WorldWideScience

Sample records for dna endprocessing role

  1. WRN Exonuclease Structure, Molecular Mechanism, and DNA EndProcessing Role

    Energy Technology Data Exchange (ETDEWEB)

    Perry, J. Jefferson P.; Yannone, Steven M.; Holden, Lauren G.; Hitomi, Chiharu; Asaithamby, Aroumougame; Han, Seungil; Cooper, PriscillaK.; Chen, David J.; Tainer, John A.

    2006-02-15

    WRN is unique among the five human RecQ DNA helicases by having a functional exonuclease domain (WRN-exo) and being defective in the premature aging and cancer-related disorder Werner syndrome. Here, we characterize WRN-exo crystal structures, biochemical activity and participation in DNA end-joining. Metal ion complex structures, active site mutations and activity assays reveal a two-metal-ion mediated nuclease mechanism. The DNA end-binding Ku70/80 complex specifically stimulates WRN-exo activity, and structure-based mutational inactivation of WRN-exo alters DNA end-joining in human cells. We furthermore establish structural and biochemical similarities of WRN-exo to DnaQ family replicative proofreading exonucleases, with WRN-specific adaptations consistent with dsDNA specificity and functionally important conformational changes. These results indicate WRN-exo is a human DnaQ family member and support analogous proof-reading activities that are stimulated by Ku70/80 with implications for WRN functions in age related pathologies and maintenance of genomic integrity.

  2. Roles of DNA methyltransferases in Arabidopsis development ...

    African Journals Online (AJOL)

    Mutations that cause severe loss of DNA methylation often leads to abnormal development. In the present review, we summarized recent findings of the three major DNA methyltransferases mutants playing vital role in development of Arabidopsis thaliana. Keywords: DNA methylation, epigenetics, methyltransferase, mutant ...

  3. The role of DNA dependent protein kinase in synapsis of DNA ends

    NARCIS (Netherlands)

    E.P.W.C. Weterings (Eric); N.S. Verkaik (Nicole); H.T. Brüggenwirth (Hennie); D.C. van Gent (Dik); J.H.J. Hoeijmakers (Jan)

    2003-01-01

    textabstractDNA dependent protein kinase (DNA-PK) plays a central role in the non-homologous end-joining pathway of DNA double strand break repair. Its catalytic subunit (DNA-PK(CS)) functions as a serine/threonine protein kinase. We show that DNA-PK forms a stable complex at DNA termini that blocks

  4. Functional roles of DNA polymerases β and γ

    International Nuclear Information System (INIS)

    Huebscher, U.; Kuenzle, C.C.; Spadari, S.

    1979-01-01

    The physiological functions of DNA polymerases (deoxynucleosidetriphosphate:DNA deoxynucleotidyltransferase, EC2.7.7.7)β and γ were investigated by using neuronal nuclei and synaptosomes isolated from rat brain. uv irradiation of neuronal nuclei from 60-day-old rats resulted in a 7- to 10-fold stimulation of DNA repair synthesis attributable to DNA polymerase β which, at this developmental stage, is virtually the only DNA polymerase present in the nuclei. No repair synthesis could be elicited by treating the nuclei with N-methyl-N-nitrosourea, but this was probably due to the inability of brain tissue to excise alkylated bases from DNA. The role of DNA polymerase γ was studied in synaptosomes by using a system mimicking in vivo mitochondrial DNA synthesis. By showing that under these conditions, DNA replication occurs in miatochondria, and exploiting the fact that DNA polymerase γ is the only DNA polymerase present in mitochondria, evidence was obtained for a role of DNA polymerase γ in mitochondrial DNA replication. Based on these results and on the wealth of literature on DNA polymerase α, we conclude that DNA polymerase α is mainly responsible for DNA replication in nuclei, DNA polymerase β is involved in nuclear DNA repair, and DNA polymerase γ is the mitochondrial replicating enzyme. However, minor roles for DNA polymerase α in DNA repair or for DNA polymerase β in DNA replication cannot be excluded

  5. Transcription of tandemly repetitive DNA: functional roles.

    Science.gov (United States)

    Biscotti, Maria Assunta; Canapa, Adriana; Forconi, Mariko; Olmo, Ettore; Barucca, Marco

    2015-09-01

    A considerable fraction of the eukaryotic genome is made up of satellite DNA constituted of tandemly repeated sequences. These elements are mainly located at centromeres, pericentromeres, and telomeres and are major components of constitutive heterochromatin. Although originally satellite DNA was thought silent and inert, an increasing number of studies are providing evidence on its transcriptional activity supporting, on the contrary, an unexpected dynamicity. This review summarizes the multiple structural roles of satellite noncoding RNAs at chromosome level. Indeed, satellite noncoding RNAs play a role in the establishment of a heterochromatic state at centromere and telomere. These highly condensed structures are indispensable to preserve chromosome integrity and genome stability, preventing recombination events, and ensuring the correct chromosome pairing and segregation. Moreover, these RNA molecules seem to be involved also in maintaining centromere identity and in elongation, capping, and replication of telomere. Finally, the abnormal variation of centromeric and pericentromeric DNA transcription across major eukaryotic lineages in stress condition and disease has evidenced the critical role that these transcripts may play and the potentially dire consequences for the organism.

  6. The Role of the Transcriptional Response to DNA Replication Stress.

    Science.gov (United States)

    Herlihy, Anna E; de Bruin, Robertus A M

    2017-03-02

    During DNA replication many factors can result in DNA replication stress. The DNA replication stress checkpoint prevents the accumulation of replication stress-induced DNA damage and the potential ensuing genome instability. A critical role for post-translational modifications, such as phosphorylation, in the replication stress checkpoint response has been well established. However, recent work has revealed an important role for transcription in the cellular response to DNA replication stress. In this review, we will provide an overview of current knowledge of the cellular response to DNA replication stress with a specific focus on the DNA replication stress checkpoint transcriptional response and its role in the prevention of replication stress-induced DNA damage.

  7. The Role of the Transcriptional Response to DNA Replication Stress

    Science.gov (United States)

    Herlihy, Anna E.; de Bruin, Robertus A.M.

    2017-01-01

    During DNA replication many factors can result in DNA replication stress. The DNA replication stress checkpoint prevents the accumulation of replication stress-induced DNA damage and the potential ensuing genome instability. A critical role for post-translational modifications, such as phosphorylation, in the replication stress checkpoint response has been well established. However, recent work has revealed an important role for transcription in the cellular response to DNA replication stress. In this review, we will provide an overview of current knowledge of the cellular response to DNA replication stress with a specific focus on the DNA replication stress checkpoint transcriptional response and its role in the prevention of replication stress-induced DNA damage. PMID:28257104

  8. The role of DNA dependent protein kinase in synapsis of DNA ends.

    Science.gov (United States)

    Weterings, Eric; Verkaik, Nicole S; Brüggenwirth, Hennie T; Hoeijmakers, Jan H J; van Gent, Dik C

    2003-12-15

    DNA dependent protein kinase (DNA-PK) plays a central role in the non-homologous end-joining pathway of DNA double strand break repair. Its catalytic subunit (DNA-PK(CS)) functions as a serine/threonine protein kinase. We show that DNA-PK forms a stable complex at DNA termini that blocks the action of exonucleases and ligases. The DNA termini become accessible after autophosphorylation of DNA-PK(CS), which we demonstrate to require synapsis of DNA ends. Interestingly, the presence of DNA-PK prevents ligation of the two synapsed termini, but allows ligation to another DNA molecule. This alteration of the ligation route is independent of the type of ligase that we used, indicating that the intrinsic architecture of the DNA-PK complex itself is not able to support ligation of the synapsed DNA termini. We present a working model in which DNA-PK creates a stable molecular bridge between two DNA ends that is remodeled after DNA-PK autophosphorylation in such a way that the extreme termini become accessible without disrupting synapsis. We infer that joining of synapsed DNA termini would require an additional protein factor.

  9. Role of DNA profiling in forensic odontology

    Directory of Open Access Journals (Sweden)

    S Leena Sakari

    2015-01-01

    Full Text Available The recent advances in DNA profiling have made DNA evidence to be more widely accepted in courts. This has revolutionized the aspect of forensic odontology. DNA profiling/DNA fingerprinting has come a long way from the conventional fingerprints. DNA that is responsible for all the cell′s activities, yields valuable information both in the healthy and diseased individuals. When other means of traditional identification become impossible following mass calamities or fire explosions, teeth provide a rich source of DNA as they have a high chemical as well as physical resistance. The recent evolution in the isolation of DNA and the ways of running a DNA fingerprint are highlighted in this literature review.

  10. Exonuclease 1 and its versatile roles in DNA repair

    DEFF Research Database (Denmark)

    Keijzers, Guido; Liu, Dekang; Rasmussen, Lene Juel

    2016-01-01

    Exonuclease 1 (EXO1) is a multifunctional 5' → 3' exonuclease and a DNA structure-specific DNA endonuclease. EXO1 plays roles in DNA replication, DNA mismatch repair (MMR) and DNA double-stranded break repair (DSBR) in lower and higher eukaryotes and contributes to meiosis, immunoglobulin...... maturation, and micro-mediated end-joining in higher eukaryotes. In human cells, EXO1 is also thought to play a role in telomere maintenance. Mutations in the human EXO1 gene correlate with increased susceptibility to some cancers. This review summarizes recent studies on the enzymatic functions...

  11. Transcription-induced DNA supercoiling: New roles of intranucleosomal DNA loops in DNA repair and transcription.

    Science.gov (United States)

    Gerasimova, N S; Pestov, N A; Kulaeva, O I; Clark, D J; Studitsky, V M

    2016-05-26

    RNA polymerase II (Pol II) transcription through chromatin is accompanied by formation of small intranucleosomal DNA loops. Pol II captured within a small loop drives accumulation of DNA supercoiling, facilitating further transcription. DNA breaks relieve supercoiling and induce Pol II arrest, allowing detection of DNA damage hidden in chromatin structure.

  12. The role of DNA methylation in Obesity and Diabetes

    OpenAIRE

    ISHANT KHURANA

    2018-01-01

    A significant proportion of human disease causality remains unexplained. It is increasingly becoming clear that Epigenetics is a key contributor to many diseases, including cardiovascular diseases, atherosclerosis and diabetes. Epigenetics refers to the external modification to DNA that turn genes “ON” and “OFF”. These modifications do not change the DNA sequence, but instead, they effect cells ability to “read” genes. This thesis investigates the role of DNA methylation in Obesity and Diabet...

  13. Role of fetal DNA in preeclampsia (review).

    Science.gov (United States)

    Konečná, Barbora; Vlková, Barbora; Celec, Peter

    2015-02-01

    Preeclampsia is an autoimmune disorder characterized by hypertension. It begins with abnormal cytotrophoblast apoptosis, which leads to inflammation and an increase in the levels of anti-angiogenic factors followed by the disruption of the angiogenic status. Increased levels of fetal DNA and RNA coming from the placenta, one of the most commonly affected organs in pregnancies complicated by preeclampsia, have been found in pregnant women with the condition. However, it remains unknown as to whether this is a cause or a consequence of preeclampsia. Few studies have been carried out on preeclampsia in which an animal model of preeclampsia was induced by an injection of different types of DNA that are mimic fetal DNA and provoke inflammation through Toll-like receptor 9 (TLR9) or cyclic guanosine monophosphate-adenosine monophosphate (cGAMP). The specific mechanisms involved in the development of preeclampsia are not yet fully understood. It is hypothesized that the presence of different fragments of fetal DNA in maternal plasma may cause for the development of preeclampsia. The function of DNase during preeclampsia also remains unresolved. Studies have suggested that its activity is decreased or the DNA is protected against its effects. Further research is required to uncover the pathogenesis of preeclampsia and focus more on the condition of patients with the condition.

  14. Role of marine pollutants in impairment of DNA integrity.

    Digital Repository Service at National Institute of Oceanography (India)

    Sarker, S.; Sarkar, A.

    In this article, we present an overview on the role of marine pollutants in impairment of DNA integrity in marine gastropods exposed to xenobiotics released from various sources into the coastal ecosystem. We provide an insight into the impact...

  15. Role of the Checkpoint Clamp in DNA Damage Response

    Directory of Open Access Journals (Sweden)

    Mihoko Kai

    2013-01-01

    Full Text Available DNA damage occurs during DNA replication, spontaneous chemical reactions, and assaults by external or metabolism-derived agents. Therefore, all living cells must constantly contend with DNA damage. Cells protect themselves from these genotoxic stresses by activating the DNA damage checkpoint and DNA repair pathways. Coordination of these pathways requires tight regulation in order to prevent genomic instability. The checkpoint clamp complex consists of Rad9, Rad1 and Hus1 proteins, and is often called the 9-1-1 complex. This PCNA (proliferating cell nuclear antigen-like donut-shaped protein complex is a checkpoint sensor protein that is recruited to DNA damage sites during the early stage of the response, and is required for checkpoint activation. As PCNA is required for multiple pathways of DNA metabolism, the checkpoint clamp has also been implicated in direct roles in DNA repair, as well as in coordination of the pathways. Here we discuss roles of the checkpoint clamp in DNA damage response (DDR.

  16. The Role of Repulsion in Colloidal Crystal Engineering with DNA

    Energy Technology Data Exchange (ETDEWEB)

    Seo, Soyoung E. [Department; Li, Tao [X-ray; Senesi, Andrew J. [X-ray; Mirkin, Chad A. [Department; Lee, Byeongdu [X-ray

    2017-11-07

    Hybridization interactions between DNA-functionalized nanoparticles (DNA-NPs) can be used to program the crystallization behavior of superlattices, yielding access to complex three-dimensional structures with more than 30 different lattice symmetries. The first superlattice structures using DNA-NPs as building blocks were identified almost two decades ago, yet the role of repulsive interactions in guiding structure formation is still largely unexplored. Here, a com-prehensive approach is taken to study the role of repulsion in the assembly behavior of DNA-NPs, enabling the calculation of interparticle interaction potentials based on experimental results. In this work, we used two different means to assemble DNA-NPs—Watson-Crick base pairing interactions and depletion interactions—and systematically varied the salt concen-tration to study the effective interactions in DNA-NP superlattices. A comparison between the two systems allows us to decouple the repulsive forces from the attractive hybridization interactions that are sensitive to the ionic environment. We find that the gap distance between adjacent DNA-NPs follows a simple power law dependence on solution ionic strength regardless of the type of attractive forces present. This result suggests that the observed trend is driven by repulsive inter-actions. To better understand such behavior, we propose a mean-field model that provides a mathematical description for the observed trend. This model shows that the trend is due to the variation in the effective cross-sectional diameter of DNA duplex and the thickness of DNA shell.

  17. Role of DNA-PK in cellular responses to DNA double-strand breaks

    International Nuclear Information System (INIS)

    Chen, D.J.

    2003-01-01

    DNA double-strand breaks (DSBs) are probably the most dangerous of the many different types of DNA damage that occur within the cell. DSBs are generated by exogenous agents such as ionizing radiation (IR) or by endogenously generated reactive oxygen species and occur as intermediates during meiotic and V(D)J recombination. The repair of DSBs is of paramount importance to the cell as misrepair of DSBs can lead to cell death or promote tumorigenesis. In eukaryotes there exists two distinct mechanisms for DNA DSB repair: homologous recombination (HR) and non-homologous end joining (NHEJ). In mammalian cells, however, it is clear that nonhomologous repair of DSBs is highly active and plays a major role in conferring radiation resistance to the cell. The NHEJ machinery minimally consists of the DNA-dependent Protein Kinase (DNA-PK) and a complex of XRCC4 and DNA Ligase IV. The DNA-PK complex is composed of a 470 kDa catalytic subunit (DNA-PKcs), and the heterodimeric Ku70 and Ku80 DNA end-binding complex. DNA-PKcs is a PI-3 kinase with homology to ATM and ATR in its C-terminal kinase domain. The DNA-PK complex protects and tethers the ends, and directs assembly and, perhaps, the activation of other NHEJ proteins. We have previously demonstrated that the kinase activity of DNA-PK is essential for DNA DSB repair and V(D)J recombination. It is, therefore, of immense interest to determine the in vivo targets of DNA-PKcs and the mechanisms by which phosphorylation of these targets modulates NHEJ. Recent studies have resulted in the identification of a number of protein targets that are phosphorylated by and/or interact with DNA-PKcs. Our laboratory has recently identified autophosphorylation site(s) on DNA-PKcs. We find that phosphorylation at these sites in vivo is an early and essential response to DSBs and demonstrate, for the first time, the localization of DNA-PKcs to the sites of DNA damage in vivo. Furthermore, mutation of these phosphorylation sites in mammalian

  18. Role for DNA topoisomerase II in prostatic growth

    International Nuclear Information System (INIS)

    Nelson, W.G. V.

    1987-01-01

    In the studies presented the role of the mammalian type II topoisomerase in the proliferation of normal and neoplastic rat prostate cells in vitro and in vivo was evaluated. First, the utility of mammalian type II topoisomerase inhibitors for the study of the biologic functions of the enzyme was assessed. Novobiocin inhibited rat topoisomerase II, but also interacted directly with chromatin in rat ventral prostate nuclei as well. Teniposide and amsacrine both trapped topoisomerase II in a covalent enzyme-DNA reaction intermediate that could be recovered using a K-SDS precipitation assay. The specific trapping of covalent topoisomerase II-DNA complexes by teniposide was exploited to implicate topoisomerase II in DNA replication in cultured Dunning R3327-G rat prostatic adenocarcinoma cells. In 3 H-thymidine pulse and pulse-chase labelling experiments, newly replicated DNA was found to be enriched among DNA linked topoisomerase II following teniposide treatment. Additional experiments demonstrated that topoisomerase II formed covalent complexes in the presence of teniposide directly with nascent DNA chains. On the basis of this data, a model for topoisomerase II function in untangling intertwined daughter DNA strands during replication by acting in the wake of the DNA replication fork near the site of DNA synthesis was proposed

  19. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    Science.gov (United States)

    Jette, Nicholas; Lees-Miller, Susan P.

    2015-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082

  20. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    OpenAIRE

    Jette, Nicholas; Lees-Miller, Susan P.

    2014-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemi...

  1. Modifications of DNA clamps and their role in DNA damage management

    NARCIS (Netherlands)

    Wit, N.

    2013-01-01

    We show that proliferating cell nuclear antigen (PCNA) modification plays an important role in the efficient regulation of mammalian translesion DNA synthesis (TLS), but, as opposed to lower eukaryotes such as yeast, TLS polymerases can also be activated without ubiquitinated PCNA (PCNA-Ub). Future

  2. The Role of 8-Oxoguanine DNA Glycosylase-1 in Inflammation

    Directory of Open Access Journals (Sweden)

    Xueqing Ba

    2014-09-01

    Full Text Available Many, if not all, environmental pollutants/chemicals and infectious agents increase intracellular levels of reactive oxygen species (ROS at the site of exposure. ROS not only function as intracellular signaling entities, but also induce damage to cellular molecules including DNA. Among the several dozen ROS-induced DNA base lesions generated in the genome, 8-oxo-7,8-dihydroguanine (8-oxoG is one of the most abundant because of guanine’s lowest redox potential among DNA bases. In mammalian cells, 8-oxoG is repaired by the 8-oxoguanine DNA glycosylase-1 (OGG1-initiated DNA base excision repair pathway (OGG1–BER. Accumulation of 8-oxoG in DNA has traditionally been associated with mutagenesis, as well as various human diseases and aging processes, while the free 8-oxoG base in body fluids is one of the best biomarkers of ongoing pathophysiological processes. In this review, we discuss the biological significance of the 8-oxoG base and particularly the role of OGG1–BER in the activation of small GTPases and changes in gene expression, including those that regulate pro-inflammatory chemokines/cytokines and cause inflammation.

  3. Genetic exchanges caused by ultraviolet photoproducts in phage lamda DNA molecules: the role of DNA replication

    International Nuclear Information System (INIS)

    Lin, P.F.; Howard-Flanders, P.; Yale Univ., New Haven, Conn.

    1976-01-01

    Genetic recombination induced by structural damage in DNA molecules was investigated in E. coli K12(lamda) lysogens infected with genetically marked phage lamda. Photoproducts were induced in the phage DNA before infection by exposing them either to 313 nm light in the presence of acetophenone or to 254 nm light. To test the role of the replication of the damage phage DNA on the frequency of the induced recombination , both heteroimmune and homoimmune crosses were performed, and scored for P + recombinants. In heteroimmune crosses, recombination was less frequent in infected cells exposed to visible light and in wild type cells able to perform excision repair than in excision-defective lysogens. Therefore, much of the induced recombination can be attributed to the pyrimidine dimers in the phage DNA. In homoimmune crosses, replication of the phage DNA containing ultraviolet photoproducts was represented by lamda immunity, and was further blocked by the lack of the P gene product needed for replication. The 254 nm photoproducts increased the frequency of recombination in these homoimmune crosses, even though phage DNA replication was blocked. Irradiation with 313 nm light and acetophenone M, which produces dimers and unknown photoproducts, was not as effective per dimer as the 254 nm light. It is concluded from these results that certain unidentified 254 nm photoproducts can cause recombination even in the absence of DNA replication. They are not pyrimidine dimers, as they are not susceptible to excision repair or photoreactivation. In contrast, pyrimidine dimers appear to cause recombination only when the DNA containing them undergoes replication. (orig./MG) [de

  4. The role of DNA polymerase {iota} in UV mutational spectra

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Jun-Hyuk [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Besaratinia, Ahmad [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Lee, Dong-Hyun [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States); Lee, Chong-Soon [Department of Biochemistry, College of Natural Sciences, Yeungnam University, Gyongsan 712-749 (Korea, Republic of); Pfeifer, Gerd P. [Division of Biology, Beckman Research Institute, City of Hope, Duarte, CA 91010 (United States)]. E-mail: gpfeifer@coh.org

    2006-07-25

    UVB (280-320 nm) and UVC (200-280 nm) irradiation generate predominantly cyclobutane pyrimidine dimers (CPDs) and (6-4) photoproducts in DNA. CPDs are thought to be responsible for most of the UV-induced mutations. Thymine-thymine CPDs, and probably also CPDs containing cytosine, are replicated in vivo in a largely accurate manner by a DNA polymerase {eta} (Pol {eta}) dependent process. Pol {eta} is a DNA damage-tolerant and error-prone DNA polymerase encoded by the POLH (XPV) gene in humans. Another member of the Y family of error-prone DNA polymerases is POLI encoding DNA polymerase iota (Pol {iota}). In order to clarify the specific role of Pol {iota} in UV mutagenesis, we have used an siRNA knockdown approach in combination with a supF shuttle vector which replicates in mammalian cells, similar as we have previously done for Pol {eta}. Synthetic RNA duplexes were used to efficiently inhibit Pol {iota} expression in 293T cells. The supF shuttle vector was irradiated with 254 nm UVC and replicated in 293T cells in presence of anti-Pol {iota} siRNA. Surprisingly, there was a consistent reduction of recovered plasmid from cells with Pol {iota} knockdown and this was independent of UV irradiation of the plasmid. The supF mutant frequency was unchanged in the siRNA knockdown cells relative to control cells confirming that Pol {iota} does not play an important role in UV mutagenesis. UV-induced supF mutants were sequenced from siRNA-treated cells and controls. Neither the type of mutations nor their distribution along the supF gene were significantly different between controls and siRNA knockdown cells and were predominantly C to T and CC to TT transitions at dipyrimidine sites. These results show that Pol {iota} has no significant role in UV lesion bypass and mutagenesis in vivo and provides some initial data suggesting that this polymerase may be involved in replication of extrachromosomal DNA.

  5. Role of nuclear hexokinase II in DNA repair

    International Nuclear Information System (INIS)

    Khanna, S.; Bhatt, A.N.; Dwarakanath, B.S.; Kalaiarasan, P.; Brahmachari, V.

    2012-01-01

    A common signature of many cancer cells is a high glucose catabolic rate primarily due to the over expression of Type II hexokinase (HKII; responsible for the phosphorylation of glucose), generally known as cytosolic and mitochondrial bound enzyme that also suppresses cell death. Although, nuclear localization and transcriptional regulation of HKII has been reported in yeast; we and few others have recently demonstrated its nuclear localization in malignant cell lines. Interestingly, modification of a human glioma cell line (BMG-1) for enhancing glycolysis through mitochondrial respiration (OPMBMG cells) resulted in a higher nuclear localization of HKII as compared to the parental cells with concomitant increase in DNA repair and radio-resistance. Further, the glucose phosphorylation activity of the nuclear HKII was nearly 2 folds higher in the relatively more radioresistant HeLa cells (human cervical cancer cell line) as compared to MRC-5 cells (human normal lung fibroblast cell line). Therefore, we hypothesize that nuclear HKII facilitates DNA repair, in a hither to unknown mechanism, that may partly contribute to the enhanced resistance of highly glycolytic cells to radiation. Sequence alignment studies suggest that the isoenzymes, HKI and HKII share strong homology in the kinase active site, which is also found in few protein kinases. Interestingly HKI has been shown to phosphorylate H2A in-vitro. Further, in-silico protein-protein interaction data suggest that HKII can interact with several DNA repair proteins including ATM. Taken together; available experimental evidences as well as in-silico predictions strongly suggest that HKII may play a role in DNA repair by phosphorylation of certain DNA repair proteins. (author)

  6. Surface physicochemistry and ionic strength affects eDNA's role in bacterial adhesion to abiotic surfaces

    DEFF Research Database (Denmark)

    Regina, Viduthalai R.; Lokanathan, Arcot R.; Modrzynski, Jakub Jan

    2014-01-01

    Extracellular DNA (eDNA) is an important structural component of biofilms formed by many bacteria, but few reports have focused on its role in initial cell adhesion. The aim of this study was to investigate the role of eDNA in bacterial adhesion to abiotic surfaces, and determine to which extent ...

  7. Cell cycle phase dependent role of DNA polymerase beta in DNA repair and survival after ionizing radiation.

    NARCIS (Netherlands)

    Vermeulen, C.; Verwijs-Janssen, M.; Begg, A.C.; Vens, C.

    2008-01-01

    PURPOSE: The purpose of the present study was to determine the role of DNA polymerase beta in repair and response after ionizing radiation in different phases of the cell cycle. METHODS AND MATERIALS: Synchronized cells deficient and proficient in DNA polymerase beta were irradiated in different

  8. Roles of Mitochondrial DNA Mutations in Stem Cell Ageing

    Directory of Open Access Journals (Sweden)

    Tianhong Su

    2018-03-01

    Full Text Available Mitochondrial DNA (mtDNA mutations accumulate in somatic stem cells during ageing and cause mitochondrial dysfunction. In this review, we summarize the studies that link mtDNA mutations to stem cell ageing. We discuss the age-related behaviours of the somatic mtDNA mutations in stem cell populations and how they potentially contribute to stem cell ageing by altering mitochondrial properties in humans and in mtDNA-mutator mice. We also draw attention to the diverse fates of the mtDNA mutations with different origins during ageing, with potential selective pressures on the germline inherited but not the somatic mtDNA mutations.

  9. DNA mismatch repair and its many roles in eukaryotic cells

    DEFF Research Database (Denmark)

    Liu, Dekang; Keijzers, Guido; Rasmussen, Lene Juel

    2017-01-01

    in the clinic, and as a biomarker of cancer susceptibility in animal model systems. Prokaryotic MMR is well-characterized at the molecular and mechanistic level; however, MMR is considerably more complex in eukaryotic cells than in prokaryotic cells, and in recent years, it has become evident that MMR plays...... novel roles in eukaryotic cells, several of which are not yet well-defined or understood. Many MMR-deficient human cancer cells lack mutations in known human MMR genes, which strongly suggests that essential eukaryotic MMR components/cofactors remain unidentified and uncharacterized. Furthermore......, the mechanism by which the eukaryotic MMR machinery discriminates between the parental (template) and the daughter (nascent) DNA strand is incompletely understood and how cells choose between the EXO1-dependent and the EXO1–independent subpathways of MMR is not known. This review summarizes recent literature...

  10. The Intertwined Roles of DNA Damage and Transcription

    OpenAIRE

    Di Palo, Giacomo

    2016-01-01

    DNA damage and transcription are two interconnected events. Transcription can induce damage and scheduled DNA damage can be required for transcription. Here, we analyzed genome-wide distribution of 8oxodG-marked oxidative DNA damage obtained by OxiDIP-Seq, and we found a correlation with transcription of protein coding genes.

  11. Role of oxidative DNA damage in genome instability and cancer

    International Nuclear Information System (INIS)

    Bignami, M.; Kunkel, T.

    2009-01-01

    Inactivation of mismatch repair (MMR) is associated with a dramatic genomic instability that is observed experimentally as a mutator phenotype and micro satellite instability (MSI). It has been implicit that the massive genetic instability in MMR defective cells simply reflects the accumulation of spontaneous DNA polymerase errors during DNA replication. We recently identified oxidation damage, a common threat to DNA integrity to which purines are very susceptible, as an important cofactor in this genetic instability

  12. DNA Damage and Base Excision Repair in Mitochondria and Their Role in Aging

    Directory of Open Access Journals (Sweden)

    Ricardo Gredilla

    2011-01-01

    Full Text Available During the last decades, our knowledge about the processes involved in the aging process has exponentially increased. However, further investigation will be still required to globally understand the complexity of aging. Aging is a multifactorial phenomenon characterized by increased susceptibility to cellular loss and functional decline, where mitochondrial DNA mutations and mitochondrial DNA damage response are thought to play important roles. Due to the proximity of mitochondrial DNA to the main sites of mitochondrial-free radical generation, oxidative stress is a major source of mitochondrial DNA mutations. Mitochondrial DNA repair mechanisms, in particular the base excision repair pathway, constitute an important mechanism for maintenance of mitochondrial DNA integrity. The results reviewed here support that mitochondrial DNA damage plays an important role in aging.

  13. Role of cyclobutane dimers in UV-denaturation of DNA

    International Nuclear Information System (INIS)

    Zavil'gel'skij, G.B.; Zuev, A.V.

    1978-01-01

    UV irradiation of double-stranded DNA produces local denatured regions. The evidence presented indicates that these single-stranded regions arise from photoproducts other than pyrimidine dimers. The irradiation of T2 DNA at 8x10 4 erg/mm 2 (254 nm) produces 6-8% thymine dimers, amd Tsub(mel) drops by 12-14 deg C, accompanied by a significant broadening of the transition profile. The kinetics of denatured region formation and lowering Tsub(mel) corresponds to that of formation of crosslinkages and differs markedly from the kinetics of formation of cyclobutane pyrimidine dimers. Treatment of UV-irradiated DNA with light in the presence of yeast photoreactivating enzyme monomerizes almost all thymine dimers but does not change the Tsub(mel). Local denatured regions are detected in UV-irradiated DNA and are absent from AcPhM-sensibilized DNA, which contains 20-25% thymine dimers, as determined by the accridine orange fluorescence technique. S1 nuclease from Aspergillis oryzae produces single-strand breaks in UV-irradiated DNA of phage PM2 but is not active on AcPhM-treated PM2 DNA, which contains about 50 thymine dimers. It is supposed that the formation of a cyclobutane dimer only weakens the hydrogen bonds in the AT base pair rather than breaks them. Local denatured regions are thought to arise from the accumulation in UV-irradiated DNA (254 nm) of the sufficient number of photoproducts with impaired ability to base pairing

  14. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S

    2010-01-01

    (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow......Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  15. A critical role for topoisomerase IIb and DNA double strand breaks in transcription.

    Science.gov (United States)

    Calderwood, Stuart K

    2016-05-26

    Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb.

  16. Interactive Roles of DNA Helicases and Translocases with the Single-Stranded DNA Binding Protein RPA in Nucleic Acid Metabolism.

    Science.gov (United States)

    Awate, Sanket; Brosh, Robert M

    2017-06-08

    Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies.

  17. Crystal Structures of DNA-Whirly Complexes and Their Role in Arabidopsis Organelle Genome Repair

    Energy Technology Data Exchange (ETDEWEB)

    Cappadocia, Laurent; Maréchal, Alexandre; Parent, Jean-Sébastien; Lepage, Étienne; Sygusch, Jurgen; Brisson, Normand (Montreal)

    2010-09-07

    DNA double-strand breaks are highly detrimental to all organisms and need to be quickly and accurately repaired. Although several proteins are known to maintain plastid and mitochondrial genome stability in plants, little is known about the mechanisms of DNA repair in these organelles and the roles of specific proteins. Here, using ciprofloxacin as a DNA damaging agent specific to the organelles, we show that plastids and mitochondria can repair DNA double-strand breaks through an error-prone pathway similar to the microhomology-mediated break-induced replication observed in humans, yeast, and bacteria. This pathway is negatively regulated by the single-stranded DNA (ssDNA) binding proteins from the Whirly family, thus indicating that these proteins could contribute to the accurate repair of plant organelle genomes. To understand the role of Whirly proteins in this process, we solved the crystal structures of several Whirly-DNA complexes. These reveal a nonsequence-specific ssDNA binding mechanism in which DNA is stabilized between domains of adjacent subunits and rendered unavailable for duplex formation and/or protein interactions. Our results suggest a model in which the binding of Whirly proteins to ssDNA would favor accurate repair of DNA double-strand breaks over an error-prone microhomology-mediated break-induced replication repair pathway.

  18. The role of DNA repair in herpesvirus pathogenesis.

    Science.gov (United States)

    Brown, Jay C

    2014-10-01

    In cells latently infected with a herpesvirus, the viral DNA is present in the cell nucleus, but it is not extensively replicated or transcribed. In this suppressed state the virus DNA is vulnerable to mutagenic events that affect the host cell and have the potential to destroy the virus' genetic integrity. Despite the potential for genetic damage, however, herpesvirus sequences are well conserved after reactivation from latency. To account for this apparent paradox, I have tested the idea that host cell-encoded mechanisms of DNA repair are able to control genetic damage to latent herpesviruses. Studies were focused on homologous recombination-dependent DNA repair (HR). Methods of DNA sequence analysis were employed to scan herpesvirus genomes for DNA features able to activate HR. Analyses were carried out with a total of 39 herpesvirus DNA sequences, a group that included viruses from the alpha-, beta- and gamma-subfamilies. The results showed that all 39 genome sequences were enriched in two or more of the eight recombination-initiating features examined. The results were interpreted to indicate that HR can stabilize latent herpesvirus genomes. The results also showed, unexpectedly, that repair-initiating DNA features differed in alpha- compared to gamma-herpesviruses. Whereas inverted and tandem repeats predominated in alpha-herpesviruses, gamma-herpesviruses were enriched in short, GC-rich initiation sequences such as CCCAG and depleted in repeats. In alpha-herpesviruses, repair-initiating repeat sequences were found to be concentrated in a specific region (the S segment) of the genome while repair-initiating short sequences were distributed more uniformly in gamma-herpesviruses. The results suggest that repair pathways are activated differently in alpha- compared to gamma-herpesviruses. Copyright © 2014. Published by Elsevier Inc.

  19. Understanding the role of thiol and disulfide self-assembled DNA receptor monolayers for biosensing applications.

    Science.gov (United States)

    Carrascosa, Laura G; Martínez, Lidia; Huttel, Yves; Román, Elisa; Lechuga, Laura M

    2010-09-01

    A detailed study of the immobilization of three differently sulfur-modified DNA receptors for biosensing applications is presented. The three receptors are DNA-(CH)n-SH-, DNA-(CH)n-SS-(CH)n-DNA, and DNA-(CH)n-SS-DMTO. Nanomechanical and surface plasmon resonance biosensors and fluorescence and radiolabelling techniques were used for the experimental evaluation. The results highlight the critical role of sulfur linker type in DNA self-assembly, affecting the kinetic adsorption and spatial distribution of DNA chains within the monolayer and the extent of chemisorption and physisorption. A spacer (mercaptohexanol, MCH) is used to evaluate the relative efficiencies of chemisorption of the three receptors by analysing the extent to which MCH can remove physisorbed molecules from each type of monolayer. It is demonstrated that -SH derivatization is the most suitable for biosensing purposes as it results in densely packed monolayers with the lowest ratio of physisorbed probes.

  20. Role of the hydrophilic channels of simian virus 40 T-antigen helicase in DNA replication.

    Science.gov (United States)

    Wang, Weiping; Manna, David; Simmons, Daniel T

    2007-05-01

    The simian virus 40 (SV40) hexameric helicase consists of a central channel and six hydrophilic channels located between adjacent large tier domains within each hexamer. To study the function of the hydrophilic channels in SV40 DNA replication, a series of single-point substitutions were introduced at sites not directly involved in protein-protein contacts. The mutants were characterized biochemically in various ways. All mutants oligomerized normally in the absence of DNA. Interestingly, 8 of the 10 mutants failed to unwind an origin-containing DNA fragment and nine of them were totally unable to support SV40 DNA replication in vitro. The mutants fell into four classes based on their biochemical properties. Class A mutants bound DNA normally and had normal ATPase and helicase activities but failed to unwind origin DNA and support SV40 DNA replication. Class B mutants were compromised in single-stranded DNA and origin DNA binding at low protein concentrations. They were defective in helicase activity and unwinding of the origin and in supporting DNA replication. Class C and D mutants possessed higher-than-normal single-stranded DNA binding activity at low protein concentrations. The class C mutants failed to separate origin DNA and support DNA replication. The class D mutants unwound origin DNA normally but were compromised in their ability to support DNA replication. Taken together, these results suggest that the hydrophilic channels have an active role in the unwinding of SV40 DNA from the origin and the placement of the resulting single strands within the helicase.

  1. Role of DNA lesions and DNA repair in mutagenesis by carcinogens in diploid human fibroblasts

    International Nuclear Information System (INIS)

    Maher, V.M.; McCormick, J.J.

    1986-01-01

    The authors investigated the cytotoxicity, mutagenicity, and transforming activity of carcinogens and radiation in diploid human fibroblasts, using cells which differ in their DNA repair capacity. The results indicate that cell killing and induction of mutations are correlated with the number of specific lesions remaining unrepaired in the cells at a particular time posttreatment. DNA excision repair acts to eliminate potentially cytotoxic and mutagenic (and transforming) damage from DNA before these can be converted into permanent cellular effects. Normal human fibroblasts were derived from skin biopsies or circumcision material. Skin fibroblasts from xeroderma pigmentosum (XP) patients provided cells deficient in nucleotide excision repair of pyrimidine dimers or DNA adducts formed by bulky ring structures. Cytotoxicity was determined from loss of ability to form a colony. The genetic marker used was resistance to 6-thioguanine (TG). Transformation was measured by determining the frequency of anchorage-independent cells

  2. An essential nonredundant role for mycobacterial DnaK in native protein folding.

    Directory of Open Access Journals (Sweden)

    Allison Fay

    2014-07-01

    Full Text Available Protein chaperones are essential in all domains of life to prevent and resolve protein misfolding during translation and proteotoxic stress. HSP70 family chaperones, including E. coli DnaK, function in stress induced protein refolding and degradation, but are dispensable for cellular viability due to redundant chaperone systems that prevent global nascent peptide insolubility. However, the function of HSP70 chaperones in mycobacteria, a genus that includes multiple human pathogens, has not been examined. We find that mycobacterial DnaK is essential for cell growth and required for native protein folding in Mycobacterium smegmatis. Loss of DnaK is accompanied by proteotoxic collapse characterized by the accumulation of insoluble newly synthesized proteins. DnaK is required for solubility of large multimodular lipid synthases, including the essential lipid synthase FASI, and DnaK loss is accompanied by disruption of membrane structure and increased cell permeability. Trigger Factor is nonessential and has a minor role in native protein folding that is only evident in the absence of DnaK. In unstressed cells, DnaK localizes to multiple, dynamic foci, but relocalizes to focal protein aggregates during stationary phase or upon expression of aggregating peptides. Mycobacterial cells restart cell growth after proteotoxic stress by isolating persistent DnaK containing protein aggregates away from daughter cells. These results reveal unanticipated essential nonredunant roles for mycobacterial DnaK in mycobacteria and indicate that DnaK defines a unique susceptibility point in the mycobacterial proteostasis network.

  3. The role of DNA polymerase ζ in translesion synthesis across bulky DNA adducts and cross-links in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, Tetsuya, E-mail: suzukite@hiroshima-u.ac.jp [Division of Genetics and Mutagenesis, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Grúz, Petr; Honma, Masamitsu [Division of Genetics and Mutagenesis, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan); Adachi, Noritaka [Graduate School of Nanobioscience, Yokohama City University, 22-2 Seto, Kanazawa-ku, Yokohama 236-0027 (Japan); Nohmi, Takehiko [Division of Genetics and Mutagenesis, National Institute of Health Sciences, 1-18-1 Kamiyoga, Setagaya-ku, Tokyo 158-8501 (Japan)

    2016-09-15

    Highlights: • Human cells knockout (KO) and expressing catalytically dead (CD) variant of DNA polymerase ζ (Pol ζ) have been established by gene targeting techniques with Nalm-6 cells. • Both Pol ζ KO and CD cells displayed prolonged cell cycle and higher incidence of micronucleus formation than the wild-type cells in the absence of exogenous genotoxic treatments. • Pol ζ protects human cells from genotoxic stresses that induce bulky DNA lesions and cross-links. • Pol ζ plays quite limited roles in protection against strand-breaks in DNA. - Abstract: Translesion DNA synthesis (TLS) is a cellular defense mechanism against genotoxins. Defects or mutations in specialized DNA polymerases (Pols) involved in TLS are believed to result in hypersensitivity to various genotoxic stresses. Here, DNA polymerase ζ (Pol ζ)-deficient (KO: knockout) and Pol ζ catalytically dead (CD) human cells were established and their sensitivity towards cytotoxic activities of various genotoxins was examined. The CD cells were engineered by altering the DNA sequence encoding two amino acids essential for the catalytic activity of Pol ζ, i.e., D2781 and D2783, to alanines. Both Pol ζ KO and CD cells displayed a prolonged cell cycle and higher incidence of micronuclei formation than the wild-type (WT) cells in the absence of exogenous genotoxic treatments, and the order of abnormality was CD > KO > WT cells. Both KO and CD cells exhibited higher sensitivity towards the killing effects of benzo[a]pyrene diol epoxide, mitomycin C, potassium bromate, N-methyl-N′-nitro-N-nitrosoguanidine, and ultraviolet C irradiation than WT cells, and there were no differences between the sensitivities of KO and CD cells. Interestingly, neither KO nor CD cells were sensitive to the cytotoxic effects of hydrogen peroxide. Since KO and CD cells displayed similar sensitivities to the genotoxins, we employed only KO cells to further examine their sensitivity to other genotoxic agents. KO cells were

  4. The role of DNA polymerase ζ in translesion synthesis across bulky DNA adducts and cross-links in human cells

    International Nuclear Information System (INIS)

    Suzuki, Tetsuya; Grúz, Petr; Honma, Masamitsu; Adachi, Noritaka; Nohmi, Takehiko

    2016-01-01

    Highlights: • Human cells knockout (KO) and expressing catalytically dead (CD) variant of DNA polymerase ζ (Pol ζ) have been established by gene targeting techniques with Nalm-6 cells. • Both Pol ζ KO and CD cells displayed prolonged cell cycle and higher incidence of micronucleus formation than the wild-type cells in the absence of exogenous genotoxic treatments. • Pol ζ protects human cells from genotoxic stresses that induce bulky DNA lesions and cross-links. • Pol ζ plays quite limited roles in protection against strand-breaks in DNA. - Abstract: Translesion DNA synthesis (TLS) is a cellular defense mechanism against genotoxins. Defects or mutations in specialized DNA polymerases (Pols) involved in TLS are believed to result in hypersensitivity to various genotoxic stresses. Here, DNA polymerase ζ (Pol ζ)-deficient (KO: knockout) and Pol ζ catalytically dead (CD) human cells were established and their sensitivity towards cytotoxic activities of various genotoxins was examined. The CD cells were engineered by altering the DNA sequence encoding two amino acids essential for the catalytic activity of Pol ζ, i.e., D2781 and D2783, to alanines. Both Pol ζ KO and CD cells displayed a prolonged cell cycle and higher incidence of micronuclei formation than the wild-type (WT) cells in the absence of exogenous genotoxic treatments, and the order of abnormality was CD > KO > WT cells. Both KO and CD cells exhibited higher sensitivity towards the killing effects of benzo[a]pyrene diol epoxide, mitomycin C, potassium bromate, N-methyl-N′-nitro-N-nitrosoguanidine, and ultraviolet C irradiation than WT cells, and there were no differences between the sensitivities of KO and CD cells. Interestingly, neither KO nor CD cells were sensitive to the cytotoxic effects of hydrogen peroxide. Since KO and CD cells displayed similar sensitivities to the genotoxins, we employed only KO cells to further examine their sensitivity to other genotoxic agents. KO cells were

  5. Proteomic investigations reveal a role for RNA processing factor THRAP3 in the DNA damage response

    DEFF Research Database (Denmark)

    Beli, Petra; Lukashchuk, Natalia; Wagner, Sebastian A

    2012-01-01

    /ATR/DNA-PK target consensus motif, suggesting an important role of downstream kinases in amplifying DDR signals. We show that the splicing-regulator phosphatase PPM1G is recruited to sites of DNA damage, while the splicing-associated protein THRAP3 is excluded from these regions. Moreover, THRAP3 depletion causes...

  6. The role of DNA methylation and histone modifications in neurodegenerative diseases: A systematic review

    NARCIS (Netherlands)

    K.-X. Wen (Ke-Xin); J. Milic (Jelena); El-Khodor, B. (Bassem); K. Dhana (Klodian); J. Nano (Jana); Pulido, T. (Tammy); B. Kraja (Bledar); A. Zaciragic (Asija); W.M. Bramer (Wichor); J. Troup; R. Chowdhury (Rajiv); Arfam Ikram, M.; A. Dehghan (Abbas); T. Muka (Taulant); O.H. Franco (Oscar)

    2016-01-01

    textabstractImportance Epigenetic modifications of the genome, such as DNA methylation and histone modifications, have been reported to play a role in neurodegenerative diseases (ND) such as Alzheimer's disease (AD) and Parkinson's disease (PD). Objective To systematically review studies

  7. Possible role of repetitious DNA in recombinatory joining during chromosome rearrangement in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Lee, C.S.

    1975-01-01

    It is postulated that certain repetitious DNA components play a role in the recombination processes during chromosome rearrangements. When the distribution of silver grain densities after the in situ hybridization of repetitious DNA and the distribution of chromosome breaks due to x-irradiation are compared, a strong correlation is found for the euchromatic portion of the D. melanogaster salivary X chromosome. These observations justify the postulate above that certain repetitious DNA provides homologous regions in the DNA of broken chromosome ends necessary for proper recombinatory joining. (U.S.)

  8. Molecular targets, DNA breakage, DNA repair: Their roles in mutation induction in mammalian germ cells

    International Nuclear Information System (INIS)

    Sega, G.A.

    1989-01-01

    Variability in genetic sensitivity among different germ-cell stages in the mammal to various mutagens could be the result of how much chemical reaches the different stages, what molecular targets may be affected in the different stages and whether or not repair of lesions occurs. Several chemicals have been found to bind very strongly to protamine in late-spermatid and early-spermatozoa stages in the mouse. The chemicals also produce their greatest genetic damage in these same germ-cell stages. While chemical binding to DNA has not been correlated with the level of induced genetic damage, DNA breakage in the sensitive stages has been shown to increase. This DNA breakage is believed to indirectly result from chemical binding to sulfhydryl groups in protamine which prevents normal chromatin condensation within the sperm nucleus. 22 refs., 5 figs

  9. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  10. Functional role of a highly repetitive DNA sequence in anchorage of the mouse genome.

    Science.gov (United States)

    Neuer-Nitsche, B; Lu, X N; Werner, D

    1988-09-12

    The major portion of the eukaryotic genome consists of various categories of repetitive DNA sequences which have been studied with respect to their base compositions, organizations, copy numbers, transcription and species specificities; their biological roles, however, are still unclear. A novel quality of a highly repetitive mouse DNA sequence is described which points to a functional role: All copies (approximately 50,000 per haploid genome) of this DNA sequence reside on genomic Alu I DNA fragments each associated with nuclear polypeptides that are not released from DNA by proteinase K, SDS and phenol extraction. By this quality the repetitive DNA sequence is classified as a member of the sub-set of DNA sequences involved in tight DNA-polypeptide complexes which have been previously shown to be components of the subnuclear structure termed 'nuclear matrix'. From these results it has to be concluded that the repetitive DNA sequence characterized in this report represents or comprises a signal for a large number of site specific attachment points of the mouse genome in the nuclear matrix.

  11. Direct non transcriptional role of NF-Y in DNA replication.

    Science.gov (United States)

    Benatti, Paolo; Belluti, Silvia; Miotto, Benoit; Neusiedler, Julia; Dolfini, Diletta; Drac, Marjorie; Basile, Valentina; Schwob, Etienne; Mantovani, Roberto; Blow, J Julian; Imbriano, Carol

    2016-04-01

    NF-Y is a heterotrimeric transcription factor, which plays a pioneer role in the transcriptional control of promoters containing the CCAAT-box, among which genes involved in cell cycle regulation, apoptosis and DNA damage response. The knock-down of the sequence-specific subunit NF-YA triggers defects in S-phase progression, which lead to apoptotic cell death. Here, we report that NF-Y has a critical function in DNA replication progression, independent from its transcriptional activity. NF-YA colocalizes with early DNA replication factories, its depletion affects the loading of replisome proteins to DNA, among which Cdc45, and delays the passage from early to middle-late S phase. Molecular combing experiments are consistent with a role for NF-Y in the control of fork progression. Finally, we unambiguously demonstrate a direct non-transcriptional role of NF-Y in the overall efficiency of DNA replication, specifically in the DNA elongation process, using a Xenopus cell-free system. Our findings broaden the activity of NF-Y on a DNA metabolism other than transcription, supporting the existence of specific TFs required for proper and efficient DNA replication. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  12. The portal protein plays essential roles at different steps of the SPP1 DNA packaging process

    International Nuclear Information System (INIS)

    Isidro, Anabela; Henriques, Adriano O.; Tavares, Paulo

    2004-01-01

    A large number of viruses use a specialized portal for entry of DNA to the viral capsid and for its polarized exit at the beginning of infection. These families of viruses assemble an icosahedral procapsid containing a portal protein oligomer in one of its 12 vertices. The viral ATPase (terminase) interacts with the portal vertex to form a powerful molecular motor that translocates DNA to the procapsid interior against a steep concentration gradient. The portal protein is an essential component of this DNA packaging machine. Characterization of single amino acid substitutions in the portal protein gp6 of bacteriophage SPP1 that block DNA packaging identified sequential steps in the packaging mechanism that require its action. Gp6 is essential at early steps of DNA packaging and for DNA translocation to the capsid interior, it affects the efficiency of DNA packaging, it is a central component of the headful sensor that determines the size of the packaged DNA molecule, and is essential for closure of the portal pore by the head completion proteins to prevent exit of the DNA encapsidated. Functional regions of gp6 necessary at each step are identified within its primary structure. The similarity between the architecture of portal oligomers and between the DNA packaging strategies of viruses using portals strongly suggests that the portal protein plays the same roles in a large number of viruses

  13. Evidence for roles of the Escherichia coli Hda protein beyond regulatory inactivation of DnaA.

    Science.gov (United States)

    Baxter, Jamie C; Sutton, Mark D

    2012-08-01

    The ATP-bound form of the Escherichia coli DnaA protein binds 'DnaA boxes' present in the origin of replication (oriC) and operator sites of several genes, including dnaA, to co-ordinate their transcription with initiation of replication. The Hda protein, together with the β sliding clamp, stimulates the ATPase activity of DnaA via a process termed regulatory inactivation of DnaA (RIDA), to regulate the activity of DnaA in DNA replication. Here, we used the mutant dnaN159 strain, which expresses the β159 clamp protein, to gain insight into how the actions of Hda are co-ordinated with replication. Elevated expression of Hda impeded growth of the dnaN159 strain in a Pol II- and Pol IV-dependent manner, suggesting a role for Hda managing the actions of these Pols. In a wild-type strain, elevated levels of Hda conferred sensitivity to nitrofurazone, and suppressed the frequency of -1 frameshift mutations characteristic of Pol IV, while loss of hda conferred cold sensitivity. Using the dnaN159 strain, we identified 24 novel hda alleles, four of which supported E. coli viability despite their RIDA defect. Taken together, these findings suggest that although one or more Hda functions are essential for cell viability, RIDA may be dispensable. © 2012 Blackwell Publishing Ltd.

  14. DNA methylation results depend on DNA integrity – role of post mortem interval

    Directory of Open Access Journals (Sweden)

    Mathias eRhein

    2015-05-01

    Full Text Available Major questions of neurological and psychiatric mechanisms involve the brain functions on a molecular level and cannot be easily addressed due to limitations in access to tissue samples. Post mortem studies are able to partly bridge the gap between brain tissue research retrieved from animal trials and the information derived from peripheral analysis (e.g. measurements in blood cells in patients. Here, we wanted to know how fast DNA degradation is progressing under controlled conditions in order to define thresholds for tissue quality to be used in respective trials. Our focus was on the applicability of partly degraded samples for bisulfite sequencing and the determination of simple means to define cut-off values.After opening the brain cavity, we kept two consecutive pig skulls at ambient temperature (19-21°C and removed cortex tissue up to a post mortem interval (PMI of 120h. We calculated the percentage of degradation on DNA gel electrophoresis of brain DNA to estimate quality and relate this estimation spectrum to the quality of human post-mortem control samples. Functional DNA quality was investigated by bisulfite sequencing of two functionally relevant genes for either the serotonin receptor 5 (SLC6A4 or aldehyde dehydrogenase 2 (ALDH2.Testing our approach in a heterogeneous collective of human blood and brain samples, we demonstrate integrity of measurement quality below the threshold of 72h PMI.While sequencing technically worked for all timepoints irrespective of conceivable DNA degradation, there is a good correlation between variance of methylation to degradation levels documented in the gel (R2=0.4311, p=0.0392 for advancing post mortem intervals (PMI. This otherwise elusive phenomenon is an important prerequisite for the interpretation and evaluation of samples prior to in-depth processing via an affordable and easy assay to estimate identical sample quality and thereby comparable methylation measurements.

  15. Role of DNA deletion length in mutation and cell survival

    International Nuclear Information System (INIS)

    Braby, L.A.; Morgan, T.L.

    1992-01-01

    A model is presented which is based on the assumption that malignant transformation, mutation, chromosome aberration, and reproductive death of cells are all manifestations of radiation induced deletions in the DNA of the cell, and that the size of the deletion in relation to the spacing of essential genes determines the consequences of that deletion. It is assumed that two independent types of potentially lethal lesions can result in DNA deletions, and that the relative numbers of these types of damage is dependent on radiation quality. The repair of the damage reduces the length of a deletion, but does not always eliminate it. The predictions of this model are in good agreement with a wide variety of experimental evidence. (author)

  16. Genotoxicity induced by xenobiotics:the role of DNA adducts, individual susceptibility and DNA repair

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Koskinen, M.; Štětina, R.; Vodičková, L.; Kuricová, M.; Hemminki, K.

    2002-01-01

    Roč. 10, č. 1 (2002), s. 322 ISSN 1107-3756. [World Congress on Advances in Oncology /7./ and International Symposium on Molecular Medicine /5./. Hersonissos, 10.10.2002-12.10.2002] R&D Projects: GA ČR GA310/01/0802 Institutional research plan: CEZ:AV0Z5039906 Keywords : DNA adducts Subject RIV: FM - Hygiene Impact factor: 2.063, year: 2002

  17. Role of DNA conformation & energetic insights in Msx-1-DNA recognition as revealed by molecular dynamics studies on specific and nonspecific complexes.

    Science.gov (United States)

    Kachhap, Sangita; Singh, Balvinder

    2015-01-01

    In most of homeodomain-DNA complexes, glutamine or lysine is present at 50th position and interacts with 5th and 6th nucleotide of core recognition region. Molecular dynamics simulations of Msx-1-DNA complex (Q50-TG) and its variant complexes, that is specific (Q50K-CC), nonspecific (Q50-CC) having mutation in DNA and (Q50K-TG) in protein, have been carried out. Analysis of protein-DNA interactions and structure of DNA in specific and nonspecific complexes show that amino acid residues use sequence-dependent shape of DNA to interact. The binding free energies of all four complexes were analysed to define role of amino acid residue at 50th position in terms of binding strength considering the variation in DNA on stability of protein-DNA complexes. The order of stability of protein-DNA complexes shows that specific complexes are more stable than nonspecific ones. Decomposition analysis shows that N-terminal amino acid residues have been found to contribute maximally in binding free energy of protein-DNA complexes. Among specific protein-DNA complexes, K50 contributes more as compared to Q50 towards binding free energy in respective complexes. The sequence dependence of local conformation of DNA enables Q50/Q50K to make hydrogen bond with nucleotide(s) of DNA. The changes in amino acid sequence of protein are accommodated and stabilized around TAAT core region of DNA having variation in nucleotides.

  18. DNA dynamics play a role as a basal transcription factor in the positioning and regulation of gene transcription initiation

    OpenAIRE

    Alexandrov, Boian S.; Gelev, Vladimir; Yoo, Sang Wook; Alexandrov, Ludmil B.; Fukuyo, Yayoi; Bishop, Alan R.; Rasmussen, Kim ?.; Usheva, Anny

    2009-01-01

    We assess the role of DNA breathing dynamics as a determinant of promoter strength and transcription start site (TSS) location. We compare DNA Langevin dynamic profiles of representative gene promoters, calculated with the extended non-linear PBD model of DNA with experimental data on transcription factor binding and transcriptional activity. Our results demonstrate that DNA dynamic activity at the TSS can be suppressed by mutations that do not affect basal transcription factor binding–DNA co...

  19. Role of complex formation in the photosensitized degradation of DNA induced by N'-formylkynurenine

    International Nuclear Information System (INIS)

    Walrant, P.; Santus, R.; Charlier, M.

    1976-01-01

    N'-Formylkynurenine derivatives efficiently bind to DNA or polynucleotides. Homopolynucleotides and DNA displayed marked differences in the binding process. Association constants were derived which indicated that the oxidized indole ring is more strongly bound to DNA than the unoxidized one. Irradiation of such complexes with wavelengths greater than 320 nm induced pyrimidine dimer formation as well as DNA chain breaks. Complex formation is shown to play an important role in these photosensitized reactions. The photodynamic action of N-formylkynurenine on DNA constituents was negligible at neutral pH but guanine and xanthine derivatives were sensitizable at higher pH. Thymine dimer splitting can occur in aggregated frozen aqueous solutions of N'-formylkynurenine and thymine dimer but this photosensitized splitting was negligible in liquid solutions at room temperature. (author)

  20. The role of RNase H2 in processing ribonucleotides incorporated during DNA replication.

    Science.gov (United States)

    Williams, Jessica S; Gehle, Daniel B; Kunkel, Thomas A

    2017-05-01

    Saccharomyces cerevisiae RNase H2 resolves RNA-DNA hybrids formed during transcription and it incises DNA at single ribonucleotides incorporated during nuclear DNA replication. To distinguish between the roles of these two activities in maintenance of genome stability, here we investigate the phenotypes of a mutant of yeast RNase H2 (rnh201-RED; ribonucleotide excision defective) that retains activity on RNA-DNA hybrids but is unable to cleave single ribonucleotides that are stably incorporated into the genome. The rnh201-RED mutant was expressed in wild type yeast or in a strain that also encodes a mutant allele of DNA polymerase ε (pol2-M644G) that enhances ribonucleotide incorporation during DNA replication. Similar to a strain that completely lacks RNase H2 (rnh201Δ), the pol2-M644G rnh201-RED strain exhibits replication stress and checkpoint activation. Moreover, like its null mutant counterpart, the double mutant pol2-M644G rnh201-RED strain and the single mutant rnh201-RED strain delete 2-5 base pairs in repetitive sequences at a high rate that is topoisomerase 1-dependent. The results highlight an important role for RNase H2 in maintaining genome integrity by removing single ribonucleotides incorporated during DNA replication. Published by Elsevier B.V.

  1. The Role of Mitochondrial DNA in Mediating Alveolar Epithelial Cell Apoptosis and Pulmonary Fibrosis

    Science.gov (United States)

    Kim, Seok-Jo; Cheresh, Paul; Jablonski, Renea P.; Williams, David B.; Kamp, David W.

    2015-01-01

    Convincing evidence has emerged demonstrating that impairment of mitochondrial function is critically important in regulating alveolar epithelial cell (AEC) programmed cell death (apoptosis) that may contribute to aging-related lung diseases, such as idiopathic pulmonary fibrosis (IPF) and asbestosis (pulmonary fibrosis following asbestos exposure). The mammalian mitochondrial DNA (mtDNA) encodes for 13 proteins, including several essential for oxidative phosphorylation. We review the evidence implicating that oxidative stress-induced mtDNA damage promotes AEC apoptosis and pulmonary fibrosis. We focus on the emerging role for AEC mtDNA damage repair by 8-oxoguanine DNA glycosylase (OGG1) and mitochondrial aconitase (ACO-2) in maintaining mtDNA integrity which is important in preventing AEC apoptosis and asbestos-induced pulmonary fibrosis in a murine model. We then review recent studies linking the sirtuin (SIRT) family members, especially SIRT3, to mitochondrial integrity and mtDNA damage repair and aging. We present a conceptual model of how SIRTs modulate reactive oxygen species (ROS)-driven mitochondrial metabolism that may be important for their tumor suppressor function. The emerging insights into the pathobiology underlying AEC mtDNA damage and apoptosis is suggesting novel therapeutic targets that may prove useful for the management of age-related diseases, including pulmonary fibrosis and lung cancer. PMID:26370974

  2. Genomic survey, gene expression analysis and structural modeling suggest diverse roles of DNA methyltransferases in legumes.

    Directory of Open Access Journals (Sweden)

    Rohini Garg

    Full Text Available DNA methylation plays a crucial role in development through inheritable gene silencing. Plants possess three types of DNA methyltransferases (MTases, namely Methyltransferase (MET, Chromomethylase (CMT and Domains Rearranged Methyltransferase (DRM, which maintain methylation at CG, CHG and CHH sites. DNA MTases have not been studied in legumes so far. Here, we report the identification and analysis of putative DNA MTases in five legumes, including chickpea, soybean, pigeonpea, Medicago and Lotus. MTases in legumes could be classified in known MET, CMT, DRM and DNA nucleotide methyltransferases (DNMT2 subfamilies based on their domain organization. First three MTases represent DNA MTases, whereas DNMT2 represents a transfer RNA (tRNA MTase. Structural comparison of all the MTases in plants with known MTases in mammalian and plant systems have been reported to assign structural features in context of biological functions of these proteins. The structure analysis clearly specified regions crucial for protein-protein interactions and regions important for nucleosome binding in various domains of CMT and MET proteins. In addition, structural model of DRM suggested that circular permutation of motifs does not have any effect on overall structure of DNA methyltransferase domain. These results provide valuable insights into role of various domains in molecular recognition and should facilitate mechanistic understanding of their function in mediating specific methylation patterns. Further, the comprehensive gene expression analyses of MTases in legumes provided evidence of their role in various developmental processes throughout the plant life cycle and response to various abiotic stresses. Overall, our study will be very helpful in establishing the specific functions of DNA MTases in legumes.

  3. Understanding DNA Under Oxidative Stress and Sensitization: The Role of Molecular Modeling

    Directory of Open Access Journals (Sweden)

    Antonio eMonari

    2015-07-01

    Full Text Available DNA is constantly exposed to damaging threats coming from oxidative stress, i.e. from the presence of free radicals and reactive oxygen species. Sensitization from exogenous and endogenous compounds that strongly enhance the frequency of light-induced lesions also plays an important role. The experimental determination of DNA lesions, though a difficult subject, is somehow well established and allows to elucidate even extremely rare DNA lesions. In parallel, molecular modeling has become fundamental to clearly understand the fine mechanisms related to DNA defects induction. Indeed, it offers an unprecedented possibility to get access to an atomistic or even electronic resolution. Ab initio molecular dynamics may also describe the time-evolution of the molecular system and its reactivity. Yet the modeling of DNA (photo-reactions does necessitate elaborate multi-scale methodologies to tackle a damage induction reactivity that takes place in a complex environment. The double-stranded DNA environment is first characterized by a very high flexibility, that dynamical effects are to be taken into account, but also a strongly inhomogeneous electrostatic embedding. Additionally, one aims at capturing more subtle effects, such as the sequence selectivity which is of critical important for DNA damage. The structure and dynamics of the DNA/sensitizers complexes, as well as the photo-induced electron- and energy-transfer phenomena taking place upon sensitization, should be carefully modeled. Finally the factors inducing different repair ratios for different lesions should also be rationalized.In this review we will critically analyze the different computational strategies used to model DNA lesions. A clear picture of the complex interplay between reactivity and structural factors will be sketched. The use of proper multi-scale modeling leads to the in-depth comprehension of DNA lesions mechanism and also to the rational design of new chemo-therapeutic agents.

  4. A Major Role of DNA Polymerase δ in Replication of Both the Leading and Lagging DNA Strands.

    Science.gov (United States)

    Johnson, Robert E; Klassen, Roland; Prakash, Louise; Prakash, Satya

    2015-07-16

    Genetic studies with S. cerevisiae Polδ (pol3-L612M) and Polε (pol2-M644G) mutant alleles, each of which display a higher rate for the generation of a specific mismatch, have led to the conclusion that Polε is the primary leading strand replicase and that Polδ is restricted to replicating the lagging strand template. Contrary to this widely accepted view, here we show that Polδ plays a major role in the replication of both DNA strands, and that the paucity of pol3-L612M-generated errors on the leading strand results from their more proficient removal. Thus, the apparent lack of Polδ contribution to leading strand replication is due to differential mismatch removal rather than differential mismatch generation. Altogether, our genetic studies with Pol3 and Pol2 mutator alleles support the conclusion that Polδ, and not Polε, is the major DNA polymerase for carrying out both leading and lagging DNA synthesis. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. DNA interstrand cross-link repair: understanding role of Fanconi anemia pathway and therapeutic implications.

    Science.gov (United States)

    Shukla, Pallavi; Solanki, Avani; Ghosh, Kanjaksha; Vundinti, Babu Rao

    2013-11-01

    Interstrand cross-links (ICLs) are extremely toxic DNA lesions that prevent DNA double-helix separation due to the irreversible covalent linkage binding of some agents on DNA strands. Agents that induce these ICLs are thus widely used as chemotherapeutic drugs but may also lead to tumor growth. Fanconi anemia (FA) is a rare genetic disorder that leads to ICL sensitivity. This review provides update on current understanding of the role of FA proteins in repairing ICLs at various stages of cell cycle. We also discuss link between DNA cross-link genotoxicity caused by aldehydes in FA pathway. Besides this, we summarize various ICL agents that act as drugs to treat different types of tumors and highlight strategies for modulating ICL sensitivity for therapeutic interventions that may be helpful in controlling cancer and life-threatening disease, FA. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Roles of genes and Alu repeats in nonlinear correlations of HUMHBB DNA sequence

    International Nuclear Information System (INIS)

    Xiao Yi; Huang Yanzhao

    2004-01-01

    DNA sequences of different species and different portion of the DNA of the same species may have completely different correlation properties, but the origin of these correlations is still not very clear and is currently being investigated, especially in different particular cases. We report here a study of the DNA sequence of human beta globin region (HUMHBB) which has strong linear and nonlinear correlations. We studied the roles of two of the typical elements of DNA sequence, genes and Alu repeats, in the nonlinear correlations of HUMHBB. We find that there exist strong nonlinear correlations between the exons or introns in different genes and between the Alu repeats. They may be one of the major sources of the nonlinear correlations in HUMBHB

  7. Senataxin plays an essential role with DNA damage response proteins in meiotic recombination and gene silencing.

    Directory of Open Access Journals (Sweden)

    Olivier J Becherel

    2013-04-01

    Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.

  8. The role of proteins and metal ions in the protection of chromatin DNA at fast neutrons action

    International Nuclear Information System (INIS)

    Radu, L.; Preoteasa, V.; Radulescu, I.; Constantinescu, B.

    1997-01-01

    The role of chromatin proteins and of some ions on the fast neutrons actions on chromatin DNA from rat Walker tumors was analysed. The DNA in chromatin is effectively protected against fast neutrons actions by DNA bound proteins and specially by histones, because of the limited accessibility of the condensed chromatin DNA to hydroxyl radicals and of the scavenging of radicals by the chromatin proteins. The ions utilised protect chromatin DNA against the damage produced ed by fast neutrons, through the induction of structural DNA changes with a less accessibility to OH radicals. (authors)

  9. Unsolved mystery: the role of BRCA1 in DNA end-joining

    International Nuclear Information System (INIS)

    Saha, Janapriya; Davis, Anthony J.

    2016-01-01

    Heritable mutations in the tumor suppressor gene BRCA1 increase a woman's lifetime risk of developing breast and ovarian cancer. BRCA1's tumor suppressor function is directly linked to its myriad of functions in the cellular response to DNA double-strand breaks (DSBs). BRCA1 interacts with an extensive array of DNA damage responsive proteins and plays important roles in DSB repair, mediated by the homologous recombination pathway, and in the activation of cell cycle checkpoints. However, the role of BRCA1 in the other two DSB repair pathways, classical non-homologous end-joining (C-NHEJ) and alternative NHEJ (A-NHEJ), remains unclear. In this review, we will discuss the current literature on BRCA1's potential role(s) in modulating both C-NHEJ and A-NHEJ. We also present a model showing that BRCA1 contributes to genomic maintenance by promoting precise DNA repair across all cell cycle phases via the direct modulation of DNA end-joining

  10. Opposing roles of RNF8/RNF168 and deubiquitinating enzymes in ubiquitination-dependent DNA double-strand break response signaling and DNA-repair pathway choice

    International Nuclear Information System (INIS)

    Nakada, Shinichiro

    2016-01-01

    The E3 ubiquitin ligases ring finger protein (RNF) 8 and RNF168 transduce the DNA double-strand break (DSB) response (DDR) signal by ubiquitinating DSB sites. The depletion of RNF8 or RNF168 suppresses the accumulation of DNA-repair regulating factors such as 53BP1 and RAP80 at DSB sites, suggesting roles for RNF8- and RNF168-mediated ubiquitination in DSB repair. This mini-review provides a brief overview of the RNF8- and RNF168-dependent DDR-signaling and DNA-repair pathways. The choice of DNA-repair pathway when RNF8- and RNF168-mediated ubiquitination-dependent DDR signaling is negatively regulated by deubiquitinating enzymes (DUBs) is reviewed to clarify how the opposing roles of RNF8/RNF168 and DUBs regulate ubiquitination-dependent DDR signaling and the choice of DNA-repair pathway

  11. Probing the role of intercalating protein sidechains for kink formation in DNA.

    Directory of Open Access Journals (Sweden)

    Achim Sandmann

    Full Text Available Protein binding can induce DNA kinks, which are for example important to enhance the specificity of the interaction and to facilitate the assembly of multi protein complexes. The respective proteins frequently exhibit amino acid sidechains that intercalate between the DNA base steps at the site of the kink. However, on a molecular level there is only little information available about the role of individual sidechains for kink formation. To unravel structural principles of protein-induced DNA kinking we have performed molecular dynamics (MD simulations of five complexes that varied in their architecture, function, and identity of intercalated residues. Simulations were performed for the DNA complexes of wildtype proteins (Sac7d, Sox-4, CcpA, TFAM, TBP and for mutants, in which the intercalating residues were individually or combined replaced by alanine. The work revealed that for systems with multiple intercalated residues, not all of them are necessarily required for kink formation. In some complexes (Sox-4, TBP, one of the residues proved to be essential for kink formation, whereas the second residue has only a very small effect on the magnitude of the kink. In other systems (e.g. Sac7d each of the intercalated residues proved to be individually capable of conferring a strong kink suggesting a partially redundant role of the intercalating residues. Mutation of the key residues responsible for kinking either resulted in stable complexes with reduced kink angles or caused conformational instability as evidenced by a shift of the kink to an adjacent base step. Thus, MD simulations can help to identify the role of individual inserted residues for kinking, which is not readily apparent from an inspection of the static structures. This information might be helpful for understanding protein-DNA interactions in more detail and for designing proteins with altered DNA binding properties in the future.

  12. The potential role for use of mitochondrial DNA copy number as predictive biomarker in presbycusis.

    Science.gov (United States)

    Falah, Masoumeh; Houshmand, Massoud; Najafi, Mohammad; Balali, Maryam; Mahmoudian, Saeid; Asghari, Alimohamad; Emamdjomeh, Hessamaldin; Farhadi, Mohammad

    2016-01-01

    Age-related hearing impairment, or presbycusis, is the most common communication disorder and neurodegenerative disease in the elderly. Its prevalence is expected to increase, due to the trend of growth of the elderly population. The current diagnostic test for detection of presbycusis is implemented after there has been a change in hearing sensitivity. Identification of a pre-diagnostic biomarker would raise the possibility of preserving hearing sensitivity before damage occurs. Mitochondrial dysfunction, including the production of reactive oxygen species and induction of expression of apoptotic genes, participates in the progression of presbycusis. Mitochondrial DNA sequence variation has a critical role in presbycusis. However, the nature of the relationship between mitochondrial DNA copy number, an important biomarker in many other diseases, and presbycusis is undetermined. Fifty-four subjects with presbycusis and 29 healthy controls were selected after ear, nose, throat examination and pure-tone audiometry. DNA was extracted from peripheral blood samples. The copy number of mitochondrial DNA relative to the nuclear genome was measured by quantitative real-time polymerase chain reaction. Subjects with presbycusis had a lower median mitochondrial DNA copy number than healthy subjects and the difference was statistically significant ( P =0.007). Mitochondrial DNA copy number was also significantly associated with degree of hearing impairment ( P =0.025) and audiogram configuration ( P =0.022). The findings of this study suggest that lower mitochondrial DNA copy number is responsible for presbycusis through alteration of mitochondrial function. Moreover, the significant association of mitochondrial DNA copy number in peripheral blood samples with the degree of hearing impairment and audiogram configuration has potential for use as a standard test for presbycusis, providing the possibility of the development of an easy-to-use biomarker for the early detection of

  13. Divergent Roles of RPA Homologs of the Model Archaeon Halobacterium salinarum in Survival of DNA Damage.

    Science.gov (United States)

    Evans, Jessica J; Gygli, Patrick E; McCaskill, Julienne; DeVeaux, Linda C

    2018-04-20

    The haloarchaea are unusual in possessing genes for multiple homologs to the ubiquitous single-stranded DNA binding protein (SSB or replication protein A, RPA) found in all three domains of life. Halobacterium salinarum contains five homologs: two are eukaryotic in organization, two are prokaryotic and are encoded on the minichromosomes, and one is uniquely euryarchaeal. Radiation-resistant mutants previously isolated show upregulation of one of the eukaryotic-type RPA genes. Here, we have created deletions in the five RPA operons. These deletion mutants were exposed to DNA-damaging conditions: ionizing radiation, UV radiation, and mitomycin C. Deletion of the euryarchaeal homolog, although not lethal as in Haloferax volcanii , causes severe sensitivity to all of these agents. Deletion of the other RPA/SSB homologs imparts a variable sensitivity to these DNA-damaging agents, suggesting that the different RPA homologs have specialized roles depending on the type of genomic insult encountered.

  14. Evaluating the role of mitochondrial DNA variation to the genetic predisposition to radiation-induced toxicity

    International Nuclear Information System (INIS)

    Fachal, Laura; Mosquera-Miguel, Ana; Gómez-Caamaño, Antonio; Sánchez-García, Manuel; Calvo, Patricia; Lobato-Busto, Ramón; Salas, Antonio; Vega, Ana

    2014-01-01

    Background and purpose: Mitochondrial DNA common variants have been reported to be associated with the development of radiation-induced toxicity. Using a large cohort of patients, we aimed to validate these findings by investigating the potential role of common European mitochondrial DNA SNPs (mtSNPs) to the development of radio-toxicity. Material and methods: Overall acute and late toxicity data were assessed in a cohort of 606 prostate cancer patients by means of Standardized Total Average Toxicity (STAT) score. We carried out association tests between radiation toxicity and a selection of 15 mtSNPs (and the haplogroups defined by them). Results: Statistically significant association between mtSNPs and haplogroups with toxicity could not be validated in our Spanish cohort. Conclusions: The present study suggests that the mtDNA common variants analyzed are not associated with clinically relevant increases in risk of overall radiation-induced toxicity in prostate cancer patients

  15. Role of the inhibitors of angiotensin renin system on the DNA integrity of irradiated spermatozoids

    International Nuclear Information System (INIS)

    Spadella, Maria A.; Mansano, Naira S.; Schwarz, Franciele C.; Viani, Gustavo A.; Chies, Agnaldo B.

    2016-01-01

    Radiation action in the testes can significantly affect the reproductive capacity due to oxidative stress generated; phenomenon in which there is evidence of involvement of the Renin Angiotensin System (RAS). This study evaluated the role of AT1 receptor inhibitors, in mitigating the radioinduced DNA damage sperm from semen samples left vas deferens. Male Wistar rats were divided into six experimental groups: Control, 5Gy, Telmisartan (12mg/kg/day) and Losartan (34mg/kg/2x/day), 5 Gy + Telmisartan and 5 Gy + Losartan. The results showed increase in the percentage of sperm with fragmented DNA in irradiated groups when compared to controls, which was not reversed in the irradiated and treated groups. The radiation of 5Gy (single dose) affected the DNA-protein complex of the sperm and the treatments did not influence in reversing this damage, considering the experimental protocol used. (author)

  16. The DNA electronic specific heat at low temperature: The role of aperiodicity

    Energy Technology Data Exchange (ETDEWEB)

    Sarmento, R.G. [Departamento de Física, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Mendes, G.A. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Vasconcelos, M.S. [Escola de Ciências e Tecnologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal, RN (Brazil); Ujsághy, O. [Department of Theoretical Physics and Condensed Matter Research Group of the Hungarian Academy of Sciences, Budapest University of Technology and Economics, Budafoki út 8, H-1521 Budapest (Hungary); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza, CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza, CE (Brazil)

    2012-07-16

    The electronic specific heat spectra at constant volume (C{sub V}) of a long-range correlated extended ladder model, mimicking a DNA molecule, is theoretically analyzed for a stacked array of a double-stranded structure made up from the nucleotides guanine G, adenine A, cytosine C and thymine T. The role of the aperiodicity on C{sub V} is discussed, considering two different nucleotide arrangements with increasing disorder, namely the Fibonacci and the Rudin–Shapiro quasiperiodic structures. Comparisons are made for different values of the band fillings, considering also a finite segment of natural DNA, as part of the human chromosome Ch22. -- Highlights: ► Quasiperiodic sequence to mimic the DNA nucleotides arrangement. ► Electronic tight-binding Hamiltonian model. ► Electronic density of states. ► Electronic specific heat spectra.

  17. Concordant and opposite roles of DNA-PK and the "facilitator of chromatin transcription" (FACT in DNA repair, apoptosis and necrosis after cisplatin

    Directory of Open Access Journals (Sweden)

    Calkins Anne S

    2011-06-01

    Full Text Available Abstract Background Platinum-containing chemotherapy produces specific DNA damage and is used to treat several human solid tumors. Tumors initially sensitive to platinum-based drugs frequently become resistant. Inhibition of DNA repair is a potential strategy to enhance cisplatin effectiveness. After cisplatin treatment, a balance between repair and apoptosis determines whether cancer cells proliferate or die. DNA-dependent protein kinase (DNA-PK binds to DNA double strand breaks (DSBs through its Ku subunits and initiates non-homologous end joining. Inhibition of DNA-PK sensitizes cancer cells to cisplatin killing. The goal of this study is to elucidate the mechanism underlying the effects of DNA-PK on cisplatin sensitivity. Results Silencing the expression of the catalytic subunit of DNA-PK (DNA-PKcs increased sensitivity to cisplatin and decreased the appearance of γH2AX after cisplatin treatment. We purified DNA-PK by its Ku86 subunit and identified interactors by tandem mass spectrometry before and after cisplatin treatment. The structure specific recognition protein 1 (SSRP1, Spt16 and γH2AX appeared in the Ku86 complex 5 hours after cisplatin treatment. SSRP1 and Spt16 form the facilitator of chromatin transcription (FACT. The cisplatin-induced association of FACT with Ku86 and γH2AX was abrogated by DNase treatment. In living cells, SSRP1 and Ku86 were recruited at sites of DSBs induced by laser beams. Silencing SSRP1 expression increased sensitivity to cisplatin and decreased γH2AX appearance. However, while silencing SSRP1 in cisplatin-treated cells increased both apoptosis and necrosis, DNA-PKcs silencing, in contrast, favored necrosis over apoptosis. Conclusions DNA-PK and FACT both play roles in DNA repair. Therefore both are putative targets for therapeutic inhibition. Since DNA-PK regulates apoptosis, silencing DNA-PKcs redirects cells treated with cisplatin toward necrosis. Silencing FACT however, allows both apoptosis and

  18. Role of oxidative stress and DNA hydroxymethylation in the neurotoxicity of fine particulate matter

    International Nuclear Information System (INIS)

    Wei, Hongying; Feng, Yan; Liang, Fan; Cheng, Wei; Wu, Xiaomeng; Zhou, Ren; Wang, Yan

    2017-01-01

    Highlights: • Oxidative stress-mediated neurocytotoxicity and DNA hydroxymethylation abnormalities involved in neuronal pathology of PM 2.5 . • PM 2.5 particles and toxic compounds adsorbed on the particle caused different types of neurocytotoxicity. • DNA hydroxymethylation abnormalities participated in PM 2.5 -induced impairments in neurite outgrowth and synapse formation. - Abstract: Epidemiological studies have implicated fine particulate matter (PM 2.5 ) as a risk factor for neurodegenerative diseases and neurodevelopmental disorders. However, the underlying molecular mechanisms and the influences of different components remain largely elusive. Here, we extended our previous work to investigate the role of oxidative stress and DNA hydroxymethylation in neuronal pathology of PM 2.5 . We found PM 2.5 and its extracts (water-soluble extracts, organic extracts and carbon core component) differentially caused cell cycle arrest, cell apoptosis and the cell proliferation inhibition in neuronal cells. These effects were mechanistically related to each other and oxidative stress, suggesting PM 2.5 and toxic compounds adsorbed on the particles may cause different types of brain damages. In addition, PM 2.5 and its organic extracts increased global DNA hydroxymethylation and gene-specific DNA hydroxymethylation of neuronal genes, and subsequently interfered with their mRNA expression. The impairments in neuronal progression characterized with decreased length of neurite and reduced mRNA expression of neuronal markers and synaptic markers. The blocking effects of antioxidants demonstrated the involvement of oxidative stress-mediated hydroxymethylation abnormalities in PM 2.5 -induced defects in neurite outgrowth and synapse formation. Our results first revealed the role of oxidative stress-mediated abnormal DNA hydroxymethylation in neuronal impairments of PM 2.5 , and thoroughly evaluated the neurocytotoxicity of different components.

  19. Role of geometrical shape in like-charge attraction of DNA.

    Science.gov (United States)

    Kuron, Michael; Arnold, Axel

    2015-03-01

    While the phenomenon of like-charge attraction of DNA is clearly observed experimentally and in simulations, mean-field theories fail to predict it. Kornyshev et al. argued that like-charge attraction is due to DNA's helical geometry and hydration forces. Strong-coupling (SC) theory shows that attraction of like-charged rods is possible through ion correlations alone at large coupling parameters, usually by multivalent counterions. However for SC theory to be applicable, counterion-counterion correlations perpendicular to the DNA strands need to be sufficiently small, which is not a priori the case for DNA even with trivalent counterions. We study a system containing infinitely long DNA strands and trivalent counterions by computer simulations employing varying degrees of coarse-graining. Our results show that there is always attraction between the strands, but its magnitude is indeed highly dependent on the specific shape of the strand. While discreteness of the charge distribution has little influence on the attractive forces, the role of the helical charge distribution is considerable: charged rods maintain a finite distance in equilibrium, while helices collapse to close contact with a phase shift of π, in full agreement with SC predictions. The SC limit is applicable because counterions strongly bind to the charged sites of the helices, so that helix-counterion interactions dominate over counterion-counterion interactions. Thus DNA's helical geometry is not crucial for like-charge DNA attraction, but strongly enhances it, and electrostatic interactions in the strong-coupling limit are sufficient to explain this attraction.

  20. Exploring the roles of DNA methylation in the metal-reducing bacterium Shewanella oneidensis MR-1

    Energy Technology Data Exchange (ETDEWEB)

    Bendall, Matthew L. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Luong, Khai [Pacific Biosciences, Menlo Park, CA (United States); Wetmore, Kelly M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Blow, Matthew [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Korlach, Jonas [Pacific Biosciences, Menlo Park, CA (United States); Deutschbauer, Adam [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Malmstrom, Rex [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2013-08-30

    We performed whole genome analyses of DNA methylation in Shewanella 17 oneidensis MR-1 to examine its possible role in regulating gene expression and 18 other cellular processes. Single-Molecule Real Time (SMRT) sequencing 19 revealed extensive methylation of adenine (N6mA) throughout the 20 genome. These methylated bases were located in five sequence motifs, 21 including three novel targets for Type I restriction/modification enzymes. The 22 sequence motifs targeted by putative methyltranferases were determined via 23 SMRT sequencing of gene knockout mutants. In addition, we found S. 24 oneidensis MR-1 cultures grown under various culture conditions displayed 25 different DNA methylation patterns. However, the small number of differentially 26 methylated sites could not be directly linked to the much larger number of 27 differentially expressed genes in these conditions, suggesting DNA methylation is 28 not a major regulator of gene expression in S. oneidensis MR-1. The enrichment 29 of methylated GATC motifs in the origin of replication indicate DNA methylation 30 may regulate genome replication in a manner similar to that seen in Escherichia 31 coli. Furthermore, comparative analyses suggest that many 32 Gammaproteobacteria, including all members of the Shewanellaceae family, may 33 also utilize DNA methylation to regulate genome replication.

  1. The role of the Fanconi anemia pathway in DNA repair and maintenance of genome stability

    Directory of Open Access Journals (Sweden)

    Aleksandra M. Koczorowska

    2014-05-01

    Full Text Available The Fanconi anemia (FA pathway is one of the DNA repair systems involved in removal of DNA crosslinks. Proteins which belong to this pathway are crucial to the protection of genetic information, whereas disturbances in their function have serious implications for the whole organism. Biallelic mutations in FA genes are the cause of Fanconi anemia – a genetic disease which manifests itself through numerous congenital abnormalities, chromosomal instability and increased predisposition to cancer. The FA pathway is composed of fifteen proteins. Eight of them, in the presence of DNA interstrand crosslinks (ICLs, form a nuclear core complex responsible for monoubiquitination of FANCD2 and FANCI, which is a key step of ICL repair. FA proteins which are not involved in the monoubiquitination step participate in repair of DNA double strand breaks via homologous recombination. Some of the FA proteins, besides having a direct role in the repair of DNA damage, are engaged in replication, cell cycle control and mitosis. The unperturbed course of those processes determines the maintenance of genome stability.

  2. DNA Phosphorothioate Modification Plays a Role in Peroxides Resistance in Streptomyces lividans

    Directory of Open Access Journals (Sweden)

    Daofeng Dai

    2016-08-01

    Full Text Available DNA phosphorothioation, conferred by dnd genes, was originally discovered in the soil-dwelling bacterium Streptomyces lividans, and thereafter found to exist in various bacterial genera. However, the physiological significance of this sulfur modification of the DNA backbone remains unknown in S. lividans. Our studies indicate that DNA phosphorothioation has a major role in resistance to oxidative stress in the strain. Although Streptomyces species express multiple catalase/peroxidase and organic hydroperoxide resistance genes to protect them against peroxide damage, a wild type strain of S. lividans exhibited two-fold to 10-fold higher survival, compared to a dnd- mutant, following treatment with peroxides. RNA-seq experiments revealed that, catalase and organic hydroperoxide resistance gene expression were not up-regulated in the wild type strain, suggesting that the resistance to oxidative stress was not due to the up-regulation of these genes by DNA phosphorothioation. Quantitative RT-PCR analysis was conducted to trace the expression of the catalase and the organic hydroperoxide resistance genes after peroxides treatments. A bunch of these genes were activated in the dnd- mutant rather than the wild type strain in response to peroxides. Moreover, the organic hydroperoxide peracetic acid was scavenged more rapidly in the presence than in the absence of phosphorothioate modification, both in vivo and in vitro. The dnd gene cluster can be up-regulated by the disulfide stressor diamide. Overall, our observations suggest that DNA phosphorothioate modification functions as a peroxide resistance system in S. lividans.

  3. Regulatory mechanisms of RNA function: emerging roles of DNA repair enzymes.

    Science.gov (United States)

    Jobert, Laure; Nilsen, Hilde

    2014-07-01

    The acquisition of an appropriate set of chemical modifications is required in order to establish correct structure of RNA molecules, and essential for their function. Modification of RNA bases affects RNA maturation, RNA processing, RNA quality control, and protein translation. Some RNA modifications are directly involved in the regulation of these processes. RNA epigenetics is emerging as a mechanism to achieve dynamic regulation of RNA function. Other modifications may prevent or be a signal for degradation. All types of RNA species are subject to processing or degradation, and numerous cellular mechanisms are involved. Unexpectedly, several studies during the last decade have established a connection between DNA and RNA surveillance mechanisms in eukaryotes. Several proteins that respond to DNA damage, either to process or to signal the presence of damaged DNA, have been shown to participate in RNA quality control, turnover or processing. Some enzymes that repair DNA damage may also process modified RNA substrates. In this review, we give an overview of the DNA repair proteins that function in RNA metabolism. We also discuss the roles of two base excision repair enzymes, SMUG1 and APE1, in RNA quality control.

  4. The role of the Zn(II binding domain in the mechanism of E. coli DNA topoisomerase I

    Directory of Open Access Journals (Sweden)

    Tse-Dinh Yuk-Ching

    2002-05-01

    Full Text Available Abstract Background Escherichia coli DNA topoisomerase I binds three Zn(II with three tetracysteine motifs which, together with the 14 kDa C-terminal region, form a 30 kDa DNA binding domain (ZD domain. The 67 kDa N-terminal domain (Top67 has the active site tyrosine for DNA cleavage but cannot relax negatively supercoiled DNA. We analyzed the role of the ZD domain in the enzyme mechanism. Results Addition of purified ZD domain to Top67 partially restored the relaxation activity, demonstrating that covalent linkage between the two domains is not necessary for removal of negative supercoils from DNA. The two domains had similar affinities to ssDNA. However, only Top67 could bind dsDNA with high affinity. DNA cleavage assays showed that the Top67 had the same sequence and structure selectivity for DNA cleavage as the intact enzyme. DNA rejoining also did not require the presence of the ZD domain. Conclusions We propose that during relaxation of negatively supercoiled DNA, Top67 by itself can position the active site tyrosine near the junction of double-stranded and single-stranded DNA for cleavage. However, the interaction of the ZD domain with the passing single-strand of DNA, coupled with enzyme conformational change, is needed for removal of negative supercoils.

  5. Roles of Saccharomyces cerevisiae DNA polymerases Poleta and Polzeta in response to irradiation by simulated sunlight.

    Science.gov (United States)

    Kozmin, Stanislav G; Pavlov, Youri I; Kunkel, Thomas A; Sage, Evelyne

    2003-08-01

    Sunlight causes lesions in DNA that if unrepaired and inaccurately replicated by DNA polymerases yield mutations that result in skin cancer in humans. Two enzymes involved in translesion synthesis (TLS) of UV-induced photolesions are DNA polymerase eta (Poleta) and polymerase zeta (Polzeta), encoded by the RAD30A and REV3 genes, respectively. Previous studies have investigated the TLS roles of these polymerases in human and yeast cells irradiated with monochromatic, short wavelength UVC radiation (254 nm). However, less is known about cellular responses to solar radiation, which is of higher and mixed wavelengths (310-1100 nm) and produces a different spectrum of DNA lesions, including Dewar photoproducts and oxidative lesions. Here we report on the comparative cytotoxic and mutagenic effects of simulated sunlight (SSL) and UVC radiation on yeast wild-type, rad30Delta, rev3Delta and rev3Delta rad30Delta strains. The results with SSL support several previous interpretations on the roles of these two polymerases in TLS of photodimers and (6-4) photoproducts derived from studies with UVC. They further suggest that Poleta participates in the non-mutagenic bypass of SSL-dependent cytosine-containing Dewar photoproducts and 8-oxoguanine, while Polzeta is mainly responsible for the mutagenic bypass of all types of Dewar photoproducts. They also suggest that in the absence of Polzeta, Poleta contributes to UVC- and SSL-induced mutagenesis, possibly by the bypass of photodimers containing deaminated cytosine.

  6. Role of Estrogen and Other Sex Hormones in Brain Aging. Neuroprotection and DNA Repair

    Science.gov (United States)

    Zárate, Sandra; Stevnsner, Tinna; Gredilla, Ricardo

    2017-01-01

    Aging is an inevitable biological process characterized by a progressive decline in physiological function and increased susceptibility to disease. The detrimental effects of aging are observed in all tissues, the brain being the most important one due to its main role in the homeostasis of the organism. As our knowledge about the underlying mechanisms of brain aging increases, potential approaches to preserve brain function rise significantly. Accumulating evidence suggests that loss of genomic maintenance may contribute to aging, especially in the central nervous system (CNS) owing to its low DNA repair capacity. Sex hormones, particularly estrogens, possess potent antioxidant properties and play important roles in maintaining normal reproductive and non-reproductive functions. They exert neuroprotective actions and their loss during aging and natural or surgical menopause is associated with mitochondrial dysfunction, neuroinflammation, synaptic decline, cognitive impairment and increased risk of age-related disorders. Moreover, loss of sex hormones has been suggested to promote an accelerated aging phenotype eventually leading to the development of brain hypometabolism, a feature often observed in menopausal women and prodromal Alzheimer’s disease (AD). Although data on the relation between sex hormones and DNA repair mechanisms in the brain is still limited, various investigations have linked sex hormone levels with different DNA repair enzymes. Here, we review estrogen anti-aging and neuroprotective mechanisms, which are currently an area of intense study, together with the effect they may have on the DNA repair capacity in the brain. PMID:29311911

  7. Emerging critical roles of Fe-S clusters in DNA replication and repair

    Science.gov (United States)

    Fuss, Jill O.; Tsai, Chi-Lin; Ishida, Justin P.; Tainer, John A.

    2015-01-01

    Fe-S clusters are partners in the origin of life that predate cells, acetyl-CoA metabolism, DNA, and the RNA world. The double helix solved the mystery of DNA replication by base pairing for accurate copying. Yet, for genome stability necessary to life, the double helix has equally important implications for damage repair. Here we examine striking advances that uncover Fe-S cluster roles both in copying the genetic sequence by DNA polymerases and in crucial repair processes for genome maintenance, as mutational defects cause cancer and degenerative disease. Moreover, we examine an exciting, controversial role for Fe-S clusters in a third element required for life – the long-range coordination and regulation of replication and repair events. By their ability to delocalize electrons over both Fe and S centers, Fe-S clusters have unbeatable features for protein conformational control and charge transfer via double-stranded DNA that may fundamentally transform our understanding of life, replication, and repair. PMID:25655665

  8. Role of Estrogen and Other Sex Hormones in Brain Aging. Neuroprotection and DNA Repair

    Directory of Open Access Journals (Sweden)

    Sandra Zárate

    2017-12-01

    Full Text Available Aging is an inevitable biological process characterized by a progressive decline in physiological function and increased susceptibility to disease. The detrimental effects of aging are observed in all tissues, the brain being the most important one due to its main role in the homeostasis of the organism. As our knowledge about the underlying mechanisms of brain aging increases, potential approaches to preserve brain function rise significantly. Accumulating evidence suggests that loss of genomic maintenance may contribute to aging, especially in the central nervous system (CNS owing to its low DNA repair capacity. Sex hormones, particularly estrogens, possess potent antioxidant properties and play important roles in maintaining normal reproductive and non-reproductive functions. They exert neuroprotective actions and their loss during aging and natural or surgical menopause is associated with mitochondrial dysfunction, neuroinflammation, synaptic decline, cognitive impairment and increased risk of age-related disorders. Moreover, loss of sex hormones has been suggested to promote an accelerated aging phenotype eventually leading to the development of brain hypometabolism, a feature often observed in menopausal women and prodromal Alzheimer’s disease (AD. Although data on the relation between sex hormones and DNA repair mechanisms in the brain is still limited, various investigations have linked sex hormone levels with different DNA repair enzymes. Here, we review estrogen anti-aging and neuroprotective mechanisms, which are currently an area of intense study, together with the effect they may have on the DNA repair capacity in the brain.

  9. Role of XRCC4 phosphorylation by DNA-PK in the regulation of NHEJ repair pathway of DNA double strand break

    International Nuclear Information System (INIS)

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Kamdar, Radhika P.; Sicheng, Liu; Wanotayan, Rujira; Matsumoto, Yoshihisa

    2014-01-01

    Non-homologous end-joining (NHEJ) is the predominant pathway of DNA double strand breaks in higher eukaryotes and is active throughout the cell cycle. NHEJ repair includes many factors as Ku70/86, DNA-PKcs, XRCC4-Ligase IV complex and XLF (also known as Cernunnos). In these factors, DNA-PKcs acts as central regulator in NHEJ repair. It recruited at the DNA damages site after DNA damage and after association with Ku its kinase activity is activated. It phosphorylates many of important NHEJ proteins in vitro including XRCC4, Ku 70/86, Artemis, and even DNA-PKcs but till now, very less studies have been done to know the role and significance of phosphorylation in the NHEJ repair. Studies by other researchers identified various phosphorylation sites in XRCC4 by DNA-PK using mass spectrometry but these phosphorylation sites were shown to be dispensable for DSB repair. In the present investigation, we identified 3 serine and one new threonine phosphorylation sites in XRCC4 protein by DNA-PK. In vivo phosphorylation at these sites was verified by generating phosphorylation specific antibodies and the requirement for DNA-PK therein was verified by using DNA-PK inhibitor and DNA-PK proficient and deficient cell lines in response to radiation and zeocin treatment. We have also found that phosphorylation at these sites showed dose dependency in response to radiation treatment. The two serine and one threonine phosphorylation site is also biological important as their mutation into alanine significantly elevated radiosensitivity as measured by colony formation assay. Neutral comet assay showed delayed kinetics in DSB repair of these mutants. Furthermore, we have found a protein, with putative DSB repair function, which interacts with domain including the phosphorylation sites.These results indicate that these phosphorylation sites would mediate functional link between XRCC4 and DNA-PK. (author)

  10. DNA polymerases beta and lambda mediate overlapping and independent roles in base excision repair in mouse embryonic fibroblasts.

    Directory of Open Access Journals (Sweden)

    Elena K Braithwaite

    2010-08-01

    Full Text Available Base excision repair (BER is a DNA repair pathway designed to correct small base lesions in genomic DNA. While DNA polymerase beta (pol beta is known to be the main polymerase in the BER pathway, various studies have implicated other DNA polymerases in back-up roles. One such polymerase, DNA polymerase lambda (pol lambda, was shown to be important in BER of oxidative DNA damage. To further explore roles of the X-family DNA polymerases lambda and beta in BER, we prepared a mouse embryonic fibroblast cell line with deletions in the genes for both pol beta and pol lambda. Neutral red viability assays demonstrated that pol lambda and pol beta double null cells were hypersensitive to alkylating and oxidizing DNA damaging agents. In vitro BER assays revealed a modest contribution of pol lambda to single-nucleotide BER of base lesions. Additionally, using co-immunoprecipitation experiments with purified enzymes and whole cell extracts, we found that both pol lambda and pol beta interact with the upstream DNA glycosylases for repair of alkylated and oxidized DNA bases. Such interactions could be important in coordinating roles of these polymerases during BER.

  11. A Role for the Host DNA Damage Response in Hepatitis B Virus cccDNA Formation—and Beyond?

    Directory of Open Access Journals (Sweden)

    Sabrina Schreiner

    2017-05-01

    Full Text Available Chronic hepatitis B virus (HBV infection puts more than 250 million people at a greatly increased risk to develop end-stage liver disease. Like all hepadnaviruses, HBV replicates via protein-primed reverse transcription of a pregenomic (pg RNA, yielding an unusually structured, viral polymerase-linked relaxed-circular (RC DNA as genome in infectious particles. Upon infection, RC-DNA is converted into nuclear covalently closed circular (ccc DNA. Associating with cellular proteins into an episomal minichromosome, cccDNA acts as template for new viral RNAs, ensuring formation of progeny virions. Hence, cccDNA represents the viral persistence reservoir that is not directly targeted by current anti-HBV therapeutics. Eliminating cccDNA will thus be at the heart of a cure for chronic hepatitis B. The low production of HBV cccDNA in most experimental models and the associated problems in reliable cccDNA quantitation have long hampered a deeper understanding of cccDNA molecular biology. Recent advancements including cccDNA-dependent cell culture systems have begun to identify select host DNA repair enzymes that HBV usurps for RC-DNA to cccDNA conversion. While this list is bound to grow, it may represent just one facet of a broader interaction with the cellular DNA damage response (DDR, a network of pathways that sense and repair aberrant DNA structures and in the process profoundly affect the cell cycle, up to inducing cell death if repair fails. Given the divergent interactions between other viruses and the DDR it will be intriguing to see how HBV copes with this multipronged host system.

  12. Identification of Poxvirus Genome Uncoating and DNA Replication Factors with Mutually Redundant Roles.

    Science.gov (United States)

    Liu, Baoming; Panda, Debasis; Mendez-Rios, Jorge D; Ganesan, Sundar; Wyatt, Linda S; Moss, Bernard

    2018-04-01

    Genome uncoating is essential for replication of most viruses. For poxviruses, the process is divided into two stages: removal of the envelope, allowing early gene expression, and breaching of the core wall, allowing DNA release, replication, and late gene expression. Subsequent studies showed that the host proteasome and the viral D5 protein, which has an essential role in DNA replication, are required for vaccinia virus (VACV) genome uncoating. In a search for additional VACV uncoating proteins, we noted a report that described a defect in DNA replication and late expression when the gene encoding a 68-kDa ankyrin repeat/F-box protein (68k-ank), associated with the cellular SCF (Skp1, cullin1, F-box-containing complex) ubiquitin ligase complex, was deleted from the attenuated modified vaccinia virus Ankara (MVA). Here we showed that the 68k-ank deletion mutant exhibited diminished genome uncoating, formation of DNA prereplication sites, and degradation of viral cores as well as an additional, independent defect in DNA synthesis. Deletion of the 68k-ank homolog of VACV strain WR, however, was without effect, suggesting the existence of compensating genes. By inserting VACV genes into an MVA 68k-ank deletion mutant, we discovered that M2, a member of the poxvirus immune evasion (PIE) domain superfamily and a regulator of NF-κB, and C5, a member of the BTB/Kelch superfamily associated with cullin-3-based ligase complexes, independently rescued the 68k-ank deletion phenotype. Thus, poxvirus uncoating and DNA replication are intertwined processes involving at least three viral proteins with mutually redundant functions in addition to D5. IMPORTANCE Poxviruses comprise a family of large DNA viruses that infect vertebrates and invertebrates and cause diseases of medical and zoological importance. Poxviruses, unlike most other DNA viruses, replicate in the cytoplasm, and their large genomes usually encode 200 or more proteins with diverse functions. About 90 genes may

  13. The potential role for use of mitochondrial DNA copy number as predictive biomarker in presbycusis

    Directory of Open Access Journals (Sweden)

    Falah M

    2016-10-01

    Full Text Available Masoumeh Falah,1,2 Massoud Houshmand,3 Mohammad Najafi,2 Maryam Balali,1 Saeid Mahmoudian,1 Alimohamad Asghari,4 Hessamaldin Emamdjomeh,1 Mohammad Farhadi1 1ENT and Head & Neck Research Center and Department, Iran University of Medical Sciences, Tehran, Iran; 2Cellular and Molecular Research Center, Biochemistry Department, Iran University of Medical Sciences, Tehran, Iran; 3Department of Medical Genetics, National Institute for Genetic Engineering and Biotechnology, Tehran, Iran; 4Skull base research center, Iran University of Medical Sciences, Tehran, Iran Objectives: Age-related hearing impairment, or presbycusis, is the most common communication disorder and neurodegenerative disease in the elderly. Its prevalence is expected to increase, due to the trend of growth of the elderly population. The current diagnostic test for detection of presbycusis is implemented after there has been a change in hearing sensitivity. Identification of a pre-diagnostic biomarker would raise the possibility of preserving hearing sensitivity before damage occurs. Mitochondrial dysfunction, including the production of reactive oxygen species and induction of expression of apoptotic genes, participates in the progression of presbycusis. Mitochondrial DNA sequence variation has a critical role in presbycusis. However, the nature of the relationship between mitochondrial DNA copy number, an important biomarker in many other diseases, and presbycusis is undetermined.Methods: Fifty-four subjects with presbycusis and 29 healthy controls were selected after ear, nose, throat examination and pure-tone audiometry. DNA was extracted from peripheral blood samples. The copy number of mitochondrial DNA relative to the nuclear genome was measured by quantitative real-time polymerase chain reaction.Results: Subjects with presbycusis had a lower median mitochondrial DNA copy number than healthy subjects and the difference was statistically significant (P=0.007. Mitochondrial DNA

  14. Emerging roles of the nucleolus in regulating the DNA damage response: the noncanonical DNA repair enzyme APE1/Ref-1 as a paradigmatical example.

    Science.gov (United States)

    Antoniali, Giulia; Lirussi, Lisa; Poletto, Mattia; Tell, Gianluca

    2014-02-01

    An emerging concept in DNA repair mechanisms is the evidence that some key enzymes, besides their role in the maintenance of genome stability, display also unexpected noncanonical functions associated with RNA metabolism in specific subcellular districts (e.g., nucleoli). During the evolution of these key enzymes, the acquisition of unfolded domains significantly amplified the possibility to interact with different partners and substrates, possibly explaining their phylogenetic gain of functions. After nucleolar stress or DNA damage, many DNA repair proteins can freely relocalize from nucleoli to the nucleoplasm. This process may represent a surveillance mechanism to monitor the synthesis and correct assembly of ribosomal units affecting cell cycle progression or inducing p53-mediated apoptosis or senescence. A paradigm for this kind of regulation is represented by some enzymes of the DNA base excision repair (BER) pathway, such as apurinic/apyrimidinic endonuclease 1 (APE1). In this review, the role of the nucleolus and the noncanonical functions of the APE1 protein are discussed in light of their possible implications in human pathologies. A productive cross-talk between DNA repair enzymes and proteins involved in RNA metabolism seems reasonable as the nucleolus is emerging as a dynamic functional hub that coordinates cell growth arrest and DNA repair mechanisms. These findings will drive further analyses on other BER proteins and might imply that nucleic acid processing enzymes are more versatile than originally thought having evolved DNA-targeted functions after a previous life in the early RNA world.

  15. The role of cytosine methylation on charge transport through a DNA strand

    Energy Technology Data Exchange (ETDEWEB)

    Qi, Jianqing, E-mail: jqqi@uw.edu; Anantram, M. P., E-mail: anantmp@uw.edu [Department of Electrical Engineering, University of Washington, Seattle, Washington 98195-2500 (United States); Govind, Niranjan, E-mail: niri.govind@pnnl.gov [William R. Wiley Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

    2015-09-07

    Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.

  16. The role of glutathione in DNA damage by potassium bromate in vitro.

    Science.gov (United States)

    Parsons, J L; Chipman, J K

    2000-07-01

    We have investigated the role of reduced glutathione (GSH) in the genetic toxicity of the rodent renal carcinogen potassium bromate (KBrO(3)). A statistically significant increase in the concentration of 8-oxodeoxyguanosine (8-oxodG) relative to deoxyguanosine was measured following incubation of calf thymus DNA with KBrO(3) and GSH or N-acetylcysteine (NACys). This was dependent on these thiols and was associated with the loss of GSH and production of oxidized glutathione. A short-lived (potassium chlorate (KClO(3)) or potassium iodate (KIO(3)) were used instead of KBrO(3), though GSH depletion also occurred with KIO(3), but not with KClO(3). Other reductants and thiols in combination with KBrO(3) did not cause a significant increase in DNA oxidation. DNA strand breakage was also induced by KBrO(3) in human white blood cells (5 mM) and rat kidney epithelial cells (NRK-52E, 1.5 mM). This was associated with an apparent small depletion of thiols in NRK-52E cells at 15 min and with an elevation of 8-oxodG at a delayed time of 24 h. Depletion of intra-cellular GSH by diethylmaleate in human lymphocytes decreased the amount of strand breakage induced by KBrO(3). Extracellular GSH, however, protected against DNA strand breakage by KBrO(3), possibly due to the inability of the reactive product to enter the cell. In contrast, membrane-permeant NACys enhanced KBrO(3)-induced DNA strand breakage in these cells. DNA damage by KBrO(3) is therefore largely dependent on access to intracellular GSH.

  17. A Role of hIPI3 in DNA Replication Licensing in Human Cells.

    Science.gov (United States)

    Huang, Yining; Amin, Aftab; Qin, Yan; Wang, Ziyi; Jiang, Huadong; Liang, Lu; Shi, Linjing; Liang, Chun

    2016-01-01

    The yeast Ipi3p is required for DNA replication and cell viability in Sacharomyces cerevisiae. It is an essential component of the Rix1 complex (Rix1p/Ipi2p-Ipi1p-Ipi3p) that is required for the processing of 35S pre-rRNA in pre-60S ribosomal particles and for the initiation of DNA replication. The human IPI3 homolog is WDR18 (WD repeat domain 18), which shares significant homology with yIpi3p. Here we report that knockdown of hIPI3 resulted in substantial defects in the chromatin association of the MCM complex, DNA replication, cell cycle progression and cell proliferation. Importantly, hIPI3 silencing did not result in a reduction of the protein level of hCDC6, hMCM7, or the ectopically expressed GFP protein, indicating that protein synthesis was not defective in the same time frame of the DNA replication and cell cycle defects. Furthermore, the mRNA and protein levels of hIPI3 fluctuate in the cell cycle, with the highest levels from M phase to early G1 phase, similar to other pre-replicative (pre-RC) proteins. Moreover, hIPI3 interacts with other replication-initiation proteins, co-localizes with hMCM7 in the nucleus, and is important for the nuclear localization of hMCM7. We also found that hIPI3 preferentially binds to the origins of DNA replication including those at the c-Myc, Lamin-B2 and β-Globin loci. These results indicate that hIPI3 is involved in human DNA replication licensing independent of its role in ribosome biogenesis.

  18. Role of CYP1B1 in PAH-DNA adduct formation and breast cancer risk

    Energy Technology Data Exchange (ETDEWEB)

    Goth-Goldstein, Regine; Russell, Marion L.; Muller, A.P.; Caleffi, M.; Eschiletti, J.; Graudenz, M.; Sohn, Michael D.

    2010-04-01

    This study investigated the hypothesis that increased exposure to polycyclic aromatic hydrocarbons (PAHs) increases breast cancer risk. PAHs are products of incomplete burning of organic matter and are present in cigarette smoke, ambient air, drinking water, and diet. PAHs require metabolic transformation to bind to DNA, causing DNA adducts, which can lead to mutations and are thought to be an important pre-cancer marker. In breast tissue, PAHs appear to be metabolized to their cancer-causing form primarily by the cytochrome P450 enzyme CYP1B1. Because the genotoxic impact of PAH depends on their metabolism, we hypothesized that high CYP1B1 enzyme levels result in increased formation of PAH-DNA adducts in breast tissue, leading to increased development of breast cancer. We have investigated molecular mechanisms of the relationship between PAH exposure, CYP1B1 expression and breast cancer risk in a clinic-based case-control study. We collected histologically normal breast tissue from 56 women (43 cases and 13 controls) undergoing breast surgery and analyzed these specimens for CYP1B1 genotype, PAH-DNA adducts and CYP1B1 gene expression. We did not detect any difference in aromatic DNA adduct levels of cases and controls, only between smokers and non-smokers. CYP1B1 transcript levels were slightly lower in controls than cases, but the difference was not statistically significant. We found no correlation between the levels of CYP1B1 expression and DNA adducts. If CYP1B1 has any role in breast cancer etiology it might be through its metabolism of estrogen rather than its metabolism of PAHs. However, due to the lack of statistical power these results should be interpreted with caution.

  19. Is There Still Any Role for Oxidative Stress in Mitochondrial DNA-Dependent Aging?

    Directory of Open Access Journals (Sweden)

    Gábor Zsurka

    2018-03-01

    Full Text Available Recent deep sequencing data has provided compelling evidence that the spectrum of somatic point mutations in mitochondrial DNA (mtDNA in aging tissues lacks G > T transversion mutations. This fact cannot, however, be used as an argument for the missing contribution of reactive oxygen species (ROS to mitochondria-related aging because it is probably caused by the nucleotide selectivity of mitochondrial DNA polymerase γ (POLG. In contrast to point mutations, the age-dependent accumulation of mitochondrial DNA deletions is, in light of recent experimental data, still explainable by the segregation of mutant molecules generated by the direct mutagenic effects of ROS (in particular, of HO· radicals formed from H2O2 by a Fenton reaction. The source of ROS remains controversial, because the mitochondrial contribution to tissue ROS production is probably lower than previously thought. Importantly, in the discussion about the potential role of oxidative stress in mitochondria-dependent aging, ROS generated by inflammation-linked processes and the distribution of free iron also require careful consideration.

  20. The role of mitochondrial DNA large deletion for the development of presbycusis in Fischer 344 rats.

    Science.gov (United States)

    Yin, Shankai; Yu, Zhiping; Sockalingam, Ravi; Bance, Manohar; Sun, Genlou; Wang, Jian

    2007-09-01

    Age-related hearing loss, or presbycusis, has been associated with large-scale mitochondrial DNA (mtDNA) deletion in previous studies. However, the role of this mtDNA damage in presbycusis is still not clear because the deletion in inner ears has not been measured quantitatively and analyzed in parallel with the time course of presbycusis. In the present study, the deletion was quantified using quantitative real-time PCR (qRT-PCR) in male Fischer 344 rats of different ages. It was found that the deletion increased quickly during young adulthood and reached over 60% at 6 months of age. However, a significant hearing loss was not seen until after 12 months of age. The results suggest that the existence of the deletion per se does not necessarily imply cochlear damage, but rather a critical level of the accumulated deletion seems to precede the hearing loss. The long delay may indicate the involvement of mechanisms other than mtDNA deletion in the development of presbycusis.

  1. Evaluation of Patients with an Apparent False Positive Stool DNA Test: The Role of Repeat Stool DNA Testing.

    Science.gov (United States)

    Cooper, Gregory S; Markowitz, Sanford D; Chen, Zhengyi; Tuck, Missy; Willis, Joseph E; Berger, Barry M; Brenner, Dean E; Li, Li

    2018-03-07

    There is uncertainty as to the appropriate follow-up of patients who test positive on multimarker stool DNA (sDNA) testing and have a colonoscopy without neoplasia. To determine the prevalence of missed colonic or occult upper gastrointestinal neoplasia in patients with an apparent false positive sDNA. We prospectively identified 30 patients who tested positive with a commercially available sDNA followed by colonoscopy without neoplastic lesions. Patients were invited to undergo repeat sDNA at 11-29 months after the initial test followed by repeat colonoscopy and upper endoscopy. We determined the presence of neoplastic lesions on repeat evaluation stratified by results of repeat sDNA. Twelve patients were restudied. Seven patients had a negative second sDNA test and a normal second colonoscopy and upper endoscopy. In contrast, 5 of 12 subjects had a persistently positive second sDNA test, and 3 had positive findings, including a 3-cm sessile transverse colon adenoma with high-grade dysplasia, a 2-cm right colon sessile serrated adenoma with dysplasia, and a nonadvanced colon adenoma (p = 0.045). These corresponded to a positive predictive value of 0.60 (95% CI 0.17-1.00) and a negative predictive value of 1.00 (95% CI 1.00-1.00) for the second sDNA test. In addition, the medical records of all 30 subjects with apparent false positive testing were reviewed and no documented cases of malignant tumors were recorded. Repeat positive sDNA testing may identify a subset of patients with missed or occult colorectal neoplasia after negative colonoscopy for an initially positive sDNA. High-quality colonoscopy with careful attention to the right colon in patients with positive sDNA is critically important and may avoid false negative colonoscopy.

  2. The role of DNA restriction-modification systems in the biology of Bacillus anthracis

    Directory of Open Access Journals (Sweden)

    Ramakrishnan eSitaraman

    2016-01-01

    Full Text Available Restriction-modification (R-M systems are widespread among prokaryotes and, depending on their type, may be viewed as selfish genetic elements that persist as toxin-antitoxin modules or as cellular defense systems against phage infection. Studies in the last decade have made it amply clear that these two options do not exhaust the list of possible biological roles for R-M systems. Their presence in a cell may also have a bearing on other processes such as horizontal gene transfer and gene regulation. From genome sequencing and experimental data, we know that Bacillus anthracis encodes at least three methylation-dependent (typeIV restriction endonucleases, and an orphan DNA methyltransferase. In this article, we first present an outline of our current knowledge of R-M systems in Bacillus anthracis. Based on available DNA sequence data, and on our current understanding of the functions of similar genes in other systems, we conclude with hypotheses on the possible roles of the three restriction endonucleases and the orphan DNA methyltransferase.

  3. Nickel exposure induces oxidative damage to mitochondrial DNA in Neuro2a cells: the neuroprotective roles of melatonin.

    Science.gov (United States)

    Xu, Shang-Cheng; He, Min-Di; Lu, Yong-Hui; Li, Li; Zhong, Min; Zhang, Yan-Wen; Wang, Yuan; Yu, Zheng-Ping; Zhou, Zhou

    2011-11-01

    Recent studies suggest that oxidative stress and mitochondrial dysfunction play important roles in the neurotoxicity of nickel. Because mitochondrial DNA (mtDNA) is highly vulnerable to oxidative stress and melatonin can efficiently protect mtDNA against oxidative damage in various pathological conditions, the aims of this study were to determine whether mtDNA oxidative damage was involved in the neurotoxicity of nickel and to assay the neuroprotective effects of melatonin in mtDNA. In this study, we exposed mouse neuroblastoma cell lines (Neuro2a) to different concentrations of nickel chloride (NiCl(2), 0.125, 0.25, and 0.5 mm) for 24 hr. We found that nickel significantly increased reactive oxygen species (ROS) production and mitochondrial superoxide levels. In addition, nickel exposure increased mitochondrial 8-hydroxyguanine (8-OHdG) content and reduced mtDNA content and mtDNA transcript levels. Consistent with this finding, nickel was found to destroy mtDNA nucleoid structure and decrease protein levels of Tfam, a key protein component for nucleoid organization. However, all the oxidative damage to mtDNA induced by nickel was efficiently attenuated by melatonin pretreatment. Our results suggest that oxidative damage to mtDNA may account for the neurotoxicity of nickel. Melatonin has great pharmacological potential in protecting mtDNA against the adverse effects of nickel in the nervous system. © 2011 John Wiley & Sons A/S.

  4. Role of Chromatin assembly factor 1 in DNA replication of Plasmodium falciparum.

    Science.gov (United States)

    Gupta, Mohit Kumar; Agarawal, Meetu; Banu, Khadija; Reddy, K Sony; Gaur, Deepak; Dhar, Suman Kumar

    2018-01-01

    Nucleosome assembly in P. falciparum could be the key process in maintaining its genomic integrity as DNA replicates more than once per cell cycle during several stages of its life cycle. Here, we report the functional characterization of P. falciparum chromatin assembly factor 1 (CAF1), which interacts with several proteins namely PfCAF2, Histones, PfHP1 and others. Consistent with the above findings, we demonstrate the presence of PfCAF1 at the telomeric repeat regions, central and subtelomeric var genes of multiple var gene family along with PfHP1. Further, we report the upregulation of PfCAF1 after treatment with genotoxic agents like MMS and HU. Together, these findings establish role of PfCAF1 in heterochromatin maintenance and as histone chaperone in nucleosome assembly and DNA damage repair. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. The Role of XPG in Processing (CAGn/(CTGn DNA Hairpins

    Directory of Open Access Journals (Sweden)

    Hou Caixia

    2011-03-01

    Full Text Available Abstract Background During DNA replication or repair, disease-associated (CAGn/(CTGn expansion can result from formation of hairpin structures in the repeat tract of the newly synthesized or nicked DNA strand. Recent studies identified a nick-directed (CAGn/(CTGn hairpin repair (HPR system that removes (CAGn/(CTGn hairpins from human cells via endonucleolytic incisions. Because the process is highly similar to the mechanism by which XPG and XPF endonucleases remove bulky DNA lesions during nucleotide excision repair, we assessed the potential role of XPG in conducting (CAGn/(CTGn HPR. Results To determine if the XPG endonuclease is involved in (CAGn/(CTGn hairpin removal, two XPG-deficient cell lines (GM16024 and AG08802 were examined for their ability to process (CAGn/(CTGn hairpins in vitro. We demonstrated that the GM16024 cell line processes all hairpin substrates as efficiently as HeLa cells, and that the AG08802 cell line is partially defective in HPR. Analysis of repair intermediates revealed that nuclear extracts from both XPG-deficient lines remove CAG/CTG hairpins via incisions, but the incision products are distinct from those generated in HeLa extracts. We also show that purified recombinant XPG protein greatly stimulates HPR in XPG-deficient extracts by promoting an incision 5' to the hairpin. Conclusions Our results strongly suggest that 1 human cells possess multiple pathways to remove (CAGn/(CTGn hairpins located in newly synthesized (or nicked DNA strand; and 2 XPG, although not essential for (CAGn/(CTGn hairpin removal, stimulates HPR by facilitating a 5' incision to the hairpin. This study reveals a novel role for XPG in genome-maintenance and implicates XPG in diseases caused by trinucleotide repeat expansion.

  6. Photoprotective role of epidermal melanin granules against ultraviolet damage and DNA repair in guinea pig skin

    International Nuclear Information System (INIS)

    Ishikawa, T.; Kodama, K.; Matsumoto, J.; Takayama, S.

    1984-01-01

    We previously developed a quantitative autoradiographic technique with special forceps for measuring unscheduled DNA synthesis (UDS) in mouse skin after treatment with ultraviolet light in vivo. By this method, we investigated the relationship between the protective role of melanin and UV-induced DNA repair in black-and-white guinea pigs. Flat areas containing a sharp border between pigmented and unpigmented skin were selected. The skin of the selected areas was shaved and irradiated with short-wave UV (254 nm) or UV-AB (270 to 440 nm, emission peak at 312 nm) at various doses. Immediately after irradiation, the skin was clamped off with forceps, and an isotonic aqueous solution of [methyl- 3 H]thymidine was injected s.c. into the clamped off portion. UDS was clearly demonstrated as silver grains in this portion of the skin after irradiation with 254 nm UV or UV-AB. Errors due to individual differences were avoided by comparing the intensities of UDS in basal cells from pigmented skin and unpigmented skin of the same animals. Unexpectedly, in groups of animals treated with 254 nm UV or UV-AB, no difference in UDS in pigmented and unpigmented skin was seen at any UV dose. These results suggested that epidermal melanin granules do not significantly protect DNA of basal cells against 254 nm UV or UV-AB irradiation. Results of a study on the effect of the wavelength of irradiation on the UDS response of albino guinea pigs are also reported

  7. Role of gene 59 of bacteriophage T4 in repair of uv-irradiated and alkylated DNA in vivo

    International Nuclear Information System (INIS)

    Wu, R.; Wu, J.L.; Yeh, Y.C.

    1975-01-01

    Nonsense mutants in gene 59 (amC5, am HL628) were used to study the role of this gene in the repair of uv-damaged and alkylated DNA of bacteriophage T4 in vivo. The higher sensitivity to uv irradiation and alkylation of gene 59 mutants after exposure to these agents was established by a comparison of the survival fractions with wild type. Zonal centrifugal analysis of both parental and nascent mutant intracellular DNA molecules after uv irradiation showed that immediately after exposure the size of single-stranded DNA fragments was the same as the wild-type intracellular DNA. However, the capability of rejoining fragmented intracellular DNA was greatly reduced in the mutant. In contrast, the wild-type-infected cells under the same condition resumed DNA replication and repaired its DNA to normal size. Methyl methanesulfonate induced more randomly fragmented intracellular DNA, when compared to uv irradiation. The rate of rejoining under these conditions as judged from their sedimentation profiles was also greatly reduced in mutant-infected cells. Further evidence is presented that uv repair is not a simple consequence of arrested DNA replication, which is a phenotype of the mutant when infected in a nonpermissive host, Escherichia coli B(su - ), but rather that the DNA repair function of gene 59 is independent of the replication function. These and other data presented indicate that a product(s) of gene 59 is essential for both repair of uv lesions and repair of alkylation damage of DNA in vivo. It is suggested that gene 59 may have two functions during viral development: DNA replication and replication repair of DNA molecules

  8. DNA-based nanobiostructured devices: The role of quasiperiodicity and correlation effects

    Energy Technology Data Exchange (ETDEWEB)

    Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil); Freire, V.N. [Departamento de Física, Universidade Federal do Ceará, 60455-760, Fortaleza-CE (Brazil); Caetano, E.W.S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531, Fortaleza-CE (Brazil); Lyra, M.L.; Moura, F.A.B.F. de [Instituto de Física, Universidade Federal de Alagoas, 57072-970, Maceió-AL (Brazil)

    2014-02-01

    The purpose of this review is to present a comprehensive and up-to-date account of the main physical properties of DNA-based nanobiostructured devices, stressing the role played by their quasi-periodicity arrangement and correlation effects. Although the DNA-like molecule is usually described as a short-ranged correlated random ladder, artificial segments can be grown following quasiperiodic sequences as, for instance, the Fibonacci and Rudin–Shapiro ones. They have interesting properties like a complex fractal spectra of energy, which can be considered as their indelible mark, and collective properties that are not shared by their constituents. These collective properties are due to the presence of long-range correlations, which are expected to be reflected somehow in their various spectra (electronic transmission, density of states, etc.) defining another description of disorder. Although long-range correlations are responsible for the effective electronic transport at specific resonant energies of finite DNA segments, much of the anomalous spread of an initially localized electron wave-packet can be accounted by short-range pair correlations, suggesting that an approach based on the inclusion of further short-range correlations on the nucleotide distribution leads to an adequate description of the electronic properties of DNA segments. The introduction of defects may generate states within the gap, and substantially improves the conductance, specially of finite branches. They usually become exponentially localized for any amount of disorder, and have the property to tailor the electronic transport properties of DNA-based nanoelectronic devices. In particular, symmetric and antisymmetric correlations have quite distinct influence on the nature of the electronic states, and a diluted distribution of defects lead to an anomalous diffusion of the electronic wave-packet. Nonlinear contributions, arising from the coupling between electrons and the molecular

  9. Mechanism of cluster DNA damage repair in response to high-atomic number and energy particles radiation

    Energy Technology Data Exchange (ETDEWEB)

    Asaithamby, Aroumougame, E-mail: Aroumougame.Asaithamy@UTsouthwestern.edu [Division of Molecular Radiation Biology, Department of Radiation Oncology, University of Texas Southwestern Medical Center at Dallas, Dallas, TX 75390 (United States); Chen, David J., E-mail: David.Chen@UTsouthwestern.edu [Division of Molecular Radiation Biology, Department of Radiation Oncology, University of Texas Southwestern Medical Center at Dallas, Dallas, TX 75390 (United States)

    2011-06-03

    Low-linear energy transfer (LET) radiation (i.e., {gamma}- and X-rays) induces DNA double-strand breaks (DSBs) that are rapidly repaired (rejoined). In contrast, DNA damage induced by the dense ionizing track of high-atomic number and energy (HZE) particles is slowly repaired or is irreparable. These unrepaired and/or misrepaired DNA lesions may contribute to the observed higher relative biological effectiveness for cell killing, chromosomal aberrations, mutagenesis, and carcinogenesis in HZE particle irradiated cells compared to those treated with low-LET radiation. The types of DNA lesions induced by HZE particles have been characterized in vitro and usually consist of two or more closely spaced strand breaks, abasic sites, or oxidized bases on opposing strands. It is unclear why these lesions are difficult to repair. In this review, we highlight the potential of a new technology allowing direct visualization of different types of DNA lesions in human cells and document the emerging significance of live-cell imaging for elucidation of the spatio-temporal characterization of complex DNA damage. We focus on the recent insights into the molecular pathways that participate in the repair of HZE particle-induced DSBs. We also discuss recent advances in our understanding of how different end-processing nucleases aid in repair of DSBs with complicated ends generated by HZE particles. Understanding the mechanism underlying the repair of DNA damage induced by HZE particles will have important implications for estimating the risks to human health associated with HZE particle exposure.

  10. Mechanism of cluster DNA damage repair in response to high-atomic number and energy particles radiation

    International Nuclear Information System (INIS)

    Asaithamby, Aroumougame; Chen, David J.

    2011-01-01

    Low-linear energy transfer (LET) radiation (i.e., γ- and X-rays) induces DNA double-strand breaks (DSBs) that are rapidly repaired (rejoined). In contrast, DNA damage induced by the dense ionizing track of high-atomic number and energy (HZE) particles is slowly repaired or is irreparable. These unrepaired and/or misrepaired DNA lesions may contribute to the observed higher relative biological effectiveness for cell killing, chromosomal aberrations, mutagenesis, and carcinogenesis in HZE particle irradiated cells compared to those treated with low-LET radiation. The types of DNA lesions induced by HZE particles have been characterized in vitro and usually consist of two or more closely spaced strand breaks, abasic sites, or oxidized bases on opposing strands. It is unclear why these lesions are difficult to repair. In this review, we highlight the potential of a new technology allowing direct visualization of different types of DNA lesions in human cells and document the emerging significance of live-cell imaging for elucidation of the spatio-temporal characterization of complex DNA damage. We focus on the recent insights into the molecular pathways that participate in the repair of HZE particle-induced DSBs. We also discuss recent advances in our understanding of how different end-processing nucleases aid in repair of DSBs with complicated ends generated by HZE particles. Understanding the mechanism underlying the repair of DNA damage induced by HZE particles will have important implications for estimating the risks to human health associated with HZE particle exposure.

  11. Role for a region of helically unstable DNA within the Epstein-Barr virus latent cycle origin of DNA replication oriP in origin function

    International Nuclear Information System (INIS)

    Polonskaya, Zhanna; Benham, Craig J.; Hearing, Janet

    2004-01-01

    The minimal replicator of the Epstein-Barr virus (EBV) latent cycle origin of DNA replication oriP is composed of two binding sites for the Epstein-Barr virus nuclear antigen-1 (EBNA-1) and flanking inverted repeats that bind the telomere repeat binding factor TRF2. Although not required for minimal replicator activity, additional binding sites for EBNA-1 and TRF2 and one or more auxiliary elements located to the right of the EBNA-1/TRF2 sites are required for the efficient replication of oriP plasmids. Another region of oriP that is predicted to be destabilized by DNA supercoiling is shown here to be an important functional component of oriP. The ability of DNA fragments of unrelated sequence and possessing supercoiled-induced DNA duplex destabilized (SIDD) structures, but not fragments characterized by helically stable DNA, to substitute for this component of oriP demonstrates a role for the SIDD region in the initiation of oriP-plasmid DNA replication

  12. Mitochondrial DNA (mtDNA) variants in the European haplogroups HV, JT, and U do not have a major role in schizophrenia.

    Science.gov (United States)

    Torrell, Helena; Salas, Antonio; Abasolo, Nerea; Morén, Constanza; Garrabou, Glòria; Valero, Joaquín; Alonso, Yolanda; Vilella, Elisabet; Costas, Javier; Martorell, Lourdes

    2014-10-01

    It has been reported that certain genetic factors involved in schizophrenia could be located in the mitochondrial DNA (mtDNA). Therefore, we hypothesized that mtDNA mutations and/or variants would be present in schizophrenia patients and may be related to schizophrenia characteristics and mitochondrial function. This study was performed in three steps: (1) identification of pathogenic mutations and variants in 14 schizophrenia patients with an apparent maternal inheritance of the disease by sequencing the entire mtDNA; (2) case-control association study of 23 variants identified in step 1 (16 missense, 3 rRNA, and 4 tRNA variants) in 495 patients and 615 controls, and (3) analyses of the associated variants according to the clinical, psychopathological, and neuropsychological characteristics and according to the oxidative and enzymatic activities of the mitochondrial respiratory chain. We did not identify pathogenic mtDNA mutations in the 14 sequenced patients. Two known variants were nominally associated with schizophrenia and were further studied. The MT-RNR2 1811A > G variant likely does not play a major role in schizophrenia, as it was not associated with clinical, psychopathological, or neuropsychological variables, and the MT-ATP6 9110T > C p.Ile195Thr variant did not result in differences in the oxidative and enzymatic functions of the mitochondrial respiratory chain. The patients with apparent maternal inheritance of schizophrenia did not exhibit any mutations in their mtDNA. The variants nominally associated with schizophrenia in the present study were not related either to phenotypic characteristics or to mitochondrial function. We did not find evidence pointing to a role for mtDNA sequence variation in schizophrenia. © 2014 Wiley Periodicals, Inc.

  13. Role of DNA repair in repair of cytogenetic damages. Slowly repaired DNA injuries involved in cytogenetic damages repair

    International Nuclear Information System (INIS)

    Zaichkina, S.I.; Rozanova, O.M.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    Caffeine was used to study the kinetics of cytogenetic damages repair in Chinese hamster fibroblasts. Its half-time (90 min) was shown to correlate with that of repair of slowly repaired DNA damages. The caffeine-induced increase in the number of irreparable DNA damages, attributed to inhibition of double-strand break repair, is in a quantitative correlation with the effect of the cytogenetic damage modification

  14. Role of Mitochondrial DNA Copy Number Alteration in Human Renal Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Chen-Sung Lin

    2016-05-01

    Full Text Available We investigated the role of mitochondrial DNA (mtDNA copy number alteration in human renal cell carcinoma (RCC. The mtDNA copy numbers of paired cancer and non-cancer parts from five resected RCC kidneys after radical nephrectomy were determined by quantitative polymerase chain reaction (Q-PCR. An RCC cell line, 786-O, was infected by lentiviral particles to knock down mitochondrial transcriptional factor A (TFAM. Null target (NT and TFAM-knockdown (TFAM-KD represented the control and knockdown 786-O clones, respectively. Protein or mRNA expression levels of TFAM; mtDNA-encoded NADH dehydrogenase subunit 1 (ND1, ND6 and cytochrome c oxidase subunit 2 (COX-2; nuclear DNA (nDNA-encoded succinate dehydrogenase subunit A (SDHA; v-akt murine thymoma viral oncogene homolog 1 gene (AKT-encoded AKT and v-myc myelocytomatosis viral oncogene homolog gene (c-MYC-encoded MYC; glycolytic enzymes including hexokinase II (HK-II, glucose 6-phosphate isomerase (GPI, phosphofructokinase (PFK, and lactate dehydrogenase subunit A (LDHA; and hypoxia-inducible factors the HIF-1α and HIF-2α, pyruvate dehydrogenase kinase 1 (PDK1, and pyruvate dehydrogenase E1 component α subunit (PDHA1 were analyzed by Western blot or Q-PCR. Bioenergetic parameters of cellular metabolism, basal mitochondrial oxygen consumption rate (mOCRB and basal extracellular acidification rate (ECARB, were measured by a Seahorse XFe-24 analyzer. Cell invasiveness was evaluated by a trans-well migration assay and vimentin expression. Doxorubicin was used as a chemotherapeutic agent. The results showed a decrease of mtDNA copy numbers in resected RCC tissues (p = 0.043. The TFAM-KD clone expressed lower mtDNA copy number (p = 0.034, lower mRNA levels of TFAM (p = 0.008, ND1 (p = 0.007, and ND6 (p = 0.017, and lower protein levels of TFAM and COX-2 than did the NT clone. By contrast, the protein levels of HIF-2α, HK-II, PFK, LDHA, AKT, MYC and vimentin; trans-well migration activity (p = 0

  15. Possible roles of HIV-1 nucleocapsid protein in the specificity of proviral DNA synthesis and in its variability.

    Science.gov (United States)

    Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L

    1997-05-02

    Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.

  16. Strategic role of the ubiquitin-dependent segregase p97 (VCP or Cdc48) in DNA replication.

    Science.gov (United States)

    Ramadan, Kristijan; Halder, Swagata; Wiseman, Katherine; Vaz, Bruno

    2017-02-01

    Genome amplification (DNA synthesis) is one of the most demanding cellular processes in all proliferative cells. The DNA replication machinery (also known as the replisome) orchestrates genome amplification during S-phase of the cell cycle. Genetic material is particularly vulnerable to various events that can challenge the replisome during its assembly, activation (firing), progression (elongation) and disassembly from chromatin (termination). Any disturbance of the replisome leads to stalling of the DNA replication fork and firing of dormant replication origins, a process known as DNA replication stress. DNA replication stress is considered to be one of the main causes of sporadic cancers and other pathologies related to tissue degeneration and ageing. The mechanisms of replisome assembly and elongation during DNA synthesis are well understood. However, once DNA synthesis is complete, the process of replisome disassembly, and its removal from chromatin, remains unclear. In recent years, a growing body of evidence has alluded to a central role in replisome regulation for the ubiquitin-dependent protein segregase p97, also known as valosin-containing protein (VCP) in metazoans and Cdc48 in lower eukaryotes. By orchestrating the spatiotemporal turnover of the replisome, p97 plays an essential role in DNA replication. In this review, we will summarise our current knowledge about how p97 controls the replisome from replication initiation, to elongation and finally termination. We will also further examine the more recent findings concerning the role of p97 and how mutations in p97 cofactors, also known as adaptors, cause DNA replication stress induced genomic instability that leads to cancer and accelerated ageing. To our knowledge, this is the first comprehensive review concerning the mechanisms involved in the regulation of DNA replication by p97.

  17. Role of Macronutrients and Micronutrients in DNA Damage: Results From a Food Frequency Questionnaire

    Directory of Open Access Journals (Sweden)

    Carina Ladeira

    2017-02-01

    Full Text Available The links between diet and genomic instability have been under investigation for several decades, and evidence suggests a significant causal or preventive role for various dietary factors. This study investigates the influence of macronutrients (calories, protein, and glucides and micronutrients, such as vitamins and minerals, as assessed by a food frequency questionnaire, on genotoxicity biomarkers measured by cytokinesis-blocked micronucleus assay and comet assay. The results found significant positive and negative correlations. Micronucleus frequency tends to increase with higher intake of caffeine, calcium, magnesium, zinc, and protein ( P  < .05, Spearman correlation. Calorie and omega-6 intakes are negatively correlated with DNA damage measured by the comet assay. These results are somewhat controversial because some of the correlations found are contrary to dominant views in the literature; however, we suggest that unraveling the association between diet and genetic instability requires a much better understanding of the modulating role of macronutrients and micronutrients.

  18. The role of DNA methylation on Octopus vulgaris development and their perspectives

    Directory of Open Access Journals (Sweden)

    Eva eDíaz-Freije

    2014-02-01

    Full Text Available DNA methylation is a common regulator of gene expression and development in mammalian and other vertebrate genomes. DNA methylation has been studied so far in a few bivalve mollusk species, finding a wide spectrum of levels. We focused our study in the common octopus, Octopus vulgaris, an important organism for neuroscience, physiology and ethology research as well as for human consumption. We aim to confirm the existence of DNA methylation in O. vulgaris and ultimately, if methylation plays a role in gene regulation during octopus development. We used a genome-wide approach, methylation-sensitive amplified polymorphism (MSAP, firstly in four different tissues from the same specimens from adult benthonic individuals to test whether gene expression is regulated by methylation. Secondly, we tested the hypothesis that methylation underlies development by assessing MSAP patters from paralarvae to adult developmental stages. Our data indicate that octopus genome is widely methylated since clear differences can be observed, and the methylation pattern change with the development. The statistical analyses showed significant differences in methylation pattern between paralarvae, where higher internal cytosine methylation is observed, and the three other post-hatching stages. This suggests an important role of cytosine methylation during the first step of development, when major morphological changes take place. However, methylation seems to have little effect on gene expression during the benthonic phase, since any significant effect was revealed in the AMOVA performed. Our observations highlight the importance of epigenetic mechanism in the first developmental steps of the common octopus and open new perspectives to overcome high mortality rate during paralarvae growth. Thus, better understanding the molecular regulation patterns could lead to new approaches that increase the efficiency of husbandry of this emergent species for aquaculture.

  19. Role of specific cations and water entropy on the stability of branched DNA motif structures.

    Science.gov (United States)

    Pascal, Tod A; Goddard, William A; Maiti, Prabal K; Vaidehi, Nagarajan

    2012-10-11

    DNA three-way junctions (TWJs) are important intermediates in various cellular processes and are the simplest of a family of branched nucleic acids being considered as scaffolds for biomolecular nanotechnology. Branched nucleic acids are stabilized by divalent cations such as Mg(2+), presumably due to condensation and neutralization of the negatively charged DNA backbone. However, electrostatic screening effects point to more complex solvation dynamics and a large role of interfacial waters in thermodynamic stability. Here, we report extensive computer simulations in explicit water and salt on a model TWJ and use free energy calculations to quantify the role of ionic character and strength on stability. We find that enthalpic stabilization of the first and second hydration shells by Mg(2+) accounts for 1/3 and all of the free energy gain in 50% and pure MgCl(2) solutions, respectively. The more distorted DNA molecule is actually destabilized in pure MgCl(2) compared to pure NaCl. Notably, the first shell, interfacial waters have very low translational and rotational entropy (i.e., mobility) compared to the bulk, an entropic loss that is overcompensated by increased enthalpy from additional electrostatic interactions with Mg(2+). In contrast, the second hydration shell has anomalously high entropy as it is trapped between an immobile and bulklike layer. The nonmonotonic entropic signature and long-range perturbations of the hydration shells to Mg(2+) may have implications in the molecular recognition of these motifs. For example, we find that low salt stabilizes the parallel configuration of the three-way junction, whereas at normal salt we find antiparallel configurations deduced from the NMR. We use the 2PT analysis to follow the thermodynamics of this transition and find that the free energy barrier is dominated by entropic effects that result from the decreased surface area of the antiparallel form which has a smaller number of low entropy waters in the first

  20. Contrasting roles for DNA methyltransferases and histone deacetylases in single-item and associative recognition memory.

    Science.gov (United States)

    Scott, Hannah; Smith, Anna E; Barker, Gareth R; Uney, James B; Warburton, E Clea

    2017-03-01

    Recognition memory enables us to judge whether we have encountered a stimulus before and to recall associated information, including where the stimulus was encountered. The perirhinal cortex (PRh) is required for judgment of stimulus familiarity, while hippocampus (HPC) and medial prefrontal cortex (mPFC) are additionally involved when spatial information associated with a stimulus needs to be remembered. While gene expression is known to be essential for the consolidation of long-term recognition memory, the underlying regulatory mechanisms are not fully understood. Here we investigated the roles of two epigenetic mechanisms, DNA methylation and histone deacetylation, in recognition memory. Infusion of DNA methyltransferase inhibitors into PRh impaired performance in novel object recognition and object-in-place tasks while infusions into HPC or mPFC impaired object-in-place performance only. In contrast, inhibition of histone deacetylases in PRh, but not mPFC, enhanced recognition memory. These results support the emerging role of epigenetic processes in learning and memory.

  1. Contrasting roles for DNA methyltransferases and histone deacetylases in single-item and associative recognition memory

    Directory of Open Access Journals (Sweden)

    Hannah Scott

    2017-03-01

    Full Text Available Recognition memory enables us to judge whether we have encountered a stimulus before and to recall associated information, including where the stimulus was encountered. The perirhinal cortex (PRh is required for judgment of stimulus familiarity, while hippocampus (HPC and medial prefrontal cortex (mPFC are additionally involved when spatial information associated with a stimulus needs to be remembered. While gene expression is known to be essential for the consolidation of long-term recognition memory, the underlying regulatory mechanisms are not fully understood. Here we investigated the roles of two epigenetic mechanisms, DNA methylation and histone deacetylation, in recognition memory. Infusion of DNA methyltransferase inhibitors into PRh impaired performance in novel object recognition and object-in-place tasks while infusions into HPC or mPFC impaired object-in-place performance only. In contrast, inhibition of histone deacetylases in PRh, but not mPFC, enhanced recognition memory. These results support the emerging role of epigenetic processes in learning and memory.

  2. Homologous Recombination DNA Repair Genes Play a Critical Role in Reprogramming to a Pluripotent State

    Directory of Open Access Journals (Sweden)

    Federico González

    2013-03-01

    Full Text Available Induced pluripotent stem cells (iPSCs hold great promise for personalized regenerative medicine. However, recent studies show that iPSC lines carry genetic abnormalities, suggesting that reprogramming may be mutagenic. Here, we show that the ectopic expression of reprogramming factors increases the level of phosphorylated histone H2AX, one of the earliest cellular responses to DNA double-strand breaks (DSBs. Additional mechanistic studies uncover a direct role of the homologous recombination (HR pathway, a pathway essential for error-free repair of DNA DSBs, in reprogramming. This role is independent of the use of integrative or nonintegrative methods in introducing reprogramming factors, despite the latter being considered a safer approach that circumvents genetic modifications. Finally, deletion of the tumor suppressor p53 rescues the reprogramming phenotype in HR-deficient cells primarily through the restoration of reprogramming-dependent defects in cell proliferation and apoptosis. These mechanistic insights have important implications for the design of safer approaches to creating iPSCs.

  3. The Role of Altered Nucleotide Excision Repair and UVB-Induced DNA Damage in Melanomagenesis

    Directory of Open Access Journals (Sweden)

    Timothy Budden

    2013-01-01

    Full Text Available UVB radiation is the most mutagenic component of the UV spectrum that reaches the earth’s surface and causes the development of DNA damage in the form of cyclobutane pyrimidine dimers and 6-4 photoproducts. UV radiation usually results in cellular death, but if left unchecked, it can affect DNA integrity, cell and tissue homeostasis and cause mutations in oncogenes and tumour-suppressor genes. These mutations, if unrepaired, can lead to abnormal cell growth, increasing the risk of cancer development. Epidemiological data strongly associates UV exposure as a major factor in melanoma development, but the exact biological mechanisms involved in this process are yet to be fully elucidated. The nucleotide excision repair (NER pathway is responsible for the repair of UV-induced lesions. Patients with the genetic disorder Xeroderma Pigmentosum have a mutation in one of eight NER genes associated with the XP complementation groups XP-A to XP-G and XP variant (XP-V. XP is characterized by diminished repair capacity, as well as a 1000-fold increase in the incidence of skin cancers, including melanoma. This has suggested a significant role for NER in melanoma development as a result of UVB exposure. This review discusses the current research surrounding UVB radiation and NER capacity and how further investigation of NER could elucidate the role of NER in avoiding UV-induced cellular death resulting in melanomagenesis.

  4. ROLE OF DNA METHYLATION AS A DIAGNOSTIC BIOMARKER OF SPORADIC BREAST CANCER

    Directory of Open Access Journals (Sweden)

    Wirsma Arif Harahap

    2017-02-01

    Full Text Available The initiation and progression of breast cancer have been recognized for many years to be secondary to the accumulation of genetic mutations which lead to aberrant cellular function. Genetic mutations, either inherited or sporadic, may result in the activation of oncogenes and the inactivation of tumor suppressor genes. The more recent discovery that reversible alterations in histone proteins and deoxyribonucleic acid (DNA can also lead to tumorigenesis has introduced a novel term to the field of cancer research: epigenetics.  Epigenetics refers to the study of heritable changes in gene regulation that do not involve a change in the DNA sequence. The most often studied in epigenetics of breast cancer is DNA methylation. That a promoter methylation result in transcription blockade supports the notion that cellular inhibition takes place. Compared to normal tissues, hypermethylation occurs from double to triple in cancerous ones. DNA methylation plays a crucial role in oncogenesis and is one of the hallmarks of cancer. Detection of aberrantly methylated CpG islands in promoter region of several genes in DNA sample derived from nipple aspirates, serum, or cancer tissue associated with down regulation of expression or loss of function of these genes has been associated with early stages of breast cancer, where  hypermethylation of CpG island points to poorer prognosis in breast cancer.  DNA methylation has been identified as signature for TNBC. Methylation of BRCA1 gene is frequently demonstrated in young, estrogen receptor-negative breast cancer patients. Methylation of specific genes is known to differ across race and socioeconomic status. BRCA1 methylation in premenopausal women with sporadic breast cancer in West Sumatra region has been higher than in Western women. DNA methylation may be used to enhance current breast cancer classification. There is such a distinction between methylation and gene expression profiles of breast cancer that not

  5. Possible role(s) of nuclear matrix and DNA loop organization in fixation or repair of DNA double-strand breaks

    International Nuclear Information System (INIS)

    Malyapa, R.S.; Wright, W.D.; Roti Roti, J.L.

    1995-01-01

    DNA double-strand breaks produced by ionizing radiation are considered to be a critical radiation-induced lesion responsible, in part, for cell killing. However, the manner in which structures within the nucleus involving DNA organization contribute to the balance between fixation or repair of these critical lesions remains largely obscure. The repair process requires both functional enzymes and substrate availability, i.e., access to and orientation of damage sites. Therefore, the ability to repair damaged DNA could be influenced not only by DNA integrity but also by the spatial organization of DNA. Therefore, the authors investigated the possibility that radiation-induced DNA damage differentially affects DNA supercoiling ability in cells of differing radiosensitivities using radioresistant and radiosensitive mutants of different origins. This study was also designed to determine if differences in the composition of the nuclear matrix exist between cell lines of each origin. Results from these studies indicate that differences in the composition of the nuclear matrix proteins and DNA stability might be related to intrinsic radiation resistance

  6. Dimer monomer transition and dimer re-formation play important role for ATM cellular function during DNA repair

    International Nuclear Information System (INIS)

    Du, Fengxia; Zhang, Minjie; Li, Xiaohua; Yang, Caiyun; Meng, Hao; Wang, Dong; Chang, Shuang; Xu, Ye; Price, Brendan; Sun, Yingli

    2014-01-01

    Highlights: • ATM phosphorylates the opposite strand of the dimer in response to DNA damage. • The PETPVFRLT box of ATM plays a key role in its dimer dissociation in DNA repair. • The dephosphorylation of ATM is critical for dimer re-formation after DNA repair. - Abstract: The ATM protein kinase, is a serine/threonine protein kinase that is recruited and activated by DNA double-strand breaks, mediates responses to ionizing radiation in mammalian cells. Here we show that ATM is held inactive in unirradiated cells as a dimer and phosphorylates the opposite strand of the dimer in response to DNA damage. Cellular irradiation induces rapid intermolecular autophosphorylation of serine 1981 that causes dimer dissociation and initiates cellular ATM kinase activity. ATM cannot phosphorylate the substrates when it could not undergo dimer monomer transition. After DNA repair, the active monomer will undergo dephosphorylation to form dimer again and dephosphorylation is critical for dimer re-formation. Our work reveals novel function of ATM dimer monomer transition and explains why ATM dimer monomer transition plays such important role for ATM cellular activity during DNA repair

  7. A ChIP-chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response.

    Science.gov (United States)

    Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole

    2009-03-01

    IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP-chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response.

  8. A ChIP–chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response

    Science.gov (United States)

    Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole

    2009-01-01

    IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP–chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response. PMID:19129219

  9. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun, E-mail: yizc@buaa.edu.cn

    2012-11-15

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  10. The role of DNA methylation in catechol-enhanced erythroid differentiation of K562 cells

    International Nuclear Information System (INIS)

    Li, Xiao-Fei; Wu, Xiao-Rong; Xue, Ming; Wang, Yan; Wang, Jie; Li, Yang; Suriguga,; Zhang, Guang-Yao; Yi, Zong-Chun

    2012-01-01

    Catechol is one of phenolic metabolites of benzene in vivo. Catechol is also widely used in pharmaceutical and chemical industries. In addition, fruits, vegetables and cigarette smoke also contain catechol. Our precious study showed that several benzene metabolites (phenol, hydroquinone, and 1,2,4-benzenetriol) inhibited erythroid differentiation of K562 cells. In present study, the effect of catechol on erythroid differentiation of K562 cells was investigated. Moreover, to address the role of DNA methylation in catechol-induced effect on erythroid differentiation in K562 cells, methylation levels of erythroid-specific genes were analyzed by Quantitative MassARRAY methylation analysis platform. Benzidine staining showed that exposure to catechol enhanced hemin-induced hemoglobin accumulation in K562 cells in concentration- and time-dependent manners. The mRNA expression of erythroid specific genes, including α-globin, β-globin, γ-globin, erythroid 5-aminolevulinate synthase, erythroid porphobilinogen deaminase, and transcription factor GATA-1 genes, showed a significant concentration-dependent increase in catechol-treated K562 cells. The exposure to catechol caused a decrease in DNA methylation levels at a few CpG sites in some erythroid specific genes including α-globin, β-globin and erythroid porphobilinogen deaminase genes. These results indicated that catechol improved erythroid differentiation potency of K562 cells at least partly via up-regulating transcription of some erythroid related genes, and suggested that inhibition of DNA methylation might be involved in up-regulated expression of some erythroid related genes. -- Highlights: ► Catechol enhanced hemin-induced hemoglobin accumulation. ► Exposure to catechol resulted in up-regulated expression of erythroid genes. ► Catechol reduced methylation levels at some CpG sites in erythroid genes.

  11. The role of DNA methylation during anoxia tolerance in a freshwater turtle (Trachemys scripta elegans).

    Science.gov (United States)

    Wijenayake, Sanoji; Storey, Kenneth B

    2016-04-01

    Oxygen deprivation is a lethal stress that only a few animals can tolerate for extended periods. This study focuses on analyzing the role of DNA methylation in aiding natural anoxia tolerance in a champion vertebrate anaerobe, the red-eared slider turtle (Trachemys scripta elegans). We examined the relative expression and total enzymatic activity of four DNA methyltransferases (DNMT1, DNMT2, DNMT3a and DNMT3b), two methyl-binding domain proteins (MBD1 and MBD2), and relative genomic levels of 5-methylcytosine under control, 5 h anoxic, and 20 h anoxic conditions in liver, heart, and white skeletal muscle (n = 4, p < 0.05). In liver, protein expression of DNMT1, DNMT2, MBD1, and MBD2 rose significantly by two- to fourfold after 5 h anoxic submergence compared to normoxic-control conditions. In heart, 5 h anoxia submergence resulted in a 1.4-fold increase in DNMT3a levels and a significant decrease in MBD1 and MBD2 levels to ~30 % of control values. In white muscle, DNMT3a and DNMT3b increased threefold and MBD1 levels increased by 50 % in response to 5 h anoxia. Total DNMT activity rose by 0.6-2.0-fold in liver and white muscle and likewise global 5mC levels significantly increased in liver and white muscle under 5 and 20 h anoxia. The results demonstrate an overall increase in DNA methylation, DNMT protein expression and enzymatic activity in response to 5 and 20 h anoxia in liver and white muscle indicating a potential downregulation of gene expression via this epigenetic mechanism during oxygen deprivation.

  12. Role of teh Rad52 Amino-terminal DNA Binding Activity in DNA Strand Capture in Homologous Recombination

    DEFF Research Database (Denmark)

    Shi, Idina; Hallwyl, Swee Chuang Lim; Seong, Changhyun

    2009-01-01

    Saccharomyces cerevisiae Rad52 protein promotes homologous recombination by nucleating the Rad51 recombinase onto replication protein A-coated single-stranded DNA strands and also by directly annealing such strands. We show that the purified rad52-R70A mutant protein, with a compromised amino-ter...

  13. Mitochondrial DNA plays an equal role in influencing female and male longevity in centenarians.

    Science.gov (United States)

    He, Yong-Han; Lu, Xiang; Tian, Jiao-Yang; Yan, Dong-Jing; Li, Yu-Chun; Lin, Rong; Perry, Benjamin; Chen, Xiao-Qiong; Yu, Qin; Cai, Wang-Wei; Kong, Qing-Peng

    2016-10-01

    The mitochondrion is a double membrane-bound organelle which plays important functional roles in aging and many other complex phenotypes. Transmission of the mitochondrial genome in the matrilineal line causes the evolutionary selection sieve only in females. Theoretically, beneficial or neutral variations are more likely to accumulate and be retained in the female mitochondrial genome during evolution, which may be an initial trigger of gender dimorphism in aging. The asymmetry of evolutionary processes between gender could lead to males and females aging in different ways. If so, gender specific variation loads could be an evolutionary result of maternal heritage of mitochondrial genomes, especially in centenarians who live to an extreme age and are considered as good models for healthy aging. Here, we tested whether the mitochondrial variation loads were associated with altered aging patterns by investigating the mtDNA haplogroup distribution and genetic diversity between female and male centenarians. We found no evidence of differences in aging patterns between genders in centenarians. Our results indicate that the evolutionary consequence of gender dimorphism in mitochondrial genomes is not a factor in the altered aging patterns in human, and that mitochondrial DNA contributes equally to longevity in males and females. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. High resolution melting (HRM) analysis of DNA--its role and potential in food analysis.

    Science.gov (United States)

    Druml, Barbara; Cichna-Markl, Margit

    2014-09-01

    DNA based methods play an increasing role in food safety control and food adulteration detection. Recent papers show that high resolution melting (HRM) analysis is an interesting approach. It involves amplification of the target of interest in the presence of a saturation dye by the polymerase chain reaction (PCR) and subsequent melting of the amplicons by gradually increasing the temperature. Since the melting profile depends on the GC content, length, sequence and strand complementarity of the product, HRM analysis is highly suitable for the detection of single-base variants and small insertions or deletions. The review gives an introduction into HRM analysis, covers important aspects in the development of an HRM analysis method and describes how HRM data are analysed and interpreted. Then we discuss the potential of HRM analysis based methods in food analysis, i.e. for the identification of closely related species and cultivars and the identification of pathogenic microorganisms. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Probing the role of interfacial waters in protein-DNA recognition using a hybrid implicit/explicit solvation model

    Science.gov (United States)

    Li, Shen; Bradley, Philip

    2013-01-01

    When proteins bind to their DNA target sites, ordered water molecules are often present at the protein-DNA interface bridging protein and DNA through hydrogen bonds. What is the role of these ordered interfacial waters? Are they important determinants of the specificity of DNA sequence recognition, or do they act in binding in a primarily non-specific manner, by improving packing of the interface, shielding unfavorable electrostatic interactions, and solvating unsatisfied polar groups that are inaccessible to bulk solvent? When modeling details of structure and binding preferences, can fully implicit solvent models be fruitfully applied to protein-DNA interfaces, or must the individualistic properties of these interfacial waters be accounted for? To address these questions, we have developed a hybrid implicit/explicit solvation model that specifically accounts for the locations and orientations of small numbers of DNA-bound water molecules while treating the majority of the solvent implicitly. Comparing the performance of this model to its fully implicit counterpart, we find that explicit treatment of interfacial waters results in a modest but significant improvement in protein sidechain placement and DNA sequence recovery. Base-by-base comparison of the performance of the two models highlights DNA sequence positions whose recognition may be dependent on interfacial water. Our study offers large-scale statistical evidence for the role of ordered water for protein DNA recognition, together with detailed examination of several well-characterized systems. In addition, our approach provides a template for modeling explicit water molecules at interfaces that should be extensible to other systems. PMID:23444044

  16. Essential and distinct roles of the F-box and helicase domains of Fbh1 in DNA damage repair

    Directory of Open Access Journals (Sweden)

    Shinagawa Hideo

    2008-03-01

    Full Text Available Abstract Background DNA double-strand breaks (DSBs are induced by exogenous insults such as ionizing radiation and chemical exposure, and they can also arise as a consequence of stalled or collapsed DNA replication forks. Failure to repair DSBs can lead to genomic instability or cell death and cancer in higher eukaryotes. The Schizosaccharomyces pombe fbh1 gene encodes an F-box DNA helicase previously described to play a role in the Rhp51 (an orthologue of S. cerevisiae RAD51-dependent recombinational repair of DSBs. Fbh1 fused to GFP localizes to discrete nuclear foci following DNA damage. Results To determine the functional roles of the highly conserved F-box and helicase domains, we have characterized fbh1 mutants carrying specific mutations in these domains. We show that the F-box mutation fbh1-fb disturbs the nuclear localization of Fbh1, conferring an fbh1 null-like phenotype. Moreover, nuclear foci do not form in fbh1-fb cells with DNA damage even if Fbh1-fb is targeted to the nucleus by fusion to a nuclear localization signal sequence. In contrast, the helicase mutation fbh1-hl causes the accumulation of Fbh1 foci irrespective of the presence of DNA damage and confers damage sensitivity greater than that conferred by the null allele. Additional mutation of the F-box alleviates the hypermorphic phenotype of the fbh1-hl mutant. Conclusion These results suggest that the F-box and DNA helicase domains play indispensable but distinct roles in Fbh1 function. Assembly of the SCFFbh1 complex is required for both the nuclear localization and DNA damage-induced focus formation of Fbh1 and is therefore prerequisite for the Fbh1 recombination function.

  17. A structural role for the PHP domain in E. coli DNA polymerase III.

    Science.gov (United States)

    Barros, Tiago; Guenther, Joel; Kelch, Brian; Anaya, Jordan; Prabhakar, Arjun; O'Donnell, Mike; Kuriyan, John; Lamers, Meindert H

    2013-05-14

    In addition to the core catalytic machinery, bacterial replicative DNA polymerases contain a Polymerase and Histidinol Phosphatase (PHP) domain whose function is not entirely understood. The PHP domains of some bacterial replicases are active metal-dependent nucleases that may play a role in proofreading. In E. coli DNA polymerase III, however, the PHP domain has lost several metal-coordinating residues and is likely to be catalytically inactive. Genomic searches show that the loss of metal-coordinating residues in polymerase PHP domains is likely to have coevolved with the presence of a separate proofreading exonuclease that works with the polymerase. Although the E. coli Pol III PHP domain has lost metal-coordinating residues, the structure of the domain has been conserved to a remarkable degree when compared to that of metal-binding PHP domains. This is demonstrated by our ability to restore metal binding with only three point mutations, as confirmed by the metal-bound crystal structure of this mutant determined at 2.9 Å resolution. We also show that Pol III, a large multi-domain protein, unfolds cooperatively and that mutations in the degenerate metal-binding site of the PHP domain decrease the overall stability of Pol III and reduce its activity. While the presence of a PHP domain in replicative bacterial polymerases is strictly conserved, its ability to coordinate metals and to perform proofreading exonuclease activity is not, suggesting additional non-enzymatic roles for the domain. Our results show that the PHP domain is a major structural element in Pol III and its integrity modulates both the stability and activity of the polymerase.

  18. A role for recombination junctions in the segregation of mitochondrial DNA in yeast.

    Science.gov (United States)

    Lockshon, D; Zweifel, S G; Freeman-Cook, L L; Lorimer, H E; Brewer, B J; Fangman, W L

    1995-06-16

    In S. cerevisiae, mitochondrial DNA (mtDNA) molecules, in spite of their high copy number, segregate as if there were a small number of heritable units. The rapid segregation of mitochondrial genomes can be analyzed using mtDNA deletion variants. These small, amplified genomes segregate preferentially from mixed zygotes relative to wild-type mtDNA. This segregation advantage is abolished by mutations in a gene, MGT1, that encodes a recombination junction-resolving enzyme. We show here that resolvase deficiency causes a larger proportion of molecules to be linked together by recombination junctions, resulting in the aggregation of mtDNA into a small number of cytological structures. This change in mtDNA structure can account for the increased mitotic loss of mtDNA and the altered pattern of mtDNA segregation from zygotes. We propose that the level of unresolved recombination junctions influences the number of heritable units of mtDNA.

  19. Using AFM to probe the complexation of DNA with anionic lipids mediated by Ca(2+): the role of surface pressure.

    Science.gov (United States)

    Luque-Caballero, Germán; Martín-Molina, Alberto; Sánchez-Treviño, Alda Yadira; Rodríguez-Valverde, Miguel A; Cabrerizo-Vílchez, Miguel A; Maldonado-Valderrama, Julia

    2014-04-28

    Complexation of DNA with lipids is currently being developed as an alternative to classical vectors based on viruses. Most of the research to date focuses on cationic lipids owing to their spontaneous complexation with DNA. Nonetheless, recent investigations have revealed that cationic lipids induce a large number of adverse effects on DNA delivery. Precisely, the lower cytotoxicity of anionic lipids accounts for their use as a promising alternative. However, the complexation of DNA with anionic lipids (mediated by cations) is still in early stages and is not yet well understood. In order to explore the molecular mechanisms underlying the complexation of anionic lipids and DNA we proposed a combined methodology based on the surface pressure-area isotherms, Gibbs elasticity and Atomic Force Microscopy (AFM). These techniques allow elucidation of the role of the surface pressure in the complexation and visualization of the interfacial aggregates for the first time. We demonstrate that the DNA complexes with negatively charged model monolayers (DPPC/DPPS 4 : 1) only in the presence of Ca(2+), but is expelled at very high surface pressures. Also, according to the Gibbs elasticity plot, the complexation of lipids and DNA implies a whole fluidisation of the monolayer and a completely different phase transition map in the presence of DNA and Ca(2+). AFM imaging allows identification for the first time of specific morphologies associated with different packing densities. At low surface coverage, a branched net like structure is observed whereas at high surface pressure fibers formed of interfacial aggregates appear. In summary, Ca(2+) mediates the interaction between DNA and negatively charged lipids and also the conformation of the ternary system depends on the surface pressure. Such observations are important new generic features of the interaction between DNA and anionic lipids.

  20. Role of O6-alkylguanine-DNA alkyltransferase in the resistance of mouse spermatogenic cells to O6-alkylating agents.

    Science.gov (United States)

    Thompson, M J; Abdul-Rahman, S; Baker, T G; Rafferty, J A; Margison, G P; Bibby, M C

    2000-07-01

    The O(6)-alkylguanine-DNA alkyltransferase inactivator O(6)-benzylguanine was administered to BALB/c mice either alone or before exposure to 1,3-bis(2-chloroethyl)-1-nitrosourea to study the role of the DNA repair protein O(6)-alkylguanine-DNA alkyltransferase in the protection of the testis against anti-cancer O(6)-alkylating agents. Exposure of the mice to 1, 3-bis(2-chloroethyl)-1-nitrosourea or O(6)-benzylguanine alone did not produce any marked testicular toxicity at the times studied. Testicular O(6)-alkylguanine-DNA alkyltransferase concentrations were assayed between 0 and 240 min after O(6)-benzylguanine treatment and were shown to be > 95% depleted 15 min after treatment with O(6)-benzylguanine and remained at > 95% at all the times assayed. Histological examination, the reduction in testicular mass and the induction of spermatogenic cell apoptosis showed that this depletion significantly potentiated 1, 3-bis(2-chloroethyl)-1-nitrosourea-induced testicular damage after treatment. Major histological damage was apparent 42 days after treatment, demonstrating that the stem spermatogonia were significantly affected by the combination. These results demonstrate that O(6)-alkylguanine-DNA alkyltransferase plays a significant role in protecting the spermatogenic cells from damage caused by DNA alkylation and indicate that the observed toxicity may result from damage to stem spermatogonia.

  1. The Role of DNA Methylation in Xylogenesis in Different Tissues of Poplar

    Directory of Open Access Journals (Sweden)

    Qingshi Wang

    2016-07-01

    Full Text Available In trees, xylem tissues play a key role in the formation of woody tissues, which have important uses for pulp and timber production; also DNA methylation plays an important part in gene regulation during xylogenesis in trees. In our study, methylation-sensitive amplified polymorphism (MSAP analysis was used to analyze the role cytosine methylation plays in wood formation in the commercially important tree species Populus tomentosa. This analysis compared the methylation patterns between xylem tissues (developing xylem and mature xylem and non-xylem tissues (cambium, shoot apex, young leaf, mature leaf, phloem, root, male catkin, and female catkin and found 10,316 polymorphic methylation sites. MSAP identified 132 candidate genes with the same methylation patterns in xylem tissues, including seven wood-related genes. The expression of these genes differed significantly between xylem and non-xylem tissue types (P<0.01. This indicated that the difference of expression of specific genes with unique methylation patterns, rather than relative methylation levels between the two tissue types plays a critical role in wood biosynthesis. However, 46.2% of candidate genes with the same methylation pattern in vascular tissues (cambium, phloem, and developing xylem did not have distinct expression patterns in xylem and non-xylem tissue. Also, bisulfite sequencing and transcriptome sequencing of MYB, NAC and FASCICLIN-LIKE AGP 13 revealed that the location of cytosine methylation in the gene might affect the expression of different transcripts from the corresponding gene. The expression of different transcripts that produce distinct proteins from a single gene might play an important role in the regulation of xylogenesis.

  2. The role of hnRPUL1 involved in DNA damage response is related to PARP1.

    Directory of Open Access Journals (Sweden)

    Zehui Hong

    Full Text Available Heterogeneous nuclear ribonucleoprotein U-like 1 (hnRPUL1 -also known as adenovirus early region 1B-associated proteins 5 (E1B-AP5 - plays a role in RNA metabolism. Recently, hnRPUL1 has also been shown to be involved in DNA damage response, but the function of hnRPUL1 in response to DNA damage remains unclear. Here, we have demonstrated that hnRPUL1 is associated with PARP1 and recruited to DNA double-strand breaks (DSBs sites in a PARP1-mediated poly (ADP-ribosyl ation dependent manner. In turn, hnRPUL1 knockdown enhances the recruitment of PARP1 to DSBs sites. Specifically, we showed that hnRPUL1 is also implicated in the transcriptional regulation of PARP1 gene. Thus, we propose hnRPUL1 as a new component related to PARP1 in DNA damage response and repair.

  3. Role of Mitochondrial DNA Mutations in Cellular Vulnerability to Mitochondria-Specific Environmental Toxins

    National Research Council Canada - National Science Library

    Hirsch, Etienne C

    2005-01-01

    In recent years, growing evidence has shown that mutations of mitochondrial DNA (mtDNA) are an important cause of mitochondrial disorders in humans, and have been associated with common neurodegenerative disorders, aging and cancers...

  4. New insight into multifunctional role of peroxiredoxin family protein: Determination of DNA protection properties of bacterioferritin comigratory protein under hyperthermal and oxidative stresses

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Sangmin, E-mail: taeinlee2011@kangwon.ac.kr [Department of Biochemistry, College of Natural Sciences, Kangwon National University, 1 Kangwondaehak-gil, Chuncheon-si, Gangwon-do, 24341, South Korea (Korea, Republic of); Chung, Jeong Min [Department of Biochemistry, College of Natural Sciences, Kangwon National University, 1 Kangwondaehak-gil, Chuncheon-si, Gangwon-do, 24341, South Korea (Korea, Republic of); Yun, Hyung Joong; Won, Jonghan [Advanced Nano Surface Research Group, Korea Basic Science Institute, 169-148 Gwahak-ro, Daejeon, 305-333 (Korea, Republic of); Jung, Hyun Suk, E-mail: hsjung@kangwon.ac.kr [Department of Biochemistry, College of Natural Sciences, Kangwon National University, 1 Kangwondaehak-gil, Chuncheon-si, Gangwon-do, 24341, South Korea (Korea, Republic of)

    2016-01-22

    Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stress by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.

  5. New insight into multifunctional role of peroxiredoxin family protein: Determination of DNA protection properties of bacterioferritin comigratory protein under hyperthermal and oxidative stresses

    International Nuclear Information System (INIS)

    Lee, Sangmin; Chung, Jeong Min; Yun, Hyung Joong; Won, Jonghan; Jung, Hyun Suk

    2016-01-01

    Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stress by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.

  6. Analysis of the role of PCNA-DNA contacts during clamp loading

    Directory of Open Access Journals (Sweden)

    Goedken Eric R

    2010-01-01

    Full Text Available Abstract Background Sliding clamps, such as Proliferating Cell Nuclear Antigen (PCNA in eukaryotes, are ring-shaped protein complexes that encircle DNA and enable highly processive DNA replication by serving as docking sites for DNA polymerases. In an ATP-dependent reaction, clamp loader complexes, such as the Replication Factor-C (RFC complex in eukaryotes, open the clamp and load it around primer-template DNA. Results We built a model of RFC bound to PCNA and DNA based on existing crystal structures of clamp loaders. This model suggests that DNA would enter the clamp at an angle during clamp loading, thereby interacting with positively charged residues in the center of PCNA. We show that simultaneous mutation of Lys 20, Lys 77, Arg 80, and Arg 149, which interact with DNA in the RFC-PCNA-DNA model, compromises the ability of yeast PCNA to stimulate the DNA-dependent ATPase activity of RFC when the DNA is long enough to extend through the clamp. Fluorescence anisotropy binding experiments show that the inability of the mutant clamp proteins to stimulate RFC ATPase activity is likely caused by reduction in the affinity of the RFC-PCNA complex for DNA. We obtained several crystal forms of yeast PCNA-DNA complexes, measuring X-ray diffraction data to 3.0 Å resolution for one such complex. The resulting electron density maps show that DNA is bound in a tilted orientation relative to PCNA, but makes different contacts than those implicated in clamp loading. Because of apparent partial disorder in the DNA, we restricted refinement of the DNA to a rigid body model. This result contrasts with previous analysis of a bacterial clamp bound to DNA, where the DNA was well resolved. Conclusion Mutational analysis of PCNA suggests that positively charged residues in the center of the clamp create a binding surface that makes contact with DNA. Disruption of this positive surface, which had not previously been implicated in clamp loading function, reduces RFC

  7. Functional role of DNA mismatch repair gene PMS2 in prostate cancer cells.

    Science.gov (United States)

    Fukuhara, Shinichiro; Chang, Inik; Mitsui, Yozo; Chiyomaru, Takeshi; Yamamura, Soichiro; Majid, Shahana; Saini, Sharanjot; Deng, Guoren; Gill, Ankurpreet; Wong, Darryn K; Shiina, Hiroaki; Nonomura, Norio; Lau, Yun-Fai C; Dahiya, Rajvir; Tanaka, Yuichiro

    2015-06-30

    DNA mismatch repair (MMR) enzymes act as proofreading complexes that maintains genomic integrity and MMR-deficient cells show an increased mutation rate. MMR has also been shown to influence cell signaling and the regulation of tumor development. MMR consists of various genes and includes post-meiotic segregation (PMS) 2 which is a vital component of mutL-alpha. In prostate, the functional role of this gene has never been reported and in this study, our aim was to investigate the effect of PMS2 on growth properties of prostate cancer (PCa) cells. Previous studies have shown PMS2 to be deficient in DU145 cells and this lack of expression was confirmed by Western blotting whereas normal prostatic PWR-1E and RWPE-1 cells expressed this gene. PMS2 effects on various growth properties of DU145 were then determined by creating stable gene transfectants. Interestingly, PMS2 caused decreased cell proliferation, migration, invasion, and in vivo growth; and increased apoptosis as compared to vector control. We further analyzed genes affected by PMS2 expression and observe the apoptosis-related TMS1 gene to be significantly upregulated whereas anti-apoptotic BCL2A1 was downregulated. These results demonstrate a functional role for PMS2 to protect against PCa progression by enhancing apoptosis of PCa cells.

  8. A p53-independent role for the MDM2 antagonist Nutlin-3 in DNA damage response initiation

    Directory of Open Access Journals (Sweden)

    Kumar Sonia

    2011-02-01

    Full Text Available Abstract Background The mammalian DNA-damage response (DDR has evolved to protect genome stability and maximize cell survival following DNA-damage. One of the key regulators of the DDR is p53, itself tightly regulated by MDM2. Following double-strand DNA breaks (DSBs, mediators including ATM are recruited to the site of DNA-damage. Subsequent phosphorylation of p53 by ATM and ATM-induced CHK2 results in p53 stabilization, ultimately intensifying transcription of p53-responsive genes involved in DNA repair, cell-cycle checkpoint control and apoptosis. Methods In the current study, we investigated the stabilization and activation of p53 and associated DDR proteins in response to treatment of human colorectal cancer cells (HCT116p53+/+ with the MDM2 antagonist, Nutlin-3. Results Using immunoblotting, Nutlin-3 was observed to stabilize p53, and activate p53 target proteins. Unexpectedly, Nutlin-3 also mediated phosphorylation of p53 at key DNA-damage-specific serine residues (Ser15, 20 and 37. Furthermore, Nutlin-3 induced activation of CHK2 and ATM - proteins required for DNA-damage-dependent phosphorylation and activation of p53, and the phosphorylation of BRCA1 and H2AX - proteins known to be activated specifically in response to DNA damage. Indeed, using immunofluorescent labeling, Nutlin-3 was seen to induce formation of γH2AX foci, an early hallmark of the DDR. Moreover, Nutlin-3 induced phosphorylation of key DDR proteins, initiated cell cycle arrest and led to formation of γH2AX foci in cells lacking p53, whilst γH2AX foci were also noted in MDM2-deficient cells. Conclusion To our knowledge, this is the first solid evidence showing a secondary role for Nutlin-3 as a DDR triggering agent, independent of p53 status, and unrelated to its role as an MDM2 antagonist.

  9. Role of Rad54, Rad54b and Snm1 in DNA damage repair

    NARCIS (Netherlands)

    J. Wesoly (Joanna)

    2003-01-01

    textabstractThe aim of this thesis is to investigate the function of a number of genes involved in mammalian DNA damage repair, in particular in repair of DNA double-strand breaks (DSBs). Among a large number of different damages that can be introduced to DNA, DSBs are especially toxic. If

  10. Role of noble metal nanoparticles in DNA base damage and catalysis: a radiation chemical investigation

    International Nuclear Information System (INIS)

    Sharma, Geeta K.

    2011-01-01

    In the emerging field of nanoscience and nanotechnology, tremendous focus has been made by researcher to explore the applications of nanomaterials for human welfare by converting the findings into technology. Some of the examples have been the use of nanoparticles in the field of opto-electronic, fuel cells, medicine and catalysis. These wide applications and significance lies in the fact that nanoparticles possess unique physical and chemical properties very different from their bulk precursors. Numerous methods for the synthesis of noble nanoparticles with tunable shape and size have been reported in literature. The goal of our group is to use different methods of synthesis of noble metal nanoparticles (Au, Ag, Pt and Pd) and test their protective/damaging role towards DNA base damage induced by ionizing radiation (Au and Ag) and to test the catalytic activity of nanoparticles (Pt and Pd) in certain known organic synthesis/electron transfer reactions. Using radiation chemical techniques such as pulse radiolysis and steady state radiolysis complemented by the product analysis using HPLC/LC-MS, a detailed mechanism for the formation of transient species, kinetics leading to the formation of stable end products is studied in the DNA base damage induced by ionizing radiation in presence and absence of Au and Ag nanoparticles. Unraveling the complex interaction between catalysts and reactants under operando conditions is a key step towards gaining fundamental insight in catalysis. The catalytic activity of Pt and Pd nanoparticles in electron transfer and Suzuki coupling reactions has been determined. Investigations are currently underway to gain insight into the interaction between catalysts and reactants using time resolved spectroscopic measurements. These studies will be detailed during the presentation. (author)

  11. The Role of DNA Methylation and Histone Modifications in Neurodegenerative Diseases: A Systematic Review.

    Directory of Open Access Journals (Sweden)

    Ke-Xin Wen

    Full Text Available Epigenetic modifications of the genome, such as DNA methylation and histone modifications, have been reported to play a role in neurodegenerative diseases (ND such as Alzheimer's disease (AD and Parkinson's disease (PD.To systematically review studies investigating epigenetic marks in AD or PD.Eleven bibliographic databases (Embase.com, Medline (Ovid, Web-of-Science, Scopus, PubMed, Cinahl (EBSCOhost, Cochrane Central, ProQuest, Lilacs, Scielo and Google Scholar were searched until July 11th 2016 to identify relevant articles. We included all randomized controlled trials, cohort, case-control and cross-sectional studies in humans that examined associations between epigenetic marks and ND. Two independent reviewers, with a third reviewer available for disagreements, performed the abstract and full text selection. Data was extracted using a pre-designed data collection form.Of 6,927 searched references, 73 unique case-control studies met our inclusion criteria. Overall, 11,453 individuals were included in this systematic review (2,640 AD and 2,368 PD outcomes. There was no consistent association between global DNA methylation pattern and any ND. Studies reported epigenetic regulation of 31 genes (including cell communication, apoptosis, and neurogenesis genes in blood and brain tissue in relation to AD and PD. Methylation at the BDNF, SORBS3 and APP genes in AD were the most consistently reported associations. Methylation of α-synuclein gene (SNCA was also found to be associated with PD. Seven studies reported histone protein alterations in AD and PD.Many studies have investigated epigenetics and ND. Further research should include larger cohort or longitudinal studies, in order to identify clinically significant epigenetic changes. Identifying relevant epigenetic changes could lead to interventional strategies in ND.

  12. Role of Protein Phosphorylation in the Regulation of Cell Cycle and DNA-Related Processes in Bacteria

    DEFF Research Database (Denmark)

    Garcia-Garcia, Transito; Poncet, Sandrine; Derouiche, Abderahmane

    2016-01-01

    In all living organisms, the phosphorylation of proteins modulates various aspects of their functionalities. In eukaryotes, protein phosphorylation plays a key role in cell signaling, gene expression, and differentiation. Protein phosphorylation is also involved in the global control of DNA repli...

  13. Role of protein structure and the role of individual fingers in zinc finger protein-DNA recognition: a molecular dynamics simulation study and free energy calculations

    Science.gov (United States)

    Hamed, Mazen Y.

    2018-05-01

    Molecular dynamics and MM_GBSA energy calculations on various zinc finger proteins containing three and four fingers bound to their target DNA gave insights into the role of each finger in the DNA binding process as part of the protein structure. The wild type Zif 268 (PDB code: 1AAY) gave a ΔG value of - 76.1 (14) kcal/mol. Zinc fingers ZF1, ZF2 and ZF3 were mutated in one experiment and in another experiment one finger was cut and the rest of the protein was studied for binding. The ΔΔG values for the Zinc Finger protein with both ZF1 and ZF2 mutated was + 80 kcal/mol, while mutating only ZF1 the ΔΔG value was + 52 kcal/mol (relative to the wild type). Cutting ZF3 and studying the protein consisting only of ZF1 linked to ZF2 gave a ΔΔG value of + 68 kcal/mol. Upon cutting ZF1, the resulting ZF2 linked to ZF3 protein gave a ΔΔG value of + 41 kcal/mol. The above results shed light on the importance of each finger in the binding process, especially the role of ZF1 as the anchoring finger followed in importance by ZF2 and ZF3. The energy difference between the binding of the wild type protein Zif268 (1AAY) and that for individual finger binding to DNA according to the formula: ΔΔGlinkers, otherstructuralfactors = ΔGzif268 - (ΔGF1+F2+F3) gave a value = - 44.5 kcal/mol. This stabilization can be attributed to the contribution of linkers and other structural factors in the intact protein in the DNA binding process. DNA binding energies of variant proteins of the wild type Zif268 which differ in their ZF1 amino acid sequence gave evidence of a good relationship between binding energy and recognition and specificity, this finding confirms the reported vital role of ZF1 in the ZF protein scanning and anchoring to the target DNA sequence. The role of hydrogen bonds in both specific and nonspecific amino acid-DNA contacts is discussed in relation to mutations. The binding energies of variant Zinc Finger proteins confirmed the role of ZF1 in the recognition

  14. Role of minor groove width and hydration pattern on amsacrine interaction with DNA.

    Directory of Open Access Journals (Sweden)

    Deepak K Jangir

    Full Text Available Amsacrine is an anilinoacridine derivative anticancer drug, used to treat a wide variety of malignancies. In cells, amsacrine poisons topoisomerase 2 by stabilizing DNA-drug-enzyme ternary complex. Presence of amsacrine increases the steady-state concentration of these ternary complexes which in turn hampers DNA replication and results in subsequent cell death. Due to reversible binding and rapid slip-out of amsacrine from DNA duplex, structural data is not available on amsacrine-DNA complexes. In the present work, we designed five oligonucleotide duplexes, differing in their minor groove widths and hydration pattern, and examined their binding with amsacrine using attenuated total reflection Fourier transform infrared (ATR-FTIR spectroscopy. Complexes of amsacrine with calf thymus DNA were also evaluated for a comparison. Our results demonstrate for the first time that amsacrine is not a simple intercalator; rather mixed type of DNA binding (intercalation and minor groove takes place between amsacrine and DNA. Further, this binding is highly sensitive towards the geometries and hydration patterns of different minor grooves present in the DNA. This study shows that ligand binding to DNA could be very sensitive to DNA base composition and DNA groove structures. Results demonstrated here could have implication for understanding cytotoxic mechanism of aminoacridine based anticancer drugs and provide directions to modify these drugs for better efficacy and few side-effects.

  15. A role for the weak DnaA binding sites in bacterial replication origins

    DEFF Research Database (Denmark)

    Charbon, Godefroid; Løbner-Olesen, Anders

    2011-01-01

    DnaA initiates the chromosomal DNA replication in nearly all bacteria, and replication origins are characterized by binding sites for the DnaA protein (DnaA-boxes) along with an ‘AT-rich’ region. However, great variation in number, spatial organization and specificity of DnaA-boxes is observed...... between species. In the study by Taylor et al. (2011), new and unexpectedly weak DnaA-boxes were identified within the Caulobacter crescentus origin of replication (Cori). The position of weak and stronger DnaA-boxes follows a pattern seen in Escherichia coli oriC. This raises the possibility...... that bacterial origins might be more alike than previously thought....

  16. Novel essential residues of Hda for interaction with DnaA in the regulatory inactivation of DnaA: unique roles for Hda AAA Box VI and VII motifs.

    Science.gov (United States)

    Nakamura, Kenta; Katayama, Tsutomu

    2010-04-01

    Escherichia coli ATP-DnaA initiates chromosomal replication. For preventing extra-initiations, a complex of ADP-Hda and the DNA-loaded replicase clamp promotes DnaA-ATP hydrolysis, yielding inactive ADP-DnaA. However, the Hda-DnaA interaction mode remains unclear except that the Hda Box VII Arg finger (Arg-153) and DnaA sensor II Arg-334 within each AAA(+) domain are crucial for the DnaA-ATP hydrolysis. Here, we demonstrate that direct and functional interaction of ADP-Hda with DnaA requires the Hda residues Ser-152, Phe-118 and Asn-122 as well as Hda Arg-153 and DnaA Arg-334. Structural analyses suggest intermolecular interactions between Hda Ser-152 and DnaA Arg-334 and between Hda Phe-118 and the DnaA Walker B motif region, in addition to an intramolecular interaction between Hda Asn-122 and Arg-153. These interactions likely sustain a specific association of ADP-Hda and DnaA, promoting DnaA-ATP hydrolysis. Consistently, ATP-DnaA and ADP-DnaA interact with the ADP-Hda-DNA-clamp complex with similar affinities. Hda Phe-118 and Asn-122 are contained in the Box VI region, and their hydrophobic and electrostatic features are basically conserved in the corresponding residues of other AAA(+) proteins, suggesting a conserved role for Box VI. These findings indicate novel interaction mechanisms for Hda-DnaA as well as a potentially fundamental mechanism in AAA(+) protein interactions.

  17. Determining the role of mother race in neonatal outcome of trisomies 21, 18 and 13 using cell free DNA analysis

    Directory of Open Access Journals (Sweden)

    Najmie Saadati

    2016-12-01

    Full Text Available To determine the role of mother race in neonatal outcome of trisomies 21, 18 and 13 using cell free DNA (cf-DNA analysis. All women administered for a sonographic imaging at their 10-22 weeks’ gestation which were qualified for cf-DNA testing were suggested for increasing aneuploidy risk, between March 1, 2015 to March 30 , 2016. The cf-DNA analysis was conducted after women received genetic counseling in a specialty laboratory. The results were validated by amniocentesis. A total of 1992 women were screened using cf-DNA analysis. The participants were 1631 Non Arabs (Fars, Kurd, and Lor and 361 Arabs. The fetus risk for trisomy 21 in the Arab women of Arab race was two as much as Non Arab race, but trisomies 18 and 13 in women of Non Arab race were more than Arab race. The role of mother race (such as Arab and Non Arab in neonatal outcome is very important.

  18. Does a role for selenium in DNA damage repair explain apparent controversies in its use in chemoprevention?

    Science.gov (United States)

    Diamond, Alan M.

    2013-01-01

    The trace element selenium is an essential micronutrient that has received considerable attention for its potential use in the prevention of cancer. In spite of this interest, the mechanism(s) by which selenium might function as a chemopreventive remain to be determined. Considerable experimental evidence indicates that one possible mechanism by which selenium supplementation may exert its benefits is by enhancing the DNA damage repair response, and this includes data obtained using cultured cells, animal models as well as in human clinical studies. In these studies, selenium supplementation has been shown to be beneficial in reducing the frequency of DNA adducts and chromosome breaks, consequentially reducing the likelihood of detrimental mutations that ultimately contribute to carcinogenesis. The benefits of selenium can be envisioned as being due, at least in part, to it being a critical constituent of selenoproteins such as glutathione peroxidases and thioredoxin reductases, proteins that play important roles in antioxidant defence and maintaining the cellular reducing environment. Selenium, therefore, may be protective by preventing DNA damage from occurring as well as by increasing the activity of repair enzymes such as DNA glycosylases and DNA damage repair pathways that involve p53, BRCA1 and Gadd45. An improved understanding of the mechanism of selenium’s impact on DNA repair processes may help to resolve the apparently contradicting data obtained from decades of animal work, human epidemiology and more recently, clinical supplementation studies. PMID:23204505

  19. Protective roles of bacterioruberin and intracellular KCl in the resistance of Halobacterium salinarium against DNA-damaging agents

    International Nuclear Information System (INIS)

    Shahmohammadi, H.R.; Asgarani, E.; Terato, Hiroaki; Saito, Takeshi; Ohyama, Yoshihiko; Gekko, Kunihiko; Yamamoto, Osamu; Ide, Hiroshi

    1998-01-01

    Halobacterium salinarium, a member of the extremely halophilic archaebacteria, contains a C 50 -carotenoid namely bacterioruberin. We have previously reported the high resistance of this organism against the lethal actions of DNA-damaging agents including ionizing radiation and ultraviolet light (UV). In this study, we have examined whether bacterioruberin and the highly concentrated salts in this bacterium play protective roles against the lethal actions of ionizing radiation, UV, hydrogen peroxide, and mitomycin-C (MMC). The colourless mutant of H. salinarium deficient in bacterioruberin was more sensitive than the red-pigmented wild-type to all tested DNA-damaging agents except MMC. Circular dichroism (CD) spectra of H. salinarium chromosomal DNA at various concentrations of KCl (0-3.5 M) were similar to that of B-DNA, indicating that no conformational changes occurred as a result of high salt concentrations. However, DNA strand-breaks induced by ionizing radiation were significantly reduced by the presence of either bacterioruberin or concentrated KCl, presumably due to scavenging of free radicals. These results suggest that bacterioruberin and intracellular KCl of H. salinarium protect this organism against the lethal effects of oxidative DNA-damaging agents. (author)

  20. Radiation-induced energy migration within solid DNA: The role of misonidazole as an electron trap

    International Nuclear Information System (INIS)

    Al-Kazwini, A.T.; O'Neill, P.; Adams, G.E.; Fielden, E.M.

    1990-01-01

    The in-pulse luminescence emission from solid DNA produced upon irradiation with electron pulses of energy below 260 keV has been investigated in vacuo at 293 K to gain an insight into the existence of radiation-induced charge/energy migration within DNA. The DNA samples contained misonidazole in the range 3 to 330 base pairs per misonidazole molecule. Under these conditions greater than 90% of the total energy is deposited in the DNA. The in-pulse radiation-induced luminescence spectrum of DNA was found to be critically dependent upon the misonidazole content of DNA. The luminescence intensity from the mixtures decreases with increasing content of misonidazole, and at the highest concentration, the intensity at 550 nm is reduced to 50% of that from DNA only. In the presence of 1 atm of oxygen, the observed emission intensity from DNA in the wavelength region 350-575 was reduced by 35-40% compared to that from DNA in vacuo. It is concluded that electron migration can occur in solid mixtures of DNA over a distance of up to about 100 base pairs

  1. Damaged DNA binding protein 2 plays a role in breast cancer cell growth.

    Directory of Open Access Journals (Sweden)

    Zilal Kattan

    Full Text Available The Damaged DNA binding protein 2 (DDB2, is involved in nucleotide excision repair as well as in other biological processes in normal cells, including transcription and cell cycle regulation. Loss of DDB2 function may be related to tumor susceptibility. However, hypothesis of this study was that DDB2 could play a role in breast cancer cell growth, resulting in its well known interaction with the proliferative marker E2F1 in breast neoplasia. DDB2 gene was overexpressed in estrogen receptor (ER-positive (MCF-7 and T47D, but not in ER-negative breast cancer (MDA-MB231 and SKBR3 or normal mammary epithelial cell lines. In addition, DDB2 expression was significantly (3.0-fold higher in ER-positive than in ER-negative tumor samples (P = 0.0208 from 16 patients with breast carcinoma. Knockdown of DDB2 by small interfering RNA in MCF-7 cells caused a decrease in cancer cell growth and colony formation. Inversely, introduction of the DDB2 gene into MDA-MB231 cells stimulated growth and colony formation. Cell cycle distribution and 5 Bromodeoxyuridine incorporation by flow cytometry analysis showed that the growth-inhibiting effect of DDB2 knockdown was the consequence of a delayed G1/S transition and a slowed progression through the S phase of MCF-7 cells. These results were supported by a strong decrease in the expression of S phase markers (Proliferating Cell Nuclear Antigen, cyclin E and dihydrofolate reductase. These findings demonstrate for the first time that DDB2 can play a role as oncogene and may become a promising candidate as a predictive marker in breast cancer.

  2. Role of DNA damage in ultraviolet (313 nm) inactivation of yeasts Saccharomyces cerevisial

    International Nuclear Information System (INIS)

    Pospelov, M.E.; Ivanova, Eh.V.; Frajkin, G.Ya.

    1984-01-01

    Relative contribution of photoinhibition of cell respiration and DNA damage to lethal effect, caused by ultraviolet (UV) radiation of 313 m in certain yeast strains Saccharomyces cerevisiae, has been studied. It is shown that cell inactivation is mainly conditioned by DNA photodamage. When studying photoreactivation it has been established, that dimers of pyrimidine bases are the main lethal photoproducts, formed in DNA Under the effect of UV-radiation of 313 nm

  3. The role of DNA base excision repair in brain homeostasis and disease

    DEFF Research Database (Denmark)

    Akbari, Mansour; Morevati, Marya; Croteau, Deborah

    2015-01-01

    Chemical modification and spontaneous loss of nucleotide bases from DNA are estimated to occur at the rate of thousands per human cell per day. DNA base excision repair (BER) is a critical mechanism for repairing such lesions in nuclear and mitochondrial DNA. Defective expression or function of p...... energy homeostasis, mitochondrial function and cellular bioenergetics, with especially strong influence on neurological function. Further studies in this area could lead to novel approaches to prevent and treat human neurodegenerative disease....

  4. Nuclear alpha spectrin: Critical roles in DNA interstrand cross-link repair and genomic stability

    OpenAIRE

    Lambert, Muriel W

    2016-01-01

    Non-erythroid alpha spectrin (?IISp) is a structural protein which we have shown is present in the nucleus of human cells. It interacts with a number of nuclear proteins such as actin, lamin, emerin, chromatin remodeling factors, and DNA repair proteins. ?IISp?s interaction with DNA repair proteins has been extensively studied. We have demonstrated that nuclear ?IISp is critical in DNA interstrand cross-link (ICL) repair in S phase, in both genomic (non-telomeric) and telomeric DNA, and in ma...

  5. Role of DNA Repair Factor Xeroderma Pigmentosum Protein Group C in Response to Replication Stress As Revealed by DNA Fragile Site Affinity Chromatography and Quantitative Proteomics.

    Science.gov (United States)

    Beresova, Lucie; Vesela, Eva; Chamrad, Ivo; Voller, Jiri; Yamada, Masayuki; Furst, Tomas; Lenobel, Rene; Chroma, Katarina; Gursky, Jan; Krizova, Katerina; Mistrik, Martin; Bartek, Jiri

    2016-12-02

    Replication stress (RS) fuels genomic instability and cancer development and may contribute to aging, raising the need to identify factors involved in cellular responses to such stress. Here, we present a strategy for identification of factors affecting the maintenance of common fragile sites (CFSs), which are genomic loci that are particularly sensitive to RS and suffer from increased breakage and rearrangements in tumors. A DNA probe designed to match the high flexibility island sequence typical for the commonly expressed CFS (FRA16D) was used as specific DNA affinity bait. Proteins significantly enriched at the FRA16D fragment under normal and replication stress conditions were identified using stable isotope labeling of amino acids in cell culture-based quantitative mass spectrometry. The identified proteins interacting with the FRA16D fragment included some known CFS stabilizers, thereby validating this screening approach. Among the hits from our screen so far not implicated in CFS maintenance, we chose Xeroderma pigmentosum protein group C (XPC) for further characterization. XPC is a key factor in the DNA repair pathway known as global genomic nucleotide excision repair (GG-NER), a mechanism whose several components were enriched at the FRA16D fragment in our screen. Functional experiments revealed defective checkpoint signaling and escape of DNA replication intermediates into mitosis and the next generation of XPC-depleted cells exposed to RS. Overall, our results provide insights into an unexpected biological role of XPC in response to replication stress and document the power of proteomics-based screening strategies to elucidate mechanisms of pathophysiological significance.

  6. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    Science.gov (United States)

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Roles of C-Terminal Region of Yeast and Human Rad52 in Rad51-Nucleoprotein Filament Formation and ssDNA Annealing.

    Directory of Open Access Journals (Sweden)

    Nilesh V Khade

    Full Text Available Yeast Rad52 (yRad52 has two important functions at homologous DNA recombination (HR; annealing complementary single-strand DNA (ssDNA molecules and recruiting Rad51 recombinase onto ssDNA (recombination mediator activity. Its human homolog (hRAD52 has a lesser role in HR, and apparently lacks mediator activity. Here we show that yRad52 can load human Rad51 (hRAD51 onto ssDNA complexed with yeast RPA in vitro. This is biochemically equivalent to mediator activity because it depends on the C-terminal Rad51-binding region of yRad52 and on functional Rad52-RPA interaction. It has been reported that the N-terminal two thirds of both yRad52 and hRAD52 is essential for binding to and annealing ssDNA. Although a second DNA binding region has been found in the C-terminal region of yRad52, its role in ssDNA annealing is not clear. In this paper, we also show that the C-terminal region of yRad52, but not of hRAD52, is involved in ssDNA annealing. This suggests that the second DNA binding site is required for the efficient ssDNA annealing by yRad52. We propose an updated model of Rad52-mediated ssDNA annealing.

  8. Multifunctional Role of ATM/Tel1 Kinase in Genome Stability: From the DNA Damage Response to Telomere Maintenance

    Science.gov (United States)

    2014-01-01

    The mammalian protein kinase ataxia telangiectasia mutated (ATM) is a key regulator of the DNA double-strand-break response and belongs to the evolutionary conserved phosphatidylinositol-3-kinase-related protein kinases. ATM deficiency causes ataxia telangiectasia (AT), a genetic disorder that is characterized by premature aging, cerebellar neuropathy, immunodeficiency, and predisposition to cancer. AT cells show defects in the DNA damage-response pathway, cell-cycle control, and telomere maintenance and length regulation. Likewise, in Saccharomyces cerevisiae, haploid strains defective in the TEL1 gene, the ATM ortholog, show chromosomal aberrations and short telomeres. In this review, we outline the complex role of ATM/Tel1 in maintaining genomic stability through its control of numerous aspects of cellular survival. In particular, we describe how ATM/Tel1 participates in the signal transduction pathways elicited by DNA damage and in telomere homeostasis and its importance as a barrier to cancer development. PMID:25247188

  9. Protective role of 3-nitrotyrosine against gamma radiation-induced DNA strand breaks: A comparison study with tyrosine

    International Nuclear Information System (INIS)

    Shi Weiqun; Ni Meinan; Kong Fuquan; Sui Li; Hu Jia; Xu Diandou; Li Yanmei

    2008-01-01

    3-Nitrotyrosine(3-NY) has been reported as a potential source of reactive oxygen species (ROSs). In this work, plasmid pBR322 DNA was irradiated by gamma rays in aqueous solution in presence and absence of 3-NY, DNA strand breaks were analyzed by neutral electrophoresis followed by quantification with image analysis software. It was found that the presence of 3-NY could effectively reduce radiation-induced DNA strand breaks. A side-by-side comparison was performed between 3-NY and tyrosine, the results showed that the protective role 3-NY was comparable with tyrosine, which might imply that protein tyrosine nitration might not significantly decrease its ability as a free radical scavenger

  10. Evidence for the role of Mycobacterium tuberculosis RecG helicase in DNA repair and recombination.

    Science.gov (United States)

    Thakur, Roshan S; Basavaraju, Shivakumar; Somyajit, Kumar; Jain, Akshatha; Subramanya, Shreelakshmi; Muniyappa, Kalappa; Nagaraju, Ganesh

    2013-04-01

    In order to survive and replicate in a variety of stressful conditions during its life cycle, Mycobacterium tuberculosis must possess mechanisms to safeguard the integrity of the genome. Although DNA repair and recombination related genes are thought to play key roles in the repair of damaged DNA in all organisms, so far only a few of them have been functionally characterized in the tubercle bacillus. In this study, we show that M. tuberculosis RecG (MtRecG) expression was induced in response to different genotoxic agents. Strikingly, expression of MtRecG in Escherichia coli ∆recG mutant strain provided protection against mitomycin C, methyl methane sulfonate and UV induced cell death. Purified MtRecG exhibited higher binding affinity for the Holliday junction (HJ) compared with a number of canonical recombinational DNA repair intermediates. Notably, although MtRecG binds at the core of the mobile and immobile HJs, and with higher binding affinity for the immobile HJ, branch migration was evident only in the case of the mobile HJ. Furthermore, immobile HJs stimulate MtRecG ATPase activity less efficiently than mobile HJs. In addition to HJ substrates, MtRecG exhibited binding affinity for a variety of branched DNA structures including three-way junctions, replication forks, flap structures, forked duplex and a D-loop structure, but demonstrated strong unwinding activity on replication fork and flap DNA structures. Together, these results support that MtRecG plays an important role in processes related to DNA metabolism under normal as well as stress conditions. © 2013 The Authors Journal compilation © 2013 FEBS.

  11. Susceptibility patterns and the role of extracellular DNA in Staphylococcus epidermidis biofilm resistance to physico-chemical stress exposure.

    Science.gov (United States)

    Olwal, Charles Ochieng'; Ang'ienda, Paul Oyieng'; Onyango, David Miruka; Ochiel, Daniel Otieno

    2018-05-02

    Over 65% of human infections are ascribed to bacterial biofilms that are often highly resistant to antibiotics and host immunity. Staphylococcus epidermidis is the predominant cause of recurrent nosocomial and biofilm-related infections. However, the susceptibility patterns of S. epidermidis biofilms to physico-chemical stress induced by commonly recommended disinfectants [(heat, sodium chloride (NaCl), sodium hypochlorite (NaOCl) and hydrogen peroxide (H 2 O 2 )] in domestic and human healthcare settings remains largely unknown. Further, the molecular mechanisms of bacterial biofilms resistance to the physico-chemical stresses remain unclear. Growing evidence demonstrates that extracellular DNA (eDNA) protects bacterial biofilms against antibiotics. However, the role of eDNA as a potential mechanism underlying S. epidermidis biofilms resistance to physico-chemical stress exposure is yet to be understood. Therefore, this study aimed to evaluate the susceptibility patterns of and eDNA release by S. epidermidis biofilm and planktonic cells to physico-chemical stress exposure. S. epidermidis biofilms exposed to physico-chemical stress conditions commonly recommended for disinfection [heat (60 °C), 1.72 M NaCl, solution containing 150 μL of waterguard (0.178 M NaOCl) in 1 L of water or 1.77 M H 2 O 2 ] for 30 and 60 min exhibited lower log reductions of CFU/mL than the corresponding planktonic cells (p chemical stress induced by the four commonly recommended disinfectants than the analogous planktonic cells. Further, S. epidermidis biofilms enhanced eDNA release in response to the sub-lethal heat and oxidative stress exposure than the corresponding planktonic cells suggesting a role of eDNA in biofilms resistance to the physico-chemical stresses.

  12. The role of DNA double-strand breaks in spontaneous homologous recombination in S. cerevisiae

    DEFF Research Database (Denmark)

    Lettier, Gaëlle; Feng, Q.; Mayolo, A.A. de

    2006-01-01

    of meiosis and result from the induction of a large number of DNA double-strand breaks (DSBs). By analogy, it is generally believed that the rare spontaneous mitotic HR events are due to repair of DNA DSBs that accidentally occur during mitotic growth. Here we provide the first direct evidence that most...

  13. Role of the CCA bulge of prohead RNA of bacteriophage ø29 in DNA packaging.

    Science.gov (United States)

    Zhao, Wei; Morais, Marc C; Anderson, Dwight L; Jardine, Paul J; Grimes, Shelley

    2008-11-14

    The oligomeric ring of prohead RNA (pRNA) is an essential component of the ATP-driven DNA packaging motor of bacteriophage ø29. The A-helix of pRNA binds the DNA translocating ATPase gp16 (gene product 16) and the CCA bulge in this helix is essential for DNA packaging in vitro. Mutation of the bulge by base substitution or deletion showed that the size of the bulge, rather than its sequence, is primary in DNA packaging activity. Proheads reconstituted with CCA bulge mutant pRNAs bound the packaging ATPase gp16 and the packaging substrate DNA-gp3, although DNA translocation was not detected with several mutants. Prohead/bulge-mutant pRNA complexes with low packaging activity had a higher rate of ATP hydrolysis per base pair of DNA packaged than proheads with wild-type pRNA. Cryoelectron microscopy three-dimensional reconstruction of proheads reconstituted with a CCA deletion pRNA showed that the protruding pRNA spokes of the motor occupy a different position relative to the head when compared to particles with wild-type pRNA. Therefore, the CCA bulge seems to dictate the orientation of the pRNA spokes. The conformational changes observed for this mutant pRNA may affect gp16 conformation and/or subsequent ATPase-DNA interaction and, consequently, explain the decreased packaging activity observed for CCA mutants.

  14. Role of DNA polymerase α in chromosomal aberration production by ionizing radiation

    International Nuclear Information System (INIS)

    Bender, M.A.

    1983-01-01

    Aphidicolin is a tetracyclic diterpinoid fungal antibiotic which inhibits DNA synthesis in eukaryotic cells by interfering specifically with DNA polymerase α, apparently by binding to and inactivating the DNA-polymerase α complex. We have shown that aphidicolin, like other inhibitors of DNA synthesis, both induces chromosomal aberrations in human peripheral lymphocytes, and, as a post-treatment, interacts synergistically with x rays to produce greatly enhanced aberration yields. The present experiments explore the effects of aphidicolin in human lymphocytes in the post-DNA-synthetic G 2 phase of the cell cycle. These experiments utilized labeling with tritiated thymidine to positively identify cells in the S phase at the time of treatment, and used serial colcemid collections and fixations to determine aberration yields over as much of the G 2 phase as feasible. Because DNA polymerase α is the only DNA synthetic or repair enzyme known to be affected by aphidicolin, we infer that this enzyme is directly involved in the repair of DNA lesions which can result in visible chromosomal aberrations. (DT)

  15. Possible role of mtDNA depletion and respiratory chain defects in aristolochic acid I-induced acute nephrotoxicity

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, Zhenzhou, E-mail: jiangcpu@yahoo.com.cn; Bao, Qingli, E-mail: bao_ql@126.com; Sun, Lixin, E-mail: slxcpu@126.com; Huang, Xin, E-mail: huangxinhx66@sohu.com; Wang, Tao, E-mail: wangtao1331@126.com; Zhang, Shuang, E-mail: cat921@sina.com; Li, Han, E-mail: hapo1101@163.com; Zhang, Luyong, E-mail: lyzhang@cpu.edu.cn

    2013-01-15

    This report describes an investigation of the pathological mechanism of acute renal failure caused by toxic tubular necrosis after treatment with aristolochic acid I (AAI) in Sprague–Dawley (SD) rats. The rats were gavaged with AAI at 0, 5, 20, or 80 mg/kg/day for 7 days. The pathologic examination of the kidneys showed severe acute tubular degenerative changes primarily affecting the proximal tubules. Supporting these results, we detected significantly increased concentrations of blood urea nitrogen (BUN) and creatinine (Cr) in the rats treated with AAI, indicating damage to the kidneys. Ultrastructural examination showed that proximal tubular mitochondria were extremely enlarged and dysmorphic with loss and disorientation of their cristae. Mitochondrial function analysis revealed that the two indicators for mitochondrial energy metabolism, the respiratory control ratio (RCR) and ATP content, were reduced in a dose-dependent manner after AAI treatment. The RCR in the presence of substrates for complex I was reduced more significantly than in the presence of substrates for complex II. In additional experiments, the activity of respiratory complex I, which is partly encoded by mitochondrial DNA (mtDNA), was more significantly impaired than that of respiratory complex II, which is completely encoded by nuclear DNA (nDNA). A real-time PCR assay revealed a marked reduction of mtDNA in the kidneys treated with AAI. Taken together, these results suggested that mtDNA depletion and respiratory chain defects play critical roles in the pathogenesis of kidney injury induced by AAI, and that the same processes might contribute to aristolochic acid-induced nephrotoxicity in humans. -- Highlights: ► AAI-induced acute renal failure in rats and the proximal tubule was the target. ► Tubular mitochondria were morphologically aberrant in ultrastructural examination. ► AAI impair mitochondrial bioenergetic function and mtDNA replication.

  16. Two Tetrahymena G-DNA-binding proteins, TGP1 and TGP3, share novel motifs and may play a role in micronuclear division

    OpenAIRE

    Lu, Quan; Henderson, Eric

    2000-01-01

    G-DNA is a four-stranded DNA structure with diverse putative biological roles. We have previously purified and cloned a novel G-DNA-binding protein TGP1 from the ciliate Tetrahymena thermophila. Here we report the molecular cloning of TGP3, an additional G-DNA-binding protein from the same organism. The TGP3 cDNA encodes a 365 amino acid protein that is homologous to TGP1 (34% identity and 44% similarity). The proteins share a sequence pattern that contains two novel repetitive and homologous...

  17. NMR assignments for the amino-terminal residues of trp repressor and their role in DNA binding

    International Nuclear Information System (INIS)

    Arrowsmith, C.H.; Carey, J.; Treat-Clemons, L.; Jardetzky, O.

    1989-01-01

    The trp repressor of Escherichia coli specifically binds to operator DNAs in three operons involved in tryptophan metabolism. The NMR spectra of repressor and a chymotryptic fragment lacking the six amino-terminal residues are compared. Two-dimensional J-correlated spectra of the two forms of the protein are superimposable except for cross-peaks that are associated with the N-terminal region. The chemical shifts and relaxation behavior of the N-terminal resonances suggest mobile arms. Spin-echo experiments on a ternary complex of repressor with L-tryptophan and operator DNA indicate that the termini are also disordered in the complex, although removal of the arms reduces the DNA binding energy. Relaxation measurements on the armless protein show increased mobility for several residues, probably due to helix fraying in the newly exposed N-terminal region. DNA binding by the armless protein does not reduce the mobility of these residues. Thus, it appears that the arms serve to stabilize the N-terminal helix but that this structural role does not explain their contribution to the DNA binding energy. These results suggest that the promiscuous DNA binding by the arms seen in the X-ray crystal structure is found in solution as well

  18. Excision of deaminated cytosine from the vertebrate genome: role of the SMUG1 uracil–DNA glycosylase

    Science.gov (United States)

    Nilsen, Hilde; Haushalter, Karl A.; Robins, Peter; Barnes, Deborah E.; Verdine, Gregory L.; Lindahl, Tomas

    2001-01-01

    Gene-targeted mice deficient in the evolutionarily conserved uracil–DNA glycosylase encoded by the UNG gene surprisingly lack the mutator phenotype characteristic of bacterial and yeast ung– mutants. A complementary uracil–DNA glycosylase activity detected in ung–/– murine cells and tissues may be responsible for the repair of deaminated cytosine residues in vivo. Here, specific neutralizing antibodies were used to identify the SMUG1 enzyme as the major uracil–DNA glycosylase in UNG-deficient mice. SMUG1 is present at similar levels in cell nuclei of non-proliferating and proliferating tissues, indicating a replication- independent role in DNA repair. The SMUG1 enzyme is found in vertebrates and insects, whereas it is absent in nematodes, plants and fungi. We propose a model in which SMUG1 has evolved in higher eukaryotes as an anti-mutator distinct from the UNG enzyme, the latter being largely localized to replication foci in mammalian cells to counteract de novo dUMP incorporation into DNA. PMID:11483530

  19. Role of DNA mismatch repair and p53 in signaling induction of apoptosis by alkylating agents

    OpenAIRE

    Hickman, Mark J.; Samson, Leona D.

    1999-01-01

    All cells are unavoidably exposed to chemicals that can alkylate DNA to form genotoxic damage. Among the various DNA lesions formed, O6-alkylguanine lesions can be highly cytotoxic, and we recently demonstrated that O6-methylguanine (O6MeG) and O6-chloroethylguanine (O6CEG) specifically initiate apoptosis in hamster cells. Here we show, in both hamster and human cells, that the MutSα branch of the DNA mismatch repair pathway (but not the MutSβ branch) is absolutely required for signaling the ...

  20. Role of Mitochondrial DNA Mutations in Cellular Vulnerability to Mitochondria-Specific Environmental Toxins

    National Research Council Canada - National Science Library

    Hirsch, Etienne C

    2005-01-01

    .... To test such a hypothesis in Parkinson's disease we proposed to: 1) develop an animal model with accumulated mtDNA mutations in catecholaminergic neurons by creating a transgenic mouse containing a tyrosine hydroxylase (TH...

  1. A dual role of extracellular DNA during biofilm formation of Neisseria meningitidis

    DEFF Research Database (Denmark)

    Lappann, M.; Claus, H.; van Alen, T.

    2010-01-01

    formation, whereas biofilm formation of cc with low point prevalence (ST-8 cc and ST-11 cc) was eDNA-independent. For initial biofilm formation, a ST-32 cc type strain, but not a ST-11 type strain, utilized eDNA. The release of eDNA was mediated by lytic transglycosylase and cytoplasmic N......-acetylmuramyl-l-alanine amidase genes. In late biofilms, outer membrane phospholipase A-dependent autolysis, which was observed in most cc, but not in ST-8 and ST-11 strains, was required for shear force resistance of microcolonies. Taken together, N. meningitidis evolved two different biofilm formation strategies, an e....... On the contrary, spreaders (ST-11 and ST-8 cc) are unable to use eDNA for biofilm formation and might compensate for poor colonization properties by high transmission rates....

  2. A combinatorial role for MutY and Fpg DNA glycosylases in mutation avoidance in Mycobacterium smegmatis

    International Nuclear Information System (INIS)

    Hassim, Farzanah; Papadopoulos, Andrea O.; Kana, Bavesh D.; Gordhan, Bhavna G.

    2015-01-01

    Highlights: • We studied the combined role of MutY and Fpg DNA glycosylases in M. smegmatis. • Loss of MutY showed increased sensitivity to oxidative damage. • Loss of MutY together with the Fpg glycosylases showed increased mutation rates. • Our data indicate interplay between these enzymes to control mutagenesis. - Abstract: Hydroxyl radical (·OH) among reactive oxygen species cause damage to nucleobases with thymine being the most susceptible, whilst in contrast, the singlet oxygen ( 1 0 2 ) targets only guanine bases. The high GC content of mycobacterial genomes predisposes these organisms to oxidative damage of guanine. The exposure of cellular DNA to ·OH and one-electron oxidants results in the formation of two main degradation products, the pro-mutagenic 8-oxo-7,8-dihydroguanine (8-oxoGua) and the cytotoxic 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). These lesions are repaired through the base excision repair (BER) pathway and we previously, demonstrated a combinatorial role for the mycobacterial Endonuclease III (Nth) and the Nei family of DNA glycosylases in mutagenesis. In addition, the formamidopyrimidine (Fpg/MutM) and MutY DNA glycosylases have also been implicated in mutation avoidance and BER in mycobacteria. In this study, we further investigate the combined role of MutY and the Fpg/Nei DNA glycosylases in Mycobacterium smegmatis and demonstrate that deletion of mutY resulted in enhanced sensitivity to oxidative stress, an effect which was not exacerbated in Δfpg1 Δfpg2 or Δnei1 Δnei2 double mutant backgrounds. However, combinatorial loss of the mutY, fpg1 and fpg2 genes resulted in a significant increase in mutation rates suggesting interplay between these enzymes. Consistent with this, there was a significant increase in C → A mutations with a corresponding change in cell morphology of rifampicin resistant mutants in the Δfpg1 Δfpg2 ΔmutY deletion mutant. In contrast, deletion of mutY together with the nei homologues

  3. A combinatorial role for MutY and Fpg DNA glycosylases in mutation avoidance in Mycobacterium smegmatis

    Energy Technology Data Exchange (ETDEWEB)

    Hassim, Farzanah; Papadopoulos, Andrea O.; Kana, Bavesh D.; Gordhan, Bhavna G., E-mail: bhavna.gordhan@nhls.ac.za

    2015-09-15

    Highlights: • We studied the combined role of MutY and Fpg DNA glycosylases in M. smegmatis. • Loss of MutY showed increased sensitivity to oxidative damage. • Loss of MutY together with the Fpg glycosylases showed increased mutation rates. • Our data indicate interplay between these enzymes to control mutagenesis. - Abstract: Hydroxyl radical (·OH) among reactive oxygen species cause damage to nucleobases with thymine being the most susceptible, whilst in contrast, the singlet oxygen ({sup 1}0{sub 2}) targets only guanine bases. The high GC content of mycobacterial genomes predisposes these organisms to oxidative damage of guanine. The exposure of cellular DNA to ·OH and one-electron oxidants results in the formation of two main degradation products, the pro-mutagenic 8-oxo-7,8-dihydroguanine (8-oxoGua) and the cytotoxic 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). These lesions are repaired through the base excision repair (BER) pathway and we previously, demonstrated a combinatorial role for the mycobacterial Endonuclease III (Nth) and the Nei family of DNA glycosylases in mutagenesis. In addition, the formamidopyrimidine (Fpg/MutM) and MutY DNA glycosylases have also been implicated in mutation avoidance and BER in mycobacteria. In this study, we further investigate the combined role of MutY and the Fpg/Nei DNA glycosylases in Mycobacterium smegmatis and demonstrate that deletion of mutY resulted in enhanced sensitivity to oxidative stress, an effect which was not exacerbated in Δfpg1 Δfpg2 or Δnei1 Δnei2 double mutant backgrounds. However, combinatorial loss of the mutY, fpg1 and fpg2 genes resulted in a significant increase in mutation rates suggesting interplay between these enzymes. Consistent with this, there was a significant increase in C → A mutations with a corresponding change in cell morphology of rifampicin resistant mutants in the Δfpg1 Δfpg2 ΔmutY deletion mutant. In contrast, deletion of mutY together with the nei

  4. Do mtDNA Deletions Play a Role in the Development of Nasal Polyposis?

    Directory of Open Access Journals (Sweden)

    Arzu Tatar

    2014-04-01

    Full Text Available Objective:Nasal polyposis (NP is an inflammatory disease of the nasal mucosa and paranasal sinuses. Mitochondria are the cellular organelles which produce cellular energy by Oxidative Phosphorylation (OXPHOS, and they have own inheritance material, mtDNA. mtDNA is affected by reactive oxygen samples (ROS which are produced by both OXPHOS and the inflammatory process. The aim of this study was to investigate the 4977 bp and 7400 bp deletions of mtDNA in nasal polyposis tissue, and to indicate the possible association of mtDNA deletions with NP. Methods:Thirty-three patients, aged 15 to 65 years, with nasal polyposis were selected to be assessed for mitochondrial DNA deletions. The patients with possible mtDNA mutations due to mitochondrial disease, being treated with radiotherapy, of advanced age, with a familiar history, aspirin hypersensitivity, or a history of asthma, were excluded. Polyp excision surgery was applied to the treatment of the NP, and after histopathological diagnosis 1x1 cm of polyp tissue samples were used to isolate mtDNA. The 4977 bp and 7400 bp deletion regions, and two control regions of mtDNA were assessed by using four pairs of primers. DNA extractions from the NP tissues and peripheral blood samples of the patients were made, and then Polymerase Chain Reactions (PCR were made. PCR products were separated in 2% agarose gel.Results:No patient had either the 4977 bp deletion or the 7400 bp deletion in their NP tissue, and neither were these deletions evident in their peripheral blood. Two control sequences, one of them from a non-deleted region, and the other from a possible deletion region, were detected in the NP tissues and peripheral blood of all the patients.Conclusions:We had anticipated that some mtDNA deletion might have occurred in NP tissue due to the increased ROS levels caused by chronic inflammation, but we did not detect any deletion. Probably, the duration of inflammation in NP is insufficient to form mtDNA

  5. Translocation of DNA Molecules through Nanopores with Salt Gradients: The Role of Osmotic Flow

    Science.gov (United States)

    Hatlo, Marius M.; Panja, Debabrata; van Roij, René

    2011-08-01

    Recent experiments of translocation of double-stranded DNA through nanopores [M. Wanunu , Nature Nanotech. 5, 160 (2009)NNAABX1748-338710.1038/nnano.2009.379] reveal that the DNA capture rate can be significantly influenced by a salt gradient across the pore. We show that osmotic flow combined with electrophoretic effects can quantitatively explain the experimental data on the salt-gradient dependence of the capture rate.

  6. Molecular genetic analysis of a vaccinia virus gene with an essential role in DNA replication

    International Nuclear Information System (INIS)

    Evans, E.V.A.

    1989-01-01

    The poxvirus, vaccinia, is large DNA virus which replicates in the cytoplasma of the host cell. The virus is believed to encode most or all of the functions required for the temporally regulated transcription and replication of its 186 kilobase genome. Physical and genetic autonomy from the host make vaccinia a useful eukaryotic organism in which to study replication genes and proteins, using a combination of biochemical and genetic techniques. Essential viral functions for replication are identified by conditional lethal mutants that fail to synthesize DNA at the non-permissive temperatures. One such group contains the non-complementing alleles ts17, ts24, ts69 (WR strain). Studies were undertaken to define the phenotype of ts mutants, and to identify and characterize the affected gene and protein. Mutant infection was essentially normal at 32 degree C, but at 39 degree C the mutants did not incorporate 3 H-thymidine into nascent viral DNA or synthesize late viral proteins. If mutant cultures were shifted to non-permissive conditions at the height of replication, DNA synthesis was halted rapidly, implying that the mutants are defective in DNA elongation. The gene affected in the WR mutants and in ts6389, a DNA-minus mutant of the IHD strain, was mapped by marker rescue and corresponds to open reading frame 5 (orfD5) of the viral HindIII D fragment

  7. Role of methionine on epigenetic modification of DNA methylation and gene expression in animals

    Directory of Open Access Journals (Sweden)

    Naifeng Zhang

    2018-03-01

    Full Text Available DNA methylation is one of the main epigenetic phenomena affecting gene expression. It is an important mechanism for the development of embryo, growth and health of animals. As a key nutritional factor limiting the synthesis of protein, methionine serves as the precursor of S-adenosylmethionine (SAM in the hepatic one-carbon metabolism. The dietary fluctuation of methionine content can alter the levels of metabolic substrates in one-carbon metabolism, e.g., the SAM, S-adenosylhomocysteine (SAH, and change the expression of genes related to the growth and health of animals by DNA methylation reactions. The ratio of SAM to SAH is called ‘methylation index’ but it should be carefully explained because the complexity of methylation reaction. Alterations of methylation in a specific cytosine-guanine (CpG site, rather than the whole promoter region, might be enough to change gene expression. Aberrant methionine cycle may provoke molecular changes of one-carbon metabolism that results in deregulation of cellular hemostasis and health problems. The importance of DNA methylation has been underscored but the mechanisms of methionine affecting DNA methylation are poorly understood. Nutritional epigenomics provides a promising insight into the targeting epigenetic changes in animals from a nutritional standpoint, which will deepen and expand our understanding of genes, molecules, tissues, and animals in which methionine alteration influences DNA methylation and gene expression. Keywords: Epigenetics, Methionine, DNA methylation, Gene expression, Epigenetic modification

  8. Striking Plasticity of CRISPR-Cas9 and Key Role of Non-target DNA, as Revealed by Molecular Simulations.

    Science.gov (United States)

    Palermo, Giulia; Miao, Yinglong; Walker, Ross C; Jinek, Martin; McCammon, J Andrew

    2016-10-26

    The CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 system recently emerged as a transformative genome-editing technology that is innovating basic bioscience and applied medicine and biotechnology. The endonuclease Cas9 associates with a guide RNA to match and cleave complementary sequences in double stranded DNA, forming an RNA:DNA hybrid and a displaced non-target DNA strand. Although extensive structural studies are ongoing, the conformational dynamics of Cas9 and its interplay with the nucleic acids during association and DNA cleavage are largely unclear. Here, by employing multi-microsecond time scale molecular dynamics, we reveal the conformational plasticity of Cas9 and identify key determinants that allow its large-scale conformational changes during nucleic acid binding and processing. We show how the "closure" of the protein, which accompanies nucleic acid binding, fundamentally relies on highly coupled and specific motions of the protein domains, collectively initiating the prominent conformational changes needed for nucleic acid association. We further reveal a key role of the non-target DNA during the process of activation of the nuclease HNH domain, showing how the nontarget DNA positioning triggers local conformational changes that favor the formation of a catalytically competent Cas9. Finally, a remarkable conformational plasticity is identified as an intrinsic property of the HNH domain, constituting a necessary element that allows for the HNH repositioning. These novel findings constitute a reference for future experimental studies aimed at a full characterization of the dynamic features of the CRISPR-Cas9 system, and-more importantly-call for novel structure engineering efforts that are of fundamental importance for the rational design of new genome-engineering applications.

  9. Role for Artemis nuclease in the repair of radiation-induced DNA double strand breaks by alternative end joining.

    Science.gov (United States)

    Moscariello, Mario; Wieloch, Radi; Kurosawa, Aya; Li, Fanghua; Adachi, Noritaka; Mladenov, Emil; Iliakis, George

    2015-07-01

    Exposure of cells to ionizing radiation or radiomimetic drugs generates DNA double-strand breaks that are processed either by homologous recombination repair (HRR), or by canonical, DNA-PKcs-dependent non-homologous end-joining (C-NHEJ). Chemical or genetic inactivation of factors involved in C-NHEJ or HRR, but also their local failure in repair proficient cells, promotes an alternative, error-prone end-joining pathway that serves as backup (A-EJ). There is evidence for the involvement of Artemis endonuclease, a protein deficient in a human radiosensitivity syndrome associated with severe immunodeficiency (RS-SCID), in the processing of subsets of DSBs by HRR or C-NHEJ. It is thought that within HRR or C-NHEJ Artemis processes DNA termini at complex DSBs. Whether Artemis has a role in A-EJ remains unknown. Here, we analyze using pulsed-field gel electrophoresis (PFGE) and specialized reporter assays, DSB repair in wild-type pre-B NALM-6 lymphocytes, as well as in their Artemis(-/-), DNA ligase 4(-/-) (LIG4(-/-)), and LIG4(-/-)/Artemis(-/-) double mutant counterparts, under conditions allowing evaluation of A-EJ. Our results substantiate the suggested roles of Artemis in C-NHEJ and HRR, but also demonstrate a role for the protein in A-EJ that is confirmed in Artemis deficient normal human fibroblasts. We conclude that Artemis is a nuclease participating in DSB repair by all major repair pathways. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Kub5-Hera, the human Rtt103 homolog, plays dual functional roles in transcription termination and DNA repair.

    Science.gov (United States)

    Morales, Julio C; Richard, Patricia; Rommel, Amy; Fattah, Farjana J; Motea, Edward A; Patidar, Praveen L; Xiao, Ling; Leskov, Konstantin; Wu, Shwu-Yuan; Hittelman, Walter N; Chiang, Cheng-Ming; Manley, James L; Boothman, David A

    2014-04-01

    Functions of Kub5-Hera (In Greek Mythology Hera controlled Artemis) (K-H), the human homolog of the yeast transcription termination factor Rtt103, remain undefined. Here, we show that K-H has functions in both transcription termination and DNA double-strand break (DSB) repair. K-H forms distinct protein complexes with factors that repair DSBs (e.g. Ku70, Ku86, Artemis) and terminate transcription (e.g. RNA polymerase II). K-H loss resulted in increased basal R-loop levels, DSBs, activated DNA-damage responses and enhanced genomic instability. Significantly lowered Artemis protein levels were detected in K-H knockdown cells, which were restored with specific K-H cDNA re-expression. K-H deficient cells were hypersensitive to cytotoxic agents that induce DSBs, unable to reseal complex DSB ends, and showed significantly delayed γ-H2AX and 53BP1 repair-related foci regression. Artemis re-expression in K-H-deficient cells restored DNA-repair function and resistance to DSB-inducing agents. However, R loops persisted consistent with dual roles of K-H in transcription termination and DSB repair.

  11. The Role of DNA Methylation Changes in Radiation-Induced Transgenerational Genomic Instability and Bystander Effects in cranial irradiated Mice

    Science.gov (United States)

    Zhang, Meng; Sun, Yeqing; Gao, Yinglong; Zhang, Baodong

    Heavy-ion radiation could lead to genome instability in the germline, and therefore to transgenerational genome and epigenome instability in offspring of exposed males. The exact mechanisms of radiation-induced genome instability in directly exposed and in bystander organ remain obscure, yet accumulating evidence points to the role of DNA methylation changes in genome instability development. The potential of localized body-part exposures to affect the germline and thus induce genome and epigenome changes in the progeny has not been studied. To investigate whether or not the paternal cranial irradiation can exert deleterious changes in the protected germline and the offsprings, we studied the alteration of DNA methylation in the shielded testes tissue. Here we report that the localized paternal cranial irradiation results in a significant altered DNA methylation in sperm cells and leads to a profound epigenetic dysregulation in the unexposed progeny conceived 3 months after paternal exposure. The possible molecular mechanisms and biological consequences of the observed changes are discussed. Keywords: Heavy-ion radiation; Transgenerational effect; Genomic Instability Bystander Effects; DNA methylation.

  12. Protective role of quercetin against copper(II)-induced oxidative stress: A spectroscopic, theoretical and DNA damage study.

    Science.gov (United States)

    Jomova, Klaudia; Lawson, Michael; Drostinova, Lenka; Lauro, Peter; Poprac, Patrik; Brezova, Vlasta; Michalik, Martin; Lukes, Vladimir; Valko, Marian

    2017-12-01

    The radical scavenging and metal chelating properties of flavonoids indicate that they may play a protective role in diseases with perturbed metal homeostasis such as Alzheimer's disease. In this work we investigated the effect of the coordination of quercetin to copper(II) in view of the formation of ROS in Cu-catalyzed Fenton reaction. ABTS and DPPH assays confirmed that the copper(II)-quercetin complex exhibits a stronger radical scavenging activity than does quercetin alone. EPR spin trapping experiments have shown that chelation of quercetin to copper significantly suppressed the formation of hydroxyl radicals in the Cu(II)-Fenton reaction. DNA damage experiments revealed a protective effect for quercetin, but only at higher stoichiometric ratios of quercetin relative to copper. DNA protective effect of quercetin against ROS attack was described by two mechanisms. The first mechanism lies in suppressed formation of ROS due to the decreased catalytic action of copper in the Fenton reaction, as a consequence of its chelation and direct scavenging of ROS by free quercetin. Since the Cu-quercetin complex intercalates into DNA, the second mechanism was attributed to a suppressed intercalating ability of the Cu-quercetin complex due to the mildly intercalating free quercetin into DNA, thus creating a protective wall against stronger intercalators. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Role of DNA methylation and epigenetic silencing of HAND2 in endometrial cancer development.

    Directory of Open Access Journals (Sweden)

    Allison Jones

    2013-11-01

    Full Text Available Endometrial cancer incidence is continuing to rise in the wake of the current ageing and obesity epidemics. Much of the risk for endometrial cancer development is influenced by the environment and lifestyle. Accumulating evidence suggests that the epigenome serves as the interface between the genome and the environment and that hypermethylation of stem cell polycomb group target genes is an epigenetic hallmark of cancer. The objective of this study was to determine the functional role of epigenetic factors in endometrial cancer development.Epigenome-wide methylation analysis of >27,000 CpG sites in endometrial cancer tissue samples (n = 64 and control samples (n = 23 revealed that HAND2 (a gene encoding a transcription factor expressed in the endometrial stroma is one of the most commonly hypermethylated and silenced genes in endometrial cancer. A novel integrative epigenome-transcriptome-interactome analysis further revealed that HAND2 is the hub of the most highly ranked differential methylation hotspot in endometrial cancer. These findings were validated using candidate gene methylation analysis in multiple clinical sample sets of tissue samples from a total of 272 additional women. Increased HAND2 methylation was a feature of premalignant endometrial lesions and was seen to parallel a decrease in RNA and protein levels. Furthermore, women with high endometrial HAND2 methylation in their premalignant lesions were less likely to respond to progesterone treatment. HAND2 methylation analysis of endometrial secretions collected using high vaginal swabs taken from women with postmenopausal bleeding specifically identified those patients with early stage endometrial cancer with both high sensitivity and high specificity (receiver operating characteristics area under the curve = 0.91 for stage 1A and 0.97 for higher than stage 1A. Finally, mice harbouring a Hand2 knock-out specifically in their endometrium were shown to develop

  14. Single-base resolution maps of cultivated and wild rice methylomes and regulatory roles of DNA methylation in plant gene expression

    DEFF Research Database (Denmark)

    Li, Xin; Zhu, Jingde; Hu, Fengyi

    2012-01-01

    DNA methylation plays important biological roles in plants and animals. To examine the rice genomic methylation landscape and assess its functional significance, we generated single-base resolution DNA methylome maps for Asian cultivated rice Oryza sativa ssp. japonica, indica and their wild rela...

  15. Different roles of the Mre11 complex in the DNA damage response in Aspergillus nidulans.

    Science.gov (United States)

    Semighini, Camile P; von Zeska Kress Fagundes, Márcia Regina; Ferreira, Joseane Cristina; Pascon, Renata Castiglioni; de Souza Goldman, Maria Helena; Goldman, Gustavo Henrique

    2003-06-01

    The Mre11-Rad50-Nbs1 protein complex has emerged as a central player in the cellular DNA damage response. Mutations in scaANBS1, which encodes the apparent homologue of human Nbs1 in Aspergillus nidulans, inhibit growth in the presence of the anti-topoisomerase I drug camptothecin. We have used the scaANBS1 cDNA as a bait in a yeast two-hybrid screening and report the identification of the A. nidulans Mre11 homologue (mreA). The inactivated mreA strain was more sensitive to several DNA damaging and oxidative stress agents. Septation in A. nidulans is dependent not only on the uvsBATR gene, but also on the mre11 complex. scaANBS1 and mreA genes are both involved in the DNA replication checkpoint whereas mreA is specifically involved in the intra-S-phase checkpoint. ScaANBS1 also participates in G2-M checkpoint control upon DNA damage caused by MMS. In addition, the scaANBS1 gene is also important for ascospore viability, whereas mreA is required for successful meiosis in A. nidulans. Consistent with this view, the Mre11 complex and the uvsCRAD51 gene are highly expressed at the mRNA level during the sexual development.

  16. Role of excision repair in postradiation recovery of biological activity of cellular DNA Bacillus subtilis

    International Nuclear Information System (INIS)

    Filippov, V.D.

    1976-01-01

    DNA extracted from UV-irradiated prototroph cells of Bacillus subtilis uvr + (45 sec. of UV light, 20% survivals) has a lowered transforming activity (TA) of markers purB and metB, and a lowered ratio TA pur/TA met. During the subsequent incubation of uvr + cells in glucose-salt medium free of nitrogen sources the TA of markers and the ratio between them increase. No increase is observed during the postradiation incubation under the same conditions or in a nutrition medium of uvr cells, deficient in escision of pyrimidine dimers. The increment of DNA begins approsimately in 30 min. after the beginning of incubation of irradiated uvr cells in nutrition medium. On the basis of these facts it is concluded that neither the replication of damaged DNA nor the postreplication repair, but only excision repair, can provide the recovery of biological (transforming) activity of cellular DNA in Bac. subtilis. The system given might be a suitable model for testing compounds which affect the activity of this process. The well-known inhibitors of dark repair, caffeine, proflavine to inhibit reversibly the initial steps of the process/ and especially acriflavine, delay the recovery of markers of cellular DNA in irradiated uvr + cells. Caffeine is proved to inhibit reversibly the initial steps of the process

  17. Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

    Science.gov (United States)

    Hendershot, Jenna M.; O'Brien, Patrick J.

    2014-01-01

    Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

  18. Role of DNA mismatch repair and p53 in signaling induction of apoptosis by alkylating agents.

    Science.gov (United States)

    Hickman, M J; Samson, L D

    1999-09-14

    All cells are unavoidably exposed to chemicals that can alkylate DNA to form genotoxic damage. Among the various DNA lesions formed, O(6)-alkylguanine lesions can be highly cytotoxic, and we recently demonstrated that O(6)-methylguanine (O(6)MeG) and O(6)-chloroethylguanine (O(6)CEG) specifically initiate apoptosis in hamster cells. Here we show, in both hamster and human cells, that the MutSalpha branch of the DNA mismatch repair pathway (but not the MutSbeta branch) is absolutely required for signaling the initiation of apoptosis in response to O(6)MeGs and is partially required for signaling apoptosis in response to O(6)CEGs. Further, O(6)MeG lesions signal the stabilization of the p53 tumor suppressor, and such signaling is also MutSalpha-dependent. Despite this, MutSalpha-dependent apoptosis can be executed in a p53-independent manner. DNA mismatch repair status did not influence the response of cells to other inducers of p53 and apoptosis. Thus, it appears that mismatch repair status, rather than p53 status, is a strong indicator of the susceptibility of cells to alkylation-induced apoptosis. This experimental system will allow dissection of the signal transduction events that couple a specific type of DNA base lesion with the final outcome of apoptotic cell death.

  19. cDNA Library Screening Identifies Protein Interactors Potentially Involved in Non-telomeric Roles of Arabidopsis Telomerase

    Directory of Open Access Journals (Sweden)

    Ladislav eDokládal

    2015-11-01

    Full Text Available Telomerase-reverse transcriptase (TERT plays an essential catalytic role in maintaining telomeres. However, in animal systems telomerase plays additional non-telomeric functional roles. We previously screened an Arabidopsis cDNA library for proteins that interact with the C-terminal extension (CTE TERT domain and identified a nuclear-localized protein that contains a RNA recognition motif (RRM. This RRM-protein forms homodimers in both plants and yeast. Mutation of the gene encoding the RRM-protein had no detectable effect on plant growth and development, nor did it affect telomerase activity or telomere length in vivo, suggesting a non-telomeric role for TERT/RRM-protein complexes. The gene encoding the RRM-protein is highly expressed in leaf and reproductive tissues. We further screened an Arabidopsis cDNA library for proteins that interact with the RRM-protein and identified five interactors. These proteins are involved in numerous non-telomere-associated cellular activities. In plants, the RRM-protein, both alone and in a complex with its interactors, localizes to nuclear speckles. Transcriptional analyses in wild-type and rrm mutant plants, as well as transcriptional co-analyses, suggest that TERT, the RRM-protein, and the RRM-protein interactors may play important roles in non-telomeric cellular functions.

  20. Role of exonucleolytic processing and polymerase-DNA association in bypass of lesions during replication in vitro. Significance for SOS-targeted mutagenesis

    International Nuclear Information System (INIS)

    Shwartz, H.; Shavitt, O.; Livneh, Z.

    1988-01-01

    The role of exonuclease activity in trans-lesion DNA replication with Escherichia coli DNA polymerase III holoenzyme was investigated. RecA protein inhibited the 3'----5' exonuclease activity of the polymerase 2-fold when assayed in the absence of replication and had no effect on turnover of dNTPs into dNMPs. In contrast, single-stranded DNA-binding protein, which had no effect on the exonuclease activity in the absence of replication, showed a pronounced 7-fold suppression of the 3'----5' exonuclease activity during replication. The excision of incorporated dNMP alpha S residues from DNA by the 3'----5' exonuclease activity of DNA polymerase III holoenzyme was inhibited 10-20-fold; still no increase in bypass of pyrimidine photodimers was observed. Thus, in agreement with our previous results in which the exonuclease activity was inhibited at the protein level, inhibition at the DNA level also did not increase bypass of photodimers. Fractionation of the replication mixture after termination of DNA synthesis on a Bio-Gel A-5m column under conditions which favor polymerase-DNA binding yielded a termination complex which could perform turnover of dNTPs into dNMPs. Adding challenge-primed single-stranded DNA to the complex yielded a burst of DNA synthesis which was promoted most likely by DNA polymerase III holoenzyme molecules transferred from the termination complex to the challenge DNA thus demonstrating the instability of the polymerase-DNA association. Addition of a fresh sample of DNA polymerase III holoenzyme to purified termination products, which consist primarily of partially replicated molecules with nascent chains terminated at UV lesions, did not result in any net DNA synthesis as expected

  1. The role of DNA polymerase I in liquid holding recovery of UV-irradiated Escherichia coli

    International Nuclear Information System (INIS)

    Tang, M.-S.; Patrick, M.H.

    1977-01-01

    Excision of cyclobutyl dipyrimidines from, and accumulation of strand interruptions in, DNA of different strains of E.coli K12 were determined during liquid holding recovery after UV irradiation. The extent of Pyr Pyr excision was the same (20 to 25%) for both a polA mutant (E.coli P3478) and its parental wild type strain (E.coli W3110); however, single strand interruptions accumulated during liquid holding of polA cells, but not in the parental strain. In contrast, excision was greatly reduced in a mutant (KMBL 1789) which is defective in the 5' → 3' exonucleolytic function of DNA polymerase I. These data suggest that excision and resynthesis during liquid holding are carried out primarily, if not entirely, by DNA polymerase I. It is further concluded that excision alone is both a necessary and sufficient condition to elicit liquid holding recovery, and that this excision requires a functional polymerase I 5' → 3' exonuclease. (author)

  2. DNA and cancer biology: role in radiation and drug sensitivity, carcinogenesis and mutations

    International Nuclear Information System (INIS)

    Yielding, K.L.

    1974-01-01

    The DNA excision repair mechanism is an important factor in the resistance exhibited by tumor cells toward both x rays and alkylating agents as demonstrated by the fact that the chemical alterations to cellular DNA caused by these agents are substrates for the repair enzymes. Furthermore, experiments performed in our laboratory demonstrate that: (a) tumor sensitivity to alkylating agents and x-ray can be increased by inhibition of the repair process, and (b) there is a suggestion that this sensitization can be achieved with some degree of selectivity, thereby improving the balance of sensitivites between tumor and normal tissue. Other work from this laboratory has shown that cocarcinogens probably act by preventing repair of carcinogenic damage to the DNA genome. The possibility has also been raised that mistakes made during repair synthesis might be responsible for some genetic diversity and for the mutations which arise in resting cells. (U.S.)

  3. The intrinsic role of nanoconfinement in chemical equilibrium: evidence from DNA hybridization.

    Science.gov (United States)

    Rubinovich, Leonid; Polak, Micha

    2013-05-08

    Recently we predicted that when a reaction involving a small number of molecules occurs in a nanometric-scale domain entirely segregated from the surrounding media, the nanoconfinement can shift the position of equilibrium toward products via reactant-product reduced mixing. In this Letter, we demonstrate how most-recently reported single-molecule fluorescence measurements of partial hybridization of ssDNA confined within nanofabricated chambers provide the first experimental confirmation of this entropic nanoconfinement effect. Thus, focusing separately on each occupancy-specific equilibrium constant, quantitatively reveals extra stabilization of the product upon decreasing the chamber occupancy or size. Namely, the DNA hybridization under nanoconfined conditions is significantly favored over the identical reaction occurring in bulk media with the same reactant concentrations. This effect, now directly verified for DNA, can be relevant to actual biological processes, as well as to diverse reactions occurring within molecular capsules, nanotubes, and other functional nanospaces.

  4. Role of DNA polymerase I in liquid holding recovery of uv-irradiated Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Tang, M S; Patrick, M H [Texas Univ., Dallas (USA)

    1977-09-01

    Excision of cyclobutyl dipyrimidines from, and accumulation of strand interruptions in DNA of different strains of E.coli K12 were determined during liquid holding recovery after uv irradiation. The extent of Pyr <> Pyr excision was the same (20 to 25%) for both a polA mutant (E.coli P3478) and its parental wild type strain (E.coli W3110); however, single strand interruptions accumulated during liquid holding of polA cells, but not in the parental strain. In contrast, excision was greatly reduced in a mutant (KMBL 1789) which is defective in the 5' ..-->.. 3' exonucleolytic function of DNA polymerase I. These data suggest that excision and resynthesis during liquid holding are carried out primarily, if not entirely, by DNA polymerase I. It is further concluded that excision alone is both a necessary and sufficient condition to elicit liquid holding recovery, and that this excision requires a functional polymerase I 5' ..-->.. 3' exonuclease.

  5. Investigation of the reactions of histone protein hydroperoxides and their role in DNA damage

    International Nuclear Information System (INIS)

    Luxford, C.; Dean, R.T.; Davies, M.J.

    1998-01-01

    Free radical attack on DNA results in base changes, cross-linking and strand cleavage leading to mutations if unrepaired. Histone proteins are intimately involved in DNA packaging and are excellent candidates for investigating DNA damage arising from protein-OOH-derived radicals. This study aimed (i) to investigate the formation of hydroperoxide on the linker histone H1 via radical reactions in the presence of O 2 ; (ii) to examine the radicals formed from transition metal ion-catalyzed breakdown of histone H1-OOH and (iii) to determine whether histone H1-OOH-derived radicals can damage DNA and free bases. (i) Histone H1 solutions were γ-irradiated ( 60 Co source) in the presence of O 2 and histone H1-OOH concentrations determined using a manual iodometric assay. Formation ( histone H1-OOH was dose-dependent and, in the absence of light or transition metal ions these hydroperoxides were found to be very stable (half life of 24 hours at 4degC ). (ii) Electron Paramagnetic Resonance (EPR) spectroscopy and spin trapping was used t investigate the Cu + -catalyzed breakdown of histone H1-OOH to form histone H1 protein side chain and -backbone carbon-centred radicals. Further EPR/spin trapping experiments showed that histone H1-OOH-derived radicals can oxidise pyrimidine bases (eg. uridine with the resultant trapping of three radical species; two pyrimidine radicals, C5-yl and Ct yl adducts (via addition of histone H1-OOH-derived radicals to the C5-C6 double bond o the pyrimidine ring) and an acyl radical adduct, whose origin is currently unknown. (iii) Damage to DNA and 2'-deoxyguanosine after reaction of histone H1-OOH-derive radicals were detected and quantified using HPLC (with EC and UV detection). We have identified 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) as a significant product ( histone H1-OOH-derived oxidative DNA modification. Increasing histone H1-OOH concentrations resulted in a concomitant increase in the amount of 8-oxodG formed. Our studies show

  6. The role of Candida albicans homologous recombination factors Rad54 and Rdh54 in DNA damage sensitivity

    Directory of Open Access Journals (Sweden)

    White Theodore C

    2011-09-01

    Full Text Available Abstract Background The fungal pathogen Candida albicans is frequently seen in immune suppressed patients, and resistance to one of the most widely used antifungals, fluconazole (FLC, can evolve rapidly. In recent years it has become clear that plasticity of the Candida albicans genome contributes to drug resistance through loss of heterozygosity (LOH at resistance genes and gross chromosomal rearrangements that amplify gene copy number of resistance associated genes. This study addresses the role of the homologous recombination factors Rad54 and Rdh54 in cell growth, DNA damage and FLC resistance in Candida albicans. Results The data presented here support a role for homologous recombination in cell growth and DNA damage sensitivity, as Candida albicans rad54Δ/rad54Δ mutants were hypersensitive to MMS and menadione, and had an aberrant cell and nuclear morphology. The Candida albicans rad54Δ/rad54Δ mutant was defective in invasion of Spider agar, presumably due to the altered cellular morphology. In contrast, mutation of the related gene RDH54 did not contribute significantly to DNA damage resistance and cell growth, and deletion of either Candida albicans RAD54 or Candida albicans RDH54 did not alter FLC susceptibility. Conclusions Together, these results support a role for homologous recombination in genome stability under nondamaging conditions. The nuclear morphology defects in the rad54Δ/rad54Δ mutants show that Rad54 performs an essential role during mitotic growth and that in its absence, cells arrest in G2. The viability of the single mutant rad54Δ/rad54Δ and the inability to construct the double mutant rad54Δ/rad54Δ rdh54Δ/rdh54Δ suggests that Rdh54 can partially compensate for Rad54 during mitotic growth.

  7. Translocation, switching and gating: potential roles for ATP in long-range communication on DNA by Type III restriction endonucleases.

    Science.gov (United States)

    Szczelkun, Mark D

    2011-04-01

    To cleave DNA, the Type III RM (restriction-modification) enzymes must communicate the relative orientation of two recognition sequences, which may be separated by many thousands of base pairs. This long-range interaction requires ATP hydrolysis by a helicase domain, and both active (DNA translocation) and passive (DNA sliding) modes of motion along DNA have been proposed. Potential roles for ATP binding and hydrolysis by the helicase domains are discussed, with a focus on bipartite ATPases that act as molecular switches.

  8. A role for nuclear translocation of tripeptidyl-peptidase II in reactive oxygen species-dependent DNA damage responses

    Energy Technology Data Exchange (ETDEWEB)

    Preta, Giulio; Klark, Rainier de [Center for Molecular Medicine (CMM), Department of Medicine, Karolinska Institutet, Karolinska University Hospital, 171 76 Stockholm (Sweden); Glas, Rickard, E-mail: rickard.glas@ki.se [Center for Molecular Medicine (CMM), Department of Medicine, Karolinska Institutet, Karolinska University Hospital, 171 76 Stockholm (Sweden)

    2009-11-27

    Responses to DNA damage are influenced by cellular metabolism through the continuous production of reactive oxygen species (ROS), of which most are by-products of mitochondrial respiration. ROS have a strong influence on signaling pathways during responses to DNA damage, by relatively unclear mechanisms. Previous reports have shown conflicting data on a possible role for tripeptidyl-peptidase II (TPPII), a large cytosolic peptidase, within the DNA damage response. Here we show that TPPII translocated into the nucleus in a p160-ROCK-dependent fashion in response to {gamma}-irradiation, and that nuclear expression of TPPII was present in most {gamma}-irradiated transformed cell lines. We used a panel of nine cell lines of diverse tissue origin, including four lymphoma cell lines (T, B and Hodgkins lymphoma), a melanoma, a sarcoma, a colon and two breast carcinomas, where seven out of nine cell lines showed nuclear TPPII expression after {gamma}-irradiation. Further, this required cellular production of ROS; treatment with either N-acetyl-Cysteine (anti-oxidant) or Rotenone (inhibitor of mitochondrial respiration) inhibited nuclear accumulation of TPPII. The local density of cells was important for nuclear accumulation of TPPII at early time-points following {gamma}-irradiation (at 1-4 h), indicating a bystander effect. Further, we showed that the peptide-based inhibitor Z-Gly-Leu-Ala-OH, but not its analogue Z-Gly-(D)-Leu-Ala-OH, excluded TPPII from the nucleus. This correlated with reduced nuclear expression of p53 as well as caspase-3 and -9 activation in {gamma}-irradiated lymphoma cells. Our data suggest a role for TPPII in ROS-dependent DNA damage responses, through alteration of its localization from the cytosol into the nucleus.

  9. Roles of Saccharomyces cerevisiae DNA polymerases Polη and Polζ in response to irradiation by simulated sunlight

    Science.gov (United States)

    Kozmin, Stanislav G.; Pavlov, Youri I.; Kunkel, Thomas A.; Sage, Evelyne

    2003-01-01

    Sunlight causes lesions in DNA that if unrepaired and inaccurately replicated by DNA polymerases yield mutations that result in skin cancer in humans. Two enzymes involved in translesion synthesis (TLS) of UV-induced photolesions are DNA polymerase η (Polη) and polymerase ζ (Polζ), encoded by the RAD30A and REV3 genes, respectively. Previous studies have investigated the TLS roles of these polymerases in human and yeast cells irradiated with monochromatic, short wavelength UVC radiation (254 nm). However, less is known about cellular responses to solar radiation, which is of higher and mixed wavelengths (310–1100 nm) and produces a different spectrum of DNA lesions, including Dewar photoproducts and oxidative lesions. Here we report on the comparative cytotoxic and mutagenic effects of simulated sunlight (SSL) and UVC radiation on yeast wild-type, rad30Δ, rev3Δ and rev3Δ rad30Δ strains. The results with SSL support several previous interpretations on the roles of these two polymerases in TLS of photodimers and (6–4) photoproducts derived from studies with UVC. They further suggest that Polη participates in the non-mutagenic bypass of SSL-dependent cytosine-containing Dewar photoproducts and 8-oxoguanine, while Polζ is mainly responsible for the mutagenic bypass of all types of Dewar photoproducts. They also suggest that in the absence of Polζ, Polη contributes to UVC- and SSL-induced mutagenesis, possibly by the bypass of photodimers containing deaminated cytosine. PMID:12888515

  10. Watson-Crick hydrogen bonds : Nature and role in DNA replication

    NARCIS (Netherlands)

    Guerra, Célia Fonseca; Bickelhaupt, F. Matthias

    2006-01-01

    The hydrogen bonds in DNA Watson–Crick base pairs have long been considered predominantly electrostatic phenomena. In this chapter, we show with state-of-the-art calculations that this is not true and that electrostatic interactions and covalent contributions in these hydrogen bonds are in fact of

  11. The role of DNA barcodes in understanding and conservation of mammal diversity in southeast Asia.

    Directory of Open Access Journals (Sweden)

    Charles M Francis

    Full Text Available BACKGROUND: Southeast Asia is recognized as a region of very high biodiversity, much of which is currently at risk due to habitat loss and other threats. However, many aspects of this diversity, even for relatively well-known groups such as mammals, are poorly known, limiting ability to develop conservation plans. This study examines the value of DNA barcodes, sequences of the mitochondrial COI gene, to enhance understanding of mammalian diversity in the region and hence to aid conservation planning. METHODOLOGY AND PRINCIPAL FINDINGS: DNA barcodes were obtained from nearly 1900 specimens representing 165 recognized species of bats. All morphologically or acoustically distinct species, based on classical taxonomy, could be discriminated with DNA barcodes except four closely allied species pairs. Many currently recognized species contained multiple barcode lineages, often with deep divergence suggesting unrecognized species. In addition, most widespread species showed substantial genetic differentiation across their distributions. Our results suggest that mammal species richness within the region may be underestimated by at least 50%, and there are higher levels of endemism and greater intra-specific population structure than previously recognized. CONCLUSIONS: DNA barcodes can aid conservation and research by assisting field workers in identifying species, by helping taxonomists determine species groups needing more detailed analysis, and by facilitating the recognition of the appropriate units and scales for conservation planning.

  12. Role of Human DNA Polymerase and Its Accessory Proteins in Breast Cancer

    Science.gov (United States)

    2000-09-01

    Yuzhakov et al. (39) demonstrated a direct interac- Tabata , S. (1994) DNA Res. 1, 27-35. tion between the pol 6 heterodimer and RPA. The p7 0 27...TIGR Tentative Human Consensus (THC) sequences at Blast NCBI website and had over 100 hits in the ESTdb. A search of the NRdb provided additional clones

  13. On the role of baculovirus photolyases in DNA repair upon UV damage of occlusion bodies

    NARCIS (Netherlands)

    Biernat, M.A.; Caballero, P.; Vlak, J.M.; Oers, van M.M.

    2013-01-01

    The use of baculoviruses in insect biocontrol is hampered by their sensitivity to ultraviolet (UV) light. This irradiation induces cyclobutane pyrimidine dimers (CPDs) in DNA. CPD-photolyases repair CPDs using visible light. Plusiine baculoviruses encode photolyases, which could potentially repair

  14. RADAMOL tool: Role of radiation quality and charge transfer in damage distribution along DNA oligomer

    Czech Academy of Sciences Publication Activity Database

    Štěpán, Václav; Davídková, Marie

    2014-01-01

    Roč. 68, č. 8 (2014), s. 240-247 ISSN 1434-6060 R&D Projects: GA MŠk LD12008; GA MŠk MP1002 Nano-IBCT Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:61389005 Keywords : radiation damage * ionizations * DNA Subject RIV: BO - Biophysics Impact factor: 1.228, year: 2014

  15. Role of DNA lesions and repair in the transformation of human cells

    International Nuclear Information System (INIS)

    Maher, V.M.; McCormick, J.J.

    1987-01-01

    Results of studies on the transformation of diploid human fibroblasts in culture into tumor-forming cells by exposure to chemical carcinogens or radiation indicate that such transformation is multi-stepped process that at least one step, acquisition of anchorage independence, occurs as a mutagenic event. Studies comparing normal-repairing human cells with DNA repair-deficient cells, such as those derived from cancer-prone xeroderma pigmentosum patients, indicate that excision repair in human fibroblasts is essentially an error-free process that the ability to excise potentially cytotoxic, mutagenic, or transforming lesions induced DNA by carcinogens determines their ultimate biological consequences. Cells deficient in excision repair are abnormally sensitive to these agents. Studies with cells treated at various times in the cell cycle show that there is a certain limited amount of time available for DNA repair between the initial exposure and the onset of the cellular event responsible for mutation induction and transformation to anchorage independence. The data suggest that DNA replication on a template containing unexcised lesions (photoproducts, adducts) is the critical event

  16. Role of DNA damage repair capacity in radiation induced adaptive response

    International Nuclear Information System (INIS)

    Yuan Dexiao; Pan Yan; Zhao Meijia; Chen Honghong; Shao Cunlin

    2009-01-01

    This work was to explore γ-ray induced radioadaptive response (RAR) in Chinese hamster ovary(CHO) cell lines of different DNA damage repair capacities. CHO-9 cells and the two repair-deficient strains, EM-C11(DNA single strand break repair deficient) and XR-C1(DNA double strand break repair deficient), were irradiated with a priming dose of 0.08 Gy or 0.016 Gy. After 4 or 7 hours, they were irradiated again with a challenging dose of 1 Gy. The micronucleus induction and plating efficiency of the cells were assayed. Under 0.08 Gy priming dose and 4-h interval, just the CHO-9 cells showed RAR, while with the 7-h interval the CHO-9 and EM-C11 showed RAR, but XR-C1 did not. When the cells were pretreated with a lower priming dose of 0.016 Gy in a 4-h time interval, all the three cell lines showed RAR to subsequent 1 Gy irradiation. It can be concluded that RAR is not only related to the priming dose and time interval, but also has close dependence on the ability of DNA damage repair. (authors)

  17. DNA damage in the oligodendrocyte lineage and its role in brain aging.

    Science.gov (United States)

    Tse, Kai-Hei; Herrup, Karl

    2017-01-01

    Myelination is a recent evolutionary addition that significantly enhances the speed of transmission in the neural network. Even slight defects in myelin integrity impair performance and enhance the risk of neurological disorders. Indeed, myelin degeneration is an early and well-recognized neuropathology that is age associated, but appears before cognitive decline. Myelin is only formed by fully differentiated oligodendrocytes, but the entire oligodendrocyte lineage are clear targets of the altered chemistry of the aging brain. As in neurons, unrepaired DNA damage accumulates in the postmitotic oligodendrocyte genome during normal aging, and indeed may be one of the upstream causes of cellular aging - a fact well illustrated by myelin co-morbidity in premature aging syndromes arising from deficits in DNA repair enzymes. The clinical and experimental evidence from Alzheimer's disease, progeroid syndromes, ataxia-telangiectasia and other conditions strongly suggest that oligodendrocytes may in fact be uniquely vulnerable to oxidative DNA damage. If this damage remains unrepaired, as is increasingly true in the aging brain, myelin gene transcription and oligodendrocyte differentiation is impaired. Delineating the relationships between early myelin loss and DNA damage in brain aging will offer an additional dimension outside the neurocentric view of neurodegenerative disease. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  18. Roles of the Amino Group of Purine Bases in the Thermodynamic Stability of DNA Base Pairing

    Directory of Open Access Journals (Sweden)

    Shu-ichi Nakano

    2014-08-01

    Full Text Available The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I and 2'-deoxyribo-2,6-diaminopurine (D as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G•C > D•T ≈ I•C > A•T > G•T > I•T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.

  19. Role of DNA methylation in expression and transmission of porcine endogenous retroviruses

    Czech Academy of Sciences Publication Activity Database

    Matoušková, Magda; Veselý, Pavel; Daniel, Petr; Mattiuzzo, G.; Hector, R.D.; Scobie, L.; Takeuchi, Y.; Hejnar, Jiří

    2013-01-01

    Roč. 87, č. 22 (2013), s. 12110-12120 ISSN 0022-538X R&D Projects: GA MŠk(CZ) LK11215 Institutional support: RVO:68378050 Keywords : PERV transmission * xenotransplantation * DNA methylation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.648, year: 2013

  20. A combinatorial role for MutY and Fpg DNA glycosylases in mutation avoidance in Mycobacterium smegmatis.

    Science.gov (United States)

    Hassim, Farzanah; Papadopoulos, Andrea O; Kana, Bavesh D; Gordhan, Bhavna G

    2015-09-01

    Hydroxyl radical (OH) among reactive oxygen species cause damage to nucleobases with thymine being the most susceptible, whilst in contrast, the singlet oxygen ((1)02) targets only guanine bases. The high GC content of mycobacterial genomes predisposes these organisms to oxidative damage of guanine. The exposure of cellular DNA to OH and one-electron oxidants results in the formation of two main degradation products, the pro-mutagenic 8-oxo-7,8-dihydroguanine (8-oxoGua) and the cytotoxic 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyGua). These lesions are repaired through the base excision repair (BER) pathway and we previously, demonstrated a combinatorial role for the mycobacterial Endonuclease III (Nth) and the Nei family of DNA glycosylases in mutagenesis. In addition, the formamidopyrimidine (Fpg/MutM) and MutY DNA glycosylases have also been implicated in mutation avoidance and BER in mycobacteria. In this study, we further investigate the combined role of MutY and the Fpg/Nei DNA glycosylases in Mycobacterium smegmatis and demonstrate that deletion of mutY resulted in enhanced sensitivity to oxidative stress, an effect which was not exacerbated in Δfpg1 Δfpg2 or Δnei1 Δnei2 double mutant backgrounds. However, combinatorial loss of the mutY, fpg1 and fpg2 genes resulted in a significant increase in mutation rates suggesting interplay between these enzymes. Consistent with this, there was a significant increase in C → A mutations with a corresponding change in cell morphology of rifampicin resistant mutants in the Δfpg1 Δfpg2 ΔmutY deletion mutant. In contrast, deletion of mutY together with the nei homologues did not result in any growth/survival defects or changes in mutation rates. Taken together these data indicate that the mycobacterial mutY, in combination with the Fpg DNA N-glycosylases, plays an important role in controlling mutagenesis under oxidative stress. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Role of plasma EBV DNA levels in predicting recurrence of nasopharyngeal carcinoma in a western population

    International Nuclear Information System (INIS)

    Ferrari, Daris; Alterio, Daniela; Foa, Paolo; Codecà, Carla; Bertuzzi, Cecilia; Broggio, Francesca; Crepaldi, Francesca; Luciani, Andrea; Floriani, Irene; Ansarin, Mohssen; Chiesa, Fausto

    2012-01-01

    Loco-regionally advanced nasopharyngeal carcinomas can be cured by the combination of chemotherapy and radiotherapy. In Eastern countries, plasma levels of viral Epstein-Barr deoxyribonucleic acid (DNA) are accurate in predicting recurrence, but few data are available in Western populations. The aim of this prospective study was to evaluate the relationship between viral Epstein-Barr DNA copy numbers in plasma and the response rate, progression-free survival and overall survival in a cohort of Western patients with stage IIb-IVb nasopharyngeal cancer. We evaluated plasma samples from 36 consecutive patients treated with induction chemotherapy followed by chemoradiation. EBV copy numbers were determined after DNA extraction using real-time quantitative polymerase chain reaction. Survival curves were estimated using the Kaplan–Meier method. Circulating Epstein-Barr virus DNA levels were measured before treatment, at the end of concomitant chemo- and radiotherapy, and during the follow-up period. Pre-treatment levels significantly correlated with the initial stage and probability of relapse. Their increase was 100% specific and 71.3% sensitive in detecting loco-regional or metastatic recurrence (an overall accuracy of 94.4%). Three-year progression-free and overall survival were respectively 78.2% and 97.1%. The results of this study confirm that patients from a Western country affected by loco-regionally advanced nasopharyngeal carcinoma have high plasma Epstein-Barr virus DNA levels at diagnosis. The monitoring of plasma levels is sensitive and highly specific in detecting disease recurrence and metastases

  2. Acute Smc5/6 depletion reveals its primary role in rDNA replication by restraining recombination at fork pausing sites.

    Directory of Open Access Journals (Sweden)

    Xiao P Peng

    2018-01-01

    Full Text Available Smc5/6, a member of the conserved SMC family of complexes, is essential for growth in most organisms. Its exact functions in a mitotic cell cycle are controversial, as chronic Smc5/6 loss-of-function alleles produce varying phenotypes. To circumvent this issue, we acutely depleted Smc5/6 in budding yeast and determined the first cell cycle consequences of Smc5/6 removal. We found a striking primary defect in replication of the ribosomal DNA (rDNA array. Each rDNA repeat contains a programmed replication fork barrier (RFB established by the Fob1 protein. Fob1 removal improves rDNA replication in Smc5/6 depleted cells, implicating Smc5/6 in the management of programmed fork pausing. A similar improvement is achieved by removing the DNA helicase Mph1 whose recombinogenic activity can be inhibited by Smc5/6 under DNA damage conditions. DNA 2D gel analyses further show that Smc5/6 loss increases recombination structures at RFB regions; moreover, mph1∆ and fob1∆ similarly reduce this accumulation. These findings point to an important mitotic role for Smc5/6 in restraining recombination events when protein barriers in rDNA stall replication forks. As rDNA maintenance influences multiple essential cellular processes, Smc5/6 likely links rDNA stability to overall mitotic growth.

  3. Symposium cellular response to DNA damage the role of poly(ADP-ribose) poly(ADP-ribose) in the cellular response to DNA damage

    International Nuclear Information System (INIS)

    Berger, N.A.

    1985-01-01

    Poly(ADP-ribose) polymerase is a chromatin-bound enzyme which, on activation by DNA strand breaks, catalyzes the successive transfer of ADP-ribose units from NAD to nuclear proteins. Poly(ADP-ribose) synthesis is stimulated by DNA strand breaks, and the polymer may alter the structure and/or function of chromosomal proteins to facilitate the DNA repair process. Inhibitors of Poly(ADP-ribose) polymerase or deficiencies of the substrate, NAD, lead to retardation of the DNA repair process. When DNA strand breaks are extensive or when breaks fail to be repaired, the stimulus for activation of Poly(ADP-ribose) persists and the activated enzyme is capable of totaly consuming cellular pools of NAD. Depletion of NAD and consequent lowering of cellular ATP pools, due to activation of Poly(ADP-ribose) polymerase, may account for rapid cell death before DNA repair takes place and before the genetic effects of DNA damage become manifest

  4. Exploring the Role of Genetic Modifiers in DNA Repair and Breast Cancer

    Science.gov (United States)

    2013-09-01

    organismal sensitivity to the alkylating agent N-methyl-N- nitrosourea . Can- cer Res. 63: 7047–7050. Goytisolo, F. A., E. Samper, J. Martin-Caballero, P...this study refers to this distinction. DNA- alkylating agents (methyl methanesulfonate [MMS], ethylmethanesulfonate [EMS], melphalan, etc.) are of...particular interest at low doses, as this class of genotoxic agents encompasses a number of natural and industrial environmental carcinogens (2). Alkylating

  5. [Role of proton-motive force in the conjugative DNA transport in Staphylococci].

    Science.gov (United States)

    Gavriliuk, V G; Vinnikov, A I

    1997-01-01

    Sensitivity of the conjugative process in staphylococci to the action of uncouplers of oxidative phosphorylation and inhibitors of electron transport systems have been proved, that testifies to the energy-dependent character of conjugative transport of DNA. Proceeding of the conjugation process depends upon the generation of delta microH+ on the membrane of both the donor and recipient cells. contribution of protonmotive forces to providing for the transfer of plasmids during conjugation to staphylococci has been defined.

  6. Role of special cross-links in structure formation of bacterial DNA polymer

    Science.gov (United States)

    Agarwal, Tejal; Manjunath, G. P.; Habib, Farhat; Lakshmi Vaddavalli, Pavana; Chatterji, Apratim

    2018-01-01

    Using data from contact maps of the DNA-polymer of Escherichia coli (E. Coli) (at kilobase pair resolution) as an input to our model, we introduce cross-links between monomers in a bead-spring model of a ring polymer at very specific points along the chain. Via suitable Monte Carlo simulations, we show that the presence of these cross-links leads to a particular organization of the chain at large (micron) length scales of the DNA. We also investigate the structure of a ring polymer with an equal number of cross-links at random positions along the chain. We find that though the polymer does get organized at the large length scales, the nature of the organization is quite different from the organization observed with cross-links at specific biologically determined positions. We used the contact map of E. Coli bacteria which has around 4.6 million base pairs in a single circular chromosome. In our coarse-grained flexible ring polymer model, we used 4642 monomer beads and observed that around 80 cross-links are enough to induce the large-scale organization of the molecule accounting for statistical fluctuations caused by thermal energy. The length of a DNA chain even of a simple bacterial cell such as E. Coli is much longer than typical proteins, hence we avoided methods used to tackle protein folding problems. We define new suitable quantities to identify the large scale structure of a polymer chain with a few cross-links.

  7. The role of DNA amplification and cultural growth in complicated acute appendicitis

    Directory of Open Access Journals (Sweden)

    Francesca Tocchioni

    2016-09-01

    Full Text Available Bacterial growth of peritoneal fluid specimens obtained during surgical procedures for acute appendicitis may be useful to optimize further antibiotic therapy in complicated cases. DNA amplification represents a fast technique to detect microbial sequences. We aimed to compare the potential of DNA amplification versus traditional bacterial growth culture highlighting advantages and drawbacks in a surgical setting. Peritoneal fluid specimens were collected during surgery from 36 children who underwent appendectomy between May and December 2012. Real-time polymerase chain reaction (RT-PCR and cultures were performed on each sample. RT-PCR showed an amplification of 16S in 18/36 samples, Escherichia coli (in 7 cases, Pseudomonas aeruginosa (3, Fusobacterium necrophorum (3, Adenovirus (2, E.coli (1, Klebsiella pneumoniae (1, Serratia marcescens/Enterobacter cloacae (1. Bacterial growth was instead observed only in four patients (3 E.coli and 1 P.aeruginosa and Bacteroides ovatus. Preoperative C-reactive protein and inflammation degree, the most reliable indicators of bacterial translocation, were elevated as expected. DNA amplification was a quick and useful method to detect pathogens and it was even more valuable in detecting aggressive pathogens such as anaerobes, difficult to preserve in biological cultures; its drawbacks were the lack of biological growths and of antibiograms. In our pilot study RT-PCR and cultures did not influence the way patients were treated.

  8. Role of DNA methylation in miR-200c/141 cluster silencing in invasive breast cancer cells.

    Science.gov (United States)

    Neves, Rui; Scheel, Christina; Weinhold, Sandra; Honisch, Ellen; Iwaniuk, Katharina M; Trompeter, Hans-Ingo; Niederacher, Dieter; Wernet, Peter; Santourlidis, Simeon; Uhrberg, Markus

    2010-08-03

    The miR-200c/141 cluster has recently been implicated in the epithelial to mesenchymal transition (EMT) process. The expression of these two miRNAs is inversely correlated with tumorigenicity and invasiveness in several human cancers. The role of these miRNAs in cancer progression is based in part on their capacity to target the EMT activators ZEB1 and ZEB2, two transcription factors, which in turn repress expression of E-cadherin. Little is known about the regulation of the mir200c/141 cluster, whose targeting has been proposed as a promising new therapy for the most aggressive tumors. We show that the miR-200c/141 cluster is repressed by DNA methylation of a CpG island located in the promoter region of these miRNAs. Whereas in vitro methylation of the miR-200c/141 promoter led to shutdown of promoter activity, treatment with a demethylating agent caused transcriptional reactivation in breast cancer cells formerly lacking expression of miR-200c and miR-141. More importantly, we observed that DNA methylation of the identified miR-200c/141 promoter was tightly correlated with phenotype and the invasive capacity in a panel of 8 human breast cancer cell lines. In line with this, in vitro induction of EMT by ectopic expression of the EMT transcription factor Twist in human immortalized mammary epithelial cells (HMLE) was accompanied by increased DNA methylation and concomitant repression of the miR-200c/141 locus. The present study demonstrates that expression of the miR-200c/141 cluster is regulated by DNA methylation, suggesting epigenetic regulation of this miRNA locus in aggressive breast cancer cell lines as well as untransformed mammary epithelial cells. This epigenetic silencing mechanism might represent a novel component of the regulatory circuit for the maintenance of EMT programs in cancer and normal cells.

  9. Dad's Snoring May Have Left Molecular Scars in Your DNA: the Emerging Role of Epigenetics in Sleep Disorders.

    Science.gov (United States)

    Morales-Lara, Daniela; De-la-Peña, Clelia; Murillo-Rodríguez, Eric

    2018-04-01

    The sleep-wake cycle is a biological phenomena under the orchestration of neurophysiological, neurochemical, neuroanatomical, and genetical mechanisms. Moreover, homeostatic and circadian processes participate in the regulation of sleep across the light-dark period. Further complexity of the understanding of the genesis of sleep engages disturbances which have been characterized and classified in a variety of sleep-wake cycle disorders. The most prominent sleep alterations include insomnia as well as excessive daytime sleepiness. On the other side, several human diseases have been linked with direct changes in DNA, such as chromatin configuration, genomic imprinting, DNA methylation, histone modifications (acetylation, methylation, ubiquitylation or sumoylation, etc.), and activating RNA molecules that are transcribed from DNA but not translated into proteins. Epigenetic theories primarily emphasize the interaction between the environment and gene expression. According to these approaches, the environment to which mammals are exposed has a significant role in determining the epigenetic modifications occurring in chromosomes that ultimately would influence not only development but also the descendants' physiology and behavior. Thus, what makes epigenetics intriguing is that, unlike genetic variation, modifications in DNA are altered directly by the environment and, in some cases, these epigenetic changes may be inherited by future generations. Thus, it is likely that epigenetic phenomena might contribute to the homeostatic and/or circadian control of sleep and, possibly, have an undescribed link with sleep disorders. An exciting new horizon of research is arising between sleep and epigenetics since it represents the relevance of the study of how the genome learns from its experiences and modulates behavior, including sleep.

  10. Protective role of OH scavengers and DNA/chromatin organization in the induction of DNA breaks: mechanistic models and Monte Carlo simulations

    International Nuclear Information System (INIS)

    Ballarini, F.; Rossetti, M.; Scannicchio, D.; Jacob, P.; Molinelli, S.; Ottolenghi, A.; Volata, A.

    2003-01-01

    Radiation-induced DNA damage can be modulated by various factors, including the environment scavenging capacity (SC) and the DNA organization within the cell nucleus (chromatin compactness, DNA-binding proteins etc.). In this context the induction of ssb and dsb by photons and light ions of different energies impinging on different DNA structures (e.g. linear DNA, SV40 'minichromosomes' and cellular DNA) at different OH-radical SC values was modelled with the Monte Carlo PARTRAC code. Presently PARTRAC can transport electrons, photons, protons and alpha particles in liquid water with an 'event-by-event' approach, and can simulate the DNA content of mammalian cells with an 'atom-by-atom' description, from nucleotide pairs to chromatin fibre loops and chromosome territories. Energy depositions in the sugar-phosphate were considered as potential (direct) ssb. The production, diffusion and reaction of chemical species were explicitly simulated; reactions of OH radicals with the sugar-phosphate were assumed to lead to 'indirect' ssb with probability 65%. Two ssb on opposite strands within 10 bp were considered as a dsb. Yields of ssb and dsb/Gy/Dalton were calculated for different DNA structures as a function of the OH mean life time. By Zyuzikov, N.; Michael, B.D. (Gray Cancer Institute, (GB)); Wu, L. (Ch Zyuzdirect damage yields. In general, also depending on radiation quality, linear DNA was found to be more susceptible to strand breakage than SV40 minichromosomes, which in turn showed higher damage yields with respect to cellular DNA. The very good agreement found with available experimental data provided a validation of the model and allowed us to quantify separately the protective effect of OH scavengers and DNA/chromatin organization. Comparisons with data on nucleoids (DNA unfolded and depleted of histones) suggested that the experimental procedures used to obtain such targets might lower the environment SC, due to the loss of cellular scavenging compounds

  11. Seasonal variability in the persistence of dissolved environmental DNA (eDNA in a marine system: The role of microbial nutrient limitation.

    Directory of Open Access Journals (Sweden)

    Ian Salter

    Full Text Available Environmental DNA (eDNA can be defined as the DNA pool recovered from an environmental sample that includes both extracellular and intracellular DNA. There has been a significant increase in the number of recent studies that have demonstrated the possibility to detect macroorganisms using eDNA. Despite the enormous potential of eDNA to serve as a biomonitoring and conservation tool in aquatic systems, there remain some important limitations concerning its application. One significant factor is the variable persistence of eDNA over natural environmental gradients, which imposes a critical constraint on the temporal and spatial scales of species detection. In the present study, a radiotracer bioassay approach was used to quantify the kinetic parameters of dissolved eDNA (d-eDNA, a component of extracellular DNA, over an annual cycle in the coastal Northwest Mediterranean. Significant seasonal variability in the biological uptake and turnover of d-eDNA was observed, the latter ranging from several hours to over one month. Maximum uptake rates of d-eDNA occurred in summer during a period of intense phosphate limitation (turnover <5 hrs. Corresponding increases in bacterial production and uptake of adenosine triphosphate (ATP demonstrated the microbial utilization of d-eDNA as an organic phosphorus substrate. Higher temperatures during summer may amplify this effect through a general enhancement of microbial metabolism. A partial least squares regression (PLSR model was able to reproduce the seasonal cycle in d-eDNA persistence and explained 60% of the variance in the observations. Rapid phosphate turnover and low concentrations of bioavailable phosphate, both indicative of phosphate limitation, were the most important parameters in the model. Abiotic factors such as pH, salinity and oxygen exerted minimal influence. The present study demonstrates significant seasonal variability in the persistence of d-eDNA in a natural marine environment that can

  12. Role of DNA repair in repair of cytogenetic damages. Contribution of repair of single-strand DNA breaks to cytogenetic damages repair

    International Nuclear Information System (INIS)

    Rozanova, O.M.; Zaichkina, S.I.; Aptikaev, G.F.; Ganassi, E.Eh.

    1989-01-01

    The comparison was made between the results of the effect of poly(ADP-ribosylation) ingibitors (e.g. nicotinamide and 3-aminobenzamide) and a chromatin proteinase ingibitor, phenylmethylsulfonylfluoride, on the cytogenetic damages repair, by a micronuclear test, and DNA repair in Chinese hamster fibroblasts. The values of the repair half-periods (5-7 min for the cytogenetic damages and 5 min for the rapidly repaired DNA damages) and a similar modyfying effect with regard to radiation cytogenetic damages and kynetics of DNA damages repair were found to be close. This confirms the contribution of repair of DNA single-strand breaks in the initiation of structural damages to chromosomes

  13. A role for small RNAs in DNA double-strand break repair

    DEFF Research Database (Denmark)

    Wei, W.; Ba, Z.; Wu, Y.

    2012-01-01

    Eukaryotes have evolved complex mechanisms to repair DNA double-strand breaks (DSBs) through coordinated actions of protein sensors, transducers, and effectors. Here we show that ∼21-nucleotide small RNAs are produced from the sequences in the vicinity of DSB sites in Arabidopsis and in human cells....... We refer to these as diRNAs for DSB-induced small RNAs. In Arabidopsis, the biogenesis of diRNAs requires the PI3 kinase ATR, RNA polymerase IV (Pol IV), and Dicer-like proteins. Mutations in these proteins as well as in Pol V cause significant reduction in DSB repair efficiency. In Arabidopsis, di...

  14. Zebrafish: swimming towards a role for fanconi genes in DNA repair.

    Science.gov (United States)

    Scata, Kimberly A; El-Deiry, Wafik S

    2004-06-01

    The zebrafish, Danio rerio, has become a favorite model organism for geneticists and developmental biologists. Recently cancer biologists have turned to this tiny fish to help them unravel the mysteries of conserved pathways such as the Fanconi Anemia (FA) pathway. Although a relatively rare disease, the genes involved in FA are part of a large network of DNA damage response/repair genes. Liu and colleagues have recapitulated some of the clinical manifestations of human FA by knocking down the zebrafish FANC-D2 gene thereby providing a new model for probing the underlying causes of these phenotypes.

  15. Exploring a causal role of DNA methylation in the relationship between maternal vitamin B12 during pregnancy and child's IQ at age 8, cognitive performance and educational attainment

    DEFF Research Database (Denmark)

    Caramaschi, Doretta; Sharp, Gemma C; Nohr, Ellen A

    2017-01-01

    An adequate intake of vitamin B12 during pregnancy plays an important role in offspring neurodevelopment, potentially via epigenetic processes. We used a two-step Mendelian randomization approach to assess whether DNA methylation plays a mediating and causal role in associations between maternal...

  16. A defined role for multiple Fanconi anemia gene products in DNA-damage-associated ubiquitination.

    Science.gov (United States)

    Tan, Winnie; Deans, Andrew J

    2017-06-01

    Fanconi anemia (FA) is an inherited blood disorder that causes bone marrow failure and high predisposition to cancers. The FA pathway guards the cell's genome stability by orchestrating the repair of interstrand cross-linking during the S phase of the cell cycle, preventing the chromosomal instability that is a key event in bone marrow failure syndrome. Central to the FA pathway is loss of monoubiquitinated forms of the Fanconi proteins FANCI and FANCD2, a process that is normally mediated by a "core complex" of seven other Fanconi proteins. Each protein, when mutated, can cause FA. The FA core-complex-catalyzed reaction is critical for signaling DNA cross-link damage such as that induced by chemotherapies. Here, we present a perspective on the current understanding of FANCI and FANCD2 monoubiquitination-mediated DNA repair. Our recent biochemical reconstitution of the monoubiquitination (and deubiquitination) reactions creates a paradigm for understanding FA. Further biochemical analysis will create new opportunities to address the leukemic phenotype of FA patients. Copyright © 2017 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

  17. The Role of DNA Methylation in the Development and Progression of Lung Adenocarcinoma

    Directory of Open Access Journals (Sweden)

    Keith M. Kerr

    2007-01-01

    Full Text Available Lung cancer, caused by smoking in ∼87% of cases, is the leading cause of cancer death in the United States and Western Europe. Adenocarcinoma is now the most common type of lung cancer in men and women in the United States, and the histological subtype most frequently seen in never-smokers and former smokers. The increasing frequency of adenocarcinoma, which occurs more peripherally in the lung, is thought to be at least partially related to modifications in cigarette manufacturing that have led to a change in the depth of smoke inhalation. The rising incidence of lung adenocarcinoma and its lethal nature underline the importance of understanding the development and progression of this disease. Alterations in DNA methylation are recognized as key epigenetic changes in cancer, contributing to chromosomal instability through global hypomethylation, and aberrant gene expression through alterations in the methylation levels at promoter CpG islands. The identification of sequential changes in DNA methylation during progression and metastasis of lung adenocarcinoma, and the elucidation of their interplay with genetic changes, will broaden our molecular understanding of this disease, providing insights that may be applicable to the development of targeted drugs, as well as powerful markers for early detection and patient classification.

  18. What role for DNA damage and repair in the bystander response?

    International Nuclear Information System (INIS)

    Prise, Kevin M.; Folkard, Melvyn; Kuosaite, Virginija; Tartier, Laurence; Zyuzikov, Nikolai; Shao, Chunlin

    2006-01-01

    The radiation-induced bystander effect challenges the accepted paradigm of direct DNA damage in response to energy deposition driving the biological consequences of radiation exposure. With the bystander response, cells which have not been directly exposed to radiation respond to their neighbours being targeted. In our own studies we have used novel targeted microbeam approaches to specifically irradiate parts of individual cells within a population to quantify the bystander response and obtain mechanistic information. Using this approach it has become clear that energy deposited by radiation in nuclear DNA is not required to trigger the effect, with cytoplasmic irradiation required. Irradiated cells also trigger a bystander response regardless of whether they themselves live or die, suggesting that the phenotype of the targeted cell is not a determining factor. Despite this however, a range of evidence has shown that repair status is important for dealing with the consequences of a bystander signal. Importantly, repair processes involved in the processing of dsb appear to be involved suggesting that the bystander response involves the delayed or indirect production of dsb-type lesions in bystander cells. Whether these are infact true dsb or complexes of oxidised bases in combination with strand breaks and the mechanisms for their formation, remains to be elucidated

  19. Transcription blockage by homopurine DNA sequences: role of sequence composition and single-strand breaks

    Science.gov (United States)

    Belotserkovskii, Boris P.; Neil, Alexander J.; Saleh, Syed Shayon; Shin, Jane Hae Soo; Mirkin, Sergei M.; Hanawalt, Philip C.

    2013-01-01

    The ability of DNA to adopt non-canonical structures can affect transcription and has broad implications for genome functioning. We have recently reported that guanine-rich (G-rich) homopurine-homopyrimidine sequences cause significant blockage of transcription in vitro in a strictly orientation-dependent manner: when the G-rich strand serves as the non-template strand [Belotserkovskii et al. (2010) Mechanisms and implications of transcription blockage by guanine-rich DNA sequences., Proc. Natl Acad. Sci. USA, 107, 12816–12821]. We have now systematically studied the effect of the sequence composition and single-stranded breaks on this blockage. Although substitution of guanine by any other base reduced the blockage, cytosine and thymine reduced the blockage more significantly than adenine substitutions, affirming the importance of both G-richness and the homopurine-homopyrimidine character of the sequence for this effect. A single-strand break in the non-template strand adjacent to the G-rich stretch dramatically increased the blockage. Breaks in the non-template strand result in much weaker blockage signals extending downstream from the break even in the absence of the G-rich stretch. Our combined data support the notion that transcription blockage at homopurine-homopyrimidine sequences is caused by R-loop formation. PMID:23275544

  20. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    Science.gov (United States)

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Roles of nibrin and ATM/ATR kinases on the G2 checkpoint under endogenous or radio-induced DNA damage

    Directory of Open Access Journals (Sweden)

    Katherine Marcelain

    2005-01-01

    Full Text Available Checkpoint response to DNA damage involves the activation of DNA repair and G2 lengthening subpathways. The roles of nibrin (NBS1 and the ATM/ATR kinases in the G2 DNA damage checkpoint, evoked by endogenous and radio-induced DNA damage, were analyzed in control, A-T and NBS lymphoblast cell lines. Short-term responses to G2 treatments were evaluated by recording changes in the yield of chromosomal aberrations in the ensuing mitosis, due to G2 checkpoint adaptation, and also in the duration of G2 itself. The role of ATM/ATR in the G2 checkpoint pathway repairing chromosomal aberrations was unveiled by caffeine inhibition of both kinases in G2. In the control cell lines, nibrin and ATM cooperated to provide optimum G2 repair for endogenous DNA damage. In the A-T cells, ATR kinase substituted successfully for ATM, even though no G2 lengthening occurred. X-ray irradiation (0.4 Gy in G2 increased chromosomal aberrations and lengthened G2, in both mutant and control cells. However, the repair of radio-induced DNA damage took place only in the controls. It was associated with nibrin-ATM interaction, and ATR did not substitute for ATM. The absence of nibrin prevented the repair of both endogenous and radio-induced DNA damage in the NBS cells and partially affected the induction of G2 lengthening.

  2. Role of APC and DNA mismatch repair genes in the development of colorectal cancers

    Directory of Open Access Journals (Sweden)

    Roy Deodutta

    2003-12-01

    Full Text Available Abstract Colorectal cancer is the third most common cause of cancer-related death in both men and women in the western hemisphere. According to the American Cancer Society, an estimated 105,500 new cases of colon cancer with 57,100 deaths will occur in the U.S. in 2003, accounting for about 10% of cancer deaths. Among the colon cancer patients, hereditary risk contributes approximately 20%. The main inherited colorectal cancers are the familial adenomatous polyposis (FAP and the hereditary nonpolyposis colorectal cancers (HNPCC. The FAP and HNPCC are caused due to mutations in the adenomatous polyposis coli (APC and DNA mismatch repair (MMR genes. The focus of this review is to summarize the functions of APC and MMR gene products in the development of colorectal cancers.

  3. Role of cholesterol on the transfection barriers of cationic lipid/DNA complexes

    Science.gov (United States)

    Pozzi, Daniela; Cardarelli, Francesco; Salomone, Fabrizio; Marchini, Cristina; Amenitsch, Heinz; Barbera, Giorgia La; Caracciolo, Giulio

    2014-08-01

    Most lipid formulations need cholesterol for efficient transfection, but the precise motivation remains unclear. Here, we have investigated the effect of cholesterol on the transfection efficiency (TE) of cationic liposomes made of 1,2-dioleoyl-3-trimethylammonium-propane and dioleoylphosphocholine in Chinese hamster ovary cells. The transfection mechanisms of cholesterol-containing lipoplexes have been investigated by TE, synchrotron small angle X-ray scattering, and laser scanning confocal microscopy experiments. We prove that cholesterol-containing lipoplexes enter the cells using different endocytosis pathways. Formulations with high cholesterol content efficiently escape from endosomes and exhibit a lamellar-nonlamellar phase transition in mixture with biomembrane mimicking lipid formulations. This might explain both the DNA release ability and the high transfection efficiency. These studies highlight the enrichment in cholesterol as a decisive factor for transfection and will contribute to the rational design of lipid nanocarriers with superior TE.

  4. The role of monovalent cations in the ATPase reaction of DNA gyrase.

    Science.gov (United States)

    Hearnshaw, Stephen James; Chung, Terence Tsz-Hong; Stevenson, Clare Elizabeth Mary; Maxwell, Anthony; Lawson, David Mark

    2015-04-01

    Four new crystal structures of the ATPase domain of the GyrB subunit of Escherichia coli DNA gyrase have been determined. One of these, solved in the presence of K(+), is the highest resolution structure reported so far for this domain and, in conjunction with the three other structures, reveals new insights into the function of this domain. Evidence is provided for the existence of two monovalent cation-binding sites: site 1, which preferentially binds a K(+) ion that interacts directly with the α-phosphate of ATP, and site 2, which preferentially binds an Na(+) ion and the functional significance of which is not clear. The crystallographic data are corroborated by ATPase data, and the structures are compared with those of homologues to investigate the broader conservation of these sites.

  5. The role of peptide and DNA vaccines in myeloid leukemia immunotherapy

    Directory of Open Access Journals (Sweden)

    Lin Chen

    2013-02-01

    Full Text Available Abstract While chemotherapy and targeted therapy are successful in inducing the remission of myeloid leukemia as acute myeloid leukemia (AML and chronic myeloid leukemia (CML, the disease remains largely incurable. This observation is likely due to the drug resistance of leukemic cells, which are responsible for disease relapse. Myeloid leukemia vaccines may most likely be beneficial for eradicating minimal residual disease after treatment with chemotherapy or targeted therapy. Several targeted immunotherapies using leukemia vaccines have been heavily investigated in clinical and preclinical trials. This review will focus on peptides and DNA vaccines in the context of myeloid leukemias, and optimal strategies for enhancing the efficacy of vaccines based on myeloid leukemia immunization are also summarized.

  6. Role of DNA methylation in miR-200c/141 cluster silencing in invasive breast cancer cells

    Directory of Open Access Journals (Sweden)

    Wernet Peter

    2010-08-01

    Full Text Available Abstract Background The miR-200c/141 cluster has recently been implicated in the epithelial to mesenchymal transition (EMT process. The expression of these two miRNAs is inversely correlated with tumorigenicity and invasiveness in several human cancers. The role of these miRNAs in cancer progression is based in part on their capacity to target the EMT activators ZEB1 and ZEB2, two transcription factors, which in turn repress expression of E-cadherin. Little is known about the regulation of the mir200c/141 cluster, whose targeting has been proposed as a promising new therapy for the most aggressive tumors. Findings We show that the miR-200c/141 cluster is repressed by DNA methylation of a CpG island located in the promoter region of these miRNAs. Whereas in vitro methylation of the miR-200c/141 promoter led to shutdown of promoter activity, treatment with a demethylating agent caused transcriptional reactivation in breast cancer cells formerly lacking expression of miR-200c and miR-141. More importantly, we observed that DNA methylation of the identified miR-200c/141 promoter was tightly correlated with phenotype and the invasive capacity in a panel of 8 human breast cancer cell lines. In line with this, in vitro induction of EMT by ectopic expression of the EMT transcription factor Twist in human immortalized mammary epithelial cells (HMLE was accompanied by increased DNA methylation and concomitant repression of the miR-200c/141 locus. Conclusions The present study demonstrates that expression of the miR-200c/141 cluster is regulated by DNA methylation, suggesting epigenetic regulation of this miRNA locus in aggressive breast cancer cell lines as well as untransformed mammary epithelial cells. This epigenetic silencing mechanism might represent a novel component of the regulatory circuit for the maintenance of EMT programs in cancer and normal cells.

  7. The role of the PHP domain associated with DNA polymerase X from Thermus thermophilus HB8 in base excision repair.

    Science.gov (United States)

    Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji

    2012-11-01

    Base excision repair (BER) is one of the most commonly used DNA repair pathways involved in genome stability. X-family DNA polymerases (PolXs) play critical roles in BER, especially in filling single-nucleotide gaps. In addition to a polymerase core domain, bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain with phosphoesterase activity which is also required for BER. However, the role of the PHP domain of PolX in bacterial BER remains unresolved. We found that the PHP domain of Thermus thermophilus HB8 PolX (ttPolX) functions as two types of phosphoesterase in BER, including a 3'-phosphatase and an apurinic/apyrimidinic (AP) endonuclease. Experiments using T. thermophilus HB8 cell lysates revealed that the majority of the 3'-phosphatase and AP endonuclease activities are attributable to the another phosphoesterase in T. thermophilus HB8, endonuclease IV (ttEndoIV). However, ttPolX possesses significant 3'-phosphatase activity in ΔttendoIV cell lysate, indicating possible complementation. Our experiments also reveal that there are only two enzymes that display the 3'-phosphatase activity in the T. thermophilus HB8 cell, ttPolX and ttEndoIV. Furthermore, phenotypic analysis of ΔttpolX, ΔttendoIV, and ΔttpolX/ΔttendoIV using hydrogen peroxide and sodium nitrite supports the hypothesis that ttPolX functions as a backup for ttEndoIV in BER. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. ErbB4 localization to cardiac myocyte nuclei, and its role in myocyte DNA damage response

    International Nuclear Information System (INIS)

    Icli, Basak; Bharti, Ajit; Pentassuglia, Laura; Peng, Xuyang; Sawyer, Douglas B.

    2012-01-01

    Highlights: ► ErbB4 localizes to cardiac myocyte nuclei as a full-length receptor. ► Cardiac myocytes express predominantly JM-a/CYT-1 ErbB4. ► Myocyte p53 activation in response to doxorubicin requires ErbB4 activity. -- Abstract: The intracellular domain of ErbB4 receptor tyrosine kinase is known to translocate to the nucleus of cells where it can regulate p53 transcriptional activity. The purpose of this study was to examine whether ErbB4 can localize to the nucleus of adult rat ventricular myocytes (ARVM), and regulate p53 in these cells. We demonstrate that ErbB4 does locate to the nucleus of cardiac myocytes as a full-length protein, although nuclear location occurs as a full-length protein that does not require Protein Kinase C or γ-secretase activity. Consistent with this we found that only the non-cleavable JM-b isoform of ErbB4 is expressed in ARVM. Doxorubicin was used to examine ErbB4 role in regulation of a DNA damage response in ARVM. Doxorubicin induced p53 and p21 was suppressed by treatment with AG1478, an EGFR and ErbB4 kinase inhibitor, or suppression of ErbB4 expression with small interfering RNA. Thus ErbB4 localizes to the nucleus as a full-length protein, and plays a role in the DNA damage response induced by doxorubicin in cardiac myocytes.

  9. The role of oxytocin receptor gene (OXTR) DNA methylation (DNAm) in human social and emotional functioning: a systematic narrative review.

    Science.gov (United States)

    Maud, Catherine; Ryan, Joanne; McIntosh, Jennifer E; Olsson, Craig A

    2018-05-29

    The neuropeptide Oxytocin (OXT) plays a central role in birthing, mother-infant bonding and a broad range of related social behaviours in mammals. More recently, interest has extended to epigenetic programming of genes involved in oxytocinergic neurotransmission. This review brings together early findings in a rapidly developing field of research, examining relationships between DNA methylation (DNAm) of the Oxytocin Receptor Gene (OXTR) and social and emotional behaviour in human populations. A systematic search across Web of Knowledge/Science, Scopus, Medline and EMBASE captured all published studies prior to June 2017 examining the association between OXTR DNAm and human social and emotional outcomes. Search terms included 'oxytocin gene' or 'oxytocin receptor gene' and 'epigenetics' or 'DNA methylation'. Any article with a focus on social and emotional functioning was then identified from this set by manual review. Nineteen studies met eligibility criteria. There was considerable heterogeneity of study populations, tissue samples, instrumentation, measurement, and OXTR site foci. Only three studies examined functional consequences of OXTR DNAm on gene expression and protein synthesis. Increases in OXTR DNAm were associated with callous-unemotional traits in youth, social cognitive deficits in Autistic Spectrum Disorder (ASD), rigid thinking in anorexia nervosa, affect regulation problems, and problems with facial and emotional recognition. In contrast, reductions in DNAm were associated with perinatal stress, postnatal depression, social anxiety and autism in children. Consistent with an emerging field of inquiry, there is not yet sufficient evidence to draw conclusions about the role of OXTR DNAm in human social and emotional behaviour. However, taken together, findings point to increased OXTR DNAm in general impairments in social, cognitive and emotional functioning, and decreased OXTR DNAm in specific patterns of impairment related to mood and anxiety

  10. The Roles of Several Residues of Escherichia coli DNA Photolyase in the Highly Efficient Photo-Repair of Cyclobutane Pyrimidine Dimers

    Directory of Open Access Journals (Sweden)

    Lei Xu

    2010-01-01

    Full Text Available Escherichia coli DNA photolyase is an enzyme that repairs the major kind of UV-induced lesions, cyclobutane pyrimidine dimer (CPD in DNA utilizing 350–450 nm light as energy source. The enzyme has very high photo-repair efficiency (the quantum yield of the reaction is ~0.85, which is significantly greater than many model compounds that mimic photolyase. This suggests that some residues of the protein play important roles in the photo-repair of CPD. In this paper, we have focused on several residues discussed their roles in catalysis by reviewing the existing literature and some hypotheses.

  11. Roles for the yeast RAD18 and RAD52 DNA repair genes in UV mutagenesis.

    Science.gov (United States)

    Armstrong, J D; Chadee, D N; Kunz, B A

    1994-11-01

    Experimental evidence indicates that although the Saccharomyces cerevisiae RAD18 and RAD52 genes are not required for nucleotide excision repair, they function in the processing of UV-induced DNA damage in yeast. Conflicting statements regarding the UV mutability of strains deleted for RAD18 prompted us to re-examine the influence of RAD18, and RAD52, on UV mutagenesis. To do so, we characterized mutations induced by UV in SUP4-o, a yeast suppressor tRNA gene. SUP4-o was maintained on a plasmid in isogenic strains that either carried one of two different rad18 deletions (rad18 delta) or had RAD52 disrupted. Both rad18 deletions decreased the frequency of UV-induced SUP4-o mutations to levels close to those for spontaneous mutagenesis in the rad18 delta backgrounds, and prevented a net increase in mutant yield. A detailed analysis of mutations isolated after UV irradiation of one of the rad18 delta strains uncovered little evidence of the specificity features typical for UV mutagenesis in the isogenic repair-proficient (RAD) parent (e.g., predominance of G.C-->A.T transitions). Evidently, UV induction of SUP4-o mutations is highly dependent on the RAD18 gene. Compared to the RAD strain, disruption of RAD52 reduced the frequency and yield of UV mutagenesis by about two-thirds. Closer inspection revealed that 80% of this reduction was due to a decrease in the frequency of G.C-->A.T transitions. In addition, there were differences in the distributions and site specificities of single base-pair substitutions. Thus, RAD52 also participates in UV mutagenesis of a plasmid-borne gene in yeast, but to a lesser extent than RAD18.

  12. Role of the Escherichia coli grpE heat shock protein in the initiation of bacteriophage lambda DNA replication.

    Science.gov (United States)

    Osipiuk, J; Zylicz, M

    1991-01-01

    Initiation of replication of lambda DNA requires assembly of the proper nucleoprotein complex consisting of the lambda origin of replication-lambda O-lambda P-dnaB proteins. The dnaJ, dnaK and grpE heat shock proteins destabilize the lambda P-dnaB interaction in this complex permitting dnaB helicase to unwind lambda DNA near ori lambda sequence. First step of this disassembling reaction is the binding of dnaK protein to lambda P protein. In this report we examined the influence of dnaJ and grpE proteins on stability of the lambda P-dnaK complex. Our results show that grpE alone dissociates this complex, but both grpE and dnaJ together do not. These results suggest that, in the presence of grpE protein, dnaK protein has a higher affinity for lambda P protein complexed with dnaJ protein than in the situation where grpE protein is not used.

  13. The role of the HCR system in the repair of lethal lesions of Bacillus subtilis phages and their transfecting DNA damaged by radiation and alkylating agents

    International Nuclear Information System (INIS)

    Vizdalova, M.; Janovska, E.; Zhestyanikov, V.D.

    1980-01-01

    The role of the HCR system in the repair of prelethal lesions induced by UV light, γ radiation and alkylating agents was studied in the Bacillus subtilis SPP1 phage, its heat sensitive mutants (N3, N73 nad ts 1 ) and corresponding infectious DNA. The survival of phages and their transfecting DNA after treatment with UV light is substantially higher in hcr + cells than in hcr cells, the differences being more striking in intact phages than in their transfecting DNA's. Repair inhibitors reduce survival in hcr + cells: caffeine lowers the survival of UV-irradiated phage SPP1 in exponentially growing hcr + cells but has no effect on its survival in competent hcr + cells; acriflavin and ethidium bromide decrease the survival of the UV-irradiated SPP1 phage in both exponentially growing and competent hcr + cells to the level of survival observed in hcr cells; moreover, ethidium bromide lowers the number of infective centres in hcr + cells of the UV-irradiated DNA of the SPP1 phage. Repair inhibitors do not lower the survival of the UV-irradiated phages or their DNA in hcr cells. The repair mechanism under study also effectively repairs lesions induced by polyfunctional alkylating agents in the transfecting DNA's of B. subtilis phages but is not functional with lesions induced by these agents in free phages and lesions caused in the phages and their DNA by ethyl methanesulphonate or γ radiation. (author)

  14. The flexible loop L1 of the H3K4 demethylase JARID1B ARID domain has a crucial role in DNA-binding activity

    International Nuclear Information System (INIS)

    Yao, Wenming; Peng, Yu; Lin, Donghai

    2010-01-01

    JARID1B, a member of the JmjC demethylase family, has a crucial role in H3K4me3 demethylation. The ARID domain is a potential DNA-binding domain of JARID1B. Previous studies indicate that a GC-rich DNA motif is the specific target of the ARID domain. However, the details of the interaction between the ARID domain and duplex DNA require further study. Here, we utilized NMR spectroscopy to assign the backbone amino acids and mapped the DNA-binding sites of the human JARID1B ARID domain. Perturbations to 1 H- 15 N correlation spectra revealed that the flexible loop L1 of ARID was the main DNA-binding interface. EMSA and intrinsic fluorescence experiments demonstrated that mutations on loop L1 strongly reduced the DNA-binding activity of JARID1B ARID. Furthermore, transfection of mutant forms resulted in a distinct loss of intrinsic H3K4 demethylase activity, implying that the flexible loop L1 made a major contribution to sustaining the DNA-binding ability of JARID1B ARID domain.

  15. Role of Macronutrients and Micronutrients in DNA Damage: Results From a Food Frequency Questionnaire.

    Science.gov (United States)

    Ladeira, Carina; Carolino, Elisabete; Gomes, Manuel C; Brito, Miguel

    2017-01-01

    The links between diet and genomic instability have been under investigation for several decades, and evidence suggests a significant causal or preventive role for various dietary factors. This study investigates the influence of macronutrients (calories, protein, and glucides) and micronutrients, such as vitamins and minerals, as assessed by a food frequency questionnaire, on genotoxicity biomarkers measured by cytokinesis-blocked micronucleus assay and comet assay. The results found significant positive and negative correlations. Micronucleus frequency tends to increase with higher intake of caffeine, calcium, magnesium, zinc, and protein ( P macronutrients and micronutrients.

  16. Mycobacterial UvrD1 is a Ku-dependent DNA helicase that plays a role in multiple DNA repair events, including double-strand break repair.

    Science.gov (United States)

    Sinha, Krishna Murari; Stephanou, Nicolas C; Gao, Feng; Glickman, Michael S; Shuman, Stewart

    2007-05-18

    Mycobacterium tuberculosis and other bacterial pathogens have a Ku-dependent nonhomologous end joining pathway of DNA double-strand break repair. Here we identify mycobacterial UvrD1 as a novel interaction partner for Ku in a genome-wide yeast two-hybrid screen. UvrD1 per se is a vigorous DNA-dependent ATPase but a feeble DNA helicase. Ku stimulates UvrD1 to catalyze ATP-dependent unwinding of 3'-tailed DNAs. UvrD1, Ku, and DNA form a stable ternary complex in the absence of ATP. The Ku binding determinants are located in the distinctive C-terminal segment of UvrD1. A second mycobacterial paralog, UvrD2, is a vigorous Ku-independent DNA helicase. Ablation of UvrD1 sensitizes Mycobacterium smegmatis to killing by ultraviolet and ionizing radiation and to a single chromosomal break generated by I-SceI endonuclease. The physical and functional interactions of bacterial Ku and UvrD1 highlight the potential for cross-talk between components of nonhomologous end joining and nucleotide excision repair pathways.

  17. Thymidine kinase 2 (H126N) knockin mice show the essential role of balanced deoxynucleotide pools for mitochondrial DNA maintenance

    OpenAIRE

    Akman, Hasan O.; Dorado, Beatriz; López, Luis C.; García-Cazorla, Ángeles; Vilà, Maya R.; Tanabe, Lauren M.; Dauer, William T.; Bonilla, Eduardo; Tanji, Kurenai; Hirano, Michio

    2008-01-01

    Mitochondrial DNA (mtDNA) depletion syndrome (MDS), an autosomal recessive condition, is characterized by variable organ involvement with decreased mtDNA copy number and activities of respiratory chain enzymes in affected tissues. MtDNA depletion has been associated with mutations in nine autosomal genes, including thymidine kinase (TK2), which encodes a ubiquitous mitochondrial protein. To study the pathogenesis of TK2-deficiency, we generated mice harboring an H126N Tk2 mutation. Homozygous...

  18. Internalization of Staphylococcus aureus in Lymphocytes Induces Oxidative Stress and DNA Fragmentation: Possible Ameliorative Role of Nanoconjugated Vancomycin

    Directory of Open Access Journals (Sweden)

    Subhankari Prasad Chakraborty

    2011-01-01

    Full Text Available Staphylococcus aureus is the most frequently isolated pathogen causing bloodstream infections, skin and soft tissue infections and pneumonia. Lymphocyte is an important immune cell. The aim of the present paper was to test the ameliorative role of nanoconjugated vancomycin against Vancomycin-sensitive Staphylococcus aureus (VSSA and vancomycin-resistant Staphylococcus aureus (VRSA infection-induced oxidative stress in lymphocytes. VSSA and VRSA infections were developed in Swiss mice by intraperitoneal injection of 5×106 CFU/mL bacterial solutions. Nanoconjugated vancomycin was adminstrated to VSSA- and VRSA-infected mice at its effective dose for 10 days. Vancomycin was adminstrated to VSSA- and VRSA-infected mice at a similar dose, respectively, for 10 days. Vancomycin and nanoconjugated vancomycin were adminstrated to normal mice at their effective doses for 10 days. The result of this study reveals that in vivo VSSA and VRSA infection significantly increases the level of lipid peroxidation, protein oxidation, oxidized glutathione level, nitrite generation, nitrite release, and DNA damage and decreases the level of reduced glutathione, antioxidant enzyme status, and glutathione-dependent enzymes as compared to control group, which were increased or decreased significantly near to normal in nanoconjugated vancomycin-treated group. These findings suggest the potential use and beneficial role of nanoconjugated vancomycin against VSSA and VRSA infection-induced oxidative stress in lymphocytes.

  19. Role of the inhibitors of angiotensin renin system on the DNA integrity of irradiated spermatozoids; Papel dos inibidores dos sistema renina angiotensina sobre a integridade do DNA de espermatozoides irradiados

    Energy Technology Data Exchange (ETDEWEB)

    Spadella, Maria A.; Mansano, Naira S.; Schwarz, Franciele C.; Viani, Gustavo A.; Chies, Agnaldo B. [Faculdade de Medicina de Marilia (FAMEMA), Marilia, SP (Brazil)

    2016-07-01

    Radiation action in the testes can significantly affect the reproductive capacity due to oxidative stress generated; phenomenon in which there is evidence of involvement of the Renin Angiotensin System (RAS). This study evaluated the role of AT1 receptor inhibitors, in mitigating the radioinduced DNA damage sperm from semen samples left vas deferens. Male Wistar rats were divided into six experimental groups: Control, 5Gy, Telmisartan (12mg/kg/day) and Losartan (34mg/kg/2x/day), 5 Gy + Telmisartan and 5 Gy + Losartan. The results showed increase in the percentage of sperm with fragmented DNA in irradiated groups when compared to controls, which was not reversed in the irradiated and treated groups. The radiation of 5Gy (single dose) affected the DNA-protein complex of the sperm and the treatments did not influence in reversing this damage, considering the experimental protocol used. (author)

  20. Role of quantitative and qualitative characteristics of free circulating DNA in the management of patients with non-small cell lung cancer.

    Science.gov (United States)

    Ulivi, Paola; Silvestrini, Rosella

    2013-12-01

    The release of DNA into peripheral blood is a common event in cancer patients, occurring as a consequence of necrotic and apoptotic processes typical of tumor cells. However, free circulating DNA (fcDNA) is also present in patients with benign diseases and in healthy individuals. Both quantitative and qualitative aspects of fcDNA have been studied as potential biomarkers in a number of tumor types. In particular, quantitative analysis of fcDNA has been shown to play an important role in the diagnosis of non-small cell lung cancer (NSCLC), because of its ability to discriminate between healthy subjects and individuals with NSCLC. Additionally, fcDNA in cancer patients derives predominantly from tumor tissue and, as such, it can be used for the molecular characterization of the primary tumor. Targeted therapies in NSCLC have, in recent years, produced promising results, highlighting the importance of molecular profiling of the primary cancer lesions. Considering that little or no tumor material is available for at least some of the patients, the possibility of using fcDNA for molecular analysis becomes increasingly important. In the present review we evaluated several quantitative and qualitative aspects of fcDNA that could be instrumental for the differential diagnosis of lung disease. There is ample evidence in the literature to support the possible use of peripheral blood-derived fcDNA in the early diagnosis and molecular characterization of lung cancer. This non-invasive method may also turn out to be valuable in monitoring drug response and in identifying induced mechanisms of drug resistance. Before it can be implemented in routine clinical practice, however, additional efforts are needed to standardize the methodology.

  1. Regulating repression: roles for the sir4 N-terminus in linker DNA protection and stabilization of epigenetic states.

    Directory of Open Access Journals (Sweden)

    Stephanie Kueng

    Full Text Available Silent information regulator proteins Sir2, Sir3, and Sir4 form a heterotrimeric complex that represses transcription at subtelomeric regions and homothallic mating type (HM loci in budding yeast. We have performed a detailed biochemical and genetic analysis of the largest Sir protein, Sir4. The N-terminal half of Sir4 is dispensable for SIR-mediated repression of HM loci in vivo, except in strains that lack Yku70 or have weak silencer elements. For HM silencing in these cells, the C-terminal domain (Sir4C, residues 747-1,358 must be complemented with an N-terminal domain (Sir4N; residues 1-270, expressed either independently or as a fusion with Sir4C. Nonetheless, recombinant Sir4C can form a complex with Sir2 and Sir3 in vitro, is catalytically active, and has sedimentation properties similar to a full-length Sir4-containing SIR complex. Sir4C-containing SIR complexes bind nucleosomal arrays and protect linker DNA from nucleolytic digestion, but less effectively than wild-type SIR complexes. Consistently, full-length Sir4 is required for the complete repression of subtelomeric genes. Supporting the notion that the Sir4 N-terminus is a regulatory domain, we find it extensively phosphorylated on cyclin-dependent kinase consensus sites, some being hyperphosphorylated during mitosis. Mutation of two major phosphoacceptor sites (S63 and S84 derepresses natural subtelomeric genes when combined with a serendipitous mutation (P2A, which alone can enhance the stability of either the repressed or active state. The triple mutation confers resistance to rapamycin-induced stress and a loss of subtelomeric repression. We conclude that the Sir4 N-terminus plays two roles in SIR-mediated silencing: it contributes to epigenetic repression by stabilizing the SIR-mediated protection of linker DNA; and, as a target of phosphorylation, it can destabilize silencing in a regulated manner.

  2. CANCER AND NEUROLOGIC DEGENERATION IN XERODERMA PIGMENTOSUM: LONG TERM FOLLOW-UP CHARACTERIZES THE ROLE OF DNA REPAIR

    Science.gov (United States)

    Bradford, Porcia T.; Goldstein, Alisa M.; Tamura, Deborah; Khan, Sikandar G.; Ueda, Takahiro; Boyle, Jennifer; Oh, Kyu-Seon; Imoto, Kyoko; Inui, Hiroki; Moriwaki, Shin-Ichi; Emmert, Steffen; Pike, Kristen M.; Raziuddin, Arati; Plona, Teri M.; DiGiovanna, John J.; Tucker, Margaret A.; Kraemer, Kenneth H.

    2011-01-01

    Background We determined the frequency of cancer, neurologic degeneration and mortality in xeroderma pigmentosum (XP) patients with defective DNA repair in a four decade natural history study. Methods All 106 XP patients admitted to the NIH from 1971 to 2009 were evaluated from clinical records and follow-up. Results In the 65 percent (n=69) of patients with skin cancer, non-melanoma skin cancer (NMSC) was increased 10,000–fold and melanoma was increased 2,000-fold in patients under age 20. The 9 year median age at diagnosis of first non-melanoma skin cancer (NMSC) (n=64) was significantly younger than the 22 year median age at diagnosis of first melanoma (n= 38), a relative age reversal from the general population suggesting different mechanisms of carcinogenesis between NMSC and melanoma. XP patients with marked burning on minimal sun exposure (n=65) were less likely to develop skin cancer than those who did not. This may be related to the extreme sun protection they receive from an earlier age, decreasing their total UV exposure. Progressive neurologic degeneration was present in 24% (n=25) with 16/25 in complementation group XP-D. The most common causes of death were skin cancer (34%, n=10), neurologic degeneration (31%, n=9), and internal cancer (17%, n=5). The median age at death (29 years) in XP patients with neurodegeneration was significantly younger than those XP patients without neurodegeneration (37 years) (p=0.02). Conclusion This 39 year follow-up study of XP patients indicates a major role of DNA repair genes in the etiology of skin cancer and neurologic degeneration. PMID:21097776

  3. The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

    Science.gov (United States)

    Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

    2018-01-01

    The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

  4. Role of aldo-keto reductases and other doxorubicin pharmacokinetic genes in doxorubicin resistance, DNA binding, and subcellular localization

    International Nuclear Information System (INIS)

    Heibein, Allan D; Guo, Baoqing; Sprowl, Jason A; MacLean, David A; Parissenti, Amadeo M

    2012-01-01

    Since proteins involved in chemotherapy drug pharmacokinetics and pharmacodynamics have a strong impact on the uptake, metabolism, and efflux of such drugs, they likely play critical roles in resistance to chemotherapy drugs in cancer patients. To investigate this hypothesis, we conducted a whole genome microarray study to identify difference in the expression of genes between isogenic doxorubicin-sensitive and doxorubicin-resistant MCF-7 breast tumour cells. We then assessed the degree of over-representation of doxorubicin pharmacokinetic and pharmacodynamic genes in the dataset of doxorubicin resistance genes. Of 27,958 Entrez genes on the array, 7.4 per cent or 2,063 genes were differentially expressed by ≥ 2-fold between wildtype and doxorubicin-resistant cells. The false discovery rate was set at 0.01 and the minimum p value for significance for any gene within the “hit list” was 0.01. Seventeen and 43 per cent of doxorubicin pharmacokinetic genes were over-represented in the hit list, depending upon whether the gene name was identical or within the same gene family, respectively. The most over-represented genes were within the 1C and 1B families of aldo-keto reductases (AKRs), which convert doxorubicin to doxorubicinol. Other genes convert doxorubicin to other metabolites or affect the influx, efflux, or cytotoxicity of the drug. In further support of the role of AKRs in doxorubicin resistance, we observed that, in comparison to doxorubicin, doxorubincol exhibited dramatically reduced cytotoxicity, reduced DNA-binding activity, and strong localization to extra nuclear lysosomes. Pharmacologic inhibition of the above AKRs in doxorubicin-resistant cells increased cellular doxorubicin levels, restored doxorubicin cytotoxicity and re-established doxorubicin localization to the nucleus. The properties of doxorubicinol were unaffected. These findings demonstrate the utility of using curated pharmacokinetic and pharmacodynamic knowledge bases to identify

  5. Single-base resolution maps of cultivated and wild rice methylomes and regulatory roles of DNA methylation in plant gene expression

    Directory of Open Access Journals (Sweden)

    Li Xin

    2012-07-01

    Full Text Available Abstract Background DNA methylation plays important biological roles in plants and animals. To examine the rice genomic methylation landscape and assess its functional significance, we generated single-base resolution DNA methylome maps for Asian cultivated rice Oryza sativa ssp. japonica, indica and their wild relatives, Oryza rufipogon and Oryza nivara. Results The overall methylation level of rice genomes is four times higher than that of Arabidopsis. Consistent with the results reported for Arabidopsis, methylation in promoters represses gene expression while gene-body methylation generally appears to be positively associated with gene expression. Interestingly, we discovered that methylation in gene transcriptional termination regions (TTRs can significantly repress gene expression, and the effect is even stronger than that of promoter methylation. Through integrated analysis of genomic, DNA methylomic and transcriptomic differences between cultivated and wild rice, we found that primary DNA sequence divergence is the major determinant of methylational differences at the whole genome level, but DNA methylational difference alone can only account for limited gene expression variation between the cultivated and wild rice. Furthermore, we identified a number of genes with significant difference in methylation level between the wild and cultivated rice. Conclusions The single-base resolution methylomes of rice obtained in this study have not only broadened our understanding of the mechanism and function of DNA methylation in plant genomes, but also provided valuable data for future studies of rice epigenetics and the epigenetic differentiation between wild and cultivated rice.

  6. DNA methylation

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

  7. Opposing roles of Toll-like receptor and cytosolic DNA-STING signaling pathways for Staphylococcus aureus cutaneous host defense.

    Directory of Open Access Journals (Sweden)

    Philip O Scumpia

    2017-07-01

    Full Text Available Successful host defense against pathogens requires innate immune recognition of the correct pathogen associated molecular patterns (PAMPs by pathogen recognition receptors (PRRs to trigger the appropriate gene program tailored to the pathogen. While many PRR pathways contribute to the innate immune response to specific pathogens, the relative importance of each pathway for the complete transcriptional program elicited has not been examined in detail. Herein, we used RNA-sequencing with wildtype and mutant macrophages to delineate the innate immune pathways contributing to the early transcriptional response to Staphylococcus aureus, a ubiquitous microorganism that can activate a wide variety of PRRs. Unexpectedly, two PRR pathways-the Toll-like receptor (TLR and Stimulator of Interferon Gene (STING pathways-were identified as dominant regulators of approximately 95% of the genes that were potently induced within the first four hours of macrophage infection with live S. aureus. TLR signaling predominantly activated a pro-inflammatory program while STING signaling activated an antiviral/type I interferon response with live but not killed S. aureus. This STING response was largely dependent on the cytosolic DNA sensor cyclic guanosine-adenosine synthase (cGAS. Using a cutaneous infection model, we found that the TLR and STING pathways played opposite roles in host defense to S. aureus. TLR signaling was required for host defense, with its absence reducing interleukin (IL-1β production and neutrophil recruitment, resulting in increased bacterial growth. In contrast, absence of STING signaling had the opposite effect, enhancing the ability to restrict the infection. These results provide novel insights into the complex interplay of innate immune signaling pathways triggered by S. aureus and uncover opposing roles of TLR and STING in cutaneous host defense to S. aureus.

  8. The sub-nucleolar localization of PHF6 defines its role in rDNA transcription and early processing events

    Science.gov (United States)

    Todd, Matthew A M; Huh, Michael S; Picketts, David J

    2016-01-01

    Ribosomal RNA synthesis occurs in the nucleolus and is a tightly regulated process that is targeted in some developmental diseases and hyperactivated in multiple cancers. Subcellular localization and immunoprecipitation coupled mass spectrometry demonstrated that a proportion of plant homeodomain (PHD) finger protein 6 (PHF6) protein is localized within the nucleolus and interacts with proteins involved in ribosomal processing. PHF6 sequence variants cause Börjeson–Forssman–Lehmann syndrome (BFLS, MIM#301900) and are also associated with a female-specific phenotype overlapping with Coffin–Siris syndrome (MIM#135900), T-cell acute lymphoblastic leukemia (MIM#613065), and acute myeloid leukemia (MIM#601626); however, very little is known about its cellular function, including its nucleolar role. HEK 293T cells were treated with RNase A, DNase I, actinomycin D, or 5,6-dichloro-β-D-ribofuranosylbenzimadole, followed by immunocytochemistry to determine PHF6 sub-nucleolar localization. We observed RNA-dependent localization of PHF6 to the sub-nucleolar fibrillar center (FC) and dense fibrillar component (DFC), at whose interface rRNA transcription occurs. Subsequent ChIP-qPCR analysis revealed strong enrichment of PHF6 across the entire rDNA-coding sequence but not along the intergenic spacer (IGS) region. When rRNA levels were quantified in a PHF6 gain-of-function model, we observed an overall decrease in rRNA transcription, accompanied by a modest increase in repressive promoter-associated RNA (pRNA) and a significant increase in the expression levels of the non-coding IGS36RNA and IGS39RNA transcripts. Collectively, our results demonstrate a role for PHF6 in carefully mediating the overall levels of ribosome biogenesis within a cell. PMID:27165002

  9. The Prognostic Roles of Gender and O6-Methylguanine-DNA Methyltransferase Methylation Status in Glioblastoma Patients: The Female Power.

    Science.gov (United States)

    Franceschi, Enrico; Tosoni, Alicia; Minichillo, Santino; Depenni, Roberta; Paccapelo, Alexandro; Bartolini, Stefania; Michiara, Maria; Pavesi, Giacomo; Urbini, Benedetta; Crisi, Girolamo; Cavallo, Michele A; Tosatto, Luigino; Dazzi, Claudio; Biasini, Claudia; Pasini, Giuseppe; Balestrini, Damiano; Zanelli, Francesca; Ramponi, Vania; Fioravanti, Antonio; Giombelli, Ermanno; De Biase, Dario; Baruzzi, Agostino; Brandes, Alba A

    2018-04-01

    Clinical and molecular factors are essential to define the prognosis in patients with glioblastoma (GBM). O6-methylguanine-DNA methyltransferase (MGMT) methylation status, age, Karnofsky Performance Status (KPS), and extent of surgical resection are the most relevant prognostic factors. Our investigation of the role of gender in predicting prognosis shows a slight survival advantage for female patients. We performed a prospective evaluation of the Project of Emilia Romagna on Neuro-Oncology (PERNO) registry to identify prognostic factors in patients with GBM who received standard treatment. A total of 169 patients (99 males [58.6%] and 70 females [41.4%]) were evaluated prospectively. MGMT methylation was evaluable in 140 patients. Among the male patients, 36 were MGMT methylated (25.7%) and 47 were unmethylated (33.6%); among the female patients, 32 were methylated (22.9%) and 25 were unmethylated (17.9%). Survival was longer in the methylated females compared with the methylated males (P = 0.028) but was not significantly different between the unmethylated females and the unmethylated males (P = 0.395). In multivariate analysis, gender and MGMT methylation status considered together (methylated females vs. methylated males; hazard ratio [HR], 0.459; 95% confidence interval [CI], 0.242-0.827; P = 0.017), age (HR, 1.025; 95% CI, 1.002-1.049; P = 0.032), and KPS (HR, 0.965; 95% CI, 0.948-0.982; P factor. Copyright © 2018 Elsevier Inc. All rights reserved.

  10. Genetic and non-genetic influences during pregnancy on infant global and site specific DNA methylation: role for folate gene variants and vitamin B12.

    Directory of Open Access Journals (Sweden)

    Jill A McKay

    Full Text Available Inter-individual variation in patterns of DNA methylation at birth can be explained by the influence of environmental, genetic and stochastic factors. This study investigates the genetic and non-genetic determinants of variation in DNA methylation in human infants. Given its central role in provision of methyl groups for DNA methylation, this study focuses on aspects of folate metabolism. Global (LUMA and gene specific (IGF2, ZNT5, IGFBP3 DNA methylation were quantified in 430 infants by Pyrosequencing®. Seven polymorphisms in 6 genes (MTHFR, MTRR, FOLH1, CβS, RFC1, SHMT involved in folate absorption and metabolism were analysed in DNA from both infants and mothers. Red blood cell folate and serum vitamin B(12 concentrations were measured as indices of vitamin status. Relationships between DNA methylation patterns and several covariates viz. sex, gestation length, maternal and infant red cell folate, maternal and infant serum vitamin B(12, maternal age, smoking and genotype were tested. Length of gestation correlated positively with IGF2 methylation (rho = 0.11, p = 0.032 and inversely with ZNT5 methylation (rho = -0.13, p = 0.017. Methylation of the IGFBP3 locus correlated inversely with infant vitamin B(12 concentration (rho = -0.16, p = 0.007, whilst global DNA methylation correlated inversely with maternal vitamin B(12 concentrations (rho = 0.18, p = 0.044. Analysis of common genetic variants in folate pathway genes highlighted several associations including infant MTRR 66G>A genotype with DNA methylation (χ(2 = 8.82, p = 0.003 and maternal MTHFR 677C>T genotype with IGF2 methylation (χ(2 = 2.77, p = 0.006. These data support the hypothesis that both environmental and genetic factors involved in one-carbon metabolism influence DNA methylation in infants. Specifically, the findings highlight the importance of vitamin B(12 status, infant MTRR genotype and maternal MTHFR genotype, all of which may influence the supply of methyl groups for

  11. The regiochemical distribution of positive charges along cholesterol polyamine carbamates plays significant roles in modulating DNA binding affinity and lipofection.

    Science.gov (United States)

    Geall, A J; Eaton, M A; Baker, T; Catterall, C; Blagbrough, I S

    1999-10-15

    We have quantified the effects of the regiochemical distribution of positive charges along the polyamine moiety in lipopolyamines for DNA molecular recognition. High affinity binding leads to charge neutralisation, DNA condensation and ultimately to lipofection. Binding affinities for calf thymus DNA were determined using an ethidium bromide displacement assay and condensation was detected by changes in turbidity using light scattering. The in vitro transfection competence of cholesterol polyamine carbamates was measured in CHO cells. In the design of DNA condensing and transfecting agents for non-viral gene therapy, the interrelationship of ammonium ions, not just their number, must be considered.

  12. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  13. The role of DNA-protein interaction in the UV damage of T7 bacteriophage at high fluences

    International Nuclear Information System (INIS)

    Fekete, A.; Ronto, G.

    1980-01-01

    The influence of higher fluences (0.5-10 kJm -2 ) and that of phage protein coat on the UV (lambda = 254 nm) damage of T7 DNA were studied by UV difference spectroscopy. Beside the pyrimidine dimers and adducts produced also in isolated DNA in the case of intact phages and fluences exceeding 0.5 kJ m -2 other photoproducts, probably DNA-protein cross-links were identified as well. Phages deprived of their protein coat by a thermal treatment show similar UV damage to that of isolated DNA. (author)

  14. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  15. Role of damage-specific DNA polymerases in M13 phage mutagenesis induced by a major lipid peroxidation product trans-4-hydroxy-2-nonenal

    Energy Technology Data Exchange (ETDEWEB)

    Janowska, Beata [Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw (Poland); Kurpios-Piec, Dagmara [Department of Biochemistry, Medical University of Warsaw, Banacha 1, 02-097 Warsaw (Poland); Prorok, Paulina [Institute of Genetics and Biotechnology, Warsaw University, Pawinskiego 5a, 02-106 Warsaw (Poland); Szparecki, Grzegorz [Medical University of Warsaw, Zwirki i Wigury 61, 02-097 Warsaw (Poland); Komisarski, Marek [Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw (Poland); Kowalczyk, Pawel [Interdisciplinary Centre for Mathematical and Computational Modelling, Warsaw University, Pawinskiego 5a, 02-106 Warsaw (Poland); Janion, Celina [Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw (Poland); Tudek, Barbara, E-mail: tudek@ibb.waw.pl [Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw (Poland); Institute of Genetics and Biotechnology, Warsaw University, Pawinskiego 5a, 02-106 Warsaw (Poland)

    2012-01-03

    One of the major lipid peroxidation products trans-4-hydroxy-2-nonenal (HNE), forms cyclic propano- or ethenoadducts bearing six- or seven-carbon atom side chains to G > C Much-Greater-Than A > T. To specify the role of SOS DNA polymerases in HNE-induced mutations, we tested survival and mutation spectra in the lacZ{alpha} gene of M13mp18 phage, whose DNA was treated in vitro with HNE, and which was grown in uvrA{sup -}Escherichia coli strains, carrying one, two or all three SOS DNA polymerases. When Pol IV was the only DNA SOS polymerase in the bacterial host, survival of HNE-treated M13 DNA was similar to, but mutation frequency was lower than in the strain containing all SOS DNA polymerases. When only Pol II or Pol V were present in host bacteria, phage survival decreased dramatically. Simultaneously, mutation frequency was substantially increased, but exclusively in the strain carrying only Pol V, suggesting that induction of mutations by HNE is mainly dependent on Pol V. To determine the role of Pol II and Pol IV in HNE induced mutagenesis, Pol II or Pol IV were expressed together with Pol V. This resulted in decrease of mutation frequency, suggesting that both enzymes can compete with Pol V, and bypass HNE-DNA adducts in an error-free manner. However, HNE-DNA adducts were easily bypassed by Pol IV and only infrequently by Pol II. Mutation spectrum established for strains expressing only Pol V, showed that in uvrA{sup -} bacteria the frequency of base substitutions and recombination increased in relation to NER proficient strains, particularly mutations at adenine sites. Among base substitutions A:T {yields} C:G, A:T {yields} G:C, G:C {yields} A:T and G:C {yields} T:A prevailed. The results suggest that Pol V can infrequently bypass HNE-DNA adducts inducing mutations at G, C and A sites, while bypass by Pol IV and Pol II is error-free, but for Pol II infrequent.

  16. The 3'-to-5' exonuclease activity of vaccinia virus DNA polymerase is essential and plays a role in promoting virus genetic recombination.

    Science.gov (United States)

    Gammon, Don B; Evans, David H

    2009-05-01

    Poxviruses are subjected to extraordinarily high levels of genetic recombination during infection, although the enzymes catalyzing these reactions have never been identified. However, it is clear that virus-encoded DNA polymerases play some unknown yet critical role in virus recombination. Using a novel, antiviral-drug-based strategy to dissect recombination and replication reactions, we now show that the 3'-to-5' proofreading exonuclease activity of the viral DNA polymerase plays a key role in promoting recombination reactions. Linear DNA substrates were prepared containing the dCMP analog cidofovir (CDV) incorporated into the 3' ends of the molecules. The drug blocked the formation of concatemeric recombinant molecules in vitro in a process that was catalyzed by the proofreading activity of vaccinia virus DNA polymerase. Recombinant formation was also blocked when CDV-containing recombination substrates were transfected into cells infected with wild-type vaccinia virus. These inhibitory effects could be overcome if CDV-containing substrates were transfected into cells infected with CDV-resistant (CDV(r)) viruses, but only when resistance was linked to an A314T substitution mutation mapping within the 3'-to-5' exonuclease domain of the viral polymerase. Viruses encoding a CDV(r) mutation in the polymerase domain still exhibited a CDV-induced recombination deficiency. The A314T substitution also enhanced the enzyme's capacity to excise CDV molecules from the 3' ends of duplex DNA and to recombine these DNAs in vitro, as judged from experiments using purified mutant DNA polymerase. The 3'-to-5' exonuclease activity appears to be an essential virus function, and our results suggest that this might be because poxviruses use it to promote genetic exchange.

  17. A Crystallographic Study of the Role of Sequence Context in Thymine Glycol Bypass by a Replicative DNA Polymerase Serendipitously Sheds Light on the Exonuclease Complex

    Energy Technology Data Exchange (ETDEWEB)

    Aller, Pierre; Duclos, Stéphanie; Wallace, Susan S.; Doublié, Sylvie (Vermont)

    2012-06-27

    Thymine glycol (Tg) is the most common oxidation product of thymine and is known to be a strong block to replicative DNA polymerases. A previously solved structure of the bacteriophage RB69 DNA polymerase (RB69 gp43) in complex with Tg in the sequence context 5'-G-Tg-G shed light on how Tg blocks primer elongation: The protruding methyl group of the oxidized thymine displaces the adjacent 5'-G, which can no longer serve as a template for primer elongation [Aller, P., Rould, M. A., Hogg, M, Wallace, S. S. and Doublie S. (2007). A structural rationale for stalling of a replicative DNA polymerase at the most common oxidative thymine lesion, thymine glycol. Proc. Natl. Acad. Sci. USA, 104, 814-818.]. Several studies showed that in the sequence context 5'-C-Tg-purine, Tg is more likely to be bypassed by Klenow fragment, an A-family DNA polymerase. We set out to investigate the role of sequence context in Tg bypass in a B-family polymerase and to solve the crystal structures of the bacteriophage RB69 DNA polymerase in complex with Tg-containing DNA in the three remaining sequence contexts: 5'-A-Tg-G, 5'-T-Tg-G, and 5'-C-Tg-G. A combination of several factors - including the associated exonuclease activity, the nature of the 3' and 5' bases surrounding Tg, and the cis-trans interconversion of Tg - influences Tg bypass. We also visualized for the first time the structure of a well-ordered exonuclease complex, allowing us to identify and confirm the role of key residues (Phe123, Met256, and Tyr257) in strand separation and in the stabilization of the primer strand in the exonuclease site.

  18. DNA Barcode Authentication and Library Development for the Wood of Six Commercial Pterocarpus Species: the Critical Role of Xylarium Specimens.

    Science.gov (United States)

    Jiao, Lichao; Yu, Min; Wiedenhoeft, Alex C; He, Tuo; Li, Jianing; Liu, Bo; Jiang, Xiaomei; Yin, Yafang

    2018-01-31

    DNA barcoding has been proposed as a useful tool for forensic wood identification and development of a reliable DNA reference library is an essential first step. Xylaria (wood collections) are potentially enormous data repositories if DNA information could be extracted from wood specimens. In this study, 31 xylarium wood specimens and 8 leaf specimens of six important commercial species of Pterocarpus were selected to investigate the reliability of DNA barcodes for authentication at the species level and to determine the feasibility of building wood DNA barcode reference libraries from xylarium specimens. Four DNA barcodes (ITS2, matK, ndhF-rpl32 and rbcL) and their combination were tested to evaluate their discrimination ability for Pterocarpus species with both TaxonDNA and tree-based analytical methods. The results indicated that the combination barcode of matK + ndhF-rpl32 + ITS2 yielded the best discrimination for the Pterocarpus species studied. The mini-barcode ndhF-rpl32 (167-173 bps) performed well distinguishing P. santalinus from its wood anatomically inseparable species P. tinctorius. Results from this study verified not only the feasibility of building DNA barcode libraries using xylarium wood specimens, but the importance of using wood rather than leaves as the source tissue, when wood is the botanical material to be identified.

  19. Deciphering the Role of Alternative Non-Homologous End Joining (Alt-NHEJ) DNA Repair in Breast Cancer

    Science.gov (United States)

    2017-12-01

    consecutive TTAGGG repeats. To detect rare reads containing fusion junctions, we exploited the novel sequence arrangement created by the ligation of the 39G...journal.pgen.1001005 (2010). 14 van Kregten, M. et al. T-DNA integration in plants results from polymerase-theta-mediated DNA repair. Nat Plants 2

  20. Heteroduplex DNA position defines the roles of the Sgs1, Srs2, and Mph1 helicases in promoting distinct recombination outcomes.

    Directory of Open Access Journals (Sweden)

    Katrina Mitchel

    Full Text Available The contributions of the Sgs1, Mph1, and Srs2 DNA helicases during mitotic double-strand break (DSB repair in yeast were investigated using a gap-repair assay. A diverged chromosomal substrate was used as a repair template for the gapped plasmid, allowing mismatch-containing heteroduplex DNA (hDNA formed during recombination to be monitored. Overall DSB repair efficiencies and the proportions of crossovers (COs versus noncrossovers (NCOs were determined in wild-type and helicase-defective strains, allowing the efficiency of CO and NCO production in each background to be calculated. In addition, the products of individual NCO events were sequenced to determine the location of hDNA. Because hDNA position is expected to differ depending on whether a NCO is produced by synthesis-dependent-strand-annealing (SDSA or through a Holliday junction (HJ-containing intermediate, its position allows the underlying molecular mechanism to be inferred. Results demonstrate that each helicase reduces the proportion of CO recombinants, but that each does so in a fundamentally different way. Mph1 does not affect the overall efficiency of gap repair, and its loss alters the CO-NCO by promoting SDSA at the expense of HJ-containing intermediates. By contrast, Sgs1 and Srs2 are each required for efficient gap repair, strongly promoting NCO formation and having little effect on CO efficiency. hDNA analyses suggest that all three helicases promote SDSA, and that Sgs1 and Srs2 additionally dismantle HJ-containing intermediates. The hDNA data are consistent with the proposed role of Sgs1 in the dissolution of double HJs, and we propose that Srs2 dismantles nicked HJs.

  1. DNA damage and DNA damage response in human bronchial epithelial BEAS-2B cells following exposure to 2-nitrobenzanthrone and 3-nitrobenzanthrone: role in apoptosis.

    Science.gov (United States)

    Oya, Elisabeth; Ovrevik, Johan; Arlt, Volker M; Nagy, Eszter; Phillips, David H; Holme, Jørn A

    2011-11-01

    Nitro-polycyclic aromatic hydrocarbons (nitro-PAHs) are mutagenic and carcinogenic environmental pollutants found in diesel exhaust and on urban air pollution particles. In the present study, human bronchial epithelial BEAS-2B cells were exposed to 2-nitrobenzanthrone (2-NBA) and 3-nitrobenzanthrone (3-NBA). DNA damage responses were compared to those observed after exposure to 1-nitropyrene (1-NP) and benzo[a]pyrene (B[a]P). Examination by microscopy revealed that 3-NBA was the most potent toxic compound while weaker responses were observed with 1-NP and B[a]P. Most interestingly, 2-NBA did not induce cell death or any other stress-related responses. 3-NBA induced a typical apoptotic cell death judged by nuclear condensation and little plasma membrane damage as well as cleavage of caspase 3 and poly-(ADP-ribose) polymerase (PARP). Exposure to 3-NBA resulted in an accumulation of cells in S-phase, and further analysis by Western blotting, immunocytochemistry and flow cytometry revealed that 3-NBA induced a DNA damage response characterized by phosphorylation of ATM (ataxia-telangiectasia mutated), checkpoint kinase (Chk) 2/Chk1, H2AX and p53. The p53 inhibitor pifithrin-α inhibited 3-NBA-induced apoptosis while small effects were seen using pifithrin-μ, suggesting that 3-NBA-induced cell death is a result of transcriptional activation of p53. In conclusion, 3-NBA is a potent inducer of apoptosis, which seemed to be triggered by the DNA damage response. Furthermore, a change of the nitro-group to the second position (i.e. 2-NBA) dramatically changed the cellular reactivity of the compound.

  2. Mobile phone radiation induces mode-dependent DNA damage in a mouse spermatocyte-derived cell line: a protective role of melatonin.

    Science.gov (United States)

    Liu, Chuan; Gao, Peng; Xu, Shang-Cheng; Wang, Yuan; Chen, Chun-Hai; He, Min-Di; Yu, Zheng-Ping; Zhang, Lei; Zhou, Zhou

    2013-11-01

    To evaluate whether exposure to mobile phone radiation (MPR) can induce DNA damage in male germ cells. A mouse spermatocyte-derived GC-2 cell line was exposed to a commercial mobile phone handset once every 20 min in standby, listen, dialed or dialing modes for 24 h. DNA damage was determined using an alkaline comet assay. The levels of DNA damage were significantly increased following exposure to MPR in the listen, dialed and dialing modes. Moreover, there were significantly higher increases in the dialed and dialing modes than in the listen mode. Interestingly, these results were consistent with the radiation intensities of these modes. However, the DNA damage effects of MPR in the dialing mode were efficiently attenuated by melatonin pretreatment. These results regarding mode-dependent DNA damage have important implications for the safety of inappropriate mobile phone use by males of reproductive age and also suggest a simple preventive measure: Keeping mobile phones as far away from our body as possible, not only during conversations but during 'dialed' and 'dialing' operation modes. Since the 'dialed' mode is actually part of the standby mode, mobile phones should be kept at a safe distance from our body even during standby operation. Furthermore, the protective role of melatonin suggests that it may be a promising pharmacological candidate for preventing mobile phone use-related reproductive impairments.

  3. Investigating the role of melanin in UVA/UVB- and hydrogen peroxide-induced cellular and mitochondrial ROS production and mitochondrial DNA damage in human melanoma cells.

    Science.gov (United States)

    Swalwell, Helen; Latimer, Jennifer; Haywood, Rachel M; Birch-Machin, Mark A

    2012-02-01

    Skin cancer incidence is dramatically increasing worldwide, with exposure to ultraviolet radiation (UVR) a predominant factor. The UVA component initiates oxidative stress in human skin, although its exact role in the initiation of skin cancer, particularly malignant melanoma, remains unclear and is controversial because there is evidence for a melanin-dependent mechanism in UVA-linked melanoma studies. Nonpigmented (CHL-1, A375), moderately pigmented (FM55, SKmel23), and highly pigmented (FM94, hyperpigmented FM55) human melanoma cell lines have been used to investigate UVA-induced production of reactive oxygen species using FACS analysis, at both the cellular (dihydrorhodamine-123) and the mitochondrial (MitoSOX) level, where most cellular stress is generated. For the first time, downstream mtDNA damage (utilizing a quantitative long-PCR assay) has been investigated. Using UVA, UVB, and H(2)O(2) as cellular stressors, we have explored the dual roles of melanin as a photoprotector and photosensitizer. The presence of melanin has no influence over cellular oxidative stress generation, whereas, in contrast, melanin protects against mitochondrial superoxide generation and mtDNA damage (one-way ANOVA with post hoc Tukey's analysis, Pmelanin binds directly to DNA, it acts as a direct photosensitizer of mtDNA damage during UVA irradiation (Pmelanin. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. The roles of DNA damage-dependent signals and MAPK cascades in tributyltin-induced germline apoptosis in Caenorhabditis elegans.

    Science.gov (United States)

    Wang, Yun; Wang, Shunchang; Luo, Xun; Yang, Yanan; Jian, Fenglei; Wang, Xuemin; Xie, Lucheng

    2014-08-01

    The induction of apoptosis is recognized to be a major mechanism of tributyltin (TBT) toxicity. However, the underlying signaling pathways for TBT-induced apoptosis remain unclear. In this study, using the nematode Caenorhabditis elegans, we examined whether DNA damage response (DDR) pathway and mitogen-activated protein kinase (MAPK) signaling cascades are involved in TBT-induced germline apoptosis and cell cycle arrest. Our results demonstrated that exposing worms to TBT at the dose of 10nM for 6h significantly increased germline apoptosis in N2 strain. Germline apoptosis was absent in strains that carried ced-3 or ced-4 loss-of-function alleles, indicating that both caspase protein CED-3 and Apaf-1 protein CED-4 were required for TBT-induced apoptosis. TBT-induced apoptosis was blocked in the Bcl-2 gain-of-function strain ced-9(n1950), whereas TBT induced a minor increase in the BH3-only protein EGL-1 mutated strain egl-1(n1084n3082). Checkpoint proteins HUS-1 and CLK-2 exerted proapoptotic effects, and the null mutation of cep-1, the homologue of tumor suppressor gene p53, significantly inhibited TBT-induced apoptosis. Apoptosis in the loss-of-function strains of ERK, JNK and p38 MAPK signaling pathways were completely or mildly suppressed under TBT stress. These results were supported by the results of mRNA expression levels of corresponding genes. The present study indicated that TBT-induced apoptosis required the core apoptotic machinery, and that DDR genes and MAPK pathways played essential roles in signaling the processes. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. DNA: Structure and function

    DEFF Research Database (Denmark)

    Sinden, Richard R.; E. Pearson, Christopher; N. Potaman, Vladimir

    1998-01-01

    This chapter discusses the structure and function of DNA. DNA occupies a critical role in cells, because it is the source of all intrinsic genetic information. Chemically, DNA is a very stable molecule, a characteristic important for a macromolecule that may have to persist in an intact form...

  6. Effect of human polymorphonuclear and mononuclear leukocytes on chromosomal and plasmid DNA of Escherichia coli. Role of acid DNase

    International Nuclear Information System (INIS)

    Rozenberg-Arska, M.; van Strijp, J.A.; Hoekstra, W.P.; Verhoef, J.

    1984-01-01

    Phagocytosis and killing by polymorphonuclear and mononuclear leukocytes are important host resistance factors against invading microorganisms. Evidence showing that killing is rapidly followed by degradation of bacterial components is limited. Therefore, we studied the fate of Escherichia coli DNA following phagocytosis of E. coli by polymorphonuclear and mononuclear leukocytes. [ 3 H]Thymidine-labeled, unencapsulated E. coli PC2166 and E. coli 048K1 were incubated in serum, washed, and added to leukocytes. Uptake and killing of the bacteria and degradation of DNA were measured. Although phagocytosis and killing by mononuclear leukocytes was less efficient than that by polymorphonuclear leukocytes, only mononuclear leukocytes were able to degrade E. coli PC2166 DNA. Within 2 h, 60% of the radioactivity added to mononuclear leukocytes was released into the supernate, of which 40% was acid soluble. DNA of E. coli 048K1 was not degraded. To further analyze the capacity of mononuclear leukocytes to degrade E. coli DNA, chromosomal and plasmid DNA was isolated from ingested bacteria and subjected to agarose gel-electrophoresis. Only chromosomal DNA was degraded after phagocytosis. Plasmid DNA of E. coli carrying a gene coding for ampicillin resistance remained intact for a 2-h period after ingestion, and was still able to transform recipient E. coli cells after this period. Although we observed no DNA degradation during phagocytosis by polymorphonuclear leukocytes, lysates of both polymorphonuclear and mononuclear leukocytes contained acid-DNase activity with a pH optimum of 4.9. However, the DNase activity of mononuclear leukocytes was 20 times higher than that of polymorphonuclear leukocytes. No difference was observed between DNase activity from polymorphonuclear and mononuclear leukocytes from a chronic granulomatous disease patient with DNase activity from control polymorphonuclear and mononuclear leukocytes

  7. DMPD: Activation of lymphokine genes in T cells: role of cis-acting DNA elements thatrespond to T cell activation signals. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available thatrespond to T cell activation signals. Arai N, Naito Y, Watanabe M, Masuda ES, Yamaguchi-Iwai Y, Tsuboi A, Heike T,Matsud... in T cells: role of cis-acting DNA elements thatrespond to T cell activation signals. Authors Arai N, Naito Y, Watanabe M, Masud...a ES, Yamaguchi-Iwai Y, Tsuboi A, Heike T,Matsuda I, Yokota

  8. Role of Cell Cycle Regulation and MLH1, A Key DNA Mismatch Repair Protein, In Adaptive Survival Responses. Final Report

    Energy Technology Data Exchange (ETDEWEB)

    David A. Boothman

    1999-08-11

    Due to several interesting findings on both adaptive survival responses (ASRs) and DNA mismatch repair (MMR), this grant was separated into two discrete Specific Aim sets (each with their own discrete hypotheses). The described experiments were simultaneously performed.

  9. Role of Brush Biopsy and DNA Cytometry for Prevention, Diagnosis, Therapy, and Followup Care of Oral Cancer

    Directory of Open Access Journals (Sweden)

    Alfred Böcking

    2011-01-01

    Full Text Available Late diagnosis resulting in late treatment and locoregional failure after surgery are the main causes of death in patients with oral squamous cell carcinomas (SCCs. Actually, exfoliative cytology is increasingly used for early detection of oral cancer and has been the subject of intense research over the last five years. Significant advances have been made both in relation to screening and evaluation of precursor lesions. As this noninvasive procedure is well tolerated by patients, more lesions may be screened and thus more oral cancers may be found in early, curable stages. Moreover, the additional use of DNA image cytometry is a reasonable tool for the assessment of the resection margins of SCC. DNA image cytometry could help to find the appropriate treatment option for the patients. Finally, diagnostic DNA image cytometry is an accurate method and has internationally been standardized. In conclusion, DNA image cytometry has increasing impact on the prevention, diagnostic, and therapeutical considerations in head and neck SCC.

  10. The two different isoforms of the RSC chromatin remodeling complex play distinct roles in DNA damage responses.

    Directory of Open Access Journals (Sweden)

    Anna L Chambers

    Full Text Available The RSC chromatin remodeling complex has been implicated in contributing to DNA double-strand break (DSB repair in a number of studies. Both survival and levels of H2A phosphorylation in response to damage are reduced in the absence of RSC. Importantly, there is evidence for two isoforms of this complex, defined by the presence of either Rsc1 or Rsc2. Here, we investigated whether the two isoforms of RSC provide distinct contributions to DNA damage responses. First, we established that the two isoforms of RSC differ in the presence of Rsc1 or Rsc2 but otherwise have the same subunit composition. We found that both rsc1 and rsc2 mutant strains have intact DNA damage-induced checkpoint activity and transcriptional induction. In addition, both strains show reduced non-homologous end joining activity and have a similar spectrum of DSB repair junctions, suggesting perhaps that the two complexes provide the same functions. However, the hypersensitivity of a rsc1 strain cannot be complemented with an extra copy of RSC2, and likewise, the hypersensitivity of the rsc2 strain remains unchanged when an additional copy of RSC1 is present, indicating that the two proteins are unable to functionally compensate for one another in DNA damage responses. Rsc1, but not Rsc2, is required for nucleosome sliding flanking a DNA DSB. Interestingly, while swapping the domains from Rsc1 into the Rsc2 protein does not compromise hypersensitivity to DNA damage suggesting they are functionally interchangeable, the BAH domain from Rsc1 confers upon Rsc2 the ability to remodel chromatin at a DNA break. These data demonstrate that, despite the similarity between Rsc1 and Rsc2, the two different isoforms of RSC provide distinct functions in DNA damage responses, and that at least part of the functional specificity is dictated by the BAH domains.

  11. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

    International Nuclear Information System (INIS)

    Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

    1989-01-01

    A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

  12. Thymidine kinase 2 (H126N) knockin mice show the essential role of balanced deoxynucleotide pools for mitochondrial DNA maintenance.

    Science.gov (United States)

    Akman, Hasan O; Dorado, Beatriz; López, Luis C; García-Cazorla, Angeles; Vilà, Maya R; Tanabe, Lauren M; Dauer, William T; Bonilla, Eduardo; Tanji, Kurenai; Hirano, Michio

    2008-08-15

    Mitochondrial DNA (mtDNA) depletion syndrome (MDS), an autosomal recessive condition, is characterized by variable organ involvement with decreased mtDNA copy number and activities of respiratory chain enzymes in affected tissues. MtDNA depletion has been associated with mutations in nine autosomal genes, including thymidine kinase (TK2), which encodes a ubiquitous mitochondrial protein. To study the pathogenesis of TK2-deficiency, we generated mice harboring an H126N Tk2 mutation. Homozygous Tk2 mutant (Tk2(-/-)) mice developed rapidly progressive weakness after age 10 days and died between ages 2 and 3 weeks. Tk2(-/-) animals showed Tk2 deficiency, unbalanced dNTP pools, mtDNA depletion and defects of respiratory chain enzymes containing mtDNA-encoded subunits that were most prominent in the central nervous system. Histopathology revealed an encephalomyelopathy with prominent vacuolar changes in the anterior horn of the spinal cord. The H126N TK2 mouse is the first knock-in animal model of human MDS and demonstrates that the severity of TK2 deficiency in tissues may determine the organ-specific phenotype.

  13. Endogenously generated DNA nucleobase modifications source, and significance as possible biomarkers of malignant transformation risk, and role in anticancer therapy.

    Science.gov (United States)

    Olinski, Ryszard; Gackowski, Daniel; Cooke, Marcus S

    2018-01-01

    The DNA of all living cells undergoes continuous structural and chemical alteration, which may be derived from exogenous sources, or endogenous, metabolic pathways, such as cellular respiration, replication and DNA demethylation. It has been estimated that approximately 70,000 DNA lesions may be generated per day in a single cell, and this has been linked to a wide variety of diseases, including cancer. However, it is puzzling why potentially mutagenic DNA modifications, occurring at a similar level in different organs/tissue, may lead to organ/tissue specific cancers, or indeed non-malignant disease - what is the basis for this differential response? We suggest that it is perhaps the precise location of damage, within the genome, that is a key factor. Finally, we draw attention to the requirement for reliable methods for identification and quantification of DNA adducts/modifications, and stress the need for these assays to be fully validated. Once these prerequisites are satisfied, measurement of DNA modifications may be helpful as a clinical parameter for treatment monitoring, risk group identification and development of prevention strategies. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Structural modelling and molecular dynamics of a multi-stress responsive WRKY TF-DNA complex towards elucidating its role in stress signalling mechanisms in chickpea.

    Science.gov (United States)

    Konda, Aravind Kumar; Farmer, Rohit; Soren, Khela Ram; P S, Shanmugavadivel; Setti, Aravind

    2017-07-28

    Chickpea is a premier food legume crop with high nutritional quality and attains prime importance in the current era of 795 million people being undernourished worldwide. Chickpea production encounters setbacks due to various stresses and understanding the role of key transcription factors (TFs) involved in multiple stresses becomes inevitable. We have recently identified a multi-stress responsive WRKY TF in chickpea. The present study was conducted to predict the structure of WRKY TF to identify the DNA-interacting residues and decipher DNA-protein interactions. Comparative modelling approach produced 3D model of the WRKY TF with good stereochemistry, local/global quality and further revealed W19, R20, K21, and Y22 motifs within a vicinity of 5 Å to the DNA amongst R18, G23, Q24, K25, Y36, Y37, R38 and K47 and these positions were equivalent to the 2LEX WRKY domain of Arabidopsis. Molecular simulations analysis of reference protein -PDB ID 2LEX, along with Car-WRKY TF modelled structure with the DNA coordinates derived from PDB ID 2LEX and docked using HADDOCK were executed. Root Mean Square (RMS) Deviation and RMS Fluctuation values yielded consistently stable trajectories over 50 ns simulation. Strengthening the obtained results, neither radius of gyration, distance and total energy showed any signs of DNA-WRKY complex falling apart nor any significant dissociation event over 50 ns run. Therefore, the study provides first insights into the structural properties of multi-stress responsive WRKY TF-DNA complex in chickpea, enabling genome wide identification of TF binding sites and thereby deciphers their gene regulatory networks.

  15. Nanostructures via DNA scaffold metallization

    OpenAIRE

    Ning, C.; Zinchenko, A.; Baigl, D.; Pyshkina, O.; Sergeyev, V.; Endo, Kazunaka; Yoshikawa, K.

    2005-01-01

    The critical role of polymers in process of noble metals nanostructures formation is well known, however, the use of DNA chain template in this process is yet largely unknown. In this study we demonstrate different ways of silver deposition on DNA template and report the influence of silver nanostructures formation on DNA conformational state. Metallization of DNA chain proceeds by two different scenarios depending on DNA conformation. If DNA chain is unfolded (elongated) chain, silver reduct...

  16. Role for DNA methylation in the regulation of miR-200c and miR-141 expression in normal and cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Vrba, Lukas; Jensen, Taylor J.; Garbe, James C.; Heimark, Ronald L.; Cress, Anne E.; Dickinson, Sally; Stampfer, Martha R.; Futscher, Bernard W.

    2009-12-23

    BACKGROUND: The microRNA-200 family participates in the maintenance of an epithelial phenotype and loss of its expression can result in epithelial to mesenchymal transition (EMT). Furthermore, the loss of expression of miR-200 family members is linked to an aggressive cancer phenotype. Regulation of the miR-200 family expression in normal and cancer cells is not fully understood. METHODOLOGY/ PRINCIPAL FINDINGS: Epigenetic mechanisms participate in the control of miR-200c and miR-141 expression in both normal and cancer cells. A CpG island near the predicted mir-200c/mir-141 transcription start site shows a striking correlation between miR-200c and miR-141 expression and DNA methylation in both normal and cancer cells, as determined by MassARRAY technology. The CpG island is unmethylated in human miR-200/miR-141 expressing epithelial cells and in miR-200c/miR-141 positive tumor cells. The CpG island is heavily methylated in human miR-200c/miR-141 negative fibroblasts and miR-200c/miR-141 negative tumor cells. Mouse cells show a similar inverse correlation between DNA methylation and miR-200c expression. Enrichment of permissive histone modifications, H3 acetylation and H3K4 trimethylation, is seen in normal miR-200c/miR-141-positive epithelial cells, as determined by chromatin immunoprecipitation coupled to real-time PCR. In contrast, repressive H3K9 dimethylation marks are present in normal miR-200c/miR-141-negative fibroblasts and miR-200c/miR-141 negative cancer cells and the permissive histone modifications are absent. The epigenetic modifier drug, 5-aza-2'-deoxycytidine, reactivates miR-200c/miR-141 expression showing that epigenetic mechanisms play a functional role in their transcriptional control. CONCLUSIONS/ SIGNIFICANCE: We report that DNA methylation plays a role in the normal cell type-specific expression of miR-200c and miR-141 and this role appears evolutionarily conserved, since similar results were obtained in mouse. Aberrant DNA methylation

  17. DNA damage and autophagy

    International Nuclear Information System (INIS)

    Rodriguez-Rocha, Humberto; Garcia-Garcia, Aracely; Panayiotidis, Mihalis I.; Franco, Rodrigo

    2011-01-01

    Both exogenous and endogenous agents are a threat to DNA integrity. Exogenous environmental agents such as ultraviolet (UV) and ionizing radiation, genotoxic chemicals and endogenous byproducts of metabolism including reactive oxygen species can cause alterations in DNA structure (DNA damage). Unrepaired DNA damage has been linked to a variety of human disorders including cancer and neurodegenerative disease. Thus, efficient mechanisms to detect DNA lesions, signal their presence and promote their repair have been evolved in cells. If DNA is effectively repaired, DNA damage response is inactivated and normal cell functioning resumes. In contrast, when DNA lesions cannot be removed, chronic DNA damage triggers specific cell responses such as cell death and senescence. Recently, DNA damage has been shown to induce autophagy, a cellular catabolic process that maintains a balance between synthesis, degradation, and recycling of cellular components. But the exact mechanisms by which DNA damage triggers autophagy are unclear. More importantly, the role of autophagy in the DNA damage response and cellular fate is unknown. In this review we analyze evidence that supports a role for autophagy as an integral part of the DNA damage response.

  18. Repair pathways independent of the Fanconi anemia nuclear core complex play a predominant role in mitigating formaldehyde-induced DNA damage

    International Nuclear Information System (INIS)

    Noda, Taichi; Takahashi, Akihisa; Kondo, Natsuko; Mori, Eiichiro; Okamoto, Noritomo; Nakagawa, Yosuke; Ohnishi, Ken; Zdzienicka, Malgorzata Z.; Thompson, Larry H.; Helleday, Thomas; Asada, Hideo

    2011-01-01

    The role of the Fanconi anemia (FA) repair pathway for DNA damage induced by formaldehyde was examined in the work described here. The following cell types were used: mouse embryonic fibroblast cell lines FANCA -/- , FANCC -/- , FANCA -/- C -/- , FANCD2 -/- and their parental cells, the Chinese hamster cell lines FANCD1 mutant (mt), FANCGmt, their revertant cells, and the corresponding wild-type (wt) cells. Cell survival rates were determined with colony formation assays after formaldehyde treatment. DNA double strand breaks (DSBs) were detected with an immunocytochemical γH2AX-staining assay. Although the sensitivity of FANCA -/- , FANCC -/- and FANCA -/- C -/- cells to formaldehyde was comparable to that of proficient cells, FANCD1mt, FANCGmt and FANCD2 -/- cells were more sensitive to formaldehyde than the corresponding proficient cells. It was found that homologous recombination (HR) repair was induced by formaldehyde. In addition, γH2AX foci in FANCD1mt cells persisted for longer times than in FANCD1wt cells. These findings suggest that formaldehyde-induced DSBs are repaired by HR through the FA repair pathway which is independent of the FA nuclear core complex. -- Research highlights: → We examined to clarify the repair pathways of formaldehyde-induced DNA damage. Formaldehyde induces DNA double strand breaks (DSBs). → DSBs are repaired through the Fanconi anemia (FA) repair pathway. → This pathway is independent of the FA nuclear core complex. → We also found that homologous recombination repair was induced by formaldehyde.

  19. The roles of family B and D DNA polymerases in Thermococcus species 9°N Okazaki fragment maturation.

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F

    2015-05-15

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. The Roles of Family B and D DNA Polymerases in Thermococcus Species 9°N Okazaki Fragment Maturation*

    Science.gov (United States)

    Greenough, Lucia; Kelman, Zvi; Gardner, Andrew F.

    2015-01-01

    During replication, Okazaki fragment maturation is a fundamental process that joins discontinuously synthesized DNA fragments into a contiguous lagging strand. Efficient maturation prevents repeat sequence expansions, small duplications, and generation of double-stranded DNA breaks. To address the components required for the process in Thermococcus, Okazaki fragment maturation was reconstituted in vitro using purified proteins from Thermococcus species 9°N or cell extracts. A dual color fluorescence assay was developed to monitor reaction substrates, intermediates, and products. DNA polymerase D (polD) was proposed to function as the replicative polymerase in Thermococcus replicating both the leading and the lagging strands. It is shown here, however, that it stops before the previous Okazaki fragments, failing to rapidly process them. Instead, Family B DNA polymerase (polB) was observed to rapidly fill the gaps left by polD and displaces the downstream Okazaki fragment to create a flap structure. This flap structure was cleaved by flap endonuclease 1 (Fen1) and the resultant nick was ligated by DNA ligase to form a mature lagging strand. The similarities to both bacterial and eukaryotic systems and evolutionary implications of archaeal Okazaki fragment maturation are discussed. PMID:25814667

  1. Roles of POLD4, smallest subunit of DNA polymerase {delta}, in nuclear structures and genomic stability of human cells

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Qin Miao [Division of Molecular Carcinogenesis, Center for Neurological Diseases and Cancer, Nagoya University Graduate School of Medicine, Nagoya (Japan); Akashi, Tomohiro [Division of Molecular Mycology and Medicine, Center for Neurological Diseases and Cancer, Nagoya University Graduate School of Medicine, Nagoya (Japan); Masuda, Yuji; Kamiya, Kenji [Research Institute for Radiation Biology and Medicine, Hiroshima University, Hiroshima 734-8553 (Japan); Takahashi, Takashi [Division of Molecular Carcinogenesis, Center for Neurological Diseases and Cancer, Nagoya University Graduate School of Medicine, Nagoya (Japan); Suzuki, Motoshi, E-mail: msuzuki@med.nagoya-u.ac.jp [Division of Molecular Carcinogenesis, Center for Neurological Diseases and Cancer, Nagoya University Graduate School of Medicine, Nagoya (Japan)

    2010-01-01

    Mammalian DNA polymerase {delta} (pol {delta}) is essential for DNA replication, though the functions of this smallest subunit of POLD4 have been elusive. We investigated pol {delta} activities in vitro and found that it was less active in the absence of POLD4, irrespective of the presence of the accessory protein PCNA. shRNA-mediated reduction of POLD4 resulted in a marked decrease in colony formation activity by Calu6, ACC-LC-319, and PC-10 cells. We also found that POLD4 reduction was associated with an increased population of karyomere-like cells, which may be an indication of DNA replication stress and/or DNA damage. The karyomere-like cells retained an ability to progress through the cell cycle, suggesting that POLD4 reduction induces modest genomic instability, while allowing cells to grow until DNA damage reaches an intolerant level. Our results indicate that POLD4 is required for the in vitro pol {delta} activity, and that it functions in cell proliferation and maintenance of genomic stability of human cells.

  2. Roles of POLD4, smallest subunit of DNA polymerase δ, in nuclear structures and genomic stability of human cells

    International Nuclear Information System (INIS)

    Huang, Qin Miao; Akashi, Tomohiro; Masuda, Yuji; Kamiya, Kenji; Takahashi, Takashi; Suzuki, Motoshi

    2010-01-01

    Mammalian DNA polymerase δ (pol δ) is essential for DNA replication, though the functions of this smallest subunit of POLD4 have been elusive. We investigated pol δ activities in vitro and found that it was less active in the absence of POLD4, irrespective of the presence of the accessory protein PCNA. shRNA-mediated reduction of POLD4 resulted in a marked decrease in colony formation activity by Calu6, ACC-LC-319, and PC-10 cells. We also found that POLD4 reduction was associated with an increased population of karyomere-like cells, which may be an indication of DNA replication stress and/or DNA damage. The karyomere-like cells retained an ability to progress through the cell cycle, suggesting that POLD4 reduction induces modest genomic instability, while allowing cells to grow until DNA damage reaches an intolerant level. Our results indicate that POLD4 is required for the in vitro pol δ activity, and that it functions in cell proliferation and maintenance of genomic stability of human cells.

  3. The possible role of solitons in energy transfer in DNA: the relevance of studies with Auger emitters

    International Nuclear Information System (INIS)

    Baverstock, K.F.; Cundall, R.B.

    1988-01-01

    The interpretation of some experiments in which ionising energy is directly absorbed by DNA involve postulates that large scale energy migration takes place in DNA over long distances (kilobase pairs). A possible mechanism for such processes is provided by solitary vibrational waves called solitons. (Solitons arise when a pseudo-one dimensional system with non-linear characteristics suffers a large local transitory displacement from equilibrium). Various synthetic polymers, such as polyacetylene are known, to sustain solitons and various physical properties of biopolymers such as DNA can be described in terms of 'open states' associated with inplane rotation of a group of the hydrogen bonded bases which has solitonic properties. The absorption of ionising energy by DNA systems can provide the transient displacement from equilibrium necessary to set-up wave conditions appropriate for soliton production. Auger emitters would be particularly well suited for inducing solitons and offer the possibility for causing ionising energy to be 'injected' into the DNA molecule at a specific point in the molecular sequence. Experiments to test the hypothesis that this event causes long range energy transfer are discussed. (author)

  4. [The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

    Science.gov (United States)

    Hagemann, Rudolf

    2007-01-01

    At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

  5. A critical role of T follicular helper cells in human mucosal anti-influenza response that can be enhanced by immunological adjuvant CpG-DNA.

    Science.gov (United States)

    Aljurayyan, A N; Sharma, R; Upile, N; Beer, H; Vaughan, C; Xie, C; Achar, P; Ahmed, M S; McNamara, P S; Gordon, S B; Zhang, Q

    2016-08-01

    T Follicular helper cells (TFH) are considered critical for B cell antibody response, and recent efforts have focused on promoting TFH in order to enhance vaccine efficacy. We studied the frequency and function of TFH in nasopharynx-associated lymphoid tissues (NALT) from children and adults, and its role in anti-influenza antibody response following stimulation by a live-attenuated influenza vaccine (LAIV) or an inactivated seasonal virus antigen (sH1N1). We further studied whether CpG-DNA promotes TFH and by which enhances anti-influenza response. We showed NALT from children aged 1.5-10 years contained abundant TFH, suggesting efficient priming of TFH during early childhood. Stimulation by LAIV induced a marked increase in TFH that correlated with a strong production of anti-hemagglutinin (HA) IgA/IgG/IgM antibodies in tonsillar cells. Stimulation by the inactivated sH1N1 antigen induced a small increase in TFH which was markedly enhanced by CpG-DNA, accompanied by enhanced anti-HA antibody responses. In B cell co-culture experiment, anti-HA responses were only seen in the presence of TFH, and addition of plasmacytoid dendritic cell to TFH-B cell co-culture enhanced the TFH-mediated antibody production following CpG-DNA and sH1N1 antigen stimulation. Induction of TFH differentiation from naïve T cells was also shown following the stimulation. Our results support a critical role of TFH in human mucosal anti-influenza antibody response. Use of an adjuvant such as CpG-DNA that has the capacity to promote TFH by which to enhance antigen-induced antibody responses in NALT tissue may have important implications for future vaccination strategies against respiratory pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. The role of total cell-free DNA in predicting outcomes among trauma patients in the intensive care unit

    DEFF Research Database (Denmark)

    Gögenur, Mikail; Burcharth, Jakob; Gögenur, Ismail

    2017-01-01

    searched Pubmed, Embase, Scopus and the Cochrane Central Register for Controlled Trials and reference lists of relevant articles for studies that assessed the prognostic value of cell-free DNA detection in trauma patients in the intensive care unit. Outcomes of interest included survival, posttraumatic...

  7. Sporadic colorectal cancer and individual susceptibility: A review of the association studies investigating the role of DNA repair genetic polymorphisms

    Czech Academy of Sciences Publication Activity Database

    Naccarati, Alessio; Pardini, B.; Hemminki, K.; Vodička, Pavel

    2007-01-01

    Roč. 635, 2-3(2007), s.118-145 ISSN 1383-5742 R&D Projects: GA MZd NR8563; GA ČR GA310/05/2626 Institutional research plan: CEZ:AV0Z50390512 Keywords : Sporadic colorectal cancer * Individual susceptibility * DNA repair Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.353, year: 2007

  8. ANTIMUTAGENICITY OF CINNAMALDEHYDE AND VANILLIN IN HUMAN CELLS: GLOBAL GENE EXPRESSION AND POSSIBLE ROLE OF DNA DAMAGE AND REPAIR

    Science.gov (United States)

    This study investigated the possibility that chemicals identified as antimutagens may, in fact, operate through a mechanism involving DNA damage. We addressed this question by using two chemicals to which a large proportion of the population are exposed: vanillin and cinnemaldehy...

  9. Dynamics of Dnmt1 interaction with the replication machinery and its role in postreplicative maintenance of DNA methylation

    Science.gov (United States)

    Schermelleh, Lothar; Haemmer, Andrea; Spada, Fabio; Rösing, Nicole; Meilinger, Daniela; Rothbauer, Ulrich; Cardoso, M. Cristina; Leonhardt, Heinrich

    2007-01-01

    Postreplicative maintenance of genomic methylation patterns was proposed to depend largely on the binding of DNA methyltransferase 1 (Dnmt1) to PCNA, a core component of the replication machinery. We investigated how the slow and discontinuous DNA methylation could be mechanistically linked with fast and processive DNA replication. Using photobleaching and quantitative live cell imaging we show that Dnmt1 binding to PCNA is highly dynamic. Activity measurements of a PCNA-binding-deficient mutant with an enzyme-trapping assay in living cells showed that this interaction accounts for a 2-fold increase in methylation efficiency. Expression of this mutant in mouse dnmt1−/− embryonic stem (ES) cells restored CpG island methylation. Thus association of Dnmt1 with the replication machinery enhances methylation efficiency, but is not strictly required for maintaining global methylation. The transient nature of this interaction accommodates the different kinetics of DNA replication and methylation while contributing to faithful propagation of epigenetic information. PMID:17576694

  10. Transient GFP expression in Nicotiana plumbaginifolia suspension cells: the role of gene silencing, cell death and T-DNA loss.

    Science.gov (United States)

    Weld, R; Heinemann, J; Eady, C

    2001-03-01

    The transient nature of T-DNA expression was studied with a gfp reporter gene transferred to Nicotiana plumbaginifolia suspension cells from Agrobacterium tumefaciens. Individual GFP-expressing protoplasts were isolated after 4 days' co-cultivation. The protoplasts were cultured without selection and 4 weeks later the surviving proto-calluses were again screened for GFP expression. Of the proto-calluses initially expressing GFP, 50% had lost detectable GFP activity during the first 4 weeks of culture. Multiple T-DNA copies of the gfp gene were detected in 10 of 17 proto-calluses lacking visible GFP activity. The remaining 7 cell lines contained no gfp sequences. Our results confirm that transiently expressed T-DNAs can be lost during growth of somatic cells and demonstrate that transiently expressing cells frequently integrate multiple T-DNAs that become silenced. In cells competent for DNA uptake, cell death and gene silencing were more important barriers to the recovery of stably expressing transformants than lack of T-DNA integration.

  11. DNA damage response and role of shelterin complex in human peripheral blood mononuclear cells exposed to gamma radiation

    International Nuclear Information System (INIS)

    Saini, Divyalakshmi; Das, Birajalaxmi

    2013-01-01

    Telomeres are the DNA protein structures that cap the ends of linear DNA. It consists of short repetitive DNA sequences (TTAGGG)n and specialized telomere binding proteins. There are six telomeric proteins (TRF1, TRF2, TIN2, TERF2, PTOP and POT1) called as shelterin complex/telosome which maintains telomere integrity. The function of this 'telosome' is to protect the natural ends of the chromosomes from being recognized as artificial DNA breaks, thereby preventing chromosome end-to-end fusions. DNA Damage Response (DDR) induced by radiation and its interaction with telomeric protein complex is poorly understood in human PBMCs at G 0 stage. Alterations in either telomeric DNA or telomere binding proteins can impair the function of the telosome, which may lead to senescence or apoptosis. Ionizing radiation which induces a plethora of DNA lesions in human cell may also alter the expression of telomere associated proteins. In the present study, we have made an attempt to study the DNA damage response of telomere proteins in human peripheral blood mononuclear cells exposed to gamma radiation. Venous blood samples were collected from eight random healthy volunteers and PBMCs were separated. Dose response as well as time point kinetics study was carried out at transcription as well as protein level. PBMCs were irradiated at various doses between 10 cGy to 2.0 Gy at a dose rate of 1.0 Gy/min. Total RNA was isolated for gene expression analysis at 0 hour and 4 hours respectively. cDNA was prepared and transcriptional pattern as studied using real time q-PCR where Taqman probes were used. Time point kinetics of transcriptional pattern of TRF1, TRF2, TIN2, TERF2, PTOP and POT1 was carried out at 0 min, 15 min, 30 min, 60 min, and 120 min for two different doses (1.0 Gy and 2.0 Gy). Dose response and time point kinetics of TRF2 was studied at similar doses using confocal microscopy. Our results revealed that at 2.0 Gy there was a two fold increase at the level of transcription

  12. Metabolic consequences of DNA damage: The role of poly (ADP-ribose) polymerase as mediator of the suicide response

    International Nuclear Information System (INIS)

    Berger, N.A.; Berger, S.J.

    1986-01-01

    Recent studies show that DNA damage can produce rapid alterations in steady state levels of deoxynucleoside triphosphate pools, for example, MNNG or uv-irradiation cause rapid increases in dATP and dTTP pools without significant changes in dGTP or dCTP pools. In vitro, studies with purified eukaryotic DNA polymerases show that the frequency of nucleotide misincorporation was affected by alterations in relative concentrations of the deoxynucleoside triphosphates. Thus the alterations in dNTP pool sizes that occur consequent to DNA damage may contribute to an increased mutagenic frequency. Poly(ADP-ribose) polymerase mediated suicide mechanism may participate in the toxicity of adenosine deaminase deficiency and severe combined immune deficiency disease in humans. Individuals with this disease suffer severe lymphopenia due to the toxic effects of deoxyadenosine. The lymphocytotoxic effect of adenosine deaminase deficiency can be simulated in lymphocyte cell lines from normal individuals by incubating them with the adenosine deaminase inhibitor, deoxycoformycin. Incubation of such leukocytes with deoxycoformycin and deoxyadenosine results in the gradual accumulation of DNA strand breaks and the depletion of NAD + leading to cell death over a period of several days. This depletion of NAD and loss of cell viability were effectively blocked by nicotinamide or 3-amino benzamide. Thus, persistent activation of poly(ADP-ribose) polymerase by unrepaired or recurrent DNA strand breaks may activate the suicide mechanism of cell death. This study provides a basis for the interesting suggestion that treatment with nicotinamide could block the persistent activity of poly(ADP-ribose) polymerase and may help preserve lymphocyte function in patients with adenosine deaminase deficiency. 16 refs., 3 figs., 2 tabs

  13. Study of ultraviolet light-induced DNA damage and repair: the role of the (6-4) photoproduct

    International Nuclear Information System (INIS)

    Franklin, W.A.

    1985-01-01

    Ultraviolet light induces lethal, mutagenic, and carcinogenic effects to cells. These effects are a result of the induction of photoproducts in the cellular DNA. One class of photoproducts was found as alkaline labile lesions in DNA, and it was proposed that such lesions were precursor products to the 6,4'-[pyrimidin-2'-one]-pyrimidine class of photoproducts that have been previously shown to occur in UV light-irradiated DNA. Using a series of dinucleotide compounds, the precursor compounds were isolated, and were demonstrated to be alkaline labile. These products were named the UV light-induced pyrimidine-pyrimidone (6-4) photoproducts, and their chemistry of formation in dinucleotides and DNA was studied. The formation of these photoproducts under conditions of chemical photosensitization was also measured. The most abundant of the (6-4) photoproducts is the thymine-cytosine (6-4) product, and the molecular structure of this compounds was determined by the use of infrared spectroscopy, proton NMR, and mass spectroscopy. The (6-4) products have been recently shown to be the major UV light-induced premutagenic lesions in E. coli. In E. coli, the repair of the (6-4) products is under the control of the uvrABC excision pathway. The rate of removal of (6-4) products was measured in a series of human cells lines. The rate of removal of (6-4) products from the DNA of a xeroderma pigmentosum complementation group A cell line was nearly that of the normal cells, yet these cells are unable to excise cyclobutane pyrimidine dimers. These results suggest that the removal of cyclobutane pyrimidine dimers and (6-4) products may be controlled by separate enzymatic pathways

  14. The role of mitochondrial DNA damage at skeletal muscle oxidative stress on the development of type 2 diabetes.

    Science.gov (United States)

    Dos Santos, Julia Matzenbacher; de Oliveira, Denise Silva; Moreli, Marcos Lazaro; Benite-Ribeiro, Sandra Aparecida

    2018-04-20

    Reduced cellular response to insulin in skeletal muscle is one of the major components of the development of type 2 diabetes (T2D). Mitochondrial dysfunction involves in the accumulation of toxic reactive oxygen species (ROS) that leads to insulin resistance. The aim of this study was to verify the involvement of mitochondrial DNA damage at ROS generation in skeletal muscle during development of T2D. Wistar rats were fed a diet containing 60% fat over 8 weeks and at day 14 a single injection of STZ (25 mg/kg) was administered (T2D-induced). Control rats received standard food and an injection of citrate buffer. Blood and soleus muscle were collected. Abdominal fat was quantified as well as glucose, triglyceride, LDL, HDL, and total cholesterol in plasma and mtDNA copy number, cytochrome b (cytb) mRNA, 8-hydroxyguanosine, and 8-isoprostane (a marker of ROS) in soleus muscle. T2D-induced animal presented similar characteristics to humans that develop T2D such as changes in blood glucose, abdominal fat, LDL, HDL and cholesterol total. In soleus muscle 8-isoprostane, mtDNA copy number and 8-hydroxyguanosine were increased, while cytb mRNA was decreased in T2D. Our results suggest that in the development of T2D, when risks factors of T2D are present, intracellular oxidative stress increases in skeletal muscle and is associated with a decrease in cytb transcription. To overcome this process mtDNA increased but due to the proximity of ROS generation, mtDNA remains damaged by oxidation leading to an increase in ROS in a vicious cycle accounting to the development of insulin resistance and further T2D.

  15. Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

    2014-10-01

    Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. DNA damage in hemodialysis patients with chronic kidney disease; a test of the role of diabetes mellitus; a comet assay investigation.

    Science.gov (United States)

    Mamur, Sevcan; Unal, Fatma; Altok, Kadriye; Deger, Serpil Muge; Yuzbasioglu, Deniz

    2016-04-01

    The incidence of chronic kidney disease (CKD) is increasing rapidly. Diabetes mellitus (DM) is the most important cause of CKD. We studied the possible role of DM in CKD patients with respect to DNA damage, as assessed by the comet assay in 60 CKD patients (with or without DM) undergoing hemodialysis and in 26 controls. Effects of other factors, such as age, sex, hypertension, duration of hemodialysis, body mass index (BMI), and levels of hemoglobin (HB), intact parathormone (iPTH), and ferritin (FER), were also examined. Primary DNA damage measured by the comet assay was significantly higher in CKD patients than in controls. Among CKD patients, the following correlations were observed. (1) There was no difference in comet tail length or tail intensity between diabetic and non-diabetic individuals. (2) Age, sex, hemoglobin, hypertension, duration of hemodialysis, and ferritin levels affected neither tail length nor intensity. (3) BMI values above 25kg/m(2) and iPTH levels above 300pg/ml were associated with significantly greater comet tail length. Our results indicate that primary DNA damage is increased in CKD patients undergoing hemodialysis, compared to controls; however, DM had no additional effect. Copyright © 2016. Published by Elsevier B.V.

  17. Trans-ancestry genome-wide association study identifies 12 genetic loci influencing blood pressure and implicates a role for DNA methylation

    Science.gov (United States)

    Drong, Alexander W; Abbott, James; Wahl, Simone; Tan, Sian-Tsung; Scott, William R; Campanella, Gianluca; Chadeau-Hyam, Marc; Afzal, Uzma; Ahluwalia, Tarunveer S; Bonder, Marc Jan; Chen, Peng; Dehghan, Abbas; Edwards, Todd L; Esko, Tõnu; Go, Min Jin; Harris, Sarah E; Hartiala, Jaana; Kasela, Silva; Kasturiratne, Anuradhani; Khor, Chiea-Chuen; Kleber, Marcus E; Li, Huaixing; Yu Mok, Zuan; Nakatochi, Masahiro; Sapari, Nur Sabrina; Saxena, Richa; Stewart, Alexandre F R; Stolk, Lisette; Tabara, Yasuharu; Teh, Ai Ling; Wu, Ying; Wu, Jer-Yuarn; Zhang, Yi; Aits, Imke; Da Silva Couto Alves, Alexessander; Das, Shikta; Dorajoo, Rajkumar; Hopewell, Jemma C; Kim, Yun Kyoung; Koivula, Robert W; Luan, Jian’an; Lyytikäinen, Leo-Pekka; Nguyen, Quang N; Pereira, Mark A; Postmus, Iris; Raitakari, Olli T; Bryan, Molly Scannell; Scott, Robert A; Sorice, Rossella; Tragante, Vinicius; Traglia, Michela; White, Jon; Yamamoto, Ken; Zhang, Yonghong; Adair, Linda S; Ahmed, Alauddin; Akiyama, Koichi; Asif, Rasheed; Aung, Tin; Barroso, Inês; Bjonnes, Andrew; Braun, Timothy R; Cai, Hui; Chang, Li-Ching; Chen, Chien-Hsiun; Cheng, Ching-Yu; Chong, Yap-Seng; Collins, Rory; Courtney, Regina; Davies, Gail; Delgado, Graciela; Do, Loi D; Doevendans, Pieter A; Gansevoort, Ron T; Gao, Yu-Tang; Grammer, Tanja B; Grarup, Niels; Grewal, Jagvir; Gu, Dongfeng; Wander, Gurpreet S; Hartikainen, Anna-Liisa; Hazen, Stanley L; He, Jing; Heng, Chew-Kiat; Hixson, James E; Hofman, Albert; Hsu, Chris; Huang, Wei; Husemoen, Lise L N; Hwang, Joo-Yeon; Ichihara, Sahoko; Igase, Michiya; Isono, Masato; Justesen, Johanne M; Katsuya, Tomohiro; Kibriya, Muhammad G; Kim, Young Jin; Kishimoto, Miyako; Koh, Woon-Puay; Kohara, Katsuhiko; Kumari, Meena; Kwek, Kenneth; Lee, Nanette R; Lee, Jeannette; Liao, Jiemin; Lieb, Wolfgang; Liewald, David C M; Matsubara, Tatsuaki; Matsushita, Yumi; Meitinger, Thomas; Mihailov, Evelin; Milani, Lili; Mills, Rebecca; Mononen, Nina; Müller-Nurasyid, Martina; Nabika, Toru; Nakashima, Eitaro; Ng, Hong Kiat; Nikus, Kjell; Nutile, Teresa; Ohkubo, Takayoshi; Ohnaka, Keizo; Parish, Sarah; Paternoster, Lavinia; Peng, Hao; Peters, Annette; Pham, Son T; Pinidiyapathirage, Mohitha J; Rahman, Mahfuzar; Rakugi, Hiromi; Rolandsson, Olov; Ann Rozario, Michelle; Ruggiero, Daniela; Sala, Cinzia F; Sarju, Ralhan; Shimokawa, Kazuro; Snieder, Harold; Sparsø, Thomas; Spiering, Wilko; Starr, John M; Stott, David J; Stram, Daniel O; Sugiyama, Takao; Szymczak, Silke; Tang, W H Wilson; Tong, Lin; Trompet, Stella; Turjanmaa, Väinö; Ueshima, Hirotsugu; Uitterlinden, André G; Umemura, Satoshi; Vaarasmaki, Marja; van Dam, Rob M; van Gilst, Wiek H; van Veldhuisen, Dirk J; Viikari, Jorma S; Waldenberger, Melanie; Wang, Yiqin; Wang, Aili; Wilson, Rory; Wong, Tien-Yin; Xiang, Yong-Bing; Yamaguchi, Shuhei; Ye, Xingwang; Young, Robin D; Young, Terri L; Yuan, Jian-Min; Zhou, Xueya; Asselbergs, Folkert W; Ciullo, Marina; Clarke, Robert; Deloukas, Panos; Franke, Andre; Franks, Paul W; Franks, Steve; Friedlander, Yechiel; Gross, Myron D; Guo, Zhirong; Hansen, Torben; Jarvelin, Marjo-Riitta; Jørgensen, Torben; Jukema, J Wouter; kähönen, Mika; Kajio, Hiroshi; Kivimaki, Mika; Lee, Jong-Young; Lehtimäki, Terho; Linneberg, Allan; Miki, Tetsuro; Pedersen, Oluf; Samani, Nilesh J; Sørensen, Thorkild I A; Takayanagi, Ryoichi; Toniolo, Daniela; Ahsan, Habibul; Allayee, Hooman; Chen, Yuan-Tsong; Danesh, John; Deary, Ian J; Franco, Oscar H; Franke, Lude; Heijman, Bastiaan T; Holbrook, Joanna D; Isaacs, Aaron; Kim, Bong-Jo; Lin, Xu; Liu, Jianjun; März, Winfried; Metspalu, Andres; Mohlke, Karen L; Sanghera, Dharambir K; Shu, Xiao-Ou; van Meurs, Joyce B J; Vithana, Eranga; Wickremasinghe, Ananda R; Wijmenga, Cisca; Wolffenbuttel, Bruce H W; Yokota, Mitsuhiro; Zheng, Wei; Zhu, Dingliang; Vineis, Paolo; Kyrtopoulos, Soterios A; Kleinjans, Jos C S; McCarthy, Mark I; Soong, Richie; Gieger, Christian; Scott, James

    2016-01-01

    We carried out a trans-ancestry genome-wide association and replication study of blood pressure phenotypes among up to 320,251 individuals of East Asian, European and South Asian ancestry. We find genetic variants at 12 new loci to be associated with blood pressure (P = 3.9 × 10−11 to 5.0 × 10−21). The sentinel blood pressure SNPs are enriched for association with DNA methylation at multiple nearby CpG sites, suggesting that, at some of the loci identified, DNA methylation may lie on the regulatory pathway linking sequence variation to blood pressure. The sentinel SNPs at the 12 new loci point to genes involved in vascular smooth muscle (IGFBP3, KCNK3, PDE3A and PRDM6) and renal (ARHGAP24, OSR1, SLC22A7 and TBX2) function. The new and known genetic variants predict increased left ventricular mass, circulating levels of NT-proBNP, and cardiovascular and all-cause mortality (P = 0.04 to 8.6 × 10−6). Our results provide new evidence for the role of DNA methylation in blood pressure regulation. PMID:26390057

  18. Crucial role of dynamic linker histone binding and divalent ions for DNA accessibility and gene regulation revealed by mesoscale modeling of oligonucleosomes

    Science.gov (United States)

    Collepardo-Guevara, Rosana; Schlick, Tamar

    2012-01-01

    Monte Carlo simulations of a mesoscale model of oligonucleosomes are analyzed to examine the role of dynamic-linker histone (LH) binding/unbinding in high monovalent salt with divalent ions, and to further interpret noted chromatin fiber softening by dynamic LH in monovalent salt conditions. We find that divalent ions produce a fiber stiffening effect that competes with, but does not overshadow, the dramatic softening triggered by dynamic-LH behavior. Indeed, we find that in typical in vivo conditions, dynamic-LH binding/unbinding reduces fiber stiffening dramatically (by a factor of almost 5, as measured by the elasticity modulus) compared with rigidly fixed LH, and also the force needed to initiate chromatin unfolding, making it consistent with those of molecular motors. Our data also show that, during unfolding, divalent ions together with LHs induce linker-DNA bending and DNA–DNA repulsion screening, which guarantee formation of heteromorphic superbeads-on-a-string structures that combine regions of loose and compact fiber independently of the characteristics of the LH–core bond. These structures might be important for gene regulation as they expose regions of the DNA selectively. Dynamic control of LH binding/unbinding, either globally or locally, in the presence of divalent ions, might constitute a mechanism for regulation of gene expression. PMID:22790986

  19. Inferring a role for methylation of intergenic DNA in the regulation of genes aberrantly expressed in precursor B-cell acute lymphoblastic leukemia.

    Science.gov (United States)

    Almamun, Md; Kholod, Olha; Stuckel, Alexei J; Levinson, Benjamin T; Johnson, Nathan T; Arthur, Gerald L; Davis, J Wade; Taylor, Kristen H

    2017-09-01

    A complete understanding of the mechanisms involved in the development of pre-B ALL is lacking. In this study, we integrated DNA methylation data and gene expression data to elucidate the impact of aberrant intergenic DNA methylation on gene expression in pre-B ALL. We found a subset of differentially methylated intergenic loci that were associated with altered gene expression in pre-B ALL patients. Notably, 84% of these regions were also bound by transcription factors (TF) known to play roles in differentiation and B-cell development in a lymphoblastoid cell line. Further, an overall downregulation of eRNA transcripts was observed in pre-B ALL patients and these transcripts were associated with the downregulation of putative target genes involved in B-cell migration, proliferation, and apoptosis. The identification of novel putative regulatory regions highlights the significance of intergenic DNA sequences and may contribute to the identification of new therapeutic targets for the treatment of pre-B ALL.

  20. ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage

    Science.gov (United States)

    Maya, Ruth; Balass, Moshe; Kim, Seong-Tae; Shkedy, Dganit; Leal, Juan-Fernando Martinez; Shifman, Ohad; Moas, Miri; Buschmann, Thomas; Ronai, Ze'ev; Shiloh, Yosef; Kastan, Michael B.; Katzir, Ephraim; Oren, Moshe

    2001-01-01

    The p53 tumor suppressor protein, a key regulator of cellular responses to genotoxic stress, is stabilized and activated after DNA damage. The rapid activation of p53 by ionizing radiation and radiomimetic agents is largely dependent on the ATM kinase. p53 is phosphorylated by ATM shortly after DNA damage, resulting in enhanced stability and activity of p53. The Mdm2 oncoprotein is a pivotal negative regulator of p53. In response to ionizing radiation and radiomimetic drugs, Mdm2 undergoes rapid ATM-dependent phosphorylation prior to p53 accumulation. This results in a decrease in its reactivity with the 2A10 monoclonal antibody. Phage display analysis identified a consensus 2A10 recognition sequence, possessing the core motif DYS. Unexpectedly, this motif appears twice within the human Mdm2 molecule, at positions corresponding to residues 258–260 and 393–395. Both putative 2A10 epitopes are highly conserved and encompass potential phosphorylation sites. Serine 395, residing within the carboxy-terminal 2A10 epitope, is the major target on Mdm2 for phosphorylation by ATM in vitro. Mutational analysis supports the conclusion that Mdm2 undergoes ATM-dependent phosphorylation on serine 395 in vivo in response to DNA damage. The data further suggests that phosphorylated Mdm2 may be less capable of promoting the nucleo-cytoplasmic shuttling of p53 and its subsequent degradation, thereby enabling p53 accumulation. Our findings imply that activation of p53 by DNA damage is achieved, in part, through attenuation of the p53-inhibitory potential of Mdm2. PMID:11331603

  1. Role of GSTT1 deletion in DNA oxidative damage by exposure to polycyclic aromatic hydrocarbons in humans

    Czech Academy of Sciences Publication Activity Database

    Garte, S.; Taioli, E.; Popov, T.; Kalina, I.; Šrám, Radim; Farmer, P.

    2007-01-01

    Roč. 120, - (2007), s. 2499-2503 ISSN 0020-7136 Grant - others:EU(GB) 2000-00091 Institutional research plan: CEZ:AV0Z50390512 Source of funding: R - rámcový projekt EK Keywords : metabolic polymorphism * GSTT1 genotype * oxidative DNA damage Subject RIV: DN - Health Impact of the Environment Quality Impact factor: 4.555, year: 2007

  2. Dpb11/TopBP1 plays distinct roles in DNA replication, checkpoint response and homologous recombination

    DEFF Research Database (Denmark)

    Germann, Susanne Manuela; Østergaard, Vibe Hallundbæk; Haas, Caroline

    2011-01-01

    DPB11/TopBP1 is an essential evolutionarily conserved gene involved in initiation of DNA replication and checkpoint signaling. Here, we show that Saccharomyces cerevisiae Dpb11 forms nuclear foci that localize to sites of DNA damage in G1, S and G2 phase, a recruitment that is conserved for its...... and Tel1, and of the checkpoint mediator Rad9. In a site-directed mutagenesis screen, we identify a separation-of-function mutant, dpb11-PF, that is sensitive to DSB-inducing agents yet remains proficient for DNA replication and the S-phase checkpoint at the permissive temperature. The dpb11-PF mutant...... homologue TopBP1 in Gallus gallus. Damage-induced Dpb11 foci are distinct from Sld3 replication initiation foci. Further, Dpb11 foci are dependent on the checkpoint proteins Mec3 (9-1-1 complex) and Rad24, and require the C-terminal domain of Dpb11. Dpb11 foci are independent of the checkpoint kinases Mec1...

  3. Role of cerium oxide nanoparticle-induced autophagy as a safeguard to exogenous H2O2-mediated DNA damage in tobacco BY-2 cells.

    Science.gov (United States)

    Sadhu, Abhishek; Ghosh, Ilika; Moriyasu, Yuji; Mukherjee, Anita; Bandyopadhyay, Maumita

    2018-04-13

    The effect of cerium oxide nanoparticle (CeNP) in plants has elicited substantial controversy. While some investigators have reported that CeNP possesses antioxidant properties, others observed CeNP to induce reactive oxygen species (ROS). In spite of considerable research carried out on the effects of CeNP in metazoans, fundamental studies that can unveil its intracellular consequences linking ROS production, autophagy and DNA damage are lacking in plants. To elucidate the impact of CeNP within plant cells, tobacco BY-2 cells were treated with 10, 50 and 250 µg ml-1 CeNP (Ce10, Ce50 and Ce250), for 24 h. Results demonstrated concentration-dependent accumulation of Ca2+ and ROS at all CeNP treatment sets. However, significant DNA damage and alteration in antioxidant defence systems were noted prominently at Ce50 and Ce250. Moreover, Ce50 and Ce250 induced DNA damage, analysed by comet assay and DNA diffusion experiments, complied with the concomitant increase in ROS. Furthermore, to evaluate the antioxidant property of CeNP, treated cells were washed after 24 h (to minimise CeNP interference) and challenged with H2O2 for 3 h. Ce10 did not induce genotoxicity and H2O2 exposure to Ce10-treated cells showed lesser DNA breakage than cells treated with H2O2 only. Interestingly, Ce10 provided better protection over N-acetyl-L-cysteine against exogenous H2O2 in BY-2 cells. CeNP exposure to transgenic BY-2 cells expressing GFP-Atg8 fusion protein exhibited formation of autophagosomes at Ce10. Application of vacuolar protease inhibitor E-64c and fluorescent basic dye acridine orange, further demonstrated accumulation of particulate matters in the vacuole and occurrence of acidic compartments, the autophagolysosomes, respectively. BY-2 cells co-treated with CeNP and autophagy inhibitor 3-methyladenine exhibited increased DNA damage in Ce10 and cell death at all assessed treatment sets. Thus, current results substantiate an alternative autophagy-mediated, antioxidant and

  4. Cell-type specific role of the RNA-binding protein, NONO, in the DNA double-strand break response in the mouse testes.

    Science.gov (United States)

    Li, Shuyi; Shu, Feng-Jue; Li, Zhentian; Jaafar, Lahcen; Zhao, Shourong; Dynan, William S

    2017-03-01

    The tandem RNA recognition motif protein, NONO, was previously identified as a candidate DNA double-strand break (DSB) repair factor in a biochemical screen for proteins with end-joining stimulatory activity. Subsequent work showed that NONO and its binding partner, SFPQ, have many of the properties expected for bona fide repair factors in cell-based assays. Their contribution to the DNA damage response in intact tissue in vivo has not, however, been demonstrated. Here we compare DNA damage sensitivity in the testes of wild-type mice versus mice bearing a null allele of the NONO homologue (Nono gt ). In wild-type mice, NONO protein was present in Sertoli, peritubular myoid, and interstitial cells, with an increase in expression following induction of DNA damage. As expected for the product of an X-linked gene, NONO was not detected in germ cells. The Nono gt/0 mice had at most a mild testis developmental phenotype in the absence of genotoxic stress. However, following irradiation at sublethal, 2-4 Gy doses, Nono gt/0 mice displayed a number of indicators of radiosensitivity as compared to their wild-type counterparts. These included higher levels of persistent DSB repair foci, increased numbers of apoptotic cells in the seminiferous tubules, and partial degeneration of the blood-testis barrier. There was also an almost complete loss of germ cells at later times following irradiation, evidently arising as an indirect effect reflecting loss of stromal support. Results demonstrate a role for NONO protein in protection against direct and indirect biological effects of ionizing radiation in the whole animal. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Repair pathways independent of the Fanconi anemia nuclear core complex play a predominant role in mitigating formaldehyde-induced DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Noda, Taichi [Department of Biology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Takahashi, Akihisa [Department of Biology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Kondo, Natsuko [Particle Radiation Oncology Research Center, Research Reactor Institute, Kyoto University, Kumatori-cho, Sennan-gun, Osaka 590-0494 (Japan); Mori, Eiichiro [Department of Biology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Okamoto, Noritomo [Department of Otorhinolaryngology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Nakagawa, Yosuke [Department of Oral and Maxillofacial Surgery, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); Ohnishi, Ken [Department of Biology, Ibaraki Prefectual University of Health Sciences, 4669-2 Ami, Ami-mati, Inasiki-gun, Ibaraki 300-0394 (Japan); Zdzienicka, Malgorzata Z. [Department of Molecular Cell Genetics, Collegium Medicum in Bydgoszcz, Nicolaus-Copernicus-University in Torun, ul. Sklodowskiej-Curie 9, 85-094 Bydgoszcz (Poland); Thompson, Larry H. [Biosciences and Biotechnology Division, L452, Lawrence Livermore National Laboratory, P.O. Box 808, Livermore, CA 94551-0808 (United States); Helleday, Thomas [Gray Institute for Radiation Oncology and Biology, University of Oxford, Old Road Campus Research Building, Off Roosevelt Drive, Oxford, OX3 7DQ (United Kingdom); Department of Genetics, Microbiology and Toxicology Stockholm University, SE-106 91 Stockholm (Sweden); Asada, Hideo [Department of Dermatology, School of Medicine, Nara Medical University, 840 Shijo-cho, Kashihara, Nara 634-8521 (Japan); and others

    2011-01-07

    The role of the Fanconi anemia (FA) repair pathway for DNA damage induced by formaldehyde was examined in the work described here. The following cell types were used: mouse embryonic fibroblast cell lines FANCA{sup -/-}, FANCC{sup -/-}, FANCA{sup -/-}C{sup -/-}, FANCD2{sup -/-} and their parental cells, the Chinese hamster cell lines FANCD1 mutant (mt), FANCGmt, their revertant cells, and the corresponding wild-type (wt) cells. Cell survival rates were determined with colony formation assays after formaldehyde treatment. DNA double strand breaks (DSBs) were detected with an immunocytochemical {gamma}H2AX-staining assay. Although the sensitivity of FANCA{sup -/-}, FANCC{sup -/-} and FANCA{sup -/-}C{sup -/-} cells to formaldehyde was comparable to that of proficient cells, FANCD1mt, FANCGmt and FANCD2{sup -/-} cells were more sensitive to formaldehyde than the corresponding proficient cells. It was found that homologous recombination (HR) repair was induced by formaldehyde. In addition, {gamma}H2AX foci in FANCD1mt cells persisted for longer times than in FANCD1wt cells. These findings suggest that formaldehyde-induced DSBs are repaired by HR through the FA repair pathway which is independent of the FA nuclear core complex. -- Research highlights: {yields} We examined to clarify the repair pathways of formaldehyde-induced DNA damage. Formaldehyde induces DNA double strand breaks (DSBs). {yields} DSBs are repaired through the Fanconi anemia (FA) repair pathway. {yields} This pathway is independent of the FA nuclear core complex. {yields} We also found that homologous recombination repair was induced by formaldehyde.

  6. A genome-wide scan reveals important roles of DNA methylation in human longevity by regulating age-related disease genes.

    Directory of Open Access Journals (Sweden)

    Fu-Hui Xiao

    Full Text Available It is recognized that genetic factors contribute to human longevity. Besides the hypothesis of existence of longevity genes, another suggests that a lower frequency of risk alleles decreases the incidence of age-related diseases in the long-lived people. However, the latter finds no support from recent genetic studies. Considering the crucial role of epigenetic modification in gene regulation, we then hypothesize that suppressing disease-related genes in longevity individuals is likely achieved by epigenetic modification, e.g. DNA methylation. To test this hypothesis, we investigated the genome-wide methylation profile in 4 Chinese female centenarians and 4 middle-aged controls using methyl-DNA immunoprecipitation sequencing. 626 differentially methylated regions (DMRs were observed between both groups. Interestingly, genes with these DMRs were enriched in age-related diseases, including type-2 diabetes, cardiovascular disease, stroke and Alzheimer's disease. This pattern remains rather stable after including methylomes of two white individuals. Further analyses suggest that the observed DMRs likely have functional roles in regulating disease-associated gene expressions, with some genes [e.g. caspase 3 (CASP3] being down-regulated whereas the others [i.e. interleukin 1 receptor, type 2 (IL1R2] up-regulated. Therefore, our study suggests that suppressing the disease-related genes via epigenetic modification is an important contributor to human longevity.

  7. Role of the Coulomb interaction in the low-frequency density of states of DNA double helices

    International Nuclear Information System (INIS)

    Garcia, A.E.; Krumhansl, J.A.

    1988-01-01

    The complete vibrational frequency spectrum of several DNA double-helical oligomers is calculated using established pair potentials. Various cutoff values are used for the range of the Coulomb interactions. At very low frequency the integrated density of states shows a noninteger exponent with values ranging from 0.75 to 1.55, depending on the cutoff value for the Coulomb interactions. We conclude that the cumulative densities of states in those molecules depend more on competing interactions than on various proposed universal laws

  8. Role of transposon-derived small RNAs in the interplay between genomes and parasitic DNA in rice.

    Directory of Open Access Journals (Sweden)

    Misuzu Nosaka

    2012-09-01

    Full Text Available RNA silencing is a defense system against "genomic parasites" such as transposable elements (TE, which are potentially harmful to host genomes. In plants, transcripts from TEs induce production of double-stranded RNAs (dsRNAs and are processed into small RNAs (small interfering RNAs, siRNAs that suppress TEs by RNA-directed DNA methylation. Thus, the majority of TEs are epigenetically silenced. On the other hand, most of the eukaryotic genome is composed of TEs and their remnants, suggesting that TEs have evolved countermeasures against host-mediated silencing. Under some circumstances, TEs can become active and increase in copy number. Knowledge is accumulating on the mechanisms of TE silencing by the host; however, the mechanisms by which TEs counteract silencing are poorly understood. Here, we show that a class of TEs in rice produces a microRNA (miRNA to suppress host silencing. Members of the microRNA820 (miR820 gene family are located within CACTA DNA transposons in rice and target a de novo DNA methyltransferase gene, OsDRM2, one of the components of epigenetic silencing. We confirmed that miR820 negatively regulates the expression of OsDRM2. In addition, we found that expression levels of various TEs are increased quite sensitively in response to decreased OsDRM2 expression and DNA methylation at TE loci. Furthermore, we found that the nucleotide sequence of miR820 and its recognition site within the target gene in some Oryza species have co-evolved to maintain their base-pairing ability. The co-evolution of these sequences provides evidence for the functionality of this regulation. Our results demonstrate how parasitic elements in the genome escape the host's defense machinery. Furthermore, our analysis of the regulation of OsDRM2 by miR820 sheds light on the action of transposon-derived small RNAs, not only as a defense mechanism for host genomes but also as a regulator of interactions between hosts and their parasitic elements.

  9. Cytoprotective effect against UV-induced DNA damage and oxidative stress: role of new biological UV filter.

    Science.gov (United States)

    Said, T; Dutot, M; Martin, C; Beaudeux, J-L; Boucher, C; Enee, E; Baudouin, C; Warnet, J-M; Rat, P

    2007-03-01

    The majority of chemical solar filters are cytotoxic, particularly on sensitive ocular cells (corneal and conjunctival cells). Consequently, a non-cytotoxic UV filter would be interesting in dermatology, but more especially in ophthalmology. In fact, light damage to the eye can be avoided thanks to a very efficient ocular antioxidant system; indeed, the chromophores absorb light and dissipate its energy. After middle age, a decrease in the production of antioxidants and antioxidative enzymes appears with accumulation of endogenous molecules that are phototoxic. UV radiations can induce reactive oxygen species formation, leading to various ocular diseases. Because most UV filters are cytotoxic for the eye, we investigated the anti-UV properties of Calophyllum inophyllum oil in order to propose it as a potential vehicle, free of toxicity, with a natural UV filter action in ophthalmic formulation. Calophyllum inophyllum oil, even at low concentration (1/10,000, v/v), exhibited significant UV absorption properties (maximum at 300nm) and was associated with an important sun protection factor (18-22). Oil concentrations up to 1% were not cytotoxic on human conjunctival epithelial cells, and Calophyllum inophyllum oil appeared to act as a cytoprotective agent against oxidative stress and DNA damage (85% of the DNA damage induced by UV radiations were inhibited with 1% Calophyllum oil) and did not induce in vivo ocular irritation (Draize test on New Zealand rabbits). Calophyllum inophyllum oil thus exhibited antioxidant and cytoprotective properties, and therefore might serve, for the first time, as a natural UV filter in ophthalmic preparations.

  10. Investigating the potential role of genetic and epigenetic variation of DNA methyltransferase genes in hyperplastic polyposis syndrome.

    Directory of Open Access Journals (Sweden)

    Musa Drini

    2011-02-01

    Full Text Available Hyperplastic Polyposis Syndrome (HPS is a condition associated with multiple serrated polyps, and an increased risk of colorectal cancer (CRC. At least half of CRCs arising in HPS show a CpG island methylator phenotype (CIMP, potentially linked to aberrant DNA methyltransferase (DNMT activity. CIMP is associated with methylation of tumor suppressor genes including regulators of DNA mismatch repair (such as MLH1, MGMT, and negative regulators of Wnt signaling (such as WIF1. In this study, we investigated the potential for interaction of genetic and epigenetic variation in DNMT genes, in the aetiology of HPS.We utilized high resolution melting (HRM analysis to screen 45 cases with HPS for novel sequence variants in DNMT1, DNMT3A, DNMT3B, and DNMT3L. 21 polyps from 13 patients were screened for BRAF and KRAS mutations, with assessment of promoter methylation in the DNMT1, DNMT3A, DNMT3B, DNMT3L MLH1, MGMT, and WIF1 gene promoters.No pathologic germline mutations were observed in any DNA-methyltransferase gene. However, the T allele of rs62106244 (intron 10 of DNMT1 gene was over-represented in cases with HPS (p<0.01 compared with population controls. The DNMT1, DNMT3A and DNMT3B promoters were unmethylated in all instances. Interestingly, the DNMT3L promoter showed low levels of methylation in polyps and normal colonic mucosa relative to matched disease free cells with methylation level negatively correlated to expression level in normal colonic tissue. DNMT3L promoter hypomethylation was more often found in polyps harbouring KRAS mutations (p = 0.0053. BRAF mutations were common (11 out of 21 polyps, whilst KRAS mutations were identified in 4 of 21 polyps.Genetic or epigenetic alterations in DNMT genes do not appear to be associated with HPS, but further investigation of genetic variation at rs62106244 is justified given the high frequency of the minor allele in this case series.

  11. A role for CaV1 and calcineurin signaling in depolarization-induced changes in neuronal DNA methylation.

    Science.gov (United States)

    Hannon, Eilis; Chand, Annisa N; Evans, Mark D; Wong, Chloe C Y; Grubb, Matthew S; Mill, Jonathan

    2015-07-01

    Direct manipulations of neuronal activity have been shown to induce changes in DNA methylation (DNAm), although little is known about the cellular signaling pathways involved. Using reduced representation bisulfite sequencing, we identify DNAm changes associated with moderate chronic depolarization in dissociated rat hippocampal cultures. Consistent with previous findings, these changes occurred primarily in the vicinity of loci implicated in neuronal function, being enriched in intergenic regions and underrepresented in CpG-rich promoter regulatory regions. We subsequently used 2 pharmacological interventions (nifedipine and FK-506) to test whether the identified changes depended on 2 interrelated signaling pathways known to mediate multiple forms of neuronal plasticity. Both pharmacological manipulations had notable effects on the extent and magnitude of depolarization-induced DNAm changes indicating that a high proportion of activity-induced changes are likely to be mediated by calcium entry through L-type Ca V 1 channels and/or downstream signaling via the calcium-dependent phosphatase calcineurin.

  12. Role of the RecF pathway of recombination in the metabolism of uv-irradiated DNA in Escherichia coli K-12

    International Nuclear Information System (INIS)

    Rothman, R.H.

    1976-01-01

    The RecF pathway of genetic recombination in Escherichia coli is potentially capable of supporting wild type levels of recombination, but in wild type cells it plays a relatively minor role in this process. RecF and recL single mutants were found to be ultraviolet-sensitive but recombination proficient. These observations led to the hypothesis that the main function of the RecF pathway lies in the metabolism of uv-damaged DNA. The role of reF and recL in pathways of recovery from uv-irradiation has been examined. Both recF - and recL - inhibited post-replication joining of DNA fragments synthesized on uv-damaged DNA templates (post-replication repair). The addition of a uvrB5 mutation to the single mutants did not affect the cell's ability to complete post-replication repair in the case of recL, but did completely prevent completion of joining in the case of recF. It was hypothesized that recF is an endonuclease weakly indirectly suppressible by the presence of functional correndo II. It is suggested that recF is necessary to cleave the crossed strand intermediate at the end of repair. RecL, in addition to its involvement in post-replication repair, was also found to be involved in excision repair. A uvrB recB recC recF multiple mutant was as sensitive as a uvrB recA strain, suggesting that it is devoid of any repair abilities. RecB - was shown to have an inhibitory effect of post-replication repair. The uvrB recF mutant, however, was totally devoid of post-replication repair even though recB + contributed to the recovery of the strain. Thus the role of recB in post-replication repair is unclear. Lastly, the effects of recF and recL on uv-inducible repair was studied. W-reactivation of uv-irradiated lambda was used as an assay for inducible repair. The conclusions from these experiments were unclear. They seemed to imply that W-reactivation is effected by the combined action of excision repair and post-replication repair

  13. DNA bending in solution: NMR studies on the structural roles of A/T tracts and the sequences at the junction

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, G. (Los Alamos National Lab., NM (USA)); Umemoto, K.; Sarma, M.H.; Sarma, R.H. (State Univ. of New York, Albany (USA))

    1989-01-01

    A summary of ID/2D-NMR studies on d(GA{sub 4}T{sub 4}C){sub 2}, and (GA{sub 4}U{sub 4}C){sub 2}, and d(GT{sub 4}A{sub 4}C){sub 2} in solution is reported in this article. Results of these studies indicate one important structural property of A {center dot} T pairs, i.e., A {center dot} T pairs are propeller twisted, which results in a series of interstrand bifurcated H-bonds inside the A/T tract. The structural similarity of d(GA{sub 4}T{sub 4}C){sub 2} and d(GA{sub 4}U{sub 4}C){sub 2} suggests that the methyl group of thymine may be of little consequence as far as this structural peculiarity of the A/T tract is concerned. Comparison of d(GA{sub 4}T{sub 4}C){sub 2} (i.e., junction B-DNA model) and d(GT{sub 4}A{sub 4}C){sub 2} (i.e., straight B-DNA model) structures shows that not only the structural peculiarity of the A/T tract but also the sequence that joins two neighboring A/T tracts play crucial roles in DNA bending. In other words, when two A/T tracts are joined at the A {yields} T sequence, a junction is created, whereas when two A/T tracts are connected at the T {yields} A sequence, no discontinuity is observed.

  14. Altered hepatic mRNA expression of immune response-associated DNA damage in mice liver induced by potassium bromate: Protective role of vanillin.

    Science.gov (United States)

    Ben Saad, Hajer; Driss, Dorra; Ben Amara, Ibtissem; Boudawara, Ons; Boudawara, Tahia; Ellouz Chaabouni, Samia; Mounir Zeghal, Khaled; Hakim, Ahmed

    2016-12-01

    Chronic exposure to potassium bromate (KBrO 3 ), a toxic halogen existing widely in the environment, environment through contaminated drinking water, has become a global problem of public health. The present study investigates the protective role of vanillin against KBrO 3 induced oxidative stress, distruption in inflammatory cytokines expression, DNA damage, and histopathological changes. Adult mice were exposed orally to KBrO 3 (2g/L of drinking water) for 2 weeks The co-administration of vanillin to the KBrO 3 -treated mice significantly prevented the plasma transaminases increase in. Furthermore, it inhibited hepatic lipid peroxidation (malondialdehyde), advanced oxidation protein product (AOPP) and protein carbonyl (PCO) formation and attenuated the KBrO 3 -mediated depletion of enzymatic and non enzymatic antioxidants catalase, superoxide dismutase, and glutathione peroxidase activities and glutathione level in the liver. In addition, vanillin markedly attenuated the expression levels of proinflammatory cytokines, including tumor necrosis factor-α, interleukin-1β, interleukin-6, and COX2 and prevented KBrO 3 -induced hepatic cell alteration and necrosis, as indicated by histopathological data. DNA damage, as assessed by the alkaline comet assay, was also found to be low in the co-treated group. Thus, these findings show that vanillin acts as potent chemopreventive agent against KBrO 3 -mediated liver oxidative stress and genotoxicity through its antioxidant properties. © 2015 Wiley Periodicals, Inc. Environ Toxicol 31: 1796-1807, 2016. © 2015 Wiley Periodicals, Inc.

  15. DNA double strand break repair pathway plays a significant role in determining the radiotherapy induced normal tissue toxicity among head-and-neck and breast cancer

    International Nuclear Information System (INIS)

    Sadashiva, Satish Rao Bola; Mumbrekar, Kamalesh Dattaram; Venkatesh, Goutham Hassan; Fernandes, Donald Jerard; Bejadi, Vadhiraja Manjunath; Kapaettu, Satyamoorthy

    2014-01-01

    The ability to predict individual risk of radiotherapy induced normal tissue complications prior to the therapy may give an opportunity to personalize the treatment aiming improved therapeutic effect and quality of life. Therefore, predicting the risk of developing acute reactions before the initiation of radiation therapy may serve as a potential biomarker. DNA double-strand break (DSB) induction and its repair kinetics in lymphocytes of Head-and-Neck (n = 183) and Breast cancer (n = 132) patients undergoing chemoradiation or radiation therapy alone were analyzed by performing γ-H2AX foci, neutral comet and a modified neutral filter elution assay. Candidate radioresponsive genes like DNA repair, antioxidant pathway, profibrotic cytokine genes were screened for the common variants for their association with normal tissue toxicity outcome. Patients were stratified as non-over responders (NOR) and over responders (OR) based on their Radiation Therapy Oncology Group grading for normal tissue adverse reactions. Our results suggest that DSB repair plays a major role in the development of normal tissue adverse reactions in H and N and Breast cancer patients. The cellular (γ-H2AX analysis) and SNP analysis may have the potential to be developed into a clinically useful predictive assay for identifying the normal tissue over reactors

  16. A role for the malignant brain tumour (MBT domain protein LIN-61 in DNA double-strand break repair by homologous recombination.

    Directory of Open Access Journals (Sweden)

    Nicholas M Johnson

    Full Text Available Malignant brain tumour (MBT domain proteins are transcriptional repressors that function within Polycomb complexes. Some MBT genes are tumour suppressors, but how they prevent tumourigenesis is unknown. The Caenorhabditis elegans MBT protein LIN-61 is a member of the synMuvB chromatin-remodelling proteins that control vulval development. Here we report a new role for LIN-61: it protects the genome by promoting homologous recombination (HR for the repair of DNA double-strand breaks (DSBs. lin-61 mutants manifest numerous problems associated with defective HR in germ and somatic cells but remain proficient in meiotic recombination. They are hypersensitive to ionizing radiation and interstrand crosslinks but not UV light. Using a novel reporter system that monitors repair of a defined DSB in C. elegans somatic cells, we show that LIN-61 contributes to HR. The involvement of this MBT protein in HR raises the possibility that MBT-deficient tumours may also have defective DSB repair.

  17. Protective role of probiotic lactic acid bacteria against dietary fumonisin B1-induced toxicity and DNA-fragmentation in sprague-dawley rats.

    Science.gov (United States)

    Khalil, Ashraf A; Abou-Gabal, Ashgan E; Abdellatef, Amira A; Khalid, Ahmed E

    2015-08-18

    The genus Fusarium, especially F. verticillioides and F. proliferatum, has been found in several agricultural products worldwide, especially in maize. Regardless the occurrence of symptoms, the presence of Fusarium in maize constitutes an imminent risk due to its ability to produce fumonisins, mycotoxins with proven carcinogenic effect on rats, swine, and equines and already classified as possible carcinogens to humans. The toxicity of incremental levels of fumonisin B1 (FB1), that is, 50, 100, and 200 mg FB1/kg diet, and the role of Lactobacillus delbrueckii subsp. lactis DSM 20076 (LL) and Pediococcus acidilactici NNRL B-5627 (PA) supplementation in counteracting the FB1 effects in intoxicated rats were monitored over a period of 4 weeks. Effects on the feed intake and body weight gain were noticed. A significant (p ≤ 0.05) increase in the level of liver and kidney functions markers and DNA fragmentation was also noticed in rat groups T100 and T200. The lactic acid bacteria (LAB) supplementation could bring back the normal serum biochemical parameters in rats fed on fumonisin B1-contaminated diets (T50 and T100) compared to FB1-treated groups. In rats of high-dosage dietary groups supplemented with LAB (T200-LL and T200-PA), the supplementation reduced the serum activity levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and creatinine by 11.3, 11.9, 32, and 20%, respectively. DNA fragmentations were observed in the rat group treated with 200 mg FB1 after 3 weeks, while fragmentation was noticed in treated groups with 100 and 200 mg FB1 after 4 weeks. No DNA fragmentation was apparent in FB1-treated rats co-administered the LL or PA strain. These results suggest that in male rats consuming diets containing FB1, there is a time- and dose-dependent increase in serum enzyme activities and DNA lesions. Moreover, Lb. delbrueckii subsp. lactis (LL) and P. acidilactici (PA) strains have a protective effect

  18. Role of cytochrome P450 IA2 in acetanilide 4-hydroxylation as determined with cDNA expression and monoclonal antibodies.

    Science.gov (United States)

    Liu, G; Gelboin, H V; Myers, M J

    1991-02-01

    The role of P450 IA2 in the hydroxylation of acetanilide was examined using an inhibitory monoclonal antibody (MAb) 1-7-1 and vaccinia cDNA expression producing murine P450 IA1 (mIA1), murine P450 IA2 (mIA2), or human P450 IA2 (hIA2). Acetanilide hydroxylase (AcOH) activity was measured using an HPLC method with more than 500-fold greater sensitivity than previously described procedures. This method, which does not require the use of radioactive acetanilide, was achieved by optimizing both the gradient system and the amount of enzyme needed to achieve detection by uv light. MAb 1-7-1 inhibits up to 80% of the AcOH activity in both rat liver microsomes and cDNA expressed mouse and human P450 IA2. MAb 1-7-1, which recognizes both P450 IA1 and P450 IA2, completely inhibits the aryl hydrocarbon hydroxylase (AHH) activity of cDNA expressed in IA1. The inhibition of only 80% of the AHH activity present in MC liver microsomes by MAb 1-7-1 suggests that additional P450 forms are contributing to the overall AHH activity present in methylcholanthrene (MC)-liver microsomes as MAb 1-7-1 almost completely inhibits the AHH activity of expressed mIA1. Maximal inhibition of IA2 by 1-7-1 results in an 80% decrease in acetanilide hydroxylase activity in both liver microsomes and expressed mouse and human IA2. The capacity of MAb 1-7-1 to produce identical levels of inhibition of acetanilide hydroxylase activity in rat MC microsomes (80%) and in expressed mouse (81%) and human P450 IA2 (80%) strongly suggests that P450 IA2 is the major and perhaps the only enzyme responsible for the metabolism of acetanilide. These results demonstrate the complementary utility of monoclonal antibodies and cDNA expression for defining the contribution of specific P450 enzymes to the metabolism of a given substrate. This complementary approach allows for a more precise determination of the inhibitory capacity of MAb with respect to the metabolic capacity of the target P450.

  19. Meta-Analysis of DNA Tumor-Viral Integration Site Selection Indicates a Role for Repeats, Gene Expression and Epigenetics

    Directory of Open Access Journals (Sweden)

    Janet M. Doolittle-Hall

    2015-11-01

    Full Text Available Oncoviruses cause tremendous global cancer burden. For several DNA tumor viruses, human genome integration is consistently associated with cancer development. However, genomic features associated with tumor viral integration are poorly understood. We sought to define genomic determinants for 1897 loci prone to hosting human papillomavirus (HPV, hepatitis B virus (HBV or Merkel cell polyomavirus (MCPyV. These were compared to HIV, whose enzyme-mediated integration is well understood. A comprehensive catalog of integration sites was constructed from the literature and experimentally-determined HPV integration sites. Features were scored in eight categories (genes, expression, open chromatin, histone modifications, methylation, protein binding, chromatin segmentation and repeats and compared to random loci. Random forest models determined loci classification and feature selection. HPV and HBV integrants were not fragile site associated. MCPyV preferred integration near sensory perception genes. Unique signatures of integration-associated predictive genomic features were detected. Importantly, repeats, actively-transcribed regions and histone modifications were common tumor viral integration signatures.

  20. A role for CaV1 and calcineurin signaling in depolarization-induced changes in neuronal DNA methylation

    Directory of Open Access Journals (Sweden)

    Eilis Hannon

    2015-07-01

    Full Text Available Direct manipulations of neuronal activity have been shown to induce changes in DNA methylation (DNAm, although little is known about the cellular signaling pathways involved. Using reduced representation bisulfite sequencing, we identify DNAm changes associated with moderate chronic depolarization in dissociated rat hippocampal cultures. Consistent with previous findings, these changes occurred primarily in the vicinity of loci implicated in neuronal function, being enriched in intergenic regions and underrepresented in CpG-rich promoter regulatory regions. We subsequently used 2 pharmacological interventions (nifedipine and FK-506 to test whether the identified changes depended on 2 interrelated signaling pathways known to mediate multiple forms of neuronal plasticity. Both pharmacological manipulations had notable effects on the extent and magnitude of depolarization-induced DNAm changes indicating that a high proportion of activity-induced changes are likely to be mediated by calcium entry through L-type CaV1 channels and/or downstream signaling via the calcium-dependent phosphatase calcineurin.

  1. The role of ecologic diversification in sibling speciation of Empidonax flycatchers (Tyrannidae): multigene evidence from mtDNA.

    Science.gov (United States)

    Johnson, N K; Cicero, C

    2002-10-01

    Avian genera characterized by sibling species with distinctive habitat preferences present an evolutionary enigma in view of the more commonplace occurrence of syntopic congeners that differ strikingly in colour and pattern. No existing theory has explained the evolutionary background that led to these differences. Here we propose that great phenotypic similarity among some groups of sibling species limits their coexistence and that clues to their radiation can be seen in patterns of geographical occurrence. To illustrate our thesis we focused on the New World flycatcher genus Empidonax, a group of 15 species notorious for their great phenotypic similarity. Using 3069 base pairs of mitochondrial DNA from four genes, we produced a complete molecular phylogeny that identified four clades, three of which represent close relatives. The fourth clade includes only E. virescens, which apparently has no close living relatives. The majority of species, including many distant relatives, are completely (58.1%) or essentially (6.7%) allopatric in breeding distribution and exhibit striking ecological segregation into distinctive climate-vegetation zones. Even where ranges overlap, occupancy of the same habitat by different species is rare. Phylogenetic and distributional patterns in Empidonax suggest a peripatric model of stepwise colonization and then range expansion of small groups of pioneers during glacial periods into initially enlarging, distinctive habitats destined to be widespread during interglacials. Vicariance is not indicated in the absence of barriers of appropriate age and geographical position. Rapoport's rule that northern species have larger ranges than southern species is strongly supported.

  2. Role of Growth Arrest and DNA Damage–inducible α in Akt Phosphorylation and Ubiquitination after Mechanical Stress-induced Vascular Injury

    Science.gov (United States)

    Mitra, Sumegha; Sammani, Saad; Wang, Ting; Boone, David L.; Meyer, Nuala J.; Dudek, Steven M.; Moreno-Vinasco, Liliana; Garcia, Joe G. N.

    2011-01-01

    Rationale: The stress-induced growth arrest and DNA damage–inducible α (GADD45a) gene is up-regulated by mechanical stress with GADD45a knockout (GADD45a−/−) mice demonstrating both increased susceptibility to ventilator-induced lung injury (VILI) and reduced levels of the cell survival and vascular permeability signaling effector (Akt). However, the functional role of GADD45a in the pathogenesis of VILI is unknown. Objectives: We sought to define the role of GADD45a in the regulation of Akt activation induced by mechanical stress. Methods: VILI-challenged GADD45a−/− mice were administered a constitutively active Akt1 vector and injury was assessed by bronchoalveolar lavage cell counts and protein levels. Human pulmonary artery endothelial cells (EC) were exposed to 18% cyclic stretch (CS) under conditions of GADD45a silencing and used for immunoprecipitation, Western blotting or immunofluoresence. EC were also transfected with mutant ubiquitin vectors to characterize site-specific Akt ubiquitination. DNA methylation was measured using methyl-specific polymerase chain reaction assay. Measurements and Main Results: Studies exploring the linkage of GADD45a with mechanical stress and Akt regulation revealed VILI-challenged GADD45a−/− mice to have significantly reduced lung injury on overexpression of Akt1 transgene. Increased mechanical stress with 18% CS in EC induced Akt phosphorylation via E3 ligase tumor necrosis factor receptor–associated factor 6 (TRAF6)–mediated Akt K63 ubiquitination resulting in Akt trafficking and activation at the membrane. GADD45a is essential to this process because GADD45a-silenced endothelial cells and GADD45a−/− mice exhibited increased Akt K48 ubiquitination leading to proteasomal degradation. These events involve loss of ubiquitin carboxyl terminal hydrolase 1 (UCHL1), a deubiquitinating enzyme that normally removes K48 polyubiquitin chains bound to Akt thus promoting Akt K63 ubiquitination. Loss of GADD45a

  3. The role of nutritional factors in cellular protection against DNA damage, altered gene expression and malignant transformation

    International Nuclear Information System (INIS)

    Borek, C.

    1986-01-01

    In recent years data from epidemiological studies and laboratory experiments have revealed numerous links between diet and cancer. The complex role of nutritional factors in modifying cancer incidence may be attributed in part to dietary agents acting as potentiators or promoters of cancer, serving as auxilliary agents to other environmental factors; as causes of cancer, or as cancer preventive agents. Studies can be carried on in vitro, in cell culture systems, where malignant transformation serves as an end point. These systems afford the opportunity to study the direct effect of nutrition in oncogenesis and the role of dietary factors in modulating the frequency and course of neoplastic development in its various stages. 20 refs., 1 fig., 3 tabs

  4. DNA double strand break repair in mammalian cells: role of MRE11 and BLM proteins at the initiation of Non Homologous End Joining (NHEJ)

    International Nuclear Information System (INIS)

    Grabarz, Anastazja

    2011-01-01

    DNA double strand breaks (DSBs) are highly cytotoxic lesions, which can lead to genetic rearrangements. Two pathways are responsible for repairing these lesions: homologous recombination (HR) and non homologous end joining (NHEJ). In our laboratory, an intrachromosomal substrate has been established in order to measure the efficiency and the fidelity of NHEJ in living cells (Guirouilh-Barbat 2004). This approach led us to identify a KU-independent alternative pathway, which uses micro homologies in the proximity of the junction to accomplish repair - the alternative NHEJ (Guirouilh-Barbat 2004, Guirouilh-Barbat et Rass 2007). The goal of my thesis consisted in identifying and characterising major actors of this pathway. In the absence of KU, alternative NHEJ would be initiated by ssDNA resection of damaged ends. We showed that the nuclease activity of MRE11 is necessary for this mechanism. MRE11 overexpression leads to a two fold stimulation of NHEJ efficiency, while the extinction of MRE11 by siRNA results in a two fold decrease. Our results demonstrate that the proteins RAD50 and CtIP act in the same pathway as MRE11. Moreover, in cells deficient for XRCC4, MIRIN - an inhibitor of the MRN complex - leads to a decrease in repair efficiency, implicating MRE11 in alternative NHEJ. We also showed that MRE11 can act in an ATM-dependent and independent manner (Rass et Grabarz Nat Struct Mol Biol 2009). The initiation of break resection needs to be pursued by a more extensive degradation of DNA, which is accomplished in yeast by the proteins Exo1 and Sgs1/Dna2. In human cells, in vitro studies have recently proposed a similar model of a two-step break resection. We chose to elucidate the role of one of the human homologs of Sgs1 - the RecQ helicase BLM - in the resection process. Our experiments show, that he absence of BLM decreases the efficiency of end joining by NHEJ, accompanied by an increase in error-prone events, especially long-range deletions (≥200 nt). This

  5. Role of DNA damage and repair as predeterminant factor in the development of radiotherapy induced acute adverse reactions

    International Nuclear Information System (INIS)

    Satish Rao, B.S.; Kamalesh, D.M.; Goutham, H.V.; Donald, J.F.; Sharan, Krishna; Vadhiraja, B.M.; Satyamoorthy, K.

    2013-01-01

    Radiotherapy induced normal tissue toxicity is one of the major limitations for the compromised the therapeutic outcome and also worsens the quality of life of survivors. Further, the clinical experience demonstrated inter-individual variability with respect to their normal tissue toxicity. Therefore, the discovery of contributing key factors of variability or predicting the risk of developing acute reactions before the initiation of radiation therapy may serve as a powerful predictive biomarker for individualizing radiotherapy, anticipating increased therapeutic effect. DNA double-strand break (DSB) induction and its repair in lymphocytes of head-and-neck and breast cancer patients undergoing chemoradiation or radiation therapy alone were analyzed by performing γ-H2AX foci, neutral comet and a modified neutral filter elution assays. Treatment induced normal tissue adverse reactions (acute skin reaction, oral mucositis) were assessed by the criteria of Radiation Therapy Oncology Group. The residual damage (RD) at 6 hrs of post irradiation was used as parameters to measure cellular radiosensitivity and for its correlation with radiotherapy induced acute reactions in patients stratified as non-over responders (NOR) and over responders (OR). A large inter-individual variation in the radiosensitivity was observed in the cancer individuals with respect to their lymphocyte radiosensitivity and the severity of normal tissue adverse reactions. There was a significant difference in RD (p<0.05) between the NOR and OR in breast cancer radiotherapy. Further, the increased normal tissue toxicity such as oral mucositis and skin reactions was associated with the reduced DSB repair (p<0.05) in head-and-neck cancer patients. The percentile analysis was found to be useful in predicting the OR amongst the head-and-neck cancer patients. Our results suggest that γ-H2AX analysis may have its potential to be developed into a clinically useful predictive assay for identifying the

  6. Behavioral vs. molecular sources of conflict between nuclear and mitochondrial DNA: The role of male-biased dispersal in a Holarctic sea duck

    Science.gov (United States)

    Peters, Jeffrey L.; Bolender, Kimberly A.; Pearce, John M.

    2012-01-01

    Genetic studies of waterfowl (Anatidae) have observed the full spectrum of mitochondrial (mt) DNA population divergence, from apparent panmixia to deep, reciprocally monophyletic lineages. Yet, these studies often found weak or no nuclear (nu) DNA structure, which was often attributed to male-biased gene flow, a common behaviour within this family. An alternative explanation for this ‘conflict’ is that the smaller effective population size and faster sorting rate of mtDNA relative to nuDNA lead to different signals of population structure. We tested these alternatives by sequencing 12 nuDNA introns for a Holarctic pair of waterfowl subspecies, the European goosander (Mergus merganser merganser) and the North American common merganser (M. m. americanus), which exhibit strong population structure in mtDNA. We inferred effective population sizes, gene flow and divergence times from published mtDNA sequences and simulated expected differentiation for nuDNA based on those histories. Between Europe and North America, nuDNA ФST was 3.4-fold lower than mtDNA ФST, a result consistent with differences in sorting rates. However, despite geographically structured and monophyletic mtDNA lineages within continents, nuDNA ФST values were generally zero and significantly lower than predicted. This between- and within-continent contrast held when comparing mtDNA and nuDNA among published studies of ducks. Thus, male-mediated gene flow is a better explanation than slower sorting rates for limited nuDNA differentiation within continents, which is also supported by nonmolecular data. This study illustrates the value of quantitatively testing discrepancies between mtDNA and nuDNA to reject the null hypothesis that conflict simply reflects different sorting rates.

  7. Role of DNA methylation in miR-200c/141 cluster silencing in invasive breast cancer cells

    OpenAIRE

    Neves, Rui; Scheel, Christina; Weinhold, Sandra; Honisch, Ellen; Iwaniuk, Katharina M; Trompeter, Hans-Ingo; Niederacher, Dieter; Wernet, Peter; Santourlidis, Simeon; Uhrberg, Markus

    2010-01-01

    Abstract Background The miR-200c/141 cluster has recently been implicated in the epithelial to mesenchymal transition (EMT) process. The expression of these two miRNAs is inversely correlated with tumorigenicity and invasiveness in several human cancers. The role of these miRNAs in cancer progression is based in part on their capacity to target the EMT activators ZEB1 and ZEB2, two transcription factors, which in turn repress expression of E-cadherin. Little is known about the regulation of t...

  8. Role of genetic polymorphisms of CYP1A1, CYP3A5, CYP2C9, CYP2D6, and PON1 in the modulation of DNA damage in workers occupationally exposed to organophosphate pesticides

    International Nuclear Information System (INIS)

    Singh, Satyender; Kumar, Vivek; Vashisht, Kapil; Singh, Priyanka; Banerjee, Basu Dev; Rautela, Rajender Singh; Grover, Shyam Sunder; Rawat, Devendra Singh; Pasha, Syed Tazeen; Jain, Sudhir Kumar; Rai, Arvind

    2011-01-01

    Organophosphate pesticides (OPs) are primarily metabolized by several xenobiotic metabolizing enzymes (XMEs). Very few studies have explored genetic polymorphisms of XMEs and their association with DNA damage in pesticide-exposed workers. The present study was designed to determine the role of genetic polymorphisms of CYP1A1, CYP3A5, CYP2C9, CYP2D6, and PON1 in the modulation of DNA damage in workers occupationally exposed to OPs. We examined 284 subjects including 150 workers occupationally exposed to OPs and 134 normal healthy controls. The DNA damage was evaluated using the alkaline comet assay and genotyping was done using PCR–RFLP. The results revealed that the PONase activity toward paraoxonase and AChE activity was found significantly lowered in workers as compared to control subjects (p < 0.001). Workers showed significantly higher DNA damage compared to control subjects (14.37 ± 2.15 vs. 6.24 ± 1.37 tail% DNA, p < 0.001). Further, the workers with CYP2D6*3 PM and PON1 (QQ and MM) genotypes were found to have significantly higher DNA damage when compared to other genotypes (p < 0.05). In addition, significant increase in DNA damage was also observed in workers with concomitant presence of certain CYP2D6 and PON1 (Q192R and L55M) genotypes which need further extensive studies. In conclusion, the results indicate that the PON1 and CYP2D6 genotypes can modulate DNA damage elicited by some OPs possibly through gene-environment interactions. -- Highlights: ► Role of CYP1A1, CYP3A5, CYP2C, CYP2D6 and PON1 genotypes on DNA damage. ► Workers exposed to some OPs demonstrated increased DNA damage. ► CYP2D6 *3 PM and PON1 (Q192R and L55M) genotypes are associated with DNA damage. ► Concomitant presence of certain CYP2D6 and PON1 genotypes can increase DNA damage.

  9. Role of genetic polymorphisms of CYP1A1, CYP3A5, CYP2C9, CYP2D6, and PON1 in the modulation of DNA damage in workers occupationally exposed to organophosphate pesticides

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Satyender [Division of Biochemistry and Biotechnology, National Centre for Disease Control 22, Sham Nath Marg, Delhi-110054 (India); Kumar, Vivek [Environmental Biochemistry and Molecular Biology laboratory, Department of Biochemistry, University College of Medical Sciences and GTB Hospital, University of Delhi, Dilshad Garden, Delhi-110095 (India); Vashisht, Kapil; Singh, Priyanka [Division of Biochemistry and Biotechnology, National Centre for Disease Control 22, Sham Nath Marg, Delhi-110054 (India); Banerjee, Basu Dev, E-mail: banerjeebd@hotmail.com [Environmental Biochemistry and Molecular Biology laboratory, Department of Biochemistry, University College of Medical Sciences and GTB Hospital, University of Delhi, Dilshad Garden, Delhi-110095 (India); Rautela, Rajender Singh; Grover, Shyam Sunder; Rawat, Devendra Singh; Pasha, Syed Tazeen [Division of Biochemistry and Biotechnology, National Centre for Disease Control 22, Sham Nath Marg, Delhi-110054 (India); Jain, Sudhir Kumar [Centre for Epidemiology and Parasitic Diseases, National Centre for Disease Control 22, Sham Nath Marg, Delhi-110054 (India); Rai, Arvind [Division of Biochemistry and Biotechnology, National Centre for Disease Control 22, Sham Nath Marg, Delhi-110054 (India)

    2011-11-15

    Organophosphate pesticides (OPs) are primarily metabolized by several xenobiotic metabolizing enzymes (XMEs). Very few studies have explored genetic polymorphisms of XMEs and their association with DNA damage in pesticide-exposed workers. The present study was designed to determine the role of genetic polymorphisms of CYP1A1, CYP3A5, CYP2C9, CYP2D6, and PON1 in the modulation of DNA damage in workers occupationally exposed to OPs. We examined 284 subjects including 150 workers occupationally exposed to OPs and 134 normal healthy controls. The DNA damage was evaluated using the alkaline comet assay and genotyping was done using PCR-RFLP. The results revealed that the PONase activity toward paraoxonase and AChE activity was found significantly lowered in workers as compared to control subjects (p < 0.001). Workers showed significantly higher DNA damage compared to control subjects (14.37 {+-} 2.15 vs. 6.24 {+-} 1.37 tail% DNA, p < 0.001). Further, the workers with CYP2D6*3 PM and PON1 (QQ and MM) genotypes were found to have significantly higher DNA damage when compared to other genotypes (p < 0.05). In addition, significant increase in DNA damage was also observed in workers with concomitant presence of certain CYP2D6 and PON1 (Q192R and L55M) genotypes which need further extensive studies. In conclusion, the results indicate that the PON1 and CYP2D6 genotypes can modulate DNA damage elicited by some OPs possibly through gene-environment interactions. -- Highlights: Black-Right-Pointing-Pointer Role of CYP1A1, CYP3A5, CYP2C, CYP2D6 and PON1 genotypes on DNA damage. Black-Right-Pointing-Pointer Workers exposed to some OPs demonstrated increased DNA damage. Black-Right-Pointing-Pointer CYP2D6 *3 PM and PON1 (Q192R and L55M) genotypes are associated with DNA damage. Black-Right-Pointing-Pointer Concomitant presence of certain CYP2D6 and PON1 genotypes can increase DNA damage.

  10. The Role of Mitochondrial DNA Damage and Repair in the Resistance of BCR/ABL-Expressing Cells to Tyrosine Kinase Inhibitors

    Directory of Open Access Journals (Sweden)

    Janusz Blasiak

    2013-08-01

    Full Text Available Chronic myeloid leukemia (CML is a hematological malignancy that arises from the transformation of stem hematopoietic cells by the fusion oncogene BCR/ABL and subsequent clonal expansion of BCR/ABL-positive progenitor leukemic cells. The BCR/ABL protein displays a constitutively increased tyrosine kinase activity that alters many regulatory pathways, leading to uncontrolled growth, impaired differentiation and increased resistance to apoptosis featured by leukemic cells. Current CML therapy is based on tyrosine kinase inhibitors (TKIs, primarily imatinib, which induce apoptosis in leukemic cells. However, some patients show primary resistance to TKIs while others develop it in the course of therapy. In both cases, resistance may be underlined by perturbations in apoptotic signaling in leukemic cells. As mitochondria may play an important role in such signaling, alteration in mitochondrial metabolism may change resistance to pro-apoptotic action of TKIs in BCR/ABL-positive cells. Because BCR/ABL may induce reactive oxygen species and unfaithful DNA repair, it may affect the stability of mitochondrial DNA, influencing mitochondrial apoptotic signaling and in this way change the sensitivity of CML cells to TKIs. Moreover, cancer cells, including BCR/ABL-positive cells, show an increased level of glucose metabolism, resulting from the shift from oxidative phosphorylation to glycolysis to supply ATP for extensive proliferation. Enhanced level of glycolysis may be associated with TKI resistance and requires change in the expression of several genes regulated mostly by hypoxia-inducible factor-1α, HIF-1α. Such regulation may be associated with the impaired mitochondrial respiratory system in CML cells. In summary, mitochondria and mitochondria-associated molecules and pathways may be attractive targets to overcome TKI resistance in CML.

  11. Prognostic role of APC and RASSF1A promoter methylation status in cell free circulating DNA of operable gastric cancer patients.

    Science.gov (United States)

    Balgkouranidou, I; Matthaios, D; Karayiannakis, A; Bolanaki, H; Michailidis, P; Xenidis, N; Amarantidis, K; Chelis, L; Trypsianis, G; Chatzaki, E; Lianidou, E S; Kakolyris, S

    2015-08-01

    Gastric carcinogenesis is a multistep process including not only genetic mutations but also epigenetic alterations. The best known and more frequent epigenetic alteration is DNA methylation affecting tumor suppressor genes that may be involved in various carcinogenetic pathways. The aim of the present study was to investigate the methylation status of APC promoter 1A and RASSF1A promoter in cell free DNA of operable gastric cancer patients. Using methylation specific PCR, we examined the methylation status of APC promoter 1A and RASSF1A promoter in 73 blood samples obtained from patients with gastric cancer. APC and RASSF1A promoters were found to be methylated in 61 (83.6%) and 50 (68.5%) of the 73 gastric cancer samples examined, but in none of the healthy control samples (p APC promoter and elevated CEA (p = 0.033) as well as CA-19.9 (p = 0.032) levels, was noticed. The Kaplan-Meier estimates of survival, significantly favored patients with a non-methylated APC promoter status (p = 0.008). No other significant correlations between APC and RASSF1A methylation status and different tumor variables examined was observed. Serum RASSF1A and APC promoter hypermethylation is a frequent epigenetic event in patients with early operable gastric cancer. The observed correlations between APC promoter methylation status and survival as well as between a hypermethylated RASSF1A promoter and nodal positivity may be indicative of a prognostic role for those genes in early operable gastric cancer. Additional studies, in a larger cohort of patients are required to further explore whether these findings could serve as potential molecular biomarkers of survival and/or response to specific treatments. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Methylation status of the APC and RASSF1A promoter in cell-free circulating DNA and its prognostic role in patients with colorectal cancer.

    Science.gov (United States)

    Matthaios, Dimitrios; Balgkouranidou, Ioanna; Karayiannakis, Anastasios; Bolanaki, Helen; Xenidis, Nikolaos; Amarantidis, Kyriakos; Chelis, Leonidas; Romanidis, Konstantinos; Chatzaki, Aikaterini; Lianidou, Evi; Trypsianis, Grigorios; Kakolyris, Stylianos

    2016-07-01

    DNA methylation is the most frequent epigenetic alteration. Using methylation-specific polymerase chain reaction (MSP), the methylation status of the adenomatous polyposis coli ( APC ) and Ras association domain family 1 isoform A ( RASSF1A ) genes was examined in cell-free circulating DNA from 155 plasma samples obtained from patients with early and advanced colorectal cancer (CRC). APC and RASSF1A hypermethylation was frequently observed in both early and advanced disease, and was significantly associated with a poorer disease outcome. The methylation status of the APC and RASSF1A promoters was investigated in cell-free DNA of patients with CRC. Using MSP, the promoter methylation status of APC and RASSF1A was examined in 155 blood samples obtained from patients with CRC, 88 of whom had operable CRC (oCRC) and 67 had metastatic CRC (mCRC). The frequency of APC methylation in patients with oCRC was 33%. Methylated APC promoter was significantly associated with older age (P=0.012), higher stage (P=0.014) and methylated RASSF1A status (P=0.050). The frequency of APC methylation in patients with mCRC was 53.7%. In these patients, APC methylation was significantly associated with methylated RASSF1A status (P=0.016). The frequency of RASSF1A methylation in patients with oCRC was 25%. Methylated RASSF1A in oCRC was significantly associated with higher stage (P=0.021). The frequency of RASSF1A methylation in mCRC was 44.8%. Methylated RASSF1A in mCRC was associated with moderate differentiation (P=0.012), high levels of carcinoembryonic antigen (P=0.023) and methylated APC status (P=0.016). Patients with an unmethylated APC gene had better survival in both early (81±5 vs. 27±4 months, PAPC . Patients with an unmethylated RASSF1A gene had better survival in both early (71±6 vs. 46±8 months, PAPC and RASSF1A promoter methylation status and survival may be indicative of a prognostic role for these genes in CRC, which requires additional testing in larger studies.

  13. The role of hRev7, the accessory subunit of hPolζ, in translesion synthesis past DNA damage induced by benzo[a]pyrene diol epoxide (BPDE

    Directory of Open Access Journals (Sweden)

    Maher Veronica M

    2010-12-01

    Full Text Available Abstract Background DNA polymerase zeta (Polζ is a specialized DNA polymerase that, unlike classical replicative polymerases, is capable of replicating past DNA lesions, i.e. of performing translesion synthesis (TLS. The catalytic subunit of hPolζ, hRev3, has been shown to play a critical role in DNA damage-induced mutagenesis in human cells, but less is known about the role of hRev7, the accessory subunit of hPolζ, in such mutagenesis. To address this question, we recently generated human fibroblasts with very significantly reduced levels of hRev7 protein and demonstrated that hRev7 is required to protect cells from ultraviolet(254 nm (UV radiation-induced cytotoxicity and mutagenesis (McNally et al., DNA Repair 7 (2008 597-604. The goal of the present study was to determine whether hRev7 is similarly involved in the tolerance of DNA damage induced by benzo[a]pyrene diol epoxide (BPDE, the reactive form of the widespread environmental carcinogen benzo[a]pyrene. Methods To determine whether hRev7 also plays a role in protecting human cells from the cytotoxicity and mutagenesis induced by benzo[a]pyrene diol epoxide (BPDE, cell strains with reduced hRev7 were compared to their parental strain and a vector control strain for the effect of BPDE on cell survival, induction of mutations, and the ability to progress through the cell cycle. Results The results show that cell strains with reduced hRev7 are more sensitive to the cytotoxic effect of BPDE than the control strains, and progress through S-phase at a slower rate than the control cells following BPDE treatment, indicating that hRev7, and likely hPolζ, is required for efficient bypass of BPDE-induced DNA lesions. However, neither the frequency nor kinds of mutations induced by BPDE in cells with reduced hRev7 differ significantly from those induced in the control strains, suggesting that hPolζ is not essential for inserting nucleotides opposite BPDE-induced DNA damage. Conclusions Taken

  14. DNA-Controlled Assembly of Soft Nanoparticles

    DEFF Research Database (Denmark)

    Vogel, Stefan

    2015-01-01

    This book covers the emerging topic of DNA nanotechnology and DNA supramolecular chemistry in its broader sense. By taking DNA out of its biological role, this biomolecule has become a very versatile building block in materials chemistry, supramolecular chemistry and bio-nanotechnology. Many nove......-covalent systems, DNA origami, DNA based switches, DNA machines, and alternative structures and templates. This broad coverage is very appealing since it combines both the synthesis of modified DNA as well as designer concepts to successfully plan and make DNA nanostructures....

  15. DNA damage and polyploidization.

    Science.gov (United States)

    Chow, Jeremy; Poon, Randy Y C

    2010-01-01

    A growing body of evidence indicates that polyploidization triggers chromosomal instability and contributes to tumorigenesis. DNA damage is increasingly being recognized for its roles in promoting polyploidization. Although elegant mechanisms known as the DNA damage checkpoints are responsible for halting the cell cycle after DNA damage, agents that uncouple the checkpoints can induce unscheduled entry into mitosis. Likewise, defects of the checkpoints in several disorders permit mitotic entry even in the presence of DNA damage. Forcing cells with damaged DNA into mitosis causes severe chromosome segregation defects, including lagging chromosomes, chromosomal fragments and chromosomal bridges. The presence of these lesions in the cleavage plane is believed to abort cytokinesis. It is postulated that if cytokinesis failure is coupled with defects of the p53-dependent postmitotic checkpoint pathway, cells can enter S phase and become polyploids. Progress in the past several years has unraveled some of the underlying principles of these pathways and underscored the important role of DNA damage in polyploidization. Furthermore, polyploidization per se may also be an important determinant of sensitivity to DNA damage, thereby may offer an opportunity for novel therapies.

  16. DNA sequence analysis, expression, distribution, and physiological role of the Xaa-prolyldipeptidyl aminopeptidase gene from Lactobacillus helveticus CNRZ32.

    Science.gov (United States)

    Yüksel, G U; Steele, J L

    1996-02-01

    Lactobacillus helveticus CNRZ32 possesses an Xaa-prolyldipeptidyl aminopeptidase (PepX), which releases amino-terminal dipeptides from peptides containing proline residues in the penultimate position. The PepX gene, designated pepX, from Lb. helveticus CNRZ32 was sequenced. Analysis of the sequence identified a putative 2379-bp pepX open-reading frame, which encodes a polypeptide of 793 amino acid residues with a deduced molecular mass of 88,111 Da. The gene shows significant sequence identity with sequenced pepX genes from lactic acid bacteria. The product of the gene contains a motif that is almost identical with the active-site motif of the serine-dependent PepX from lactococci. The introduction of pepX into Lactococcus lactis LM0230 on either pGK12 (a low-copy-number plasmid vector) or pIL253 (a high-copy-number plasmid vector) did not result in a significant increase in PepX activity, while the introduction of pepX into CNRZ32 on pGK12 resulted in a four-fold increase in PepX activity. Southern hybridization experiments revealed that the pepX gene from CNRZ32 is well conserved in lactobacilli, pediococci and streptococci. The physiological role of PepX during growth in lactobacillus MRS (a rich medium containing protein hydrolysates along with other ingredients) and milk was examined by comparing growth of CNRZ32 and a CNRZ32 PepX-negative derivative. No difference in growth rate or acid production was observed between CNRZ32 and its PepX-negative derivative in MRS. However, the CNRZ32 PepX-negative derivative grew in milk at a reduced specific growth rate when compared to wild-type CNRZ32. Introduction of the cloned PepX determinant into the CNRZ32 PepX-negative derivative resulted in a construct with a specific growth rate similar to that of wild-type CNRZ32.

  17. The electrostatic role of the Zn-Cys2His2 complex in binding of operator DNA with transcription factors: mouse EGR-1 from the Cys2His2 family.

    Science.gov (United States)

    Chirgadze, Y N; Boshkova, E A; Polozov, R V; Sivozhelezov, V S; Dzyabchenko, A V; Kuzminsky, M B; Stepanenko, V A; Ivanov, V V

    2018-01-07

    The mouse factor Zif268, known also as early growth response protein EGR-1, is a classical representative for the Cys2His2 transcription factor family. It is required for binding the RNA polymerase with operator dsDNA to initialize the transcription process. We have shown that only in this family of total six Zn-finger protein families the Zn complex plays a significant role in the protein-DNA binding. Electrostatic feature of this complex in the binding of factor Zif268 from Mus musculus with operator DNA has been considered. The factor consists of three similar Zn-finger units which bind with triplets of coding DNA. Essential contacts of the factor with the DNA phosphates are formed by three conservative His residues, one in each finger. We describe here the results of calculations of the electrostatic potentials for the Zn-Cys2His2 complex, Zn-finger unit 1, and the whole transcription factor. The potential of Zif268 has a positive area on the factor surface, and it corresponds exactly to the binding sites of each of Zn-finger units. The main part of these areas is determined by conservative His residues, which form contacts with the DNA phosphate groups. Our result shows that the electrostatic positive potential of this histidine residue is enhanced due to the Zn complex. The other contacts of the Zn-finger with DNA are related to nucleotide bases, and they are responsible for the sequence-specific binding with DNA. This result may be extended to all other members of the Cys2His2 transcription factor family.

  18. Defects of mtDNA Replication Impaired Mitochondrial Biogenesis During Trypanosoma cruzi Infection in Human Cardiomyocytes and Chagasic Patients: The Role of Nrf1/2 and Antioxidant Response

    Science.gov (United States)

    Wan, Xianxiu; Gupta, Shivali; Zago, Maria P.; Davidson, Mercy M.; Dousset, Pierre; Amoroso, Alejandro; Garg, Nisha Jain

    2012-01-01

    Background Mitochondrial dysfunction is a key determinant in chagasic cardiomyopathy development in mice; however, its relevance in human Chagas disease is not known. We determined if defects in mitochondrial biogenesis and dysregulation of peroxisome proliferator-activated receptor gamma (PPARγ) coactivator-1 (PGC-1)–regulated transcriptional pathways constitute a mechanism or mechanisms underlying mitochondrial oxidative-phosphorylation (OXPHOS) deficiency in human Chagas disease. Methods and Results We utilized human cardiomyocytes and left-ventricular tissue from chagasic and other cardiomyopathy patients and healthy donors (n>6/group). We noted no change in citrate synthase activity, yet mRNA and/or protein levels of subunits of the respiratory complexes were significantly decreased in Trypanosoma cruzi–infected cardiomyocytes (0 to 24 hours) and chagasic hearts. We observed increased mRNA and decreased nuclear localization of PGC-1-coactivated transcription factors, yet the expression of genes for PPARγ-regulated fatty acid oxidation and nuclear respiratory factor (NRF1/2)–regulated mtDNA replication and transcription machinery was enhanced in infected cardiomyocytes and chagasic hearts. The D-loop formation was normal or higher, but mtDNA replication and mtDNA content were decreased by 83% and 40% to 65%, respectively. Subsequently, we noted that reactive oxygen species (ROS), oxidative stress, and mtDNA oxidation were significantly increased, yet NRF1/2-regulated antioxidant gene expression remained compromised in infected cardiomyocytes and chagasic hearts. Conclusions The replication of mtDNA was severely compromised, resulting in a significant loss of mtDNA and expression of OXPHOS genes in T cruzi–infected cardiomyocytes and chagasic hearts. Our data suggest increased ROS generation and selective functional incapacity of NRF2-mediated antioxidant gene expression played a role in the defects in mtDNA replication and unfitness of mtDNA for

  19. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  20. Distinct roles of FANCO/RAD51C in DNA damage signaling and repair: implications for fanconi anemia and breast cancer susceptibility

    International Nuclear Information System (INIS)

    Nagaraju, G.; Somyajit, K.; Subramanya, S.

    2012-01-01

    Unrepaired or misrepaired chromosomal double-strand breaks (DSBs) can cause gross chromosomal rearrangements which eventually can lead to tumorigenesis through inactivation of tumor suppressor genes or activation of oncogenes. There are two major mechanisms of DSB repair: non-homologous end joining (NHEJ) and homologous recombination (HR). DSBs that are generated during S and G2 phase of the cell are preferentially repaired by sister chromatid recombination (SCR), an HR pathway that utilizes neighboring sister chromatid as a template. Since the copied information is accurate, SCR is potentially an error-free pathway. HR also plays a critical role in the repair of daughter strand gaps (DSGs) that arise as a result of replication fork stalling and facilitates replication fork recovery. Furthermore, in collaboration with nucleotide excision repair and translesion synthesis, HR is involved in the repair of DNA interstrand cross-links (ICLs). Thus, HR is important for the maintenance of genome integrity and its dysfunction can lead to various genetic disorders and cancer

  1. Colombian forensic genetics as a form of public science: The role of race, nation and common sense in the stabilization of DNA populations.

    Science.gov (United States)

    Schwartz-Marín, Ernesto; Wade, Peter; Cruz-Santiago, Arely; Cárdenas, Roosbelinda

    2015-12-01

    Abstract This article examines the role that vernacular notions of racialized-regional difference play in the constitution and stabilization of DNA populations in Colombian forensic science, in what we frame as a process of public science. In public science, the imaginations of the scientific world and common-sense public knowledge are integral to the production and circulation of science itself. We explore the origins and circulation of a scientific object--'La Tabla', published in Paredes et al. and used in genetic forensic identification procedures--among genetic research institutes, forensic genetics laboratories and courtrooms in Bogotá. We unveil the double life of this central object of forensic genetics. On the one hand, La Tabla enjoys an indisputable public place in the processing of forensic genetic evidence in Colombia (paternity cases, identification of bodies, etc.). On the other hand, the relations it establishes between 'race', geography and genetics are questioned among population geneticists in Colombia. Although forensic technicians are aware of the disputes among population geneticists, they use and endorse the relations established between genetics, 'race' and geography because these fit with common-sense notions of visible bodily difference and the regionalization of race in the Colombian nation.

  2. Colombian forensic genetics as a form of public science: The role of race, nation and common sense in the stabilization of DNA populations

    Science.gov (United States)

    Schwartz-Marín, Ernesto; Wade, Peter; Cruz-Santiago, Arely; Cárdenas, Roosbelinda

    2015-01-01

    This article examines the role that vernacular notions of racialized-regional difference play in the constitution and stabilization of DNA populations in Colombian forensic science, in what we frame as a process of public science. In public science, the imaginations of the scientific world and common-sense public knowledge are integral to the production and circulation of science itself. We explore the origins and circulation of a scientific object – ‘La Tabla’, published in Paredes et al. and used in genetic forensic identification procedures – among genetic research institutes, forensic genetics laboratories and courtrooms in Bogotá. We unveil the double life of this central object of forensic genetics. On the one hand, La Tabla enjoys an indisputable public place in the processing of forensic genetic evidence in Colombia (paternity cases, identification of bodies, etc.). On the other hand, the relations it establishes between ‘race’, geography and genetics are questioned among population geneticists in Colombia. Although forensic technicians are aware of the disputes among population geneticists, they use and endorse the relations established between genetics, ‘race’ and geography because these fit with common-sense notions of visible bodily difference and the regionalization of race in the Colombian nation. PMID:27480000

  3. Bioactivation of carboxylic acid compounds by UDP-Glucuronosyltransferases to DNA-damaging intermediates: role of glycoxidation and oxidative stress in genotoxicity.

    Science.gov (United States)

    Sallustio, Benedetta C; Degraaf, Yvette C; Weekley, Josephine S; Burcham, Philip C

    2006-05-01

    Nonenzymatic modification of proteins by acyl glucuronides is well documented; however, little is known about their potential to damage DNA. We have previously reported that clofibric acid undergoes glucuronidation-dependent bioactivation to DNA-damaging species in cultured mouse hepatocytes. The aim of this study was to investigate the mechanisms underlying such DNA damage, and to screen chemically diverse carboxylic acid drugs for their DNA-damaging potential in glucuronidation proficient murine hepatocytes. Cells were incubated with each aglycone for 18 h, followed by assessment of compound cytotoxicity using the MTT assay and evaluation of DNA damage using the Comet assay. Relative cytotoxic potencies were ketoprofen > diclofenac, benoxaprofen, nafenopin > gemfibrozil, probenecid > bezafibrate > clofibric acid. At a noncytotoxic (0.1 mM) concentration, only benoxaprofen, nafenopin, clofibric acid, and probenecid significantly increased Comet moments (P Clofibric acid and probenecid exhibited the greatest DNA-damaging potency, producing significant DNA damage at 0.01 mM concentrations. The two drugs produced maximal increases in Comet moment of 4.51 x and 2.57 x control, respectively. The glucuronidation inhibitor borneol (1 mM) abolished the induction of DNA damage by 0.5 mM concentrations of clofibric acid and probenecid. In an in vitro cell-free system, clofibric acid glucuronide was 10 x more potent than glucuronic acid in causing DNA strand-nicking, although both compounds showed similar rates of autoxidation to generate hydroxyl radicals. In cultured hepatocytes, the glycation inhibitor, aminoguanidine, and the iron chelator, desferrioxamine mesylate, inhibited DNA damage by clofibric acid, whereas the free radical scavengers Trolox and butylated hydroxytoluene, and the superoxide dismutase mimetic bis-3,5-diisopropylsalicylate had no effect. In conclusion, clinically relevant concentrations of two structurally unrelated carboxylic acids, probenecid and

  4. Radiobiological significance of DNA repair

    International Nuclear Information System (INIS)

    Kuzin, A.M.

    1978-01-01

    A short outline is given on the history of the problem relating to the repair of radiation injuries, specifically its molecular mechanisms. The most urgent problems which currently confront the researchers are noted. This is a further study on the role of DNA repair in post-radiation recovery, search for ways to activate and suppress DNA repair, investigations into the activity balance of various repair enzymes as well as the problem of errors in the structure of repairing DNA. An important role is attached to the investigations of DNA repair in solving a number of practical problems

  5. DNA synthesis and degradation in UV-irradiated toluene treated cells of E. coli K12: the role of polynucleotide ligase

    International Nuclear Information System (INIS)

    Strike, P.

    1977-01-01

    Toluene treated cells have been used to study the processes of DNA synthesis and DNA degradation in ultra-violet irradiated Escherichia coli K12. Synthesis and degradation are both shown to occur extensively if polynucleotide ligase is inhibited, and to occur to a much lesser extent if ligase activity is optimal. Extensive UV-induced DNA synthesis in toluene-treated cells requires ATP for the initial incision step, and DNA polymerase I. Extensive degradation also depends on the early ATP-dependent incision step, and the subsequent degradation shows a partial requirement for ATP. Curtailment of degradation by ligase requires DNA polymerase activity, but is not dependent upon DNA polymerase I. Apparently this process can be carried out with equal facility by either DNA polymerase II or polymerase III. These observations suggest that extensive DNA polymerase I-dependent repair synthesis and extensive DNA degradation are facets of two divergent pathways of excision repair, both of which depend upon the early uvrABC determined ATP-dependent incision step. (orig.) [de

  6. Ocular manifestations of xeroderma pigmentosum: long term follow-up highlights the role of DNA repair in protection from sun damage

    Science.gov (United States)

    Brooks, Brian P; Thompson, Amy H; Bishop, Rachel J; Clayton, Janine A; Chan, Chi-Chao; Tsilou, Ekaterini T; Zein, Wadih M; Tamura, Deborah; Khan, Sikandar G.; Ueda, Takahiro; Boyle, Jennifer; Oh, Kyu-Seon; Imoto, Kyoko; Inui, Hiroki; Moriwaki, Shin-Ichi; Emmert, Steffen; Iliff, Nicholas T.; Bradford, Porcia; DiGiovanna, John J.; Kraemer, Kenneth H

    2013-01-01

    the ocular surface and eyelids, tear film and tear production abnormalities, ocular surface disease and inflammation, as well as corneal abnormalities were present in this population. Burning and non-burning XP patients exhibit different rates of important ophthalmologic findings, including neoplasia. Additionally, ophthalmic characteristics can help refine diagnoses in the case of XP complex phenotypes. DNA repair plays major role in protection of the eye from sunlight induced damage. PMID:23601806

  7. The dynamic interplay between DNA topoisomerases and DNA topology.

    Science.gov (United States)

    Seol, Yeonee; Neuman, Keir C

    2016-11-01

    Topological properties of DNA influence its structure and biochemical interactions. Within the cell, DNA topology is constantly in flux. Transcription and other essential processes, including DNA replication and repair, not only alter the topology of the genome but also introduce additional complications associated with DNA knotting and catenation. These topological perturbations are counteracted by the action of topoisomerases, a specialized class of highly conserved and essential enzymes that actively regulate the topological state of the genome. This dynamic interplay among DNA topology, DNA processing enzymes, and DNA topoisomerases is a pervasive factor that influences DNA metabolism in vivo. Building on the extensive structural and biochemical characterization over the past four decades that has established the fundamental mechanistic basis of topoisomerase activity, scientists have begun to explore the unique roles played by DNA topology in modulating and influencing the activity of topoisomerases. In this review we survey established and emerging DNA topology-dependent protein-DNA interactions with a focus on in vitro measurements of the dynamic interplay between DNA topology and topoisomerase activity.

  8. DNA repair , cell repair and radiosensitivity

    International Nuclear Information System (INIS)

    Zhestyanikov, V.D.

    1983-01-01

    Data obtained in laboratory of radiation cytology and literature data testifying to a considerable role of DNA repair in cell sensitivity to radiation and chemical DNA-tropic agents have been considered. Data pointing to the probability of contribution of inducible repair of DNA into plant cells sensitivity to X-rays are obtained. Certain violations of DNA repair do not result in the increase of radiosensitivity. It is assumed that in the cases unknown mechanisms of DNA repair operate

  9. Important role of the nucleotide excision repair pathway in Mycobacterium smegmatis in conferring protection against commonly encountered DNA-damaging agents.

    Science.gov (United States)

    Kurthkoti, Krishna; Kumar, Pradeep; Jain, Ruchi; Varshney, Umesh

    2008-09-01

    Mycobacteria are an important group of human pathogens. Although the DNA repair mechanisms in mycobacteria are not well understood, these are vital for the pathogen's persistence in the host macrophages. In this study, we generated a null mutation in the uvrB gene of Mycobacterium smegmatis to allow us to compare the significance of the nucleotide excision repair (NER) pathway with two important base excision repair pathways, initiated by uracil DNA glycosylase (Ung) and formamidopyrimidine DNA glycosylase (Fpg or MutM), in an isogenic strain background. The strain deficient in NER was the most sensitive to commonly encountered DNA-damaging agents such as UV, low pH, reactive oxygen species, hypoxia, and was also sensitive to acidified nitrite. Taken together with previous observations on NER-deficient M. tuberculosis, these results suggest that NER is an important DNA repair pathway in mycobacteria.

  10. DNA methylation and memory formation.

    Science.gov (United States)

    Day, Jeremy J; Sweatt, J David

    2010-11-01

    Memory formation and storage require long-lasting changes in memory-related neuronal circuits. Recent evidence indicates that DNA methylation may serve as a contributing mechanism in memory formation and storage. These emerging findings suggest a role for an epigenetic mechanism in learning and long-term memory maintenance and raise apparent conundrums and questions. For example, it is unclear how DNA methylation might be reversed during the formation of a memory, how changes in DNA methylation alter neuronal function to promote memory formation, and how DNA methylation patterns differ between neuronal structures to enable both consolidation and storage of memories. Here we evaluate the existing evidence supporting a role for DNA methylation in memory, discuss how DNA methylation may affect genetic and neuronal function to contribute to behavior, propose several future directions for the emerging subfield of neuroepigenetics, and begin to address some of the broader implications of this work.

  11. Structural aspects of DNA in its replication and repair

    International Nuclear Information System (INIS)

    Mitra, S.; Pal, B.C.; Foote, R.S.; Bates, R.C.; Bhattacharyya, A.; Snow, E.T.; Wobbe, C.R.; Morse, C.C.; Snyder, C.E.

    1984-01-01

    The research objective of this laboratory is to investigate the structure of DNA, the mechanism of DNA replication and its regulation, and the mechanism and role of repair of the altered DNA in the expression of heritable changes. This research has two broad aims, namely investigation of (a) the regulation of DNA replication in mammals, using parvovirus DNA as a model system and (b) the role of DNA repair in mutagenesis and carcinogenesis induced by simple alkylating mutagens

  12. Mitochondrial DNA repair and aging

    International Nuclear Information System (INIS)

    Mandavilli, Bhaskar S.; Santos, Janine H.; Van Houten, Bennett

    2002-01-01

    The mitochondrial electron transport chain plays an important role in energy production in aerobic organisms and is also a significant source of reactive oxygen species that damage DNA, RNA and proteins in the cell. Oxidative damage to the mitochondrial DNA is implicated in various degenerative diseases, cancer and aging. The importance of mitochondrial ROS in age-related degenerative diseases is further strengthened by studies using animal models, Caenorhabditis elegans, Drosophila and yeast. Research in the last several years shows that mitochondrial DNA is more susceptible to various carcinogens and ROS when compared to nuclear DNA. DNA damage in mammalian mitochondria is repaired by base excision repair (BER). Studies have shown that mitochondria contain all the enzymes required for BER. Mitochondrial DNA damage, if not repaired, leads to disruption of electron transport chain and production of more ROS. This vicious cycle of ROS production and mtDNA damage ultimately leads to energy depletion in the cell and apoptosis

  13. Mitochondrial DNA repair and aging

    Energy Technology Data Exchange (ETDEWEB)

    Mandavilli, Bhaskar S.; Santos, Janine H.; Van Houten, Bennett

    2002-11-30

    The mitochondrial electron transport chain plays an important role in energy production in aerobic organisms and is also a significant source of reactive oxygen species that damage DNA, RNA and proteins in the cell. Oxidative damage to the mitochondrial DNA is implicated in various degenerative diseases, cancer and aging. The importance of mitochondrial ROS in age-related degenerative diseases is further strengthened by studies using animal models, Caenorhabditis elegans, Drosophila and yeast. Research in the last several years shows that mitochondrial DNA is more susceptible to various carcinogens and ROS when compared to nuclear DNA. DNA damage in mammalian mitochondria is repaired by base excision repair (BER). Studies have shown that mitochondria contain all the enzymes required for BER. Mitochondrial DNA damage, if not repaired, leads to disruption of electron transport chain and production of more ROS. This vicious cycle of ROS production and mtDNA damage ultimately leads to energy depletion in the cell and apoptosis.

  14. Novel roles for MLH3 deficiency and TLE6-like amplification in DNA mismatch repair-deficient gastrointestinal tumorigenesis and progression.

    Directory of Open Access Journals (Sweden)

    Peng-Chieh Chen

    2008-06-01

    Full Text Available DNA mismatch repair suppresses gastrointestinal tumorgenesis. Four mammalian E. coli MutL homologues heterodimerize to form three distinct complexes: MLH1/PMS2, MLH1/MLH3, and MLH1/PMS1. To understand the mechanistic contributions of MLH3 and PMS2 in gastrointestinal tumor suppression, we generated Mlh3(-/-;Apc(1638N and Mlh3(-/-;Pms2(-/-;Apc(1638N (MPA mice. Mlh3 nullizygosity significantly increased Apc frameshift mutations and tumor multiplicity. Combined Mlh3;Pms2 nullizygosity further increased Apc base-substitution mutations. The spectrum of MPA tumor mutations was distinct from that observed in Mlh1(-/-;Apc(1638N mice, implicating the first potential role for MLH1/PMS1 in tumor suppression. Because Mlh3;Pms2 deficiency also increased gastrointestinal tumor progression, we used array-CGH to identify a recurrent tumor amplicon. This amplicon contained a previously uncharacterized Transducin enhancer of Split (Tle family gene, Tle6-like. Expression of Tle6-like, or the similar human TLE6D splice isoform in colon cancer cells increased cell proliferation, colony-formation, cell migration, and xenograft tumorgenicity. Tle6-like;TLE6D directly interact with the gastrointestinal tumor suppressor RUNX3 and antagonize RUNX3 target transactivation. TLE6D is recurrently overexpressed in human colorectal cancers and TLE6D expression correlates with RUNX3 expression. Collectively, these findings provide important insights into the molecular mechanisms of individual MutL homologue tumor suppression and demonstrate an association between TLE mediated antagonism of RUNX3 and accelerated human colorectal cancer progression.

  15. Smad mediated regulation of inhibitor of DNA binding 2 and its role in phenotypic maintenance of human renal proximal tubule epithelial cells.

    Directory of Open Access Journals (Sweden)

    Mangalakumar Veerasamy

    Full Text Available The basic-Helix-Loop-Helix family (bHLH of transcriptional factors plays a major role in regulating cellular proliferation, differentiation and phenotype maintenance. The downregulation of one of the members of bHLH family protein, inhibitor of DNA binding 2 (Id2 has been shown to induce de-differentiation of epithelial cells. Opposing regulators of epithelial/mesenchymal phenotype in renal proximal tubule epithelial cells (PTEC, TGFβ1 and BMP7 also have counter-regulatory effects in models of renal fibrosis. We investigated the regulation of Id2 by these growth factors in human PTECs and its implication in the expression of markers of epithelial versus myofibroblastic phenotype. Cellular Id2 levels were reduced by TGFβ1 treatment; this was prevented by co-incubation with BMP7. BMP7 alone increased cellular levels of Id2. TGFβ1 and BMP7 regulated Id2 through Smad2/3 and Smad1/5 dependent mechanisms respectively. TGFβ1 mediated Id2 suppression was essential for α-SMA induction in PTECs. Although Id2 over-expression prevented α-SMA induction, it did not prevent E-cadherin loss under the influence of TGFβ1. This suggests that the loss of gate keeper function of E-cadherin alone may not necessarily result in complete EMT and further transcriptional re-programming is essential to attain mesenchymal phenotype. Although BMP7 abolished TGFβ1 mediated α-SMA expression by restoring Id2 levels, the loss of Id2 was not sufficient to induce α-SMA expression even in the context of reduced E-cadherin expression. Hence, a reduction in Id2 is critical for TGFβ1-induced α-SMA expression in this model of human PTECs but is not sufficient in it self to induce α-SMA even in the context of reduced E-cadherin.

  16. DNA Camouflage

    Science.gov (United States)

    2016-01-08

    1 DNA Camouflage Supplementary Information Bijan Zakeri1,2*, Timothy K. Lu1,2*, Peter A. Carr2,3* 1Department of Electrical Engineering and...ll.mit.edu). Distribution A: Public Release   2 Supplementary Figure 1 DNA camouflage with the 2-state device. (a) In the presence of Cre, DSD-2[α...10 1 + Cre 1 500 1,000 length (bp) chromatogram alignment template − Cre   4 Supplementary Figure 3 DNA camouflage with a switchable

  17. Replication of bacteriophage lambda DNA

    International Nuclear Information System (INIS)

    Tsurimoto, T.; Matsubara, K.

    1983-01-01

    In this paper results of studies on the mechanism of bacteriophage lambda replication using molecular biological and biochemical approaches are reported. The purification of the initiator proteins, O and P, and the role of the O and P proteins in the initiation of lambda DNA replication through interactions with specific DNA sequences are described. 47 references, 15 figures

  18. Role of DNA Methylation in Altering Gene Expression During the Early Stages of Human Breast Cancer Progression in the MCF10AT Xenograft Model

    National Research Council Canada - National Science Library

    Christman, Judith

    2004-01-01

    ...) Collect microdissected tissue representative of each of the morphologically different stages of early breast cancer progression in the MCFlOAT model to obtain RNA and DNA for miroarray analysis...

  19. Role of Cell Cycle Regulation and MLH1, A Key DNA Mismatch Repair Protein, In Adaptive Survival Responses. Final Report; FINAL

    International Nuclear Information System (INIS)

    David A. Boothman

    1999-01-01

    Due to several interesting findings on both adaptive survival responses (ASRs) and DNA mismatch repair (MMR), this grant was separated into two discrete Specific Aim sets (each with their own discrete hypotheses). The described experiments were simultaneously performed

  20. Role of baseline HIV-1 DNA level in highly-experienced patients receiving raltegravir, etravirine and darunavir/ritonavir regimen (ANRS139 TRIO trial.

    Directory of Open Access Journals (Sweden)

    Charlotte Charpentier

    Full Text Available OBJECTIVE: In the ANRS 139 TRIO trial, the use of 3 new active drugs (raltegravir, etravirine, and darunavir/ritonavir, resulted in a potent and sustained inhibition of viral replication in multidrug-resistant treatment-experienced patients. The aim of this virological sub-study of the ANRS 139 TRIO trial was to assess: (i the evolution of HIV-1 DNA over the first year; and (ii the association between baseline HIV-1 DNA and virological outcome. METHODS: Among the 103 HIV-1-infected patients included in the ANRS-139 TRIO trial, HIV-1 DNA specimens were available for 92, 84, 88, and 83 patients at Week (W0, W12, W24, and W48, respectively. Quantification of total HIV-1 DNA was performed by using the commercial kit "Generic HIV DNA Cell" (Biocentric, Bandol, France. RESULTS: Baseline median HIV-1 DNA of patients displaying virological success (n= 61, viral blip (n= 20, and virological failure (n = 11 were 2.34 log(10 copies/10(6 PBMC (IQR= 2.15-2.66, 2.42 (IQR = 2.12-2.48, and 2.68 (IQR= 2.46-2.83, respectively. Although not statistically significant, patients exhibiting virological success or viral blip had a tendency to display lower baseline HIV-1 DNA than patients experiencing virological failure (P = 0.06. Median decrease of HIV-1 DNA between baseline and W48 was -0.13 log(10 copies/10(6 PBMC (IQR = -0.34 to +0.10, mainly explained by the evolution from W0 to W4. No more changes were observed in the W4-W48 period. CONCLUSIONS: In highly-experienced multidrug-resistant patients, HIV-1 DNA slightly decreased during the first month and then remained stable during the first year of highly potent antiretroviral regimen. In this population, baseline HIV-1 DNA might help to better predict the virological response and to tailor clinical therapeutic management as more aggressive therapeutic choices in patients with higher baseline HIV-1 DNA.

  1. Role of isolated and clustered DNA damage and the post-irradiating repair process in the effects of heavy ion beam irradiation

    International Nuclear Information System (INIS)

    Tokuyama, Yuka; Terato, Hiroaki; Furusawa, Yoshiya; Ide, Hiroshi; Yasui, Akira

    2015-01-01

    Clustered DNA damage is a specific type of DNA damage induced by ionizing radiation. Any type of ionizing radiation traverses the target DNA molecule as a beam, inducing damage along its track. Our previous study showed that clustered DNA damage yields decreased with increased linear energy transfer (LET), leading us to investigate the importance of clustered DNA damage in the biological effects of heavy ion beam radiation. In this study, we analyzed the yield of clustered base damage (comprising multiple base lesions) in cultured cells irradiated with various heavy ion beams, and investigated isolated base damage and the repair process in post-irradiation cultured cells. Chinese hamster ovary (CHO) cells were irradiated by carbon, silicon, argon and iron ion beams with LETs of 13, 55, 90 and 200 keV µm -1 , respectively. Agarose gel electrophoresis of the cells with enzymatic treatments indicated that clustered base damage yields decreased as the LET increased. The aldehyde reactive probe procedure showed that isolated base damage yields in the irradiated cells followed the same pattern. To analyze the cellular base damage process, clustered DNA damage repair was investigated using DNA repair mutant cells. DNA double-strand breaks accumulated in CHO mutant cells lacking Xrcc1 after irradiation, and the cell viability decreased. On the other hand, mouse embryonic fibroblast (Mef) cells lacking both Nth1 and Ogg1 became more resistant than the wild type Mef. Thus, clustered base damage seems to be involved in the expression of heavy ion beam biological effects via the repair process. (author)

  2. The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: direct observation of desorption and layer reorientation.

    Science.gov (United States)

    Arinaga, K; Rant, U; Tornow, M; Fujita, S; Abstreiter, G; Yokoyama, N

    2006-06-20

    We study the coadsorption of mercaptohexanol onto preimmobilized oligonucleotide layers on gold. Monitoring the position of the DNA relative to the surface by optical means directly shows the mercaptohexanol-induced desorption of DNA and the reorientation of surface-tethered strands in situ and in real time. By simultaneously recording the electrochemical electrode potential, we are able to demonstrate that changes in the layer conformation are predominantly of electrostatic origin and can be reversed by applying external bias to the substrate.

  3. DNA glue

    DEFF Research Database (Denmark)

    Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.

    2008-01-01

    Significant alterations in thermal stability of parallel DNA triplexes and antiparallel duplexes were observed upon changing the attachment of ethynylpyrenes from para to ortho in the structure of phenylmethylglycerol inserted as a bulge into DNA (TINA). Insertions of two ortho-TINAs as a pseudo...

  4. Hyperstretching DNA

    NARCIS (Netherlands)

    Schakenraad, Koen; Biebricher, Andreas S.; Sebregts, Maarten; Ten Bensel, Brian; Peterman, Erwin J.G.; Wuite, Gijs J L; Heller, Iddo; Storm, Cornelis; Van Der Schoot, Paul

    2017-01-01

    The three-dimensional structure of DNA is highly susceptible to changes by mechanical and biochemical cues in vivo and in vitro. In particular, large increases in base pair spacing compared to regular B-DNA are effected by mechanical (over)stretching and by intercalation of compounds that are widely

  5. The role of reactive oxygen species (ROS and cytochrome P-450 2E1 in the generation of carcinogenic etheno-DNA adducts

    Directory of Open Access Journals (Sweden)

    Kirsten Linhart

    2014-01-01

    Full Text Available Exocyclic etheno-DNA adducts are mutagenic and carcinogenic and are formed by the reaction of lipidperoxidation (LPO products such as 4-hydoxynonenal or malondialdehyde with DNA bases. LPO products are generated either via inflammation driven oxidative stress or via the induction of cytochrome P-450 2E1 (CYP2E1. In the liver CYP2E1 is induced by various compounds including free fatty acids, acetone and ethanol. Increased levels of CYP2E1 and thus, oxidative stress are observed in the liver of patients with non-alcoholic steatohepatitis (NASH as well as in the chronic alcoholic. In addition, chronic ethanol ingestion also increases CYP2E1 in the mucosa of the oesophagus and colon. In all these tissues CYP2E1 correlates significantly with the levels of carcinogenic etheno-DNA adducts. In contrast, in patients with non-alcoholic steatohepatitis (NASH hepatic etheno-DNA adducts do not correlate with CYP2E1 indicating that in NASH etheno-DNA adducts formation is predominately driven by inflammation rather than by CYP2E1 induction. Since etheno-DNA adducts are strong mutagens producing various types of base pair substitution mutations as well as other types of genetic damage, it is strongly believed that they are involved in ethanol mediated carcinogenesis primarily driven by the induction of CYP2E1.

  6. MCM interference during licensing of DNA replication in Xenopus egg extracts-Possible Role of a C-terminal region of MCM3.

    Science.gov (United States)

    Mimura, Satoru; Kubota, Yumiko; Takisawa, Haruhiko

    2018-01-01

    The minichromosome maintenance (MCM) complex, consisting of six subunits, Mcm2-7, is loaded onto replication origins through loading factors (origin recognition complex [ORC], Cdc6, and Cdt1) and forms an MCM double hexamer that licenses the initiation of DNA replication. Previous studies with Xenopus egg extracts showed that loading factors, especially Cdc6, dissociate from chromatin on MCM loading, but the molecular mechanism and physiological significance remain largely unknown. Using a cell-free system for MCM loading onto plasmid DNA in Xenopus egg extracts, we found that MCM loaded onto DNA prevents DNA binding of the loading factors ORC, Cdc6, and Cdt1. We further report that a peptide of the C-terminal region of MCM3 (MCM3-C), previously implicated in the initial association with ORC/Cdc6 in budding yeast, prevents ORC/Cdc6/Cdt1 binding to DNA in the absence of MCM loading. ATP-γ-S suppresses inhibitory activities of both the MCM loaded onto DNA and the MCM3-C peptide. Other soluble factors in the extract, but neither MCM nor Cdt1, are required for the activity. Conservation of the amino acid sequences of MCM3-C and its activity in vertebrates implies a novel negative autoregulatory mechanism that interferes with MCM loading in the vicinity of licensed origins to ensure proper origin licensing.

  7. RAD51 interconnects between DNA replication, DNA repair and immunity.

    Science.gov (United States)

    Bhattacharya, Souparno; Srinivasan, Kalayarasan; Abdisalaam, Salim; Su, Fengtao; Raj, Prithvi; Dozmorov, Igor; Mishra, Ritu; Wakeland, Edward K; Ghose, Subroto; Mukherjee, Shibani; Asaithamby, Aroumougame

    2017-05-05

    RAD51, a multifunctional protein, plays a central role in DNA replication and homologous recombination repair, and is known to be involved in cancer development. We identified a novel role for RAD51 in innate immune response signaling. Defects in RAD51 lead to the accumulation of self-DNA in the cytoplasm, triggering a STING-mediated innate immune response after replication stress and DNA damage. In the absence of RAD51, the unprotected newly replicated genome is degraded by the exonuclease activity of MRE11, and the fragmented nascent DNA accumulates in the cytosol, initiating an innate immune response. Our data suggest that in addition to playing roles in homologous recombination-mediated DNA double-strand break repair and replication fork processing, RAD51 is also implicated in the suppression of innate immunity. Thus, our study reveals a previously uncharacterized role of RAD51 in initiating immune signaling, placing it at the hub of new interconnections between DNA replication, DNA repair, and immunity. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. DNA probes

    International Nuclear Information System (INIS)

    Castelino, J.

    1992-01-01

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  9. DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Castelino, J

    1993-12-31

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with {sup 32}P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism`s genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens 10 figs, 2 tabs

  10. Extracellular DNA metabolism in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Scott eChimileski

    2014-02-01

    Full Text Available Extracellular DNA is found in all environments and is a dynamic component of the micro-bial ecosystem. Microbial cells produce and interact with extracellular DNA through many endogenous mechanisms. Extracellular DNA is processed and internalized for use as genetic information and as a major source of macronutrients, and plays several key roles within prokaryotic biofilms. Hypersaline sites contain some of the highest extracellular DNA con-centrations measured in nature–a potential rich source of carbon, nitrogen and phosphorus for halophilic microorganisms. We conducted DNA growth studies for the halophilic archaeon Haloferax volcanii DS2 and show that this model Halobacteriales strain is capable of using exogenous double-stranded DNA as a nutrient. Further experiments with varying medium composition, DNA concentration and DNA types revealed that DNA is utilized primarily as a phosphorus source, that growth on DNA is concentration-dependent and that DNA isolated from different sources is metabolized selectively, with a bias against highly divergent methylated DNA sources. Additionally, fluorescence microscopy experiments showed that labeled DNA colocalized with Haloferax volcanii cells. The gene Hvo_1477 was also identified using a comparative genomic approach as a factor likely to be involved in extracellular DNA processing at the cell surface, and deletion of Hvo_1477 created an H. volcanii strain deficient in its ability to grow on extracellular DNA. Widespread distribution of Hvo_1477 homologs in archaea suggests metabolism of extracellular DNA may be of broad ecological and physiological relevance in this domain of life.

  11. DNA adducts as molecular dosimeters

    International Nuclear Information System (INIS)

    Lucier, G.W.

    1990-01-01

    There is compelling evidence that DNA adducts play an important role in the actions of many pulmonary carcinogens. During the last ten years sensitive methods (antibodies and 32 P-postlabeling) have been developed that permit detection of DNA adducts in tissues of animals or humans exposed to low levels of some genotoxic carcinogens. This capability has led to approaches designed to more reliably estimate the shape of the dose-response curve in the low dose region for a few carcinogens. Moreover, dosimetry comparisions can, in some cases, be made between animals and humans which help in judging the adequacy of animal models for human risk assessments. There are several points that need to be considered in the evaluation of DNA adducts as a molecular dosimeter. For example, DNA adduct formation is only one of many events that are needed for tumor development and some potent carcinogens do not form DNA adducts; i.e., TCDD. Other issues that need to be considered are DNA adduct heterogeneity, DNA repair, relationship of DNA adducts to somatic mutation and cell specificity in DNA adduct formation and persistence. Molecular epidemiology studies often require quantitation of adducts in cells such as lymphocytes which may or may not be reliable surrogates for adduct concentrations in target issues. In summary, accurate quantitation of low levels of DNA adducts may provide data useful in species to species extrapolation of risk including the development of more meaningful human monitoring programs

  12. Potential roles of DNA methylation in the initiation and establishment of replicative senescence revealed by array-based methylome and transcriptome analyses.

    Directory of Open Access Journals (Sweden)

    Mizuho Sakaki

    Full Text Available Cellular senescence is classified into two groups: replicative and premature senescence. Gene expression and epigenetic changes are reported to differ between these two groups and cell types. Normal human diploid fibroblast TIG-3 cells have often been used in cellular senescence research; however, their epigenetic profiles are still not fully understood. To elucidate how cellular senescence is epigenetically regulated in TIG-3 cells, we analyzed the gene expression and DNA methylation profiles of three types of senescent cells, namely, replicatively senescent, ras-induced senescent (RIS, and non-permissive temperature-induced senescent SVts8 cells, using gene expression and DNA methylation microarrays. The expression of genes involved in the cell cycle and immune response was commonly either down- or up-regulated in the three types of senescent cells, respectively. The altered DNA methylation patterns were observed in replicatively senescent cells, but not in prematurely senescent cells. Interestingly, hypomethylated CpG sites detected on non-CpG island regions ("open sea" were enriched in immune response-related genes that had non-CpG island promoters. The integrated analysis of gene expression and methylation in replicatively senescent cells demonstrated that differentially expressed 867 genes, including cell cycle- and immune response-related genes, were associated with DNA methylation changes in CpG sites close to the transcription start sites (TSSs. Furthermore, several miRNAs regulated in part through DNA methylation were found to affect the expression of their targeted genes. Taken together, these results indicate that the epigenetic changes of DNA methylation regulate the expression of a certain portion of genes and partly contribute to the introduction and establishment of replicative senescence.

  13. Minimal traumatic brain injury causes persistent changes in DNA methylation at BDNF gene promoters in rat amygdala: A possible role in anxiety-like behaviors.

    Science.gov (United States)

    Sagarkar, Sneha; Bhamburkar, Tanmayi; Shelkar, Gajanan; Choudhary, Amit; Kokare, Dadasaheb M; Sakharkar, Amul J

    2017-10-01

    Minimal traumatic brain injury (MTBI) often transforms into chronic neuropsychiatric conditions including anxiety, the underlying mechanisms of which are largely unknown. In the present study, we employed the closed-head injury paradigm to induce MTBI in rats and examined whether DNA methylation can explain long-term changes in the expression of the brain-derived neurotrophic factor (BDNF) in the amygdala as well as trauma-induced anxiety-like behaviors. The MTBI caused anxiety-like behaviors and altered the expression of DNA methyltransferase (DNMT) isoforms (DNMT1, DNMT3a, and DNMT3b) and factors involved in DNA demethylation such as the growth arrest and DNA damage 45 (GADD45a and GADD45b). After 30days of MTBI, the over-expression of DNMT3a and DNMT3b corresponded to heightened DNMT activity, whereas the mRNA levels of GADD45a and GADD45b were declined. The methylated cytosine levels at the BDNF promoters (Ip, IVp and IXp) were increased in the amygdala of the trauma-induced animals; these coincided negatively with the mRNA levels of exon IV and IXa, but not of exon I. Interestingly, treatment with 5-azacytidine, a pan DNMT inhibitor, normalized the MTBI-induced DNMT activity and DNA hypermethylation at exon IVp and IXp. Furthermore, 5-azacytidine also corrected the deficits in the expression of exons IV and IXa and reduced the anxiety-like behaviors. These results suggest that the DNMT-mediated DNA methylation at the BDNF IVp and IXp might be involved in the regulation of BDNF gene expression in the amygdala. Further, it could also be related to MTBI-induced anxiety-like behaviors via the regulation of synaptic plasticity. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. DNA data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Raw DNA chromatogram data produced by the ABI 373, 377, 3130 and 3730 automated sequencing machines in ABI format. These are from fish (primarily Sebastes spp.,...

  15. DNA nanotechnology

    Science.gov (United States)

    Seeman, Nadrian C.; Sleiman, Hanadi F.

    2018-01-01

    DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

  16. Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication.

    Science.gov (United States)

    Haruta, Mayumi; Shimada, Midori; Nishiyama, Atsuya; Johmura, Yoshikazu; Le Tallec, Benoît; Debatisse, Michelle; Nakanishi, Makoto

    2016-01-22

    The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. DNA nanochannels [version 1; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Dianming Wang

    2017-04-01

    Full Text Available Transmembrane proteins are mostly nanochannels playing a highly important role in metabolism. Understanding their structures and functions is vital for revealing life processes. It is of fundamental interest to develop chemical devices to mimic biological channels. Structural DNA nanotechnology has been proven to be a promising method for the preparation of fine DNA nanochannels as a result of the excellent properties of DNA molecules. This review presents the development history and current situation of three different types of DNA nanochannel: tile-based nanotube, DNA origami nanochannel, and DNA bundle nanochannel.

  18. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  19. DNA2—An Important Player in DNA Damage Response or Just Another DNA Maintenance Protein?

    Directory of Open Access Journals (Sweden)

    Elzbieta Pawłowska

    2017-07-01

    Full Text Available The human DNA2 (DNA replication helicase/nuclease 2 protein is expressed in both the nucleus and mitochondria, where it displays ATPase-dependent nuclease and helicase activities. DNA2 plays an important role in the removing of long flaps in DNA replication and long-patch base excision repair (LP-BER, interacting with the replication protein A (RPA and the flap endonuclease 1 (FEN1. DNA2 can promote the restart of arrested replication fork along with Werner syndrome ATP-dependent helicase (WRN and Bloom syndrome protein (BLM. In mitochondria, DNA2 can facilitate primer removal during strand-displacement replication. DNA2 is involved in DNA double strand (DSB repair, in which it is complexed with BLM, RPA and MRN for DNA strand resection required for homologous recombination repair. DNA2 can be a major protein involved in the repair of complex DNA damage containing a DSB and a 5′ adduct resulting from a chemical group bound to DNA 5′ ends, created by ionizing radiation and several anticancer drugs, including etoposide, mitoxantrone and some anthracyclines. The role of DNA2 in telomere end maintenance and cell cycle regulation suggests its more general role in keeping genomic stability, which is impaired in cancer. Therefore DNA2 can be an attractive target in cancer therapy. This is supported by enhanced expression of DNA2 in many cancer cell lines with oncogene activation and premalignant cells. Therefore, DNA2 can be considered as a potential marker, useful in cancer therapy. DNA2, along with PARP1 inhibition, may be considered as a potential target for inducing synthetic lethality, a concept of killing tumor cells by targeting two essential genes.

  20. DNA Self-Assembly: From Chirality to Evolution

    Directory of Open Access Journals (Sweden)

    Youri Timsit

    2013-04-01

    Full Text Available Transient or long-term DNA self-assembly participates in essential genetic functions. The present review focuses on tight DNA-DNA interactions that have recently been found to play important roles in both controlling DNA higher-order structures and their topology. Due to their chirality, double helices are tightly packed into stable right-handed crossovers. Simple packing rules that are imposed by DNA geometry and sequence dictate the overall architecture of higher order DNA structures. Close DNA-DNA interactions also provide the missing link between local interactions and DNA topology, thus explaining how type II DNA topoisomerases may sense locally the global topology. Finally this paper proposes that through its influence on DNA self-assembled structures, DNA chirality played a critical role during the early steps of evolution.

  1. Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication

    Energy Technology Data Exchange (ETDEWEB)

    Haruta, Mayumi [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Shimada, Midori, E-mail: midorism@med.nagoya-cu.ac.jp [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Nishiyama, Atsuya; Johmura, Yoshikazu [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan); Le Tallec, Benoît; Debatisse, Michelle [Institut Curie, Centre de Recherche, 26 rue d’Ulm, CNRS UMR 3244, 75248 ParisCedex 05 (France); Nakanishi, Makoto, E-mail: mkt-naka@med.nagoya-cu.ac.jp [Department of Cell Biology, Graduate School of Medical Sciences, Nagoya City University, 1 Kawasumi, Mizuho-cho, Mizuho-ku, Nagoya 467-8601 (Japan)

    2016-01-22

    The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. - Highlights: • DNMT1 depletion results in an abnormal DNA replication program. • Aberrant DNA replication is independent of the DNA damage checkpoint in DNMT1cKO. • DNMT1 catalytic activity and RFT domain are required for proper DNA replication. • DNMT1 catalytic activity and RFT domain are required for cell proliferation.

  2. Loss of maintenance DNA methylation results in abnormal DNA origin firing during DNA replication

    International Nuclear Information System (INIS)

    Haruta, Mayumi; Shimada, Midori; Nishiyama, Atsuya; Johmura, Yoshikazu; Le Tallec, Benoît; Debatisse, Michelle; Nakanishi, Makoto

    2016-01-01

    The mammalian maintenance methyltransferase DNMT1 [DNA (cytosine-5-)-methyltransferase 1] mediates the inheritance of the DNA methylation pattern during replication. Previous studies have shown that depletion of DNMT1 causes a severe growth defect and apoptosis in differentiated cells. However, the detailed mechanisms behind this phenomenon remain poorly understood. Here we show that conditional ablation of Dnmt1 in murine embryonic fibroblasts (MEFs) resulted in an aberrant DNA replication program showing an accumulation of late-S phase replication and causing severely defective growth. Furthermore, we found that the catalytic activity and replication focus targeting sequence of DNMT1 are required for a proper DNA replication program. Taken together, our findings suggest that the maintenance of DNA methylation by DNMT1 plays a critical role in proper regulation of DNA replication in mammalian cells. - Highlights: • DNMT1 depletion results in an abnormal DNA replication program. • Aberrant DNA replication is independent of the DNA damage checkpoint in DNMT1cKO. • DNMT1 catalytic activity and RFT domain are required for proper DNA replication. • DNMT1 catalytic activity and RFT domain are required for cell proliferation.

  3. The role of DNA repair in the realizatian of oxygen effect in bacteria ESCHERICHIA COLI irradiated with Various types of radiation (theoretical apalySis)

    International Nuclear Information System (INIS)

    Kozubek, S.; Krasavin, E.A.

    1983-01-01

    The regUlarities of the induction of basic types of DNA injuries influencing OER by the radiations of different LETs are considered. The DNA injuries arising from two, three and more acts of energy depositions are shown to increase with increasing LET. On the basis of proposed model the amount of irreparable by repair 11 single-strand breaks (Nsub(SSB1)sup(ir)) DNA in the dependence on LET is estimated. The dependence Nsub(SSB1)sup(ir) (LET) forms a slight maximum typical of multihit processes. The maximUm arises in the region of LET 200-300 keV/μm. The amoUnts of direct double-strand breaks (Nsub(dDSB)) DNA in both the presence and absence of oxygen in the dependence on LET have been estimated, too. The calculations show that in the region beyond the maximum of Nsub(dDSB) (LET) dependence constant ratio between NsUb(dDSB) in oxic and anoxic conditions is preserved. In the region of the maximum the ratio decreases. On the basis of our analysis a critical look at both the ''interacting radicals'' and ''oxygen in track'' hypotheses is given

  4. Dynamic DNA binding, junction recognition and G4 melting activity underlie the telomeric and genome-wide roles of human CST.

    Science.gov (United States)

    Bhattacharjee, Anukana; Wang, Yongyao; Diao, Jiajie; Price, Carolyn M

    2017-12-01

    Human CST (CTC1-STN1-TEN1) is a ssDNA-binding complex that helps resolve replication problems both at telomeres and genome-wide. CST resembles Replication Protein A (RPA) in that the two complexes harbor comparable arrays of OB-folds and have structurally similar small subunits. However, the overall architecture and functions of CST and RPA are distinct. Currently, the mechanism underlying CST action at diverse replication issues remains unclear. To clarify CST mechanism, we examined the capacity of CST to bind and resolve DNA structures found at sites of CST activity. We show that CST binds preferentially to ss-dsDNA junctions, an activity that can explain the incremental nature of telomeric C-strand synthesis following telomerase action. We also show that CST unfolds G-quadruplex structures, thus providing a mechanism for CST to facilitate replication through telomeres and other GC-rich regions. Finally, smFRET analysis indicates that CST binding to ssDNA is dynamic with CST complexes undergoing concentration-dependent self-displacement. These findings support an RPA-based model where dissociation and re-association of individual OB-folds allow CST to mediate loading and unloading of partner proteins to facilitate various aspects of telomere replication and genome-wide resolution of replication stress. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Application of flow cytometry for exploring the evolution of Geosmithia fungi living in association with bark beetles: the role of conidial DNA content

    Czech Academy of Sciences Publication Activity Database

    Veselská, Tereza; Kolařík, Miroslav

    2015-01-01

    Roč. 13, FEB 2015 (2015), s. 83-92 ISSN 1754-5048 R&D Projects: GA ČR(CZ) GAP506/11/2302 Institutional support: RVO:61388971 Keywords : Ambrosia fungi * Bark beetles * Conidial DNA content Subject RIV: EE - Microbiology, Virology Impact factor: 2.631, year: 2015

  6. Cellular heredity in haploid cultures of somatic cells. Progress report, August 1977--August 1978. [Role of DNA repair mechanisms in uv mutagenesis in cultured frog and fish cells

    Energy Technology Data Exchange (ETDEWEB)

    Freed, J.J.

    1978-09-01

    Studies in progress on cultured frog and fish cells, exploring the relation between the frequency of mutation after ultraviolet irradiation and the pathway through which DNA repair takes place are reported. The rationale is that the mutation frequency induced by a uv exposure is determined not only by the dose delivered but by the fidelity of the DNA repair process. Since frog cells express photoreversal enzyme, whether repair takes place by error-free photoreversal or by other, error-prone, mechanisms can be determined experimentally. An important question is whether an inducible, error-prone mutagenic form of repair is demonstrable. During the past year, methods necessary to determine uv survival and mutation frequency over a range of uv exposures were worked out. Using these methods, we have tested for alteration of the uv survival curve by previous conditioning exposures in frog cells was studied and uv survival and photoreversal capacity in fish cells were determined. The relation between uv survival and induction of ouabain resistance by an alkylating agent (MNNG) was examined as a background for further studies with uv. A procedure intended to accomplish DNA-mediated transfer of frog DNA photolyase enzyme to Chinese hamster cells is described.

  7. Whole genome DNA methylation: beyond genes silencing

    OpenAIRE

    Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati

    2016-01-01

    The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the ...

  8. Different Amounts of DNA in Newborn Cells of Escherichia coli Preclude a Role for the Chromosome in Size Control According to the "Adder" Model.

    Science.gov (United States)

    Huls, Peter G; Vischer, Norbert O E; Woldringh, Conrad L

    2018-01-01

    According to the recently-revived adder model for cell size control, newborn cells of Escherichia coli will grow and divide after having added a constant size or length, ΔL , irrespective of their size at birth. Assuming exponential elongation, this implies that large newborns will divide earlier than small ones. The molecular basis for the constant size increment is still unknown. As DNA replication and cell growth are coordinated, the constant ΔL could be based on duplication of an equal amount of DNA, ΔG , present in newborn cells. To test this idea, we measured amounts of DNA and lengths of nucleoids in DAPI-stained cells growing in batch culture at slow and fast rates. Deeply-constricted cells were divided in two subpopulations of longer and shorter lengths than average; these were considered to represent large and small prospective daughter cells, respectively. While at slow growth, large and small prospective daughter cells contained similar amounts of DNA, fast growing cells with multiforked replicating chromosomes, showed a significantly higher amount of DNA (20%) in the larger cells. This observation precludes the hypothesis that Δ L is based on the synthesis of a constant ΔG . Growth curves were constructed for siblings generated by asymmetric division and growing according to the adder model. Under the assumption that all cells at the same growth rate exhibit the same time between initiation of DNA replication and cell division (i.e., constant C+D -period), the constructions predict that initiation occurs at different sizes ( Li ) and that, at fast growth, large newborn cells transiently contain more DNA than small newborns, in accordance with the observations. Because the state of segregation, measured as the distance between separated nucleoids, was found to be more advanced in larger deeply-constricted cells, we propose that in larger newborns nucleoid separation occurs faster and at a shorter length, allowing them to divide earlier. We propose

  9. What Is Mitochondrial DNA?

    Science.gov (United States)

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  10. Haben repetitive DNA-Sequenzen biologische Funktionen?

    Science.gov (United States)

    John, Maliyakal E.; Knöchel, Walter

    1983-05-01

    By DNA reassociation kinetics it is known that the eucaryotic genome consists of non-repetitive DNA, middle-repetitive DNA and highly repetitive DNA. Whereas the majority of protein-coding genes is located on non-repetitive DNA, repetitive DNA forms a constitutive part of eucaryotic DNA and its amount in most cases equals or even substantially exceeds that of non-repetitive DNA. During the past years a large body of data on repetitive DNA has accumulated and these have prompted speculations ranging from specific roles in the regulation of gene expression to that of a selfish entity with inconsequential functions. The following article summarizes recent findings on structural, transcriptional and evolutionary aspects and, although by no means being proven, some possible biological functions are discussed.

  11. DNA mimic proteins: functions, structures, and bioinformatic analysis.

    Science.gov (United States)

    Wang, Hao-Ching; Ho, Chun-Han; Hsu, Kai-Cheng; Yang, Jinn-Moon; Wang, Andrew H-J

    2014-05-13

    DNA mimic proteins have DNA-like negative surface charge distributions, and they function by occupying the DNA binding sites of DNA binding proteins to prevent these sites from being accessed by DNA. DNA mimic proteins control the activities of a variety of DNA binding proteins and are involved in a wide range of cellular mechanisms such as chromatin assembly, DNA repair, transcription regulation, and gene recombination. However, the sequences and structures of DNA mimic proteins are diverse, making them difficult to predict by bioinformatic search. To date, only a few DNA mimic proteins have been reported. These DNA mimics were not found by searching for functional motifs in their sequences but were revealed only by structural analysis of their charge distribution. This review highlights the biological roles and structures of 16 reported DNA mimic proteins. We also discuss approaches that might be used to discover new DNA mimic proteins.

  12. Evidence supporting a role for TopBP1 and Brd4 in the initiation but not continuation of human papillomavirus 16 E1/E2-mediated DNA replication.

    Science.gov (United States)

    Gauson, Elaine J; Donaldson, Mary M; Dornan, Edward S; Wang, Xu; Bristol, Molly; Bodily, Jason M; Morgan, Iain M

    2015-05-01

    burden on the current, and future, generations. Targeting viral DNA replication that is mediated by two viral proteins, E1 and E2, in association with cellular proteins such as TopBP1 and Brd4 would have therapeutic benefits. This report suggests a role for these cellular proteins in the initiation of viral DNA replication by HPV16 E1-E2 but not for continuing replication. This is important if viral replication is to be effectively targeted; we need to understand the viral and cellular proteins required at each phase of viral DNA replication so that it can be effectively disrupted. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  13. Ultrasensitive determination of DNA oxidation products by gas chromatography-tandem mass spectrometry and the role of antioxidants in the prevention of oxidative damage.

    Science.gov (United States)

    Dawbaa, Sam; Aybastıer, Önder; Demir, Cevdet

    2017-04-15

    Oxidative stress is considered as one of the significant causes of DNA damage which in turn contributes to cell death through a series of intermediate processes such as cancer formation, mutation, and aging. Natural sources such as plant and fruit products have provided us with interesting substances of antioxidant activity that could be recruited in protecting the genetic materials of the cells. This study is an effort to discover some of those antioxidants effects in their standard and natural forms by performing an ultrasensitive determination of the products of DNA oxidation using GC-MS/MS. Experiments were used to determine the direct antioxidant activity of the substances contained in the tendrils of Vitis vinifera (var. alphonse) by extracting them and achieving Folin-Ciocalteau and CHROMAC analyses to determine the total phenolic content (TPC) and the antioxidant capacity of the extract, respectively; results revealed a phenolic content of 11.39±0.30mg Gallic Acid Equivalent (GAE)/g of the plant's fresh weight (FW) by Folin-Ciocalteau and 8.17±0.49mg Trolox Equivalent (TE)/g FW by CHROMAC assays. The qualitative analysis of the plant extract by HPLC-DAD technique revealed that two flavonoid glycosides namely rutin and isoquercitrin in addition to chlorogenic acid were contained in the extract. The determination of the DNA oxidation products was performed after putting DNA, rutin and isoquercitrin standard samples with different concentration, and the extract's sample under oxidative stress. Eighteen DNA oxidation products were traced using GC-MS/MS with ultra-sensitivity and the experiments proved a significant decrease in the concentration of the DNA oxidation products when the extract was used as a protectant against the oxidative stress. It is believed by conclusion that the extract of V. vinifera's (var. alphonse) tendrils has a good antioxidant activity; hence it is recommended to be used as a part of the daily healthy food list if possible

  14. Supercoil Formation During DNA Melting

    Science.gov (United States)

    Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan

    2009-03-01

    Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.

  15. The role of the DNA repair system in increasing the viability of E.coli cells under the action of small UV doses

    International Nuclear Information System (INIS)

    Kuzin, A.M.; Vilenchik, M.M.; Isakov, B.K.; AN Kazakhskoj SSR, Alma-Ata. Inst. Botaniki)

    1976-01-01

    The authors studied the action of the ultraviolet light (UV) on the colony-forming ability of E.coli K12-HCR + cultured in a meat infusion broth in the presence of glucose. An unusual shape of the curve indicates that the number of viable cells increases under the action of low UV doses. The experiment was repeated seven times, and each time the phenomenon was fully asserted (p 0.01). So it was suggested that low UV doses (about 140 erg/mm 2 ) activate the system of dark DNA repair (induction of the synthesis of repair enzymes) which repairs 'spontaneous' DNA defects and increases the number of colony-forming cells. (orig.) [de

  16. Role of the DNA repair system in increasing the viability of E. coli cells under the action of small UV doses

    Energy Technology Data Exchange (ETDEWEB)

    Kuzin, A M; Vilenchik, M M; Isakov, B K [AN SSSR, Pushchino-na-Oke. Inst. Biologicheskoj Fiziki; AN Kazakhskoj SSR, Alma-Ata. Inst. Botaniki)

    1976-12-01

    The authors studied the action of the ultraviolet light (UV) on the colony-forming ability of E.coli K12-HCR/sup +/ cultured in a meat infusion broth in the presence of glucose. An unusual shape of the curve indicates that the number of viable cells increases under the action of low UV doses. The experiment was repeated seven times, and each time the phenomenon was fully asserted (p 0.01). So it was suggested that low UV doses (about 140 erg/mm/sup 2/) activate the system of dark DNA repair (induction of the synthesis of repair enzymes) which repairs 'spontaneous' DNA defects and increases the number of colony-forming cells.

  17. Metformin inhibition of mTORC1 activation, DNA synthesis and proliferation in pancreatic cancer cells: Dependence on glucose concentration and role of AMPK

    Energy Technology Data Exchange (ETDEWEB)

    Sinnett-Smith, James; Kisfalvi, Krisztina; Kui, Robert [Division of Digestive Diseases, Department of Medicine, CURE: Digestive Diseases Research Center, David Geffen School of Medicine and Molecular Biology Institute, University of California at Los Angeles, CA (United States); Rozengurt, Enrique, E-mail: erozengurt@mednet.ucla.edu [Division of Digestive Diseases, Department of Medicine, CURE: Digestive Diseases Research Center, David Geffen School of Medicine and Molecular Biology Institute, University of California at Los Angeles, CA (United States)

    2013-01-04

    Highlights: Black-Right-Pointing-Pointer Metformin inhibits cancer cell growth but the mechanism(s) are not understood. Black-Right-Pointing-Pointer We show that the potency of metformin is sharply dependent on glucose in the medium. Black-Right-Pointing-Pointer AMPK activation was enhanced in cancer cells incubated in physiological glucose. Black-Right-Pointing-Pointer Reciprocally, metformin potently inhibited mTORC1, DNA synthesis and proliferation. Black-Right-Pointing-Pointer Metformin, at low concentrations, inhibited DNA synthesis through AMPK. -- Abstract: Metformin, a widely used anti-diabetic drug, is emerging as a potential anticancer agent but the mechanisms involved remain incompletely understood. Here, we demonstrate that the potency of metformin induced AMPK activation, as shown by the phosphorylation of its substrates acetyl-CoA carboxylase (ACC) at Ser{sup 79} and Raptor at Ser{sup 792}, was dramatically enhanced in human pancreatic ductal adenocarcinoma (PDAC) cells PANC-1 and MiaPaCa-2 cultured in medium containing physiological concentrations of glucose (5 mM), as compared with parallel cultures in medium with glucose at 25 mM. In physiological glucose, metformin inhibited mTORC1 activation, DNA synthesis and proliferation of PDAC cells stimulated by crosstalk between G protein-coupled receptors and insulin/IGF signaling systems, at concentrations (0.05-0.1 mM) that were 10-100-fold lower than those used in most previous reports. Using siRNA-mediated knockdown of the {alpha}{sub 1} and {alpha}{sub 2} catalytic subunits of AMPK, we demonstrated that metformin, at low concentrations, inhibited DNA synthesis through an AMPK-dependent mechanism. Our results emphasize the importance of using medium containing physiological concentrations of glucose to elucidate the anticancer mechanism of action of metformin in pancreatic cancer cells and other cancer cell types.

  18. Metformin inhibition of mTORC1 activation, DNA synthesis and proliferation in pancreatic cancer cells: Dependence on glucose concentration and role of AMPK

    International Nuclear Information System (INIS)

    Sinnett-Smith, James; Kisfalvi, Krisztina; Kui, Robert; Rozengurt, Enrique

    2013-01-01

    Highlights: ► Metformin inhibits cancer cell growth but the mechanism(s) are not understood. ► We show that the potency of metformin is sharply dependent on glucose in the medium. ► AMPK activation was enhanced in cancer cells incubated in physiological glucose. ► Reciprocally, metformin potently inhibited mTORC1, DNA synthesis and proliferation. ► Metformin, at low concentrations, inhibited DNA synthesis through AMPK. -- Abstract: Metformin, a widely used anti-diabetic drug, is emerging as a potential anticancer agent but the mechanisms involved remain incompletely understood. Here, we demonstrate that the potency of metformin induced AMPK activation, as shown by the phosphorylation of its substrates acetyl-CoA carboxylase (ACC) at Ser 79 and Raptor at Ser 792 , was dramatically enhanced in human pancreatic ductal adenocarcinoma (PDAC) cells PANC-1 and MiaPaCa-2 cultured in medium containing physiological concentrations of glucose (5 mM), as compared with parallel cultures in medium with glucose at 25 mM. In physiological glucose, metformin inhibited mTORC1 activation, DNA synthesis and proliferation of PDAC cells stimulated by crosstalk between G protein-coupled receptors and insulin/IGF signaling systems, at concentrations (0.05–0.1 mM) that were 10–100-fold lower than those used in most previous reports. Using siRNA-mediated knockdown of the α 1 and α 2 catalytic subunits of AMPK, we demonstrated that metformin, at low concentrations, inhibited DNA synthesis through an AMPK-dependent mechanism. Our results emphasize the importance of using medium containing physiological concentrations of glucose to elucidate the anticancer mechanism of action of metformin in pancreatic cancer cells and other cancer cell types.

  19. Thimerosal-Derived Ethylmercury Is a Mitochondrial Toxin in Human Astrocytes: Possible Role of Fenton Chemistry in the Oxidation and Breakage of mtDNA

    Directory of Open Access Journals (Sweden)

    Martyn A. Sharpe

    2012-01-01

    Full Text Available Thimerosal generates ethylmercury in aqueous solution and is widely used as preservative. We have investigated the toxicology of Thimerosal in normal human astrocytes, paying particular attention to mitochondrial function and the generation of specific oxidants. We find that ethylmercury not only inhibits mitochondrial respiration leading to a drop in the steady state membrane potential, but also concurrent with these phenomena increases the formation of superoxide, hydrogen peroxide, and Fenton/Haber-Weiss generated hydroxyl radical. These oxidants increase the levels of cellular aldehyde/ketones. Additionally, we find a five-fold increase in the levels of oxidant damaged mitochondrial DNA bases and increases in the levels of mtDNA nicks and blunt-ended breaks. Highly damaged mitochondria are characterized by having very low membrane potentials, increased superoxide/hydrogen peroxide production, and extensively damaged mtDNA and proteins. These mitochondria appear to have undergone a permeability transition, an observation supported by the five-fold increase in Caspase-3 activity observed after Thimerosal treatment.

  20. Recurring DNA copy number gain at chromosome 9p13 plays a role in the activation of multiple candidate oncogenes in progressing oral premalignant lesions

    International Nuclear Information System (INIS)

    Towle, Rebecca; Tsui, Ivy F L; Zhu, Yuqi; MacLellan, Sara; Poh, Catherine F; Garnis, Cathie

    2014-01-01

    Genomic alteration at chromosome 9p has been previously reported as a frequent and critical event in oral premalignancy. While this alteration is typically reported as a loss driven by selection for CDKN2A deactivation (at 9p21.3), we detect a recurrent DNA copy number gain of ∼2.49 Mbp at chromosome 9p13 in oral premalignant lesions (OPLs) that later progressed to invasive lesions. This recurrent alteration event has been validated using fluorescence in situ hybridization in an independent set of OPLs. Analysis of publicly available gene expression datasets aided in identifying three oncogene candidates that may have driven selection for DNA copy number increases in this region (VCP, DCTN3, and STOML2). We performed in vitro silencing and activation experiments for each of these genes in oral cancer cell lines and found that each gene is independently capable of upregulating proliferation and anchorage-independent growth. We next analyzed the activity of each of these genes in biopsies of varying histological grades that were obtained from a diseased oral tissue field in a single patient, finding further molecular evidence of parallel activation of VCP, DCTN3, and STOML2 during progression from normal healthy tissue to invasive oral carcinoma. Our results support the conclusion that DNA gain at 9p13 is important to the earliest stages of oral tumorigenesis and that this alteration event likely contributes to the activation of multiple oncogene candidates capable of governing oral cancer phenotypes

  1. Determining the role of missense mutations in the POU domain of HNF1A that reduce the DNA-binding affinity: A computational approach.

    Directory of Open Access Journals (Sweden)

    Sneha P

    Full Text Available Maturity-onset diabetes of the young type 3 (MODY3 is a non-ketotic form of diabetes associated with poor insulin secretion. Over the past years, several studies have reported the association of missense mutations in the Hepatocyte Nuclear Factor 1 Alpha (HNF1A with MODY3. Missense mutations in the POU homeodomain (POUH of HNF1A hinder binding to the DNA, thereby leading to a dysfunctional protein. Missense mutations of the HNF1A were retrieved from public databases and subjected to a three-step computational mutational analysis to identify the underlying mechanism. First, the pathogenicity and stability of the mutations were analyzed to determine whether they alter protein structure and function. Second, the sequence conservation and DNA-binding sites of the mutant positions were assessed; as HNF1A protein is a transcription factor. Finally, the biochemical properties of the biological system were validated using molecular dynamic simulations in Gromacs 4.6.3 package. Two arginine residues (131 and 203 in the HNF1A protein are highly conserved residues and contribute to the function of the protein. Furthermore, the R131W, R131Q, and R203C mutations were predicted to be highly deleterious by in silico tools and showed lower binding affinity with DNA when compared to the native protein using the molecular docking analysis. Triplicate runs of molecular dynamic (MD simulations (50ns revealed smaller changes in patterns of deviation, fluctuation, and compactness, in complexes containing the R131Q and R131W mutations, compared to complexes containing the R203C mutant complex. We observed reduction in the number of intermolecular hydrogen bonds, compactness, and electrostatic potential, as well as the loss of salt bridges, in the R203C mutant complex. Substitution of arginine with cysteine at position 203 decreases the affinity of the protein for DNA, thereby destabilizing the protein. Based on our current findings, the MD approach is an important

  2. DNA methylation in metabolic disorders

    DEFF Research Database (Denmark)

    Barres, Romain; Zierath, Juleen R

    2011-01-01

    DNA methylation is a major epigenetic modification that controls gene expression in physiologic and pathologic states. Metabolic diseases such as diabetes and obesity are associated with profound alterations in gene expression that are caused by genetic and environmental factors. Recent reports...... have provided evidence that environmental factors at all ages could modify DNA methylation in somatic tissues, which suggests that DNA methylation is a more dynamic process than previously appreciated. Because of the importance of lifestyle factors in metabolic disorders, DNA methylation provides...... a mechanism by which environmental factors, including diet and exercise, can modify genetic predisposition to disease. This article considers the current evidence that defines a role for DNA methylation in metabolic disorders....

  3. Rad52 SUMOylation affects the efficiency of the DNA repair

    DEFF Research Database (Denmark)

    Altmannova, Veronika; Eckert-Boulet, Nadine; Arneric, Milica

    2010-01-01

    Homologous recombination (HR) plays a vital role in DNA metabolic processes including meiosis, DNA repair, DNA replication and rDNA homeostasis. HR defects can lead to pathological outcomes, including genetic diseases and cancer. Recent studies suggest that the post-translational modification by ...

  4. DNA Vaccines

    Indian Academy of Sciences (India)

    diseases. Keywords. DNA vaccine, immune response, antibodies, infectious diseases. GENERAL .... tein vaccines require expensive virus/protein purification tech- niques as ... sphere continue to remain major health hazards in developing nations. ... significance since it can be produced at a very low cost and can be stored ...

  5. DNA Investigations.

    Science.gov (United States)

    Mayo, Ellen S.; Bertino, Anthony J.

    1991-01-01

    Presents a simulation activity that allow students to work through the exercise of DNA profiling and to grapple with some analytical and ethical questions involving a couple arranging with a surrogate mother to have a baby. Can be used to teach the principles of restriction enzyme digestion, gel electrophoresis, and probe hybridization. (MDH)

  6. Environmental influences on DNA curvature

    DEFF Research Database (Denmark)

    Ussery, David; Higgins, C.F.; Bolshoy, A.

    1999-01-01

    DNA curvature plays an important role in many biological processes. To study environmentalinfluences on DNA curvature we compared the anomalous migration on polyacrylamide gels ofligation ladders of 11 specifically-designed oligonucleotides. At low temperatures (25 degreesC and below) most......, whilst spermine enhanced theanomalous migration of a different set of sequences. Sequences with a GGC motif exhibitedgreater curvature than predicted by the presently-used angles for the nearest-neighbour wedgemodel and are especially sensitive to Mg2+. The data have implications for models...... for DNAcurvature and for environmentally-sensitive DNA conformations in the regulation of geneexpression....

  7. Involvement of DNA gyrase in replication and transcription of bacteriophage T7 DNA

    International Nuclear Information System (INIS)

    De Wyngaert, M.A.; Hinkle, D.C.

    1979-01-01

    Growth of bacteriophage T7 is inhibited by the antibiotic coumermycin A 1 , an inhibitor of the Escherichia coli DNA gyrase. Since growth of the phage is insensitive to the antibiotic in strains containing a coumermycin-resistent DNA gyrase, this enzyme appears to be required for phage growth. We have investigated the effect of coumermycin on the kinetics of DNA, RNA, and protein synthesis during T7 infection. DNA synthesis is completely inhibited by the antibiotic. In addition, coumermycin significantly inhibits transcription of late but not early genes. Thus, E. coli DNA gyrase may play an important role in transcription as well as in replication of T7 DNA

  8. The role of artichoke leaf tincture (Cynara scolymus) in the suppression of DNA damage and atherosclerosis in rats fed an atherogenic diet.

    Science.gov (United States)

    Bogavac-Stanojevic, Natasa; Kotur Stevuljevic, Jelena; Cerne, Darko; Zupan, Janja; Marc, Janja; Vujic, Zorica; Crevar-Sakac, Milkica; Sopic, Miron; Munjas, Jelena; Radenkovic, Miroslav; Jelic-Ivanovic, Zorana

    2018-12-01

    Polyphenols and flavonoids in artichoke leaf tincture (ALT) protect cells against oxidative damage. We examined ALT effects on deoxyribonucleic acid (DNA) damage and lipid profiles in rat plasma and gene expression in rat aorta [haemeoxygenase-1 (HO1), haemeoxygenase-2 (HO2), NADPH oxidase 4 (NOX-4), monocyte chemoattractant protein-1 (MCP-1) and nuclear factor (erythroid-derived 2)-like 2 (Nrf2)]. Eighteen male Wistar albino rats were divided into three groups (n = 6/group): The control group (CG) was fed with standard pellet chow for 11 weeks; the AD group was fed for a similar period of time with pellet chow supplemented with 2% cholesterol, 3% sunflower oil and 1% sodium cholate. The ADA group was fed with pellet chow (for 1 week), the atherogenic diet (see above) for the following 4 weeks and then with ALT (0.1 mL/kg body weight) and atherogenic diet for 6 weeks. According to HPLC analysis, the isolated main compounds in ALT were chlorogenic acid, caffeic acid, isoquercitrin and rutin. Normalized HO-1 [0.11 (0.04-0.24)] and MCP-1 [0.29 (0.21-0.47)] mRNA levels and DNA scores [12.50 (4.50-36.50)] were significantly lower in the ADA group than in the AD group [0.84 (0.35-2.51)], p = 0.021 for HO-1 [0.85 (0.61-3.45)], p = 0.047 for MCP-1 and [176.5 (66.50-221.25)], p = 0.020 for DNA scores. HO-1 mRNA was lower in the ADA group than in the CG group [0.30 (0.21-0.71), p = 0.049]. Supplementation with ALT limited the effects of the atherogenic diet through reduced MCP-1 expression, thereby preventing oxidative damage.

  9. Role of specific DNA mutations in the peripheral blood of colorectal cancer patients for the assessment of tumor stage and residual disease following tumor resection

    Science.gov (United States)

    Norcic, Gregor; Jelenc, Franc; Cerkovnik, Petra; Stegel, Vida; Novakovic, Srdjan

    2016-01-01

    In the present study, the detection of tumor-specific KRAS proto-oncogene, GTPase (KRAS) and B-Raf proto-oncogene, serine/threonine kinase (BRAF) mutations in the peripheral blood of colorectal cancer (CRC) patients at all stages and adenomas was used for the estimation of disease stage prior to surgery and for residual disease following surgery. A total of 65 CRC patients were enrolled. The primary tumor tested positive for the specific mutations (KRAS mutations in codons 12, 13, 61, 117 or 146 and BRAF mutations in codon 600) in 35 patients. In all these patients, the specimen of normal bowel resected with the tumor was also tested for the presence of the same mutations in order to exclude the germ-line mutations. Only patients who tested positive for the specific mutation in the primary tumor were included in further analysis for the presence of tumor-specific mutation in the peripheral blood. No statistically significant differences were found between the detection rates of tumor mutations in the blood and different tumor stages (P=0.491). However, statistically significant differences in the proportions of patients with detected tumor-specific DNA mutations in the peripheral blood were found when comparing the groups of patients with R0 and R2 resections (P=0.038). Tumor-specific DNA mutations in the peripheral blood were more frequently detected in the patients with an incomplete surgical clearance of the tumor due to macroscopic residual disease (R2 resections). Therefore, the study concludes that the follow-up of somatic KRAS- and BRAF-mutated DNA in the peripheral blood of CRC patients may be useful in assessing the surgical clearance of the disease. PMID:27900004

  10. Development of unidentified dna-specific hif 1α gene of lizard (hemidactylus platyurus) which plays a role in tissue regeneration process

    Science.gov (United States)

    Novianti, T.; Sadikin, M.; Widia, S.; Juniantito, V.; Arida, E. A.

    2018-03-01

    Development of unidentified specific gene is essential to analyze the availability these genes in biological process. Identification unidentified specific DNA of HIF 1α genes is important to analyze their contribution in tissue regeneration process in lizard tail (Hemidactylus platyurus). Bioinformatics and PCR techniques are relatively an easier method to identify an unidentified gene. The most widely used method is BLAST (Basic Local Alignment Sequence Tools) method for alignment the sequences from the other organism. BLAST technique is online software from website https://blast.ncbi.nlm.nih.gov/Blast.cgi that capable to generate the similar sequences from closest kinship to distant kindship. Gecko japonicus is a species that it has closest kinship with H. platyurus. Comparing HIF 1 α gene sequence of G. japonicus with the other species used multiple alignment methods from Mega7 software. Conserved base areas were identified using Clustal IX method. Primary DNA of HIF 1 α gene was design by Primer3 software. HIF 1α gene of lizard (H. platyurus) was successfully amplified using a real-time PCR machine by primary DNA that we had designed from Gecko japonicus. Identification unidentified gene of HIF 1a lizard has been done successfully with multiple alignment method. The study was conducted by analyzing during the growth of tail on day 1, 3, 5, 7, 10, 13 and 17 of lizard tail after autotomy. Process amplification of HIF 1α gene was described by CT value in real time PCR machine. HIF 1α expression of gene is quantified by Livak formula. Chi-square statistic test is 0.000 which means that there is a different expression of HIF 1 α gene in every growth day treatment.

  11. Roles of diet, lifetime physical activity and oxidative DNA damage in the occurrence of prostate cancer among men in Klang Valley, Malaysia.

    Science.gov (United States)

    Shahar, Suzana; Shafurah, Siti; Hasan Shaari, Nur Suraiya Abu; Rajikan, Roslee; Rajab, Nor Fadilah; Golkhalkhali, Babak; Zainuddin, Zulkifli Md

    2011-01-01

    There is a paucity of information on risk factors of prostate cancer, especially those related to dietary and lifestyle among Asian populations. This study aimed to determine the relationship between dietary intake (macronutrients, fruits, vegetables and lycopene), lifetime physical activity and oxidative DNA damage with prostate cancer. A case control study was carried out among 105 subjects (case n=35, control n=70), matched for age and ethnicity. Data on sociodemographic, medical, dietary intake, consumption of lycopene rich food and lifetime physical activity were obtained through an interview based questionnaire. Anthropometric measurements including weight, height and waist hip circumferences were also carried out on subjects. A total of 3 mL fasting venous blood was drawn to assess lymphocyte oxidative DNA damage using the alkaline comet assay. Cases had a significantly higher intake of fat (27.7 ± 5.5%) as compared to controls (25.1 ± 5.9%) (p diet, high intake of fruits, vegetables and lycopene rich foods and being physical active at middle age were found to be protective. Thus, it is essential for Malaysian men to consume adequate fruits and vegetables, reduce fat intake and engage in physical activity in order to reduce prostate cancer risk.

  12. Identification and characterization of PhbF: a DNA binding protein with regulatory role in the PHB metabolism of Herbaspirillum seropedicae SmR1.

    Science.gov (United States)

    Kadowaki, Marco A S; Müller-Santos, Marcelo; Rego, Fabiane G M; Souza, Emanuel M; Yates, Marshall G; Monteiro, Rose A; Pedrosa, Fabio O; Chubatsu, Leda S; Steffens, Maria B R

    2011-10-14

    Herbaspirillum seropedicae SmR1 is a nitrogen fixing endophyte associated with important agricultural crops. It produces polyhydroxybutyrate (PHB) which is stored intracellularly as granules. However, PHB metabolism and regulatory control is not yet well studied in this organism. In this work we describe the characterization of the PhbF protein from H. seropedicae SmR1 which was purified and characterized after expression in E. coli. The purified PhbF protein was able to bind to eleven putative promoters of genes involved in PHB metabolism in H. seropedicae SmR1. In silico analyses indicated a probable DNA-binding sequence which was shown to be protected in DNA footprinting assays using purified PhbF. Analyses using lacZ fusions showed that PhbF can act as a repressor protein controlling the expression of PHB metabolism-related genes. Our results indicate that H. seropedicae SmR1 PhbF regulates expression of phb-related genes by acting as a transcriptional repressor. The knowledge of the PHB metabolism of this plant-associated bacterium may contribute to the understanding of the plant-colonizing process and the organism's resistance and survival in planta.

  13. Identification and characterization of PhbF: A DNA binding protein with regulatory role in the PHB metabolism of Herbaspirillum seropedicae SmR1

    Directory of Open Access Journals (Sweden)

    Pedrosa Fabio O

    2011-10-01

    Full Text Available Abstract Background Herbaspirillum seropedicae SmR1 is a nitrogen fixing endophyte associated with important agricultural crops. It produces polyhydroxybutyrate (PHB which is stored intracellularly as granules. However, PHB metabolism and regulatory control is not yet well studied in this organism. Results In this work we describe the characterization of the PhbF protein from H. seropedicae SmR1 which was purified and characterized after expression in E. coli. The purified PhbF protein was able to bind to eleven putative promoters of genes involved in PHB metabolism in H. seropedicae SmR1. In silico analyses indicated a probable DNA-binding sequence which was shown to be protected in DNA footprinting assays using purified PhbF. Analyses using lacZ fusions showed that PhbF can act as a repressor protein controlling the expression of PHB metabolism-related genes. Conclusions Our results indicate that H. seropedicae SmR1 PhbF regulates expression of phb-related genes by acting as a transcriptional repressor. The knowledge of the PHB metabolism of this plant-associated bacterium may contribute to the understanding of the plant-colonizing process and the organism's resistance and survival in planta.

  14. A QM/MM study of the absorption spectrum of harmane in water solution and interacting with DNA: the crucial role of dynamic effects.

    Science.gov (United States)

    Etienne, Thibaud; Very, Thibaut; Perpète, Eric A; Monari, Antonio; Assfeld, Xavier

    2013-05-02

    We present a time-dependent density functional theory computation of the absorption spectra of one β-carboline system: the harmane molecule in its neutral and cationic forms. The spectra are computed in aqueous solution. The interaction of cationic harmane with DNA is also studied. In particular, the use of hybrid quantum mechanics/molecular mechanics methods is discussed, together with its coupling to a molecular dynamics strategy to take into account dynamic effects of the environment and the vibrational degrees of freedom of the chromophore. Different levels of treatment of the environment are addressed starting from purely mechanical embedding to electrostatic and polarizable embedding. We show that a static description of the spectrum based on equilibrium geometry only is unable to give a correct agreement with experimental results, and dynamic effects need to be taken into account. The presence of two stable noncovalent interaction modes between harmane and DNA is also presented, as well as the associated absorption spectrum of harmane cation.

  15. Roles of ROS mediated oxidative stress and DNA damage in 3-methyl-2-quinoxalin benzenevinylketo-1, 4-dioxide-induced immunotoxicity of Sprague-Dawley rats.

    Science.gov (United States)

    Gao, Hui; Wang, Di; Zhang, Shun; Xu, Mengjing; Yang, Wei; Yan, Peipei; Liu, Yang; Luo, Xiao; Wu, Hailei; Yao, Ping; Yan, Hong; Liu, Liegang

    2015-11-01

    3-methyl-2-quinoxalin benzenevinylketo-1, 4-dioxide (Quinocetone, QCT) has been broadly used to treat dysentery and promote animal growth in food producing animals. However, its potential toxicity could not been neglected as parts of safety assessment according to the acceptable guidelines for QCT administration. In this study, the immunotoxicity of QCT was investigated in male Sprague-Dawley (SD) rats following a 28-day oral exposure at doses of 0, 50, 800, and 2400 mg/kg/day. The food consumption, body weight gain and relative spleen weight were significantly decreased by QCT in a dose-dependent manner. Treatment of rats with QCT also notably suppressed the T-cell proliferation and natural killer (NK) cell activity, accompanied by intracellular reactive oxygen species (ROS) accumulation, antioxidant system inhibition and DNA damage enhancement. Thus, the primary finding of this study is that QCT exposure (2400 mg/kg/day) could cause immunotoxicity in SD rats due to ROS mediated oxidative stress and DNA damage. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. The communication of endogenous biomolecules (RNA, DNA, protein, hormone) via graft union might play key roles in the new traits formation of graft hybrids

    International Nuclear Information System (INIS)

    Khan, I.A.; Ghazal, L.; Arsalan, M.H.; Siddiqui, M.F.

    2018-01-01

    Plant graft hybridization is a fact of a sexual hybridization in which heritable changes trigger by grafting, it can produce hereditable variation types desired by breeders and can be used as a new method for germplasm innovation. This paper aimed to discuss new phenotypic variations such as phenotypic diversity and polyploidy formation discovered in recent years, new evidence supporting genetic material exchange between the rootstock and scion, and the timeliness, direction, and genetic stability of trait formation induced by graft hybridization. The unresolved mechanisms of trait variation were also discussed, and the relationship with exchange of chloroplast DNA (cpDNA) genetic information, horizontal gene transfer events of chloroplast and mitochondria, miRNA-mediated post-transcriptional regulation, and pressure-driven trait variations from graft hybridization were performed to clarify the relevant questions. Finally, the future research trend and key questions of graft hybridization were identified. Three clear conclusions for graft hybridization are presented: the new traits of graft hybrids have stable genetic characteristics and can be controlled via selection different genetic plant by grafting, and the products of graft hybrids were safer than those of transgenic plants. (author)

  17. DNA repair

    International Nuclear Information System (INIS)

    Setlow, R.

    1978-01-01

    Some topics discussed are as follows: difficulty in extrapolating data from E. coli to mammalian systems; mutations caused by UV-induced changes in DNA; mutants deficient in excision repair; other postreplication mechanisms; kinds of excision repair systems; detection of repair by biochemical or biophysical means; human mutants deficient in repair; mutagenic effects of UV on XP cells; and detection of UV-repair defects among XP individuals

  18. DNA requirements for interaction of the C-terminal region of Ku80 with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs).

    Science.gov (United States)

    Radhakrishnan, Sarvan Kumar; Lees-Miller, Susan P

    2017-09-01

    Non-homologous end joining (NHEJ) is the major pathway for the repair of ionizing radiation induced DNA double strand breaks (DSBs) in human cells. Critical to NHEJ is the DNA-dependent interaction of the Ku70/80 heterodimer with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK holoenzyme. However, precisely how Ku recruits DNA-PKcs to DSBs ends to enhance its kinase activity has remained enigmatic, with contradictory findings reported in the literature. Here we address the role of the Ku80 C-terminal region (CTR) in the DNA-dependent interaction of Ku70/80 with DNA-PKcs using purified components and defined DNA structures. Our results show that the Ku80 CTR is required for interaction with DNA-PKcs on short segments of blunt ended 25bp dsDNA or 25bp dsDNA with a 15-base poly dA single stranded (ss) DNA extension, but this requirement is less stringent on longer dsDNA molecules (35bp blunt ended dsDNA) or 25bp duplex DNA with either a 15-base poly dT or poly dC ssDNA extension. Moreover, the DNA-PKcs-Ku complex preferentially forms on 25 bp DNA with a poly-pyrimidine ssDNA extension.Our work clarifies the role of the Ku80 CTR and dsDNA ends on the interaction of DNA-PKcs with Ku and provides key information to guide assembly and biology of NHEJ complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Characterization of the roles of the catalytic domains of Mycobacterium tuberculosis ligase D in Ku-dependent error-prone DNA end joining.

    Science.gov (United States)

    Wright, Douglas; DeBeaux, Austin; Shi, Runhua; Doherty, Aidan J; Harrison, Lynn

    2010-09-01

    We previously established an Escherichia coli strain capable of re-circularizing linear plasmid DNA by expressing the Mycobacterium tuberculosis Ku (Mt-Ku) and Mycobacterium tuberculosis ligase D (Mt-LigD) proteins from the E.coli chromosome. Repair was predominately mutagenic due to deletions at the termini. We hypothesized that these deletions could be due to a nuclease activity of Mt-LigD that was previously detected in vitro. Mt-LigD has three domains: an N-terminal polymerase domain (PolDom), a central domain with 3'-phosphoesterase and nuclease activity and a C-terminal ligase domain (LigDom). We generated bacterial strains expressing Mt-Ku and mutant versions of Mt-LigD. Plasmid re-circularization experiments in bacteria showed that the PolDom alone had no re-circularization activity. However, an increase in the total and accurate repair was found when the central domain was deleted. This provides further evidence that this central domain does have nuclease activity that can generate deletions during repair. Deletion of only the PolDom of Mt-LigD resulted in a complete loss of accurate repair and a significant reduction in total repair. This is in agreement with published in vitro work indicating that the PolDom is the major Mt-Ku-binding site. Interestingly, the LigDom alone was able to re-circularize plasmid DNA but only in an Mt-Ku-dependent manner, suggesting a potential second site for Ku-LigD interaction. This work has increased our understanding of the mutagenic repair by Mt-Ku and Mt-LigD and has extended the in vitro biochemical experiments by examining the importance of the Mt-LigD domains during repair in bacteria.

  20. Photocleavage of DNA by copper(II) complexes

    Indian Academy of Sciences (India)

    Department of Inorganic and Physical Chemistry, Indian Institute of Science, Bangalore 560 012 e-mail: ... induced DNA cleavage activity is summarized in this article. ... per(II) complexes play important roles in DNA cleavage reactions.

  1. Cooperation between catalytic and DNA binding domains enhances thermostability and supports DNA synthesis at higher temperatures by thermostable DNA polymerases.

    Science.gov (United States)

    Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I

    2012-03-13

    We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases.

  2. Fanconi anemia and DNA repair.

    Science.gov (United States)

    Grompe, M; D'Andrea, A

    2001-10-01

    Fanconi anemia (FA) is an autosomal recessive disorder caused by defects in at least eight distinct genes FANCA, B, C, D1, D2, E, F and G. The clinical phenotype of all FA complementation groups is similar and is characterized by progressive bone marrow failure, cancer proneness and typical birth defects. The principal cellular phenotype is hypersensitivity to DNA damage, particularly interstrand DNA crosslinks. The FA proteins constitute a multiprotein pathway whose precise biochemical function(s) remain unknown. Five of the FA proteins (FANCA, C, E, F and G) interact in a nuclear complex upstream of FANCD2. FANCB and FANCD1 have not yet been cloned, but it is likely that FANCB is part of the nuclear complex and that FANCD1 acts downstream of FANCD2. The FA nuclear complex regulates the mono-ubiquitination of FANCD2 in response to DNA damage, resulting in targeting of this protein into nuclear foci. These foci also contain BRCA1 and other DNA damage response proteins. In male meiosis, FANCD2 also co-localizes with BRCA1 at synaptonemal complexes. Together, these data suggest that the FA pathway functions primarily as a DNA damage response system, although its exact role (direct involvement in DNA repair versus indirect, facilitating role) has not yet been defined.

  3. DNA testing in homicide investigations.

    Science.gov (United States)

    Prahlow, Joseph A; Cameron, Thomas; Arendt, Alexander; Cornelis, Kenneth; Bontrager, Anthony; Suth, Michael S; Black, Lisa; Tobey, Rebbecca; Pollock, Sharon; Stur, Shawn; Cotter, Kenneth; Gabrielse, Joel

    2017-10-01

    Objectives With the widespread use of DNA testing, police, death investigators, and attorneys need to be aware of the capabilities of this technology. This review provides an overview of scenarios where DNA evidence has played a major role in homicide investigations in order to highlight important educational issues for police, death investigators, forensic pathologists, and attorneys. Methods This was a nonrandom, observational, retrospective study. Data were obtained from the collective files of the authors from casework during a 15-year period, from 2000 through 2014. Results A series of nine scenarios, encompassing 11 deaths, is presented from the standpoint of the police and death investigation, the forensic pathology autopsy performance, the subsequent DNA testing of evidence, and, ultimately, the final adjudication of cases. Details of each case are presented, along with a discussion that focuses on important aspects of sample collection for potential DNA testing, especially at the crime scene and the autopsy. The presentation highlights the diversity of case and evidence types in which DNA testing played a valuable role in the successful prosecution of the case. Conclusions By highlighting homicides where DNA testing contributed to the successful adjudication of cases, police, death investigators, forensic pathologists, and attorneys will be better informed regarding the types of evidence and situations where such testing is of potential value.

  4. DNA: Polymer and molecular code

    Science.gov (United States)

    Shivashankar, G. V.

    1999-10-01

    The thesis work focusses upon two aspects of DNA, the polymer and the molecular code. Our approach was to bring single molecule micromanipulation methods to the study of DNA. It included a home built optical microscope combined with an atomic force microscope and an optical tweezer. This combined approach led to a novel method to graft a single DNA molecule onto a force cantilever using the optical tweezer and local heating. With this method, a force versus extension assay of double stranded DNA was realized. The resolution was about 10 picoN. To improve on this force measurement resolution, a simple light backscattering technique was developed and used to probe the DNA polymer flexibility and its fluctuations. It combined the optical tweezer to trap a DNA tethered bead and the laser backscattering to detect the beads Brownian fluctuations. With this technique the resolution was about 0.1 picoN with a millisecond access time, and the whole entropic part of the DNA force-extension was measured. With this experimental strategy, we measured the polymerization of the protein RecA on an isolated double stranded DNA. We observed the progressive decoration of RecA on the l DNA molecule, which results in the extension of l , due to unwinding of the double helix. The dynamics of polymerization, the resulting change in the DNA entropic elasticity and the role of ATP hydrolysis were the main parts of the study. A simple model for RecA assembly on DNA was proposed. This work presents a first step in the study of genetic recombination. Recently we have started a study of equilibrium binding which utilizes fluorescence polarization methods to probe the polymerization of RecA on single stranded DNA. In addition to the study of material properties of DNA and DNA-RecA, we have developed experiments for which the code of the DNA is central. We studied one aspect of DNA as a molecular code, using different techniques. In particular the programmatic use of template specificity makes

  5. DNA repair

    International Nuclear Information System (INIS)

    Van Zeeland, A.A.

    1984-01-01

    In this chapter a series of DNA repair pathways are discussed which are available to the cell to cope with the problem of DNA damaged by chemical or physical agents. In the case of microorganisms our knowledge about the precise mechanism of each DNA repair pathway and the regulation of it has been improved considerably when mutants deficient in these repair mechanisms became available. In the case of mammalian cells in culture, until recently there were very little repair deficient mutants available, because in almost all mammalian cells in culture at least the diploid number of chromosomes is present. Therefore the frequency of repair deficient mutants in such populations is very low. Nevertheless because replica plating techniques are improving some mutants from Chinese hamsters ovary cells and L5178Y mouse lymphoma cells are now available. In the case of human cells, cultures obtained from patients with certain genetic diseases are available. A number of cells appear to be sensitive to some chemical or physical mutagens. These include cells from patients suffering from xeroderma pigmentosum, Ataxia telangiectasia, Fanconi's anemia, Cockayne's syndrome. However, only in the case of xeroderma pigmentosum cells, has the sensitivity to ultraviolet light been clearly correlated with a deficiency in excision repair of pyrimidine dimers. Furthermore the work with strains obtained from biopsies from man is difficult because these cells generally have low cloning efficiencies and also have a limited lifespan in vitro. It is therefore very important that more repair deficient mutants will become available from established cell lines from human or animal origin

  6. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  7. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    Science.gov (United States)

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  8. Mitogenomic analyses from ancient DNA

    DEFF Research Database (Denmark)

    Paijmans, Johanna L. A.; Gilbert, Tom; Hofreiter, Michael

    2013-01-01

    The analysis of ancient DNA is playing an increasingly important role in conservation genetic, phylogenetic and population genetic analyses, as it allows incorporating extinct species into DNA sequence trees and adds time depth to population genetics studies. For many years, these types of DNA...... analyses (whether using modern or ancient DNA) were largely restricted to the analysis of short fragments of the mitochondrial genome. However, due to many technological advances during the past decade, a growing number of studies have explored the power of complete mitochondrial genome sequences...... yielded major progress with regard to both the phylogenetic positions of extinct species, as well as resolving population genetics questions in both extinct and extant species....

  9. A lncRNA to repair DNA

    DEFF Research Database (Denmark)

    Lukas, Jiri; Altmeyer, Matthias

    2015-01-01

    Long non-coding RNAs (lncRNAs) have emerged as regulators of various biological processes, but to which extent lncRNAs play a role in genome integrity maintenance is not well understood. In this issue of EMBO Reports, Sharma et al [1] identify the DNA damage-induced lncRNA DDSR1 as an integral...... player of the DNA damage response (DDR). DDSR1 has both an early role by modulating repair pathway choices, and a later function when it regulates gene expression. Sharma et al [1] thus uncover a dual role for a hitherto uncharacterized lncRNA during the cellular response to DNA damage....

  10. Autophagy in DNA Damage Response

    Directory of Open Access Journals (Sweden)

    Piotr Czarny

    2015-01-01

    Full Text Available DNA damage response (DDR involves DNA repair, cell cycle regulation and apoptosis, but autophagy is also suggested to play a role in DDR. Autophagy can be activated in response to DNA-damaging agents, but the exact mechanism underlying this activation is not fully understood, although it is suggested that it involves the inhibition of mammalian target of rapamycin complex 1 (mTORC1. mTORC1 represses autophagy via phosphorylation of the ULK1/2–Atg13–FIP200 complex thus preventing maturation of pre-autophagosomal structures. When DNA damage occurs, it is recognized by some proteins or their complexes, such as poly(ADPribose polymerase 1 (PARP-1, Mre11–Rad50–Nbs1 (MRN complex or FOXO3, which activate repressors of mTORC1. SQSTM1/p62 is one of the proteins whose levels are regulated via autophagic degradation. Inhibition of autophagy by knockout of FIP200 results in upregulation of SQSTM1/p62, enhanced DNA damage and less efficient damage repair. Mitophagy, one form of autophagy involved in the selective degradation of mitochondria, may also play role in DDR. It degrades abnormal mitochondria and can either repress or activate apoptosis, but the exact mechanism remains unknown. There is a need to clarify the role of autophagy in DDR, as this process may possess several important biomedical applications, involving also cancer therapy.

  11. DNA Topology and the Initiation of Virus DNA Packaging.

    Directory of Open Access Journals (Sweden)

    Choon Seok Oh

    Full Text Available During progeny assembly, viruses selectively package virion genomes from a nucleic acid pool that includes host nucleic acids. For large dsDNA viruses, including tailed bacteriophages and herpesviruses, immature viral DNA is recognized and translocated into a preformed icosahedral shell, the prohead. Recognition involves specific interactions between the viral packaging enzyme, terminase, and viral DNA recognition sites. Generally, viral DNA is recognized by terminase's small subunit (TerS. The large terminase subunit (TerL contains translocation ATPase and endonuclease domains. In phage lambda, TerS binds a sequence repeated three times in cosB, the recognition site. TerS binding to cosB positions TerL to cut the concatemeric DNA at the adjacent nicking site, cosN. TerL introduces staggered nicks in cosN, generating twelve bp cohesive ends. Terminase separates the cohesive ends and remains bound to the cosB-containing end, in a nucleoprotein structure called Complex I. Complex I docks on the prohead's portal vertex and translocation ensues. DNA topology plays a role in the TerSλ-cosBλ interaction. Here we show that a site, I2, located between cosN and cosB, is critically important for an early DNA packaging step. I2 contains a complex static bend. I2 mutations block DNA packaging. I2 mutant DNA is cut by terminase at cosN in vitro, but in vivo, no cos cleavage is detected, nor is there evidence for Complex I. Models for what packaging step might be blocked by I2 mutations are presented.

  12. The Triple Roles of Glutathione for a DNA-Cleaving DNAzyme and Development of a Fluorescent Glutathione/Cu2+-Dependent DNAzyme Sensor for Detection of Cu2+ in Drinking Water.

    Science.gov (United States)

    Wang, Shijin; Liu, Chengcheng; Li, Guiying; Sheng, Yongjie; Sun, Yanhong; Rui, Hongyue; Zhang, Jin; Xu, Jiacui; Jiang, Dazhi

    2017-03-24

    Pistol-like DNAzyme (PLDz) is an oxidative DNA-cleaving catalytic DNA with ascorbic acid as cofactor. Herein, glutathione was induced into the reaction system to maintain reduced ascorbic acid levels for higher efficient cleavage. However, data indicated that glutathione played triple roles in PLDz-catalyzed reactions. Glutathione alone had no effect on PLDz, and showed inhibitory effect on ascorbic acid-induced PLDz catalysis, but exhibited stimulating effect on Cu 2+ -promoted self-cleavage of PLDz. Further analysis of the effect of glutathione/Cu 2+ on PLDz indicated that H 2 O 2 played a key role in PLDz catalysis. Finally, we developed a fluorescent Cu 2+ sensor (PL-Cu 1.0) based on the relationship between glutathione/Cu 2+ and catalytic activity of PLDz. The fluorescent intensity showed a linear response toward the logarithm concentration of Cu 2+ over the range from 80 nM to 30 μM, with a detection limit of 21.1 nM. PL-Cu 1.0 provided only detection of Cu 2+ over other divalent metal ions. Ca 2+ and Mg 2+ could not interfere with Cu 2+ detection even at a 1000-fold concentration. We further applied PL-Cu 1.0 for Cu 2+ detection in tap and bottled water. Water stored in copper taps overnight had relatively high Cu 2+ concentrations, with a maximum 22.3 μM. Trace Cu 2+ (52.2 nM) in deep spring was detected among the tested bottled water. Therefore, PL-Cu 1.0 is feasible to detect Cu 2+ in drinking water, with a practical application.

  13. [Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

    Science.gov (United States)

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2016-01-01

    Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

  14. DNA translocation by human uracil DNA glycosylase: the case of single-stranded DNA and clustered uracils.

    Science.gov (United States)

    Schonhoft, Joseph D; Stivers, James T

    2013-04-16

    Human uracil DNA glycosylase (hUNG) plays a central role in DNA repair and programmed mutagenesis of Ig genes, requiring it to act on sparsely or densely spaced uracil bases located in a variety of contexts, including U/A and U/G base pairs, and potentially uracils within single-stranded DNA (ssDNA). An interesting question is whether the facilitated search mode of hUNG, which includes both DNA sliding and hopping, changes in these different contexts. Here we find that hUNG uses an enhanced local search mode when it acts on uracils in ssDNA, and also, in a context where uracils are densely clustered in duplex DNA. In the context of ssDNA, hUNG performs an enhanced local search by sliding with a mean sliding length larger than that of double-stranded DNA (dsDNA). In the context of duplex DNA, insertion of high-affinity abasic product sites between two uracil lesions serves to significantly extend the apparent sliding length on dsDNA from 4 to 20 bp and, in some cases, leads to directionally biased 3' → 5' sliding. The presence of intervening abasic product sites mimics the situation where hUNG acts iteratively on densely spaced uracils. The findings suggest that intervening product sites serve to increase the amount of time the enzyme remains associated with DNA as compared to nonspecific DNA, which in turn increases the likelihood of sliding as opposed to falling off the DNA. These findings illustrate how the search mechanism of hUNG is not predetermined but, instead, depends on the context in which the uracils are located.

  15. The role of DNA repair in the realization of oxygen effect in bacteria Escherichia coli irradiated with various types of radiation

    International Nuclear Information System (INIS)

    Kozubek, S.; Krasavin, E.A.

    1983-01-01

    The role of the balance of E. coli repair systems in the sensitivity to ionizing radiation of different LETs is considered. The influence of modifying factors on the balance between fast (2) and slow (3) repair systems is analysed. It is shown that in the case of γg-irradiation of aerobic cells the decreased power of repair 3 in some limits can be compensated by increased power of repair 2 so that the sensitivity remains constant. In anaerobic conditions decreasing power of repair 3 leads inevitably to markedly increased sensitivity. Different mechanisms of the action of radioprotectors on the repair balance in aerobic or anaerobic state are discussed. The role of repair balance in the radiosensitivity of irradiated wild type cells is shown to become unimportant for high LET radiation owing to the presence of markedly increased ratio of direct double-strand breaks

  16. The Role of ERK1/2 in the Progression of Anti-Androgen Resistance of mtDNA Deficient Prostate Cancer

    Science.gov (United States)

    2012-05-01

    cancers are not viable if mitochondria as a whole are removed. Mitochondria serve multiple roles for the eukaryote including ATP synthesis , redox...transcriptional and/or translational regulation, PTMs, and/or proteasomal degradation by both sterol and non- sterol products of the mevalonate pathway (46, 47...intermediate in the synthesis of cholesterol. Cell Metab. 2005;1(3):179-89. 49. Nguyen AD, McDonald JG, Bruick RK, DeBose-Boyd RA. Hypoxia stimulates

  17. Photocleavage of DNA by copper (II) complexes

    Indian Academy of Sciences (India)

    The chemistry of ternary and binary copper(II) complexes showing efficient visible lightinduced DNA cleavage activity is summarized in this article. The role of the metal in photo-induced DNA cleavage reactions is explored by designing complex molecules having a variety of ligands. Ternary copper(II) complexes with amino ...

  18. uv photobiology: DNA damage and repair

    International Nuclear Information System (INIS)

    Sutherland, B.M.

    1978-01-01

    The following topics are discussed: targets that determine the fate of the cell when uv light interacts with a cell; comparison of action spectrum for a given biological effect with the absorption spectrum of different biological macromolecules; biological effects of damage to DNA; measurement of mutations; chemical damage to DNA; photoreactivation; role of pyrimidine dimers in induction of skin cancer by uv

  19. Human Parvovirus B19 Utilizes Cellular DNA Replication Machinery for Viral DNA Replication.

    Science.gov (United States)

    Zou, Wei; Wang, Zekun; Xiong, Min; Chen, Aaron Yun; Xu, Peng; Ganaie, Safder S; Badawi, Yomna; Kleiboeker, Steve; Nishimune, Hiroshi; Ye, Shui Qing; Qiu, Jianming

    2018-03-01

    associated with the replicating single-stranded DNA viral genome and played a critical role in viral DNA replication. In contrast, the DNA damage response-induced phosphorylated forms of RPA32 were dispensable for viral DNA replication. Copyright © 2018 American Society for Microbiology.

  20. Role of the DNA Mismatch Repair Gene MutS4 in Driving the Evolution of Mycobacterium yongonense Type I via Homologous Recombination.

    Science.gov (United States)

    Kim, Byoung-Jun; Kim, Bo-Ram; Kook, Yoon-Hoh; Kim, Bum-Joon

    2017-01-01

    We recently showed that Mycobacterium yongonense could be divided into two genotypes: Type I, in which the rpoB gene has been transferred from Mycobacterium parascrofulaceum , and Type II, in which the rpoB gene has not been transferred. Comparative genome analysis of three M. yongonense Type I, two M. yongonense Type II and M. parascrofulaceum type strains were performed in this study to gain insight into gene transfer from M. parascrofulaceum into M. yongonense Type I strains. We found two genome regions transferred from M. parascrofulaceum : one contained 3 consecutive genes, including the rpoBC operon, and the other contained 57 consecutive genes that had been transferred into M. yongonense Type I genomes via homologous recombination. Further comparison between the M. yongonense Type I and II genomes revealed that Type I, but not Type II has a distinct DNA mismatch repair gene ( MutS4 subfamily) that was possibly transferred via non-homologous recombination from other actinomycetes. We hypothesized that it could facilitate homologous recombination from the M. parascrofulaceum to the M. yongonense Type I genomes. We therefore generated recombinant Mycobacterium smegmatis containing a MutS4 operon of M. yongonense . We found that the M. tuberculosis rpoB fragment with a rifampin resistance-conferring mutation was more frequently inserted into recombinant M. smegmatis than the wild type, suggesting that MutS4 is a driving force in the gene transfer from M. parascrofulaceum to M. yongonense Type I strains via homologous recombination. In conclusion, our data indicated that MutS4 in M. yongonense Type I genomes may drive gene transfer from M. parascrofulaceum via homologous recombination, resulting in division of M. yongonense into two genotypes, Type I and II.

  1. Role of the DNA Mismatch Repair Gene MutS4 in Driving the Evolution of Mycobacterium yongonense Type I via Homologous Recombination

    Directory of Open Access Journals (Sweden)

    Byoung-Jun Kim

    2017-12-01

    Full Text Available We recently showed that Mycobacterium yongonense could be divided into two genotypes: Type I, in which the rpoB gene has been transferred from Mycobacterium parascrofulaceum, and Type II, in which the rpoB gene has not been transferred. Comparative genome analysis of three M. yongonense Type I, two M. yongonense Type II and M. parascrofulaceum type strains were performed in this study to gain insight into gene transfer from M. parascrofulaceum into M. yongonense Type I strains. We found two genome regions transferred from M. parascrofulaceum: one contained 3 consecutive genes, including the rpoBC operon, and the other contained 57 consecutive genes that had been transferred into M. yongonense Type I genomes via homologous recombination. Further comparison between the M. yongonense Type I and II genomes revealed that Type I, but not Type II has a distinct DNA mismatch repair gene (MutS4 subfamily that was possibly transferred via non-homologous recombination from other actinomycetes. We hypothesized that it could facilitate homologous recombination from the M. parascrofulaceum to the M. yongonense Type I genomes. We therefore generated recombinant Mycobacterium smegmatis containing a MutS4 operon of M. yongonense. We found that the M. tuberculosis rpoB fragment with a rifampin resistance-conferring mutation was more frequently inserted into recombinant M. smegmatis than the wild type, suggesting that MutS4 is a driving force in the gene transfer from M. parascrofulaceum to M. yongonense Type I strains via homologous recombination. In conclusion, our data indicated that MutS4 in M. yongonense Type I genomes may drive gene transfer from M. parascrofulaceum via homologous recombination, resulting in division of M. yongonense into two genotypes, Type I and II.

  2. Peptide Dendrimer/Lipid Hybrid Systems Are Efficient DNA Transfection Reagents: Structure–Activity Relationships Highlight the Role of Charge Distribution Across Dendrimer Generations

    Science.gov (United States)

    2013-01-01

    Efficient DNA delivery into cells is the prerequisite of the genetic manipulation of organisms in molecular and cellular biology as well as, ultimately, in nonviral gene therapy. Current reagents, however, are relatively inefficient, and structure–activity relationships to guide their improvement are hard to come by. We now explore peptide dendrimers as a new type of transfection reagent and provide a quantitative framework for their evaluation. A collection of dendrimers with cationic and hydrophobic amino acid motifs (such as KK, KA, KH, KL, and LL) distributed across three dendrimer generations was synthesized by a solid-phase protocol that provides ready access to dendrimers in milligram quantities. In conjunction with a lipid component (DOTMA/DOPE), the best reagent, G1,2,3-KL ((LysLeu)8(LysLysLeu)4(LysLysLeu)2LysGlySerCys-NH2), improves transfection by 6–10-fold over commercial reagents under their respective optimal conditions. Emerging structure–activity relationships show that dendrimers with cationic and hydrophobic residues distributed in each generation are transfecting most efficiently. The trigenerational dendritic structure has an advantage over a linear analogue worth up to an order of magnitude. The success of placing the decisive cationic charge patterns in inner shells rather than previously on the surface of macromolecules suggests that this class of dendrimers significantly differs from existing transfection reagents. In the future, this platform may be tuned further and coupled to cell-targeting moieties to enhance transfection and cell specificity. PMID:23682947

  3. Autophosphorylation of DNA-PKCS regulates its dynamics at DNA double-strand breaks.

    Science.gov (United States)

    Uematsu, Naoya; Weterings, Eric; Yano, Ken-ichi; Morotomi-Yano, Keiko; Jakob, Burkhard; Taucher-Scholz, Gisela; Mari, Pierre-Olivier; van Gent, Dik C; Chen, Benjamin P C; Chen, David J

    2007-04-23

    The DNA-dependent protein kinase catalytic subunit (DNA-PK(CS)) plays an important role during the repair of DNA double-strand breaks (DSBs). It is recruited to DNA ends in the early stages of the nonhomologous end-joining (NHEJ) process, which mediates DSB repair. To study DNA-PK(CS) recruitment in vivo, we used a laser system to introduce DSBs in a specified region of the cell nucleus. We show that DNA-PK(CS) accumulates at DSB sites in a Ku80-dependent manner, and that neither the kinase activity nor the phosphorylation status of DNA-PK(CS) influences its initial accumulation. However, impairment of both of these functions results in deficient DSB repair and the maintained presence of DNA-PK(CS) at unrepaired DSBs. The use of photobleaching techniques allowed us to determine that the kinase activity and phosphorylation status of DNA-PK(CS) influence the stability of its binding to DNA ends. We suggest a model in which DNA-PK(CS) phosphorylation/autophosphorylation facilitates NHEJ by destabilizing the interaction of DNA-PK(CS) with the DNA ends.

  4. Recruitment of DNA methyltransferase I to DNA repair sites

    Science.gov (United States)

    Mortusewicz, Oliver; Schermelleh, Lothar; Walter, Joachim; Cardoso, M. Cristina; Leonhardt, Heinrich

    2005-01-01

    In mammalian cells, the replication of genetic and epigenetic information is directly coupled; however, little is known about the maintenance of epigenetic information in DNA repair. Using a laser microirradiation system to introduce DNA lesions at defined subnuclear sites, we tested whether the major DNA methyltransferase (Dnmt1) or one of the two de novo methyltransferases (Dnmt3a, Dnmt3b) are recruited to sites of DNA repair in vivo. Time lapse microscopy of microirradiated mammalian cells expressing GFP-tagged Dnmt1, Dnmt3a, or Dnmt3b1 together with red fluorescent protein-tagged proliferating cell nuclear antigen (PCNA) revealed that Dnmt1 and PCNA accumulate at DNA damage sites as early as 1 min after irradiation in S and non-S phase cells, whereas recruitment of Dnmt3a and Dnmt3b was not observed. Deletion analysis showed that Dnmt1 recruitment was mediated by the PCNA-binding domain. These data point to a direct role of Dnmt1 in the restoration of epigenetic information during DNA repair. PMID:15956212

  5. A DNA Microarray Analysis of Chemokine and Receptor Genes in the Rat Dental Follicle – Role of Secreted Frizzled-Related Protein-1 in Osteoclastogenesis

    Science.gov (United States)

    Liu, Dawen; Wise, Gary E.

    2007-01-01

    The dental follicle, a loose connective tissue sac that surrounds the unerupted tooth, appears to regulate the osteoclastogenesis needed for eruption; i.e., bone resorption to form an eruption pathway. Thus, DNA microarray studies were conducted to determine which chemokines and their receptors were expressed chronologically in the dental follicle, chemokines that might attract osteoclast precursors. In the rat first mandibular molar, a major burst of osteoclastogenesis occurs at day 3 with a minor burst at day 10. The results of the microarray confirmed our previous studies showing the gene expression of molecules such as CSF-1 and MCP-1 in the dental follicle cells. Other new genes also were detected, including secreted frizzled-related protein-1 (SFRP-1), which was found to be down-regulated at days 3 and 9. Using rat bone marrow cultures to conduct in vitro osteoclastogenic assays, it was demonstrated that SFRP-1 inhibited osteoclast formation in a concentration-dependent fashion. However, with increasing concentrations of SFRP-1, the number of TRAP-positive mononuclear cells increased suggesting that SFRP-1 inhibits osteoclast formation by inhibiting the fusion of mononuclear cells (osteoclast precursors). Co-culturing bone marrow mononuclear cells and dental follicle cells demonstrated that the dental follicle cells were secreting a product(s) that inhibited osteoclastogenesis, as measured by counting of TRAP-positive osteoclasts. Adding an antibody either to SFRP-1 or OPG partially restored osteoclastogenesis. Adding both anti-SFRP-1 and anti-OPG fully negated the inhibitory effect of the follicle cells upon osteoclastogenesis. These results strongly suggest that SFRP-1 and OPG, both secreted by the dental follicle cells, use different pathways to exert their inhibitory effect on osteoclastogenesis. Based on these in vitro studies of osteoclastogenesis, it is likely that the down-regulation of SFRP-1 gene expression in the dental follicle at days 3 and 9 is

  6. Inhibiting DNA Polymerases as a Therapeutic Intervention against Cancer

    Directory of Open Access Journals (Sweden)

    Anthony J. Berdis

    2017-11-01

    Full Text Available Inhibiting DNA synthesis is an important therapeutic strategy that is widely used to treat a number of hyperproliferative diseases including viral infections, autoimmune disorders, and cancer. This chapter describes two major categories of therapeutic agents used to inhibit DNA synthesis. The first category includes purine and pyrmidine nucleoside analogs that directly inhibit DNA polymerase activity. The second category includes DNA damaging agents including cisplatin and chlorambucil that modify the composition and structure of the nucleic acid substrate to indirectly inhibit DNA synthesis. Special emphasis is placed on describing the molecular mechanisms of these inhibitory effects against chromosomal and mitochondrial DNA polymerases. Discussions are also provided on the mechanisms associated with resistance to these therapeutic agents. A primary focus is toward understanding the roles of specialized DNA polymerases that by-pass DNA lesions produced by DNA damaging agents. Finally, a section is provided that describes emerging areas in developing new therapeutic strategies targeting specialized DNA polymerases.

  7. Impact of Consuming Extra-Virgin Olive Oil or Nuts within a Mediterranean Diet on DNA Methylation in Peripheral White Blood Cells within the PREDIMED-Navarra Randomized Controlled Trial: A Role for Dietary Lipids.

    Science.gov (United States)

    Arpón, Ana; Milagro, Fermín I; Razquin, Cristina; Corella, Dolores; Estruch, Ramón; Fitó, Montserrat; Marti, Amelia; Martínez-González, Miguel A; Ros, Emilio; Salas-Salvadó, Jordi; Riezu-Boj, José-Ignacio; Martínez, J Alfredo

    2017-12-23

    DNA methylation could be reversible and mouldable by environmental factors, such as dietary exposures. The objective was to analyse whether an intervention with two Mediterranean diets, one rich in extra-virgin olive oil (MedDiet + EVOO) and the other one in nuts (MedDiet + nuts), was influencing the methylation status of peripheral white blood cells (PWBCs) genes. A subset of 36 representative individuals were selected within the PREvención con DIeta MEDiterránea (PREDIMED-Navarra) trial, with three intervention groups in high cardiovascular risk volunteers: MedDiet + EVOO, MedDiet + nuts, and a low-fat control group. Methylation was assessed at baseline and at five-year follow-up. Ingenuity pathway analysis showed routes with differentially methylated CpG sites (CpGs) related to intermediate metabolism, diabetes, inflammation, and signal transduction. Two CpGs were specifically selected: cg01081346- CPT1B / CHKB-CPT1B and cg17071192- GNAS/GNASAS , being associated with intermediate metabolism. Furthermore, cg01081346 was associated with PUFAs intake, showing a role for specific fatty acids on epigenetic modulation. Specific components of MedDiet, particularly nuts and EVOO, were able to induce methylation changes in several PWBCs genes. These changes may have potential benefits in health; especially those changes in genes related to intermediate metabolism, diabetes, inflammation and signal transduction, which may contribute to explain the role of MedDiet and fat quality on health outcomes.