractive mechanisms to explain the sustained hyperexcitability of chronic epilepsy. Here, through methylation analysis of all annotated C-phosphate-G islands and promoter regions in the human genome, we report a pilot study of the methylation profiles of temporal lobe epilepsy with or without hippocampal sclerosis. Furthermore, by comparative analysis of expression and promoter methylation, we identify methylation sensitive non-coding RNA in human temporal lobe epilepsy. A total of 146 protein-coding genes exhibited altered DNA methylation in temporal lobe epilepsy hippocampus (n = 9) when compared to control (n = 5), with 81.5% of the promoters of these genes displaying hypermethylation. Unique methylation profiles were evident in temporal lobe epilepsy with or without hippocampal sclerosis, in addition to a common methylation profile regardless of pathology grade. Gene ontology terms associated with development, neuron remodelling and neuron maturation were over-represented in the methylation profile of Watson Grade 1 samples (mild hippocampal sclerosis). In addition to genes associated with neuronal, neurotransmitter/synaptic transmission and cell death functions, differential hypermethylation of genes associated with transcriptional regulation was evident in temporal lobe epilepsy, but overall few genes previously associated with epilepsy were among the differentially methylated. Finally, a panel of 13, methylation-sensitive microRNA were identified in temporal lobe epilepsy including MIR27A, miR-193a-5p (MIR193A) and miR-876-3p (MIR876), and the differential methylation of long non-coding RNA documented for the first time. The present study therefore reports select, genome-wide DNA methylation changes in human temporal lobe epilepsy that may contribute to the molecular architecture of the epileptic brain. PMID

  20. DNA Methylation Alterations in Breast Cancer

    National Research Council Canada - National Science Library

    Yamamoto, Fumiichiro

    2002-01-01

    We have performed the NotI-MseI MS-AFLP experiments using normal and tumor DNA from breast cancer patients and determined the identity of bands exhibiting consistent changes in breast cancer DNA fingerprint...

  1. High variation and very low differentiation in wide ranging plains zebra (Equus quagga): insights from mtDNA and microsatellites

    DEFF Research Database (Denmark)

    Lorenzen, Eline D; Arctander, Peter; Siegismund, Hans R

    2008-01-01

    units. Both marker sets showed high levels of genetic variation and very low levels of differentiation. There was no geographical structuring of mitochondrial DNA haplotypes in the phylogenetic tree, and the plains zebra showed the lowest overall differentiation recorded in any African ungulate studied...

  2. Classical and quantum fingerprinting strategies

    International Nuclear Information System (INIS)

    Scott, A.; Walgate, J.; Sanders, B.

    2005-01-01

    Full text: Fingerprinting enables two parties to infer whether the messages they hold are the same or different when the cost of communication is high: each message is associated with a smaller fingerprint and comparisons between messages are made in terms of their fingerprints alone. When the two parties are forbidden access to a public coin, it is known that fingerprints composed of quantum information can be made exponentially smaller than those composed of classical information. We present specific constructions of classical fingerprinting strategies through the use of constant-weight codes and provide bounds on the worst-case error probability with the help of extremal set theory. These classical strategies are easily outperformed by quantum strategies constructed from line packings and equiangular tight frames. (author)

  3. Induction of DNA-strand breaks after X- irradiation in murine bone cells of various differentiation capacities

    Science.gov (United States)

    Lau, P.; Hellweg, C. E.; Kirchner, S.; Arenz, A.; Baumstark-Khan, C.; Horneck, G.

    Bone loss resulting from long-duration space flight is a well known medical risk for space travellers, as a weakened skeleton is more susceptible to bone fractures. In addition to weightlessness the astronaut is also exposed to cosmic ionizing radiation. In order to elucidate changes in bone cell metabolism by ionizing radiation, a ground-based bone cell model has been developed. This model consists of a bunch of immortalized murine osteocyte, osteoblast and pre-osteoblast cell lines representing discrete stages of differentiation: The osteocyte cell line MLO-Y4 (obtained from L. Bonewald, Kansas City, USA), the osteoblast cell line OCT-1 (obtained from D. Chen, San Antonio, USA), and the subclones 4 and 24 of the osteoblast cell line MC3T3-E1 (obtained from ATCC, Manassas, Virginia, USA). Regarding their growth properties, MLO-Y4 cells show the highest growth velocity with a doubling time of 15.8 h. The osteoblast cell line OCT-1 has a doubling time of 27.3 h. The respective values for MC3T3-E1 subclone 24 and S4 are 90.5 h and 51.6 h. To investigate the stage of differentiation, the expression of alkaline phosphatase, of osteocalcin and of E11 was examined. Survival after X-ray exposure was determined using the colony forming ability test. The resulting dose-effect relationships revealed significant differences. The parameter D0 of the survival curves ranges between 1.8 Gy for OCT-1, 1.9 Gy for MLO-Y4, 2.0 Gy for subclone 24 and 2,3 Gy for subclone 4. The quantitative acquisition of DNA-strand breaks was performed by Fluorescent Analysis of DNA-Unwinding (FADU). The results can be correlated with the corresponding survival curve. In conclusion, the cell lines with higher differentiation levels are less sensitive to radiation when compared to the lower differentiated osteoblast cell lines.

  4. DNA Methylation in Skeletal Muscle Stem Cell Specification, Proliferation, and Differentiation

    Directory of Open Access Journals (Sweden)

    Rhianna C. Laker

    2016-01-01

    Full Text Available An unresolved and critically important question in skeletal muscle biology is how muscle stem cells initiate and regulate the genetic program during muscle development. Epigenetic dynamics are essential for cellular development and organogenesis in early life and it is becoming increasingly clear that epigenetic remodeling may also be responsible for the cellular adaptations that occur in later life. DNA methylation of cytosine bases within CpG dinucleotide pairs is an important epigenetic modification that reduces gene expression when located within a promoter or enhancer region. Recent advances in the field suggest that epigenetic regulation is essential for skeletal muscle stem cell identity and subsequent cell development. This review summarizes what is currently known about how skeletal muscle stem cells regulate the myogenic program through DNA methylation, discusses a novel role for metabolism in this process, and addresses DNA methylation dynamics in adult skeletal muscle in response to physical activity.

  5. Differential mitochondrial DNA and gene expression in inherited retinal dysplasia in miniature Schnauzer dogs.

    Science.gov (United States)

    Appleyard, Greg D; Forsyth, George W; Kiehlbauch, Laura M; Sigfrid, Kristen N; Hanik, Heather L J; Quon, Anita; Loewen, Matthew E; Grahn, Bruce H

    2006-05-01

    To investigate the molecular basis of inherited retinal dysplasia in miniature Schnauzers. Retina and retinal pigment epithelial tissues were collected from canine subjects at the age of 3 weeks. Total RNA isolated from these tissues was reverse transcribed to make representative cDNA pools that were compared for differences in gene expression by using a subtractive hybridization technique referred to as representational difference analysis (RDA). Expression differences identified by RDA were confirmed and quantified by real-time reverse-transcription PCR. Mitochondrial morphology from leukocytes and skeletal muscle of normal and affected miniature Schnauzers was examined by transmission electron microscopy. RDA screening of retinal pigment epithelial cDNA identified differences in mRNA transcript coding for two mitochondrial (mt) proteins--cytochrome oxidase subunit 1 and NADH dehydrogenase subunit 6--in affected dogs. Contrary to expectations, these identified sequences did not contain mutations. Based on the implication of mt-DNA-encoded proteins by the RDA experiments we used real-time PCR to compare the relative amounts of mt-DNA template in white blood cells from normal and affected dogs. White blood cells of affected dogs contained less than 30% of the normal amount of two specific mtDNA sequences, compared with the content of the nuclear-encoded glyceraldehyde-3-phosphate dehydrogenase (GA-3-PDH) reference gene. Retina and RPE tissue from affected dogs had reduced mRNA transcript levels for the two mitochondrial genes detected in the RDA experiment. Transcript levels for another mtDNA-encoded gene as well as the nuclear-encoded mitochondrial Tfam transcription factor were reduced in these tissues in affected dogs. Mitochondria from affected dogs were reduced in number and size and were unusually electron dense. Reduced levels of nuclear and mitochondrial transcripts in the retina and RPE of miniature Schnauzers affected with retinal dysplasia suggest that

  6. Subtractive cloning of cDNA from Aspergillus oryzae differentially regulated between solid-state culture and liquid (submerged) culture.

    Science.gov (United States)

    Akao, Takeshi; Gomi, Katsuya; Goto, Kuniyasu; Okazaki, Naoto; Akita, Osamu

    2002-07-01

    In solid-state cultures (SC), Aspergillus oryzae shows characteristics such as high-level production and secretion of enzymes and hyphal differentiation with asexual development which are absent in liquid (submerged) culture (LC). It was predicted that many of the genes involved in the characteristics of A. oryzae in SC are differentially expressed between SC and LC. We generated two subtracted cDNA libraries with bi-directional cDNA subtractive hybridizations to isolate and identify such genes. Among them, we identified genes upregulated in or specific to SC, such as the AOS ( A. oryzae SC-specific gene) series, and those downregulated or not expressed in SC, such as the AOL ( A. oryzae LC-specific) series. Sequencing analyses revealed that the AOS series and the AOL series contain genes encoding extra- and intracellular enzymes and transport proteins. However, half were functionally unclassified by nucleotide sequences. Also, by expression profile, the AOS series comprised two groups. These gene products' molecular functions and physiological roles in SC await further investigation.

  7. Differential Processing of Low and High LET Radiation Induced DNA Damage: Investigation of Switch from ATM to ATR Signaling

    Science.gov (United States)

    Saha, Janapriya; Wang, Minli; Hada, Megumi; Cucinotta, Francis A.

    2011-01-01

    The members of the phosphatidylinositol kinase-like kinase family of proteins namely ataxia-telangiectasia mutated (ATM) and ATM- and Rad3-related (ATR) are directly responsible for the maintenance of genomic integrity by mounting DDR through signaling and facilitating the recruitment of repair factors at the sites of DNA damage along with coordinating the deployment of cell cycle checkpoints to permit repair by phosphorylating Checkpoint kinase Chk1, Chk2 and p53. High LET radiation from GCR (Galactic Cosmic Rays) consisting mainly of protons and high energy and charged (HZE) particles from SPE (Solar Particle Event) pose a major health risk for astronauts on their space flight missions. The determination of these risks and the design of potential safeguards require sound knowledge of the biological consequences of lesion induction and the capability of the cells to counter them. We here strive to determine the coordination of ATM and ATR kinases at the break sites directly affecting checkpoint signaling and DNA repair and whether differential processing of breaks induced by low and high LET radiation leads to possible augmentation of swap of these damage sensors at the sites of DNA damage. Exposure of cells to IR triggers rapid autophosphorylation of serine-1981 that causes dimer dissociation and initiates monomer formation of ATM. ATM kinase activity depends on the disruption of the dimer, which allows access and phosphorylation of downstream ATM substrates like Chk2. Evidence suggests that ATM is activated by the alterations in higher-order chromatin structure although direct binding of ATM to DSB ends may be a crucial step in its activation. On the other hand, in case of ATR, RPA (replication protein A)-coated ssDNA (single-stranded DNA) generated as a result of stalled DNA replication or during processing of chromosomal lesions is crucial for the localization of ATR to sites of DNA damage in association with ATR-interacting protein (ATRIP). Although the

  8. Molecular Fingerprinting Approach in Plant Species Evaluation for a Nuclear Power Programme

    International Nuclear Information System (INIS)

    Azhar Mohamed

    2011-01-01

    Deoxyribonucleic acid (DNA) as a tool for marker technology is found to be remarkable, advanced and exciting in recent years. DNA markers are valuable tools and important in various plant breeding analyses for identification, gene mapping, marker systems and mutagenesis response. As gene expression is related to concurrent cellular activities and is mobilised in the adaptation of plants to adverse environmental conditions, changes at the DNA levels can be detected simultaneously. The changes also reflect response onto plant traits in which selection for better quality plant materials can be made and/or used as bio-indicator response in tracking any environmental change. The objective of the present study is to show Inter Simple Sequence Repeat (ISSR) markers as an important technique in differentiating plant DNA genomic in various species for the evaluation of their diversity and radiation effects in population. The technique has been found to be rapid, simple, reliable and robust in generating molecular fingerprinting database in bio surveillance for a nuclear power programme. (author)

  9. Modeling Audio Fingerprints : Structure, Distortion, Capacity

    NARCIS (Netherlands)

    Doets, P.J.O.

    2010-01-01

    An audio fingerprint is a compact low-level representation of a multimedia signal. An audio fingerprint can be used to identify audio files or fragments in a reliable way. The use of audio fingerprints for identification consists of two phases. In the enrollment phase known content is fingerprinted,

  10. Reference point detection for improved fingerprint matching

    NARCIS (Netherlands)

    Ignatenko, T.; Kalker, A.A.C.M.; Veen, van der M.; Bazen, A.; Delp, E.J.; Wong, P.W.

    2006-01-01

    One of the important stages of fingerprint recognition is the registration of the fingerprints with respect to the original template. This is not a straightforward task as fingerprint images may have been subject to rotations and translations. Popular techniques for fingerprint registration use a

  11. Labeling Adipose-Derived Stem Cells with Hoechst 33342: Usability and Effects on Differentiation Potential and DNA Damage

    Directory of Open Access Journals (Sweden)

    P. Schendzielorz

    2016-01-01

    Full Text Available Adipose-derived stem cells (ASCs have been extensively studied in the field of stem cell research and possess numerous clinical applications. Cell labeling is an essential component of various experimental protocols and Hoechst 33342 (H33342 represents a cost-effective and easy methodology for live staining. The purpose of this study was to evaluate the labeling of rat ASCs with two different concentrations of H33342 (0.5 μg/mL and 5 μg/mL, with particular regard to usability, interference with cell properties, and potential DNA damage. Hoechst 33342 used at a low concentration of 0.5 μg/mL did not significantly affect cell proliferation, viability, or differentiation potential of the ASCs, nor did it cause any significant DNA damage as measured by the olive tail moment. High concentrations of 5 μg/mL H33342, however, impaired the proliferation and viability of the ASCs, and considerable DNA damage was observed. Undesirable colabeling of unlabeled cocultivated cells was seen in particular with higher concentrations of H33342, independent of varying washing procedures. Hence, H33342 labeling with lower concentrations represents a usable method, which does not affect the tested cell properties. However, the colabeling of adjacent cells is a drawback of the technique.

  12. Fingerprints of dynamical instabilities

    International Nuclear Information System (INIS)

    Chomaz, Ph.; Colonna, M.; Guarnera, A.

    1993-01-01

    It is explained why any reduced descriptions, such as mean field approximation, are stochastic in nature. It is shown that the introduction of this stochastic dynamics leads to a predictive theory in a statistical sens whatever the individual trajectories are characterized by the occurrence of bifurcations, instabilities or phase transitions. Concerning nuclear matter, the spinodal instability is discussed. In such a critical situation, the possibility to replace the stochastic part of the collision integral in the Boltzmann-Langevin model by the numerical noise associated with the finite number of test particles in ordinary BUU treatment is studied. It is shown that the fingerprints of these instabilities are kept during the evolution because of the relatively long recombination time compared with the typical time scales imposed by the Coulomb repulsion and the possible collective expansion. (author) 5 refs., 12 figs

  13. Influence of Skin Diseases on Fingerprint Recognition

    Science.gov (United States)

    Drahansky, Martin; Dolezel, Michal; Urbanek, Jaroslav; Brezinova, Eva; Kim, Tai-hoon

    2012-01-01

    There are many people who suffer from some of the skin diseases. These diseases have a strong influence on the process of fingerprint recognition. People with fingerprint diseases are unable to use fingerprint scanners, which is discriminating for them, since they are not allowed to use their fingerprints for the authentication purposes. First in this paper the various diseases, which might influence functionality of the fingerprint-based systems, are introduced, mainly from the medical point of view. This overview is followed by some examples of diseased finger fingerprints, acquired both from dactyloscopic card and electronic sensors. At the end of this paper the proposed fingerprint image enhancement algorithm is described. PMID:22654483

  14. cDNA-AFLP analysis reveals differential gene expression in response to salt stress in foxtail millet (Setaria italica L.).

    Science.gov (United States)

    Jayaraman, Ananthi; Puranik, Swati; Rai, Neeraj Kumar; Vidapu, Sudhakar; Sahu, Pranav Pankaj; Lata, Charu; Prasad, Manoj

    2008-11-01

    Plant growth and productivity are affected by various abiotic stresses such as heat, drought, cold, salinity, etc. The mechanism of salt tolerance is one of the most important subjects in plant science as salt stress decreases worldwide agricultural production. In our present study we used cDNA-AFLP technique to compare gene expression profiles of a salt tolerant and a salt-sensitive cultivar of foxtail millet (Seteria italica) in response to salt stress to identify early responsive differentially expressed transcripts accumulated upon salt stress and validate the obtained result through quantitative real-time PCR (qRT-PCR). The expression profile was compared between a salt tolerant (Prasad) and susceptible variety (Lepakshi) of foxtail millet in both control condition (L0 and P0) and after 1 h (L1 and P1) of salt stress. We identified 90 transcript-derived fragments (TDFs) that are differentially expressed, out of which 86 TDFs were classified on the basis of their either complete presence or absence (qualitative variants) and 4 on differential expression pattern levels (quantitative variants) in the two varieties. Finally, we identified 27 non-redundant differentially expressed cDNAs that are unique to salt tolerant variety which represent different groups of genes involved in metabolism, cellular transport, cell signaling, transcriptional regulation, mRNA splicing, seed development and storage, etc. The expression patterns of seven out of nine such genes showed a significant increase of differential expression in tolerant variety after 1 h of salt stress in comparison to salt-sensitive variety as analyzed by qRT-PCR. The direct and indirect relationship of identified TDFs with salinity tolerance mechanism is discussed.

  15. Huella genética vs. Huella dactilar/Geneticprint vs. Fingerprint

    Directory of Open Access Journals (Sweden)

    Israel Estrada Camacho

    2015-01-01

    Full Text Available From the earliest times of history, man has struggled to establish an identification system that would differentiate it from their peers. To this end it has established specific techniques and methods. This study was intended precisely to know them the advantages and disadvantages presented two foolproof methods to identify the geneticprint and the traditional fingerprint. For which was conducted a bibliography search specialized in human identification methods, also had personal communication with experts in the field of Dactiloscopy expert and genetics forensic, with the intention of obtaining data, anecdotes and experiences that provide data for the development of this research, in order to know in depth each technique therefore in conclusion is considered that the time factor is still a great advantage of the use of the Dactiloscopy, since in a few minutes at a low cost and reliable results can be obtained. Unlike the previous main disadvantages of DNA analysis are high cost and time to perform your analysis. Still have to consider that the application of molecular techniques in the identification of persons allowed to solve those cases which could not solved using classical techniques of identification (fingerprint, dental chart, etc..

  16. Elevated polygenic burden for autism is associated with differential DNA methylation at birth

    DEFF Research Database (Denmark)

    Hannon, Eilis; Schendel, Diana; Ladd-Acosta, Christine

    2018-01-01

    BACKGROUND: Autism spectrum disorder (ASD) is a severe neurodevelopmental disorder characterized by deficits in social communication and restricted, repetitive behaviors, interests, or activities. The etiology of ASD involves both inherited and environmental risk factors, with epigenetic processes...... hypothesized as one mechanism by which both genetic and non-genetic variation influence gene regulation and pathogenesis. The aim of this study was to identify DNA methylation biomarkers of ASD detectable at birth. METHODS: We quantified neonatal methylomic variation in 1263 infants-of whom ~ 50% went...... on to subsequently develop ASD-using DNA isolated from archived blood spots taken shortly after birth. We used matched genotype data from the same individuals to examine the molecular consequences of ASD-associated genetic risk variants, identifying methylomic variation associated with elevated polygenic burden...

  17. Effect of Chromatin Structure on the Extent and Distribution of DNA Double Strand Breaks Produced by Ionizing Radiation; Comparative Study of hESC and Differentiated Cells Lines.

    Science.gov (United States)

    Venkatesh, Priyanka; Panyutin, Irina V; Remeeva, Evgenia; Neumann, Ronald D; Panyutin, Igor G

    2016-01-02

    Chromatin structure affects the extent of DNA damage and repair. Thus, it has been shown that heterochromatin is more protective against DNA double strand breaks (DSB) formation by ionizing radiation (IR); and that DNA DSB repair may proceed differently in hetero- and euchromatin regions. Human embryonic stem cells (hESC) have a more open chromatin structure than differentiated cells. Here, we study the effect of chromatin structure in hESC on initial DSB formation and subsequent DSB repair. DSB were scored by comet assay; and DSB repair was assessed by repair foci formation via 53BP1 antibody staining. We found that in hESC, heterochromatin is confined to distinct regions, while in differentiated cells it is distributed more evenly within the nuclei. The same dose of ionizing radiation produced considerably more DSB in hESC than in differentiated derivatives, normal human fibroblasts; and one cancer cell line. At the same time, the number of DNA repair foci were not statistically different among these cells. We showed that in hESC, DNA repair foci localized almost exclusively outside the heterochromatin regions. We also noticed that exposure to ionizing radiation resulted in an increase in heterochromatin marker H3K9me3 in cancer HT1080 cells, and to a lesser extent in IMR90 normal fibroblasts, but not in hESCs. These results demonstrate the importance of chromatin conformation for DNA protection and DNA damage repair; and indicate the difference of these processes in hESC.

  18. Thermodynamics of translesion synthesis across a major DNA adduct of antitumor oxaliplatin: Differential scanning calorimetric study

    Czech Academy of Sciences Publication Activity Database

    Florian, Jakub; Brabec, Viktor

    2012-01-01

    Roč. 18, č. 6 (2012), s. 1634-1639 ISSN 0947-6539 R&D Projects: GA ČR(CZ) GD301/09/H004; GA ČR(CZ) GAP301/10/0598 Institutional research plan: CEZ:AV0Z50040702 Keywords : antitumor platinum * DNA * calorimetry Subject RIV: BO - Biophysics Impact factor: 5.831, year: 2012

  19. DNA methyl transferases are differentially expressed in the human anterior eye segment.

    Science.gov (United States)

    Bonnin, Nicolas; Belville, Corinne; Chiambaretta, Frédéric; Sapin, Vincent; Blanchon, Loïc

    2014-08-01

    DNA methylation is an epigenetic mark involved in the control of genes expression. Abnormal epigenetic events have been reported in human pathologies but weakly documented in eye diseases. The purpose of this study was to establish DNMT mRNA and protein expression levels in the anterior eye segment tissues and their related (primary or immortalized) cell cultures as a first step towards future in vivo and in vitro methylomic studies. Total mRNA was extracted from human cornea, conjunctiva, anterior lens capsule, trabeculum and related cell cultures (cornea epithelial, trabecular meshwork, keratocytes for primary cells; and HCE, Chang, B-3 for immortalized cells). cDNA was quantified by real-time PCR using specific primers for DNMT1, 2, 3A, 3B and 3L. Immunolocalization assays were carried out on human cornea using specific primary antibodies for DNMT1, 2 and 3A, 3B and 3L. All DNMT transcripts were detected in human cornea, conjunctiva, anterior lens capsule, trabeculum and related cells but showed statistically different expression patterns between tissues and cells. DNMT2 protein presented a specific and singular expression pattern in corneal endothelium. This study produced the first inventory of the expression patterns of DNMTs in human adult anterior eye segment. Our research highlights that DNA methylation cannot be ruled out as a way to bring new insights into well-known ocular diseases. In addition, future DNA methylation studies using various cells as experimental models need to be conducted with attention to approach the results analysis from a global tissue perspective. © 2014 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

  20. Differential immunoadsorption coupled with rate nephelometry for estimation of DNA-binding immunoglobulins

    International Nuclear Information System (INIS)

    DeBari, V.A.; Nicotra, J.; Blaney, J.F.; Schultz, E.F.; Needle, M.A.

    1984-01-01

    The authors describe a technique for estimating the mass of anti-DNA antibodies by immunonephelometry of serum immunoglobulins (IgG, IgA, IgM) before and after adsorption onto DNA bound to agarose-polylysine columns. Sixteen patients with systemic lupus erythematosus and 16 age- and sex-matched controls were studied. Precision was determined for high-value (in 10 patients) and low-value (in nine controls) ranges for each of the immunoglobulins. They found anti-DNA antibody concentrations (mean +/- SD) in systemic lupus erythematosus of 1.981 +/- 1.015 g/L for IgG 0.257 +/- 0.215 g/L for IgA and 0.282 +/- 0.234 g/L for IgM. Sensitivity and linearity are such that fivefold dilutions of patients' serum with either a buffered albumin solution or control serum yielded values close to the expected values for IgG. Similarly diluted sera gave inordinately high values in the radiometric binding assay. Neither parametric (linear regression) nor nonparametric correlation methods (Spearman's rank and Kendall's tau) show a significant correlation between patients' data obtained by the present technique and that by a radiometric binding assay, although combined data from patients and controls demonstrate a significant nonparametric correlation

  1. Differential Tus-Ter binding and lock formation: implications for DNA replication termination in Escherichia coli.

    Science.gov (United States)

    Moreau, Morgane J J; Schaeffer, Patrick M

    2012-10-01

    In E. coli, DNA replication termination occurs at Ter sites and is mediated by Tus. Two clusters of five Ter sites are located on each side of the terminus region and constrain replication forks in a polar manner. The polarity is due to the formation of the Tus-Ter-lock intermediate. Recently, it has been shown that DnaB helicase which unwinds DNA at the replication fork is preferentially stopped at the non-permissive face of a Tus-Ter complex without formation of the Tus-Ter-lock and that fork pausing efficiency is sequence dependent, raising two essential questions: Does the affinity of Tus for the different Ter sites correlate with fork pausing efficiency? Is formation of the Tus-Ter-lock the key factor in fork pausing? The combined use of surface plasmon resonance and GFP-Basta showed that Tus binds strongly to TerA-E and G, moderately to TerH-J and weakly to TerF. Out of these ten Ter sites only two, TerF and H, were not able to form significant Tus-Ter-locks. Finally, Tus's resistance to dissociation from Ter sites and the strength of the Tus-Ter-locks correlate with the differences in fork pausing efficiency observed for the different Ter sites by Duggin and Bell (2009).

  2. Amyloid protein-mediated differential DNA methylation status regulates gene expression in Alzheimer’s disease model cell line

    International Nuclear Information System (INIS)

    Sung, Hye Youn; Choi, Eun Nam; Ahn Jo, Sangmee; Oh, Seikwan; Ahn, Jung-Hyuck

    2011-01-01

    Highlights: ► Genome-wide DNA methylation pattern in Alzheimer’s disease model cell line. ► Integrated analysis of CpG methylation and mRNA expression profiles. ► Identify three Swedish mutant target genes; CTIF, NXT2 and DDR2 gene. ► The effect of Swedish mutation on alteration of DNA methylation and gene expression. -- Abstract: The Swedish mutation of amyloid precursor protein (APP-sw) has been reported to dramatically increase beta amyloid production through aberrant cleavage at the beta secretase site, causing early-onset Alzheimer’s disease (AD). DNA methylation has been reported to be associated with AD pathogenesis, but the underlying molecular mechanism of APP-sw-mediated epigenetic alterations in AD pathogenesis remains largely unknown. We analyzed genome-wide interplay between promoter CpG DNA methylation and gene expression in an APP-sw-expressing AD model cell line. To identify genes whose expression was regulated by DNA methylation status, we performed integrated analysis of CpG methylation and mRNA expression profiles, and identified three target genes of the APP-sw mutant; hypomethylated CTIF (CBP80/CBP20-dependent translation initiation factor) and NXT2 (nuclear exporting factor 2), and hypermethylated DDR2 (discoidin domain receptor 2). Treatment with the demethylating agent 5-aza-2′-deoxycytidine restored mRNA expression of these three genes, implying methylation-dependent transcriptional regulation. The profound alteration in the methylation status was detected at the −435, −295, and −271 CpG sites of CTIF, and at the −505 to −341 region in the promoter of DDR2. In the promoter region of NXT2, only one CpG site located at −432 was differentially unmethylated in APP-sw cells. Thus, we demonstrated the effect of the APP-sw mutation on alteration of DNA methylation and subsequent gene expression. This epigenetic regulatory mechanism may contribute to the pathogenesis of AD.

  3. Oncogenic RAS enables DNA damage- and p53-dependent differentiation of acute myeloid leukemia cells in response to chemotherapy.

    Directory of Open Access Journals (Sweden)

    Mona Meyer

    Full Text Available Acute myeloid leukemia (AML is a clonal disease originating from myeloid progenitor cells with a heterogeneous genetic background. High-dose cytarabine is used as the standard consolidation chemotherapy. Oncogenic RAS mutations are frequently observed in AML, and are associated with beneficial response to cytarabine. Why AML-patients with oncogenic RAS benefit most from high-dose cytarabine post-remission therapy is not well understood. Here we used bone marrow cells expressing a conditional MLL-ENL-ER oncogene to investigate the interaction of oncogenic RAS and chemotherapeutic agents. We show that oncogenic RAS synergizes with cytotoxic agents such as cytarabine in activation of DNA damage checkpoints, resulting in a p53-dependent genetic program that reduces clonogenicity and increases myeloid differentiation. Our data can explain the beneficial effects observed for AML patients with oncogenic RAS treated with higher dosages of cytarabine and suggest that induction of p53-dependent differentiation, e.g. by interfering with Mdm2-mediated degradation, may be a rational approach to increase cure rate in response to chemotherapy. The data also support the notion that the therapeutic success of cytotoxic drugs may depend on their ability to promote the differentiation of tumor-initiating cells.

  4. Nucleus fingerprinting for the unique identification of Feulgen-stained nuclei

    Science.gov (United States)

    Friedrich, David; Brozio, Matthias; Bell, André; Biesterfeld, Stefan; Böcking, Alfred; Aach, Til

    2012-03-01

    DNA Image Cytometry is a method for non-invasive cancer diagnosis which measures the DNA content of Feulgen-stained nuclei. DNA content is measured using a microscope system equipped with a digital camera as a densitometer and estimating the DNA content from the absorption of light when passing through the nuclei. However, a DNA Image Cytometry measurement is only valid if each nucleus is only measured once. To assist the user in preventing multiple measurements of the same nucleus, we have developed a unique digital identifier for the characterization of Feulgen-stained nuclei, the so called Nucleus Fingerprint. Only nuclei with a new fingerprint can be added to the measurement. This fingerprint is based on basic nucleus features, the contour of the nucleus and the spatial relationship to nuclei in the vicinity. Based on this characterization, a classifier for testing two nuclei for identity is presented. In a pairwise comparison of ~40000 pairs of mutually different nuclei, 99.5% were classified as different. In another 450 tests, the fingerprints of the same nucleus recorded a second time were in all cases judged identical. We therefore conclude that our Nucleus Fingerprint approach robustly prevents the repeated measurement of nuclei in DNA Image Cytometry.

  5. Inhibitor of DNA binding 1 (Id1) induces differentiation and proliferation of mouse embryonic carcinoma P19CL6 cells

    International Nuclear Information System (INIS)

    Meng, Qingzhen; Jia, Zhuqing; Wang, Weiping; Li, Binhong; Ma, Kangtao; Zhou, Chunyan

    2011-01-01

    Highlights: → Id1 was upregulated during the cardiac differentiation process of P19CL6 cells. → Id1 upregulated expression of cardiac specific genes Gata4, α-MHC and ISL1. → Id1 promoted proliferation of P19CL6 cells. → Overexpression of Id1 increased activity of TOP flash. → Wnt3a or LiCl treatment promoted Id1 expression in P19CL6 cells. -- Abstract: The inhibitor of DNA binding (Id) family of genes encodes negative regulators of basic helix-loop-helix transcription factors and has been implicated in such diverse cellular processes as differentiation, proliferation, apoptosis and migration. Id knockout mouse embryos display multiple cardiac defects but the specific role of Id1 in cardiac differentiation is unclear. In the present study, we investigated the function of Id1 in DMSO-induced P19CL6 cells, a widely-accepted cell model of cardiac differentiation. We found that Id1 was upregulated during the cardiac differentiation of P19CL6 cells. The expression of cardiac specific marker genes, Gata4, α-MHC and ISL1, was upregulated in P19CL6 cells stably transfected with Id1 (P19CL6-Id1) during cardiac differentiation. The overexpression of Id1 reduced the number of cells in G1 phase and increased the cell population in G2, M and S phases, while knockdown of Id1 increased the number of cells in G1 phase from 48.6 ± 2.51% to 62.2 ± 1.52% at day 0 of cardiac induction, and from 52.5 ± 3.41% to 63.7 ± 1.02% at day 3 after cardiac induction, indicating that Id1 promoted proliferation of P19CL6 cells. Luciferase assays showed that the activity of TOP flash was higher in P19CL6-Id1 cells than wildtype P19CL6 cells, while Id1 expression was also upregulated in P19CL6 cells treated with Wnt3a or LiCl. This indicates that there may be positive feedback between Id1 and Wnt signaling which plays an important role in cardiac differentiation.

  6. Distributed construction of quantum fingerprints

    OpenAIRE

    Ambainis, Andris; Shi, Yaoyun

    2003-01-01

    Quantum fingerprints are useful quantum encodings introduced by Buhrman, Cleve, Watrous, and de Wolf (Physical Review Letters, Volume 87, Number 16, Article 167902, 2001; quant-ph/0102001) in obtaining an efficient quantum communication protocol. We design a protocol for constructing the fingerprint in a distributed scenario. As an application, this protocol gives rise to a communication protocol more efficient than the best known classical protocol for a communication problem.

  7. Euchromatin islands in large heterochromatin domains are enriched for CTCF binding and differentially DNA-methylated regions

    Directory of Open Access Journals (Sweden)

    Wen Bo

    2012-10-01

    Full Text Available Abstract Background The organization of higher order chromatin is an emerging epigenetic mechanism for understanding development and disease. We and others have previously observed dynamic changes during differentiation and oncogenesis in large heterochromatin domains such as Large Organized Chromatin K (lysine modifications (LOCKs, of histone H3 lysine-9 dimethylation (H3K9me2 or other repressive histone posttranslational modifications. The microstructure of these regions has not previously been explored. Results We analyzed the genome-wide distribution of H3K9me2 in two human pluripotent stem cell lines and three differentiated cells lines. We identified > 2,500 small regions with very low H3K9me2 signals in the body of LOCKs, which were termed as euchromatin islands (EIs. EIs are 6.5-fold enriched for DNase I Hypersensitive Sites and 8-fold enriched for the binding of CTCF, the major organizer of higher-order chromatin. Furthermore, EIs are 2–6 fold enriched for differentially DNA-methylated regions associated with tissue types (T-DMRs, reprogramming (R-DMRs and cancer (C-DMRs. Gene ontology (GO analysis suggests that EI-associated genes are functionally related to organ system development, cell adhesion and cell differentiation. Conclusions We identify the existence of EIs as a finer layer of epigenomic architecture within large heterochromatin domains. Their enrichment for CTCF sites and DNAse hypersensitive sites, as well as association with DMRs, suggest that EIs play an important role in normal epigenomic architecture and its disruption in disease.

  8. An SDN-Based Fingerprint Hopping Method to Prevent Fingerprinting Attacks

    Directory of Open Access Journals (Sweden)

    Zheng Zhao

    2017-01-01

    Full Text Available Fingerprinting attacks are one of the most severe threats to the security of networks. Fingerprinting attack aims to obtain the operating system information of target hosts to make preparations for future attacks. In this paper, a fingerprint hopping method (FPH is proposed based on software-defined networks to defend against fingerprinting attacks. FPH introduces the idea of moving target defense to show a hopping fingerprint toward the fingerprinting attackers. The interaction of the fingerprinting attack and its defense is modeled as a signal game, and the equilibriums of the game are analyzed to develop an optimal defense strategy. Experiments show that FPH can resist fingerprinting attacks effectively.

  9. Adiabatic differential scanning calorimetric study of divalent cation induced DNA - DPPC liposome formulation compacted for gene delivery

    Directory of Open Access Journals (Sweden)

    Erhan Süleymanoglu

    2004-11-01

    Full Text Available Complexes between nucleic acids and phospholipid vesicles have been developed as stable non-viral gene delivery vehicles. Currently employed approach uses positively charged lipid species and a helper zwitterionic lipid, the latter being applied for the stabilization of the whole complex. However, besides problematic steps during their preparation, cationic lipids are toxic for cells. The present work describes some energetic issues pertinent to preparation and use of neutral lipid-DNA self-assemblies, thus avoiding toxicity of lipoplexes. Differential scanning calorimetry data showed stabilization of polynucleotide helix upon its interaction with liposomes in the presence of divalent metal cations. It is thus possible to suggest this self-assembly as an improved formulation for use in gene delivery.

  10. Fingerprint Change: Not Visible, But Tangible.

    Science.gov (United States)

    Negri, Francesca V; De Giorgi, Annamaria; Bozzetti, Cecilia; Squadrilli, Anna; Petronini, Pier Giorgio; Leonardi, Francesco; Bisogno, Luigi; Garofano, Luciano

    2017-09-01

    Hand-foot syndrome, a chemotherapy-induced cutaneous toxicity, can cause an alteration in fingerprints causing a setback for cancer patients due to the occurrence of false rejections. A colon cancer patient was fingerprinted after not having been able to use fingerprint recognition devices after 6 months of adjuvant chemotherapy. The fingerprint images were digitally processed to improve fingerprint definition without altering the papillary design. No evidence of skin toxicity was present. Two months later, the situation returned to normal. The fingerprint evaluation conducted on 15 identification points highlighted the quantitative and qualitative fingerprint alteration details detected after the end of chemotherapy and 2 months later. Fingerprint alteration during chemotherapy has been reported, but to our knowledge, this particular case is the first ever reported without evident clinical signs. Alternative fingerprint identification methods as well as improved biometric identification systems are needed in case of unexpected situations. © 2017 American Academy of Forensic Sciences.

  11. Robust efficient video fingerprinting

    Science.gov (United States)

    Puri, Manika; Lubin, Jeffrey

    2009-02-01

    We have developed a video fingerprinting system with robustness and efficiency as the primary and secondary design criteria. In extensive testing, the system has shown robustness to cropping, letter-boxing, sub-titling, blur, drastic compression, frame rate changes, size changes and color changes, as well as to the geometric distortions often associated with camcorder capture in cinema settings. Efficiency is afforded by a novel two-stage detection process in which a fast matching process first computes a number of likely candidates, which are then passed to a second slower process that computes the overall best match with minimal false alarm probability. One key component of the algorithm is a maximally stable volume computation - a three-dimensional generalization of maximally stable extremal regions - that provides a content-centric coordinate system for subsequent hash function computation, independent of any affine transformation or extensive cropping. Other key features include an efficient bin-based polling strategy for initial candidate selection, and a final SIFT feature-based computation for final verification. We describe the algorithm and its performance, and then discuss additional modifications that can provide further improvement to efficiency and accuracy.

  12. Magnetic resonance fingerprinting.

    Science.gov (United States)

    Ma, Dan; Gulani, Vikas; Seiberlich, Nicole; Liu, Kecheng; Sunshine, Jeffrey L; Duerk, Jeffrey L; Griswold, Mark A

    2013-03-14

    Magnetic resonance is an exceptionally powerful and versatile measurement technique. The basic structure of a magnetic resonance experiment has remained largely unchanged for almost 50 years, being mainly restricted to the qualitative probing of only a limited set of the properties that can in principle be accessed by this technique. Here we introduce an approach to data acquisition, post-processing and visualization--which we term 'magnetic resonance fingerprinting' (MRF)--that permits the simultaneous non-invasive quantification of multiple important properties of a material or tissue. MRF thus provides an alternative way to quantitatively detect and analyse complex changes that can represent physical alterations of a substance or early indicators of disease. MRF can also be used to identify the presence of a specific target material or tissue, which will increase the sensitivity, specificity and speed of a magnetic resonance study, and potentially lead to new diagnostic testing methodologies. When paired with an appropriate pattern-recognition algorithm, MRF inherently suppresses measurement errors and can thus improve measurement accuracy.

  13. Generating cancelable fingerprint templates.

    Science.gov (United States)

    Ratha, Nalini K; Chikkerur, Sharat; Connell, Jonathan H; Bolle, Ruud M

    2007-04-01

    Biometrics-based authentication systems offer obvious usability advantages over traditional password and token-based authentication schemes. However, biometrics raises several privacy concerns. A biometric is permanently associated with a user and cannot be changed. Hence, if a biometric identifier is compromised, it is lost forever and possibly for every application where the biometric is used. Moreover, if the same biometric is used in multiple applications, a user can potentially be tracked from one application to the next by cross-matching biometric databases. In this paper, we demonstrate several methods to generate multiple cancelable identifiers from fingerprint images to overcome these problems. In essence, a user can be given as many biometric identifiers as needed by issuing a new transformation "key." The identifiers can be cancelled and replaced when compromised. We empirically compare the performance of several algorithms such as Cartesian, polar, and surface folding transformations of the minutiae positions. It is demonstrated through multiple experiments that we can achieve revocability and prevent cross-matching of biometric databases. It is also shown that the transforms are noninvertible by demonstrating that it is computationally as hard to recover the original biometric identifier from a transformed version as by randomly guessing. Based on these empirical results and a theoretical analysis we conclude that feature-level cancelable biometric construction is practicable in large biometric deployments.

  14. Retinoblastoma pathway defects show differential ability to activate the constitutive DNA damage response in human tumorigenesis

    DEFF Research Database (Denmark)

    Tort, F.; Bartkova, J.; Sehested, M.

    2006-01-01

    culture models with differential defects of retinoblastoma pathway components, as overexpression of cyclin D1 or lack of p16(Ink4a), either alone or combined, did not elicit detectable DDR. In contrast, inactivation of pRb, the key component of the pathway, activated the DDR in cultured human or mouse...... with their hierarchical positions along the retinoblastoma pathway. Our data provide new insights into oncogene-evoked DDR in human tumorigenesis, with potential implications for individualized management of tumors with elevated cyclin D1 versus cyclin E, due to their distinct clinical variables and biological behavior....

  15. Identification of Differentially Expressed IGFBP5-Related Genes in Breast Cancer Tumor Tissues Using cDNA Microarray Experiments.

    Science.gov (United States)

    Akkiprik, Mustafa; Peker, İrem; Özmen, Tolga; Amuran, Gökçe Güllü; Güllüoğlu, Bahadır M; Kaya, Handan; Özer, Ayşe

    2015-11-10

    IGFBP5 is an important regulatory protein in breast cancer progression. We tried to identify differentially expressed genes (DEGs) between breast tumor tissues with IGFBP5 overexpression and their adjacent normal tissues. In this study, thirty-eight breast cancer and adjacent normal breast tissue samples were used to determine IGFBP5 expression by qPCR. cDNA microarrays were applied to the highest IGFBP5 overexpressed tumor samples compared to their adjacent normal breast tissue. Microarray analysis revealed that a total of 186 genes were differentially expressed in breast cancer compared with normal breast tissues. Of the 186 genes, 169 genes were downregulated and 17 genes were upregulated in the tumor samples. KEGG pathway analyses showed that protein digestion and absorption, focal adhesion, salivary secretion, drug metabolism-cytochrome P450, and phenylalanine metabolism pathways are involved. Among these DEGs, the prominent top two genes (MMP11 and COL1A1) which potentially correlated with IGFBP5 were selected for validation using real time RT-qPCR. Only COL1A1 expression showed a consistent upregulation with IGFBP5 expression and COL1A1 and MMP11 were significantly positively correlated. We concluded that the discovery of coordinately expressed genes related with IGFBP5 might contribute to understanding of the molecular mechanism of the function of IGFBP5 in breast cancer. Further functional studies on DEGs and association with IGFBP5 may identify novel biomarkers for clinical applications in breast cancer.

  16. Electronic fingerprinting of the dead.

    Science.gov (United States)

    Rutty, G N; Stringer, K; Turk, E E

    2008-01-01

    To date, a number of methods exist for the capture of fingerprints from cadavers that can then be used in isolation as a primary method for the identification of the dead. We report the use of a handheld, mobile wireless unit used in conjunction with a personal digital assistant (PDA) device for the capture of fingerprints from the dead. We also consider a handheld single-digit fingerprint scanner that utilises a USB laptop connection for the electronic capture of cadaveric fingerprints. Both are single-operator units that, if ridge detail is preserved, can collect a 10-set of finger pad prints in approximately 45 and 90 s, respectively. We present our observations on the restrictions as to when such devices can be used with cadavers. We do, however, illustrate that the images are of sufficient quality to allow positive identification from finger pad prints of the dead. With the development of mobile, handheld, biometric, PDA-based units for the police, we hypothesize that, under certain circumstances, devices such as these could be used for the accelerated acquisition of fingerprint identification data with the potential for rapid near-patient identification in the future.

  17. DNA Three-Way Junction for Differentiation of Single-Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles.

    Science.gov (United States)

    Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin

    2017-05-23

    A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Repair kinetics of DNA double-strand breaks and incidence of apoptosis in mouse neural stem/progenitor cells and their differentiated neurons exposed to ionizing radiation.

    Science.gov (United States)

    Kashiwagi, Hiroki; Shiraishi, Kazunori; Sakaguchi, Kenta; Nakahama, Tomoya; Kodama, Seiji

    2018-05-01

    Neuronal loss leads to neurodegenerative disorders, including Alzheimer's disease, Parkinson's disease and Huntington's disease. Because of their long lifespans, neurons are assumed to possess highly efficient DNA repair ability and to be able to protect themselves from deleterious DNA damage such as DNA double-strand breaks (DSBs) produced by intrinsic and extrinsic sources. However, it remains largely unknown whether the DSB repair ability of neurons is more efficient compared with that of other cells. Here, we investigated the repair kinetics of X-ray-induced DSBs in mouse neural cells by scoring the number of phosphorylated 53BP1 foci post irradiation. We found that p53-independent apoptosis was induced time dependently during differentiation from neural stem/progenitor cells (NSPCs) into neurons in culture for 48 h. DSB repair in neurons differentiated from NSPCs in culture was faster than that in mouse embryonic fibroblasts (MEFs), possibly due to the higher DNA-dependent protein kinase activity, but it was similar to that in NSPCs. Further, the incidence of p53-dependent apoptosis induced by X-irradiation in neurons was significantly higher than that in NSPCs. This difference in response of X-ray-induced apoptosis between neurons and NSPCs may reflect a difference in the fidelity of non-homologous end joining or a differential sensitivity to DNA damage other than DSBs.

  19. Differentially expressed genes in Populus simonii x P. nigra in respnse to NaCl stress using cDNA-AFLP

    Science.gov (United States)

    Salinity is an important environmental factor limiting growth and productivity of plants, and affects almost every aspect of the plant physiology and biochemistry. The objective of this study was to apply cDNA-AFLP and to identify differentially expressed genes in response to NaCl stress vs. no-stre...

  20. On the introduction of secondary fingerprint classification

    CSIR Research Space (South Africa)

    Msiza, IS

    2011-07-01

    Full Text Available The concept of fingerprint classification is an important one because of the need to, before executing a database search procedure, virtually break the fingerprint template database into smaller, manageable partitions. This is done in order to avoid...

  1. Fingerprint matching with optical coherence tomography

    CSIR Research Space (South Africa)

    Moolla, Y

    2015-12-01

    Full Text Available Fingerprint recognition is an important security technique with a steadily growing usage for the identification and verification of individuals. However, current fingerprint acquisition systems have certain disadvantages, which include...

  2. Fingerprint separation: an application of ICA

    Science.gov (United States)

    Singh, Meenakshi; Singh, Deepak Kumar; Kalra, Prem Kumar

    2008-04-01

    Among all existing biometric techniques, fingerprint-based identification is the oldest method, which has been successfully used in numerous applications. Fingerprint-based identification is the most recognized tool in biometrics because of its reliability and accuracy. Fingerprint identification is done by matching questioned and known friction skin ridge impressions from fingers, palms, and toes to determine if the impressions are from the same finger (or palm, toe, etc.). There are many fingerprint matching algorithms which automate and facilitate the job of fingerprint matching, but for any of these algorithms matching can be difficult if the fingerprints are overlapped or mixed. In this paper, we have proposed a new algorithm for separating overlapped or mixed fingerprints so that the performance of the matching algorithms will improve when they are fed with these inputs. Independent Component Analysis (ICA) has been used as a tool to separate the overlapped or mixed fingerprints.

  3. Role of DNA profiling in forensic odontology

    Directory of Open Access Journals (Sweden)

    S Leena Sakari

    2015-01-01

    Full Text Available The recent advances in DNA profiling have made DNA evidence to be more widely accepted in courts. This has revolutionized the aspect of forensic odontology. DNA profiling/DNA fingerprinting has come a long way from the conventional fingerprints. DNA that is responsible for all the cell′s activities, yields valuable information both in the healthy and diseased individuals. When other means of traditional identification become impossible following mass calamities or fire explosions, teeth provide a rich source of DNA as they