Cloning, expression and characterization of COI1 gene (AsCOI1 from Aquilaria sinensis (Lour. Gilg
Directory of Open Access Journals (Sweden)
Yongcui Liao
2015-09-01
Full Text Available Aquilaria sinensis, a kind of typically wounding-induced medicinal plant with a great economical value, is widely used in the production of traditional Chinese medicine, perfume and incense. Coronatine-insensitive protein 1 (COI1 acts as a receptor in jasmonate (JA signaling pathway, and regulates the expression of JA-responsive genes in plant defense. However, little is known about the COI1 gene in A. sinensis. Here, based on the transcriptome data, a full-length cDNA sequence of COI1 (termed as AsCOI1 was firstly cloned by RT–PCR and rapid-amplification of cDNA ends (RACE strategies. AsCOI1 is 2330 bp in length (GenBank accession No. KM189194, and contains a complete open frame (ORF of 1839 bp. The deduced protein was composed of 612 amino acids, with a predicted molecular weight of 68.93 kDa and an isoelectric point of 6.56, and was predicted to possess F-box and LRRs domains. Combining bioinformatics prediction with subcellular localization experiment analysis, AsCOI1 was appeared to locate in nucleus. AsCOI1 gene was highly expressed in roots and stems, the major organs of agarwood formation. Methyl jasmonate (MeJA, mechanical wounding and heat stress could significantly induce the expression level of AsCOI1 gene. AsCOI1 is an early wound-responsive gene, and it likely plays some role in agarwood formation.
DNA Barcoding the Medusozoa using mtCOI
Ortman, Brian D.; Bucklin, Ann; Pagès, Francesc; Youngbluth, Marsh
2010-12-01
The Medusozoa are a clade within the Cnidaria comprising the classes Hydrozoa, Scyphozoa, and Cubozoa. Identification of medusozoan species is challenging, even for taxonomic experts, due to their fragile forms and complex, morphologically-distinct life history stages. In this study 231 sequences for a portion of the mitochondrial Cytochrome Oxidase I (mtCOI) gene were obtained from 95 species of Medusozoans including; 84 hydrozoans (61 siphonophores, eight anthomedusae, four leptomedusae, seven trachymedusae, and four narcomedusae), 10 scyphozoans (three coronatae, four semaeostomae, two rhizostomae, and one stauromedusae), and one cubozoan. This region of mtCOI has been used as a DNA barcode (i.e., a molecular character for species recognition and discrimination) for a diverse array of taxa, including some Cnidaria. Kimura 2-parameter (K2P) genetic distances between sequence variants within species ranged from 0 to 0.057 (mean 0.013). Within the 13 genera for which multiple species were available, K2P distance between congeneric species ranged from 0.056 to 0.381. A cluster diagram generated by Neighbor Joining (NJ) using K2P distances reliably clustered all barcodes of the same species with ≥99% bootstrap support, ensuring accurate identification of species. Intra- and inter-specific variation of the mtCOI gene for the Medusozoa are appropriate for this gene to be used as a DNA barcode for species-level identification, but not for phylogenetic analysis or taxonomic classification of unknown sequences at higher taxonomic levels. This study provides a set of molecular tools that can be used to address questions of speciation, biodiversity, life-history, and population boundaries in the Medusozoa.
Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina).
Dentinger, Bryn T M; Didukh, Maryna Y; Moncalvo, Jean-Marc
2011-01-01
DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (~450 bp) representing ~100 morphospecies from ~650 collections of Agaricomycotina using several sets of new primers. Large introns (~1500 bp) at variable locations were detected in ~5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (~30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms.
COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.
Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K
2009-09-01
Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.
Bakar, Mohamad-Azam Akmal Abu; Rovie-Ryan, Jeffrine Japning; Ampeng, Ahmad; Yaakop, Salmah; Nor, Shukor Md; Md-Zain, Badrul Munir
2018-04-01
Mousedeer is one of the primitive mammals that can be found mainly in Southeast-Asia region. There are two species of mousedeer in Malaysia which are Tragulus kanchil and Tragulus napu. Both species can be distinguish by size, coat coloration, and throat pattern but clear diagnosis still cannot be found. The objective of the study is to show the genetic distance relationship between T. kanchil and T. napu and their population based on mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and D-loop region. There are 42 sample of mousedeer were used in this study collected by PERHILITAN from different locality. Another 29 D-loop sequence were retrieved from Genbank for comparative analysis. All sample were amplified using universal primer and species-specific primer for COI and D-loop genes via PCR process. The amplified sequences were analyzed to determine genetic distance of T. kanchil and T. napu. From the analysis, the average genetic distance between T. kanchil and T. napu based on locus COI and D-loop were 0.145 and 0.128 respectively. The genetic distance between populations of T. kanchil based on locus COI was between 0.003-0.013. For locus D-loop, genetic distance analysis showed distance in relationship between west-coast populations to east-coast population of T. kanchil. COI and D-loop mtDNA region provided a clear picture on the relationship within the mousedeer species. Last but not least, conservation effort toward protecting this species can be done by study the molecular genetics and prevent the extinction of this species.
Directory of Open Access Journals (Sweden)
Mahir Budak
2011-09-01
Full Text Available Cephinae is traditionally divided into three tribes and about 24 genera based on morphology and host utilization. There has been no study testing the monophyly of taxa under a strict phylogenetic criterion. A molecular phylogeny of Cephinae based on a total of 68 sequences of mtDNA COI gene, representing seven genera of Cephinae, is reconstructed to test the traditional limits and relationships of taxa. Monophyly of the traditional tribes is not supported. Monophyly of the genera are largely supported except for Pachycephus. A few host shift events are suggested based on phylogenetic relationships among taxa. These results indicate that a more robust phylogeny is required for a more plausible conclusion. We also report two species of Cephus for the first time from Turkey.
Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians
Directory of Open Access Journals (Sweden)
Chiari Ylenia
2005-03-01
Full Text Available Abstract Background Identifying species of organisms by short sequences of DNA has been in the center of ongoing discussions under the terms DNA barcoding or DNA taxonomy. A C-terminal fragment of the mitochondrial gene for cytochrome oxidase subunit I (COI has been proposed as universal marker for this purpose among animals. Results Herein we present experimental evidence that the mitochondrial 16S rRNA gene fulfills the requirements for a universal DNA barcoding marker in amphibians. In terms of universality of priming sites and identification of major vertebrate clades the studied 16S fragment is superior to COI. Amplification success was 100% for 16S in a subset of fresh and well-preserved samples of Madagascan frogs, while various combination of COI primers had lower success rates.COI priming sites showed high variability among amphibians both at the level of groups and closely related species, whereas 16S priming sites were highly conserved among vertebrates. Interspecific pairwise 16S divergences in a test group of Madagascan frogs were at a level suitable for assignment of larval stages to species (1–17%, with low degrees of pairwise haplotype divergence within populations (0–1%. Conclusion We strongly advocate the use of 16S rRNA as standard DNA barcoding marker for vertebrates to complement COI, especially if samples a priori could belong to various phylogenetically distant taxa and false negatives would constitute a major problem.
Nagy, Zoltán T; Sonet, Gontran; Glaw, Frank; Vences, Miguel
2012-01-01
DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7-100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41-48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge.
Ordoñez, June Feliciano F; Ventolero, Minerva Fatimae H; Santos, Mudjekeewis D
2017-07-01
The introduction of genetically enhanced tilapia has significantly boosted the performance of Philippine aquaculture industry. While enhanced strains contribute to the increase in tilapia production, genetic characterization of present tilapia stocks is critical to maintain their quality and to ensure the genetic gains are sustained. To understand and determine the genetic relationship of the genetically enhanced strains produced in the Philippines, mitochondrial cytochrome oxidase subunit I (COI) gene using DNA barcoding approach was analyzed. Specimens representing 10 genetically enhanced strains (GIFT, FaST, GET-EXCEL, GST, SST, COLD, YY-male, GMT, Molobicus, and BEST), three red tilapia (Taiwan red, Florida red, and FAC-red), and two pure lines (initially identified as O. aureus and O. spilurus) were collected, sequenced, and identified using DNA barcoding. Results revealed that farmed tilapias consisted of four different Oreochromis species. As expected, COI could not distinguish individuals at the strain level but surprisingly, mismatch between the species of maternal origin and present-day offspring was observed. This particular result may pose a question on the genetic purity and integrity of the strains being distributed to farmers and suggests a re-evaluation of the effectiveness of major tilapia breeding centers in maintaining their stocks.
Lan, Zhao Jun; Lin, Long Feng; Zhao, Jun
2017-04-18
Both Hemibarbus labeo and H. medius (Cypriniformes: Cyprinidae: Gobioninae) are primary freshwater fishes and are widely distributed. As such, they provide an ideal model for phylogeographical studies. However, the similarity in morphological characters between these two species made the description of their distributions and the validation of species quite challenging. Here we employed variations in the DNA sequences of mitochondrial COI and ND5 genes (2151 bp) to solve this challenge and to study the population genetics structure of these two species. Among the 130 specimens belonging to 8 populations of H. labeo and 9 populations of H. medius from 17 drainage systems in southern China,196 variable sites (9.1% in the full sequences) falling into 50 haplotypes were identified. The haplotype diversity (h) and the nucleotide diversity (π) were 0.964 and 0.019, respectively, indicating a high level of genetic diversity and an evolutionary potential in both species. The result of neighbor-joining tree based on composite nucleotide sequences of the mtDNA COI and ND5 genes showed that the H. labeo and H. medius fell into two major clades (clade1and clade2): clade1was composed of some specimens of Oujiang River, all the specimens of Hanjiang River and Jiulongjiang River, whereas all remaining populations fell in clade2. The genetic distance between clade I and clade II was 0.036, while that between H. labeo and H. medius was 0.027. The haplotype network analyses indicated that the populations of Hanjiang River and Jiulongjiang River had relatively high genetic variation with the rest rivers. The po-pulations of Hainan Island migrated northward to Moyangjaing River. Haplotypes of the rivers of Hainan Island and Moyangjang River had relatively higher genetic variation with the Yangtze River than Pearl River. The populations of Xiangjiang River had no genetic variation with the populations of Guijiang River and Liujiang River. Analysis of molecular variance (AMOVA
We utilized two molecular methods to aid in resolving the Gonatocerus tuberculifemur complex, potential glassy-winged sharpshooter (GWSS) biological control candidate agents from South America. The two methods used were DNA sequencing of both the mitochondrial cytochrome oxidase subunit 1 gene (COI...
Nagy, Zoltán T.; Sonet, Gontran; Glaw, Frank; Vences, Miguel
2012-01-01
Background DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Methodology/Principal Findings Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7–100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41–48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. Conclusions/Significance The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade
Species Authentication of Common Meat Based on PCR Analysis of the Mitochondrial COI Gene.
Dai, Zhenyu; Qiao, Jiao; Yang, Siran; Hu, Shen; Zuo, Jingjing; Zhu, Weifeng; Huang, Chunhong
2015-07-01
Adulteration of meat products and costly animal-derived commodities with their inferior/cheaper counterparts is a grievous global problem. Species authentication is still technical challenging, especially to those deep processed products. The present study described the design of seven sets of species-specific primer based on a high heterozygous region of mitochondrial cytochrome c oxidase subunit I (COI) gene. These primers were proven to have high species specificity and no cross-reactions and unexpected products to different DNA source. Multiplex PCR assay was achieved for rapid and economical identification of four commonly consumed meats (pork, beef, chicken, and mutton). The conventional PCR assay was sensitive down to 0.001 ng of DNA template in the reactant. The developed method was also powerful in detecting as low as 0.1-mg adulterated pork (0.05 % in wt/wt) in an artificial counterfeited mutton. Validation test showed that the assay is specific, reproducible, and robust in commercial deep processed meats, leatherware, and feather commodities. This proposed method will be greatly beneficial to the consumers, food industry, leather, and feather commodity manufacture.
Molecular phylogeny of Anopheles hyrcanus group (Diptera: Culicidae) based on mtDNA COI.
Fang, Yuan; Shi, Wen-Qi; Zhang, Yi
2017-05-08
The Anopheles hyrcanus group, which includes at least 25 species, is widely distributed in the Oriental and Palearctic regions. Some group members have been incriminated as vectors of malaria and other mosquito-borne diseases. It is difficult to identify Hyrcanus Group members by morphological features. Thus, molecular phylogeny has been proposed as an important complementary method to traditional morphological taxonomy. Based on the GenBank database and our original study data, we used 466 mitochondrial DNA COI sequences belonging to 18 species to reconstruct the molecular phylogeny of the Hyrcanus Group across its worldwide geographic range. The results are as follows. 1) The average conspecific K2P divergence was 0.008 (range 0.002-0.017), whereas sequence divergence between congroup species averaged 0.064 (range 0.026-0.108). 2) The topology of COI tree of the Hyrcanus Group was generally consistent with classical morphological taxonomy in terms of species classification, but disagreed in subgroup division. In the COI tree, the group was divided into at least three main clusters. The first cluster contained An. nimpe; the second was composed of the Nigerrimus Subgroup and An. argyropus; and the third cluster was comprised of the Lesteri Subgroup and other unassociated species. 3) Phylogenetic analysis of COI indicated that ancient hybridizations probably occurred among the three closely related species, An. sinensis, An. belenrae, and An. kleini. 4) The results supported An. paraliae as a probable synonym of An. lesteri, and it was possible that An. pseudopictus and An. hyrcanus were the same species, as evident from their extremely low interspecific genetic divergence (0.020 and 0.007, respectively) and their phylogenetic positions. In summary, we reconstructed the molecular phylogeny and analysed genetic divergence of the Hyrcanus Group using mitochondrial COI sequences. Our results suggest that in the future of malaria surveillance, we should not only pay
Metz, Edward C.; Robles-Sikisaka, Refugio; Vacquier, Victor D.
1998-01-01
Strong positive Darwinian selection acts on two sperm fertilization proteins, lysin and 18-kDa protein, from abalone (Haliotis). To understand the phylogenetic context for this dramatic molecular evolution, we obtained sequences of mitochondrial cytochrome c oxidase subunit I (mtCOI), and genomic sequences of lysin, 18-kDa, and a G protein subunit. Based on mtDNA differentiation, four north Pacific abalone species diverged within the past 2 million years (Myr), and remaining north Pacific species diverged over a period of 4–20 Myr. Between-species nonsynonymous differences in lysin and 18-kDa exons exceed nucleotide differences in introns by 3.5- to 24-fold. Remarkably, in some comparisons nonsynonymous substitutions in lysin and 18-kDa genes exceed synonymous substitutions in mtCOI. Lysin and 18-kDa intron/exon segments were sequenced from multiple red abalone individuals collected over a 1,200-km range. Only two nucleotide changes and two sites of slippage variation were detected in a total of >29,000 nucleotides surveyed. However, polymorphism in mtCOI and a G protein intron was found in this species. This finding suggests that positive selection swept one lysin allele and one 18-kDa allele to fixation. Similarities between mtCOI and lysin gene trees indicate that rapid adaptive evolution of lysin has occurred consistently through the history of the group. Comparisons with mtCOI molecular clock calibrations suggest that nonsynonymous substitutions accumulate 2–50 times faster in lysin and 18-kDa genes than in rapidly evolving mammalian genes. PMID:9724763
Species-level para- and polyphyly in DNA barcode gene trees
DEFF Research Database (Denmark)
Mutanen, Marko; Kivelä, Sami M.; Vos, Rutger A.
2016-01-01
was paid to accurate species identification to ensure data integrity. We investigated the effects of tree-building method, sampling effort, and other methodological issues, all of which can influence estimates of non-monophyly. We found a 12% incidence of non-monophyly, a value significantly lower than...... between species and gene genealogies, as indicated by situations where conspecific individuals do not form a monophyletic cluster in a gene tree. In two previous reviews, non-monophyly has been reported as being common in mitochondrial DNA gene trees. We developed a novel web service "Monophylizer......" to detect non-monophyly in phylogenetic trees and used it to ascertain the incidence of species non-monophyly in COI (a.k.a. cox1) barcode sequence data from 4977 species and 41,583 specimens of European Lepidoptera, the largest data set of DNA barcodes analyzed from this regard. Particular attention...
Joseph, Sneha; Poriya, Paresh; Kundu, Rahul
2016-11-01
The present study reports the phylogenetic relationship of six zoanthid species belonging to three genera, Isaurus, Palythoa, and Zoanthus identified using systematic computational analysis of mtDNA gene sequences. All six species are first recorded from the coasts of Kathiawar Peninsula, India. Genus: Isaurus is represented by Isaurus tuberculatus, genus Zoanthus is represented by Zoanthus kuroshio and Zoanthus sansibaricus, while genus Palythoa is represented by Palythoa tuberculosa, P. sp. JVK-2006 and Palythoa heliodiscus. Results of the present study revealed that among the various species observed along the coastline, a minimum of 99% sequence divergence and a maximum of 96% sequence divergence were seen. An interspecific divergence of 1-4% and negligible intraspecific divergence was observed. These results not only highlighted the efficiency of the COI gene region in species identification but also demonstrated the genetic variability of zoanthids along the Saurashtra coastline of the west coast of India.
Directory of Open Access Journals (Sweden)
Tomoko Matsuda
Full Text Available The spider mite sub-family Tetranychinae includes many agricultural pests. The internal transcribed spacer (ITS region of nuclear ribosomal RNA genes and the cytochrome c oxidase subunit I (COI gene of mitochondrial DNA have been used for species identification and phylogenetic reconstruction within the sub-family Tetranychinae, although they have not always been successful. The 18S and 28S rRNA genes should be more suitable for resolving higher levels of phylogeny, such as tribes or genera of Tetranychinae because these genes evolve more slowly and are made up of conserved regions and divergent domains. Therefore, we used both the 18S (1,825-1,901 bp and 28S (the 5' end of 646-743 bp rRNA genes to infer phylogenetic relationships within the sub-family Tetranychinae with a focus on the tribe Tetranychini. Then, we compared the phylogenetic tree of the 18S and 28S genes with that of the mitochondrial COI gene (618 bp. As observed in previous studies, our phylogeny based on the COI gene was not resolved because of the low bootstrap values for most nodes of the tree. On the other hand, our phylogenetic tree of the 18S and 28S genes revealed several well-supported clades within the sub-family Tetranychinae. The 18S and 28S phylogenetic trees suggest that the tribes Bryobiini, Petrobiini and Eurytetranychini are monophyletic and that the tribe Tetranychini is polyphyletic. At the genus level, six genera for which more than two species were sampled appear to be monophyletic, while four genera (Oligonychus, Tetranychus, Schizotetranychus and Eotetranychus appear to be polyphyletic. The topology presented here does not fully agree with the current morphology-based taxonomy, so that the diagnostic morphological characters of Tetranychinae need to be reconsidered.
Dai, Qing-Yan; Gao, Qiang; Wu, Chun-Sheng; Chesters, Douglas; Zhu, Chao-Dong; Zhang, Ai-Bing
2012-01-01
Unlike distinct species, closely related species offer a great challenge for phylogeny reconstruction and species identification with DNA barcoding due to their often overlapping genetic variation. We tested a sibling species group of pine moth pests in China with a standard cytochrome c oxidase subunit I (COI) gene and two alternative internal transcribed spacer (ITS) genes (ITS1 and ITS2). Five different phylogenetic/DNA barcoding analysis methods (Maximum likelihood (ML)/Neighbor-joining (NJ), "best close match" (BCM), Minimum distance (MD), and BP-based method (BP)), representing commonly used methodology (tree-based and non-tree based) in the field, were applied to both single-gene and multiple-gene analyses. Our results demonstrated clear reciprocal species monophyly for three relatively distant related species, Dendrolimus superans, D. houi, D. kikuchii, as recovered by both single and multiple genes while the phylogenetic relationship of three closely related species, D. punctatus, D. tabulaeformis, D. spectabilis, could not be resolved with the traditional tree-building methods. Additionally, we find the standard COI barcode outperforms two nuclear ITS genes, whatever the methods used. On average, the COI barcode achieved a success rate of 94.10-97.40%, while ITS1 and ITS2 obtained a success rate of 64.70-81.60%, indicating ITS genes are less suitable for species identification in this case. We propose the use of an overall success rate of species identification that takes both sequencing success and assignation success into account, since species identification success rates with multiple-gene barcoding system were generally overestimated, especially by tree-based methods, where only successfully sequenced DNA sequences were used to construct a phylogenetic tree. Non-tree based methods, such as MD, BCM, and BP approaches, presented advantages over tree-based methods by reporting the overall success rates with statistical significance. In addition, our
Directory of Open Access Journals (Sweden)
Qing-Yan Dai
Full Text Available Unlike distinct species, closely related species offer a great challenge for phylogeny reconstruction and species identification with DNA barcoding due to their often overlapping genetic variation. We tested a sibling species group of pine moth pests in China with a standard cytochrome c oxidase subunit I (COI gene and two alternative internal transcribed spacer (ITS genes (ITS1 and ITS2. Five different phylogenetic/DNA barcoding analysis methods (Maximum likelihood (ML/Neighbor-joining (NJ, "best close match" (BCM, Minimum distance (MD, and BP-based method (BP, representing commonly used methodology (tree-based and non-tree based in the field, were applied to both single-gene and multiple-gene analyses. Our results demonstrated clear reciprocal species monophyly for three relatively distant related species, Dendrolimus superans, D. houi, D. kikuchii, as recovered by both single and multiple genes while the phylogenetic relationship of three closely related species, D. punctatus, D. tabulaeformis, D. spectabilis, could not be resolved with the traditional tree-building methods. Additionally, we find the standard COI barcode outperforms two nuclear ITS genes, whatever the methods used. On average, the COI barcode achieved a success rate of 94.10-97.40%, while ITS1 and ITS2 obtained a success rate of 64.70-81.60%, indicating ITS genes are less suitable for species identification in this case. We propose the use of an overall success rate of species identification that takes both sequencing success and assignation success into account, since species identification success rates with multiple-gene barcoding system were generally overestimated, especially by tree-based methods, where only successfully sequenced DNA sequences were used to construct a phylogenetic tree. Non-tree based methods, such as MD, BCM, and BP approaches, presented advantages over tree-based methods by reporting the overall success rates with statistical significance. In
Zhang, Cheng; Li, Qingqing; Wu, Xugan; Liu, Qing; Cheng, Yongxu
2017-11-20
The Chinese mitten crab, Eriocheir sinensis, is one of the important native crab species in East Asian region, which has been widely cultured throughout China, particularly in river basins of Yangtze, Huanghe and Liaohe. This study was designed to evaluate the genetic diversity and genetic structure of cultured and wild E. sinensis populations from the three river basins based on mitochondrial DNA (mtDNA) cytochrome oxidase subunit I (COI) and cytochrome b (Cyt b). The results showed that there were 62 variable sites and 30 parsimony informative sites in the 647 bp of sequenced mtDNA COI from 335 samples. Similarly, a 637 bp segment of Cyt b provided 59 variable sites and 26 parsimony informative sites. AMOVA showed that the levels of genetic differentiation were low among six populations. Although the haplotype diversity and nucleotide diversity of Huanghe wild population had slightly higher than the other populations, there were no significant differences. There was no significant differentiation between the genetic and geographic distance of the six populations, and haplotype network diagram indicated that there may exist genetic hybrids of E. sinensis from different river basins. The results of clustering and neutrality tests revealed that the distance of geographical locations were not completely related to their genetic distance values for the six populations. In conclusion, these results have great significance for the evaluation and exploitation of germplasm resources of E. sinensis.
Wolbachia and DNA barcoding insects: patterns, potential, and problems.
Smith, M Alex; Bertrand, Claudia; Crosby, Kate; Eveleigh, Eldon S; Fernandez-Triana, Jose; Fisher, Brian L; Gibbs, Jason; Hajibabaei, Mehrdad; Hallwachs, Winnie; Hind, Katharine; Hrcek, Jan; Huang, Da-Wei; Janda, Milan; Janzen, Daniel H; Li, Yanwei; Miller, Scott E; Packer, Laurence; Quicke, Donald; Ratnasingham, Sujeevan; Rodriguez, Josephine; Rougerie, Rodolphe; Shaw, Mark R; Sheffield, Cory; Stahlhut, Julie K; Steinke, Dirk; Whitfield, James; Wood, Monty; Zhou, Xin
2012-01-01
Wolbachia is a genus of bacterial endosymbionts that impacts the breeding systems of their hosts. Wolbachia can confuse the patterns of mitochondrial variation, including DNA barcodes, because it influences the pathways through which mitochondria are inherited. We examined the extent to which these endosymbionts are detected in routine DNA barcoding, assessed their impact upon the insect sequence divergence and identification accuracy, and considered the variation present in Wolbachia COI. Using both standard PCR assays (Wolbachia surface coding protein--wsp), and bacterial COI fragments we found evidence of Wolbachia in insect total genomic extracts created for DNA barcoding library construction. When >2 million insect COI trace files were examined on the Barcode of Life Datasystem (BOLD) Wolbachia COI was present in 0.16% of the cases. It is possible to generate Wolbachia COI using standard insect primers; however, that amplicon was never confused with the COI of the host. Wolbachia alleles recovered were predominantly Supergroup A and were broadly distributed geographically and phylogenetically. We conclude that the presence of the Wolbachia DNA in total genomic extracts made from insects is unlikely to compromise the accuracy of the DNA barcode library; in fact, the ability to query this DNA library (the database and the extracts) for endosymbionts is one of the ancillary benefits of such a large scale endeavor--which we provide several examples. It is our conclusion that regular assays for Wolbachia presence and type can, and should, be adopted by large scale insect barcoding initiatives. While COI is one of the five multi-locus sequence typing (MLST) genes used for categorizing Wolbachia, there is limited overlap with the eukaryotic DNA barcode region.
High-altitude adaptation of Tibetan chicken from MT-COI and ATP-6 perspective.
Zhao, Xiaoling; Wu, Nan; Zhu, Qing; Gaur, Uma; Gu, Ting; Li, Diyan
2016-09-01
The problem of hypoxia adaptation in high altitudes is an unsolved brainteaser in the field of life sciences. As one of the best chicken breeds with adaptability to highland environment, the Tibetan chicken, is genetically different from lowland chicken breeds. In order to gain a better understanding of the mechanism of hypoxic adaptability in high altitude, in the present study, we focused on the MT-COI together with ATP-6 gene to explore the regulatory mechanisms for hypoxia adaptability in Tibet chicken. Here, we sequenced MT-COI of 29 Tibetan chickens and 30 Chinese domestic chickens and ATP-6 gene of 28 Tibetan chickens and 29 Chinese domestic chickens. In MT-COI gene, 9 single nucleotide polymorphisms (SNPs) were detected though none of these was a missense mutation, confirming the fact that MT-COI gene is a largely conservative sequence. In ATP-6 gene, 6 single nucleotide polymorphisms (SNPs) were detected and we found a missense mutation (m.9441G > A) in the ATP-6 gene of Tibetan chicken resulting in an amino acid substitution. Due to the critical role of ATP-6 gene in the proton translocation and energy metabolism, we speculated the possibility of this mutation playing an important role in easier energy conversion and metabolism in Tibetan chickens than Chinese domestic chickens so as to better adapt to the harsh environment of the high-altitude areas. The Median-joining profile also suggested that haplotype Ha2 has the ancestral position to the other haplotypes and has significant relationship with high-altitude adaptation in ATP-6 gene. Therefore, we considered that the polymorphism (m.9441G > A) in the ATP-6 gene may affect the specific functions of ATP-6 enzyme relating to high-altitude adaptation of Tibetan chicken and MT-COI gene is a largely conservative sequence.
Directory of Open Access Journals (Sweden)
Raupach Michael J
2010-09-01
Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.
Raupach, Michael J; Astrin, Jonas J; Hannig, Karsten; Peters, Marcell K; Stoeckle, Mark Y; Wägele, Johann-Wolfgang
2010-09-13
The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI) gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97%) of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95%) of the studied Carabidae. Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.
DNA typing of Calliphorids collected from human corpses in Malaysia.
Kavitha, R; Tan, T C; Lee, H L; Nazni, W A; Sofian-Azirun, M
2013-03-01
Estimation of post-mortem interval (PMI) is crucial for time of death determination. The advent of DNA-based identification techniques forensic entomology saw the beginning of a proliferation of molecular studies into forensically important Calliphoridae (Diptera). The use of DNA to characterise morphologically indistinguishable immature calliphorids was recognised as a valuable molecular tool with enormous practical utility. The local entomofauna in most cases is important for the examination of entomological evidences. The survey of the local entomofauna has become a fundamental first step in forensic entomological studies, because different geographical distributions, seasonal and environmental factors may influence the decomposition process and the occurrence of different insect species on corpses. In this study, calliphorids were collected from 13 human corpses recovered from indoors, outdoors and aquatic conditions during the post-mortem examination by pathologists from the government hospitals in Malaysia. Only two species, Chrysomya megacephala and Chrysomya rufifacies were recovered from human corpses. DNA sequencing was performed to study the mitochondrial encoded COI gene and to evaluate the suitability of the 1300 base pairs of COI fragments for identification of blow fly species collected from real crime scene. The COI gene from blow fly specimens were sequenced and deposited in GenBank to expand local databases. The sequenced COI gene was useful in identifying calliphorids retrieved from human corpses.
Haplotype Diversity of COI Gene of Hylarana chalconota Species Found at State University of Malang
Directory of Open Access Journals (Sweden)
Dian Ratri Wulandari
2014-01-01
Full Text Available Hylarana chalconota is a cryptic species of frog endemic to Java Island [1]. This species is small with long legs, and brown skin. The Snout-Vent Length (SVL ranges between 30-40 mm for male and 45-65 mm for female. [4] Reports the existence of this species in State University of Malang, which was not found in 1995 [5]. Sampel #1 displays spots in its skin, which does not exist in sample #2. To reveal the haplotype diversity of COI gene in this species, we analyzed Cytochrome-c oxidase subunit-1 (COI sequences of both samples. Using a pair of primers according to [6] both samples had 604 bp and 574 bp fragment length, respectively. These fragments showed polymorphism; with mutation position in sites 104, 105, and 124. Based on this result, we suggest that the two samples share a different haplotypes, proposed as UM1 and UM2.
Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects
Directory of Open Access Journals (Sweden)
Vasco Elbrecht
2016-04-01
Full Text Available Cytochrome c oxidase I (COI is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate.
Directory of Open Access Journals (Sweden)
Albor Dobón
Full Text Available Resistance to biotrophic pathogens is largely dependent on the hormone salicylic acid (SA while jasmonic acid (JA regulates resistance against necrotrophs. JA negatively regulates SA and is, in itself, negatively regulated by SA. A key component of the JA signal transduction pathway is its receptor, the COI1 gene. Mutations in this gene can affect all the JA phenotypes, whereas mutations in other genes, either in JA signal transduction or in JA biosynthesis, lack this general effect. To identify components of the part of the resistance against biotrophs independent of SA, a mutagenised population of NahG plants (severely depleted of SA was screened for suppression of susceptibility. The screen resulted in the identification of intragenic and extragenic suppressors, and the results presented here correspond to the characterization of one extragenic suppressor, coi1-40. coi1-40 is quite different from previously described coi1 alleles, and it represents a strategy for enhancing resistance to biotrophs with low levels of SA, likely suppressing NahG by increasing the perception to the remaining SA. The phenotypes of coi1-40 lead us to speculate about a modular function for COI1, since we have recovered a mutation in COI1 which has a number of JA-related phenotypes reduced while others are equal to or above wild type levels.
DNA barcode for genetic traceability of Nile Perch and Nile Tilapia
International Nuclear Information System (INIS)
Avossa, Valeria
2017-01-01
For this study, mitochondrial DNA was extracted from 55 fish samples (26 Nile Perch Samples and 29 Nile Tilapia Samples collected from 3 different Ugandan regions of Lake Victoria. In order to optimize the PCR method, we also extracted DNA from two other different fish samples: one from Italy and one from a Viennese market. The COI gene was amplified using universal primers (COI2, COI3, cocktails of 8 and 4 primers respectively). After the amplification step, the amplicons were analysed using gel electrophoresis , in order to establish that the set primers worked well in the samples. The positive results of an agarose gel electrophoresis analysis with the PCR amplicons (amplicons length ~700pb) are shown.
Directory of Open Access Journals (Sweden)
Hisashi Morise
Full Text Available Soil nematodes play crucial roles in the soil food web and are a suitable indicator for assessing soil environments and ecosystems. Previous nematode community analyses based on nematode morphology classification have been shown to be useful for assessing various soil environments. Here we have conducted DNA barcode analysis for soil nematode community analyses in Japanese soils. We isolated nematodes from two different environmental soils of an unmanaged flowerbed and an agricultural field using the improved flotation-sieving method. Small subunit (SSU rDNA fragments were directly amplified from each of 68 (flowerbed samples and 48 (field samples isolated nematodes to determine the nucleotide sequence. Sixteen and thirteen operational taxonomic units (OTUs were obtained by multiple sequence alignment from the flowerbed and agricultural field nematodes, respectively. All 29 SSU rDNA-derived OTUs (rOTUs were further mapped onto a phylogenetic tree with 107 known nematode species. Interestingly, the two nematode communities examined were clearly distinct from each other in terms of trophic groups: Animal predators and plant feeders were markedly abundant in the flowerbed soils, in contrast, bacterial feeders were dominantly observed in the agricultural field soils. The data from the flowerbed nematodes suggests a possible food web among two different trophic nematode groups and plants (weeds in the closed soil environment. Finally, DNA sequences derived from the mitochondrial cytochrome oxidase c subunit 1 (COI gene were determined as a DNA barcode from 43 agricultural field soil nematodes. These nematodes were assigned to 13 rDNA-derived OTUs, but in the COI gene analysis were assigned to 23 COI gene-derived OTUs (cOTUs, indicating that COI gene-based barcoding may provide higher taxonomic resolution than conventional SSU rDNA-barcoding in soil nematode community analysis.
Morise, Hisashi; Miyazaki, Erika; Yoshimitsu, Shoko; Eki, Toshihiko
2012-01-01
Soil nematodes play crucial roles in the soil food web and are a suitable indicator for assessing soil environments and ecosystems. Previous nematode community analyses based on nematode morphology classification have been shown to be useful for assessing various soil environments. Here we have conducted DNA barcode analysis for soil nematode community analyses in Japanese soils. We isolated nematodes from two different environmental soils of an unmanaged flowerbed and an agricultural field using the improved flotation-sieving method. Small subunit (SSU) rDNA fragments were directly amplified from each of 68 (flowerbed samples) and 48 (field samples) isolated nematodes to determine the nucleotide sequence. Sixteen and thirteen operational taxonomic units (OTUs) were obtained by multiple sequence alignment from the flowerbed and agricultural field nematodes, respectively. All 29 SSU rDNA-derived OTUs (rOTUs) were further mapped onto a phylogenetic tree with 107 known nematode species. Interestingly, the two nematode communities examined were clearly distinct from each other in terms of trophic groups: Animal predators and plant feeders were markedly abundant in the flowerbed soils, in contrast, bacterial feeders were dominantly observed in the agricultural field soils. The data from the flowerbed nematodes suggests a possible food web among two different trophic nematode groups and plants (weeds) in the closed soil environment. Finally, DNA sequences derived from the mitochondrial cytochrome oxidase c subunit 1 (COI) gene were determined as a DNA barcode from 43 agricultural field soil nematodes. These nematodes were assigned to 13 rDNA-derived OTUs, but in the COI gene analysis were assigned to 23 COI gene-derived OTUs (cOTUs), indicating that COI gene-based barcoding may provide higher taxonomic resolution than conventional SSU rDNA-barcoding in soil nematode community analysis. PMID:23284767
Mutanen, Marko; Kivelä, Sami M; Vos, Rutger A; Doorenweerd, Camiel; Ratnasingham, Sujeevan; Hausmann, Axel; Huemer, Peter; Dincă, Vlad; van Nieukerken, Erik J; Lopez-Vaamonde, Carlos; Vila, Roger; Aarvik, Leif; Decaëns, Thibaud; Efetov, Konstantin A; Hebert, Paul D N; Johnsen, Arild; Karsholt, Ole; Pentinsaari, Mikko; Rougerie, Rodolphe; Segerer, Andreas; Tarmann, Gerhard; Zahiri, Reza; Godfray, H Charles J
2016-11-01
The proliferation of DNA data is revolutionizing all fields of systematic research. DNA barcode sequences, now available for millions of specimens and several hundred thousand species, are increasingly used in algorithmic species delimitations. This is complicated by occasional incongruences between species and gene genealogies, as indicated by situations where conspecific individuals do not form a monophyletic cluster in a gene tree. In two previous reviews, non-monophyly has been reported as being common in mitochondrial DNA gene trees. We developed a novel web service "Monophylizer" to detect non-monophyly in phylogenetic trees and used it to ascertain the incidence of species non-monophyly in COI (a.k.a. cox1) barcode sequence data from 4977 species and 41,583 specimens of European Lepidoptera, the largest data set of DNA barcodes analyzed from this regard. Particular attention was paid to accurate species identification to ensure data integrity. We investigated the effects of tree-building method, sampling effort, and other methodological issues, all of which can influence estimates of non-monophyly. We found a 12% incidence of non-monophyly, a value significantly lower than that observed in previous studies. Neighbor joining (NJ) and maximum likelihood (ML) methods yielded almost equal numbers of non-monophyletic species, but 24.1% of these cases of non-monophyly were only found by one of these methods. Non-monophyletic species tend to show either low genetic distances to their nearest neighbors or exceptionally high levels of intraspecific variability. Cases of polyphyly in COI trees arising as a result of deep intraspecific divergence are negligible, as the detected cases reflected misidentifications or methodological errors. Taking into consideration variation in sampling effort, we estimate that the true incidence of non-monophyly is ∼23%, but with operational factors still being included. Within the operational factors, we separately assessed the
Identifying Fishes through DNA Barcodes and Microarrays.
Directory of Open Access Journals (Sweden)
Marc Kochzius
2010-09-01
Full Text Available International fish trade reached an import value of 62.8 billion Euro in 2006, of which 44.6% are covered by the European Union. Species identification is a key problem throughout the life cycle of fishes: from eggs and larvae to adults in fisheries research and control, as well as processed fish products in consumer protection.This study aims to evaluate the applicability of the three mitochondrial genes 16S rRNA (16S, cytochrome b (cyt b, and cytochrome oxidase subunit I (COI for the identification of 50 European marine fish species by combining techniques of "DNA barcoding" and microarrays. In a DNA barcoding approach, neighbour Joining (NJ phylogenetic trees of 369 16S, 212 cyt b, and 447 COI sequences indicated that cyt b and COI are suitable for unambiguous identification, whereas 16S failed to discriminate closely related flatfish and gurnard species. In course of probe design for DNA microarray development, each of the markers yielded a high number of potentially species-specific probes in silico, although many of them were rejected based on microarray hybridisation experiments. None of the markers provided probes to discriminate the sibling flatfish and gurnard species. However, since 16S-probes were less negatively influenced by the "position of label" effect and showed the lowest rejection rate and the highest mean signal intensity, 16S is more suitable for DNA microarray probe design than cty b and COI. The large portion of rejected COI-probes after hybridisation experiments (>90% renders the DNA barcoding marker as rather unsuitable for this high-throughput technology.Based on these data, a DNA microarray containing 64 functional oligonucleotide probes for the identification of 30 out of the 50 fish species investigated was developed. It represents the next step towards an automated and easy-to-handle method to identify fish, ichthyoplankton, and fish products.
DNA barcoding and the identification of tree frogs (Amphibia: Anura: Rhacophoridae).
Dang, Ning-Xin; Sun, Feng-Hui; Lv, Yun-Yun; Zhao, Bo-Han; Wang, Ji-Chao; Murphy, Robert W; Wang, Wen-Zhi; Li, Jia-Tang
2016-07-01
The DNA barcoding gene COI (cytochrome c oxidase subunit I) effectively identifies many species. Herein, we barcoded 172 individuals from 37 species belonging to nine genera in Rhacophoridae to test if the gene serves equally well to identify species of tree frogs. Phenetic neighbor joining and phylogenetic Bayesian inference were used to construct phylogenetic trees, which resolved all nine genera as monophyletic taxa except for Rhacophorus, two new matrilines for Liuixalus, and Polypedates leucomystax species complex. Intraspecific genetic distances ranged from 0.000 to 0.119 and interspecific genetic distances ranged from 0.015 to 0.334. Within Rhacophorus and Kurixalus, the intra- and interspecific genetic distances did not reveal an obvious barcode gap. Notwithstanding, we found that COI sequences unambiguously identified rhacophorid species and helped to discover likely new cryptic species via the synthesis of genealogical relationships and divergence patterns. Our results supported that COI is an effective DNA barcoding marker for Rhacophoridae.
DNA barcodes identify Central Asian Colias butterflies (Lepidoptera, Pieridae).
Laiho, Juha; Ståhls, Gunilla
2013-12-30
A majority of the known Colias species (Lepidoptera: Pieridae, Coliadinae) occur in the mountainous regions of Central-Asia, vast areas that are hard to access, rendering the knowledge of many species limited due to the lack of extensive sampling. Two gene regions, the mitochondrial COI 'barcode' region and the nuclear ribosomal protein RpS2 gene region were used for exploring the utility of these DNA markers for species identification. A comprehensive sampling of COI barcodes for Central Asian Colias butterflies showed that the barcodes facilitated identification of most of the included species. Phylogenetic reconstruction based on parsimony and Neighbour-Joining recovered most species as monophyletic entities. For the RpS2 gene region species-specific sequences were registered for some of the included Colias spp. Nevertheless, this gene region was not deemed useful as additional molecular 'barcode'. A parsimony analysis of the combined COI and RpS2 data did not support the current subgeneric classification based on morphological characteristics.
Limitations of mitochondrial gene barcoding in Octocorallia.
McFadden, Catherine S; Benayahu, Yehuda; Pante, Eric; Thoma, Jana N; Nevarez, P Andrew; France, Scott C
2011-01-01
The widespread assumption that COI and other mitochondrial genes will be ineffective DNA barcodes for anthozoan cnidarians has not been well tested for most anthozoans other than scleractinian corals. Here we examine the limitations of mitochondrial gene barcoding in the sub-class Octocorallia, a large, diverse, and ecologically important group of anthozoans. Pairwise genetic distance values (uncorrected p) were compared for three candidate barcoding regions: the Folmer region of COI; a fragment of the octocoral-specific mitochondrial protein-coding gene, msh1; and an extended barcode of msh1 plus COI with a short, adjacent intergenic region (igr1). Intraspecific variation was barcodes, and there was no discernible barcoding gap between intra- and interspecific p values. In a case study to assess regional octocoral biodiversity, COI and msh1 barcodes each identified 70% of morphospecies. In a second case study, a nucleotide character-based analysis correctly identified 70% of species in the temperate genus Alcyonium. Although interspecific genetic distances were 2× greater for msh1 than COI, each marker identified similar numbers of species in the two case studies, and the extended COI + igr1 + msh1 barcode more effectively discriminated sister taxa in Alcyonium. Although far from perfect for species identification, a COI + igr1 + msh1 barcode nonetheless represents a valuable addition to the depauperate set of characters available for octocoral taxonomy. © 2010 Blackwell Publishing Ltd.
Unusually high genetic diversity in COI sequences of Chimarra obscura (Trichoptera: Philopotamidae)
Chimarra obscura (Walker 1852) is a philopotamid caddisfly found throughout much of North America. Using the COI DNA barcode locus, we have found unexpectedly high amounts of genetic diversity and distances within C. obscura. Of the approximately 150 specimens sampled, we have fo...
Searching for evidence of selection in avian DNA barcodes.
Kerr, Kevin C R
2011-11-01
The barcode of life project has assembled a tremendous number of mitochondrial cytochrome c oxidase I (COI) sequences. Although these sequences were gathered to develop a DNA-based system for species identification, it has been suggested that further biological inferences may also be derived from this wealth of data. Recurrent selective sweeps have been invoked as an evolutionary mechanism to explain limited intraspecific COI diversity, particularly in birds, but this hypothesis has not been formally tested. In this study, I collated COI sequences from previous barcoding studies on birds and tested them for evidence of selection. Using this expanded data set, I re-examined the relationships between intraspecific diversity and interspecific divergence and sampling effort, respectively. I employed the McDonald-Kreitman test to test for neutrality in sequence evolution between closely related pairs of species. Because amino acid sequences were generally constrained between closely related pairs, I also included broader intra-order comparisons to quantify patterns of protein variation in avian COI sequences. Lastly, using 22 published whole mitochondrial genomes, I compared the evolutionary rate of COI against the other 12 protein-coding mitochondrial genes to assess intragenomic variability. I found no conclusive evidence of selective sweeps. Most evidence pointed to an overall trend of strong purifying selection and functional constraint. The COI protein did vary across the class Aves, but to a very limited extent. COI was the least variable gene in the mitochondrial genome, suggesting that other genes might be more informative for probing factors constraining mitochondrial variation within species. © 2011 Blackwell Publishing Ltd.
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
Du, Guoying; Wu, Feifei; Guo, Hao; Xue, Hongfan; Mao, Yunxiang
2015-05-01
A total of 142 specimens of Ceramiales (Rhodophyta) were collected each month from October 2011 to November 2012 in the intertidal zone of the northwestern Yellow Sea. These specimens covered 21 species, 14 genera, and four families. Cluster analyses show that the specimens had a high diversity for the three DNA markers, namely, partial large subunit rRNA gene (LSU), universal plastid amplicon (UPA), and partial mitochondrial cytochrome c oxidase subunit I gene (COI). No intraspecific divergence was found in our collection for these markers, except for a 1-3 bp divergence in the COI of Ceramium kondoi, Symphyocladia latiuscula, and Neosiphonia japonica. Because short DNA markers were used, the phylogenetic relationships of higher taxonomic levels were hard to evaluate with poor branch support. More than half species of our collection failed to find their matched sequences owing to shortage information of DNA barcodes for macroalgae in GenBank or BOLD (Barcode of Life Data) Systems. Three specimens were presumed as Heterosiphonia crispella by cluster analyses on DNA barcodes assisted by morphological identification, which was the first record in the investigated area, implying that it might be a cryptic or invasive species in the coastal area of northwestern Yellow Sea. In the neighbor-joining trees of all three DNA markers, Heterosiphonia japonica converged with Dasya spp. and was distant from the other Heterosiphonia spp., implying that H. japonica had affinities to the genus Dasya. The LSU and UPA markers amplified and sequenced easier than the COI marker across the Ceramiales species, but the COI had a higher ability to discriminate between species.
Exploring the Utility of Partial Cytochrome c Oxidase Subunit 1 for DNA Barcoding of Gobies
Directory of Open Access Journals (Sweden)
Hyung-Bae Jeon
2012-10-01
Full Text Available Gobiids are hyperdiverse compared with other teleost groups, with about 2,000 species occurring in marine, freshwater, and blackish habitats, and they show a remarkable variety of morphologies and ecology. Testing the effectiveness of DNA barcodes on species that have emerged as a result of radiation remains a major challenge in evolutionary biology. Here, we used the cytochrome c oxidase subunit 1 (COI sequences from 144 species of gobies and related species to evaluate the performance of distance-based DNA barcoding and to conduct a phylogenetic analysis. The average intra-genus genetic distance was considerably higher than that obtained in previous studies. Additionally, the interspecific divergence at higher taxonomic levels was not significantly different from that at the intragenus level, suggesting that congeneric gobies possess substantial interspecific sequence divergence in their COI gene. However, levels of intragenus divergence varied greatly among genera, and we do not provide sufficient evidence for using COI for cryptic species delimitation. Significantly more nucleotide changes were observed at the third codon position than that at the first and the second codons, revealing that extensive variation in COI reflects synonymous changes and little protein level variation. Despite clear signatures in several genera, the COI sequences did resolve genealogical relationships in the phylogenetic analysis well. Our results support the validity of COI barcoding for gobiid species identification, but the utilization of more gene regions will assist to offer a more robust gobiid species phylogeny.
Talukder, Zahirul I; Hulke, Brent S; Qi, Lili; Scheffler, Brian E; Pegadaraju, Venkatramana; McPhee, Kevin; Gulya, Thomas J
2014-01-01
Functional markers for Sclerotinia basal stalk rot resistance in sunflower were obtained using gene-level information from the model species Arabidopsis thaliana. Sclerotinia stalk rot, caused by Sclerotinia sclerotiorum, is one of the most destructive diseases of sunflower (Helianthus annuus L.) worldwide. Markers for genes controlling resistance to S. sclerotiorum will enable efficient marker-assisted selection (MAS). We sequenced eight candidate genes homologous to Arabidopsis thaliana defense genes known to be associated with Sclerotinia disease resistance in a sunflower association mapping population evaluated for Sclerotinia stalk rot resistance. The total candidate gene sequence regions covered a concatenated length of 3,791 bp per individual. A total of 187 polymorphic sites were detected for all candidate gene sequences, 149 of which were single nucleotide polymorphisms (SNPs) and 38 were insertions/deletions. Eight SNPs in the coding regions led to changes in amino acid codons. Linkage disequilibrium decay throughout the candidate gene regions declined on average to an r (2) = 0.2 for genetic intervals of 120 bp, but extended up to 350 bp with r (2) = 0.1. A general linear model with modification to account for population structure was found the best fitting model for this population and was used for association mapping. Both HaCOI1-1 and HaCOI1-2 were found to be strongly associated with Sclerotinia stalk rot resistance and explained 7.4 % of phenotypic variation in this population. These SNP markers associated with Sclerotinia stalk rot resistance can potentially be applied to the selection of favorable genotypes, which will significantly improve the efficiency of MAS during the development of stalk rot resistant cultivars.
Yu, Hong; Kong, Lingfeng; Li, Qi
2016-01-01
In this study, we evaluated the efficacy of 12 mitochondrial protein-coding genes from 238 mitochondrial genomes of 140 molluscan species as potential DNA barcodes for mollusks. Three barcoding methods (distance, monophyly and character-based methods) were used in species identification. The species recovery rates based on genetic distances for the 12 genes ranged from 70.83 to 83.33%. There were no significant differences in intra- or interspecific variability among the 12 genes. The monophyly and character-based methods provided higher resolution than the distance-based method in species delimitation. Especially in closely related taxa, the character-based method showed some advantages. The results suggested that besides the standard COI barcode, other 11 mitochondrial protein-coding genes could also be potentially used as a molecular diagnostic for molluscan species discrimination. Our results also showed that the combination of mitochondrial genes did not enhance the efficacy for species identification and a single mitochondrial gene would be fully competent.
Liao, Jing; Chao, Zhi; Zhang, Liang
2013-11-01
To identify the common snakes in medicated liquor of Guangdong using COI barcode sequence,and to test the feasibility. The COI barcode sequences of collected medicinal snakes were amplified and sequenced. The sequences combined with the data from GenBank were analyzed for divergence and building a neighbor-joining(NJ) tree with MEGA 5.0. The genetic distance and NJ tree demonstrated that there were 241 variable sites in these species, and the average (A + T) content of 56.2% was higher than the average (G + C) content of 43.7%. The maximum interspecific genetic distance was 0.2568, and the minimum was 0. 1519. In the NJ tree,each species formed a monophyletic clade with bootstrap supports of 100%. DNA barcoding identification method based on the COI sequence is accurate and can be applied to identify the common medicinal snakes.
DNA barcoding commercially important aquatic invertebrates of Turkey.
Keskin, Emre; Atar, Hasan Hüseyin
2013-08-01
DNA barcoding was used in order to identify aquatic invertebrates sampled from fisheries bycatch and discards. A total of 440 unique cytochrome c oxidase sub unit I (COI) barcodes were generated for 22 species from three important phyla (Arthropoda, Cnidaria, and Mollusca). All the species were sequenced and submitted to GenBank and Barcode of Life Database (BOLD) databases using 654 bp-long fragment of mitochondrial COI gene. Two of them (Pontastacus leptodactylus and Rapana bezoar) were first records of the species for the BOLD database and six of them (Carcinus aestuarii, Loligo vulgaris, Melicertus kerathurus, Nephrops norvegicus, Scyllarides latus, and Scyllarus arctus) were first standard (>648 bp) COI barcode records for the GenBank database. COI barcodes were analyzed for nucleotide composition, nucleotide pair frequencies, and Kimura's two-parameter genetic distance. Mean genetic distance among species was found increasing at higher taxonomic levels. Neighbor-joining trees generated were congruent with morphometric-based taxonomic classification. Findings of this study clearly demonstrate that DNA barcodes could be used as an efficient molecular tool in identification of not only target species from fisheries but also bycatch and discard species, and so it could provide us leverage for a better understanding in monitoring and management of fisheries and biodiversity.
DNA barcoding as a tool for coral reef conservation
Neigel, J.; Domingo, A.; Stake, J.
2007-09-01
DNA Barcoding (DBC) is a method for taxonomic identification of animals that is based entirely on the 5' portion of the mitochondrial gene, cytochrome oxidase subunit I ( COI-5). It can be especially useful for identification of larval forms or incomplete specimens lacking diagnostic morphological characters. DBC can also facilitate the discovery of species and in defining “molecular taxonomic units” in problematic groups. However, DBC is not a panacea for coral reef taxonomy. In two of the most ecologically important groups on coral reefs, the Anthozoa and Porifera, COI-5 sequences have diverged too little to be diagnostic for all species. Other problems for DBC include paraphyly in mitochondrial gene trees and lack of differentiation between hybrids and their maternal ancestors. DBC also depends on the availability of databases of COI-5 sequences, which are still in early stages of development. A global effort to barcode all fish species has demonstrated the importance of large-scale coordination and is yielding promising results. Whether or not COI-5 by itself is sufficient for species assignments has become a contentious question; it is generally advantageous to use sequences from multiple loci.
Czech Academy of Sciences Publication Activity Database
Helmi, A.; Sharaf, Abdoallah
2016-01-01
Roč. 71, č. 11 (2016), s. 1266-1273 ISSN 0006-3088 Institutional support: RVO:60077344 Keywords : DNA sequencing * Aphididae * COI * biotypes * SNPs * molecular phylogeny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.759, year: 2016
DNA Barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera)
Foottit, Robert G.; Maw, Eric; Hebert, P. D. N.
2014-01-01
Background Many studies have shown the suitability of sequence variation in the 5′ region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Methodology/Principal Findings Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. Conclusions/Significance This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage. PMID:25004106
Hierarchical Trust Management of COI in Heterogeneous Mobile Networks
2017-08-01
Report: Hierarchical Trust Management of COI in Heterogeneous Mobile Networks The views, opinions and/or findings contained in this report are those of...Institute & State University Title: Hierarchical Trust Management of COI in Heterogeneous Mobile Networks Report Term: 0-Other Email: irchen@vt.edu...Reconfigurability, Survivability and Intrusion Tolerance for Community of Interest (COI) Applications – Our proposed COI trust management protocol will
Liu, Jun; Li, Qi; Kong, Lingfeng; Yu, Hong; Zheng, Xiaodong
2011-09-01
Oysters (family Ostreidae), with high levels of phenotypic plasticity and wide geographic distribution, are a challenging group for taxonomists and phylogenetics. As a useful tool for molecular species identification, DNA barcoding might offer significant potential for oyster identification and taxonomy. This study used two mitochondrial fragments, cytochrome c oxidase I (COI) and the large ribosomal subunit (16S rDNA), to assess whether oyster species could be identified by phylogeny and distance-based DNA barcoding techniques. Relationships among species were estimated by the phylogenetic analyses of both genes, and then pairwise inter- and intraspecific genetic divergences were assessed. Species forming well-differentiated clades in the molecular phylogenies were identical for both genes even when the closely related species were included. Intraspecific variability of 16S rDNA overlapped with interspecific divergence. However, average intra- and interspecific genetic divergences for COI were 0-1.4% (maximum 2.2%) and 2.6-32.2% (minimum 2.2%), respectively, indicating the existence of a barcoding gap. These results confirm the efficacy of species identification in oysters via DNA barcodes and phylogenetic analysis. © 2011 Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Jianfeng WANG
2011-08-01
Full Text Available Aphids of the subtribe Aphidina are found mainly in the North Temperate Zone. The relative lack of diagnostic morphological characteristics has obscured the identification of species in this group. However, DNA-based taxonomic methods can clarify species relationships within this group. Sequence variation in a partial segment of the mitochondrial COI gene was highly effective for resolving species relationships within Aphidina. Forty-five species were correctly identified in a neighbor-joining tree. Mean intraspecific sequence divergence was 0.17%, with a range of 0.00% to 1.54%. Mean interspecific divergence within previously recognized genera or morphologically similar species groups was 4.54%, with variation mainly in the range of 3.50% to 8.00%. Possible reasons for anomalous levels of mean nucleotide divergence within or between some taxa are discussed.
FBIS: A regional DNA barcode archival & analysis system for Indian fishes
Nagpure, Naresh Sahebrao; Rashid, Iliyas; Pathak, Ajey Kumar; Singh, Mahender; Singh, Shri Prakash; Sarkar, Uttam Kumar
2012-01-01
DNA barcode is a new tool for taxon recognition and classification of biological organisms based on sequence of a fragment of mitochondrial gene, cytochrome c oxidase I (COI). In view of the growing importance of the fish DNA barcoding for species identification, molecular taxonomy and fish diversity conservation, we developed a Fish Barcode Information System (FBIS) for Indian fishes, which will serve as a regional DNA barcode archival and analysis system. The database presently contains 2334 sequence records of COI gene for 472 aquatic species belonging to 39 orders and 136 families, collected from available published data sources. Additionally, it contains information on phenotype, distribution and IUCN Red List status of fishes. The web version of FBIS was designed using MySQL, Perl and PHP under Linux operating platform to (a) store and manage the acquisition (b) analyze and explore DNA barcode records (c) identify species and estimate genetic divergence. FBIS has also been integrated with appropriate tools for retrieving and viewing information about the database statistics and taxonomy. It is expected that FBIS would be useful as a potent information system in fish molecular taxonomy, phylogeny and genomics. Availability The database is available for free at http://mail.nbfgr.res.in/fbis/ PMID:22715304
DNA barcoding of the ichthyofauna of Taal Lake, Philippines.
Aquilino, Sean V L; Tango, Jazzlyn M; Fontanilla, Ian K C; Pagulayan, Roberto C; Basiao, Zubaida U; Ong, Perry S; Quilang, Jonas P
2011-07-01
This study represents the first molecular survey of the ichthyofauna of Taal Lake and the first DNA barcoding attempt in Philippine fishes. Taal Lake, the third largest lake in the Philippines, is considered a very important fisheries resource and is home to the world's only freshwater sardine, Sardinella tawilis. However, overexploitation and introduction of exotic fishes have caused a massive decline in the diversity of native species as well as in overall productivity of the lake. In this study, 118 individuals of 23 native, endemic and introduced fishes of Taal Lake were barcoded using the partial DNA sequence of the mitochondrial cytochrome c oxidase subunit I (COI) gene. These species belong to 21 genera, 17 families and 9 orders. Divergence of sequences within and between species was determined using Kimura 2-parameter (K2P) distance model, and a neighbour-joining tree was generated with 1000 bootstrap replications using the K2P model. All COI sequences for each of the 23 species were clearly discriminated among genera. The average within species, within genus, within family and within order percent genetic divergence was 0.60%, 11.07%, 17.67% and 24.08%, respectively. Our results provide evidence that COI DNA barcodes are effective for the rapid and accurate identification of fishes and for identifying certain species that need further taxonomic investigation. © 2011 Blackwell Publishing Ltd.
Thaler, David S; Stoeckle, Mark Y
2016-10-01
DNA barcodes for species identification and the analysis of human mitochondrial variation have developed as independent fields even though both are based on sequences from animal mitochondria. This study finds questions within each field that can be addressed by reference to the other. DNA barcodes are based on a 648-bp segment of the mitochondrially encoded cytochrome oxidase I. From most species, this segment is the only sequence available. It is impossible to know whether it fairly represents overall mitochondrial variation. For modern humans, the entire mitochondrial genome is available from thousands of healthy individuals. SNPs in the human mitochondrial genome are evenly distributed across all protein-encoding regions arguing that COI DNA barcode is representative. Barcode variation among related species is largely based on synonymous codons. Data on human mitochondrial variation support the interpretation that most - possibly all - synonymous substitutions in mitochondria are selectively neutral. DNA barcodes confirm reports of a low variance in modern humans compared to nonhuman primates. In addition, DNA barcodes allow the comparison of modern human variance to many other extant animal species. Birds are a well-curated group in which DNA barcodes are coupled with census and geographic data. Putting modern human variation in the context of intraspecies variation among birds shows humans to be a single breeding population of average variance.
E-Learning dengan Menggunakan COI Framework
Directory of Open Access Journals (Sweden)
Lydiawati Kosasih
2013-12-01
Full Text Available This study discusses some considerations in education to achieve a good quality of learning by utilizing technological advances such as E-Learning. This study uses a model of Community of Inquiry (COI as a comparative study to improve the quality of E-Learning program. Implementation of COI model in discussionforum on BiNusMaya through E-Learning is able to improve the quality of a discussion as improvement of knowledge management. This study aims to provide a proposal to the Department of Information Systems Bina Nusantara University in enhancing the effectiveness of the use of discussion forums on BiNusMaya (ELearning. By presenting the survey results related to the Binusmaya current condition,s such constraints and development expectations of both the lecturers and students for Binusmaya can be described. In addition, theapplication of CoI model is presented in a learning process especially when meeting outside of class (without face-to-face. The results of this study is expected to be the basis for developing a COI model design and implementation plan in Management Information Systems course, that may improve the quality of the use of discussion forums as part of the knowledge management process in future study.
Identifying the main mosquito species in China based on DNA barcoding.
Directory of Open Access Journals (Sweden)
Gang Wang
Full Text Available Mosquitoes are insects of the Diptera, Nematocera, and Culicidae families, some species of which are important disease vectors. Identifying mosquito species based on morphological characteristics is difficult, particularly the identification of specimens collected in the field as part of disease surveillance programs. Because of this difficulty, we constructed DNA barcodes of the cytochrome c oxidase subunit 1, the COI gene, for the more common mosquito species in China, including the major disease vectors. A total of 404 mosquito specimens were collected and assigned to 15 genera and 122 species and subspecies on the basis of morphological characteristics. Individuals of the same species grouped closely together in a Neighborhood-Joining tree based on COI sequence similarity, regardless of collection site. COI gene sequence divergence was approximately 30 times higher for species in the same genus than for members of the same species. Divergence in over 98% of congeneric species ranged from 2.3% to 21.8%, whereas divergence in conspecific individuals ranged from 0% to 1.67%. Cryptic species may be common and a few pseudogenes were detected.
International Nuclear Information System (INIS)
Morimyo, Mitsuoki
1995-01-01
Fission yeast S. pombe is assumed to be a good model for cloning of human DNA repair genes, because human gene is normally expressed in S. pombe and has a very similar protein sequence to yeast protein. We have tried to elucidate the DNA repair mechanisms of S. pombe as a model system for those of mammals. (J.P.N.)
Moftah, Marie; Abdel Aziz, Sayeda H.; Elramah, Sara; Favereaux, Alexandre
2011-01-01
The identification of species constitutes the first basic step in phylogenetic studies, biodiversity monitoring and conservation. DNA barcoding, i.e. the sequencing of a short standardized region of DNA, has been proposed as a new tool for animal species identification. The present study provides an update on the composition of shark in the Egyptian Mediterranean waters off Alexandria, since the latest study to date was performed 30 years ago, DNA barcoding was used in addition to classical taxonomical methodologies. Thus, 51 specimen were DNA barcoded for a 667 bp region of the mitochondrial COI gene. Although DNA barcoding aims at developing species identification systems, some phylogenetic signals were apparent in the data. In the neighbor-joining tree, 8 major clusters were apparent, each of them containing individuals belonging to the same species, and most with 100% bootstrap value. This study is the first to our knowledge to use DNA barcoding of the mitochondrial COI gene in order to confirm the presence of species Squalus acanthias, Oxynotus centrina, Squatina squatina, Scyliorhinus canicula, Scyliorhinus stellaris, Mustelus mustelus, Mustelus punctulatus and Carcharhinus altimus in the Egyptian Mediterranean waters. Finally, our study is the starting point of a new barcoding database concerning shark composition in the Egyptian Mediterranean waters (Barcoding of Egyptian Mediterranean Sharks [BEMS], http://www.boldsystems.org/views/projectlist.php?Barcoding%20Fish%20%28FishBOL%29). PMID:22087242
Directory of Open Access Journals (Sweden)
Marie Moftah
Full Text Available The identification of species constitutes the first basic step in phylogenetic studies, biodiversity monitoring and conservation. DNA barcoding, i.e. the sequencing of a short standardized region of DNA, has been proposed as a new tool for animal species identification. The present study provides an update on the composition of shark in the Egyptian Mediterranean waters off Alexandria, since the latest study to date was performed 30 years ago, DNA barcoding was used in addition to classical taxonomical methodologies. Thus, 51 specimen were DNA barcoded for a 667 bp region of the mitochondrial COI gene. Although DNA barcoding aims at developing species identification systems, some phylogenetic signals were apparent in the data. In the neighbor-joining tree, 8 major clusters were apparent, each of them containing individuals belonging to the same species, and most with 100% bootstrap value. This study is the first to our knowledge to use DNA barcoding of the mitochondrial COI gene in order to confirm the presence of species Squalus acanthias, Oxynotus centrina, Squatina squatina, Scyliorhinus canicula, Scyliorhinus stellaris, Mustelus mustelus, Mustelus punctulatus and Carcharhinus altimus in the Egyptian Mediterranean waters. Finally, our study is the starting point of a new barcoding database concerning shark composition in the Egyptian Mediterranean waters (Barcoding of Egyptian Mediterranean Sharks [BEMS], http://www.boldsystems.org/views/projectlist.php?Barcoding%20Fish%20%28FishBOL%29.
Directory of Open Access Journals (Sweden)
Mansour Aliabadian
Full Text Available DNA barcoding based on the mitochondrial cytochrome oxidase subunit I gene (cox1 or COI has been successful in species identification across a wide array of taxa but in some cases failed to delimit the species boundaries of closely allied allopatric species or of hybridising sister species.In this study we extend the sample size of prior studies in birds for cox1 (2776 sequences, 756 species and target especially species that are known to occur parapatrically, and/or are known to hybridise, on a Holarctic scale. In order to obtain a larger set of taxa (altogether 2719 species, we include also DNA sequences of two other mitochondrial genes: cytochrome b (cob (4614 sequences, 2087 species and 16S (708 sequences, 498 species. Our results confirm the existence of a wide gap between intra- and interspecies divergences for both cox1 and cob, and indicate that distance-based DNA barcoding provides sufficient information to identify and delineate bird species in 98% of all possible pairwise comparisons. This DNA barcoding gap was not statistically influenced by the number of individuals sequenced per species. However, most of the hybridising parapatric species pairs have average divergences intermediate between intraspecific and interspecific distances for both cox1 and cob.DNA barcoding, if used as a tool for species discovery, would thus fail to identify hybridising parapatric species pairs. However, most of them can probably still assigned to known species by character-based approaches, although development of complementary nuclear markers will be necessary to account for mitochondrial introgression in hybridising species.
Saldamando, Clara Inés; Marquez, Edna Judith
2012-09-01
The genus Spodoptera includes 30 species of moths considered important pests worldwide, with a great representation in the Western Hemisphere. In general, Noctuidae species have morphological similarities that have caused some difficulties for assertive species identification by conventional methods. The purpose of this work was to generate an approach to the genus phylogeny from several species of the genus Spodoptera and the species Bombyx mori as an out group, with the use of molecular tools. For this, a total of 102 S. frugiperda larvae were obtained at random in corn, cotton, rice, grass and sorghum, during late 2006 and early 2009, from Colombia. We took ADN samples from the larval posterior part and we analyzed a fragment of 451 base pairs of the mitochondrial gene cytochrome oxydase I (COI), to produce a maximum likelihood (ML) tree by using 62 sequences (29 Colombian haplotypes were used). Our results showed a great genetic differentiation (K2 distances) amongst S. frugiperda haplotypes from Colombia and the United States, condition supported by the estimators obtained for haplotype diversity and polymorphism. The obtained ML tree clustered most of the species with bootstrapping values from 73-99% in the interior branches; with low values also observed in some of the branches. In addition, this tree clustered two species of the Eastern hemisphere (S littoralis and S. litura) and eight species of the Western hemisphere (S. androgea, S. dolichos, S. eridania, S. exigua, S. frugiperda, S. latifascia, S. ornithogalli and S. pulchella). In Colombia, S. frugiperda, S. ornithogalli and S. albula represent a group of species referred as "the Spodoptera complex" of cotton crops, and our work demonstrated that sequencing a fragment of the COI gene, allows researchers to differentiate the first two species, and thus it can be used as an alternative method to taxonomic keys based on morphology. Finally, the ML tree did not cluster S. frugiperda with S. ornithogalli
DNA barcoding as a screening tool for cryptic diversity
DEFF Research Database (Denmark)
Huemer, Peter; Karsholt, Ole; Mutanen, Marko
2014-01-01
We explore the potential value of DNA barcode divergence for species delimitation in the genus Caryocolum Gregor & Povolný, 1954 (Lepidoptera, Gelechiidae), based on data from 44 European species (including 4 subspecies). Low intraspecific divergence of the DNA barcodes of the mtCOI (cytochrome c...... oxidase 1) gene and/or distinct barcode gaps to the nearest neighbor support species status for all examined nominal taxa. However, in 8 taxa we observed deep splits with a maximum intraspecific barcode divergence beyond a threshold of 3%, thus indicating possible cryptic diversity. The taxonomy...
DNA Barcode Identification of Freshwater Snails in the Family Bithyniidae from Thailand
Kulsantiwong, Jutharat; Prasopdee, Sattrachai; Ruangsittichai, Jiraporn; Ruangjirachuporn, Wipaporn; Boonmars, Thidarut; Viyanant, Vithoon; Pierossi, Paola; Hebert, Paul D. N.; Tesana, Smarn
2013-01-01
Freshwater snails in the family Bithyniidae are the first intermediate host for Southeast Asian liver fluke (Opisthorchis viverrini), the causative agent of opisthorchiasis. Unfortunately, the subtle morphological characters that differentiate species in this group are not easily discerned by non-specialists. This is a serious matter because the identification of bithyniid species is a fundamental prerequisite for better understanding of the epidemiology of this disease. Because DNA barcoding, the analysis of sequence diversity in the 5’ region of the mitochondrial COI gene, has shown strong performance in other taxonomic groups, we decided to test its capacity to resolve 10 species/ subspecies of bithyniids from Thailand. Our analysis of 217 specimens indicated that COI sequences delivered species-level identification for 9 of 10 currently recognized species. The mean intraspecific divergence of COI was 2.3% (range 0-9.2 %), whereas sequence divergences between congeneric species averaged 8.7% (range 0-22.2 %). Although our results indicate that DNA barcoding can differentiate species of these medically-important snails, we also detected evidence for the presence of one overlooked species and one possible case of synonymy. PMID:24223896
Jouladeh Roudbar,Arash; Eagderi,Soheil; Esmaeili,Hamid Reza; Coad,Brian; Bogutskaya,Nina
2016-01-01
Abstract The molecular status of nine species of the genus Alburnoides from different river drainages in Iran and additionally by seven species from Europe was assessed. mtDNA COI gene sequences from freshly collected specimens and available NCBI data revealed four major phylogenetic lineages. Based on the results, a distinct taxon from the Cheshmeh Ali (Ali Spring), a Damghan River tributary in the endorheic Dasht-e Kavir basin, northern Iran, which is the closest sister to Alburnoides namak...
Yang, Li; Cai, Jifeng; Wen, Jifang; Guo, Yadong
2010-08-01
To detect the 278 bp region of gene of the cytochrome oxidase subunit I (COI) in mitochondral DNA (mtDNA) of sarcosaphagous flies, identify the species of sarcosaphagous flies, and provide reference for forensic application. Samples were collected in Baotou and Chifeng of Inner Mongolia, Tianjin, Nanning, Fuzhou, Linyi of Shandong, Shijiazhuang, Yinchuan, Lanzhou, Huairou of Beijing, Xinxiang and Nanyang of Henan, Datong of Shanxi, Wuhu of Anhui, Quzhou of Zhejiang, Changsha, Zhuzhou and Yongzhou of Hunan. A total of 38 flies were randomly collected from rabbits, dogs and pigs which were set outdoors, then the flies' mitochondrial DNA (mtDNA) were extracted by the improved small insects DNA homogenate method. Amplification was conducted by Perkin-Elmer 9600 thermal cycler, then vertical non-denaturing 7% polyacrylamide gelectrophoresis. PCR products were purified using the nucleic acid purification kit. Sequences of both strands were obtained by direct sequence of the double-stranded PCR product using one of the PCR primers and the ABI PRISM big dye terminator cycle sequencing dit. Sequence reactions were electrophorsed on ABI Model 3730 DNA Sequencers. A UPGMA tree was contrasted using the maximum composite likelihood method in MEGA4. The 38 sarcosaphagous flies belonged to 3 families(Muscidae, Calliphoridae, and Sarcophagidae), 10 genuses (Musca Linnaeus, Hydrotaea Robineau-Desvoidy, Aldrichina Townsend, Hemipyrellia Townsend, Achoetandrus Bezzi, Protophormia Townsend, Chrysomya Robineau-Desvoidy, Lucilia Robineau-Desvoidy, Helicophagella Enderlein, and Boettcherisca Rohdendorf), and 12 species [Musca domestica (Linnaeus), Hydrotaea (Ophyra) capensis (Wiedemann), Lucilia caesar (Linnaeus), Lucilia illustris (Meigen), Aldrichina graham (Aldrich), Hemipyrellia ligurriens, Achoetandrus (Chrysomya) rufifacies (Macquary), Protophormia terraenovae (Robineau-Desvoidy), Chrysomya megacephala (Fabricius), Lucilia sericata (Meigen), Helicophagella melanura (Meigen), and
Lasota, Rafal; Pierscieniak, Karolina; Garcia, Pascale; Simon-Bouhet, Benoit; Wolowicz, Maciej
2016-11-01
The aim of the study was to determine genetic diversity in the soft-shell clam Mya arenaria on a wide geographical scale using mtDNA COI gene sequences. Low levels of genetic diversity was found, which can most likely be explained by a bottleneck effect during Pleistocene glaciations and/or selection. The geographical genetic structuring of the studied populations was also very low. The star-like phylogeny of the haplotypes indicates a relatively recent, rapid population expansion following the glaciation period and repeated expansion following the founder effect(s) after the initial introduction of the soft-shell clam to Europe. North American populations are characterized by the largest number of haplotypes, including rare ones, as expected for native populations. Because of the founder effect connected with initial and repeated expansion events, European populations have significantly lower numbers of haplotypes in comparison with those of North America. We also observed subtle differentiations among populations from the North and Baltic seas. The recently founded soft-shell clam population in the Black Sea exhibited the highest genetic similarity to Baltic populations, which confirmed the hypothesis that M. arenaria was introduced to the Gulf of Odessa from the Baltic Sea. The most enigmatic results were obtained for populations from the White Sea, which were characterized by high genetic affinity with American populations.
Wang, Xu; Qiu, Yue; Wei, Cong
2016-03-02
One new species of the genus Hyalessa China, H. wangi sp. nov., from Yunnan, China is described. Partial mitochondrial COI gene (DNA barcoding) of this new species is sequenced and uploaded to GenBank. A key to all species of Hyalessa is provided.
Monte, Tainá C C; Simões, Raquel O; Oliveira, Ana Paula M; Novaes, Clodoaldo F; Thiengo, Silvana C; Silva, Alexandre J; Estrela, Pedro C; Maldonado, Arnaldo
2012-11-06
The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode's main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI) gene sequences. The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8) from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions.
Directory of Open Access Journals (Sweden)
Monte Tainá CC
2012-11-01
Full Text Available Abstract Background The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode’s main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI gene sequences. Methods The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. Results The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8 from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. Conclusion The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions.
2012-01-01
Background The rat lungworm Angiostrongylus cantonensis can cause eosinophilic meningoencephalitis in humans. This nematode’s main definitive hosts are rodents and its intermediate hosts are snails. This parasite was first described in China and currently is dispersed across several Pacific islands, Asia, Australia, Africa, some Caribbean islands and most recently in the Americas. Here, we report the genetic variability among A. cantonensis isolates from different geographical locations in Brazil using mitochondrial cytochrome c oxidase subunit I (COI) gene sequences. Methods The isolates of A. cantonensis were obtained from distinct geographical locations of Brazil. Genomic DNAs were extracted, amplified by polymerase reaction, purified and sequenced. A partial sequence of COI gene was determined to assess their phylogenetic relationship. Results The sequences of A. cantonensis were monophyletic. We identified a distinct clade that included all isolates of A. cantonensis from Brazil and Asia based on eight distinct haplotypes (ac1, ac2, ac3, ac4, ac5, ac6, ac7 and ac8) from a previous study. Interestingly, the Brazilian haplotype ac5 is clustered with isolates from Japan, and the Brazilian haplotype ac8 from Rio de Janeiro, São Paulo, Pará and Pernambuco states formed a distinct clade. There is a divergent Brazilian haplotype, which we named ac9, closely related to Chinese haplotype ac6 and Japanese haplotype ac7. Conclusion The genetic variation observed among Brazilian isolates supports the hypothesis that the appearance of A. cantonensis in Brazil is likely a result of multiple introductions of parasite-carrying rats, transported on ships due to active commerce with Africa and Asia during the European colonization period. The rapid spread of the intermediate host, Achatina fulica, also seems to have contributed to the dispersion of this parasite and the infection of the definitive host in different Brazilian regions. PMID:23130987
DNA barcoding of Arctic Ocean holozooplankton for species identification and recognition
Bucklin, Ann; Hopcroft, Russell R.; Kosobokova, Ksenia N.; Nigro, Lisa M.; Ortman, Brian D.; Jennings, Robert M.; Sweetman, Christopher J.
2010-01-01
Zooplankton species diversity and distribution are important measures of environmental change in the Arctic Ocean, and may serve as 'rapid-responders' of climate-induced changes in this fragile ecosystem. The scarcity of taxonomists hampers detailed and up-to-date monitoring of these patterns for the rarer and more problematic species. DNA barcodes (short DNA sequences for species recognition and discovery) provide an alternative approach to accurate identification of known species, and can speed routine analysis of zooplankton samples. During 2004-2008, zooplankton samples were collected during cruises to the central Arctic Ocean and Chukchi Sea. A ˜700 base-pair region of the mitochondrial cytochrome oxidase I (mtCOI) gene was amplified and sequenced for 82 identified specimens of 41 species, including cnidarians (six hydrozoans, one scyphozoan), arthropod crustaceans (five amphipods, 24 copepods, one decapod, and one euphausiid); two chaetognaths; and one nemertean. Phylogenetic analysis used the Neighbor-Joining algorithm with Kimura-2-Parameter (K-2-P) distances, with 1000-fold bootstrapping. K-2-P genetic distances between individuals of the same species ranged from 0.0 to 0.2; genetic distances between species ranged widely from 0.1 to 0.7. The mtCOI gene tree showed monophyly (at 100% bootstrap value) for each of the 26 species for which more than one individual was analyzed. Of seven genera for which more than one species was analyzed, four were shown to be monophyletic; three genera were not resolved. At higher taxonomic levels, only the crustacean order Copepoda was resolved, with bootstrap value of 83%. The mtCOI barcodes accurately discriminated and identified known species of 10 taxonomic groups of Arctic Ocean holozooplankton. A comprehensive DNA barcode database for the estimated 300 described species of Arctic holozooplankton will allow rapid assessment of species diversity and distribution in this climate-vulnerable ocean ecosystem.
Species delimitation (grouping individuals into distinct taxonomic groups) is an essential part of evolutionary, conservation, and molecular ecology. Deoxyribonucleic acid (DNA) barcodes, short fragments of the cytochrome c oxidase subunit I (COI) gene, are being used in environm...
Directory of Open Access Journals (Sweden)
Mofolusho O. Falade
2016-06-01
Full Text Available DNA barcoding has been adopted as a gold standard rapid, precise and unifying identification system for animal species and provides a database of genetic sequences that can be used as a tool for universal species identification. In this study, we employed mitochondrial genes 16S rRNA (16S and cytochrome oxidase subunit I (COI for the identification of some Nigerian freshwater catfish and Tilapia species. Approximately 655 bp were amplified from the 5′ region of the mitochondrial cytochrome C oxidase subunit I (COI gene whereas 570 bp were amplified for the 16S rRNA gene. Nucleotide divergences among sequences were estimated based on Kimura 2-parameter distances and the genetic relationships were assessed by constructing phylogenetic trees using the neighbour-joining (NJ and maximum likelihood (ML methods. Analyses of consensus barcode sequences for each species, and alignment of individual sequences from within a given species revealed highly consistent barcodes (99% similarity on average, which could be compared with deposited sequences in public databases. The nucleotide distance between species belonging to different genera based on COI ranged from 0.17% between Sarotherodon melanotheron and Coptodon zillii to 0.49% between Clarias gariepinus and C. zillii, indicating that S. melanotheron and C. zillii are closely related. Based on the data obtained, the utility of COI gene was confirmed in accurate identification of three fish species from Southwest Nigeria.
Using DNA barcoding to differentiate invasive Dreissena species (Mollusca, Bivalvia
Directory of Open Access Journals (Sweden)
Jonathan Marescaux
2013-12-01
Full Text Available The zebra mussel (Dreissena polymorpha and the quagga mussel (Dreissena rostriformis bugensis are considered as the most competitive invaders in freshwaters of Europe and North America. Although shell characteristics exist to differentiate both species, phenotypic plasticity in the genus Dreissena does not always allow a clear identification. Therefore, the need to find an accurate identification method is essential. DNA barcoding has been proven to be an adequate procedure to discriminate species. The cytochrome c oxidase subunit 1 mitochondrial gene (COI is considered as the standard barcode for animals. We tested the use of this gene as an efficient DNA barcode and found that it allow rapid and accurate identification of adult Dreissena individuals.
Using DNA barcoding to differentiate invasive Dreissena species (Mollusca, Bivalvia).
Marescaux, Jonathan; Van Doninck, Karine
2013-12-30
The zebra mussel (Dreissena polymorpha) and the quagga mussel (Dreissena rostriformis bugensis) are considered as the most competitive invaders in freshwaters of Europe and North America. Although shell characteristics exist to differentiate both species, phenotypic plasticity in the genus Dreissena does not always allow a clear identification. Therefore, the need to find an accurate identification method is essential. DNA barcoding has been proven to be an adequate procedure to discriminate species. The cytochrome c oxidase subunit I mitochondrial gene (COI) is considered as the standard barcode for animals. We tested the use of this gene as an efficient DNA barcode and found that it allow rapid and accurate identification of adult Dreissena individuals.
Tarcz, Sebastian; Potekhin, Alexey; Rautian, Maria; Przyboś, Ewa
2012-05-01
This is the first phylogenetic study of the intraspecific variability within Paramecium multimicronucleatum with the application of two-loci analysis (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA) carried out on numerous strains originated from different continents. The species has been shown to have a complex structure of several sibling species within taxonomic species. Our analysis revealed the existence of 10 haplotypes for the rDNA fragment and 15 haplotypes for the COI fragment in the studied material. The mean distance for all of the studied P. multimicronucleatum sequence pairs was p=0.025/0.082 (rDNA/COI). Despite the greater variation of the COI fragment, the COI-derived tree topology is similar to the tree topology constructed on the basis of the rDNA fragment. P. multimicronucleatum strains are divided into three main clades. The tree based on COI fragment analysis presents a greater resolution of the studied P. multimicronucleatum strains. Our results indicate that the strains of P. multimicronucleatum that appear in different clades on the trees could belong to different syngens. Copyright © 2012 Elsevier Inc. All rights reserved.
Loh, W K W; Bond, P; Ashton, K J; Roberts, D T; Tibbetts, I R
2014-08-01
The barcoding of mitochondrial cytochrome c oxidase subunit 1 (coI) gene was amplified and sequenced from 16 species of freshwater fishes found in Lake Wivenhoe (south-eastern Queensland, Australia) to support monitoring of reservoir fish populations, ecosystem function and water health. In this study, 630-650 bp sequences of the coI barcoding gene from 100 specimens representing 15 genera, 13 families and two subclasses of fishes allowed 14 of the 16 species to be identified and differentiated. The mean ± s.e. Kimura 2 parameter divergence within and between species was 0.52 ± 0.10 and 23.8 ± 2.20% respectively, indicating that barcodes can be used to discriminate most of the fish species accurately. The two terapontids, Amniataba percoides and Leiopotherapon unicolor, however, shared coI DNA sequences and could not be differentiated using this gene. A barcoding database was established and a qPCR assay was developed using coI sequences to identify and quantify proportional abundances of fish species in ichthyoplankton samples from Lake Wivenhoe. These methods provide a viable alternative to the time-consuming process of manually enumerating and identifying ichthyoplankton samples. © 2014 The Fisheries Society of the British Isles.
Merkes, Christopher; Turnquist, Keith N.; Rees, Christopher B.; Amberg, Jon J.
2015-01-01
The performance of newly developed New Zealand mudsnail (Potamopyrgus antipodarum; NZMS) genetic markers for environmental (eDNA) analysis of water were compared across two laboratories. The genetic markers were tested in four quantitative polymerase chain reaction assays targeting two regions of the NZMS mitochondrial genome, specifically the cytochrome c oxidase subunit 1 (coi) and cytochrome b (cytb) genes. In a blind study, analysts tested each sample eight times with each assay. There were 10 expected-negative samples from the Black River in La Crosse, Wisconsin, 10 expected-positive samples from the Black Earth Creek in Black Earth, Wisconsin, and 10 known-positive samples from the Black River spiked with NZMS DNA. Previously extracted samples, kept at the Upper Midwest Environmental Sciences Center, were pooled by sample location and then equal quantities were distributed between the Upper Midwest Environmental Sciences Center and the Molecular Conservation Genetics Laboratory at the University of Wisconsin-Stevens Point for analysis. The assays tested were (1) the assay targeting cytb with a minor groove binder probe described by Goldberg and others (2013), (2) the cytb assay with a modified double-quenched probe, (3) an assay targeting coi with a double-quenched probe, and (4) a duplex reaction combining the modified cytb assay and the coi assay. Samples were considered positive for the presence of NZMS DNA when quantitative polymerase chain reaction amplification and probe signal was higher than the normalized threshold value above baseline fluorescence. For the duplex assay, samples were considered positive only when both probe signals were higher than the normalized threshold value above baseline fluorescence. Positive results were then confirmed by sequencing the products.
DEFF Research Database (Denmark)
Huemer, Peter; Elsner, Gustav; Karsholt, Ole
2013-01-01
The Eulamprotes wilkella species-group is revised based on morphological characters and on DNA barcodes of the mtCOI (Cytochrome c Oxidase 1) gene. Adult morphology combined with sequence information for 9 species supports the existence of 12 species, 7 of which are described as new to science: E...
Sridhar, J; Chinna Babu Naik, V; Ghodke, A; Kranthi, S; Kranthi, K R; Singh, B P; Choudhary, J S; Krishna, M S R
2017-11-01
Pink bollworm (PBW), Pectinophora gossypiella is one of the most destructive pest's globally inflicting huge economic losses in cotton even during later stages of crop growth. In the present investigation, the population genetic structure, distribution, and genetic diversity of P. gossypiella in cotton growing zones of India using partial mitochondrial DNA cytochrome oxidase-I (COI) gene was addressed. The overall haplotype (Hd), number of nucleotide differences (K), and nucleotide diversity (π) were 0.3028, 0.327, and 0.00047, respectively which suggest that entire population exhibited low level of genetic diversity. Zone-wise clustering of population revealed that central zone recorded low level of Hd (0.2730) as compared to north (0.3619) and south (0.3028) zones. The most common haplotype (H1) reported in all 19 locations could be proposed as ancestral/original haplotype. This haplotype with one mutational step formed star-like phylogeny connected with 11 other haplotypes. The phylogenetic relationship studies revealed that most haplotypes of populations are closely related to each other. Haplotype 5 was exclusively present in Dharwad (South zone) shared with populations of Hanumangarh and Bathinda (North zone). The result indicated that there is no isolation by distance effect among the Indian populations of PBW. The present study reports a low genetic diversity among PBW populations of India and H1, as ancestral haplotype from which other haplotypes have evolved suggests that the migration and dispersal over long distance and invasiveness are major factors.
Patterns of DNA barcode variation in Canadian marine molluscs.
Layton, Kara K S; Martel, André L; Hebert, Paul D N
2014-01-01
Molluscs are the most diverse marine phylum and this high diversity has resulted in considerable taxonomic problems. Because the number of species in Canadian oceans remains uncertain, there is a need to incorporate molecular methods into species identifications. A 648 base pair segment of the cytochrome c oxidase subunit I gene has proven useful for the identification and discovery of species in many animal lineages. While the utility of DNA barcoding in molluscs has been demonstrated in other studies, this is the first effort to construct a DNA barcode registry for marine molluscs across such a large geographic area. This study examines patterns of DNA barcode variation in 227 species of Canadian marine molluscs. Intraspecific sequence divergences ranged from 0-26.4% and a barcode gap existed for most taxa. Eleven cases of relatively deep (>2%) intraspecific divergence were detected, suggesting the possible presence of overlooked species. Structural variation was detected in COI with indels found in 37 species, mostly bivalves. Some indels were present in divergent lineages, primarily in the region of the first external loop, suggesting certain areas are hotspots for change. Lastly, mean GC content varied substantially among orders (24.5%-46.5%), and showed a significant positive correlation with nearest neighbour distances. DNA barcoding is an effective tool for the identification of Canadian marine molluscs and for revealing possible cases of overlooked species. Some species with deep intraspecific divergence showed a biogeographic partition between lineages on the Atlantic, Arctic and Pacific coasts, suggesting the role of Pleistocene glaciations in the subdivision of their populations. Indels were prevalent in the barcode region of the COI gene in bivalves and gastropods. This study highlights the efficacy of DNA barcoding for providing insights into sequence variation across a broad taxonomic group on a large geographic scale.
Directory of Open Access Journals (Sweden)
Strassmann Joan E
2004-03-01
Full Text Available Abstract Background Social wasps in the subfamily Polistinae (Hymenoptera: Vespidae have been important in studies of the evolution of sociality, kin selection, and within colony conflicts of interest. These studies have generally been conducted within species, because a resolved phylogeny among species is lacking. We used nuclear DNA microsatellite flanking sequences, mitochondrial COI sequence, and morphological characters to generate a phylogeny for the Polistinae (Hymenoptera using 69 species. Results Our phylogeny is largely concordant with previous phylogenies at higher levels, and is more resolved at the species level. Our results support the monophyly of the New World subgenera of Polistini, while the Old World subgenera are a paraphyletic group. All genera for which we had more than one exemplar were supported as monophyletic except Polybia which is not resolved, and may be paraphyletic. Conclusion The combination of DNA sequences from flanks of microsatellite repeats with mtCOI sequences and morphological characters proved to be useful characters establishing relationships among the different subgenera and species of the Polistini. This is the first detailed hypothesis for the species of this important group.
Bertrand, Bénédicte; Alburaki, Mohamed; Legout, Hélène; Moulin, Sibyle; Mougel, Florence; Garnery, Lionel
2015-05-01
Honeybee subspecies have been affected by human activities in Europe over the past few decades. One such example is the importation of nonlocal subspecies of bees which has had an adverse impact on the geographical repartition and subsequently on the genetic diversity of the black honeybee Apis mellifera mellifera. To restore the original diversity of this local honeybee subspecies, different conservation centres were set up in Europe. In this study, we established a black honeybee conservation centre Conservatoire de l'Abeille Noire d'Ile de France (CANIF) in the region of Ile-de-France, France. CANIF's honeybee colonies were intensively studied over a 3-year period. This study included a drone congregation area (DCA) located in the conservation centre. MtDNA COI-COII marker was used to evaluate the genetic diversity of CANIF's honeybee populations and the drones found and collected from the DCA. The same marker (mtDNA) was used to estimate the interactions and the haplotype frequency between CANIF's honeybee populations and 10 surrounding honeybee apiaries located outside of the CANIF. Our results indicate that the colonies of the conservation centre and the drones of the DCA show similar stable profiles compared to the surrounding populations with lower level of introgression. The mtDNA marker used on both DCA and colonies of the conservation centre seems to be an efficient approach to monitor and maintain the genetic diversity of the protected honeybee populations. © 2014 John Wiley & Sons Ltd.
Cloning human DNA repair genes
International Nuclear Information System (INIS)
Jeggo, P.A.; Carr, A.M.; Lehmann, A.R.
1994-01-01
Many human genes involved in the repair of UV damage have been cloned using different procedures and they have been of great value in assisting the understanding of the mechanism of nucleotide excision-repair. Genes involved in repair of ionizing radiation damage have proved more difficult to isolate. Positional cloning has localized the XRCC5 gene to a small region of chromosome 2q33-35, and a series of yeast artificial chromosomes covering this region have been isolated. Very recent work has shown that the XRCC5 gene encodes the 80 kDa subunit of the Ku DNA-binding protein. The Ku80 gene also maps to this region. Studies with fission yeast have shown that radiation sensitivity can result not only from defective DNA repair but also from abnormal cell cycle control following DNA damage. Several genes involved in this 'check-point' control in fission yeast have been isolated and characterized in detail. It is likely that a similar checkpoint control mechanism exists in human cells. (author)
Directory of Open Access Journals (Sweden)
Tun Nurul Aimi Mat Jaafar
Full Text Available BACKGROUND: DNA barcodes, typically focusing on the cytochrome oxidase I gene (COI in many animals, have been used widely as a species-identification tool. The ability of DNA barcoding to distinguish species from a range of taxa and to reveal cryptic species has been well documented. Despite the wealth of DNA barcode data for fish from many temperate regions, there are relatively few available from the Southeast Asian region. Here, we target the marine fish Family Carangidae, one of the most commercially-important families from the Indo-Malay Archipelago (IMA, to produce an initial reference DNA barcode library. METHODOLOGY/PRINCIPAL FINDINGS: Here, a 652 bp region of COI was sequenced for 723 individuals from 36 putative species of Family Carangidae distributed within IMA waters. Within the newly-generated dataset, three described species exhibited conspecific divergences up to ten times greater (4.32-4.82% than mean estimates (0.24-0.39%, indicating a discrepancy with assigned morphological taxonomic identification, and the existence of cryptic species. Variability of the mitochondrial DNA COI region was compared within and among species to evaluate the COI region's suitability for species identification. The trend in range of mean K2P distances observed was generally in accordance with expectations based on taxonomic hierarchy: 0% to 4.82% between individuals within species, 0% to 16.4% between species within genera, and 8.64% to 25.39% between genera within families. The average Kimura 2-parameter (K2P distance between individuals, between species within genera, and between genera within family were 0.37%, 10.53% and 16.56%, respectively. All described species formed monophyletic clusters in the Neighbour-joining phylogenetic tree, although three species representing complexes of six potential cryptic species were detected in Indo-Malay Carangidae; Atule mate, Selar crumenophthalmus and Seriolina nigrofasciata. CONCLUSION/SIGNIFICANCE: This
DNA variation in the phenotypically-diverse brown alga Saccharina japonica
Directory of Open Access Journals (Sweden)
Balakirev Evgeniy S
2012-07-01
Full Text Available Abstract Background Saccharina japonica (Areschoug Lane, Mayes, Druehl et Saunders is an economically important and highly morphologically variable brown alga inhabiting the northwest Pacific marine waters. On the basis of nuclear (ITS, plastid (rbcLS and mitochondrial (COI DNA sequence data, we have analyzed the genetic composition of typical Saccharina japonica (TYP and its two common morphological varieties, known as the “longipes” (LON and “shallow-water” (SHA forms seeking to clarify their taxonomical status and to evaluate the possibility of cryptic species within S. japonica. Results The data show that the TYP and LON forms are very similar genetically in spite of drastic differences in morphology, life history traits, and ecological preferences. Both, however, are genetically quite different from the SHA form. The two Saccharina lineages are distinguished by 109 fixed single nucleotide differences as well as by seven fixed length polymorphisms (based on a 4,286 bp concatenated dataset that includes three gene regions. The GenBank database reveals a close affinity of the TYP and LON forms to S. japonica and the SHA form to S. cichorioides. The three gene markers used in the present work have different sensitivity for the algal species identification. COI gene was the most discriminant gene marker. However, we have detected instances of interspecific COI recombination reflecting putative historical hybridization events between distantly related algal lineages. The recombinant sequences show highly contrasted level of divergence in the 5’- and 3’- regions of the gene, leading to significantly different tree topologies depending on the gene segment (5’- or 3’- used for tree reconstruction. Consequently, the 5’-COI “barcoding” region (~ 650 bp can be misleading for identification purposes, at least in the case of algal species that might have experienced historical hybridization events. Conclusion Taking into account
DNA barcoding amphibians and reptiles.
Vences, Miguel; Nagy, Zoltán T; Sonet, Gontran; Verheyen, Erik
2012-01-01
Only a few major research programs are currently targeting COI barcoding of amphibians and reptiles (including chelonians and crocodiles), two major groups of tetrapods. Amphibian and reptile species are typically old, strongly divergent, and contain deep conspecific lineages which might lead to problems in species assignment with incomplete reference databases. As far as known, there is no single pair of COI primers that will guarantee a sufficient rate of success across all amphibian and reptile taxa, or within major subclades of amphibians and reptiles, which means that the PCR amplification strategy needs to be adjusted depending on the specific research question. In general, many more amphibian and reptile taxa have been sequenced for 16S rDNA, which for some purposes may be a suitable complementary marker, at least until a more comprehensive COI reference database becomes available. DNA barcoding has successfully been used to identify amphibian larval stages (tadpoles) in species-rich tropical assemblages. Tissue sampling, DNA extraction, and amplification of COI is straightforward in amphibians and reptiles. Single primer pairs are likely to have a failure rate between 5 and 50% if taxa of a wide taxonomic range are targeted; in such cases the use of primer cocktails or subsequent hierarchical usage of different primer pairs is necessary. If the target group is taxonomically limited, many studies have followed a strategy of designing specific primers which then allow an easy and reliable amplification of all samples.
DNA barcoding of commercially important catfishes in the Philippines.
Quilang, Jonas P; Yu, Shiny Cathlynne S
2015-06-01
Many species of catfish are important resources for human consumption, for sport fishing and for use in aquarium industry. In the Philippines, some species are cultivated and some are caught in the wild for food and a few introduced species have become invasive. In this study, DNA barcoding using the mitochondrial cytochrome c oxidase I (COI) gene was done on commercially and economically important Philippine catfishes. A total of 75 specimens belonging to 11 species and 5 families were DNA barcoded. The genetic distances were computed and Neighbor-Joining (NJ) trees were constructed based on the Kimura 2-Parameter (K2P) method. The average K2P distances within species, genus, family and order were 0.2, 8.2, 12.7 and 21.9%, respectively. COI sequences clustered according to their species designation for 7 of the 11 catfishes. DNA barcoding was not able to discriminate between Arius dispar and A. manillensis and between Pterygoplichthys disjunctivus and P. pardalis. The morphological characters that are used to distinguish between these species do not complement molecular identification through DNA barcoding. DNA barcoding also showed that Clarias batrachus from the Philippines is different from the species found in India and Thailand, which supports earlier suggestions based on morphology that those found in India should be designated as C. magur and those in mainland Southeast Asia as C. aff. batrachus "Indochina". This study has shown that DNA barcoding can be used for species delineation and for tagging some species for further taxonomic investigation, which has implications on proper management and conservation strategies.
Directory of Open Access Journals (Sweden)
Chia-Min Hsu
Full Text Available The identification of coral recruits has been problematic due to a lack of definitive morphological characters being available for higher taxonomic resolution. In this study, we tested whether fluorescent detection of coral recruits used in combinations of different DNA-barcoding markers (cytochrome oxidase I gene [COI], open reading frame [ORF], and nuclear Pax-C intron [PaxC] could be useful for increasing the resolution of coral spat identification in ecological studies. One hundred and fifty settlement plates were emplaced at nine sites on the fringing reefs of Kenting National Park in southern Taiwan between April 2011 and September 2012. A total of 248 living coral spats and juveniles (with basal areas ranging from 0.21 to 134.57 mm(2 were detected on the plates with the aid of fluorescent light and collected for molecular analyses. Using the COI DNA barcoding technique, 90.3% (224/248 of coral spats were successfully identified into six genera, including Acropora, Isopora, Montipora, Pocillopora, Porites, and Pavona. PaxC further separated I. cuneata and I. palifera of Isopora from Acropora, and ORF successfully identified the species of Pocillopora (except P. meandrina and P. eydouxi. Moreover, other cnidarian species such as actinarians, zoanthids, and Millepora species were visually found using fluorescence and identified by COI DNA barcoding. This combination of existing approaches greatly improved the taxonomic resolution of early coral life stages, which to date has been mainly limited to the family level based on skeletal identification. Overall, this study suggests important improvements for the identification of coral recruits in ecological studies.
Hsu, Chia-Min; de Palmas, Stéphane; Kuo, Chao-Yang; Denis, Vianney; Chen, Chaolun Allen
2014-01-01
The identification of coral recruits has been problematic due to a lack of definitive morphological characters being available for higher taxonomic resolution. In this study, we tested whether fluorescent detection of coral recruits used in combinations of different DNA-barcoding markers (cytochrome oxidase I gene [COI], open reading frame [ORF], and nuclear Pax-C intron [PaxC]) could be useful for increasing the resolution of coral spat identification in ecological studies. One hundred and fifty settlement plates were emplaced at nine sites on the fringing reefs of Kenting National Park in southern Taiwan between April 2011 and September 2012. A total of 248 living coral spats and juveniles (with basal areas ranging from 0.21 to 134.57 mm(2)) were detected on the plates with the aid of fluorescent light and collected for molecular analyses. Using the COI DNA barcoding technique, 90.3% (224/248) of coral spats were successfully identified into six genera, including Acropora, Isopora, Montipora, Pocillopora, Porites, and Pavona. PaxC further separated I. cuneata and I. palifera of Isopora from Acropora, and ORF successfully identified the species of Pocillopora (except P. meandrina and P. eydouxi). Moreover, other cnidarian species such as actinarians, zoanthids, and Millepora species were visually found using fluorescence and identified by COI DNA barcoding. This combination of existing approaches greatly improved the taxonomic resolution of early coral life stages, which to date has been mainly limited to the family level based on skeletal identification. Overall, this study suggests important improvements for the identification of coral recruits in ecological studies.
Kim, Byeongseok; Yang, Mi Yeon; Kim, Myung Sook
2016-09-01
Although the marine red algal genus Neosiphonia is well characterized, many species of Neosiphonia are poorly understood. To correctly define the species delimitation of Neosiphonia yendoi using genetic variation, owing to the confusion over identification with " N. sphaerocarpa" from Korea, we investigated intensively the haplotype network of the mitochondrial COI and the plastid rbcL genes of specimens collected from Korea and Japan. The molecular analyses indicated that specimens collected in different sites of Korea and Japan belong to the same species, Neosiphonia yendoi and " Neosiphonia sphaerocarpa" from Korea, which is distinguished from N. sphaerocarpa from Florida and is allied with N. yendoi collected from the type locality, Muroran of Japan. A total of 29 COI and 13 rbcL haplotypes were found and the COI haplotype network shows evidence of a clear break between specimens from Jeju Island and all other locations of Korea, suggesting the possibility of cryptic diversity within N. yendoi.
[Significance of COI disclosure in medical research in Japan].
Sone, Saburo
2011-11-01
In medical research, remarkable increase in collaboration with industry, public organizations such as universities, research institutions, and academic societies makes researchers to be more deeply involved with the activities of commercial entities. Activities of education and research, which are the responsibilities of academic institutions and societies, conflict with the interests of individuals associated with industrial-academic collaboration. Management of such conflict of interest (COI) is of much importance for academic institutions and societies to appropriately promote industrial-academic collaborative activities. Particularly, participation not only by healthy individuals, but also patients, is essential in the medical field as subjects of clinical research. For those involved in medical research, the deeper the level of COI with commercial entities, who are the financial or benefit provider, becomes serious, the more human rights of subjects could be violated, safety of life could be endangered, and research methods, data analysis and interpretation of results could be distorted. It is also possible that research may be unfairly evaluated or not published, even if the results are accurate, sometimes resulting in the ascertained effects of reporting bias included the overestimation of efficacy and the underestimation of safety risks of interventions. According to the COI management guideline of the Japanese Association of Medical Science (JAMS), significance of COI management is discussed.
Broad-lined Supernova 2016coi with a Helium Envelope
Energy Technology Data Exchange (ETDEWEB)
Yamanaka, Masayuki [Department of Physics, Faculty of Science and Engineering, Konan University, Okamoto, Kobe, Hyogo 658-8501 (Japan); Nakaoka, Tatsuya; Kawabata, Miho [Department of Physical Science, Hiroshima University, Kagamiyama 1-3-1, Higashi-Hiroshima 739-8526 (Japan); Tanaka, Masaomi [National Astronomical Observatory of Japan, National Institutes of Natural Sciences, Osawa, Mitaka, Tokyo 181-8588 (Japan); Maeda, Keiichi [Department of Astronomy, Graduate School of Science, Kyoto University, Sakyo-ku, Kyoto 606-8502 (Japan); Honda, Satoshi; Hosoya, Kensuke; Karita, Mayu; Morihana, Kumiko [Nishi-Harima Astronomical Observatory, Center for Astronomy, University of Hyogo, 407-2 Nishigaichi, Sayo-cho, Sayo, Hyogo 679-5313 (Japan); Hanayama, Hidekazu [Ishigakijima Astronomical Observatory, National Astronomical Observatory of Japan, National Institutes of Natural Sciences, 1024-1 Arakawa, Ishigaki, Okinawa 907-0024 (Japan); Morokuma, Tomoki [Institute of Astronomy, Graduate School of Science, The University of Tokyo, 2-21-1 Osawa, Mitaka, Tokyo 181-0015 (Japan); Imai, Masataka [Department of Cosmosciences, Graduate School of Science, Hokkaido University, Kita 10 Nishi8, Kita-ku, Sapporo 060-0810 (Japan); Kinugasa, Kenzo [Nobeyama Radio Observatory, National Astronomical Observatory of Japan, National Institutes of Natural Sciences, 462-2 Nobeyama, Minamimaki, Minamisaku, Nagano 384-1305 (Japan); Murata, Katsuhiro L. [Department of Astrophysics, Nagoya University, Chikusa-ku, Nagoya 464-8602 (Japan); Nishimori, Takefumi; Gima, Hirotaka; Ito, Ayano; Morikawa, Yuto; Murakami, Kotone [Graduate School of Science and Engineering, Kagoshima University, 1-21-35 Korimoto, Kagoshima 890-0065 (Japan); Hashimoto, Osamu, E-mail: yamanaka@center.konan-u.ac.jp [Gunma Astronomical Observatory, Takayama, Gunma 377-0702 (Japan); and others
2017-03-01
We present the early-phase spectra and the light curves of the broad-lined (BL) supernova (SN) 2016coi from t = 7 to 67 days after the estimated explosion date. This SN was initially reported as a BL Type SN Ic (SN Ic-BL). However, we found that spectra up to t = 12 days exhibited the He i λ 5876, λ 6678, and λ 7065 absorption lines. We show that the smoothed and blueshifted spectra of normal SNe Ib are remarkably similar to the observed spectrum of SN 2016coi. The line velocities of SN 2016coi were similar to those of SNe Ic-BL and significantly faster than those of SNe Ib. Analyses of the line velocity and light curve suggest that the kinetic energy and the total ejecta mass of SN 2016coi are similar to those of SNe Ic-BL. Together with BL SNe 2009bb and 2012ap, for which the detection of He i was also reported, these SNe could be transitional objects between SNe Ic-BL and SNe Ib, and be classified as BL Type “Ib” SNe (SNe “Ib”-BL). Our work demonstrates the diversity of the outermost layer in BL SNe, which should be related to the variety of the evolutionary paths.
Zhang, Ruijie; Lv, Wenhua; Luan, Meiwei; Zheng, Jiajia; Shi, Miao; Zhu, Hongjie; Li, Jin; Lv, Hongchao; Zhang, Mingming; Shang, Zhenwei; Duan, Lian; Jiang, Yongshuai
2015-11-24
Different human genes often exhibit different degrees of stability in their DNA methylation levels between tissues, samples or cell types. This may be related to the evolution of human genome. Thus, we compared the evolutionary conservation between two types of genes: genes with stable DNA methylation levels (SM genes) and genes with fluctuant DNA methylation levels (FM genes). For long-term evolutionary characteristics between species, we compared the percentage of the orthologous genes, evolutionary rate dn/ds and protein sequence identity. We found that the SM genes had greater percentages of the orthologous genes, lower dn/ds, and higher protein sequence identities in all the 21 species. These results indicated that the SM genes were more evolutionarily conserved than the FM genes. For short-term evolutionary characteristics among human populations, we compared the single nucleotide polymorphism (SNP) density, and the linkage disequilibrium (LD) degree in HapMap populations and 1000 genomes project populations. We observed that the SM genes had lower SNP densities, and higher degrees of LD in all the 11 HapMap populations and 13 1000 genomes project populations. These results mean that the SM genes had more stable chromosome genetic structures, and were more conserved than the FM genes.
Pia Miglietta, Maria; Hourdez, Stephane; Cowart, Dominique A.; Schaeffer, Stephen W.; Fisher, Charles
2010-11-01
At least six morphospecies of vestimentiferan tubeworms are associated with cold seeps in the Gulf of Mexico (GOM). The physiology and ecology of the two best-studied species from depths above 1000 m in the upper Louisiana slope (Lamellibrachia luymesi and Seepiophila jonesi) are relatively well understood. The biology of one rare species from the upper slope (escarpiid sp. nov.) and three morphospecies found at greater depths in the GOM (Lamellibrachia sp. 1, L. sp. 2, and Escarpia laminata) are not as well understood. Here we address species distributions and boundaries of cold-seep tubeworms using phylogenetic hypotheses based on two mitochondrial genes. Fragments of the mitochondrial large ribosomal subunit rDNA (16S) and cytochrome oxidase subunit I (COI) genes were sequenced for 167 vestimentiferans collected from the GOM and analyzed in the context of other seep vestimentiferans for which sequence data were available. The analysis supported five monophyletic clades of vestimentiferans in the GOM. Intra-clade variation in both genes was very low, and there was no apparent correlation between the within-clade diversity and collection depth or location. Two of the morphospecies of Lamellibrachia from different depths in the GOM could not be distinguished by either mitochondrial gene. Similarly, E. laminata could not be distinguished from other described species of Escarpia from either the west coast of Africa or the eastern Pacific using COI. We suggest that the mitochondrial COI and 16S genes have little utility as barcoding markers for seep vestimentiferan tubeworms.
Dantur Juri, María J; Moreno, Marta; Prado Izaguirre, Mónica J; Navarro, Juan C; Zaidenberg, Mario O; Almirón, Walter R; Claps, Guillermo L; Conn, Jan E
2014-09-04
Anopheles pseudopunctipennis is an important malaria vector in the Neotropical region and the only species involved in Plasmodium transmission in the Andean foothills. Its wide geographical distribution in America, high preference for biting humans and capacity to rest inside dwellings after feeding, are attributes contributing to its vector status. Previous reports have tried to elucidate its taxonomic status, distinguishing populations from North, Central and South America. In the present study we used a mitochondrial marker to examine the demographic history of An. pseudopunctipennis in northwestern Argentina. Twelve localities were selected across 550 km of the distribution of this species in Argentina, including two near the Bolivian border and several in South Tucumán, for sampling. A fragment of the cytochrome oxidase I (COI) gene was sequenced and haplotype relationships were analyzed by a statistical parsimony network and a Neighbor-Joining (NJ) tree. Genetic differentiation was estimated with FST. Historical demographic processes were evaluated using diversity measures, neutrality tests and mismatch distribution. Forty-one haplotypes were identified, of which haplotype A was the most common and widely distributed. Neither the network nor the NJ tree showed any geographic differentiation between northern and southern populations. Haplotype diversities, Tajima's DT and Fu & Li's F and D neutrality tests and mismatch distribution supported a scenario of Holocene demographic expansion. The demographic pattern suggests that An. pseudopunctipennis has undergone a single colonization process, and the ancestral haplotype is shared by specimens from all localities, indicating mitochondrial gene flow. Genetic differentiation was minimal, observed only between one northern and one southern locality. The estimated time of the population expansion of this species was during the Holocene. These data suggest that regional vector control measures would be equally
Human DNA repair and recombination genes
International Nuclear Information System (INIS)
Thompson, L.H.; Weber, C.A.; Jones, N.J.
1988-09-01
Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs
DEFF Research Database (Denmark)
Pimvichai, Piyatida; Enghoff, Henrik; Panha, Somsak
2018-01-01
Species-level taxonomy and phylogeny of two genera of South-East (SE) Asian pachybolid millipedes are analysed with a combination of morphological characters and DNA sequences (two mitochondrial gene fragments: COI and 16S rRNA). Strong support is found for the genera Litostrophus Chamberlin, 192...
DNA-mediated gene transfer into ataxia-telangiectasia cells
International Nuclear Information System (INIS)
Crescenzi, M.; Pulciani, S.; Carbonari, M.; Tedesco, L.; Russo, G.; Gaetano, C.; Fiorilli, M.
1986-01-01
The complete description of the genetic lesion(s) underlying the AT mutation might, therefore, highlight not only a DNA-repair pathwa, but also an important aspect of the physiology of lymphocytes. DNA-mediated gene transfer into eukaryotic cells has proved a powerful tool for the molecular cloning of certain mammalian genes. The possibility to clone a given gene using this technology depends, basically, on the availability of a selectable marker associated with the expression of the transfected gene in the recipient cell. Recently, a human DNA repair gene has been cloned in CHO mutant cells by taking advantage of the increased resistance to ultraviolet radiation of the transformants. As a preliminary step toward the molecular cloning of the AT gene(s), the authors have attempted to confer radioresistance to AT cells by transfection with normal human DNA
DNA barcoding commercially important fish species of Turkey.
Keskın, Emre; Atar, Hasan H
2013-09-01
DNA barcoding was used in the identification of 89 commercially important freshwater and marine fish species found in Turkish ichthyofauna. A total of 1765 DNA barcodes using a 654-bp-long fragment of the mitochondrial cytochrome c oxidase subunit I gene were generated for 89 commercially important freshwater and marine fish species found in Turkish ichthyofauna. These species belong to 70 genera, 40 families and 19 orders from class Actinopterygii, and all were associated with a distinct DNA barcode. Nine and 12 of the COI barcode clusters represent the first species records submitted to the BOLD and GenBank databases, respectively. All COI barcodes (except sequences of first species records) were matched with reference sequences of expected species, according to morphological identification. Average nucleotide frequencies of the data set were calculated as T = 29.7%, C = 28.2%, A = 23.6% and G = 18.6%. Average pairwise genetic distance among individuals were estimated as 0.32%, 9.62%, 17,90% and 22.40% for conspecific, congeneric, confamilial and within order, respectively. Kimura 2-parameter genetic distance values were found to increase with taxonomic level. For most of the species analysed in our data set, there is a barcoding gap, and an overlap in the barcoding gap exists for only two genera. Neighbour-joining trees were drawn based on DNA barcodes and all the specimens clustered in agreement with their taxonomic classification at species level. Results of this study supported DNA barcoding as an efficient molecular tool for a better monitoring, conservation and management of fisheries. © 2013 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Kalia S.I. Bistolas
2017-09-01
Full Text Available Circular rep-encoding ssDNA (CRESS-DNA viruses are common constituents of invertebrate viral consortia. Despite their ubiquity and sequence diversity, the effects of CRESS-DNA viruses on invertebrate biology and ecology remain largely unknown. This study assessed the relationship between the transcriptional profile of benthic amphipods of genus Diporeia and the presence of the CRESS-DNA virus, LM29173, in the Laurentian Great Lakes to provide potential insight into the influence of these viruses on invertebrate gene expression. Twelve transcriptomes derived from Diporeia were compared, representing organisms from two amphipod haplotype clades (Great Lakes Michigan and Superior, defined by COI barcode sequencing with varying viral loads (up to 3 × 106 genome copies organism−1. Read recruitment to de novo assembled transcripts revealed 2,208 significantly over or underexpressed contigs in transcriptomes with above average LM29173 load. Of these contigs, 31.5% were assigned a putative function. The greatest proportion of annotated, differentially expressed transcripts were associated with functions including: (1 replication, recombination, and repair, (2 cell structure/biogenesis, and (3 post-translational modification, protein turnover, and chaperones. Contigs putatively associated with innate immunity displayed no consistent pattern of expression, though several transcripts were significantly overexpressed in amphipods with high viral load. Quantitation (RT-qPCR of target transcripts, non-muscular myosin heavy chain, β-actin, and ubiquitin-conjugating enzyme E2, corroborated transcriptome analysis and indicated that Lake Michigan and Lake Superior amphipods with high LM29173 load exhibit lake-specific trends in gene expression. While this investigation provides the first comparative survey of the transcriptional profile of invertebrates of variable CRESS-DNA viral load, additional inquiry is required to define the scope of host
The partial mitochondrial sequence of the Old World stingless bee ...
Indian Academy of Sciences (India)
Sequences of primers used in PCR reactions of T. pagdeni mtDNA. mtDNA genes. Primer. Sequence. ATPase (6,8). ATPS6-F. 5 -AAG ATA TAT GGA AAT AAG CT-3. tRNA-ASP-R. 5 -ATA AAA TAA CGT CAA AAT GTC A-3. COI. COI-F. 5 - ATA ATT ATT GTT GCT GAT GTA-3. COI-R. 5 -CTA TTC ATA TAA CTG GAA TTT C-3.
Phylogenetic analysis and DNA-based species confirmation in Anopheles (Nyssorhynchus.
Directory of Open Access Journals (Sweden)
Peter G Foster
Full Text Available Specimens of neotropical Anopheles (Nyssorhynchus were collected and identified morphologically. We amplified three genes for phylogenetic analysis-the single copy nuclear white and CAD genes, and the COI barcode region. Since we had multiple specimens for most species we were able to test how well the single or combined genes were able to corroborate morphologically defined species by placing the species into exclusive groups. We found that single genes, including the COI barcode region, were poor at confirming species, but that the three genes combined were able to do so much better. This has implications for species identification, species delimitation, and species discovery, and we caution that single genes are not enough. Higher level groupings were partially resolved with some well-supported groupings, whereas others were found to be either polyphyletic or paraphyletic. There were examples of known groups, such as the Myzorhynchella Section, which were poorly supported with single genes but were well supported with combined genes. From this we can infer that more sequence data will be needed in order to show more higher-level groupings with good support. We got unambiguously good support (0.94-1.0 Bayesian posterior probability from all DNA-based analyses for a grouping of An. dunhami with An. nuneztovari and An. goeldii, and because of this and because of morphological similarities we propose that An. dunhami be included in the Nuneztovari Complex. We obtained phylogenetic corroboration for new species which had been recognised by morphological differences; these will need to be formally described and named.
Potential of DNA sequences to identify zoanthids (Cnidaria: Zoantharia).
Sinniger, Frederic; Reimer, James D; Pawlowski, Jan
2008-12-01
The order Zoantharia is known for its chaotic taxonomy and difficult morphological identification. One method that potentially could help for examining such troublesome taxa is DNA barcoding, which identifies species using standard molecular markers. The mitochondrial cytochrome oxidase subunit I (COI) has been utilized to great success in groups such as birds and insects; however, its applicability in many other groups is controversial. Recently, some studies have suggested that barcoding is not applicable to anthozoans. Here, we examine the use of COI and mitochondrial 16S ribosomal DNA for zoanthid identification. Despite the absence of a clear barcoding gap, our results show that for most of 54 zoanthid samples, both markers could separate samples to the species, or species group, level, particularly when easily accessible ecological or distributional data were included. Additionally, we have used the short V5 region of mt 16S rDNA to identify eight old (13 to 50 years old) museum samples. We discuss advantages and disadvantages of COI and mt 16S rDNA as barcodes for Zoantharia, and recommend that either one or both of these markers be considered for zoanthid identification in the future.
Directory of Open Access Journals (Sweden)
Eric D Stein
Full Text Available Molecular methods, such as DNA barcoding, have the potential to enhance biomonitoring programs worldwide. Altering routinely used sample preservation methods to protect DNA from degradation may pose a potential impediment to application of DNA barcoding and metagenomics for biomonitoring using benthic macroinvertebrates. Using higher volumes or concentrations of ethanol, requirements for shorter holding times, or the need to include additional filtering may increase cost and logistical constraints to existing biomonitoring programs. To address this issue we evaluated the efficacy of various ethanol-based sample preservation methods at maintaining DNA integrity. We evaluated a series of methods that were minimally modified from typical field protocols in order to identify an approach that can be readily incorporated into existing monitoring programs. Benthic macroinvertebrates were collected from a minimally disturbed stream in southern California, USA and subjected to one of six preservation treatments. Ten individuals from five taxa were selected from each treatment and processed to produce DNA barcodes from the mitochondrial gene cytochrome c oxidase I (COI. On average, we obtained successful COI sequences (i.e. either full or partial barcodes for between 93-99% of all specimens across all six treatments. As long as samples were initially preserved in 95% ethanol, successful sequencing of COI barcodes was not affected by a low dilution ratio of 2∶1, transfer to 70% ethanol, presence of abundant organic matter, or holding times of up to six months. Barcoding success varied by taxa, with Leptohyphidae (Ephemeroptera producing the lowest barcode success rate, most likely due to poor PCR primer efficiency. Differential barcoding success rates have the potential to introduce spurious results. However, routine preservation methods can largely be used without adverse effects on DNA integrity.
Isolation and characterization of the dnaA gene of Rickettsia prowazekii
International Nuclear Information System (INIS)
Waite, R.T.; Shaw, E.I.; Winkler, H.H.; Wood, D.G.
1998-01-01
The dnaA gene encoding the initiator protein of DNA replication was isolated from the obligate intracellular bacterium, Rickettsia prowazekii. Comparison of the deduced amino acid sequence of R. prowazekii DnaA with other bacterial DnaA proteins revealed extensive similarity. However, the rickettsial sequence is unique in the number of basic lysine residues found within a highly conserved portion of the putative DNA binding region, suggesting that the rickettsial protein may recognize a DNA sequence that differs from the consensus DnaA box sequence identified in other bacteria. Consensus DnaA box sequences, found upstream of many bacterial dnaA genes, were not identified upstream of rickettsial dnaA gene. In addition, gene organization within this region differed from that of other bacteria. The putative start of transcription of the rickettsial dnaA gene was localized to a site 522 nucleotides upstream of the DnaA start codon. Key words: Rickettsia prowazekii; dnaA gene; initiator protein (authors)
Directory of Open Access Journals (Sweden)
Suriana
2012-08-01
Full Text Available The study was conducted to assess the characteristics of partial gene of cytochrome C oxidase subunit I (COI of wild silkmoth Cricula trifenestrata, and to detect the diagnostic sites from these gene for evaluation as species marker. A total of fifteen larvae of C. tifenestrata were collected from Bogor, Purwakarta, and Bantul Regencies. Genomic DNA was extracted from silk gland of individual larvae, then amplified by PCR method and sequenced. DNA sequencing was done to characterize their nucleotide and amino acid contents. The results showed that 595 nucleotides at the 5 ‘end of COI gene of C. tifenestrata was conserved at the species level, but varies at the family level. Nucleotide dominated by thymine and adenine bases (± 70%. There were 25 diagnostic sites for C. tifenestrata, and four diagnostic sites for genus level. One hundred eigthty nine (189 amino acids were alignment, and only one percent of the genes was varied among species. The 107th amino acid (valine and 138th (threonine were diagnostics amino acid for C. tifenestrata. Based on nucleotides and amino acids sequences, the phylogeny showed that C. tifenestrata lied on the same nodes with Antheraea, so the Saturniidae family is monophyletic.
Divergence of gene body DNA methylation and evolution of plant duplicate genes.
Directory of Open Access Journals (Sweden)
Jun Wang
Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.
Tan, Siew Hwa; Aris, Edah Mohd; Surin, Johari; Omar, Baharudin; Kurahashi, Hiromu; Mohamed, Zulqarnain
2009-08-01
The mitochondiral DNA region encompassing the cytochrome oxidase subunit I (COI) and cytochrome oxidase subunit II (COII) genes of two Malaysian blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) were studied. This region, which spans 2303bp and includes the COI, tRNA leucine and partial COII was sequenced from adult fly and larval specimens, and compared. Intraspecific variations were observed at 0.26% for Ch. megacephala and 0.17% for Ch. rufifacies, while sequence divergence between the two species was recorded at a minimum of 141 out of 2303 sites (6.12%). Results obtained in this study are comparable to published data, and thus support the use of DNA sequence to facilitate and complement morphology-based species identification.
Gene assembly via one-pot chemical ligation of DNA promoted by DNA nanostructures
DEFF Research Database (Denmark)
Manuguerra, Ilenia; Croce, Stefano; El-Sagheer, Afaf H.
2018-01-01
Current gene synthesis methods are driven by enzymatic reactions. Here we report the one-pot synthesis of a chemically-ligated gene from 14 oligonucleotides. The chemical ligation benefits from the highly efficient click chemistry approach templated by DNA nanostructures, and produces modified DNA...
Naddaf, Saied Reza; Oshaghi, Mohammad Ali; Vatandoost, Hassan
2012-12-01
Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI) gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran. DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474-475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P) model of neighbor-joining method. Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran) in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%. Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.
Neotropical bats: estimating species diversity with DNA barcodes.
Directory of Open Access Journals (Sweden)
Elizabeth L Clare
Full Text Available DNA barcoding using the cytochrome c oxidase subunit 1 gene (COI is frequently employed as an efficient method of species identification in animal life and may also be used to estimate species richness, particularly in understudied faunas. Despite numerous past demonstrations of the efficiency of this technique, few studies have attempted to employ DNA barcoding methodologies on a large geographic scale, particularly within tropical regions. In this study we survey current and potential species diversity using DNA barcodes with a collection of more than 9000 individuals from 163 species of Neotropical bats (order Chiroptera. This represents one of the largest surveys to employ this strategy on any animal group and is certainly the largest to date for land vertebrates. Our analysis documents the utility of this tool over great geographic distances and across extraordinarily diverse habitats. Among the 163 included species 98.8% possessed distinct sets of COI haplotypes making them easily recognizable at this locus. We detected only a single case of shared haplotypes. Intraspecific diversity in the region was high among currently recognized species (mean of 1.38%, range 0-11.79% with respect to birds, though comparable to other bat assemblages. In 44 of 163 cases, well-supported, distinct intraspecific lineages were identified which may suggest the presence of cryptic species though mean and maximum intraspecific divergence were not good predictors of their presence. In all cases, intraspecific lineages require additional investigation using complementary molecular techniques and additional characters such as morphology and acoustic data. Our analysis provides strong support for the continued assembly of DNA barcoding libraries and ongoing taxonomic investigation of bats.
Directory of Open Access Journals (Sweden)
Youzhu Cheng
2014-06-01
Full Text Available Angiostrongylus cantonensis is a zoonotic public health concern that causes human severe eosinophilic meningitis in Southeast Asia and China. As a medically important intermediate host of A. cantonensis, Bellamya lithophaga (Gastropoda: Viviparidae is often confused with other morphologically similar sibling species of genus Bellamya, such as B. aeruginosa and B. purificata in the past. Hence, the aim of the present study was to investigate evidences to discriminate these equivocal Bellamya species.This study was carried out by getting Bellamya snail samples from Fujian Province in the South-East of China. The snail morphological features, breeding grounds and phylogenetic relationship according to mitochondrial cytochrome c oxidase subunit I (COI gene marker were analyzed.Based on external morphology, radular shape and cusp formula, as well as major breeding environment, B. lithophaga could be distinguished from B. aeruginosa, B. purificata. The phylogenetic tree also unconfirmed that B. lithophaga belongs to a different genetic clade from other morphologically similar species.Our findings demonstrate the significant differences in B. lithophaga and other sibling species, which supports the traditional species delimitation in the genus Bellamya.
Hou, Feixia; Wen, Longlian; Peng, Cheng; Guo, Jinlin
2018-01-01
Seahorse documented in Chinese pharmacopeia possess important medicinal efficacy and are used as an ingredient in traditional Chinese medicines. The growing international trade threatens the species. DNA barcoding holds a great application potentiality in wildlife conservation and might prevent the illegal trade of threatened species. The COI gene was used to identify seahorse, and nine Hippocampus species were found in the three large traditional Chinese medicines markets of China. All inter-specific genetic variations were larger than 2%. Mean genetic distances between species were 17-fold larger than those within the species. Phylogenetic tree showed that each species clustered in the appropriate branch. All results demonstrated that COI-based barcoding technique could be used to identify seahorse species and played a major role in monitoring the seahorse trade.
Tay, Wee Tek; Walsh, Thomas K.; Downes, Sharon; Anderson, Craig; Jermiin, Lars S.; Wong, Thomas K. F.; Piper, Melissa C.; Chang, Ester Silva; Macedo, Isabella Barony; Czepak, Cecilia; Behere, Gajanan T.; Silvie, Pierre; Soria, Miguel F.; Frayssinet, Marie; Gordon, Karl H. J.
2017-03-01
The Old World bollworm Helicoverpa armigera is now established in Brazil but efforts to identify incursion origin(s) and pathway(s) have met with limited success due to the patchiness of available data. Using international agricultural/horticultural commodity trade data and mitochondrial DNA (mtDNA) cytochrome oxidase I (COI) and cytochrome b (Cyt b) gene markers, we inferred the origins and incursion pathways into Brazil. We detected 20 mtDNA haplotypes from six Brazilian states, eight of which were new to our 97 global COI-Cyt b haplotype database. Direct sequence matches indicated five Brazilian haplotypes had Asian, African, and European origins. We identified 45 parsimoniously informative sites and multiple substitutions per site within the concatenated (945 bp) nucleotide dataset, implying that probabilistic phylogenetic analysis methods are needed. High diversity and signatures of uniquely shared haplotypes with diverse localities combined with the trade data suggested multiple incursions and introduction origins in Brazil. Increasing agricultural/horticultural trade activities between the Old and New Worlds represents a significant biosecurity risk factor. Identifying pest origins will enable resistance profiling that reflects countries of origin to be included when developing a resistance management strategy, while identifying incursion pathways will improve biosecurity protocols and risk analysis at biosecurity hotspots including national ports.
Zagata, Patrycja; Greczek-Stachura, Magdalena; Tarcz, Sebastian; Rautian, Maria
2015-01-01
Paramecium bursaria is composed of five syngens that are morphologically indistinguishable but sexually isolated. The aim of the present study was to confirm by molecular methods (analyses of mitochondrial COI) the identification of P. bursaria syngens originating from different geographical locations. Phylograms constructed using both the neighbor-joining and maximum-likelihood methods based on a comparison of 34 sequences of P. bursaria strains and P. multimicronucleatum, P. caudatum and P.calkinsi strains used as outgroups revealed five clusters which correspond to results obtained previously by mating reaction. Our analysis shows the existence of 24 haplotypes for the COI gene sequence in the studied strains. The interspecies haplotype diversity was Hd = 0.967. We confirmed genetic differentiation between strains of P. bursaria and the occurrence of a correlation between geographical distribution and the correspondent syngen.
Comparative analysis of protocols for DNA extraction from soybean caterpillars.
Palma, J; Valmorbida, I; da Costa, I F D; Guedes, J V C
2016-04-07
Genomic DNA extraction is crucial for molecular research, including diagnostic and genome characterization of different organisms. The aim of this study was to comparatively analyze protocols of DNA extraction based on cell lysis by sarcosyl, cetyltrimethylammonium bromide, and sodium dodecyl sulfate, and to determine the most efficient method applicable to soybean caterpillars. DNA was extracted from specimens of Chrysodeixis includens and Spodoptera eridania using the aforementioned three methods. DNA quantification was performed using spectrophotometry and high molecular weight DNA ladders. The purity of the extracted DNA was determined by calculating the A260/A280 ratio. Cost and time for each DNA extraction method were estimated and analyzed statistically. The amount of DNA extracted by these three methods was sufficient for PCR amplification. The sarcosyl method yielded DNA of higher purity, because it generated a clearer pellet without viscosity, and yielded high quality amplification products of the COI gene I. The sarcosyl method showed lower cost per extraction and did not differ from the other methods with respect to preparation times. Cell lysis by sarcosyl represents the best method for DNA extraction in terms of yield, quality, and cost effectiveness.
Directory of Open Access Journals (Sweden)
Dan Yan
Full Text Available BACKGROUND: Animal horns (AHs have been applied to traditional medicine for more than thousands of years, of which clinical effects have been confirmed by the history. But now parts of AHs have been listed in the items of wildlife conservation, which limits the use for traditional medicine. The contradiction between the development of traditional medicine and the protection of wild resources has already become the common concern of zoophilists, traditional medical professionals, economists, sociologists. We believe that to strengthen the identification for threatened animals, to prevent the circulation of them, and to seek fertile animals of corresponding bioactivities as substitutes are effective strategies to solve this problem. METHODOLOGY/PRINCIPAL FINDINGS: A powerful technique of DNA barcoding based on the mitochondrial gene cytochrome c oxidase I (COI was used to identify threatened animals of Bovidae and Cervidae, as well as their illegal adulterants (including 10 species and 47 specimens. Meanwhile, the microcalorimetric technique was used to characterize the differences of bio-responses when those animal specimens acted on model organism (Escherichia coli. We found that the COI gene could be used as a universal primer to identify threatened animals and illegal adulterants mentioned above. By analyzing 223 mitochondrial COI sequences, a 100% identification success rate was achieved. We further found that the horns of Mongolian Gazelle and Red Deer could be exploited as a substitute for some functions of endangered Saiga Antelope and Sika Deer in traditional medicine, respectively. CONCLUSION/SIGNIFICANCE: Although it needs a more comprehensive evaluation of bioequivalence in order to completely solve the problem of substitutes for threatened animals, we believe that the identification (DNA barcoding of threatened animals combined with seeking substitutions (bio-response can yet be regarded as a valid strategy for establishing a balance
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
The impact of COI-based storage on order-picking times
Directory of Open Access Journals (Sweden)
Grzegorz Tarczyński
2017-09-01
Full Text Available Background: The increasing competitiveness on the global markets enforces the need for a fast and reliable delivery. This task is possible to perform by improving the order-picking systems. The implementation of automated storage and retrieval systems (AS/RS is not always profitable. In the warehouses where the order-picking is performed in accordance with the principle of picker-to-part rule, the picking efficiency optimization includes among others: the warehouse layout, the storage policy, the routing heuristic, the way of zoning, the order-batching method, and the sequencing of pick-lists. In the paper the impact of the storage policy on the order-picking times is checked. Methods: The influence of storage based on Heskett’s cube-per-order index (COI on the average order-picking times is analyzed. The items based on increasing values of COI index are divided on classes. To determine the demand for items the analytical function proposed by Caron is used. Results: In the paper the benefits of storage based on COI index are compared with random storage and storage based only on picking frequency. It is assumed that the bin, to which the picker collects items has limited capacity – some orders has to be divided on smaller pick-lists. The analysis was performed using simulation tools. Additionally, the algorithm (taking into account different sizes of picker’s bin for order-batching is presented. Conclusions: The analysis shows that the COI-based storage is particularly effective when the size of items increases. The COI-based curve is less skewed than the curve based only on picking frequency. The choice of storage policy should be carried out together with routing heuristic. The use of batching algorithm significantly increases the effectiveness of the order-picking process, but the optimal size of picker’s bin (and batch should be optimized with consideration the sorting process.
Directory of Open Access Journals (Sweden)
Mansour Aliabadian
2013-12-01
Full Text Available The mitochondrial cytochrome c-oxidase subunit I (COI can serve as a fast and accurate marker for the identification of animal species, and has been applied in a number of studies on birds. We here sequenced the COI gene for 387 individuals of 147 species of birds from the Netherlands, with 83 species being represented by >2 sequences. The Netherlands occupies a small geographic area and 95% of all samples were collected within a 50 km radius from one another. The intraspecific divergences averaged 0.29% among this assemblage, but most values were lower; the interspecific divergences averaged 9.54%. In all, 95% of species were represented by a unique barcode, with 6 species of gulls and skua (Larus and Stercorariusat least one shared barcode. This is best explained by these species representing recent radiations with ongoing hybridization. In contrast, one species, the Lesser Whitethroat Sylvia curruca showed deep divergences, averaging 5.76% and up to 8.68% between individuals. These possibly represent two distinct taxa, S. curruca and S. blythi, both clearly separated in a haplotype network analysis. Our study adds to a growing body of DNA barcodes that have become available for birds, and shows that a DNA barcoding approach enables to identify known Dutch bird species with a very high resolution. In addition some species were flagged up for further detailed taxonomic investigation, illustrating that even in ornithologically well-known areas such as the Netherlands, more is to be learned about the birds that are present.
Environmental DNA for Detection of Endangered Grouper Species (Epinephelus spp.
Directory of Open Access Journals (Sweden)
Servet A. Doğdu
2016-09-01
Full Text Available Marine ecosystems nestle species or populations known to be threatened due to human overexploitation. Reliable detection and monitoring of threatened organisms is crucial for data-driven conservation actions. Furthermore, misidentification of species represents a major problem. Here, we investigate the potential of using metabarcoding of environmental DNA (eDNA obtained directly from seawater samples to detect endangered grouper species (Epinephelus spp.. Cytochrome c oxidase subunit I (COI fragment of mtDNA was used to detect groupers species in the Mediterranean Coasts. We conducted eDNA sampling at sites by underwater diving across the range of the Grouper species habitats in Northeastern Mediterranean (Antalya-Kas Region and Iskenderun Bay. eDNA was isolated from 2 liter seawater samples which were vacuum-filtered onto 0.45-mm membrane filters. Filters were then folded inwards, placed in 2 ml tubes and stored at -20 oC until DNA extraction, which took place within 24 hours. DNA was extracted from the water sample filters using the DNeasy Blood and Tissue Kit (Qiagen, USA. Manufacturer’s protocols were used during all steps. PCR amplification of eDNA samples were done using selective primers of COI region of mitochondrial DNA, and next-generation DNA sequencing of PCR application was conducted. For the successfully obtained COI sequences, maximum matching rates were revealed as 80% for Epinephelus marginatus, 78,95% for Epinephelus aeneus, 73,48% for Epinephelus costae, 63,45% for Epinephelus caninus, 60,12% for Mycteroperca rubra and 57,12% for Hyporthodus haifensis. Despite the methodological challenges inherent in eDNA analysis, the results demonstrated that eDNA method may be proved to step towards a new beginning to detect and monitor endangered grouper species.
Epigenetic changes of DNA repair genes in cancer.
Lahtz, Christoph; Pfeifer, Gerd P
2011-02-01
'Every Hour Hurts, The Last One Kills'. That is an old saying about getting old. Every day, thousands of DNA damaging events take place in each cell of our body, but efficient DNA repair systems have evolved to prevent that. However, our DNA repair system and that of most other organisms are not as perfect as that of Deinococcus radiodurans, for example, which is able to repair massive amounts of DNA damage at one time. In many instances, accumulation of DNA damage has been linked to cancer, and genetic deficiencies in specific DNA repair genes are associated with tumor-prone phenotypes. In addition to mutations, which can be either inherited or somatically acquired, epigenetic silencing of DNA repair genes may promote tumorigenesis. This review will summarize current knowledge of the epigenetic inactivation of different DNA repair components in human cancer.
International Nuclear Information System (INIS)
Quintero Galvis, Julian Fernando; Castro, Lyda Raquel
2013-01-01
The family Neritidae has representatives in tropical and subtropical regions that occur in a variety of environments, and its known fossil record dates back to the late Cretaceous. However there have been few studies of molecular phylogeny in this family. We performed a phylogenetic reconstruction of the family Neritidae using the COI (722 bp) and the 16S rRNA (559 bp) regions of the mitochondrial genome. Neighbor-joining, maximum parsimony and Bayesian inference were performed. The best phylogenetic reconstruction was obtained using the COI region, and we consider it an appropriate marker for phylogenetic studies within the group. Consensus analysis (COI +16S rRNA) generally obtained the same tree topologies and confirmed that the genus Nerita is monophyletic. The consensus analysis using parsimony recovered a monophyletic group consisting of the genera Neritina, Septaria, Theodoxus, Puperita, and Clithon, while in the Bayesian analyses Theodoxus is separated from the other genera. The phylogenetic status of the species from the genus Nerita from the Colombian Caribbean generated in this study was consistent with that reported for the genus in previous studies. In the resulting consensus tree obtained using maximum parsimony, we included information on habitat type for each species, to map the evolution by habitat. Species of the family Neritidae possibly have their origin in marine environments, which is consistent with conclusions from previous reports based on anatomical studies.
Single gene retrieval from thermally degraded DNA
Indian Academy of Sciences (India)
To simulate single gene retrieval from ancient DNA, several related factors have been investigated. By monitoring a 889 bp polymerase chain reaction (PCR) product and genomic DNA degradation, we find that heat and oxygen (especially heat) are both crucial factors influencing DNA degradation. The heat influence ...
Genetic Diversity of Daphnia pulex in the Middle and Lower Reaches of the Yangtze River
Wang, Wenping; Zhang, Kun; Deng, Daogui; Zhang, Ya-Nan; Peng, Shuixiu; Xu, Xiaoxue
2016-01-01
Increased human activities and environmental changes may lead to genetic diversity variations of Cladocerans in water. Daphnia pulex are distributed throughout the world and often regarded as a model organism. The 16S rDNA, cytochrome c oxidase subunit I (COI), and 18S genes were used as molecular marks. The genetic diversity and phylogeny of D. pulex obtained from 10 water bodies in the middle and lower reaches of the Yangtze River were studied. For 16S rDNA, COI gene, and 18S gene, the A+T content (65.4%, 58.4%, and 54.6%) was significantly higher than the G+C content (34.6%, 41.6% and 45.4%). This result was consistent with higher A and T contents among invertebrates. Based on the genetic distances of 16S rDNA and COI genes, the genetic differences of D. pulex from 10 water bodies located in the middle and lower reaches of the Yangtze River in China was minimal (0%–0.8% for 16S rDNA and 0%–1.5% for COI gene). However, D. pulex evolved into two branches in the phylogenetic trees, which coincided with its geographical distribution. Compared with D. pulex from other countries, the average genetic distance of D. pulex obtained from 10 water bodies in the middle and lower reaches of the Yangtze River reached 9.1%–10.5%, thereby indicating that D. pulex may have evolved into different subspecies. PMID:27015539
Genetic Diversity of Daphnia pulex in the Middle and Lower Reaches of the Yangtze River.
Directory of Open Access Journals (Sweden)
Wenping Wang
Full Text Available Increased human activities and environmental changes may lead to genetic diversity variations of Cladocerans in water. Daphnia pulex are distributed throughout the world and often regarded as a model organism. The 16S rDNA, cytochrome c oxidase subunit I (COI, and 18S genes were used as molecular marks. The genetic diversity and phylogeny of D. pulex obtained from 10 water bodies in the middle and lower reaches of the Yangtze River were studied. For 16S rDNA, COI gene, and 18S gene, the A+T content (65.4%, 58.4%, and 54.6% was significantly higher than the G+C content (34.6%, 41.6% and 45.4%. This result was consistent with higher A and T contents among invertebrates. Based on the genetic distances of 16S rDNA and COI genes, the genetic differences of D. pulex from 10 water bodies located in the middle and lower reaches of the Yangtze River in China was minimal (0%-0.8% for 16S rDNA and 0%-1.5% for COI gene. However, D. pulex evolved into two branches in the phylogenetic trees, which coincided with its geographical distribution. Compared with D. pulex from other countries, the average genetic distance of D. pulex obtained from 10 water bodies in the middle and lower reaches of the Yangtze River reached 9.1%-10.5%, thereby indicating that D. pulex may have evolved into different subspecies.
N. Solovyeva, Evgeniya; N. Dunayev, Evgeniy; A. Nazarov, Roman; Rajabizadeh, Mehdi; Poyarkov Jr., Nikolay A.
2018-01-01
The morphological and genetic variation of a wide-ranging Secret Toad-headed agama, Phrynocephalus mystaceus that inhabits sand deserts of south-eastern Europe, Middle East, Middle Asia, and western China is reviewed. Based on the morphological differences and high divergence in COI (mtDNA) gene sequences a new subspecies of Ph. mystaceus is described from Khorasan Razavi Province in Iran. Partial sequences of COI mtDNA gene of 31 specimens of Ph. mystaceus from 17 localities from all major p...
DNA Array-Based Gene Profiling
Mocellin, Simone; Provenzano, Maurizio; Rossi, Carlo Riccardo; Pilati, Pierluigi; Nitti, Donato; Lise, Mario
2005-01-01
Cancer is a heterogeneous disease in most respects, including its cellularity, different genetic alterations, and diverse clinical behaviors. Traditional molecular analyses are reductionist, assessing only 1 or a few genes at a time, thus working with a biologic model too specific and limited to confront a process whose clinical outcome is likely to be governed by the combined influence of many genes. The potential of functional genomics is enormous, because for each experiment, thousands of relevant observations can be made simultaneously. Accordingly, DNA array, like other high-throughput technologies, might catalyze and ultimately accelerate the development of knowledge in tumor cell biology. Although in its infancy, the implementation of DNA array technology in cancer research has already provided investigators with novel data and intriguing new hypotheses on the molecular cascade leading to carcinogenesis, tumor aggressiveness, and sensitivity to antiblastic agents. Given the revolutionary implications that the use of this technology might have in the clinical management of patients with cancer, principles of DNA array-based tumor gene profiling need to be clearly understood for the data to be correctly interpreted and appreciated. In the present work, we discuss the technical features characterizing this powerful laboratory tool and review the applications so far described in the field of oncology. PMID:15621987
Directory of Open Access Journals (Sweden)
Kouji Satoh
Full Text Available Rice (Oryza sativa L. is a model organism for the functional genomics of monocotyledonous plants since the genome size is considerably smaller than those of other monocotyledonous plants. Although highly accurate genome sequences of indica and japonica rice are available, additional resources such as full-length complementary DNA (FL-cDNA sequences are also indispensable for comprehensive analyses of gene structure and function. We cross-referenced 28.5K individual loci in the rice genome defined by mapping of 578K FL-cDNA clones with the 56K loci predicted in the TIGR genome assembly. Based on the annotation status and the presence of corresponding cDNA clones, genes were classified into 23K annotated expressed (AE genes, 33K annotated non-expressed (ANE genes, and 5.5K non-annotated expressed (NAE genes. We developed a 60mer oligo-array for analysis of gene expression from each locus. Analysis of gene structures and expression levels revealed that the general features of gene structure and expression of NAE and ANE genes were considerably different from those of AE genes. The results also suggested that the cloning efficiency of rice FL-cDNA is associated with the transcription activity of the corresponding genetic locus, although other factors may also have an effect. Comparison of the coverage of FL-cDNA among gene families suggested that FL-cDNA from genes encoding rice- or eukaryote-specific domains, and those involved in regulatory functions were difficult to produce in bacterial cells. Collectively, these results indicate that rice genes can be divided into distinct groups based on transcription activity and gene structure, and that the coverage bias of FL-cDNA clones exists due to the incompatibility of certain eukaryotic genes in bacteria.
Directory of Open Access Journals (Sweden)
Saied Reza Naddaf
2012-12-01
Full Text Available Background: Anopheles fluviatilis, one of the major malaria vectors in Iran, is assumed to be a complex of sibling species. The aim of this study was to evaluate Cytochrome oxidase I (COI gene alongside 28S-D3 as a diagnostic tool for identification of An. fluviatilis sibling species in Iran.Methods: DNA sample belonging to 24 An. fluviatilis mosquitoes from different geographical areas in south and southeastern Iran were used for amplification of COI gene followed by sequencing. The 474–475 bp COI sequences obtained in this study were aligned with 59 similar sequences of An. fluviatilis and a sequence of Anopheles minimus, as out group, from GenBank database. The distances between group and individual sequences were calculated and phylogenetic tree for obtained sequences was generated by using Kimura two parameter (K2P model of neighbor-joining method.Results: Phylogenetic analysis using COI gene grouped members of Fars Province (central Iran in two distinct clades separate from other Iranian members representing Hormozgan, Kerman, and Sistan va Baluchestan Provinces. The mean distance between Iranian and Indian individuals was 1.66%, whereas the value between Fars Province individuals and the group comprising individuals from other areas of Iran was 2.06%.Conclusion: Presence of 2.06% mean distance between individuals from Fars Province and those from other areas of Iran is indicative of at least two sibling species in An. fluviatilis mosquitoes of Iran. This finding confirms earlier results based on RAPD-PCR and 28S-D3 analysis.
DNA-dependent protein kinase inhibits AID-induced antibody gene conversion.
Directory of Open Access Journals (Sweden)
Adam J L Cook
2007-04-01
Full Text Available Affinity maturation and class switching of antibodies requires activation-induced cytidine deaminase (AID-dependent hypermutation of Ig V(DJ rearrangements and Ig S regions, respectively, in activated B cells. AID deaminates deoxycytidine bases in Ig genes, converting them into deoxyuridines. In V(DJ regions, subsequent excision of the deaminated bases by uracil-DNA glycosylase, or by mismatch repair, leads to further point mutation or gene conversion, depending on the species. In Ig S regions, nicking at the abasic sites produced by AID and uracil-DNA glycosylases results in staggered double-strand breaks, whose repair by nonhomologous end joining mediates Ig class switching. We have tested whether nonhomologous end joining also plays a role in V(DJ hypermutation using chicken DT40 cells deficient for Ku70 or the DNA-dependent protein kinase catalytic subunit (DNA-PKcs. Inactivation of the Ku70 or DNA-PKcs genes in DT40 cells elevated the rate of AID-induced gene conversion as much as 5-fold. Furthermore, DNA-PKcs-deficiency appeared to reduce point mutation. The data provide strong evidence that double-strand DNA ends capable of recruiting the DNA-dependent protein kinase complex are important intermediates in Ig V gene conversion.
Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine
2011-10-01
Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All
DNA barcode of Chaetognatha from Indian waters
Digital Repository Service at National Institute of Oceanography (India)
Nair, V.R.; Kidangan, F.X.; Prabhu, R.G.; Bucklin, A.; Nair, S.
Chaetognatha are the second most abundant zooplankton group in the Indian waters Precise identification of the species is critical for biogeographical studies DNA barcodes using mitochondrial cytochrome c oxidase (COI) of seven dominant...
The dnaN gene codes for the beta subunit of DNA polymerase III holoenzyme of escherichia coli.
Burgers, P M; Kornberg, A; Sakakibara, Y
1981-09-01
An Escherichia coli mutant, dnaN59, stops DNA synthesis promptly upon a shift to a high temperature; the wild-type dnaN gene carried in a transducing phage encodes a polypeptide of about 41,000 daltons [Sakakibara, Y. & Mizukami, T. (1980) Mol. Gen. Genet. 178, 541-553; Yuasa, S. & Sakakibara, Y. (1980) Mol. Gen. Genet. 180, 267-273]. We now find that the product of dnaN gene is the beta subunit of DNA polymerase III holoenzyme, the principal DNA synthetic multipolypeptide complex in E. coli. The conclusion is based on the following observations: (i) Extracts from dnaN59 cells were defective in phage phi X174 and G4 DNA synthesis after the mutant cells had been exposed to the increased temperature. (ii) The enzymatic defect was overcome by addition of purified beta subunit but not by other subunits of DNA polymerase III holoenzyme or by other replication proteins required for phi X174 DNA synthesis. (iii) Partially purified beta subunit from the dnaN mutant, unlike that from the wild type, was inactive in reconstituting the holoenzyme when mixed with the other purified subunits. (iv) Increased dosage of the dnaN gene provided by a plasmid carrying the gene raised cellular levels of the beta subunit 5- to 6-fold.
Directory of Open Access Journals (Sweden)
Julián Fernando Quintero Galvis
2013-05-01
La familia Neritidae cuenta con representantes en regiones tropicales y subtropicales adaptadas a diferentes ambientes, con un registro fósil que data para finales del Cretáceo. Sin embargo no se han realizado estudios de filogenia molecular en la familia. En este estudio se realizó una reconstrucción filogenética de la familia Neritidae utilizando las regiones COI (722 pb y 16S rRNA (559 pb del genoma mitocondrial. Se realizaron análisis de distancias de Neighbor-Joining, Máxima Parsimonia e Inferencia Bayesiana. La mejor reconstrucción filogenética fue mediante la región COI, considerándola un marcador apropiado para realizar estudios filogenéticos dentro del grupo. El consenso de las relaciones filogenéticas (COI+16S rRNA permitió confirmar que el género Nerita es monofilético. El consenso del análisis de parsimonia reveló un grupo monofilético formado por los géneros Neritina, Septaria, Theodoxus, Puperita y Clithon, mientras que en el análisis bayesiano Theodoxus se encuentra separado de los otros géneros. El resultado en las especies del género Nerita del Caribe colombiano fue consistente con lo reportado para el género en estudios previos. En el árbol resultante del análisis de parsimonia se sobrepuso la
Directory of Open Access Journals (Sweden)
Ricardo Koroiva
Full Text Available We present a DNA barcoding study of Neotropical odonates from the Upper Plata basin, Brazil. A total of 38 species were collected in a transition region of "Cerrado" and Atlantic Forest, both regarded as biological hotspots, and 130 cytochrome c oxidase subunit I (COI barcodes were generated for the collected specimens. The distinct gap between intraspecific (0-2% and interspecific variation (15% and above in COI, and resulting separation of Barcode Index Numbers (BIN, allowed for successful identification of specimens in 94% of cases. The 6% fail rate was due to a shared BIN between two separate nominal species. DNA barcoding, based on COI, thus seems to be a reliable and efficient tool for identifying Neotropical odonate specimens down to the species level. These results underscore the utility of DNA barcoding to aid specimen identification in diverse biological hotspots, areas that require urgent action regarding taxonomic surveys and biodiversity conservation.
DNA methylation of amino acid transporter genes in the human placenta.
Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K
2017-12-01
Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.
Silva, F L; Wiedenbrug, S
2014-02-01
In this study, we use DNA barcodes for species delimitation to solve taxonomic conflicts in 86 specimens of 14 species belonging to the Corynoneura group (Diptera: Chironomidae: Orthocladiinae), from the Atlantic Forest, Brazil. Molecular analysis of cytochrome c-oxidase subunit I (COI) gene sequences supported 14 cohesive species groups, of which two similar groups were subsequently associated with morphological variation at the pupal stage. Eleven species previously described based on morphological criteria were linked to DNA markers. Furthermore, there is the possibility that there may be cryptic species within the Corynoneura group, since one group of species presented internal grouping, although no morphological divergence was observed. Our results support DNA-barcoding as an excellent tool for species delimitation in groups where taxonomy by means of morphology is difficult or even impossible.
Liu, Chunyu; Fetterman, Jessica L; Liu, Poching; Luo, Yan; Larson, Martin G; Vasan, Ramachandran S; Zhu, Jun; Levy, Daniel
2018-03-01
Increasing evidence implicates mitochondrial dysfunction in aging and age-related conditions. But little is known about the molecular basis for this connection. A possible cause may be mutations in the mitochondrial DNA (mtDNA), which are often heteroplasmic-the joint presence of different alleles at a single locus in the same individual. However, the involvement of mtDNA heteroplasmy in aging and age-related conditions has not been investigated thoroughly. We deep-sequenced the complete mtDNA genomes of 356 Framingham Heart Study participants (52% women, mean age 43, mean coverage 4570-fold), identified 2880 unique mutations and comprehensively annotated them by MITOMAP and PolyPhen-2. We discovered 11 heteroplasmic "hot" spots [NADH dehydrogenase (ND) subunit 1, 4, 5 and 6 genes, n = 7; cytochrome c oxidase I (COI), n = 2; 16S rRNA, n = 1; D-loop, n = 1] for which the alternative-to-reference allele ratios significantly increased with advancing age (Bonferroni correction p < 0.001). Four of these heteroplasmic mutations in ND and COI genes were predicted to be deleterious nonsynonymous mutations which may have direct impact on ATP production. We confirmed previous findings that healthy individuals carry many low-frequency heteroplasmy mutations with potentially deleterious effects. We hypothesize that the effect of a single deleterious heteroplasmy may be minimal due to a low mutant-to-wildtype allele ratio, whereas the aggregate effects of many deleterious mutations may cause changes in mitochondrial function and contribute to age-related diseases. The identification of age-related mtDNA mutations is an important step to understand the genetic architecture of age-related diseases and may uncover novel therapeutic targets for such diseases.
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Whole genome DNA methylation: beyond genes silencing
Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati
2016-01-01
The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the ...
Greczek-Stachura, Magdalena; Potekhin, Alexey; Przyboś, Ewa; Rautian, Maria; Skoblo, Inna; Tarcz, Sebastian
2012-09-01
This is the first attempt to resolve the phylogenetic relationship between different syngens of Paramecium bursaria and to investigate at a molecular level the intraspecific differentiation of strains originating from very distant geographical locations. Herein we introduce a new collection of five P. bursaria syngens maintained at St Petersburg State University, as the international collection of syngens was lost in the 1960s. To analyze the degree of speciation within Paramecium bursaria, we examined 26 strains belonging to five different syngens from distant and geographically isolated localities using rDNA (ITS1-5.8S-ITS2-5'LSU) fragments, mitochondrial cytochrome c oxidase subunit I (COI), and H4 gene fragments. It was shown that P. bursaria strains of the same syngens cluster together in all three inferred molecular phylogenies. The genetic diversity among the studied P. bursaria strains based on rDNA sequences was rather low. The COI divergence of Paramecium bursaria was also definitely lower than that observed in the Paramecium aurelia complex. The nucleotide sequences of the H4 gene analyzed in the present study indicate the extent of genetic differences between the syngens of Paramecium bursaria. Our study demonstrates the diagnostic value of molecular markers, which are important tools in the identification of Paramecium bursaria syngens. Copyright © 2011 Elsevier GmbH. All rights reserved.
Boykin, L M; Shatters, R G; Hall, D G; Burns, R E; Franqui, R A
2006-10-01
Anastrepha suspensa (Loew) is an economically important pest, restricted to the Greater Antilles and southern Florida. It infests a wide variety of hosts and is of quarantine importance in citrus, a multi-million dollar industry in Florida. The observed recent increase in citrus infested with A. suspensa in Florida has raised questions regarding host-specificity of certain populations and genetic diversity of the pest throughout its geographical distribution. Cytochrome oxidase I (COI) DNA sequence data was used to characterize the genetic diversity of A. suspensa from Florida and Caribbean populations reared from different host plants. Maximum likelihood and Bayesian phylogenetic methods were used to analyse COI data. Sequence variation among mitochondrial COI genes from 107 A. suspensa samples collected throughout Florida and the Caribbean ranged between 0 and 10% and placed all A. suspensa as a monophyletic group that united all A. suspensa in a clade sister to a Central American group of the A. fraterculus paraphyletic species complex. The most likely tree of the COI locus indicated that COI sequence variation was too low to provide resolution at the subspecies level, therefore monophyletic groups based on host-plant use, geography (Florida, Jamaica, Cayman Islands, Puerto Rico or Dominican Republic) or population sampled are not supported. This result indicates that either no population segregation has occurred based on these biological or geographical distinctions and that this is a generalist, polyphagous invasive genotype. Alternatively, if populations are distinct, the segregation event was more recent than can be distinguished based on COI sequence variation.
Phyllanthus coi (Phyllanthaceae, a new herbaceous species from the Philippines
Directory of Open Access Journals (Sweden)
Ming-Jou WU
2017-11-01
Full Text Available Phyllanthus coi M.J. Wu, Ferreras & Y.J. Chen, a new species from Benguet Province, Island of Luzon, the Philippines, is described and illustrated. Compared to its congeners in the same section, P. coi can be differentiated by having long plagiotropic branchlets with up to 30 leaves per side, seeds with sharp honey-comb-like ridges on the dorsal side, and three free styles that are not lying flat on the top of the ovary. The floral, seed and some vegetative features that distinguish this new species from its nearest morphologically related species, P. erythrotrichus C.B. Rob., P. urinaria L. and P. hookeri Müll. Arg. are provided.
Quantitative DNA methylation analysis of candidate genes in cervical cancer.
Directory of Open Access Journals (Sweden)
Erin M Siegel
Full Text Available Aberrant DNA methylation has been observed in cervical cancer; however, most studies have used non-quantitative approaches to measure DNA methylation. The objective of this study was to quantify methylation within a select panel of genes previously identified as targets for epigenetic silencing in cervical cancer and to identify genes with elevated methylation that can distinguish cancer from normal cervical tissues. We identified 49 women with invasive squamous cell cancer of the cervix and 22 women with normal cytology specimens. Bisulfite-modified genomic DNA was amplified and quantitative pyrosequencing completed for 10 genes (APC, CCNA, CDH1, CDH13, WIF1, TIMP3, DAPK1, RARB, FHIT, and SLIT2. A Methylation Index was calculated as the mean percent methylation across all CpG sites analyzed per gene (~4-9 CpG site per sequence. A binary cut-point was defined at >15% methylation. Sensitivity, specificity and area under ROC curve (AUC of methylation in individual genes or a panel was examined. The median methylation index was significantly higher in cases compared to controls in 8 genes, whereas there was no difference in median methylation for 2 genes. Compared to HPV and age, the combination of DNA methylation level of DAPK1, SLIT2, WIF1 and RARB with HPV and age significantly improved the AUC from 0.79 to 0.99 (95% CI: 0.97-1.00, p-value = 0.003. Pyrosequencing analysis confirmed that several genes are common targets for aberrant methylation in cervical cancer and DNA methylation level of four genes appears to increase specificity to identify cancer compared to HPV detection alone. Alterations in DNA methylation of specific genes in cervical cancers, such as DAPK1, RARB, WIF1, and SLIT2, may also occur early in cervical carcinogenesis and should be evaluated.
Efficacy of DNA barcoding for the species identification of spiders from Western Ghats of India.
Gaikwad, Swapnil; Warudkar, Ashwin; Shouche, Yogesh
2017-09-01
DNA barcoding has emerged as an additional tool for taxonomy and as an aid to taxonomic impediments. Due to their extensive morphological variation, spiders are taxonomically challenging. Therefore, all over the world, attempts are being made to DNA barcode species of spiders. Till now no attempts were made to DNA barcode Indian spiders despite their rich diversity. We have generated DNA barcodes for 60 species (n = 112) of spiders for the first time from India. Although only 17 species were correctly identified at the species level, DNA barcoding correctly discriminated 99% of the species studied here. We have also found high intraspecies nucleotide divergence in Plexippus paykulli suggesting cryptic diversity that needs to be studied in detail. Our study also showed non-specific amplification of the Cytochrome Oxidase I (COI) gene of endosymbiont bacteria Wolbachia. However, these cases are very rare and could be resolved by the use of modified or group specific primers.
Kim, Sungmin; Song, Kyo-Hong; Ree, Han-Il; Kim, Won
2012-01-01
Non-biting midges (Diptera: Chironomidae) are a diverse population that commonly causes respiratory allergies in humans. Chironomid larvae can be used to indicate freshwater pollution, but accurate identification on the basis of morphological characteristics is difficult. In this study, we constructed a mitochondrial cytochrome c oxidase subunit I (COI)-based DNA barcode library for Korean chironomids. This library consists of 211 specimens from 49 species, including adults and unidentified larvae. The interspecies and intraspecies COI sequence variations were analyzed. Sophisticated indexes were developed in order to properly evaluate indistinct barcode gaps that are created by insufficient sampling on both the interspecies and intraspecies levels and by variable mutation rates across taxa. In a variety of insect datasets, these indexes were useful for re-evaluating large barcode datasets and for defining COI barcode gaps. The COI-based DNA barcode library will provide a rapid and reliable tool for the molecular identification of Korean chironomid species. Furthermore, this reverse-taxonomic approach will be improved by the continuous addition of other speceis’ sequences to the library. PMID:22138764
Expression of protein-coding genes embedded in ribosomal DNA
DEFF Research Database (Denmark)
Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik
2007-01-01
Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....
Aberrant DNA methylation in 5'regions of DNA methyltransferase genes in aborted bovine clones
Institute of Scientific and Technical Information of China (English)
2008-01-01
High rate of abortion and developmental abnormalities is thought to be closely associated with inefficient epigenetic reprogramming of the transplanted nuclei during bovine cloning.It is known that one of the important mechanisms for epigenetic reprogramming is DNA methylation.DNA methylation is established and maintained by DNA methyltransferases(DNMTs),therefore,it is postulated that the inefficient epigenetic reprogramming of transplanted nuclei may be due to abnormal expression of DNMTs.Since DNA methylation can strongly inhibit gene expression,aberrant DNA methylation of DNMT genes may disturb gene expression.But presently,it is not clear whether the methylation abnormality of DNMT genes is related to developmental failure of somatic cell nuclear transfer embryos.In our study,we analyzed methylation patterns of the 5' regions of four DNMT genes including Dnmt3a,Dnmt3b,Dnmtl and Dnmt2 in four aborted bovine clones.Using bisulfite sequencing method,we found that 3 out of 4 aborted bovine clones(AF1,AF2 and AF3)showed either hypermethylation or hypomethylation in the 5' regions of Dnmt3a and Dnmt3b.indicating that Dnmt3a and Dnmt3b genes are not properly reprogrammed.However,the individual AF4 exhibited similar methylation level and pattern to age-matched in vitro fertilized (IVF)fetuses.Besides,we found that tle 5'regions of Dnmtl and Dnmt2 were nearly completely unmethylated in all normal adults.IVF fetuses,sperm and aborted clones.Together,our results suggest that the aberrant methylation of Dnmt3a and Dnmt3b 5' regions is probably associated with the high abortion of bovine clones.
Directory of Open Access Journals (Sweden)
Clara Inés Saldamando
2012-09-01
Full Text Available En este trabajo se secuenció un fragmento de 451pb del gen mitocondrial de la citocromo oxidasa I (COI en 62 secuencias del género Spodoptera y una secuencia de Bombix mori (grupo externo. Los resultados mostraron gran diferenciación genética (distancia K2 entre los haplotipos de Spodoptera frugiperda de Colombia y Estados Unidos, según los estimadores de diversidad haplotípica, diversidad y polimorfismo nucleotídicos calculados. Un árbol de ML agrupó las especies con valores de bootstrap entre 73-99% en las ramas internas. No obstante algunas ramas presentaron bajos valores de bootstrap. Este árbol formó un grupo constituido por las especies del hemisferio oriental (S. littoralis y S. litura y también agrupó las especies localizadas en el hemisferio occidental (S. androgea, S. dolichos, S. eridania, S. exigua, S. frugiperda, S. latifascia, S. ornithogalli y S. pulchella. Esto demuestra que el árbol agrupó las especies con base en su origen geográfico. Contrariamente, el árbol no agrupó a S. frugiperda con S. ornithogalli, demostrando que a pesar de que ambas coexisten en el cultivo de algodón, no comparten un ancestro común reciente. En Colombia, estas especies forman parte del “complejo Spodoptera” del algodón, y nuestros resultados demuestran que la secuenciación de este gen permite diferenciarlas sin necesidad del uso de claves taxonómicas de sus estadios larvales. Este trabajo es una aproximación a la filogenia de este género, por lo cual la inclusión de más genes (mitocondriales y nucleares son necesarios para futuros trabajos.The genus Spodoptera includes 30 species of moths considered important pests worldwide, with a great representation in the Western Hemisphere. In general, Noctuidae species have morphological similarities that have caused some difficulties for assertive species identification by conventional methods. The purpose of this work was to generate an approach to the genus phylogeny from
Zhao, Yan; Gentekaki, Eleni; Yi, Zhenzhen; Lin, Xiaofeng
2013-01-01
The mitochondrial cytochrome c oxidase subunit I (COI) gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.
International Nuclear Information System (INIS)
Billen, D.; Hellermann, G.R.
1977-01-01
An investigation has been carried out into the role of dnaB gene product in X-ray-induced repair synthesis carried out by DNA polymerase III in toluene-treated Escherichia coli K-12. A polAl polBlOO dnaB mutant deficient in both DNA polymerase I and II activities was used, and it was shown that the level of X-ray-induced, ATP-dependent, non-conservative DNA synthesis was, unlike semi-conservative DNA synthesis, unaffected by a temperature shift from 30 0 to 42 0 C. The dnaB gene product was not therefore necessary for DNA polymerase III-directed repair synthesis, which occurred in the absence of replicative synthesis. (U.K.)
DNA barcoding revealed the presence of the polyphagous leafminer pest Liriomyza sativae Blanchard in Bangladesh. DNA barcode sequences for mitochondrial COI were generated for Agromyzidae larvae, pupae and adults collected from field populations across Bangladesh. BLAST sequence similarity searches ...
Identification of genes involved in DNA replication of the Autographa californica baculovirus
Kool, M.; Ahrens, C. H.; Goldbach, R. W.; Rohrmann, G. F.; Vlak, J. M.
1994-01-01
By use of a transient replication assay, nine genes involved in DNA replication were identified in the genome of the Autographa californica baculovirus. Six genes encoding helicase, DNA polymerase, IE-1, LEF-1, LEF-2, and LEF-3 are essential for DNA replication while three genes encoding P35, IE-2,
Identification of DNA repair genes in the human genome
International Nuclear Information System (INIS)
Hoeijmakers, J.H.J.; van Duin, M.; Westerveld, A.; Yasui, A.; Bootsma, D.
1986-01-01
To identify human DNA repair genes we have transfected human genomic DNA ligated to a dominant marker to excision repair deficient xeroderma pigmentosum (XP) and CHO cells. This resulted in the cloning of a human gene, ERCC-1, that complements the defect of a UV- and mitomycin-C sensitive CHO mutant 43-3B. The ERCC-1 gene has a size of 15 kb, consists of 10 exons and is located in the region 19q13.2-q13.3. Its primary transcript is processed into two mRNAs by alternative splicing of an internal coding exon. One of these transcripts encodes a polypeptide of 297 aminoacids. A putative DNA binding protein domain and nuclear location signal could be identified. Significant AA-homology is found between ERCC-1 and the yeast excision repair gene RAD10. 58 references, 6 figures, 1 table
When gene medication is also genetic modification--regulating DNA treatment.
Foss, Grethe S; Rogne, Sissel
2007-07-26
The molecular methods used in DNA vaccination and gene therapy resemble in many ways the methods applied in genetic modification of organisms. In some regulatory regimes, this creates an overlap between 'gene medication' and genetic modification. In Norway, an animal injected with plasmid DNA, in the form of DNA vaccine or gene therapy, currently is viewed as being genetically modified for as long as the added DNA is present in the animal. However, regulating a DNA-vaccinated animal as genetically modified creates both regulatory and practical challenges. It is also counter-intuitive to many biologists. Since immune responses can be elicited also to alter traits, the borderline between vaccination and the modification of properties is no longer distinct. In this paper, we discuss the background for the Norwegian interpretation and ways in which the regulatory challenge can be handled.
The application of DNA microarrays in gene expression analysis.
van Hal, N L; Vorst, O; van Houwelingen, A M; Kok, E J; Peijnenburg, A; Aharoni, A; van Tunen, A J; Keijer, J
2000-03-31
DNA microarray technology is a new and powerful technology that will substantially increase the speed of molecular biological research. This paper gives a survey of DNA microarray technology and its use in gene expression studies. The technical aspects and their potential improvements are discussed. These comprise array manufacturing and design, array hybridisation, scanning, and data handling. Furthermore, it is discussed how DNA microarrays can be applied in the working fields of: safety, functionality and health of food and gene discovery and pathway engineering in plants.
Directory of Open Access Journals (Sweden)
Yan Zhao
Full Text Available BACKGROUND: The mitochondrial cytochrome c oxidase subunit I (COI gene is being used increasingly for evaluating inter- and intra-specific genetic diversity of ciliated protists. However, very few studies focus on assessing genetic divergence of the COI gene within individuals and how its presence might affect species identification and population structure analyses. METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the genetic variation of the COI gene in five Paramecium species for a total of 147 clones derived from 21 individuals and 7 populations. We identified a total of 90 haplotypes with several individuals carrying more than one haplotype. Parsimony network and phylogenetic tree analyses revealed that intra-individual diversity had no effect in species identification and only a minor effect on population structure. CONCLUSIONS: Our results suggest that the COI gene is a suitable marker for resolving inter- and intra-specific relationships of Paramecium spp.
DNA context represents transcription regulation of the gene in mouse embryonic stem cells
Ha, Misook; Hong, Soondo
2016-04-01
Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.
International Nuclear Information System (INIS)
Karentz, D.; Cleaver, J.E.
1985-01-01
Transfer of repair genes by DNA transfection into repair-deficient Xeroderma pigmentosum (XP) cells has thus far been unsuccessful, presenting an obstacle to cloning XP genes. The authors chose an indirect route to transfer repair genes in chromosome fragments. DNA repair-competent (UV resistant) hybrid cell lines were established by PEG-mediated fusions of DNA repair-deficient (UV sensitive) human fibroblasts (XP12RO) with wild type Chinese hamster (CHO) cells (AA8). CHO cells were exposed to 5 Krad X-rays prior to fusions, predisposing hybrid cells to lose CHO chromosome fragments preferentially. Repair-competent hybrids were selected by periodic exposures to UV light. Secondary and tertiary hybrid cell lines were developed by fusion of X-irradiated hybrids to XP12RO. The hybrid cell lines exhibit resistance to UV that is comparable to that of CHO cells and they are proficient at repair replication after UV exposure. Whole cell DNA-DNA hybridizations indicate that the hybrids have greater homology to CHO DNA than is evident between XP12RO and CHO. These observations indicate that CHO DNA sequences which can function in repair of UV-damaged DNA in human cells have been transferred into the genome of the repair-deficient XP12RO cells
A mechanism of gene amplification driven by small DNA fragments.
Directory of Open Access Journals (Sweden)
Kuntal Mukherjee
Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation
International Nuclear Information System (INIS)
Binkova, Blanka; Chvatalova, Irena; Lnenickova, Zdena; Milcova, Alena; Tulupova, Elena; Farmer, Peter B.; Sram, Radim J.
2007-01-01
Epidemiologic studies indicate that prolonged exposure to particulate air pollution may be associated with increased risk of cardiovascular diseases and cancer in general population. These effects may be attributable to polycyclic aromatic hydrocarbons (PAHs) adsorbed to respirable air particles. It is expected that metabolic and DNA repair gene polymorphisms may modulate individual susceptibility to PAH exposure. This study investigates relationships between exposure to PAHs, polymorphisms of these genes and DNA adducts in group of occupationally exposed policemen (EXP, N = 53, males, aged 22-50 years) working outdoors in the downtown area of Prague and in matched 'unexposed' controls (CON, N = 52). Personal exposure to eight carcinogenic PAHs (c-PAHs) was evaluated by personal samplers during working shift prior to collection of biological samples. Bulky-aromatic DNA adducts were analyzed in lymphocytes by 32 P-postlabeling assay. Polymorphisms of metabolizing (GSTM1, GSTP1, GSTT1, EPHX1, CYP1A1-MspI) and DNA repair (XRCC1, XPD) genes were determined by PCR-based RFLP assays. As potential modifiers and/or cofounders, urinary cotinine levels were analyzed by radioimmunoassay, plasma levels of vitamins A, C, E and folates by HPLC, cholesterol and triglycerides using commercial kits. During the sampling period ambient particulate air pollution was as follows: PM10 32-55 μg/m 3 , PM2.5 27-38 μg/m 3 , c-PAHs 18-22 ng/m 3 ; personal exposure to c-PAHs: 9.7 ng/m 3 versus 5.8 ng/m 3 (P 8 nucleotides versus 0.82 ± 0.23 adducts/10 8 nucleotides, P = 0.065), whereas the level of the B[a]P-'like' adduct was significantly higher in exposed group (0.122 ± 0.036 adducts/10 8 nucleotides versus 0.099 ± 0.035 adducts/10 8 nucleotides, P = 0.003). A significant difference in both the total (P < 0.05) and the B[a]P-'like' DNA adducts (P < 0.01) between smokers and nonsmokers within both groups was observed. A significant positive association between DNA adduct and cotinine
Gene Transfer into the Lung by Nanoparticle Dextran-Spermine/Plasmid DNA Complexes
Directory of Open Access Journals (Sweden)
Syahril Abdullah
2010-01-01
Full Text Available A novel cationic polymer, dextran-spermine (D-SPM, has been found to mediate gene expression in a wide variety of cell lines and in vivo through systemic delivery. Here, we extended the observations by determining the optimal conditions for gene expression of D-SPM/plasmid DNA (D-SPM/pDNA in cell lines and in the lungs of BALB/c mice via instillation delivery. In vitro studies showed that D-SPM could partially protect pDNA from degradation by nuclease and exhibited optimal gene transfer efficiency at D-SPM to pDNA weight-mixing ratio of 12. In the lungs of mice, the levels of gene expression generated by D-SPM/pDNA are highly dependent on the weight-mixing ratio of D-SPM to pDNA, amount of pDNA in the complex, and the assay time postdelivery. Readministration of the complex at day 1 following the first dosing showed no significant effect on the retention and duration of gene expression. The study also showed that there was a clear trend of increasing size of the complexes as the amount of pDNA was increased, where the sizes of the D-SPM/pDNA complexes were within the nanometer range.
Low, V L; Lim, P E; Chen, C D; Lim, Y A L; Tan, T K; Norma-Rashid, Y; Lee, H L; Sofian-Azirun, M
2014-06-01
The present study explored the intraspecific genetic diversity, dispersal patterns and phylogeographic relationships of Culex quinquefasciatus Say (Diptera: Culicidae) in Malaysia using reference data available in GenBank in order to reveal this species' phylogenetic relationships. A statistical parsimony network of 70 taxa aligned as 624 characters of the cytochrome c oxidase subunit I (COI) gene and 685 characters of the cytochrome c oxidase subunit II (COII) gene revealed three haplotypes (A1-A3) and four haplotypes (B1-B4), respectively. The concatenated sequences of both COI and COII genes with a total of 1309 characters revealed seven haplotypes (AB1-AB7). Analysis using tcs indicated that haplotype AB1 was the common ancestor and the most widespread haplotype in Malaysia. The genetic distance based on concatenated sequences of both COI and COII genes ranged from 0.00076 to 0.00229. Sequence alignment of Cx. quinquefasciatus from Malaysia and other countries revealed four haplotypes (AA1-AA4) by the COI gene and nine haplotypes (BB1-BB9) by the COII gene. Phylogenetic analyses demonstrated that Malaysian Cx. quinquefasciatus share the same genetic lineage as East African and Asian Cx. quinquefasciatus. This study has inferred the genetic lineages, dispersal patterns and hypothetical ancestral genotypes of Cx. quinquefasciatus. © 2013 The Royal Entomological Society.
A multiplex branched DNA assay for parallel quantitative gene expression profiling.
Flagella, Michael; Bui, Son; Zheng, Zhi; Nguyen, Cung Tuong; Zhang, Aiguo; Pastor, Larry; Ma, Yunqing; Yang, Wen; Crawford, Kimberly L; McMaster, Gary K; Witney, Frank; Luo, Yuling
2006-05-01
We describe a novel method to quantitatively measure messenger RNA (mRNA) expression of multiple genes directly from crude cell lysates and tissue homogenates without the need for RNA purification or target amplification. The multiplex branched DNA (bDNA) assay adapts the bDNA technology to the Luminex fluorescent bead-based platform through the use of cooperative hybridization, which ensures an exceptionally high degree of assay specificity. Using in vitro transcribed RNA as reference standards, we demonstrated that the assay is highly specific, with cross-reactivity less than 0.2%. We also determined that the assay detection sensitivity is 25,000 RNA transcripts with intra- and interplate coefficients of variance of less than 10% and less than 15%, respectively. Using three 10-gene panels designed to measure proinflammatory and apoptosis responses, we demonstrated sensitive and specific multiplex gene expression profiling directly from cell lysates. The gene expression change data demonstrate a high correlation coefficient (R(2)=0.94) compared with measurements obtained using the single-plex bDNA assay. Thus, the multiplex bDNA assay provides a powerful means to quantify the gene expression profile of a defined set of target genes in large sample populations.
Barr, Norman; Ruiz-Arce, Raul; Obregón, Oscar; De Leon, Rosita; Foster, Nelson; Reuter, Chris; Boratynski, Theodore; Vacek, Don
2013-02-01
The utility of the cytochrome oxidase I (COI) DNA sequence used for DNA barcoding and a Sequence Characterized Amplified Region for diagnosing boll weevil, Anthonomus grandis Boheman, variants was evaluated. Maximum likelihood analysis of COI DNA sequences from 154 weevils collected from the United States and Mexico supports previous evidence for limited gene flow between weevil populations on wild cotton and commercial cotton in northern Mexico and southern United States. The wild cotton populations represent a variant of the species called the thurberia weevil, which is not regarded as a significant pest. The 31 boll weevil COI haplotypes observed in the study form two distinct haplogroups (A and B) that are supported by five fixed nucleotide differences and a phylogenetic analysis. Although wild and commercial cotton populations are closely associated with specific haplogroups, there is not a fixed difference between the thurberia weevil variant and other populations. The Sequence Characterized Amplified Region marker generated a larger number of inconclusive results than the COI gene but also supported evidence of shared genotypes between wild and commercial cotton weevil populations. These methods provide additional markers that can assist in the identification of pest weevil populations but not definitively diagnose samples.
Directory of Open Access Journals (Sweden)
Robert Kozol
Full Text Available The discrimination and taxonomic identification of marine species continues to pose a challenge despite the growing number of diagnostic metrics and approaches. This study examined the genetic relationship between two sibling species of the genus Calanus (Crustacea; Copepoda; Calanidae, C. agulhensis and C. sinicus, using a multi-gene analysis. DNA sequences were determined for portions of the mitochondrial cytochrome c oxidase I (mtCOI; nuclear citrate synthase (CS, and large subunit (28S rRNA genes for specimens collected from the Sea of Japan and North East (NE Pacific Ocean for C. sinicus and from the Benguela Current and Agulhas Bank, off South Africa, for C. agulhensis. For mtCOI, C. sinicus and C. agulhensis showed similar levels of haplotype diversity (H(d = 0.695 and 0.660, respectively and nucleotide diversity (π = 0.003 and 0.002, respectively. Pairwise F(ST distances for mtCOI were significant only between C. agulhensis collected from the Agulhas and two C. sinicus populations: the Sea of Japan (F(ST = 0.152, p<0.01 and NE Pacific (F(ST = 0.228, p<0.005. Between the species, F(ST distances were low for both mtCOI (F(ST = 0.083, p = 0.003 and CS (F(ST = 0.050, p = 0.021. Large subunit (28S rRNA showed no variation between the species. Our results provide evidence of the lack of genetic distinction of C. sinicus and C. agulhensis, raise questions of whether C. agulhensis warrants status as a distinct species, and indicate the clear need for more intensive and extensive ecological and genetic analysis.
Gene Therapy for Chronic HBV-Can We Eliminate cccDNA?
Bloom, Kristie; Maepa, Mohube Betty; Ely, Abdullah; Arbuthnot, Patrick
2018-04-12
Chronic infection with the hepatitis B virus (HBV) is a global health concern and accounts for approximately 1 million deaths annually. Amongst other limitations of current anti-HBV treatment, failure to eliminate the viral covalently closed circular DNA (cccDNA) and emergence of resistance remain the most worrisome. Viral rebound from latent episomal cccDNA reservoirs occurs following cessation of therapy, patient non-compliance, or the development of escape mutants. Simultaneous viral co-infections, such as by HIV-1, further complicate therapeutic interventions. These challenges have prompted development of novel targeted hepatitis B therapies. Given the ease with which highly specific and potent nucleic acid therapeutics can be rationally designed, gene therapy has generated interest for antiviral application. Gene therapy strategies developed for HBV include gene silencing by harnessing RNA interference, transcriptional inhibition through epigenetic modification of target DNA, genome editing by designer nucleases, and immune modulation with cytokines. DNA-binding domains and effectors based on the zinc finger (ZF), transcription activator-like effector (TALE), and clustered regularly interspaced short palindromic repeat (CRISPR) systems are remarkably well suited to targeting episomal cccDNA. This review discusses recent developments and challenges facing the field of anti-HBV gene therapy, its potential curative significance and the progress towards clinical application.
Isolation and characterization of the human uracil DNA glycosylase gene
International Nuclear Information System (INIS)
Vollberg, T.M.; Siegler, K.M.; Cool, B.L.; Sirover, M.A.
1989-01-01
A series of anti-human placental uracil DNA glycosylase monoclonal antibodies was used to screen a human placental cDNA library in phage λgt11. Twenty-seven immunopositive plaques were detected and purified. One clone containing a 1.2-kilobase (kb) human cDNA insert was chosen for further study by insertion into pUC8. The resultant recombinant plasmid selected by hybridization a human placental mRNA that encoded a 37-kDa polypeptide. This protein was immunoprecipitated specifically by an anti-human placenta uracil DNA glycosylase monoclonal antibody. RNA blot-hybridization (Northern) analysis using placental poly(A) + RNA or total RNA from four different human fibroblast cell strains revealed a single 1.6-kb transcript. Genomic blots using DNA from each cell strain digested with either EcoRI or PstI revealed a complex pattern of cDNA-hydridizing restriction fragments. The genomic analysis for each enzyme was highly similar in all four human cell strains. In contrast, a single band was observed when genomic analysis was performed with the identical DNA digests with an actin gene probe. During cell proliferation there was an increase in the level of glycosylase mRNA that paralleled the increase in uracil DNA glycosylase enzyme activity. The isolation of the human uracil DNA glycosylase gene permits an examination of the structure, organization, and expression of a human DNA repair gene
Visually Relating Gene Expression and in vivo DNA Binding Data
Energy Technology Data Exchange (ETDEWEB)
Huang, Min-Yu; Mackey, Lester; Ker?,; nen, Soile V. E.; Weber, Gunther H.; Jordan, Michael I.; Knowles, David W.; Biggin, Mark D.; Hamann, Bernd
2011-09-20
Gene expression and in vivo DNA binding data provide important information for understanding gene regulatory networks: in vivo DNA binding data indicate genomic regions where transcription factors are bound, and expression data show the output resulting from this binding. Thus, there must be functional relationships between these two types of data. While visualization and data analysis tools exist for each data type alone, there is a lack of tools that can easily explore the relationship between them. We propose an approach that uses the average expression driven by multiple of ciscontrol regions to visually relate gene expression and in vivo DNA binding data. We demonstrate the utility of this tool with examples from the network controlling early Drosophila development. The results obtained support the idea that the level of occupancy of a transcription factor on DNA strongly determines the degree to which the factor regulates a target gene, and in some cases also controls whether the regulation is positive or negative.
Levin, D B; Danks, H V; Barber, S A
2003-06-01
Respiration, mitochondrial (mt)DNA content, and mitochondrial-specific RNA expression in fat body cells from active and cold-adapted larvae of the goldenrod gall fly, Eurosta solidaginis, and the Arctic woolly bear caterpillar, Gynaephora groenlandica, were compared. Reduced amounts of mtDNA were observed in cold-adapted larvae of both E. solidaginis and G. groenlandica collected in fall or winter, compared with summer-collected larvae. mtDNA increased to levels similar to those of summer-collected larvae after incubation at 10 degrees C or 15 degrees C for 5 h. Mitochondrial-specific RNAs (COI and 16S) were observed in fat body cells of both active and cold-adapted E. solidaginis larvae. Our results suggest that mitochondrial proteins required for respiration may be restored rapidly from stable RNAs present in overwintering larvae.
Solano, Danilo; Navarro, Juan Carlos; León-Reyes, Antonio; Benítez-Ortiz, Washington; Rodríguez-Hidalgo, Richar
2016-12-01
Tapeworms Taenia solium and Taenia saginata are the causative agents of taeniasis/cysticercosis. These are diseases with high medical and veterinary importance due to their impact on public health and rural economy in tropical countries. The re-emergence of T. solium as a result of human migration, the economic burden affecting livestock industry, and the large variability of symptoms in several human cysticercosis, encourage studies on genetic diversity, and the identification of these parasites with molecular phylogenetic tools. Samples collected from the Ecuadorian provinces: Loja, Guayas, Manabí, Tungurahua (South), and Imbabura, Pichincha (North) from 2000 to 2012 were performed under Maximum Parsimony analyses and haplotype networks using partial sequences of mitochondrial DNA, cytochrome oxidase subunit I (COI) and NADH subunit I (NDI), from Genbank and own sequences of Taenia solium and Taenia saginata from Ecuador. Both species have shown reciprocal monophyly, which confirms its molecular taxonomic identity. The COI and NDI genes results suggest phylogenetic structure for both parasite species from south and north of Ecuador. In T. solium, both genes gene revealed greater geographic structure, whereas in T. saginata, the variability for both genes was low. In conclusion, COI haplotype networks of T. solium suggest two geographical events in the introduction of this species in Ecuador (African and Asian lineages) and occurring sympatric, probably through the most common routes of maritime trade between the XV-XIX centuries. Moreover, the evidence of two NDI geographical lineages in T. solium from the north (province of Imbabura) and the south (province of Loja) of Ecuador derivate from a common Indian ancestor open new approaches for studies on genetic populations and eco-epidemiology. Copyright © 2016 Elsevier Inc. All rights reserved.
Candidate genes for cross-resistance against DNA-damaging drugs
DEFF Research Database (Denmark)
Wittig, Rainer; Nessling, Michelle; Will, Rainer D
2002-01-01
Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....
Lim, K Y; Kovarik, A; Matýăsek, R; Bezdĕk, M; Lichtenstein, C P; Leitch, A R
2000-06-01
We examined the structure, intranuclear distribution and activity of ribosomal DNA (rDNA) in Nicotiana sylvestris (2n = 2x = 24) and N. tomentosiformis (2n = 2x = 24) and compared these with patterns in N. tabacum (tobacco, 2n = 4x = 48). We also examined a long-established N. tabacum culture, TBY-2. Nicotiana tabacum is an allotetraploid thought to be derived from ancestors of N. sylvestris (S-genome donor) and N. tomentosiformis (T-genome donor). Nicotiana sylvestris has three rDNA loci, one locus each on chromosomes 10, 11, and 12. In root-tip meristematic interphase cells, the site on chromosome 12 remains condensed and inactive, while the sites on chromosomes 10 and 11 show activity at the proximal end of the locus only. Nicotiana tomentosiformis has one major locus on chromosome 3 showing activity and a minor, inactive locus on chromosome 11. In N. tabacum cv. 095-55, there are four rDNA loci on T3, S10, S11/t and S12 (S11/t carries a small T-genome translocation). The locus on S12 remains condensed and inactive in root-tip meristematic cells while the others show activity, including decondensation at interphase and secondary constrictions at metaphase. Nicotiana tabacum DNA digested with methylcytosine-sensitive enzymes revealed a hybridisation pattern for rDNA that resembled that of N. tomentosiformis and not N. sylvestris. The data indicate that active, undermethylated genes are of the N. tomentosiformis type. Since S-genome chromosomes of N. tabacum show rDNA expression, the result indicates rDNA gene conversion of the active rDNA units on these chromosomes. Gene conversion in N. tabacum is consistent with the results of previous work. However, using primers specific for the S-genome rDNA intergenic sequences (IGS) in the polymerase chain reaction (PCR) show that rDNA gene conversion has not gone to completion in N. tabacum. Furthermore, using methylation-insensitive restriction enzymes we demonstrate that about 8% of the rDNA units remain of the N
Carr, Christina M.; Hardy, Sarah M.; Brown, Tanya M.; Macdonald, Tara A.; Hebert, Paul D. N.
2011-01-01
Background Although polychaetes are one of the dominant taxa in marine communities, their distributions and taxonomic diversity are poorly understood. Recent studies have shown that many species thought to have broad distributions are actually a complex of allied species. In Canada, 12% of polychaete species are thought to occur in Atlantic, Arctic, and Pacific Oceans, but the extent of gene flow among their populations has not been tested. Methodology/Principal Findings Sequence variation in a segment of the mitochondrial cytochrome c oxidase I (COI) gene was employed to compare morphological versus molecular diversity estimates, to examine gene flow among populations of widespread species, and to explore connectivity patterns among Canada's three oceans. Analysis of 1876 specimens, representing 333 provisional species, revealed 40 times more sequence divergence between than within species (16.5% versus 0.38%). Genetic data suggest that one quarter of previously recognized species actually include two or more divergent lineages, indicating that richness in this region is currently underestimated. Few species with a tri-oceanic distribution showed genetic cohesion. Instead, large genetic breaks occur between Pacific and Atlantic-Arctic lineages, suggesting their long-term separation. High connectivity among Arctic and Atlantic regions and low connectivity with the Pacific further supports the conclusion that Canadian polychaetes are partitioned into two distinct faunas. Conclusions/Significance Results of this study confirm that COI sequences are an effective tool for species identification in polychaetes, and suggest that DNA barcoding will aid the recognition of species overlooked by the current taxonomic system. The consistent geographic structuring within presumed widespread species suggests that historical range fragmentation during the Pleistocene ultimately increased Canadian polychaete diversity and that the coastal British Columbia fauna played a minor
Directory of Open Access Journals (Sweden)
Christina M Carr
Full Text Available Although polychaetes are one of the dominant taxa in marine communities, their distributions and taxonomic diversity are poorly understood. Recent studies have shown that many species thought to have broad distributions are actually a complex of allied species. In Canada, 12% of polychaete species are thought to occur in Atlantic, Arctic, and Pacific Oceans, but the extent of gene flow among their populations has not been tested.Sequence variation in a segment of the mitochondrial cytochrome c oxidase I (COI gene was employed to compare morphological versus molecular diversity estimates, to examine gene flow among populations of widespread species, and to explore connectivity patterns among Canada's three oceans. Analysis of 1876 specimens, representing 333 provisional species, revealed 40 times more sequence divergence between than within species (16.5% versus 0.38%. Genetic data suggest that one quarter of previously recognized species actually include two or more divergent lineages, indicating that richness in this region is currently underestimated. Few species with a tri-oceanic distribution showed genetic cohesion. Instead, large genetic breaks occur between Pacific and Atlantic-Arctic lineages, suggesting their long-term separation. High connectivity among Arctic and Atlantic regions and low connectivity with the Pacific further supports the conclusion that Canadian polychaetes are partitioned into two distinct faunas.Results of this study confirm that COI sequences are an effective tool for species identification in polychaetes, and suggest that DNA barcoding will aid the recognition of species overlooked by the current taxonomic system. The consistent geographic structuring within presumed widespread species suggests that historical range fragmentation during the Pleistocene ultimately increased Canadian polychaete diversity and that the coastal British Columbia fauna played a minor role in Arctic recolonization following deglaciation
Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.
Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Rivera, Henry; Hernández-Laín, Aurelio; Coca-Robinot, David; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco
2017-01-01
Whole-exome sequencing was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase, deficiency of mitochondrial complex III and depletion of mtDNA. With whole-exome sequencing data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in thymidine kinase 2 gene ( TK2; NM_004614.4:c.323 C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes. This patient presents an atypical TK2-related myopathic form of mtDNA depletion syndromes, because despite having a very low content of mtDNA (TK2 gene in mtDNA depletion syndromes and expanded the phenotypic spectrum.
Mitochondrial DNA sequence-based phylogenetic relationship ...
Indian Academy of Sciences (India)
cophaga ranges from 0.037–0.106 and 0.049–0.207 for COI and ND5 genes, respectively (tables 2 and 3). Analysis of genetic distance on the basis of sequence difference for both the mitochondrial genes shows very little genetic difference. The discrepancy in the phylogenetic trees based on individ- ual genes may be due ...
Lee, Ping-Shin; Sing, Kong-Wah; Wilson, John-James
2015-01-01
Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i) to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii) to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp) DNA mini-barcode could distinguish most mammal species (including separating dark taxa) and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring.
Guo, Shaokun; He, Jia; Zhao, Zihua; Liu, Lijun; Gao, Liyuan; Wei, Shuhua; Guo, Xiaoyu; Zhang, Rong; Li, Zhihong
2017-12-12
Neoceratitis asiatica (Becker), which especially infests wolfberry (Lycium barbarum L.), could cause serious economic losses every year in China, especially to organic wolfberry production. In some important wolfberry plantings, it is difficult and time-consuming to rear the larvae or pupae to adults for morphological identification. Molecular identification based on DNA barcode is a solution to the problem. In this study, 15 samples were collected from Ningxia, China. Among them, five adults were identified according to their morphological characteristics. The utility of mitochondrial DNA (mtDNA) cytochrome c oxidase I (COI) gene sequence as DNA barcode in distinguishing N. asiatica was evaluated by analysing Kimura 2-parameter distances and phylogenetic trees. There were significant differences between intra-specific and inter-specific genetic distances according to the barcoding gap analysis. The uncertain larval and pupal samples were within the same cluster as N. asiatica adults and formed sister cluster to N. cyanescens. A combination of morphological and molecular methods enabled accurate identification of N. asiatica. This is the first study using DNA barcode to identify N. asiatica and the obtained DNA sequences will be added to the DNA barcode database.
Energy Technology Data Exchange (ETDEWEB)
Binkova, Blanka [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Chvatalova, Irena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Lnenickova, Zdena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Milcova, Alena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Tulupova, Elena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Cancer Biomarkers and Prevention Group, Biocentre, University of Leicester (United Kingdom); Farmer, Peter B. [Cancer Biomarkers and Prevention Group, Biocentre, University of Leicester (United Kingdom); Sram, Radim J. [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic)]. E-mail: sram@biomed.cas.cz
2007-07-01
Epidemiologic studies indicate that prolonged exposure to particulate air pollution may be associated with increased risk of cardiovascular diseases and cancer in general population. These effects may be attributable to polycyclic aromatic hydrocarbons (PAHs) adsorbed to respirable air particles. It is expected that metabolic and DNA repair gene polymorphisms may modulate individual susceptibility to PAH exposure. This study investigates relationships between exposure to PAHs, polymorphisms of these genes and DNA adducts in group of occupationally exposed policemen (EXP, N = 53, males, aged 22-50 years) working outdoors in the downtown area of Prague and in matched 'unexposed' controls (CON, N = 52). Personal exposure to eight carcinogenic PAHs (c-PAHs) was evaluated by personal samplers during working shift prior to collection of biological samples. Bulky-aromatic DNA adducts were analyzed in lymphocytes by {sup 32}P-postlabeling assay. Polymorphisms of metabolizing (GSTM1, GSTP1, GSTT1, EPHX1, CYP1A1-MspI) and DNA repair (XRCC1, XPD) genes were determined by PCR-based RFLP assays. As potential modifiers and/or cofounders, urinary cotinine levels were analyzed by radioimmunoassay, plasma levels of vitamins A, C, E and folates by HPLC, cholesterol and triglycerides using commercial kits. During the sampling period ambient particulate air pollution was as follows: PM10 32-55 {mu}g/m{sup 3}, PM2.5 27-38 {mu}g/m{sup 3}, c-PAHs 18-22 ng/m{sup 3}; personal exposure to c-PAHs: 9.7 ng/m{sup 3} versus 5.8 ng/m{sup 3} (P < 0.01) for EXP and CON groups, respectively. The total DNA adduct levels did not significantly differ between EXP and CON groups (0.92 {+-} 0.28 adducts/10{sup 8} nucleotides versus 0.82 {+-} 0.23 adducts/10{sup 8} nucleotides, P = 0.065), whereas the level of the B[a]P-'like' adduct was significantly higher in exposed group (0.122 {+-} 0.036 adducts/10{sup 8} nucleotides versus 0.099 {+-} 0.035 adducts/10{sup 8} nucleotides, P = 0
Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene
International Nuclear Information System (INIS)
Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.
1987-01-01
DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus
Chromosomal location of the human gene for DNA polymerase β
International Nuclear Information System (INIS)
McBride, O.W.; Zmudzka, B.Z.; Wilson, S.H.
1987-01-01
Inhibition studies indicate that DNA polymerase β has a synthetic role in DNA repair after exposure of mammalian cells to some types of DNA-damaging agents. The primary structure of the enzyme is highly conserved in vertebrates, and nearly full-length cDNAs for the enzyme were recently cloned from mammalian cDNA libraries. Southern blot analysis of DNA from a panel of human-rodent somatic cell hybrids, using portions of the cDNA as probe, indicates that the gene for human DNA polymerase β is single copy and located on the short arm or proximal long arm of chromosome 8 (8pter-8q22). A restriction fragment length polymorphism (RFLP) was detected in normal individuals by using a probe from the 5' end of the cDNA, and this RFLP probably is due to an insertion or duplication of DNA in 20-25% of the population. This restriction site can be used as one marker for chromosome 8 genetic linkage studies and for family studies of traits potentially involving this DNA repair gene
DNMT1-interacting RNAs block gene specific DNA methylation
Di Ruscio, Annalisa; Ebralidze, Alexander K.; Benoukraf, Touati; Amabile, Giovanni; Goff, Loyal A.; Terragni, Joylon; Figueroa, Maria Eugenia; De Figureido Pontes, Lorena Lobo; Alberich-Jorda, Meritxell; Zhang, Pu; Wu, Mengchu; D’Alò, Francesco; Melnick, Ari; Leone, Giuseppe; Ebralidze, Konstantin K.; Pradhan, Sriharsa; Rinn, John L.; Tenen, Daniel G.
2013-01-01
Summary DNA methylation was described almost a century ago. However, the rules governing its establishment and maintenance remain elusive. Here, we present data demonstrating that active transcription regulates levels of genomic methylation. We identified a novel RNA arising from the CEBPA gene locus critical in regulating the local DNA methylation profile. This RNA binds to DNMT1 and prevents CEBPA gene locus methylation. Deep sequencing of transcripts associated with DNMT1 combined with genome-scale methylation and expression profiling extended the generality of this finding to numerous gene loci. Collectively, these results delineate the nature of DNMT1-RNA interactions and suggest strategies for gene selective demethylation of therapeutic targets in disease. PMID:24107992
Li, Nan; Shen, Qing; Wang, Jiahui; Han, Chunhui; Ji, Rong; Li, Fengqin; Jiang, Tao
2015-01-01
This study identifies the pufferfish species and detects tetrodotoxin (TTX) in roasted fish fillet samples collected in Beijing, Qingdao and Xiamen, China. The cytochrome c oxidase I (COI) gene was used as the target gene for identification of the pufferfish species in the samples. Enzyme-linked immunosorbent assay (ELISA) screened the TTX levels in samples that had been detected as containing pufferfish by DNA barcode. A total of 125 samples were identified by DNA barcodes; 32 (26%) samples contained pufferfish composition and, among them, 26 (81%) were the highly toxic species Lagocephalus lunaris. All 32 samples containing the pufferfish composition were positive for TTX with levels ranging from 100 to 63,800 ng g(-1). Most of the 32 samples contained the highly toxic L. lunaris. Based on the results, we suggest that the monitoring of roasted fish fillet should be strengthened and the processing procedures should be standardised to minimise TTX poisoning caused by pufferfish.
Applications of three DNA barcodes in assorting intertidal red macroalgal flora in Qingdao, China
Zhao, Xiaobo; Pang, Shaojun; Shan, Tifeng; Liu, Feng
2013-03-01
This study is part of the endeavor to construct a comprehensive DNA barcoding database for common seaweeds in China. Identifications of red seaweeds, which have simple morphology and anatomy, are sometimes difficult solely depending on morphological characteristics. In recent years, DNA barcode technique has become a more and more effective tool to help solve some of the taxonomic difficulties. Some DNA markers such as COI (cytochrome oxidase subunit I) are proposed as standardized DNA barcodes for all seaweed species. In this study, COI, UPA (universal plastid amplicon, domain V of 23S rRNA), and ITS (nuclear internal transcribed spacer) were employed to analyze common species of intertidal red seaweeds in Qingdao (119.3°-121°E, 35.35°-37.09°N). The applicability of using one or a few combined barcodes to identify red seaweed species was tested. The results indicated that COI is a sensitive marker at species level. However, not all the tested species gave PCR amplification products due to lack of the universal primers. The second barcode UPA had effective universal primers but needed to be tested for the effectiveness of resolving closely related species. More than one ITS sequence types were found in some species in this investigation, which might lead to confusion in further analysis. Therefore ITS sequence is not recommended as a universal barcode for seaweeds identification.
DNA repair synthesis dependent on the uvrA,B gene products
International Nuclear Information System (INIS)
Moses, R.E.; Moody, E.E.M.
1975-01-01
Ultraviolet irradiation of toluene-treated Escherichia coli causes an inhibition of replicative DNA synthesis. This is followed by the appearance of nonconservative DNA repair synthesis which does not require either the polymerase or 5' → 3' exonucleolytic activities of DNA polymerase I. The repair synthesis may be catalyzed by DNA polymerase III activity but does not require a functional DNA polymerase II. The ultraviolet-induced synthesis requires ATP and is dependent on a functional uvrA and uvrB gene product. However, other uvr gene products are not required for the synthesis. The recB function is also not required
Variation in the DNA methylation pattern of expressed and nonexpressed genes in chicken.
Cooper, D N; Errington, L H; Clayton, R M
1983-01-01
Using methyl-sensitive and -insensitive restriction enzymes, Hpa II and Msp I, the methylation status of various chicken genes was examined in different tissues and developmental stages. Tissue-specific differences in methylation were found for the delta-crystallin, beta-tubulin, G3PDH, rDNA, and actin genes but not for the histone genes. Developmental decreases in methylation were noted for the delta-crystallin and actin genes in chicken kidney between embryo and adult. Since most of the sequences examined were housekeeping genes, transcriptional differences are apparently not a necessary accompaniment to changes in DNA methylation at the CpG sites examined. The only exception is sperm DNA where the delta-crystallin, beta-tubulin, and actin genes are highly methylated and almost certainly not transcribed. However the G3PDH genes are no more highly methylated in sperm than in other somatic tissues. Many sequences homologous to the rDNA and histone probes used are unmethylated in all tissues examined including sperm, but a methylated rDNA subfraction is more heavily methylated in sperm than in other tissues. We speculate as to the significance of these differences in sperm DNA methylation in the light of possible requirements for early gene activation and the probable deleterious mutagenic effects of heavy methylation within coding sequences.
Keller, Thomas E; Han, Priscilla; Yi, Soojin V
2016-04-01
Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf
DNA Barcoding of Marine Metazoa
Bucklin, Ann; Steinke, Dirk; Blanco-Bercial, Leocadio
2011-01-01
More than 230,000 known species representing 31 metazoan phyla populate the world's oceans. Perhaps another 1,000,000 or more species remain to be discovered. There is reason for concern that species extinctions may outpace discovery, especially in diverse and endangered marine habitats such as coral reefs. DNA barcodes (i.e., short DNA sequences for species recognition and discrimination) are useful tools to accelerate species-level analysis of marine biodiversity and to facilitate conservation efforts. This review focuses on the usual barcode region for metazoans: a ˜648 base-pair region of the mitochondrial cytochrome c oxidase subunit I (COI) gene. Barcodes have also been used for population genetic and phylogeographic analysis, identification of prey in gut contents, detection of invasive species, forensics, and seafood safety. More controversially, barcodes have been used to delimit species boundaries, reveal cryptic species, and discover new species. Emerging frontiers are the use of barcodes for rapid and increasingly automated biodiversity assessment by high-throughput sequencing, including environmental barcoding and the use of barcodes to detect species for which formal identification or scientific naming may never be possible.
Repair of DNA damage in the human metallothionein gene family
International Nuclear Information System (INIS)
Leadon, S.A.; Snowden, M.M.
1987-01-01
In order to distinguish enhanced repair of a sequence due to its transcriptional activity from enhanced repair due to chromatin alterations brought about by integration of a sequence into the genome, we have investigated the repair of damage both in endogenous genes and in cell lines that contain an integrated gene with an inducible promoter. The endogenous genes we are studying are the metallothioneins (MTs), a multigene family in man consisting of about 10-12 members. Cultured cells were exposed to 10-J/m 2 uv light and allowed to repair in the presence of bromodeoxyuridine. The DNA was then isolated, digested with Eco RI, and fully hybrid density DNA made by semiconservative synthesis was separated from unreplicated DNA by centrifugation in CsCl density gradients. Unreplicated, parental-density DNA was then reacted with a monoclonal antibody against bromouracil. 1 ref., 1 fig., 1 tab
MethylMix 2.0: an R package for identifying DNA methylation genes.
Cedoz, Pierre-Louis; Prunello, Marcos; Brennan, Kevin; Gevaert, Olivier
2018-04-14
DNA methylation is an important mechanism regulating gene transcription, and its role in carcinogenesis has been extensively studied. Hyper and hypomethylation of genes is a major mechanism of gene expression deregulation in a wide range of diseases. At the same time, high-throughput DNA methylation assays have been developed generating vast amounts of genome wide DNA methylation measurements. We developed MethylMix, an algorithm implemented in R to identify disease specific hyper and hypomethylated genes. Here we present a new version of MethylMix that automates the construction of DNA-methylation and gene expression datasets from The Cancer Genome Atlas (TCGA). More precisely, MethylMix 2.0 incorporates two major updates: the automated downloading of DNA methylation and gene expression datasets from TCGA and the automated preprocessing of such datasets: value imputation, batch correction and CpG sites clustering within each gene. The resulting datasets can subsequently be analyzed with MethylMix to identify transcriptionally predictive methylation states. We show that the Differential Methylation Values created by MethylMix can be used for cancer subtyping. olivier.gevaert@stanford.edu. https://bioconductor.org/packages/release/bioc/manuals/MethylMix/man/MethylMix.pdf. MethylMix 2.0 was implemented as an R package and is available in bioconductor.
Application of DNA Machineries for the Barcode Patterned Detection of Genes or Proteins.
Zhou, Zhixin; Luo, Guofeng; Wulf, Verena; Willner, Itamar
2018-06-05
The study introduces an analytical platform for the detection of genes or aptamer-ligand complexes by nucleic acid barcode patterns generated by DNA machineries. The DNA machineries consist of nucleic acid scaffolds that include specific recognition sites for the different genes or aptamer-ligand analytes. The binding of the analytes to the scaffolds initiate, in the presence of the nucleotide mixture, a cyclic polymerization/nicking machinery that yields displaced strands of variable lengths. The electrophoretic separation of the resulting strands provides barcode patterns for the specific detection of the different analytes. Mixtures of DNA machineries that yield, upon sensing of different genes (or aptamer ligands), one-, two-, or three-band barcode patterns are described. The combination of nucleic acid scaffolds acting, in the presence of polymerase/nicking enzyme and nucleotide mixture, as DNA machineries, that generate multiband barcode patterns provide an analytical platform for the detection of an individual gene out of many possible genes. The diversity of genes (or other analytes) that can be analyzed by the DNA machineries and the barcode patterned imaging is given by the Pascal's triangle. As a proof-of-concept, the detection of one of six genes, that is, TP53, Werner syndrome, Tay-Sachs normal gene, BRCA1, Tay-Sachs mutant gene, and cystic fibrosis disorder gene by six two-band barcode patterns is demonstrated. The advantages and limitations of the detection of analytes by polymerase/nicking DNA machineries that yield barcode patterns as imaging readout signals are discussed.
Jahandeh, Nadia; Ranjbar, Reza; Behzadi, Payam; Behzadi, Elham
2015-01-01
The pathotypes of uropathogenic Escherichia coli (UPEC) cause different types of urinary tract infections (UTIs). The presence of a wide range of virulence genes in UPEC enables us to design appropriate DNA microarray probes. These probes, which are used in DNA microarray technology, provide us with an accurate and rapid diagnosis and definitive treatment in association with UTIs caused by UPEC pathotypes. The main goal of this article is to introduce the UPEC virulence genes as invaluable approaches for designing DNA microarray probes. Main search engines such as Google Scholar and databases like NCBI were searched to find and study several original pieces of literature, review articles, and DNA gene sequences. In parallel with in silico studies, the experiences of the authors were helpful for selecting appropriate sources and writing this review article. There is a significant variety of virulence genes among UPEC strains. The DNA sequences of virulence genes are fabulous patterns for designing microarray probes. The location of virulence genes and their sequence lengths influence the quality of probes. The use of selected virulence genes for designing microarray probes gives us a wide range of choices from which the best probe candidates can be chosen. DNA microarray technology provides us with an accurate, rapid, cost-effective, sensitive, and specific molecular diagnostic method which is facilitated by designing microarray probes. Via these tools, we are able to have an accurate diagnosis and a definitive treatment regarding UTIs caused by UPEC pathotypes.
Wu, Liang; Yang, Jinzeng
2012-01-01
Background The tilapia family of the Cichlidae includes many fish species, which live in freshwater and saltwater environments. Several species, such as O. niloticus, O. aureus, and O. mossambicus, are excellent for aquaculture because these fish are easily reproduced and readily adapt to diverse environments. Historically, tilapia species, including O. mossambicus, S. melanotheron, and O. aureus, were introduced to Hawaii many decades ago, and the state of Hawaii uses the import permit policy to prevent O. niloticus from coming into the islands. However, hybrids produced from O. niloticus may already be present in the freshwater and marine environments of the islands. The purpose of this study was to identify tilapia species that exist in Hawaii using mitochondrial DNA analysis. Methodology/Principal Findings In this study, we analyzed 382 samples collected from 13 farm (captive) and wild tilapia populations in Oahu and the Hawaii Islands. Comparison of intraspecies variation between the mitochondrial DNA control region (mtDNA CR) and cytochrome c oxidase I (COI) gene from five populations indicated that mtDNA CR had higher nucleotide diversity than COI. A phylogenetic tree of all sampled tilapia was generated using mtDNA CR sequences. The neighbor-joining tree analysis identified seven distinctive tilapia species: O. aureus, O. mossambicus, O. niloticus, S. melanotheron, O. urolepies, T. redalli, and a hybrid of O. massambicus and O. niloticus. Of all the populations examined, 10 populations consisting of O. aureus, O. mossambicus, O. urolepis, and O. niloticus from the farmed sites were relatively pure, whereas three wild populations showed some degree of introgression and hybridization. Conclusions/Significance This DNA-based tilapia species identification is the first report that confirmed tilapia species identities in the wild and captive populations in Hawaii. The DNA sequence comparisons of mtDNA CR appear to be a valid method for tilapia species
The gene expressions of DNA methylation/demethylation enzymes ...
African Journals Online (AJOL)
A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases (Dnmts), DNA ...
2014-01-01
Background Malaria caused by Plasmodium vivax is still a public health problem in the Republic of Korea (ROK), particularly regarding the recent re-emergence of this malarial species near the demilitarized zone in northwestern Paju City, Gyeonggi-do Province. Currently, at least 4 species (An. kleini, An. pullus, An. belenrae and An. lesteri) of the Hyrcanus Group are reported as possible natural vectors of vivax malaria in the ROK, and An. sinensis, which is the most dominant species, has long been incriminated as an important natural vector of this P. vivax. However, An. sinensis was ranked recently as a low potential vector. According to the discovery of natural hybrids between An. sinensis (a low potential vector for P. vivax) and An. kleini (a high potential vector for P. vivax) in Paju City, intensive investigation of this phenomenon is warranted under laboratory conditions. Methods Mosquitoes were collected during 2010-2012 from Paju City, ROK. Hybridization experiments used iso-female line colonies of these anophelines together with DNA analysis of ribosomal DNA [second internal transcribed spacer (ITS2)] and mitochondrial DNA [cytochrome c oxidase subunit I (COI)] of the parental colonies, F1-hybrids and repeated backcross progenies were performed intensively by using a PCR-based assay and pyrosequencing technology. Results The results from hybridization experiments and molecular investigations revealed that the mitochondrial COI gene was introgressed from An. sinensis into An. kleini. The An. sinensis progenies obtained from consecutive repeated backcrosses in both directions, i.e., F2-11 progeny [(An. sinensis x An. kleini) x An. sinensis] and F3-5 progeny [(An. kleini x An. sinensis) x An. kleini] provided good supportive evidence. Conclusions This study revealed introgression of the mitochondrial COI gene between An. sinensis and An. kleini through consecutive repeated backcrosses under laboratory conditions. This new body of knowledge will be
Directory of Open Access Journals (Sweden)
Rawadee Kumlert
Full Text Available Conventional gold standard characterization of chigger mites involves chemical preparation procedures (i.e. specimen clearing for visualization of morphological features, which however contributes to destruction of the arthropod host DNA and any endosymbiont or pathogen DNA harbored within the specimen.In this study, a novel work flow based on autofluorescence microscopy was developed to enable identification of trombiculid mites to the species level on the basis of morphological traits without any special preparation, while preserving the mite DNA for subsequent genotyping. A panel of 16 specifically selected fluorescence microscopy images of mite features from available identification keys served for complete chigger morphological identification to the species level, and was paired with corresponding genotype data. We evaluated and validated this method for paired chigger morphological and genotypic ID using the mitochondrial cytochrome c oxidase subunit I gene (coi in 113 chigger specimens representing 12 species and 7 genera (Leptotrombidium, Ascoschoengastia, Gahrliepia, Walchia, Blankaartia, Schoengastia and Schoutedenichia from the Lao People's Democratic Republic (Lao PDR to the species level (complete characterization, and 153 chiggers from 5 genera (Leptotrombidium, Ascoschoengastia, Helenicula, Schoengastiella and Walchia from Thailand, Cambodia and Lao PDR to the genus level. A phylogenetic tree constructed from 77 coi gene sequences (approximately 640 bp length, n = 52 new coi sequences and n = 25 downloaded from GenBank, demonstrated clear grouping of assigned morphotypes at the genus levels, although evidence of both genetic polymorphism and morphological plasticity was found.With this new methodology, we provided the largest collection of characterized coi gene sequences for trombiculid mites to date, and almost doubled the number of available characterized coi gene sequences with a single study. The ability to provide paired
Lee, Ping-Shin; Sing, Kong-Wah; Wilson, John-James
2015-01-01
Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i) to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii) to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp) DNA mini-barcode could distinguish most mammal species (including separating dark taxa) and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring. PMID:25898278
Directory of Open Access Journals (Sweden)
Ping-Shin Lee
Full Text Available Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp DNA mini-barcode could distinguish most mammal species (including separating dark taxa and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring.
The gene expressions of DNA methylation/demethylation enzymes ...
African Journals Online (AJOL)
user
2011-01-31
Jan 31, 2011 ... A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases.
GenePublisher: automated analysis of DNA microarray data
DEFF Research Database (Denmark)
Knudsen, Steen; Workman, Christopher; Sicheritz-Ponten, T.
2003-01-01
GenePublisher, a system for automatic analysis of data from DNA microarray experiments, has been implemented with a web interface at http://www.cbs.dtu.dk/services/GenePublisher. Raw data are uploaded to the server together with aspecification of the data. The server performs normalization...
Complete gene expression profiling of Saccharopolyspora erythraea using GeneChip DNA microarrays
Directory of Open Access Journals (Sweden)
Bordoni Roberta
2007-11-01
Full Text Available Abstract Background The Saccharopolyspora erythraea genome sequence, recently published, presents considerable divergence from those of streptomycetes in gene organization and function, confirming the remarkable potential of S. erythraea for producing many other secondary metabolites in addition to erythromycin. In order to investigate, at whole transcriptome level, how S. erythraea genes are modulated, a DNA microarray was specifically designed and constructed on the S. erythraea strain NRRL 2338 genome sequence, and the expression profiles of 6494 ORFs were monitored during growth in complex liquid medium. Results The transcriptional analysis identified a set of 404 genes, whose transcriptional signals vary during growth and characterize three distinct phases: a rapid growth until 32 h (Phase A; a growth slowdown until 52 h (Phase B; and another rapid growth phase from 56 h to 72 h (Phase C before the cells enter the stationary phase. A non-parametric statistical method, that identifies chromosomal regions with transcriptional imbalances, determined regional organization of transcription along the chromosome, highlighting differences between core and non-core regions, and strand specific patterns of expression. Microarray data were used to characterize the temporal behaviour of major functional classes and of all the gene clusters for secondary metabolism. The results confirmed that the ery cluster is up-regulated during Phase A and identified six additional clusters (for terpenes and non-ribosomal peptides that are clearly regulated in later phases. Conclusion The use of a S. erythraea DNA microarray improved specificity and sensitivity of gene expression analysis, allowing a global and at the same time detailed picture of how S. erythraea genes are modulated. This work underlines the importance of using DNA microarrays, coupled with an exhaustive statistical and bioinformatic analysis of the results, to understand the transcriptional
Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo
2014-09-17
DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.
Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H; Cai, Wanzhi
2015-09-21
Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populations from central China and peripheral China regions. Analysis of molecular variance showed a high level of geographical differentiation at different hierarchical levels. Isolation-by-distance test showed no significant correlation between genetic distance and geographical distance among A. suturalis populations, which suggested gene flow is not restricted by distance. In seven peripheral populations, the high levels of genetic differentiation and the small Nem values implied that geographic barriers were more likely restrict gene flow. Neutrality tests and the Bayesian skyline plot suggested population expansion likely happened during the cooling transition between Last Interglacial and Last Glacial Maximum. All lines of evidence suggest that physical barriers, Pleistocene climatic oscillations and geographical heterogeneity have affected the population structure and distribution of this insect in China.
Multiplex cDNA quantification method that facilitates the standardization of gene expression data
Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira
2011-01-01
Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008
Yund, Philip O; Collins, Catherine; Johnson, Sheri L
2015-06-01
The colonial ascidian Botryllus schlosseri should be considered cryptogenic (i.e., not definitively classified as either native or introduced) in the Northwest Atlantic. Although all the evidence is quite circumstantial, over the last 15 years most research groups have accepted the scenario of human-mediated dispersal and classified B. schlosseri as introduced; others have continued to consider it native or cryptogenic. We address the invasion status of this species by adding 174 sequences to the growing worldwide database for the mitochondrial gene cytochrome c oxidase subunit I (COI) and analyzing 1077 sequences to compare genetic diversity of one clade of haplotypes in the Northwest Atlantic with two hypothesized source regions (the Northeast Atlantic and Mediterranean). Our results lead us to reject the prevailing view of the directionality of transport across the Atlantic. We argue that the genetic diversity patterns at COI are far more consistent with the existence of at least one haplotype clade in the Northwest Atlantic (and possibly a second) that substantially pre-dates human colonization from Europe, with this native North American clade subsequently introduced to three sites in Northeast Atlantic and Mediterranean waters. However, we agree with past researchers that some sites in the Northwest Atlantic have more recently been invaded by alien haplotypes, so that some populations are currently composed of a mixture of native and invader haplotypes. © 2015 Marine Biological Laboratory.
Conidiogenesis-related DNA photolyase gene in Beauveria bassiana.
Lee, Se Jin; Lee, Mi Rong; Kim, Sihyeon; Kim, Jong Cheol; Park, So Eun; Shin, Tae Young; Kim, Jae Su
2018-03-01
Beauveria bassiana is an entomopathogenic fungi used in environmentally mindful pest management. Its main active ingredient, conidia, is commercially available as a fungal biopesticide. Many studies of conidia production have focused on how to optimize culture conditions for maximum productivity and stability against unfavorable abiotic factors. However, understanding of how conidiogenesis-related genes provide improved conidial production remains unclear. In this study, we focus on identifying conidiogenesis-related genes in B. bassiana ERL1170 using a random mutagenesis technique. Transformation of ERL1170 using restriction enzyme-mediated integration generated one morphologically different transformant, ERL1170-pABeG #163. The transformant was confirmed to represent B. bassiana, and the binary vector was successfully integrated into the genome of ERL1170. Compared to the wild type, transformant #163 showed very slow hyphal growth and within 6 days only produced bassiana exhibits thread-like hyphae and conidiophore structures and circular conidia. To determine the location of the randomly inserted DNA, we conducted thermal asymmetric interlaced (TAIL) PCR and Escherichia coli cloning to clearly sequence the disrupted region. We identified one colony (colony No. 7) with an insertion site identified as DNA photolyase. This was confirmed through a gene knock-out study. It is possible the gene that encodes for DNA photolyase was disrupted during the insertion process and might be involved in fungal conidiogenesis. This work serves as a platform for exploring the function of a variety of B. bassiana genes involved in pest management and their downstream processing. Copyright © 2018 Elsevier Inc. All rights reserved.
The application of DNA microarrays in gene expression analysis
Hal, van N.L.W.; Vorst, O.; Houwelingen, van A.M.M.L.; Kok, E.J.; Peijnenburg, A.A.C.M.; Aharoni, A.; Tunen, van A.J.; Keijer, J.
2000-01-01
DNA microarray technology is a new and powerful technology that will substantially increase the speed of molecular biological research. This paper gives a survey of DNA microarray technology and its use in gene expression studies. The technical aspects and their potential improvements are discussed.
International Nuclear Information System (INIS)
Chan, John Y.H.; Chen, Lung-Kun; Chang, Jui-Feng
2001-01-01
The ability of cells to rejoin DNA double-strand breaks (DSBs) usually correlates with their radiosensitivity. This correlation has been demonstrated in radiosensitive cells, including the Chinese hamster ovary mutant XRS-5. XRS-5 is defective in a DNA end-binding protein, Ku80, which is a component of a DNA-dependent protein kinase complex used for joining strand breaks. However, Ku80-deficient cells are known to be retarded in cell proliferation and growth as well as other yet to be identified defects. Using custom-made 600-gene cDNA microarray filters, we found differential gene expressions between the wild-type and XRS-5 cells. Defective Ku80 apparently affects the expression of several repair genes, including topoisomerase-I and -IIA, ERCC5, MLH1, and ATM. In contrast, other DNA repair-associated genes, such as GADD45A, EGR1 MDM2 and p53, were not affected. In addition, for large numbers of growth-associated genes, such as cyclins and clks, the growth factors and cytokines were also affected. Down-regulated expression was also found in several categories of seemingly unrelated genes, including apoptosis, angiogenesis, kinase and signaling, phosphatase, stress protein, proto-oncogenes and tumor suppressors, transcription and translation factors. A RT-PCR analysis confirmed that the XRS-5 cells used were defective in Ku80 expression. The diversified groups of genes being affected could mean that Ku80, a multi-functional DNA-binding protein, not only affects DNA repair, but is also involved in transcription regulation. Our data, taken together, indicate that there are specific genes being modulated in Ku80- deficient cells, and that some of the DNA repair pathways and other biological functions are apparently linked, suggesting that a defect in one gene could have global effects on many other processes. (author)
Energy Technology Data Exchange (ETDEWEB)
Chan, John Y.H.; Chen, Lung-Kun; Chang, Jui-Feng [National Yang Ming Univ., Taipei, Taiwan (China). Inst. of Radiological Sciences] (and others)
2001-12-01
The ability of cells to rejoin DNA double-strand breaks (DSBs) usually correlates with their radiosensitivity. This correlation has been demonstrated in radiosensitive cells, including the Chinese hamster ovary mutant XRS-5. XRS-5 is defective in a DNA end-binding protein, Ku80, which is a component of a DNA-dependent protein kinase complex used for joining strand breaks. However, Ku80-deficient cells are known to be retarded in cell proliferation and growth as well as other yet to be identified defects. Using custom-made 600-gene cDNA microarray filters, we found differential gene expressions between the wild-type and XRS-5 cells. Defective Ku80 apparently affects the expression of several repair genes, including topoisomerase-I and -IIA, ERCC5, MLH1, and ATM. In contrast, other DNA repair-associated genes, such as GADD45A, EGR1 MDM2 and p53, were not affected. In addition, for large numbers of growth-associated genes, such as cyclins and clks, the growth factors and cytokines were also affected. Down-regulated expression was also found in several categories of seemingly unrelated genes, including apoptosis, angiogenesis, kinase and signaling, phosphatase, stress protein, proto-oncogenes and tumor suppressors, transcription and translation factors. A RT-PCR analysis confirmed that the XRS-5 cells used were defective in Ku80 expression. The diversified groups of genes being affected could mean that Ku80, a multi-functional DNA-binding protein, not only affects DNA repair, but is also involved in transcription regulation. Our data, taken together, indicate that there are specific genes being modulated in Ku80- deficient cells, and that some of the DNA repair pathways and other biological functions are apparently linked, suggesting that a defect in one gene could have global effects on many other processes. (author)
van Gaal, E.V.B.
2010-01-01
The aim of gene therapy is to treat, cure or prevent a disease by replacing defective genes, introducing new genes or changing the expression of a person’s genes. Success of gene therapy is dependent on successful delivery of DNA from the site of administration into cell nuclei. Naturally occurring
Barik, Tapan K; Swain, Surya N; Sahu, Bijayalaxmi; Tripathy, Bibarani; Acharya, Usha R
2018-05-01
Identification of fish species have so far been carried out mostly by classical morpho-taxonomy. In the present study, however, an attempt has been taken to identify two species of fishes Ulua mentalis and Pinjalo pinjalo of order Perciformes which happens to be the first record in Odisha coast Bay of Bengal, India during the year 2015, using DNA barcoding technique for reconfirmation over conventional morpho-taxonomy. During recent past, study of molecular-taxonomical profile of mitochondrial DNA in general and Cytochrome Oxidase subunit I (COI) gene in particular has gained enormous importance for accurate identification of species. In the present study, the partial COI sequence of Ulua mentalis and Pinjalo pinjalo were generated. Analysis using the COI gene produced phylogenetic trees in concurrence with other multi gene studies and we came across the identical phylogenetic relationship considering Neighbor-Joining and Maximum Likelihood tree. Moreover, these molecular data set further testified in Bayesian framework to reevaluate the exact taxonomic groupings within the family. Surprisingly, Ulua mentalis and Pinjalo pinjalo seems to be closely related to their sister taxa.
Lv, Lulu; Zhao, Huiqing
2014-01-01
The development of safe and efficient gene carriers is the key to the clinical success of gene therapy. The present study was designed to develop and evaluate the chitosan-graft-polyethylenimine (CP)/DNA nanoparticles as novel non-viral gene vectors for gene therapy of osteoarthritis. The CP/DNA nanoparticles were produced through a complex coacervation of the cationic polymers with pEGFP after grafting chitosan (CS) with a low molecular weight (Mw) PEI (Mw = 1.8 kDa). Particle size and zeta potential were related to the weight ratio of CP:DNA, where decreases in nanoparticle size and increases in surface charge were observed as CP content increased. The buffering capacity of CP was significantly greater than that of CS. The transfection efficiency of CP/DNA nanoparticles was similar with that of the Lipofectamine™ 2000, and significantly higher than that of CS/DNA and PEI (25 kDa)/DNA nanoparticles. The transfection efficiency of the CP/DNA nanoparticles was dependent on the weight ratio of CP:DNA (w/w). The average cell viability after the treatment with CP/DNA nanoparticles was over 90% in both chondrocytes and synoviocytes, which was much higher than that of PEI (25 kDa)/DNA nanoparticles. The CP copolymers efficiently carried the pDNA inside chondrocytes and synoviocytes, and the pDNA was detected entering into nucleus. These results suggest that CP/DNA nanoparticles with improved transfection efficiency and low cytotoxicity might be a safe and efficient non-viral vector for gene delivery to both chondrocytes and synoviocytes. PMID:24392152
International Nuclear Information System (INIS)
Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.
1998-01-01
This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)
Non-electrostatic complexes with DNA: towards novel synthetic gene delivery systems.
Soto, J; Bessodes, M; Pitard, B; Mailhe, P; Scherman, D; Byk, G
2000-05-01
We have developed new DNA complexing amphiphile based on Hoechst 33258 interaction with DNA grooves. The synthesis and physicochemical characterisation of lipid/DNA complexes, as compared to that of classical lipopolyamine for gene delivery, are described and discussed.
Park, Hyun Suk; Kim, Choong-Gon; Kim, Sung; Park, Yong-Joo; Choi, Hee-Jung; Xiao, Zhizhong; Li, Jun; Xiao, Yongshuang; Lee, Youn-Ho
2018-04-01
The rock bream, Oplegnathus fasciatus, is a common rocky reef game fish in East Asia and recently has become an aquaculture species. Despite its commercial importance, the population genetic structure of this fish species remains poorly understood. In this study, 163 specimens were collected from 6 localities along the coastal waters of Korea and China and their genetic variation was analyzed with mtDNA COI sequences. A total of 34 polymorphic sites were detected which determined 30 haplotypes. The genetic pattern reveals a low level of nucleotide diversity (0.04 ± 0.003) but a high level of haplotype diversity (0.83 ± 0.02). The 30 haplotypes are divided into two major genealogical clades: one that consists of only Zhoushan (ZS, East China Sea) specific haplotypes from the southern East China Sea and the other that consists of the remaining haplotypes from the northern East China Sea, Yellow Sea, Korea Strait, and East Sea/Sea of Japan. The two clades are separated by approximately 330 435 kyBP. Analyses of AMOVA and F st show a significant population differentiation between the ZS sample and the other ones, corroborating separation of the two genealogical clades. Larval dispersal and the fresh Yangtze River plume are invoked as the main determining factors for this population genetic structure of O. fasciatus. Neutrality tests and mismatch distribution analyses indicate late Pleistocene population expansion along the coastal waters of Korea and China approximately 133-183 kyBP during which there were periodic cycles of glaciations and deglaciations. Such population information needs to be taken into account when stock enhancement and conservation measures are implemented for this fisheries species.
Quantitative analysis of gene-specific DNA damage in human spermatozoa
International Nuclear Information System (INIS)
Sawyer, Dennis E.; Mercer, Belinda G.; Wiklendt, Agnieszka M.; Aitken, R. John
2003-01-01
Recent studies have suggested that human spermatozoa are highly susceptible to DNA damage induced by oxidative stress. However, a detailed analysis of the precise nature of this damage and the extent to which it affects the mitochondrial and nuclear genomes has not been reported. To induce DNA damage, human spermatozoa were treated in vitro with hydrogen peroxide (H 2 O 2 ; 0-5 mM) or iron (as Fe(II)SO 4 , 0-500 μM). Quantitative PCR (QPCR) was used to measure DNA damage in individual nuclear genes (hprt, β-pol and β-globin) and mitochondrial DNA. Single strand breaks were also assessed by alkaline gel electrophoresis. H 2 O 2 was found to be genotoxic toward spermatozoa at concentrations as high as 1.25 mM, but DNA damage was not detected in these cells with lower concentrations of H 2 O 2 . The mitochondrial genome of human spermatozoa was significantly (P 2 O 2 -induced DNA damage than the nuclear genome. However, both nDNA and mtDNA in human spermatozoa were significantly (P<0.001) more resistant to damage than DNA from a variety of cell lines of germ cell and myoblastoid origin. Interestingly, significant DNA damage was also not detected in human spermatozoa treated with iron. These studies report, for the first time, quantitative measurements of DNA damage in specific genes of male germ cells, and challenge the commonly held belief that human spermatozoa are particularly vulnerable to DNA damage
Insight into the Migration Routes of Plutella xylostella in China Using mtCOI and ISSR Markers
Tian, Lixia; Xu, Baoyun; Xie, Wen; Wang, Shaoli; Zhang, Youjun; Wang, Xiangjing; Wu, Qingjun
2015-01-01
The larvae of the diamondback moth, Plutella xylostella, cause major economic losses to cruciferous crops, including cabbage, which is an important vegetable crop in China. In this study, we used the mitochondrial COI gene and 11 ISSR markers to characterize the genetic structure and seasonal migration routes of 23 P. xylostella populations in China. Both the mitochondrial and nuclear markers revealed high haplotype diversity and gene flow among the populations, although some degree of genetic isolation was evident between the populations of Hainan Island and other sampling sites. The dominant haplotypes, LX1 and LX2, differed significantly from all other haplotypes both in terms of the number of individuals with those haplotypes and their distributions. Haplotypes that were shared among populations revealed that P. xylostella migrates from the lower reaches of the Yangtze River to northern China and then to northeastern China. Our results also revealed another potential migration route for P. xylostella, i.e., from southwestern China to both northwestern and southern China. PMID:26098353
Yoshizumi, Takeshi; Oikawa, Kazusato; Chuah, Jo-Ann; Kodama, Yutaka; Numata, Keiji
2018-05-14
Selective gene delivery into organellar genomes (mitochondrial and plastid genomes) has been limited because of a lack of appropriate platform technology, even though these organelles are essential for metabolite and energy production. Techniques for selective organellar modification are needed to functionally improve organelles and produce transplastomic/transmitochondrial plants. However, no method for mitochondrial genome modification has yet been established for multicellular organisms including plants. Likewise, modification of plastid genomes has been limited to a few plant species and algae. In the present study, we developed ionic complexes of fusion peptides containing organellar targeting signal and plasmid DNA for selective delivery of exogenous DNA into the plastid and mitochondrial genomes of intact plants. This is the first report of exogenous DNA being integrated into the mitochondrial genomes of not only plants, but also multicellular organisms in general. This fusion peptide-mediated gene delivery system is a breakthrough platform for both plant organellar biotechnology and gene therapy for mitochondrial diseases in animals.
DNA repair-related genes in sugarcane expressed sequence tags (ESTs
Directory of Open Access Journals (Sweden)
R.M.A. Costa
2001-12-01
Full Text Available There is much interest in the identification and characterization of genes involved in DNA repair because of their importance in the maintenance of the genome integrity. The high level of conservation of DNA repair genes means that these genetic elements may be used in phylogenetic studies as a source of information on the genetic origin and evolution of species. The mechanisms by which damaged DNA is repaired are well understood in bacteria, yeast and mammals, but much remains to be learned as regards plants. We identified genes involved in DNA repair mechanisms in sugarcane using a similarity search of the Brazilian Sugarcane Expressed Sequence Tag (SUCEST database against known sequences deposited in other public databases (National Center of Biotechnology Information (NCBI database and the Munich Information Center for Protein Sequences (MIPS Arabidopsis thaliana database. This search revealed that most of the various proteins involved in DNA repair in sugarcane are similar to those found in other eukaryotes. However, we also identified certain intriguing features found only in plants, probably due to the independent evolution of this kingdom. The DNA repair mechanisms investigated include photoreactivation, base excision repair, nucleotide excision repair, mismatch repair, non-homologous end joining, homologous recombination repair and DNA lesion tolerance. We report the main differences found in the DNA repair machinery in plant cells as compared to other organisms. These differences point to potentially different strategies plants employ to deal with DNA damage, that deserve further investigation.A identificação e caracterização de genes envolvidos com reparo de DNA são de grande interesse, dada a sua importância na manutenção da integridade genômica. Além disso, a alta conservação dos genes de reparo de DNA faz com que possam ser utilizados como fonte de informação no que diz respeito à origem e evolução das esp
Ionizing and ultraviolet radiation enhances the efficiency of DNA mediated gene transfer in vitro
International Nuclear Information System (INIS)
Perez, C.F.
1984-08-01
The enhancement effects of ionizing and non-ionizing radiation on the efficiency of DNA mediated gene transfer were studied. Confluent Rat-2 cells were transfected with purified SV40 viral DNA, irradiated with either X-rays or ultraviolet, trypsinized, plated, and assayed for the formation of foci on Rat-2 monolayers. Both ionizing and ultraviolet radiation enhanced the frequency of A-gene transformants/survivor compared to unirradiated transfected cells. These enhancements were non-linear and dose dependent. A recombinant plasmid, pOT-TK5, was constructed that contained the SV40 virus A-gene and the Herpes Simplex virus (HSV) thymidine kinase (TK) gene. Confluent Rat-2 cells transfected with pOT-TK5 DNA and then immediately irradiated with either X-rays or 330 MeV/amu argon particles at the Berkeley Bevalac showed a higher frequency of HAT + colonies/survivor than unirradiated transfected cells. Rat-2 cells transfected with the plasmid, pTK2, containing only the HSV TK-gene were enhanced for TK-transformation by both X-rays and ultraviolet radiation. The results demonstrate that radiation enhancement of the efficiency of DNA mediated gene transfer is not explained by increased nuclear uptake of the transfected DNA. Radiation increases the competence of the transfected cell population for genetic transformation. Three models for this increased competence are presented. The targeted integration model, the inducible recombination model, the partition model, and the utilization of DNA mediated gene transfer for DNA repair studies are discussed. 465 references
Ionizing and ultraviolet radiation enhances the efficiency of DNA mediated gene transfer in vitro
Energy Technology Data Exchange (ETDEWEB)
Perez, C.F.
1984-08-01
The enhancement effects of ionizing and non-ionizing radiation on the efficiency of DNA mediated gene transfer were studied. Confluent Rat-2 cells were transfected with purified SV40 viral DNA, irradiated with either X-rays or ultraviolet, trypsinized, plated, and assayed for the formation of foci on Rat-2 monolayers. Both ionizing and ultraviolet radiation enhanced the frequency of A-gene transformants/survivor compared to unirradiated transfected cells. These enhancements were non-linear and dose dependent. A recombinant plasmid, pOT-TK5, was constructed that contained the SV40 virus A-gene and the Herpes Simplex virus (HSV) thymidine kinase (TK) gene. Confluent Rat-2 cells transfected with pOT-TK5 DNA and then immediately irradiated with either X-rays or 330 MeV/amu argon particles at the Berkeley Bevalac showed a higher frequency of HAT/sup +/ colonies/survivor than unirradiated transfected cells. Rat-2 cells transfected with the plasmid, pTK2, containing only the HSV TK-gene were enhanced for TK-transformation by both X-rays and ultraviolet radiation. The results demonstrate that radiation enhancement of the efficiency of DNA mediated gene transfer is not explained by increased nuclear uptake of the transfected DNA. Radiation increases the competence of the transfected cell population for genetic transformation. Three models for this increased competence are presented. The targeted integration model, the inducible recombination model, the partition model, and the utilization of DNA mediated gene transfer for DNA repair studies are discussed. 465 references.
El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R
2013-07-01
Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.
Utility of Multi-Gene Loci for Forensic Species Diagnosis of Blowflies
Zaidi, Farrah; Wei, Shu-jun; Shi, Min; Chen, Xue-xin
2011-01-01
Contemporary studies in forensic entomology exhaustively evaluate gene sequences because these constitute the fastest and most accurate method of species identification. For this purpose single gene segments, cytochrome oxidase subunit I (COI) in particular, are commonly used. However, the limitation of such sequences in identification, especially of closely related species and populations, demand a multi-gene approach. But this raises the question of which group of genes can best fulfill the identification task? In this context the utility of five gene segments was explored among blowfly species from two distinct geographic regions, China and Pakistan. COI, cytochrome b (CYTB), NADH dehydrogenase 5 (ND5), nuclear internal transcribed spacers (ITS1 and ITS2), were sequenced for eight blowfly species including Chrysomya megacephala F. (Diptera: Calliphoidae), Ch. pinguis Walker, Lucilia sericata Meigen L. porphyrina Walker, L. illustris Meigen Hemipyrellia ligurriens Wiedemann, Aldrichina grahami Aldrich, and the housefly, Musca domestica L. (Muscidae), from Hangzhou, China; while COI, CYTB, and ITS2 were sequenced for four species, i.e. Ch. megacephala, Ch. rufifacies, L. cuprina, and the flesh fly, Sarcophaga albiceps Meigen (Sarcophagidae), from Dera Ismail Khan Pakistan. The results demonstrate a universal utility of these gene segments in the molecular identification of flies of forensic importance. PMID:21864153
DR-Integrator: a new analytic tool for integrating DNA copy number and gene expression data.
Salari, Keyan; Tibshirani, Robert; Pollack, Jonathan R
2010-02-01
DNA copy number alterations (CNA) frequently underlie gene expression changes by increasing or decreasing gene dosage. However, only a subset of genes with altered dosage exhibit concordant changes in gene expression. This subset is likely to be enriched for oncogenes and tumor suppressor genes, and can be identified by integrating these two layers of genome-scale data. We introduce DNA/RNA-Integrator (DR-Integrator), a statistical software tool to perform integrative analyses on paired DNA copy number and gene expression data. DR-Integrator identifies genes with significant correlations between DNA copy number and gene expression, and implements a supervised analysis that captures genes with significant alterations in both DNA copy number and gene expression between two sample classes. DR-Integrator is freely available for non-commercial use from the Pollack Lab at http://pollacklab.stanford.edu/ and can be downloaded as a plug-in application to Microsoft Excel and as a package for the R statistical computing environment. The R package is available under the name 'DRI' at http://cran.r-project.org/. An example analysis using DR-Integrator is included as supplemental material. Supplementary data are available at Bioinformatics online.
The evolution of CHROMOMETHYLASES and gene body DNA methylation in plants.
Bewick, Adam J; Niederhuth, Chad E; Ji, Lexiang; Rohr, Nicholas A; Griffin, Patrick T; Leebens-Mack, Jim; Schmitz, Robert J
2017-05-01
The evolution of gene body methylation (gbM), its origins, and its functional consequences are poorly understood. By pairing the largest collection of transcriptomes (>1000) and methylomes (77) across Viridiplantae, we provide novel insights into the evolution of gbM and its relationship to CHROMOMETHYLASE (CMT) proteins. CMTs are evolutionary conserved DNA methyltransferases in Viridiplantae. Duplication events gave rise to what are now referred to as CMT1, 2 and 3. Independent losses of CMT1, 2, and 3 in eudicots, CMT2 and ZMET in monocots and monocots/commelinids, variation in copy number, and non-neutral evolution suggests overlapping or fluid functional evolution of this gene family. DNA methylation within genes is widespread and is found in all major taxonomic groups of Viridiplantae investigated. Genes enriched with methylated CGs (mCG) were also identified in species sister to angiosperms. The proportion of genes and DNA methylation patterns associated with gbM are restricted to angiosperms with a functional CMT3 or ortholog. However, mCG-enriched genes in the gymnosperm Pinus taeda shared some similarities with gbM genes in Amborella trichopoda. Additionally, gymnosperms and ferns share a CMT homolog closely related to CMT2 and 3. Hence, the dependency of gbM on a CMT most likely extends to all angiosperms and possibly gymnosperms and ferns. The resulting gene family phylogeny of CMT transcripts from the most diverse sampling of plants to date redefines our understanding of CMT evolution and its evolutionary consequences on DNA methylation. Future, functional tests of homologous and paralogous CMTs will uncover novel roles and consequences to the epigenome.
Genomic survey and expression analysis of DNA repair genes in the genus Leptospira.
Martins-Pinheiro, Marinalva; Schons-Fonseca, Luciane; da Silva, Josefa B; Domingos, Renan H; Momo, Leonardo Hiroyuki Santos; Simões, Ana Carolina Quirino; Ho, Paulo Lee; da Costa, Renata M A
2016-04-01
Leptospirosis is an emerging zoonosis with important economic and public health consequences and is caused by pathogenic leptospires. The genus Leptospira belongs to the order Spirochaetales and comprises saprophytic (L. biflexa), pathogenic (L. interrogans) and host-dependent (L. borgpetersenii) members. Here, we present an in silico search for DNA repair pathways in Leptospira spp. The relevance of such DNA repair pathways was assessed through the identification of mRNA levels of some genes during infection in animal model and after exposition to spleen cells. The search was performed by comparison of available Leptospira spp. genomes in public databases with known DNA repair-related genes. Leptospires exhibit some distinct and unexpected characteristics, for instance the existence of a redundant mechanism for repairing a chemically diverse spectrum of alkylated nucleobases, a new mutS-like gene and a new shorter version of uvrD. Leptospira spp. shares some characteristics from Gram-positive, as the presence of PcrA, two RecQ paralogs and two SSB proteins; the latter is considered a feature shared by naturally competent bacteria. We did not find a significant reduction in the number of DNA repair-related genes in both pathogenic and host-dependent species. Pathogenic leptospires were enriched for genes dedicated to base excision repair and non-homologous end joining. Their evolutionary history reveals a remarkable importance of lateral gene transfer events for the evolution of the genus. Up-regulation of specific DNA repair genes, including components of SOS regulon, during infection in animal model validates the critical role of DNA repair mechanisms for the complex interplay between host/pathogen.
Caffeine inhibits gene conversion by displacing Rad51 from ssDNA
Tsabar, Michael; Mason, Jennifer M.; Chan, Yuen-Ling; Bishop, Douglas K.; Haber, James E.
2015-01-01
Efficient repair of chromosomal double-strand breaks (DSBs) by homologous recombination relies on the formation of a Rad51 recombinase filament that forms on single-stranded DNA (ssDNA) created at DSB ends. This filament facilitates the search for a homologous donor sequence and promotes strand invasion. Recently caffeine treatment has been shown to prevent gene targeting in mammalian cells by increasing non-productive Rad51 interactions between the DSB and random regions of the genome. Here we show that caffeine treatment prevents gene conversion in yeast, independently of its inhibition of the Mec1ATR/Tel1ATM-dependent DNA damage response or caffeine's inhibition of 5′ to 3′ resection of DSB ends. Caffeine treatment results in a dosage-dependent eviction of Rad51 from ssDNA. Gene conversion is impaired even at low concentrations of caffeine, where there is no discernible dismantling of the Rad51 filament. Loss of the Rad51 filament integrity is independent of Srs2's Rad51 filament dismantling activity or Rad51's ATPase activity and does not depend on non-specific Rad51 binding to undamaged double-stranded DNA. Caffeine treatment had similar effects on irradiated HeLa cells, promoting loss of previously assembled Rad51 foci. We conclude that caffeine treatment can disrupt gene conversion by disrupting Rad51 filaments. PMID:26019181
DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.
Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard
2003-04-24
Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.
Asynchronous DNA replication within the human β-globin gene locus
International Nuclear Information System (INIS)
Epner, E.; Forrester, W.C.; Groudine, M.
1988-01-01
The timing of DNA replication of the human β-globin gene locus has been studied by blot hybridization of newly synthesized BrdUrd-substituted DNA from cells in different stages of the S phase. Using probes that span >120 kilobases across the human β-globin gene locus, the authors show that the majority of this domain replicates in early S phase in the human erythroleukemia cell line K562 and in middle-to-late S phase in the lymphoid cell line Manca. However, in K562 cells three small regions display a strikingly different replication pattern than adjacent sequences. These islands, located in the inter-γ-globin gene region and approximately 20 kilobases 5' to the ε-globin gene and 20 kilobases 3' to the β-globin gene, replicate later and throughout S phase. A similar area is also present in the α-globin gene region in K562 cells. They suggest that these regions may represent sites of termination of replication forks
Observation of intermittency in gene expression on cDNA microarrays
Peterson, L E
2002-01-01
We used scaled factorial moments to search for intermittency in the log expression ratios (LERs) for thousands of genes spotted on cDNA microarrays (gene chips). Results indicate varying levels of intermittency in gene expression. The observation of intermittency in the data analyzed provides a complimentary handle on moderately expressed genes, generally not tackled by conventional techniques.
Directory of Open Access Journals (Sweden)
Gong Shiaochin
2009-03-01
Full Text Available Abstract Background Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. Results We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1 subclone genes of interest into BAC linking vectors, (2 insert desired reporter genes into respective genes and (3 link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. Conclusion The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.
Maye, Peter; Stover, Mary Louise; Liu, Yaling; Rowe, David W; Gong, Shiaochin; Lichtler, Alexander C
2009-03-13
Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP) reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1) subclone genes of interest into BAC linking vectors, (2) insert desired reporter genes into respective genes and (3) link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.
Intrinsically bent DNA in replication origins and gene promoters.
Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A
2008-06-24
Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.
International Nuclear Information System (INIS)
Tabebi, Mouna; Mkaouar-Rebai, Emna; Mnif, Mouna; Kallabi, Fakhri; Ben Mahmoud, Afif; Ben Saad, Wafa; Charfi, Nadia; Keskes-Ammar, Leila; Kamoun, Hassen; Abid, Mohamed; Fakhfakh, Faiza
2015-01-01
Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating that this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. - Highlights: • MT-COX3 m.9267G>C (p.A21P), heteroplasmic substitution, is not reported in any database. • m.9267G>C can be responsible of the MIDD associated with nephropaty. • This substitution can modify the function and the stability of the MT-CO3 protein. • This substitution can modify MT-CO3 structure (2D and 3D). • MT-COX3 m.9267G>C is associated
Energy Technology Data Exchange (ETDEWEB)
Tabebi, Mouna, E-mail: mouna.biologiste@yahoo.com [Laboratoire de Génétique Moléculaire Humaine, Faculté de Médecine de Sfax, Université de Sfax (Tunisia); Mkaouar-Rebai, Emna [Laboratoire de Génétique Moléculaire Humaine, Faculté de Médecine de Sfax, Université de Sfax (Tunisia); Mnif, Mouna [Service d' endocrinologie, C.H.U. Habib Bourguiba de Sfax (Tunisia); Kallabi, Fakhri; Ben Mahmoud, Afif [Laboratoire de Génétique Moléculaire Humaine, Faculté de Médecine de Sfax, Université de Sfax (Tunisia); Ben Saad, Wafa; Charfi, Nadia [Service d' endocrinologie, C.H.U. Habib Bourguiba de Sfax (Tunisia); Keskes-Ammar, Leila; Kamoun, Hassen [Laboratoire de Génétique Moléculaire Humaine, Faculté de Médecine de Sfax, Université de Sfax (Tunisia); Abid, Mohamed [Service d' endocrinologie, C.H.U. Habib Bourguiba de Sfax (Tunisia); Fakhfakh, Faiza, E-mail: faiza.fakhfakh@gmail.com [Laboratoire de Génétique Moléculaire Humaine, Faculté de Médecine de Sfax, Université de Sfax (Tunisia)
2015-04-10
Mitochondrial diabetes (MD) is a heterogeneous disorder characterized by a chronic hyperglycemia, maternal transmission and its association with a bilateral hearing impairment. Several studies reported mutations in mitochondrial genes as potentially pathogenic for diabetes, since mitochondrial oxidative phosphorylation plays an important role in glucose-stimulated insulin secretion from beta cells. In the present report, we studied a Tunisian family with mitochondrial diabetes (MD) and deafness associated with nephropathy. The mutational analysis screening revealed the presence of a novel heteroplasmic mutation m.9276G>C in the mitochondrial COIII gene, detected in mtDNA extracted from leukocytes of a mother and her two daughters indicating that this mutation is maternally transmitted and suggest its implication in the observed phenotype. Bioinformatic tools showed that m.9267G>C mutation (p.A21P) is « deleterious » and it can modify the function and the stability of the MT-COIII protein by affecting the assembly of mitochondrial COX subunits and the translocation of protons then reducing the activity of the respective OXPHOS complexes of ATP synthesis. The nonsynonymous mutation (p.A21P) has not been reported before, it is the first mutation described in the COXIII gene which is related to insulin dependent mitochondrial diabetes and deafness and could be specific to the Tunisian population. The m.9267G>C mutation was present with a nonsynonymous inherited mitochondrial homoplasmic variation MT-COI m.5913 G>A (D4N) responsible of high blood pressure, a clinical feature detected in all explored patients. - Highlights: • MT-COX3 m.9267G>C (p.A21P), heteroplasmic substitution, is not reported in any database. • m.9267G>C can be responsible of the MIDD associated with nephropaty. • This substitution can modify the function and the stability of the MT-CO3 protein. • This substitution can modify MT-CO3 structure (2D and 3D). • MT-COX3 m.9267G>C is associated
Promoter DNA hypermethylation and gene repression in undifferentiated Arabidopsis cells.
Directory of Open Access Journals (Sweden)
María Berdasco
Full Text Available Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells.
Use of electroporation for high-molecular-weight DNA-mediated gene transfer.
Jastreboff, M M; Ito, E; Bertino, J R; Narayanan, R
1987-08-01
Electroporation was used to introduce high-molecular-weight DNA into murine hematopoietic cells and NIH3T3 cells. CCRF-CEM cells were stably transfected with SV2NEO plasmid and the genomic DNA from G-418-resistant clones (greater than 65 kb) was introduced into mouse bone marrow and NIH3T3 cells by electroporation. NEO sequences and expression were detected in the hematopoietic tissues of lethally irradiated mice, with 24% of individual spleen colonies expressing NEO. The frequency of genomic DNA transfer into NIH3T3 cells was 0.25 X 10(-3). Electroporation thus offers a powerful mode of gene transfer not only of cloned genes but also of high-molecular-weight DNA into cells.
Directory of Open Access Journals (Sweden)
Analía A. Lanteri
2007-12-01
Full Text Available En este artículo se abordan algunos aspectos de la controversia sobre la iniciativa «Código de barras del ADN», y se hace hincapié en sus potenciales aplicaciones en Entomología. Esta iniciativa propone emplear información dentro de una misma región génica (gen mitocondrial de la Citocromo c Oxidasa I = COI, en todas las especies vivientes y con condiciones de secuenciación universalmente aceptadas y estandarizadas. En la actualidad, no pretende sustituir la taxonomía alfa y la filogenia sino agilizar las tareas de identificación, especialmente en el campo de la Biomedicina (identificación de patógenos, parásitos y vectores, el control de plagas (intercepción de especies invasoras, cualquiera sea su estado de desarrollo ontogenético y los estudios sobre conservación de la biodiversidad. Para arribar a una correcta delimitación de las especies biológicas es preciso contar con las secuencias de COI de numerosos individuos a lo largo de todo su rango geográfico y además, secuencias de genes nucleares e información morfológica y biológica detallada. Las «Unidades Evolutivas Significativas», identificadas sobre la base del «código de barras», podrían corresponder tanto a morfoespecies como a especies crípticas y a subespecies o linajes con diferentes preferencias de huéspedes. La integración del «código de barras del ADN», el trabajo de campo, las colecciones de museos y la investigación científica resultan imprescindibles para que esta herramienta redunde en avances significativos en el campo de la Sistemática Entomológica.This article deals with some of the most controversial issues of the DNA barcode initiative, focusing on its potential applications to Entomology. The barcoding proposes using information within the same gene region (Cytocrome c Oxidase I= COI mitochondrial gene, in all living species and under standard conditions of sequencing. At present, it does not attempt to replace alpha taxonomy or
Shariff, Safiah; Yaakop, Salmah; Zain, Badrul Munir Md.
2013-11-01
Members of the Opiinae subfamily (Hymenoptera: Braconidae) are well known as important parasitoids of fruit fly larvae (Diptera: Tephritidae). They are widely used as biological control agents of fruit flies, especially the Bactrocera Macquart species that infest fruits. In this study, the larvae of fruit flies were collected from infested crops including star fruit, guava, wax apple and ridge gourd. The parasitized larvae were then reared under laboratory conditions until emergence of the adult parasitoids. Additionally, Malaise trap also was used to collect parasitoid species. The general concept of the multiplex PCR has been performed is to amplify two mitochondrial DNA markers, namely cytochrome oxidase subunit I (COI) and cytochrome b (Cyt b) simultaneously. Therefore, the lengthy process of reaction will be reduced. The status of the fruit fly species has also been confirmed by using COI marker on the early stage of the larvae. Maximum parsimony (MP) and Bayesian Inference (BI) were implemented to help and support the identification of Opiinae species. The result obtained from this study showed three parasitoid genera of the Opiinae viz. Fopius Wharton, Psyttalia Walker and Diachasmimorpha Viereck. Each genus has been determined by clustering together in a similar clade according to their infested crops. Therefore, accurate determination of parasitoids and the fruit fries species was highly useful and necessary for successful biological control of Bactrocera species.
Directory of Open Access Journals (Sweden)
DasSarma Shiladitya
2007-06-01
Full Text Available Abstract Background Information transfer systems in Archaea, including many components of the DNA replication machinery, are similar to those found in eukaryotes. Functional assignments of archaeal DNA replication genes have been primarily based upon sequence homology and biochemical studies of replisome components, but few genetic studies have been conducted thus far. We have developed a tractable genetic system for knockout analysis of genes in the model halophilic archaeon, Halobacterium sp. NRC-1, and used it to determine which DNA replication genes are essential. Results Using a directed in-frame gene knockout method in Halobacterium sp. NRC-1, we examined nineteen genes predicted to be involved in DNA replication. Preliminary bioinformatic analysis of the large haloarchaeal Orc/Cdc6 family, related to eukaryotic Orc1 and Cdc6, showed five distinct clades of Orc/Cdc6 proteins conserved in all sequenced haloarchaea. Of ten orc/cdc6 genes in Halobacterium sp. NRC-1, only two were found to be essential, orc10, on the large chromosome, and orc2, on the minichromosome, pNRC200. Of the three replicative-type DNA polymerase genes, two were essential: the chromosomally encoded B family, polB1, and the chromosomally encoded euryarchaeal-specific D family, polD1/D2 (formerly called polA1/polA2 in the Halobacterium sp. NRC-1 genome sequence. The pNRC200-encoded B family polymerase, polB2, was non-essential. Accessory genes for DNA replication initiation and elongation factors, including the putative replicative helicase, mcm, the eukaryotic-type DNA primase, pri1/pri2, the DNA polymerase sliding clamp, pcn, and the flap endonuclease, rad2, were all essential. Targeted genes were classified as non-essential if knockouts were obtained and essential based on statistical analysis and/or by demonstrating the inability to isolate chromosomal knockouts except in the presence of a complementing plasmid copy of the gene. Conclusion The results showed that ten
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Hepatitis B virus DNA polymerase gene polymorphism based ...
African Journals Online (AJOL)
Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...
Satellite DNA-based artificial chromosomes for use in gene therapy.
Hadlaczky, G
2001-04-01
Satellite DNA-based artificial chromosomes (SATACs) can be made by induced de novo chromosome formation in cells of different mammalian species. These artificially generated accessory chromosomes are composed of predictable DNA sequences and they contain defined genetic information. Prototype human SATACs have been successfully constructed in different cell types from 'neutral' endogenous DNA sequences from the short arm of the human chromosome 15. SATACs have already passed a number of hurdles crucial to their further development as gene therapy vectors, including: large-scale purification; transfer of purified artificial chromosomes into different cells and embryos; generation of transgenic animals and germline transmission with purified SATACs; and the tissue-specific expression of a therapeutic gene from an artificial chromosome in the milk of transgenic animals.
Energy Technology Data Exchange (ETDEWEB)
Heilbronn, R.; zur Hausen, H. (Deutsches Krebsforschungszentrum, Heidelberg (West Germany))
1989-09-01
Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of sic HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensable for SV40 DNA amplification. The results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo.
Horizontal gene transfer and nucleotide compositional anomaly in large DNA viruses
Directory of Open Access Journals (Sweden)
Ogata Hiroyuki
2007-12-01
Full Text Available Abstract Background DNA viruses have a wide range of genome sizes (5 kb up to 1.2 Mb, compared to 0.16 Mb to 1.5 Mb for obligate parasitic bacteria that do not correlate with their virulence or the taxonomic distribution of their hosts. The reasons for such large variation are unclear. According to the traditional view of viruses as gifted "gene pickpockets", large viral genome sizes could originate from numerous gene acquisitions from their hosts. We investigated this hypothesis by studying 67 large DNA viruses with genome sizes larger than 150 kb, including the recently characterized giant mimivirus. Given that horizontally transferred DNA often have anomalous nucleotide compositions differing from the rest of the genome, we conducted a detailed analysis of the inter- and intra-genome compositional properties of these viruses. We then interpreted their compositional heterogeneity in terms of possible causes, including strand asymmetry, gene function/expression, and horizontal transfer. Results We first show that the global nucleotide composition and nucleotide word usage of viral genomes are species-specific and distinct from those of their hosts. Next, we identified compositionally anomalous (cA genes in viral genomes, using a method based on Bayesian inference. The proportion of cA genes is highly variable across viruses and does not exhibit a significant correlation with genome size. The vast majority of the cA genes were of unknown function, lacking homologs in the databases. For genes with known homologs, we found a substantial enrichment of cA genes in specific functional classes for some of the viruses. No significant association was found between cA genes and compositional strand asymmetry. A possible exogenous origin for a small fraction of the cA genes could be confirmed by phylogenetic reconstruction. Conclusion At odds with the traditional dogma, our results argue against frequent genetic transfers to large DNA viruses from their
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
DNA barcode detects high genetic structure within neotropical bird species.
Directory of Open Access Journals (Sweden)
Erika Sendra Tavares
Full Text Available BACKGROUND: Towards lower latitudes the number of recognized species is not only higher, but also phylogeographic subdivision within species is more pronounced. Moreover, new genetically isolated populations are often described in recent phylogenies of Neotropical birds suggesting that the number of species in the region is underestimated. Previous COI barcoding of Argentinean bird species showed more complex patterns of regional divergence in the Neotropical than in the North American avifauna. METHODS AND FINDINGS: Here we analyzed 1,431 samples from 561 different species to extend the Neotropical bird barcode survey to lower latitudes, and detected even higher geographic structure within species than reported previously. About 93% (520 of the species were identified correctly from their DNA barcodes. The remaining 41 species were not monophyletic in their COI sequences because they shared barcode sequences with closely related species (N = 21 or contained very divergent clusters suggestive of putative new species embedded within the gene tree (N = 20. Deep intraspecific divergences overlapping with among-species differences were detected in 48 species, often with samples from large geographic areas and several including multiple subspecies. This strong population genetic structure often coincided with breaks between different ecoregions or areas of endemism. CONCLUSIONS: The taxonomic uncertainty associated with the high incidence of non-monophyletic species and discovery of putative species obscures studies of historical patterns of species diversification in the Neotropical region. We showed that COI barcodes are a valuable tool to indicate which taxa would benefit from more extensive taxonomic revisions with multilocus approaches. Moreover, our results support hypotheses that the megadiversity of birds in the region is associated with multiple geographic processes starting well before the Quaternary and extending to more recent
Québécois and Beninese researchers collaborate in the fight ...
International Development Research Centre (IDRC) Digital Library (Canada)
2010-10-12
Oct 12, 2010 ... Québécois and Beninese researchers collaborate in the fight against AIDS ... disabled" — vulnerable groups less able to make the right choices ... Less is more: Improving yields for Sahelian women with tiny dozes of fertilizer.
Yeast DNA-repair gene RAD14 encodes a zinc metalloprotein with affinity for ultraviolet-damaged DNA
International Nuclear Information System (INIS)
Guzder, S.N.; Sung, P.; Prakash, S.; Prakash, L.
1993-01-01
Xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers due to a defect in excision repair of UV light-damaged DNA. Of the seven XP complementation groups, A--G, group A represents a severe and frequent form of the disease. The Saccharomyces cerevisiae RAD14 gene is a homolog of the XP-A correcting (XPAC) gene. Like XP-A cells, rad14-null mutants are defective in the incision step of excision repair of UV-damaged DNA. The authors have purified RAD14 protein to homogeneity from extract of a yeast strain genetically tailored to overexpress RAD14. As determined by atomic emission spectroscopy, RAD14 contains one zinc atom. They also show in vitro that RAD14 binds zinc but does not bind other divalent metal ions. In DNA mobility-shift assays, RAD14 binds specifically to UV-damaged DNA. Removal of cyclobutane pyrimidine dimers from damaged DNA by enzymatic photoreactivation has no effect on binding, strongly suggesting that RAD14 recognizes pyrimidine(6-4)pyrimidone photoproduct sites. These findings indicate that RAD14 functions in damage recognition during excision repair. 37 refs., 4 figs
Pasion, S G; Brown, G W; Brown, L M; Ray, D S
1994-12-01
In trypanosomatids, DNA replication in the nucleus and in the single mitochondrion (or kinetoplast) initiates nearly simultaneously, suggesting that the DNA synthesis (S) phases of the nucleus and the mitochondrion are coordinately regulated. To investigate the basis for the temporal link between nuclear and mitochondrial DNA synthesis phases the expression of the genes encoding DNA ligase I, the 51 and 28 kDa subunits of replication protein A, dihydrofolate reductase and the mitochondrial type II topoisomerase were analyzed during the cell cycle progression of synchronous cultures of Crithidia fasciculata. These DNA replication genes were all expressed periodically, with peak mRNA levels occurring just prior to or at the peak of DNA synthesis in the synchronized cultures. A plasmid clone (pdN-1) in which TOP2, the gene encoding the mitochondrial topoisomerase, was disrupted by the insertion of a NEO drug-resistance cassette was found to express both a truncated TOP2 mRNA and a truncated topoisomerase polypeptide. The truncated mRNA was also expressed periodically coordinate with the expression of the endogenous TOP2 mRNA indicating that cis elements necessary for periodic expression are contained within cloned sequences. The expression of both TOP2 and nuclear DNA replication genes at the G1/S boundary suggests that regulated expression of these genes may play a role in coordinating nuclear and mitochondrial S phases in trypanosomatids.
Molecular genetic and biochemical analyses of a DNA repair gene from Serratia marcescens
International Nuclear Information System (INIS)
Murphy, K.E.
1989-01-01
In Escherichia coli, the SOS response and two 3-methyladenine DNA glycosylases (TagI and TagII) are required for repair of DNA damaged by alkylating agents such as methyl methanesulfonate (MMS). Mutations of the recA gene eliminate the SOS response. TagI and TagII are encoded by the tag and alkA genes, respectively. A gene (rpr) encoding 3-methyladenine DNA glycosylase activity was isolated from the Gram-negative bacterium Serratia marcescens. The gene, localized to a 1.5-kilobase pair SmaI-HindIII restriction fragment, was cloned into plasmid pUC18. The clone complemented E. coli tag alkA and recA mutations for MMS resistance. The rpr gene did not, however, complement recA mutations for resistance to ultraviolet light or the ability to perform homologous recombination reactions, nor did it complement E. coli ada or alkB mutations. Two proteins of molecular weights 42,000 and 16,000 were produced from the rpr locus. Analysis of deletion and insertion mutants of rpr suggested that the 42kD molecule is the active protein. The 16kD protein may either be a breakdown product of the 42kD species or may be encoded by another gene overlapping the reading frame of the rpr gene. Biochemical assays showed that the rpr gene product (Rpr) possesses 3-methyladenine DNA glycosylase activity
DNA BARCODING IKAN HIAS INTRODUKSI
Directory of Open Access Journals (Sweden)
Melta Rini Fahmi
2017-05-01
ilmu pengetahuan. Species identification becomes a new challenge in the management of ornamental fish either for cultivation, or for conservation proposes. The objective of this study was to identify currently existing introduced ornamental fish in Indonesian farmers and markets using DNA barcodes COI gene. Fish samples were collected from farmers and importers of ornamental fish in Bandung and Jakarta. Total genome was extracted from caudal fin tissue using the column method. Amplification of the target gene was done by using FishF1, FishF2, FishR1, and FishR2 primers. DNA sequence was aligned with the sequences from genbank by BLAST program. Species identification was decided through the phylogenetic tree and similarity index with genbank sequences. The results showed that all of tested samples fall into five groups; Synodontis consisted of five species, Corydoras four species, Phseudoplatystoma four species, Botia three species, and Leporinus three species with 99-100 boostrap value. Sequence similarity index showed around 11 species have 99%-100% similarity index with sequence data on genbank which are Synodontis decorus, Synodontis eupterus, Synodontis greshoffi, Botia kubotai, Botia lohachata, Rasbora erythromicron, Corydoras aeneus, Gyrinocheilus aymonieri, Eigenmannia virescens, Leporinus affinis, Phractocephalus hemioliopterus. Two species were identified as hybridization product (interbreeding including leopard catfish (100% identical with Pseudoplatystoma faciatum and the leopard Synodontis (100% identical with Synodontis notatus. Analysis of nucleotide diagnostic showed Synodontis decora has seven nucleotides diagnostic, Synodontis tanganyicae 10 nucleotides, Synodontis euterus 13 nucleotides, Synodontis notatus four nucleotides, and Synodontis grashoffi 14 nucleotides. The correct identification of fish species is a useful tool for aquaculture, global marketing, management or conservation, and academic/scientific purpose.
Directory of Open Access Journals (Sweden)
Ji Hye Park
2018-01-01
Full Text Available Estimation of postmortem interval (PMI is paramount in modern forensic investigation. After the disappearance of the early postmortem phenomena conventionally used to estimate PMI, entomologic evidence provides important indicators for PMI estimation. The age of the oldest fly larvae or pupae can be estimated to pinpoint the time of oviposition, which is considered the minimum PMI (PMImin. The development rate of insects is usually temperature dependent and species specific. Therefore, species identification is mandatory for PMImin estimation using entomological evidence. The classical morphological identification method cannot be applied when specimens are damaged or have not yet matured. To overcome this limitation, some investigators employ molecular identification using mitochondrial cytochrome c oxidase subunit I (COI nucleotide sequences. The molecular identification method commonly uses Sanger’s nucleotide sequencing and molecular phylogeny, which are complex and time consuming and constitute another obstacle for forensic investigators. In this study, instead of using conventional Sanger’s nucleotide sequencing, single-nucleotide polymorphisms (SNPs in the COI gene region, which are unique between fly species, were selected and targeted for single-base extension (SBE technology. These SNPs were genotyped using a SNaPshot® kit. Eleven Calliphoridae and seven Sarcophagidae species were covered. To validate this genotyping, fly DNA samples (103 adults, 84 larvae, and 4 pupae previously confirmed by DNA barcoding were used. This method worked quickly with minimal DNA, providing a potential alternative to conventional DNA barcoding. Consisting of only a few simple electropherogram peaks, the results were more straightforward compared with those of the conventional DNA barcoding produced by Sanger’s nucleotide sequencing.
Modulation of DNA binding by gene-specific transcription factors.
Schleif, Robert F
2013-10-01
The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.
Expression of DNA repair genes in ovarian cancer samples: biological and clinical considerations.
Ganzinelli, M; Mariani, P; Cattaneo, D; Fossati, R; Fruscio, R; Corso, S; Ricci, F; Broggini, M; Damia, G
2011-05-01
The purpose of this study was to investigate retrospectively the mRNA expression of genes involved in different DNA repair pathways implicated in processing platinum-induced damage in 171 chemotherapy-naïve ovarian tumours and correlate the expression of the different genes with clinical parameters. The expression of genes involved in DNA repair pathways (PARP1, ERCC1, XPA, XPF, XPG, BRCA1, FANCA, FANCC, FANCD2, FANCF and PolEta), and in DNA damage transduction (Chk1 and Claspin) was measured by RT-PCR in 13 stage I borderline and 77 stage I and 88 III ovarian carcinomas. ERCC1, XPA, XPF and XPG genes were significantly less expressed in stage III than in stage I carcinoma; BRCA1, FANCA, FANCC, FANCD2 gene expressions were low in borderline tumours, higher in stage I carcinomas and lower in stage III samples. High levels of ERCC1, XPA, FANCC, XPG and PolEta correlated with an increase in Overall Survival (OS) and Progression Free Survival (PFS), whilst high BRCA1 levels were associated with PFS on univariate analysis. With multivariate analyses no genes retained an association when adjusted by stage, grade and residual tumour. A tendency towards a better PFS was observed in patients with the highest level of ERCC1 and BRCA1 after platinum-based therapy than those given both platinum and taxol. The expression of DNA repair genes differed in borderline stage I, stage I and stage III ovarian carcinomas. The role of DNA repair genes in predicting the response in ovarian cancer patients seems far from being established. Copyright © 2010 Elsevier Ltd. All rights reserved.
Tay, Wee Tek; Walsh, Thomas K.; Kanyesigye, Dalton; Adumo, Stella; Abongosi, Joseph; Ochen, Stephen; Sserumaga, Julius; Alibu, Simon; Abalo, Grace; Asea, Godfrey; Agona, Ambrose
2018-01-01
The fall armyworm (FAW) Spodoptera frugiperda (J. E. Smith) is a species native to the Americas. This polyphagous lepidopteran pest was first reported in Nigeria and the Democratic Republic of São Tomé and Principe in 2016, but its presence in eastern Africa has not been confirmed via molecular characterisation. In this study, FAW specimens from western and central Uganda were identified based on the partial mtDNA COI gene sequences, with mtDNA COI haplotypes matching those identified in Nigeria and São Tomé. In this study, we sequence an additional partial mtDNA Cyt b gene and also the partial mtDNA COIII gene in Ugandan FAW samples. We detected identical mitochondrial DNA haplotypes for both the mtDNA Cyt b and COI partial genes, while combining the mtDNA COI/Cyt b haplotypes and mtDNA COIII haplotypes enabled a new maternal lineage in the Ugandan corn-preferred FAW samples to be identified. Our results suggested that the African incursions of S. frugiperda involved at least three maternal lineages. Recent full genome, phylogenetic and microsatellite analyses provided evidence to support S. frugiperda as likely consisted of two sympatric sister species known as the corn-preferred and rice-preferred strains. In our Ugandan FAW populations, we identified the presence of mtDNA haplotypes representative of both sister species. It is not known if both FAW sister species were originally introduced together or separately, and whether they have since spread as a single population. Further analyses of additional specimens originally collected from São Tomé, Nigeria and throughout Africa would be required to clarify this issue. Importantly, our finding showed that the genetic diversity of the African corn-preferred FAW species is higher than previously reported. This potentially contributed to the success of FAW establishment in Africa. Furthermore, with the additional maternal lineages detected, there is likely an increase in paternal lineages, thereby increasing
Radhika, R; Bijoy Nandan, S; Harikrishnan, M
2017-11-01
Morphological identification of the marine cyclopoid copepod Dioithona rigida in combination with sequencing a 645 bp fragment of mitochondrial cytochrome oxidase c subunit I (mtCOI) gene, collected from offshore waters of Kavarathi Island, Lakshadweep Sea, is presented in this study. Kiefer in 1935 classified Dioithona as a separate genus from Oithona. The main distinguishing characters observed in the collected samples, such as the presence of well-developed P5 with 2 setae, 5 segmented urosome, 12 segmented antennule, compact dagger-like setae on the inner margin of proximal segment of exopod ramus in P1-P4 and engorged portion of P1-bearing a spine, confirmed their morphology to D. rigida. A comparison of setal formulae of the exopod and endopod of D. rigida with those recorded previously by various authors are also presented here. Maximum likelihood Tree analysis exhibited the clustering of D. rigida sequences into a single clade (accession numbers KP972540.1-KR528588.1), which in contrast was 37-42% divergent from other Oithona species. Further intra-specific divergence values of 0-2% also confirmed the genetic identity of D. rigida species. Paracyclopina nana was selected as an out group displayed a diverged array. The present results distinctly differentiated D. rigida from other Oithona species.
Zhou, X.; Robinson, J.L.; Geraci, C.J.; Parker, C.R.; Flint, O.S.; Etnier, D.A.; Ruiter, D.; DeWalt, R.E.; Jacobus, L.M.; Hebert, P.D.N.
2011-01-01
Deoxyribonucleic acid (DNA) barcoding is an effective tool for species identification and lifestage association in a wide range of animal taxa. We developed a strategy for rapid construction of a regional DNA-barcode reference library and used the caddisflies (Trichoptera) of the Great Smoky Mountains National Park (GSMNP) as a model. Nearly 1000 cytochrome c oxidase subunit I (COI) sequences, representing 209 caddisfly species previously recorded from GSMNP, were obtained from the global Trichoptera Barcode of Life campaign. Most of these sequences were collected from outside the GSMNP area. Another 645 COI sequences, representing 80 species, were obtained from specimens collected in a 3-d bioblitz (short-term, intense sampling program) in GSMNP. The joint collections provided barcode coverage for 212 species, 91% of the GSMNP fauna. Inclusion of samples from other localities greatly expedited construction of the regional DNA-barcode reference library. This strategy increased intraspecific divergence and decreased average distances to nearest neighboring species, but the DNA-barcode library was able to differentiate 93% of the GSMNP Trichoptera species examined. Global barcoding projects will aid construction of regional DNA-barcode libraries, but local surveys make crucial contributions to progress by contributing rare or endemic species and full-length barcodes generated from high-quality DNA. DNA taxonomy is not a goal of our present work, but the investigation of COI divergence patterns in caddisflies is providing new insights into broader biodiversity patterns in this group and has directed attention to various issues, ranging from the need to re-evaluate species taxonomy with integrated morphological and molecular evidence to the necessity of an appropriate interpretation of barcode analyses and its implications in understanding species diversity (in contrast to a simple claim for barcoding failure).
Directory of Open Access Journals (Sweden)
Maya Kaul
2018-03-01
Full Text Available One of the greatest ways to transform education systems is to develop community-centered professional supports for in-service teachers. Given the rise of distance learning platforms such as massive open online courses (MOOCs, there is a growing potential to deliver such supports at scale. The community of inquiry (CoI framework models the asynchronous, text-based communication that defines educational experiences within such collaborative learning environments; however, methods of CoI transcript analysis must be improved. This paper uses the University of Helsinki’s 2016 MOOC, Sustainable Energy in Education, as a case study on how the CoI framework can be used to characterize the educational experience of in-service teachers in distance learning environments. Using the CoI coding protocol, this paper employs a transcript analysis of the discussion forum posts on the MOOC (n = 78, and applies improved measures of reliability in order to understand the capacity of CoI transcript analysis to reliably define online learning experiences. The findings suggest that, while the CoI framework is able to characterize some elements of online learning communities, more work needs to be done to ensure the framework captures the more nuanced elements of such educational experiences, such as the effects of course design and the relative engagement of course participants.
DEFF Research Database (Denmark)
Lassen, S. B.; Nielsen, S. Achim; Skovgård, H.
2012-01-01
complexes are hard to distinguish. We evaluated the use of the mitochondrial DNA cytochrome oxidase I gene (COI) barcode region in the identification of species within the subgenus Culicoides. COI barcode sequence divergence within species was ... impunctatus, and Culicoides grisescens. Additionally, this study confirms the existence of Culicoides halophilus as a valid taxon and presents the first Culicoides deltus barcode sequences. Three additional groups of specimens were identified: Culicoides dk1 with a COI barcode diverging by 14.3% to 17.2% from...... other subgenus Culicoides species and Culicoides Kalix and Culicoides dk3, which diverged by 5.9% from each other and showed 12.5% to 17.6% divergence in COI barcode to subgenus Culicoides specimens....
Ohmine, Yuta; Satoh, Yukari; Kiyokawa, Kazuya; Yamamoto, Shinji; Moriguchi, Kazuki; Suzuki, Katsunori
2016-04-02
Plant pathogenic Agrobacterium strains can transfer T-DNA regions of their Ti plasmids to a broad range of eukaryotic hosts, including fungi, in vitro. In the recent decade, the yeast Saccharomyces cerevisiae is used as a model host to reveal important host proteins for the Agrobacterium-mediated transformation (AMT). Further investigation is required to understand the fundamental mechanism of AMT, including interaction at the cell surface, to expand the host range, and to develop new tools. In this study, we screened a yeast mutant library for low AMT mutant strains by advantage of a chromosome type T-DNA, which transfer is efficient and independent on integration into host chromosome. By the mutant screening, we identified four mutant strains (srs2Δ, rad52Δ, smi1Δ and erg28Δ), which showed considerably low AMT efficiency. Structural analysis of T-DNA product replicons in AMT colonies of mutants lacking each of the two DNA repair genes, SRS2 and RAD52, suggested that the genes act soon after T-DNA entry for modification of the chromosomal T-DNA to stably maintain them as linear replicons and to circularize certain T-DNA simultaneously. The cell wall synthesis regulator SMI1 might have a role in the cell surface interaction between the donor and recipient cells, but the smi1Δ mutant exhibited pleiotropic effect, i.e. low effector protein transport as well as low AMT for the chromosomal T-DNA, but relatively high AMT for integrative T-DNAs. The ergosterol synthesis regulator/enzyme-scaffold gene ERG28 probably contributes by sensing a congested environment, because growth of erg28Δ strain was unaffected by the presence of donor bacterial cells, while the growth of the wild-type and other mutant yeast strains was suppressed by their presence. RAD52 and the DNA helicase/anti-recombinase gene SRS2 are necessary to form and maintain artificial chromosomes through the AMT of chromosomal T-DNA. A sterol synthesis scaffold gene ERG28 is important in the high
Distinct co-evolution patterns of genes associated to DNA polymerase III DnaE and PolC
Directory of Open Access Journals (Sweden)
Engelen Stefan
2012-02-01
Full Text Available Abstract Background Bacterial genomes displaying a strong bias between the leading and the lagging strand of DNA replication encode two DNA polymerases III, DnaE and PolC, rather than a single one. Replication is a highly unsymmetrical process, and the presence of two polymerases is therefore not unexpected. Using comparative genomics, we explored whether other processes have evolved in parallel with each polymerase. Results Extending previous in silico heuristics for the analysis of gene co-evolution, we analyzed the function of genes clustering with dnaE and polC. Clusters were highly informative. DnaE co-evolves with the ribosome, the transcription machinery, the core of intermediary metabolism enzymes. It is also connected to the energy-saving enzyme necessary for RNA degradation, polynucleotide phosphorylase. Most of the proteins of this co-evolving set belong to the persistent set in bacterial proteomes, that is fairly ubiquitously distributed. In contrast, PolC co-evolves with RNA degradation enzymes that are present only in the A+T-rich Firmicutes clade, suggesting at least two origins for the degradosome. Conclusion DNA replication involves two machineries, DnaE and PolC. DnaE co-evolves with the core functions of bacterial life. In contrast PolC co-evolves with a set of RNA degradation enzymes that does not derive from the degradosome identified in gamma-Proteobacteria. This suggests that at least two independent RNA degradation pathways existed in the progenote community at the end of the RNA genome world.
pH-Dependent DNA Distortion and Repression of Gene Expression by Pectobacterium atrosepticum PecS.
Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne
2016-07-15
Transcriptional activity is exquisitely sensitive to changes in promoter DNA topology. Transcription factors may therefore control gene activity by modulating the relative positioning of -10 and -35 promoter elements. The plant pathogen Pectobacterium atrosepticum, which causes soft rot in potatoes, must alter gene expression patterns to ensure growth in planta. In the related soft-rot enterobacterium Dickeya dadantii, PecS functions as a master regulator of virulence gene expression. Here, we report that P. atrosepticum PecS controls gene activity by altering promoter DNA topology in response to pH. While PecS binds the pecS promoter with high affinity regardless of pH, it induces significant DNA distortion only at neutral pH, the pH at which the pecS promoter is repressed in vivo. At pH ∼8, DNA distortions are attenuated, and PecS no longer represses the pecS promoter. A specific histidine (H142) located in a crevice between the dimerization- and DNA-binding regions is required for pH-dependent changes in DNA distortion and repression of gene activity, and mutation of this histidine renders the mutant protein incapable of repressing the pecS promoter. We propose that protonated PecS induces a DNA conformation at neutral pH in which -10 and -35 promoter elements are suboptimally positioned for RNA polymerase binding; on deprotonation of PecS, binding is no longer associated with significant changes in DNA conformation, allowing gene expression. We suggest that this mode of gene regulation leads to differential expression of the PecS regulon in response to alkalinization of the plant apoplast.
Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes
International Nuclear Information System (INIS)
Zhang, H.; Wang, J.C.; Liu, L.F.
1988-01-01
Treatment of HeLa cells with a DNA topoisomerase I-specific inhibitor, camptothecin, results in rapid cessation of the synthesis of the 45S rRNA precursor. The inhibition of rRNA synthesis is reversible following drug removal and correlates with the presence of camptothecin-trapped topoisomerase I-DNA abortive complexes, which can be detected as topoisomerase I-linked DNA breaks upon lysis with sodium dodecyl sulfate. These breaks were found to be concentrated within the transcribed region of human rRNA genes. No such sites can be detected in the inactive human rRNA genes in mouse-human hybrid cells, suggesting a preferential association of topoisomerase I with actively transcribed genes. The distribution of RNA polymerase molecules along the transcription unit of human rRNA genes in camptothecin-treated HeLa cells, as assayed by nuclear run-on transcription, shows a graded decrease of the RNA polymerase density toward the 3' end of the transcription unit; the density is minimally affected near the 5' start of the transcription unit. These results suggest that DNA topoisomerase I is normally involved in the elongation step of transcription, especially when the transcripts are long, and that camptothecin interferes with this role
Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H.; Cai, Wanzhi
2015-01-01
Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populatio...
Radioactive cDNA microarrys for gene expression profiles in antidepressant therapy
International Nuclear Information System (INIS)
Lee, M. S.; Han, B. J.; Cha, J. H.; Ryu, Y. M.; Shin, E. K.; Park, J. H.; Park, Y. H.; Kim, M. K.
2002-01-01
Using radioactive cDNA microarray, we investigated a pattern of gene regulation under treatment of antidepressant on patients of depressive disoder. Basic microarray technology was performed as previously described in our research. The bioinformatic selection of human cDNAs, which is specifically designed for psychiatry, neurology, and signal transduction, were arrayed on nylon membranes. Using with 33P-labeled probes, this method provided highly sensitive gene expression profiles of our interest including brain receptors, drug metabolism, and cellular signalings. Gene expression profiles were also classified into several categories in accordance with the gene-regulation of antidepressant. The gene profiles of our interest were significantly up- (16 genes, >2.0 of Z-ratio) or down- (24 genes, <-2.0 of Z ratio) regulated when compared the good responsed group with the bad-responsed one. Consequently, we demonstrated that radioactive human cDNA microarray is highly likely to be an efficient technology for evaluating the gene regulation of antidepressants, such as selective serotonin-reuptake inhibitors (SSRIs), by using high-throughput biotechnology
Brown, William M
2015-12-01
Epigenetics is the study of processes--beyond DNA sequence alteration--producing heritable characteristics. For example, DNA methylation modifies gene expression without altering the nucleotide sequence. A well-studied DNA methylation-based phenomenon is genomic imprinting (ie, genotype-independent parent-of-origin effects). We aimed to elucidate: (1) the effect of exercise on DNA methylation and (2) the role of imprinted genes in skeletal muscle gene networks (ie, gene group functional profiling analyses). Gene ontology (ie, gene product elucidation)/meta-analysis. 26 skeletal muscle and 86 imprinted genes were subjected to g:Profiler ontology analysis. Meta-analysis assessed exercise-associated DNA methylation change. g:Profiler found four muscle gene networks with imprinted loci. Meta-analysis identified 16 articles (387 genes/1580 individuals) associated with exercise. Age, method, sample size, sex and tissue variation could elevate effect size bias. Only skeletal muscle gene networks including imprinted genes were reported. Exercise-associated effect sizes were calculated by gene. Age, method, sample size, sex and tissue variation were moderators. Six imprinted loci (RB1, MEG3, UBE3A, PLAGL1, SGCE, INS) were important for muscle gene networks, while meta-analysis uncovered five exercise-associated imprinted loci (KCNQ1, MEG3, GRB10, L3MBTL1, PLAGL1). DNA methylation decreased with exercise (60% of loci). Exercise-associated DNA methylation change was stronger among older people (ie, age accounted for 30% of the variation). Among older people, genes exhibiting DNA methylation decreases were part of a microRNA-regulated gene network functioning to suppress cancer. Imprinted genes were identified in skeletal muscle gene networks and exercise-associated DNA methylation change. Exercise-associated DNA methylation modification could rewind the 'epigenetic clock' as we age. CRD42014009800. Published by the BMJ Publishing Group Limited. For permission to use (where
Role of methionine on epigenetic modification of DNA methylation and gene expression in animals
Directory of Open Access Journals (Sweden)
Naifeng Zhang
2018-03-01
Full Text Available DNA methylation is one of the main epigenetic phenomena affecting gene expression. It is an important mechanism for the development of embryo, growth and health of animals. As a key nutritional factor limiting the synthesis of protein, methionine serves as the precursor of S-adenosylmethionine (SAM in the hepatic one-carbon metabolism. The dietary fluctuation of methionine content can alter the levels of metabolic substrates in one-carbon metabolism, e.g., the SAM, S-adenosylhomocysteine (SAH, and change the expression of genes related to the growth and health of animals by DNA methylation reactions. The ratio of SAM to SAH is called ‘methylation index’ but it should be carefully explained because the complexity of methylation reaction. Alterations of methylation in a specific cytosine-guanine (CpG site, rather than the whole promoter region, might be enough to change gene expression. Aberrant methionine cycle may provoke molecular changes of one-carbon metabolism that results in deregulation of cellular hemostasis and health problems. The importance of DNA methylation has been underscored but the mechanisms of methionine affecting DNA methylation are poorly understood. Nutritional epigenomics provides a promising insight into the targeting epigenetic changes in animals from a nutritional standpoint, which will deepen and expand our understanding of genes, molecules, tissues, and animals in which methionine alteration influences DNA methylation and gene expression. Keywords: Epigenetics, Methionine, DNA methylation, Gene expression, Epigenetic modification
Insight into the Migration Routes of Plutella xylostella in China Using mtCOI and ISSR Markers.
Directory of Open Access Journals (Sweden)
Jiaqiang Yang
Full Text Available The larvae of the diamondback moth, Plutella xylostella, cause major economic losses to cruciferous crops, including cabbage, which is an important vegetable crop in China. In this study, we used the mitochondrial COI gene and 11 ISSR markers to characterize the genetic structure and seasonal migration routes of 23 P. xylostella populations in China. Both the mitochondrial and nuclear markers revealed high haplotype diversity and gene flow among the populations, although some degree of genetic isolation was evident between the populations of Hainan Island and other sampling sites. The dominant haplotypes, LX1 and LX2, differed significantly from all other haplotypes both in terms of the number of individuals with those haplotypes and their distributions. Haplotypes that were shared among populations revealed that P. xylostella migrates from the lower reaches of the Yangtze River to northern China and then to northeastern China. Our results also revealed another potential migration route for P. xylostella, i.e., from southwestern China to both northwestern and southern China.
Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma
Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.
2012-01-01
Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009
Neuronal DNA Methyltransferases: Epigenetic Mediators between Synaptic Activity and Gene Expression?
Bayraktar, Gonca; Kreutz, Michael R
2018-04-01
DNMT3A and 3B are the main de novo DNA methyltransferases (DNMTs) in the brain that introduce new methylation marks to non-methylated DNA in postmitotic neurons. DNA methylation is a key epigenetic mark that is known to regulate important cellular processes in neuronal development and brain plasticity. Accumulating evidence disclosed rapid and dynamic changes in DNA methylation of plasticity-relevant genes that are important for learning and memory formation. To understand how DNMTs contribute to brain function and how they are regulated by neuronal activity is a prerequisite for a deeper appreciation of activity-dependent gene expression in health and disease. This review discusses the functional role of de novo methyltransferases and in particular DNMT3A1 in the adult brain with special emphasis on synaptic plasticity, memory formation, and brain disorders.
Kononov, Alexander; Ustyantsev, Kirill; Wang, Baode; Mastro, Victor C; Fet, Victor; Blinov, Alexander; Baranchikov, Yuri
2016-12-22
Moths of genus Dendrolimus (Lepidoptera: Lasiocampidae) are among the major pests of coniferous forests worldwide. Taxonomy and nomenclature of this genus are not entirely established, and there are many species with a controversial taxonomic position. We present a comparative evolutionary analysis of the most economically important Dendrolimus species in Eurasia. Our analysis was based on the nucleotide sequences of COI and COII mitochondrial genes and ITS2 spacer of nuclear ribosomal genes. All known sequences were extracted from GenBank. Additional 112 new sequences were identified for 28 specimens of D. sibiricus, D. pini, and D. superans from five regions of Siberia and the Russian Far East to be able to compare the disparate data from all previous studies. In total, 528 sequences were used in phylogenetic analysis. Two clusters of closely related species in Dendrolimus were found. The first cluster includes D. pini, D. sibiricus, and D. superans; and the second, D. spectabilis, D. punctatus, and D. tabulaeformis. Species D. houi and D. kikuchii appear to be the most basal in the genus. Genetic difference among the second cluster species is very low in contrast to the first cluster species. Phylogenetic position D. tabulaeformis as a subspecies was supported. It was found that D. sibiricus recently separated from D. superans. Integration of D. sibiricus mitochondrial DNA sequences and the spread of this species to the west of Eurasia have been established as the cause of the unjustified allocation of a new species: D. kilmez. Our study further clarifies taxonomic problems in the genus and gives more complete information on the genetic structure of D. pini, D. sibiricus, and D. superans.
Polymorphisms of Selected DNA Repair Genes and Lung Cancer in Chromium Exposure.
Halasova, E; Matakova, T; Skerenova, M; Krutakova, M; Slovakova, P; Dzian, A; Javorkova, S; Pec, M; Kypusova, K; Hamzik, J
2016-01-01
Chromium is a well-known mutagen and carcinogen involved in lung cancer development. DNA repair genes play an important role in the elimination of genetic changes caused by chromium exposure. In the present study, we investigated the polymorphisms of the following DNA repair genes: XRCC3, participating in the homologous recombination repair, and hMLH1 and hMSH2, functioning in the mismatch repair. We focused on the risk the polymorphisms present in the development of lung cancer regarding the exposure to chromium. We analyzed 106 individuals; 45 patients exposed to chromium with diagnosed lung cancer and 61 healthy controls. Genotypes were determined by a PCR-RFLP method. We unravelled a potential for increased risk of lung cancer development in the hMLH1 (rs1800734) AA genotype in the recessive model. In conclusion, gene polymorphisms in the DNA repair genes underscores the risk of lung cancer development in chromium exposed individuals.
[DNA barcoding and its utility in commonly-used medicinal snakes].
Huang, Yong; Zhang, Yue-yun; Zhao, Cheng-jian; Xu, Yong-li; Gu, Ying-le; Huang, Wen-qi; Lin, Kui; Li, Li
2015-03-01
Identification accuracy of traditional Chinese medicine is crucial for the traditional Chinese medicine research, production and application. DNA barcoding based on the mitochondrial gene coding for cytochrome c oxidase subunit I (COI), are more and more used for identification of traditional Chinese medicine. Using universal barcoding primers to sequence, we discussed the feasibility of DNA barcoding method for identification commonly-used medicinal snakes (a total of 109 samples belonging to 19 species 15 genera 6 families). The phylogenetic trees using Neighbor-joining were constructed. The results indicated that the mean content of G + C(46.5%) was lower than that of A + T (53.5%). As calculated by Kimera-2-parameter model, the mean intraspecies genetic distance of Trimeresurus albolabris, Ptyas dhumnades and Lycodon rufozonatus was greater than 2%. Further phylogenetic relationship results suggested that identification of one sample of T. albolabris was erroneous. The identification of some samples of P. dhumnades was also not correct, namely originally P. korros was identified as P. dhumnades. Factors influence on intraspecific genetic distance difference of L. rufozonatus need to be studied further. Therefore, DNA barcoding for identification of medicinal snakes is feasible, and greatly complements the morphological classification method. It is necessary to further study in identification of traditional Chinese medicine.
DNA tagging of blast resistant gene(s in three Brazilian rice cultivars
Directory of Open Access Journals (Sweden)
S.S. Sandhu
2003-12-01
Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.
Schwartzman, Jacob; Mongoue-Tchokote, Solange; Gibbs, Angela; Gao, Lina; Corless, Christopher L; Jin, Jennifer; Zarour, Luai; Higano, Celestia; True, Lawrence D; Vessella, Robert L; Wilmot, Beth; Bottomly, Daniel; McWeeney, Shannon K; Bova, G Steven; Partin, Alan W; Mori, Motomi; Alumkal, Joshi
2011-10-01
DNA methylation of promoter regions is a common event in prostate cancer, one of the most common cancers in men worldwide. Because prior reports demonstrating that DNA methylation is important in prostate cancer studied a limited number of genes, we systematically quantified the DNA methylation status of 1505 CpG dinucleotides for 807 genes in 78 paraffin-embedded prostate cancer samples and three normal prostate samples. The ERG gene, commonly repressed in prostate cells in the absence of an oncogenic fusion to the TMPRSS2 gene, was one of the most commonly methylated genes, occurring in 74% of prostate cancer specimens. In an independent group of patient samples, we confirmed that ERG DNA methylation was common, occurring in 57% of specimens, and cancer-specific. The ERG promoter is marked by repressive chromatin marks mediated by polycomb proteins in both normal prostate cells and prostate cancer cells, which may explain ERG's predisposition to DNA methylation and the fact that tumors with ERG DNA methylation were more methylated, in general. These results demonstrate that bead arrays offer a high-throughput method to discover novel genes with promoter DNA methylation such as ERG, whose measurement may improve our ability to more accurately detect prostate cancer.
DNA demethylation activates genes in seed maternal integument development in rice (Oryza sativa L.).
Wang, Yifeng; Lin, Haiyan; Tong, Xiaohong; Hou, Yuxuan; Chang, Yuxiao; Zhang, Jian
2017-11-01
DNA methylation is an important epigenetic modification that regulates various plant developmental processes. Rice seed integument determines the seed size. However, the role of DNA methylation in its development remains largely unknown. Here, we report the first dynamic DNA methylomic profiling of rice maternal integument before and after pollination by using a whole-genome bisulfite deep sequencing approach. Analysis of DNA methylation patterns identified 4238 differentially methylated regions underpin 4112 differentially methylated genes, including GW2, DEP1, RGB1 and numerous other regulators participated in maternal integument development. Bisulfite sanger sequencing and qRT-PCR of six differentially methylated genes revealed extensive occurrence of DNA hypomethylation triggered by double fertilization at IAP compared with IBP, suggesting that DNA demethylation might be a key mechanism to activate numerous maternal controlling genes. These results presented here not only greatly expanded the rice methylome dataset, but also shed novel insight into the regulatory roles of DNA methylation in rice seed maternal integument development. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
International Nuclear Information System (INIS)
Debenham, P.G.; Webb, M.B.T.; Masson, W.K.; Cox, R.
1984-01-01
An investigation was made of the feasibility of DNA-mediated gene transfer into human diploid fibroblasts derived from patients with the radiation sensitive syndrome ataxia-telangiectasia (A-T) and from a normal donor. Although they are markedly different in their growth characteristics, both normal and A-T strains give similar frequencies for DNA transfer in a model system using the recombinant plasmid pSV2-gpt. pSV2-gpt DNA transformants arise with a frequency between 10 -5 and 10 -4 per viable cell. Analysis of such transformants, although possible, is severely handicapped by the limited clonal life span of diploid human cells. Despite these problems it may be concluded that diploid human fibroblasts are competent recipients for DNA-mediated gene transfer and the putative repair deficiency of A-T does not markedly effect the efficiency of this process. (author)
DNA methylation in inflammatory genes among children with obstructive sleep apnea.
Kim, Jinkwan; Bhattacharjee, Rakesh; Khalyfa, Abdelnaby; Kheirandish-Gozal, Leila; Capdevila, Oscar Sans; Wang, Yang; Gozal, David
2012-02-01
Pediatric obstructive sleep apnea (OSA) leads to multiple end-organ morbidities that are mediated by the cumulative burden of oxidative stress and inflammation. Because not all children with OSA exhibit increased systemic inflammation, genetic and environmental factors may be affecting patterns of DNA methylation in genes subserving inflammatory functions. DNA from matched children with OSA with and without high levels of high-sensitivity C-reactive protein (hsCRP) were assessed for DNA methylation levels of 24 inflammatory-related genes. Primer-based polymerase chain reaction assays in a case-control setting involving 47 OSA cases and 31 control subjects were conducted to confirm the findings; hsCRP and myeloid-related protein (MRP) 8/14 levels were also assayed. Forkhead box P3 (FOXP3) and interferon regulatory factor 1 (IRF1) showed higher methylation in six children with OSA and high hsCRP levels compared with matched children with OSA and low hsCRP levels (P DNA methylation levels compared with children with OSA and low CRP levels and control subjects. IRF1 did not exhibit significant differences. FOXP3 DNA methylation levels correlated with hsCRP and MRP 8/14 levels and with apnea-hypopnea index (AHI), BMI z score, and apolipoprotein B levels. A stepwise multiple regression model showed that AHI was independently associated with FOXP3 DNA methylation levels (P gene, which regulates expression of T regulatory lymphocytes, is more likely to display increased methylation among children with OSA who exhibit increased systemic inflammatory responses. Thus, epigenetic modifications may constitute an important determinant of inflammatory phenotype in OSA, and FOXP3 DNA methylation levels may provide a potential biomarker for end-organ vulnerability.
A data mining approach for classifying DNA repair genes into ageing-related or non-ageing-related
Directory of Open Access Journals (Sweden)
Vasieva Olga
2011-01-01
Full Text Available Abstract Background The ageing of the worldwide population means there is a growing need for research on the biology of ageing. DNA damage is likely a key contributor to the ageing process and elucidating the role of different DNA repair systems in ageing is of great interest. In this paper we propose a data mining approach, based on classification methods (decision trees and Naive Bayes, for analysing data about human DNA repair genes. The goal is to build classification models that allow us to discriminate between ageing-related and non-ageing-related DNA repair genes, in order to better understand their different properties. Results The main patterns discovered by the classification methods are as follows: (a the number of protein-protein interactions was a predictor of DNA repair proteins being ageing-related; (b the use of predictor attributes based on protein-protein interactions considerably increased predictive accuracy of attributes based on Gene Ontology (GO annotations; (c GO terms related to "response to stimulus" seem reasonably good predictors of ageing-relatedness for DNA repair genes; (d interaction with the XRCC5 (Ku80 protein is a strong predictor of ageing-relatedness for DNA repair genes; and (e DNA repair genes with a high expression in T lymphocytes are more likely to be ageing-related. Conclusions The above patterns are broadly integrated in an analysis discussing relations between Ku, the non-homologous end joining DNA repair pathway, ageing and lymphocyte development. These patterns and their analysis support non-homologous end joining double strand break repair as central to the ageing-relatedness of DNA repair genes. Our work also showcases the use of protein interaction partners to improve accuracy in data mining methods and our approach could be applied to other ageing-related pathways.
Feng, Sheng Jun; Liu, Xue Song; Tao, Hua; Tan, Shang Kun; Chu, Shan Shan; Oono, Youko; Zhang, Xian Duo; Chen, Jian; Yang, Zhi Min
2016-12-01
We report genome-wide single-base resolution maps of methylated cytosines and transcriptome change in Cd-exposed rice. Widespread differences were identified in CG and non-CG methylation marks between Cd-exposed and Cd-free rice genomes. There are 2320 non-redundant differentially methylated regions detected in the genome. RNA sequencing revealed 2092 DNA methylation-modified genes differentially expressed under Cd exposure. More genes were found hypermethylated than those hypomethylated in CG, CHH and CHG (where H is A, C or T) contexts in upstream, gene body and downstream regions. Many of the genes were involved in stress response, metal transport and transcription factors. Most of the DNA methylation-modified genes were transcriptionally altered under Cd stress. A subset of loss of function mutants defective in DNA methylation and histone modification activities was used to identify transcript abundance of selected genes. Compared with wide type, mutation of MET1 and DRM2 resulted in general lower transcript levels of the genes under Cd stress. Transcripts of OsIRO2, OsPR1b and Os09g02214 in drm2 were significantly reduced. A commonly used DNA methylation inhibitor 5-azacytidine was employed to investigate whether DNA demethylation affected physiological consequences. 5-azacytidine provision decreased general DNA methylation levels of selected genes, but promoted growth of rice seedlings and Cd accumulation in rice plant. © 2016 John Wiley & Sons Ltd.
Alteration of gene expression and DNA methylation in drug-resistant gastric cancer.
Maeda, Osamu; Ando, Takafumi; Ohmiya, Naoki; Ishiguro, Kazuhiro; Watanabe, Osamu; Miyahara, Ryoji; Hibi, Yoko; Nagai, Taku; Yamada, Kiyofumi; Goto, Hidemi
2014-04-01
The mechanisms of drug resistance in cancer are not fully elucidated. To study the drug resistance of gastric cancer, we analyzed gene expression and DNA methylation profiles of 5-fluorouracil (5-FU)- and cisplatin (CDDP)-resistant gastric cancer cells and biopsy specimens. Drug-resistant gastric cancer cells were established with culture for >10 months in a medium containing 5-FU or CDDP. Endoscopic biopsy specimens were obtained from gastric cancer patients who underwent chemotherapy with oral fluoropyrimidine S-1 and CDDP. Gene expression and DNA methylation analyses were performed using microarray, and validated using real-time PCR and pyrosequencing, respectively. Out of 17,933 genes, 541 genes commonly increased and 569 genes decreased in both 5-FU- and CDDP-resistant AGS cells. Genes with expression changed by drugs were related to GO term 'extracellular region' and 'p53 signaling pathway' in both 5-FU- and CDDP-treated cells. Expression of 15 genes including KLK13 increased and 12 genes including ETV7 decreased, in both drug-resistant cells and biopsy specimens of two patients after chemotherapy. Out of 10,365 genes evaluated with both expression microarray and methylation microarray, 74 genes were hypermethylated and downregulated, or hypomethylated and upregulated in either 5-FU-resistant or CDDP-resistant cells. Of these genes, expression of 21 genes including FSCN1, CPT1C and NOTCH3, increased from treatment with a demethylating agent. There are alterations of gene expression and DNA methylation in drug-resistant gastric cancer; they may be related to mechanisms of drug resistance and may be useful as biomarkers of gastric cancer drug sensitivity.
Sharma, Mukul; Vedithi, Sundeep Chaitanya; Das, Madhusmita; Roy, Anindya; Ebenezer, Mannam
2017-01-01
Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%), 11 hypothetical proteins (18%), and 14 pseudogenes (23%). All these genes have homologs in M. tuberculosis and 49 (80.32%) in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA). The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes) were analyzed using quantitative Polymerase Chain Reaction (qPCR) assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the direct repair pathway. This study provided
DNA methylation and gene expression of TXNIP in adult offspring of women with diabetes in pregnancy.
Directory of Open Access Journals (Sweden)
Azadeh Houshmand-Oeregaard
Full Text Available Fetal exposure to maternal diabetes increases the risk of type 2 diabetes (T2DM, possibly mediated by epigenetic mechanisms. Low blood TXNIP DNA methylation has been associated with elevated glucose levels and risk of T2DM, and increased skeletal muscle TXNIP gene expression was reported in subjects with impaired glucose metabolism or T2DM. Subcutaneous adipose tissue (SAT and skeletal muscle play a key role in the control of whole body glucose metabolism and insulin action. The extent to which TXNIP DNA methylation levels are decreased and/or gene expression levels increased in SAT or skeletal muscle of a developmentally programmed at-risk population is unknown.The objective of this study was to investigate TXNIP DNA methylation and gene expression in SAT and skeletal muscle, and DNA methylation in blood, from adult offspring of women with gestational diabetes (O-GDM, n = 82 or type 1 diabetes (O-T1DM, n = 67 in pregnancy compared with offspring of women from the background population (O-BP, n = 57.SAT TXNIP DNA methylation was increased (p = 0.032 and gene expression decreased (p = 0.001 in O-GDM, but these differences were attenuated after adjustment for confounders. Neither blood/muscle TXNIP DNA methylation nor muscle gene expression differed between groups.We found no evidence of decreased TXNIP DNA methylation or increased gene expression in metabolic target tissues of offspring exposed to maternal diabetes. Further studies are needed to confirm and understand the paradoxical SAT TXNIP DNA methylation and gene expression changes in O-GDM subjects.
Junk DNA enhances pEI-based non-viral gene delivery
Gaal, E.V.B. van; Oosting, R.S.; Hennink, W.E.; Crommelin, D.J.A.; Mastrobattista, E.
Gene therapy aims at delivering exogenous DNA into the nuclei of target cells to establish expression of a therapeutic protein. Non-viral gene delivery is examined as a safer alternative to viral approaches, but is presently characterized by a low efficiency. In the past years several non-viral
International Nuclear Information System (INIS)
Trucksis, M.; Depew, R.E.
1981-01-01
A gene that specifies production of Escherichia coli DNA topoisomerase I (ω protein) was identified with the aid of a radioimmunoassay for this protein. E. coli DNA topoisomerase I was produced by Salmonella typhimurium merodiploids that harbored E. coli plasmid F' 123, but not by strains that lost this plasmid. Analysis of strains with spontaneous deletions of F' 123 showed that the gene, topA, required for production of the E. coli ω protein was between the trp operon and the cysB gene. Deletions that eliminated topA also eliminated the supX gene. We suggest that topA is the structural gene of E. coli DNA topoisomerase I and that topA is identical to supX
Directory of Open Access Journals (Sweden)
Mingsheng Yang
2015-03-01
Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.
Yamagishi, J; Isobe, R; Takebuchi, T; Bando, H
2003-03-01
We describe, for the first time, the generation of a viral DNA chip for simultaneous expression measurements of nearly all known open reading frames (ORFs) in the best-studied members of the family Baculoviridae, Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Bombyx mori nucleopolyhedrovirus (BmNPV). In this study, a viral DNA chip (Ac-BmNPV chip) was fabricated and used to characterize the viral gene expression profile for AcMNPV in different cell types. The viral chip is composed of microarrays of viral DNA prepared by robotic deposition of PCR-amplified viral DNA fragments on glass for ORFs in the NPV genome. Viral gene expression was monitored by hybridization to the DNA fragment microarrays with fluorescently labeled cDNAs prepared from infected Spodoptera frugiperda, Sf9 cells and Trichoplusia ni, TnHigh-Five cells, the latter a major producer of baculovirus and recombinant proteins. A comparison of expression profiles of known ORFs in AcMNPV elucidated six genes (ORF150, p10, pk2, and three late gene expression factor genes lef-3, p35 and lef- 6) the expression of each of which was regulated differently in the two cell lines. Most of these genes are known to be closely involved in the viral life cycle such as in DNA replication, late gene expression and the release of polyhedra from infected cells. These results imply that the differential expression of these viral genes accounts for the differences in viral replication between these two cell lines. Thus, these fabricated microarrays of NPV DNA which allow a rapid analysis of gene expression at the viral genome level should greatly speed the functional analysis of large genomes of NPV.
Transgelin gene is frequently downregulated by promoter DNA hypermethylation in breast cancer.
Sayar, Nilufer; Karahan, Gurbet; Konu, Ozlen; Bozkurt, Betul; Bozdogan, Onder; Yulug, Isik G
2015-01-01
CpG hypermethylation in gene promoters is a frequent mechanism of tumor suppressor gene silencing in various types of cancers. It usually occurs at early steps of cancer progression and can be detected easily, giving rise to development of promising biomarkers for both detection and progression of cancer, including breast cancer. 5-aza-2'-deoxycytidine (AZA) is a DNA demethylating and anti-cancer agent resulting in induction of genes suppressed via DNA hypermethylation. Using microarray expression profiling of AZA- or DMSO-treated breast cancer and non-tumorigenic breast (NTB) cells, we identified for the first time TAGLN gene as a target of DNA hypermethylation in breast cancer. TAGLN expression was significantly and frequently downregulated via promoter DNA hypermethylation in breast cancer cells compared to NTB cells, and also in 13/21 (61.9 %) of breast tumors compared to matched normal tissues. Analyses of public microarray methylation data showed that TAGLN was also hypermethylated in 63.02 % of tumors compared to normal tissues; relapse-free survival of patients was worse with higher TAGLN methylation; and methylation levels could discriminate between tumors and healthy tissues with 83.14 % sensitivity and 100 % specificity. Additionally, qRT-PCR and immunohistochemistry experiments showed that TAGLN expression was significantly downregulated in two more independent sets of breast tumors compared to normal tissues and was lower in tumors with poor prognosis. Colony formation was increased in TAGLN silenced NTB cells, while decreased in overexpressing BC cells. TAGLN gene is frequently downregulated by DNA hypermethylation, and TAGLN promoter methylation profiles could serve as a future diagnostic biomarker, with possible clinical impact regarding the prognosis in breast cancer.
Nwaobi, Sinifunanya E; Olsen, Michelle L
2015-09-26
DNA methylation serves to regulate gene expression through the covalent attachment of a methyl group onto the C5 position of a cytosine in a cytosine-guanine dinucleotide. While DNA methylation provides long-lasting and stable changes in gene expression, patterns and levels of DNA methylation are also subject to change based on a variety of signals and stimuli. As such, DNA methylation functions as a powerful and dynamic regulator of gene expression. The study of neuroepigenetics has revealed a variety of physiological and pathological states that are associated with both global and gene-specific changes in DNA methylation. Specifically, striking correlations between changes in gene expression and DNA methylation exist in neuropsychiatric and neurodegenerative disorders, during synaptic plasticity, and following CNS injury. However, as the field of neuroepigenetics continues to expand its understanding of the role of DNA methylation in CNS physiology, delineating causal relationships in regards to changes in gene expression and DNA methylation are essential. Moreover, in regards to the larger field of neuroscience, the presence of vast region and cell-specific differences requires techniques that address these variances when studying the transcriptome, proteome, and epigenome. Here we describe FACS sorting of cortical astrocytes that allows for subsequent examination of a both RNA transcription and DNA methylation. Furthermore, we detail a technique to examine DNA methylation, methylation sensitive high resolution melt analysis (MS-HRMA) as well as a luciferase promoter assay. Through the use of these combined techniques one is able to not only explore correlative changes between DNA methylation and gene expression, but also directly assess if changes in the DNA methylation status of a given gene region are sufficient to affect transcriptional activity.
Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M
2015-07-01
The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.
Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.
Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert
2017-11-30
Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.
Quantification of differential gene expression by multiplexed targeted resequencing of cDNA
Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.
2017-01-01
Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677
Amin, Muhammad Hilman Fu'adil; Pidada, Ida Bagus Rai; Sugiharto, Widyatmoko, Johan Nuari; Irawan, Bambang
2016-03-01
Species identification and taxonomy of sea cucumber remains a challenge problem in some taxa. Caudinidae family of sea cucumber was comerciallized in Surabaya, and it was used as sea cucumber chips. Members of Caudinid sea cucumber have similiar morphology, so it is hard to identify this sea cucumber only from morphological appearance. DNA barcoding is useful method to overcome this problem. The aim of this study was to determine Caudinid specimen of sea cucumber in East Java by morphological and molecular approach. Sample was collected from east coast of Surabaya, then preserved in absolute ethanol. After DNA isolation, Cytochrome Oxydase I (COI) gene amplification was performed using Echinoderm universal primer and PCR product was sequenced. Sequencing result was analyzed and identified in NCBI database using BLAST. Results showed that Caudinid specimen in have closely related to Acaudina molpadioides sequence in GenBank with 86% identity. Morphological data, especially based on ossicle, also showed that the specimen is Acaudina molpadioides.
Energy Technology Data Exchange (ETDEWEB)
Lee, Ji Hye; Kang, Rhee Hun; Ham, Byung Joo; Lee, Min Su; Shin, Kyung Ho; Choe, Jae Gol; Kim, Meyoung Kon [College of Medicine, Univ. of Korea, Seoul (Korea, Republic of)
2003-07-01
Major depressive disorder is a prevalent psychiatric disorder in primary care, associated with impaired patient functioning and well-being. Fluoxetine is a selective serotonin-reuptake inhibitors (SSRIs) and is a commonly prescribed antidepressant compound. Its action is primarily attributed to selective inhibition of the reuptake of serotonin (5-hydroxytryptamine) in the central nervous system. Objectives ; the aims of this study were two-fold: (1) to determine the usefulness for investigation of the transcription profiles in depression patients, and (2) to assess the differences in gene expression profiles between positive response group and negative response groups by fluoxetine treatment. This study included 53 patients with major depression (26 in positive response group with antidepressant treatment, 27 in negative response group with antidepressant treatment), and 53 healthy controls. To examine the difference of gene expression profile in depression patients, radioactive complementary DNA microarrays were used to evaluate changes in the expression of 1,152 genes in total. Using 33p-labeled probes, this method provided highly sensitive gene expression profiles including brain receptors, drug metabolism, and cellular signaling. Gene transcription profiles were classified into several categories in accordance with the antidepressant gene-regulation. The gene profiles were significantly up-(22 genes) and down-(16 genes) regulated in the positive response group when compared to the control group. Also, in the negative response group, 35 genes were up-regulated and 8 genes were down-regulated when compared to the control group. Consequently, we demonstrated that radioactive human cDNA microarray is highly likely to be an efficient technology for evaluating the gene regulation of antidepressants, such as selective serotonin-reuptake inhibitors (SSRIs), by using high-throughput biotechnology.
International Nuclear Information System (INIS)
Lee, Ji Hye; Kang, Rhee Hun; Ham, Byung Joo; Lee, Min Su; Shin, Kyung Ho; Choe, Jae Gol; Kim, Meyoung Kon
2003-01-01
Major depressive disorder is a prevalent psychiatric disorder in primary care, associated with impaired patient functioning and well-being. Fluoxetine is a selective serotonin-reuptake inhibitors (SSRIs) and is a commonly prescribed antidepressant compound. Its action is primarily attributed to selective inhibition of the reuptake of serotonin (5-hydroxytryptamine) in the central nervous system. Objectives ; the aims of this study were two-fold: (1) to determine the usefulness for investigation of the transcription profiles in depression patients, and (2) to assess the differences in gene expression profiles between positive response group and negative response groups by fluoxetine treatment. This study included 53 patients with major depression (26 in positive response group with antidepressant treatment, 27 in negative response group with antidepressant treatment), and 53 healthy controls. To examine the difference of gene expression profile in depression patients, radioactive complementary DNA microarrays were used to evaluate changes in the expression of 1,152 genes in total. Using 33p-labeled probes, this method provided highly sensitive gene expression profiles including brain receptors, drug metabolism, and cellular signaling. Gene transcription profiles were classified into several categories in accordance with the antidepressant gene-regulation. The gene profiles were significantly up-(22 genes) and down-(16 genes) regulated in the positive response group when compared to the control group. Also, in the negative response group, 35 genes were up-regulated and 8 genes were down-regulated when compared to the control group. Consequently, we demonstrated that radioactive human cDNA microarray is highly likely to be an efficient technology for evaluating the gene regulation of antidepressants, such as selective serotonin-reuptake inhibitors (SSRIs), by using high-throughput biotechnology
cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.
Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E
1999-01-01
A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...
Gene-gun DNA vaccination aggravates respiratory syncytial virus-induced pneumonitis
DEFF Research Database (Denmark)
Bartholdy, Christina; Olszewska, Wieslawa; Stryhn, Anette
2004-01-01
elicited with recombinant vaccinia virus expressing the complete RSV M2 protein, but stronger than those induced by a similar DNA construct without the beta2m gene. DNA vaccination led to enhanced pulmonary disease after RSV challenge, with increased weight loss and cell recruitment to the lung. Depletion......A CD8+ T-cell memory response to respiratory syncytial virus (RSV) was generated by using a DNA vaccine construct encoding the dominant Kd-restricted epitope from the viral transcription anti-terminator protein M2 (M2(82-90)), linked covalently to human beta2-microglobulin (beta2m). Cutaneous gene...... of CD8+ T cells reduced, but did not abolish, enhancement of disease. Mice vaccinated with a construct encoding a class I-restricted lymphocytic choriomeningitis virus epitope and beta2m suffered more severe weight loss after RSV infection than unvaccinated RSV-infected mice, although RSV-specific CD8...
Hsiao, Sheng-Tai; Chuang, Shin-Chang; Chen, Kao-Sung; Ho, Ping-Ho; Wu, Chi-Lun; Chen, Chaolun Allen
2016-09-01
The Pacific cupped oyster, Crassostrea gigas, is one of the major aquacultural shellfish species that has been introduced to Europe and America from its native source in the West Pacific. In Taiwan, the cultivated cupped oysters along the west coast have been identified as C. gigas for over centuries; however, several molecular phylogenetic studies have cast doubt upon the existence of this species in Taiwan and adjacent waters. Indeed, our analyses of mitochondrial cytochrome oxidase I (COI) sequences from 313 Crassostrea collected from 12 locations along Taiwanese and southern Chinese coastlines confirm that all samples were the Portuguese oyster, C. angulata, rather than C. gigas. Multiple lines of evidence, including haplotypic and nucleotide diversity of the COI gene, demographic history, and population genetics, suggest that Taiwanese C. angulata is unique, probably experienced a sudden population expansion after the Last Glacial Maxima around 20,000 years ago, and has a significantly limited genetic connectivity across the Taiwan Strait. Our study applies an extended sampling and DNA barcoding to confirm the absence of C. gigas in natural and cultivated populations in Taiwan and southern China, where we only found C. angulata. We highlight the importance of conserving the gene pool of the C. angulata population in Taiwan, particularly considering the current threats by large-scale environmental disturbances such as marine pollution, habitat destruction, and climate change.
Evidence for gene flow between two sympatric mealybug species (Insecta; Coccoidea; Pseudococcidae.
Directory of Open Access Journals (Sweden)
Hofit Kol-Maimon
Full Text Available Occurrence of inter-species hybrids in natural populations might be evidence of gene flow between species. In the present study we found evidence of gene flow between two sympatric, genetically related scale insect species--the citrus mealybug Planococcus citri (Risso and the vine mealybug Planococcus ficus (Signoret. These species can be distinguished by morphological, behavioral, and molecular traits. We employed the sex pheromones of the two respective species to study their different patterns of male attraction. We also used nuclear ITS2 (internal transcribed spacer 2 and mitochondrial COI (Cytochrome c oxidase sub unit 1 DNA sequences to characterize populations of the two species, in order to demonstrate the outcome of a possible gene flow between feral populations of the two species. Our results showed attraction to P. ficus pheromones of all tested populations of P. citri males but not vice versa. Furthermore, ITS2 sequences revealed the presence of 'hybrid females' among P. citri populations but not among those of P. ficus. 'hybrid females' from P. citri populations identified as P. citri females according to COI sequences. We offer two hypotheses for these results. 1 The occurrence of phenotypic and genotypic traits of P. ficus in P. citri populations may be attributed to both ancient and contemporary gene flow between their populations; and 2 we cannot rule out that an ancient sympatric speciation by which P. ficus emerged from P. citri might have led to the present situation of shared traits between these species. In light of these findings we also discuss the origin of the studied species and the importance of the pherotype phenomenon as a tool with which to study genetic relationships between congener scale insects.
Epizoanthus spp. associations revealed using DNA markers: a case study from Kochi, Japan.
Reimer, James Davis; Hirose, Mamiko; Nishisaka, Taiki; Sinniger, Frederic; Itani, Gyo
2010-09-01
Zoanthids (Cnidaria, Hexacorallia) of the genus Epizoanthus are often found in association with other marine invertebrates, including gastropods and hermit crabs. However, little information exists on the specificity and nature of these associations due to a lack of investigation into Epizoanthus species diversity, and the taxonomy of Epizoanthus is therefore confused. In this study, analyses of morphological data (tentacle number, polyp size, etc) and molecular data (mitochondrial cytochrome oxidase subunit 1 = COI, 16S ribosomal DNA = 16S rDNA) were used to examine Epizoanthus specimens from Tosa Bay, Kochi, Japan. The Epizoanthus specimens were found on both live gastropods (Gemmula unedo) and hermit crabs (Paguristes palythophilus) inhabiting G. unedo and G. cosmoi shells. While morphological analyses did not show clear differences between examined specimens, both COI and mt 16S rDNA clearly divided the specimens into two groups, one associated only with hermit crabs (= Epizoanthus sp. C), and another associated only with living gastropods (= Epizoanthus sp. S). Unexpectedly, DNA sequences from both groups did not match with two previously reported Epizoanthus species from Japan (E. indicus, E. ramosus), indicating they both may be undescribed species. These results highlight the utility of DNA "barcoding" of unknown zoanthids, and will provide a foundation for re-examinations of Epizoanthus species diversity and specificity, which will be critical in understanding the evolution of these unique marine invertebrates.
Genetic manipulation in Sulfolobus islandicus and functional analysis of DNA repair genes
DEFF Research Database (Denmark)
Zhang, Changyi; Tian, Bin; Li, Suming
2013-01-01
Recently, a novel gene-deletion method was developed for the crenarchaeal model Sulfolobus islandicus, which is a suitable tool for addressing gene essentiality in depth. Using this technique, we have investigated functions of putative DNA repair genes by constructing deletion mutants and studying...
Tarcz, Sebastian; Rautian, Maria; Potekhin, Alexey; Sawka, Natalia; Beliavskaya, Alexandra; Kiselev, Andrey; Nekrasova, Irina; Przyboś, Ewa
2014-04-01
Paramecium putrinum (Claparede & Lachmann 1858) is one of the smallest (80-140 μm long) species of the genus Paramecium. Although it commonly occurs in freshwater reservoirs, no molecular studies of P. putrinum have been conducted to date. Herein we present an assessment of molecular variation in 27 strains collected from widely separated populations by using two selected DNA fragments (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA). Both the trees and haplotype networks reconstructed for both genome fragments show that the studied strains of P. putrinum form five main haplogroups. The mean distance between the studied strains is p-distance=0.007/0.068 (rDNA/COI) and exhibits similar variability as that between P. bursaria syngens. Based on these data, one could hypothesize that the clusters revealed in the present study may correspond to previously reported syngens and that there are at least five cryptic species within P. putrinum. Copyright © 2014 Elsevier Inc. All rights reserved.
Riber, Leise; Olsson, Jan A; Jensen, Rasmus B; Skovgaard, Ole; Dasgupta, Santanu; Marinus, Martin G; Løbner-Olesen, Anders
2006-08-01
Initiation of DNA replication in Eschericia coli requires the ATP-bound form of the DnaA protein. The conversion of DnaA-ATP to DnaA-ADP is facilitated by a complex of DnaA, Hda (homologous to DnaA), and DNA-loaded beta-clamp proteins in a process termed RIDA (regulatory inactivation of DnaA). Hda-deficient cells initiate replication at each origin mainly once per cell cycle, and the rare reinitiation events never coincide with the end of the origin sequestration period. Therefore, RIDA is not the predominant mechanism to prevent immediate reinitiation from oriC. The cellular level of Hda correlated directly with dnaA gene expression such that Hda deficiency led to reduced dnaA gene expression, and overproduction of Hda led to DnaA overproduction. Hda-deficient cells were very sensitive to variations in the cellular level of DnaA, and DnaA overproduction led to uncontrolled initiation of replication from oriC, causing severe growth retardation or cell death. Based on these observations, we propose that both RIDA and dnaA gene autoregulation are required as homeostatic mechanisms to ensure that initiation of replication occurs at the same time relative to cell mass in each cell cycle.
[Gene doping: gene transfer and possible molecular detection].
Argüelles, Carlos Francisco; Hernández-Zamora, Edgar
2007-01-01
The use of illegal substances in sports to enhance athletic performance during competition has caused international sports organizations such as the COI and WADA to take anti doping measures. A new doping method know as gene doping is defined as "the non-therapeutic use of genes, genetic elements and/or cells that have the capacity to enhance athletic performance". However, gene doping in sports is not easily identified and can cause serious consequences. Molecular biology techniques are needed in order to distinguish the difference between a "normal" and an "altered" genome. Further, we need to develop new analytic methods and biological molecular techniques in anti-doping laboratories, and design programs that avoid the non therapeutic use of genes.
Directory of Open Access Journals (Sweden)
Rini Susilowati
2009-04-01
Full Text Available Tujuan penelitian ini untuk memetakan keragaman genetik lima populasi tiram mutiara di Indonesia (Sumbawa, Bali Utara, Selat Sunda, Belitung, Sulawesi Selatan dengan teknik mtDNA RFLP daerah amplifikasi Cytochrome Oxydase I (COI dan hubungan kekerabatannya. Lima puluh tiram mutiara (Pinctada margaritifera yang dianalisis menghasilkan DNA teramplifikasi sebesar 750 pb pada daerah COI mtDNA dengan teknik RFLP. Delapan belas komposit haplotipe terdeteksi dengan menggunakan tiga enzim restriksi: FokI, HaeIII, dan NlaIV. Diversitas haplotip rata-rata sebesar 0,255±0,093. Lima populasi tiram mutiara menghasilkan tiga kelompok dengan jarak genetik terendah adalah populasi Sumbawa dan Bali Utara (0,017 dan terjauh adalah populasi Sulawesi Selatan (0,142. Populasi Sulawesi Selatan merupakan populasi unik berdasarkan distribusi haplotipe BBCAA (60% dengan nilai keragaman genetik terendah (0,105 dibandingkan dengan populasi lainnya (0,177-0,328. The objectives of this study were to map the genetic diversity of five populations of pearl oyster in Indonesian waters using restriction fragment length polymorphism analysis of DNA COI gene and their genetic relationships. A total of 50 individual of pearl oysters (Pinctada margaritifera were analyzed for genetic variations within a 750-base pair region of the mitochondrial DNA COI gene using restriction fragment length polymorphism analysis. 18 composite haplotypes were detected following three digestions of endonuclease: FokI, HaeIII, and NlaIV. Five populations of pearl oysters formed three groups where the lowest values of Nei’s genetic distance were among Sumbawa and North Bali populations (0.017 and highest were among the South Sulawesi populations (0.142. The South Sulawesi populations possess uniqueness based on the haplotipe distribution of BBCAA (60% with the lowest values of genetic diversities (0.105 compared to other populations (0.177--0.328.
Effect of ionizing radiation on DNA-mediated gene transfer efficiency
International Nuclear Information System (INIS)
Rubin, J.S.; Hall, E.J.; Hei, T.K.
1986-01-01
Ionizing radiation causes a number of molecular changes in cells including DNA damage and gene amplification. In this study the authors examined whether radiation can effect the efficiency of integration and expression of exogenous DNA sequences. They examined both 137 Cs γ rays and various monoenergetic neutron beams. This enabled them to test whether the LET or RBE of the radiation had any effect. Rat2 cells were transfected with various amounts of the bacterial plasmid pSV2-GPT along with carrier DNA for 24 hours
A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1
International Nuclear Information System (INIS)
Sebastian, J.; Sancar, G.B.
1991-01-01
The PHR1 gene of Saccharomyces cerevisiae encodes the DNA repair enzyme photolyase. Transcription of PHR1 increases in response to treatment of cells with 254-nm radiation and chemical agents that damage DNA. The authors here the identification of a damage-responsive DNA binding protein, termed photolyase regulatory protein (PRP), and its cognate binding site, termed the PHR1 transcription after DNA damage. PRP activity, monitored by electrophoretic-mobility-shift assay, was detected in cells during normal growth but disappeared within 30 min after irradiation. Copper-phenanthroline footprinting of PRP-DNA complexes revealed that PRP protects a 39-base-pair region of PHR1 5' flanking sequence beginning 40 base pairs upstream from the coding sequence. Thus these observations establish that PRP is a damage-responsive repressor of PHR1 transcription
Glycoprotein is enough for sindbis virus-derived DNA vector to express heterogenous genes
Directory of Open Access Journals (Sweden)
Fu Juanjuan
2011-07-01
Full Text Available Abstract To investigate the necessity and potential application of structural genes for expressing heterogenous genes from Sindbis virus-derived vector, the DNA-based expression vector pVaXJ was constructed by placing the recombinant genome of sindbis-like virus XJ-160 under the control of the human cytomegalovirus (CMV promoter of the plasmid pVAX1, in which viral structural genes were replaced by a polylinker cassette to allow for insertion of heterologous genes. The defect helper plasmids pVaE or pVaC were developed by cloning the gene of glycoprotein E3E26KE1 or capsid protein of XJ-160 virus into pVAX1, respectively. The report gene cassette pVaXJ-EGFP or pV-Gluc expressing enhanced green fluorescence protein (EGFP or Gaussia luciferase (G.luc were constructed by cloning EGFP or G.luc gene into pVaXJ. EGFP or G.luc was expressed in the BHK-21 cells co-transfected with report gene cassettes and pVaE at levels that were comparable to those produced by report gene cassettes, pVaC and pVaE and were much higher than the levels produced by report gene cassette and pVaC, suggesting that glycoprotein is enough for Sindbis virus-derived DNA vector to express heterogenous genes in host cells. The method of gene expression from Sindbis virus-based DNA vector only co-transfected with envelop E gene increase the conveniency and the utility of alphavirus-based vector systems in general.
Mahajan, Vivek; Gaymalov, Zagit; Alakhova, Daria; Gupta, Richa; Zucker, Irving H; Kabanov, Alexander V
2016-01-01
Intramuscular administration of plasmid DNA (pDNA) with non-ionic Pluronic block copolymers increases gene expression in injected muscles and lymphoid organs. We studied the role of immune cells in muscle transfection upon inflammation. Local inflammation in murine hind limb ischemia model (MHLIM) drastically increased DNA, RNA and expressed protein levels in ischemic muscles injected with pDNA/Pluronic. The systemic inflammation (MHLIM or peritonitis) also increased expression of pDNA/Pluronic in the muscles. When pDNA/Pluronic was injected in ischemic muscles the reporter gene, Green Fluorescent Protein (GFP) co-localized with desmin(+) muscle fibers and CD11b(+) macrophages (MØs), suggesting transfection of MØs along with the muscle cells. P85 enhanced (∼ 4 orders) transfection of MØs with pDNA in vitro. Moreover, adoptively transferred MØs were shown to pass the transgene to inflamed muscle cells in MHLIM. Using a co-culture of myotubes (MTs) and transfected MØs expressing a reporter gene under constitutive (cmv-luciferase) or muscle specific (desmin-luciferase) promoter we demonstrated that P85 enhances horizontal gene transfer from MØ to MTs. Therefore, MØs can play an important role in muscle transfection with pDNA/Pluronic during inflammation, with both inflammation and Pluronic contributing to the increased gene expression. pDNA/Pluronic has potential for therapeutic gene delivery in muscle pathologies that involve inflammation. Copyright © 2015 Elsevier Ltd. All rights reserved.
Cloning and characterization of human DNA repair genes
International Nuclear Information System (INIS)
Thompson, L.H.; Brookman, K.W.; Weber, C.A.; Salazar, E.P.; Stewart, S.A.; Carrano, A.V.
1987-01-01
The isolation of two addition human genes that give efficient restoration of the repair defects in other CHO mutant lines is reported. The gene designated ERCC2 (Excision Repair Complementing Chinese hamster) corrects mutant UV5 from complementation group 1. They recently cloned this gene by first constructing a secondary transformant in which the human gene was shown to have become physically linked to the bacterial gpt dominant-marker gene by cotransfer in calcium phosphate precipitates in the primary transfection. Transformants expressing both genes were recovered by selecting for resistance to both UV radiation and mycophenolic acid. Using similar methods, the human gene that corrects CHO mutant EM9 was isolated in cosmids and named XRCC1 (X-ray Repair Complementing Chinese hamster). In this case, transformants were recovered by selecting for resistance to CldUrd, which kills EM9 very efficiently. In both genomic and cosmid transformants, the XRCC1 gene restored resistance to the normal range. DNA repair was studied using the kinetics of strand-break rejoining, which was measured after exposure to 137 Cs γ-rays
Directory of Open Access Journals (Sweden)
Mukul Sharma
2017-01-01
Full Text Available Background: Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. Methods: T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%, 11 hypothetical proteins (18%, and 14 pseudogenes (23%. All these genes have homologs in M. tuberculosis and 49 (80.32% in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. Results: It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA. The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes were analyzed using quantitative Polymerase Chain Reaction (qPCR assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the
MOLECULAR CLONING OF OVINE cDNA LEPTIN GENE
Directory of Open Access Journals (Sweden)
CLAUDIA TEREZIA SOCOL
2008-05-01
Full Text Available An efficient bacterial transformation system suitable for cloning the coding sequence of the ovine leptin gene in E. coli DH5α host cells using the pGEMT easy vector it is described in this paper. The necessity of producing leptin is based on the fact that the role of this molecule in the animal and human organism is still unknown, leptin not existing as commercial product on the Romanian market. The results obtained in the bacterial transformation, cloning, recombinant clones selection, control of the insertion experiments and DNA computational analysis represent the first steps in further genetic engineering experiments such as production of DNA libraries, DNA sequencing, protein expression, etc., for a further contribution in elucidating the role of leptin in the animal and human organism.
Optimal control of gene mutation in DNA replication.
Yu, Juanyi; Li, Jr-Shin; Tarn, Tzyh-Jong
2012-01-01
We propose a molecular-level control system view of the gene mutations in DNA replication from the finite field concept. By treating DNA sequences as state variables, chemical mutagens and radiation as control inputs, one cell cycle as a step increment, and the measurements of the resulting DNA sequence as outputs, we derive system equations for both deterministic and stochastic discrete-time, finite-state systems of different scales. Defining the cost function as a summation of the costs of applying mutagens and the off-trajectory penalty, we solve the deterministic and stochastic optimal control problems by dynamic programming algorithm. In addition, given that the system is completely controllable, we find that the global optimum of both base-to-base and codon-to-codon deterministic mutations can always be achieved within a finite number of steps.
Rand, Lucinda; Hinds, Jason; Springer, Burkhard; Sander, Peter; Buxton, Roger S; Davis, Elaine O
2003-11-01
In many species of bacteria most inducible DNA repair genes are regulated by LexA homologues and are dependent on RecA for induction. We have shown previously by analysing the induction of recA that two mechanisms for the induction of gene expression following DNA damage exist in Mycobacterium tuberculosis. Whereas one of these depends on RecA and LexA in the classical way, the other mechanism is independent of both of these proteins and induction occurs in the absence of RecA. Here we investigate the generality of each of these mechanisms by analysing the global response to DNA damage in both wild-type M. tuberculosis and a recA deletion strain of M. tuberculosis using microarrays. This revealed that the majority of the genes that were induced remained inducible in the recA mutant stain. Of particular note most of the inducible genes with known or predicted functions in DNA repair did not depend on recA for induction. Amongst these are genes involved in nucleotide excision repair, base excision repair, damage reversal and recombination. Thus, it appears that this novel mechanism of gene regulation is important for DNA repair in M. tuberculosis.
Directory of Open Access Journals (Sweden)
Yuan Jiang
Full Text Available The species belonging to Sclerodermus (Hymenoptera: Bethylidae are currently the most important insect natural enemies of wood borer pests, mainly buprestid and cerambycid beetles, in China. However, some sibling species of this genus are very difficult to distinguish because of their similar morphological features. To address this issue, we conducted phylogenetic and genetic analyses of cytochrome oxidase subunit I (COI and 28S RNA gene sequences from eight species of Sclerodermus reared from different wood borer pests. The eight sibling species were as follows: S. guani Xiao et Wu, S. sichuanensis Xiao, S. pupariae Yang et Yao, and Sclerodermus spp. (Nos. 1-5. A 594-bp fragment of COI and 750-bp fragment of 28S were subsequently sequenced. For COI, the G-C content was found to be low in all the species, averaging to about 30.0%. Sequence divergences (Kimura-2-parameter distances between congeneric species averaged to 4.5%, and intraspecific divergences averaged to about 0.09%. Further, the maximum sequence divergences between congeneric species and Sclerodermus sp. (No. 5 averaged to about 16.5%. All 136 samples analyzed were included in six reciprocally monophyletic clades in the COI neighbor-joining (NJ tree. The NJ tree inferred from the 28S rRNA sequence yielded almost identical results, but the samples from S. guani, S. sichuanensis, S. pupariae, and Sclerodermus spp. (Nos. 1-4 clustered together and only Sclerodermus sp. (No. 5 clustered separately. Our findings indicate that the standard barcode region of COI can be efficiently used to distinguish morphologically similar Sclerodermus species. Further, we speculate that Sclerodermus sp. (No. 5 might be a new species of Sclerodermus.
DNA polymorphism of HLA class II genes in primary biliary cirrhosis
DEFF Research Database (Denmark)
Morling, Niels; Dalhoff, K; Fugger, L
1992-01-01
We investigated the DNA restriction fragment length polymorphism of the major histocompatibility complex class II genes: HLA-DRB, -DQA, -DQB, DPA, -DPB, the serologically defined HLA-A, B, C, DR antigens, and the primed lymphocyte typing defined HLA-DP antigens in 23 Danish patients with primary...... than 0.05, 'corrected' P greater than 0.05). No DNA fragments specific for DRB1*0301 (DR3) could be identified. The frequencies in PBC of other genetic markers including DRw8, DRB1*08, HLA-DP antigens, DPA, and DPB genes did not differ significantly from those in controls. The associations between PBC...
Directory of Open Access Journals (Sweden)
Grégory Hoff
2016-11-01
Full Text Available Non homologous end-joining (NHEJ is a double strand break (DSB repair pathway which does not require any homologous template and can ligate two DNA ends together. The basic bacterial NHEJ machinery involves two partners: the Ku protein, a DNA end binding protein for DSB recognition and the multifunctional LigD protein composed a ligase, a nuclease and a polymerase domain, for end processing and ligation of the broken ends. In silico analyses performed in the 38 sequenced genomes of Streptomyces species revealed the existence of a large panel of NHEJ-like genes. Indeed, ku genes or ligD domain homologues are scattered throughout the genome in multiple copies and can be distinguished in two categories: the core NHEJ gene set constituted of conserved loci and the variable NHEJ gene set constituted of NHEJ-like genes present in only a part of the species. In Streptomyces ambofaciens ATCC 23877, not only the deletion of core genes but also that of variable genes led to an increased sensitivity to DNA damage induced by electron beam irradiation. Multiple mutants of ku, ligase or polymerase encoding genes showed an aggravated phenotype compared to single mutants. Biochemical assays revealed the ability of Ku-like proteins to protect and to stimulate ligation of DNA ends. RT-qPCR and GFP fusion experiments suggested that ku-like genes show a growth phase dependent expression profile consistent with their involvement in DNA repair during spores formation and/or germination.
Hornok, Sándor; Estrada-Peña, Agustín; Kontschán, Jenő; Plantard, Olivier; Kunz, Bernd; Mihalca, Andrei D; Thabah, Adora; Tomanović, Snežana; Burazerović, Jelena; Takács, Nóra; Görföl, Tamás; Estók, Péter; Tu, Vuong Tan; Szőke, Krisztina; Fernández de Mera, Isabel G; de la Fuente, José; Takahashi, Mamoru; Yamauchi, Takeo; Takano, Ai
2015-09-17
Phylogeographical studies allow precise genetic comparison of specimens, which were collected over large geographical ranges and belong to the same or closely related animal species. These methods have also been used to compare ticks of veterinary-medical importance. However, relevant data are missing in the case of ixodid ticks of bats, despite (1) the vast geographical range of both Ixodes vespertilionis and Ixodes simplex, and (2) the considerable uncertainty in their taxonomy, which is currently unresolvable by morphological clues. In the present study 21 ticks were selected from collections or were freshly removed from bats or cave walls in six European and four Asian countries. The DNA was extracted and PCRs were performed to amplify part of the cytochrome oxidase I (COI), 16S and 12S rDNA genes, followed by sequencing for identification and molecular-phylogenetic comparison. No morphological differences were observed between Ixodes vespertilionis specimens from Spain and from other parts of Europe, but corresponding genotypes had only 94.6 % COI sequence identity. An I. vespertilionis specimen collected in Vietnam was different both morphologically and genetically (i.e. with only 84.1 % COI sequence identity in comparison with I. vespertilionis from Europe). Two ticks (collected in Vietnam and in Japan) formed a monophyletic clade and shared morphological features with I. ariadnae, recently described and hitherto only reported in Europe. In addition, two Asiatic specimens of I. simplex were shown to differ markedly from European genotypes of the same species. Phylogenetic relationships of ticks showed similar clustering patterns with those of their associated bat host species. Although all three ixodid bat tick species evaluated in the present study appear to be widespread in Eurasia, they exhibit pronounced genetic differences. Data of this study also reflect that I. vespertilionis may represent a species complex.
Role of gene 59 of bacteriophage T4 in repair of uv-irradiated and alkylated DNA in vivo
International Nuclear Information System (INIS)
Wu, R.; Wu, J.L.; Yeh, Y.C.
1975-01-01
Nonsense mutants in gene 59 (amC5, am HL628) were used to study the role of this gene in the repair of uv-damaged and alkylated DNA of bacteriophage T4 in vivo. The higher sensitivity to uv irradiation and alkylation of gene 59 mutants after exposure to these agents was established by a comparison of the survival fractions with wild type. Zonal centrifugal analysis of both parental and nascent mutant intracellular DNA molecules after uv irradiation showed that immediately after exposure the size of single-stranded DNA fragments was the same as the wild-type intracellular DNA. However, the capability of rejoining fragmented intracellular DNA was greatly reduced in the mutant. In contrast, the wild-type-infected cells under the same condition resumed DNA replication and repaired its DNA to normal size. Methyl methanesulfonate induced more randomly fragmented intracellular DNA, when compared to uv irradiation. The rate of rejoining under these conditions as judged from their sedimentation profiles was also greatly reduced in mutant-infected cells. Further evidence is presented that uv repair is not a simple consequence of arrested DNA replication, which is a phenotype of the mutant when infected in a nonpermissive host, Escherichia coli B(su - ), but rather that the DNA repair function of gene 59 is independent of the replication function. These and other data presented indicate that a product(s) of gene 59 is essential for both repair of uv lesions and repair of alkylation damage of DNA in vivo. It is suggested that gene 59 may have two functions during viral development: DNA replication and replication repair of DNA molecules
Roles of genes and Alu repeats in nonlinear correlations of HUMHBB DNA sequence
International Nuclear Information System (INIS)
Xiao Yi; Huang Yanzhao
2004-01-01
DNA sequences of different species and different portion of the DNA of the same species may have completely different correlation properties, but the origin of these correlations is still not very clear and is currently being investigated, especially in different particular cases. We report here a study of the DNA sequence of human beta globin region (HUMHBB) which has strong linear and nonlinear correlations. We studied the roles of two of the typical elements of DNA sequence, genes and Alu repeats, in the nonlinear correlations of HUMHBB. We find that there exist strong nonlinear correlations between the exons or introns in different genes and between the Alu repeats. They may be one of the major sources of the nonlinear correlations in HUMBHB
Novel PVA-DNA nanoparticles prepared by ultra high pressure technology for gene delivery
International Nuclear Information System (INIS)
Kimura, Tsuyoshi; Okuno, Akira; Miyazaki, Kozo; Furuzono, Tsutomu; Ohya, Yuichi; Ouchi, Tatsuro; Mutsuo, Shingo; Yoshizawa, Hidekazu; Kitamura, Yoshiro; Fujisato, Toshiyta; Kishida, Akio
2004-01-01
Polyvinyl alcohol (PVA)-DNA nanoparticles have been developed by ultra high pressure (UHP) technology. Mixture solutions of DNA and PVA having various molecular weights (Mw) and degree of saponifications (DS) were treated under 10,000 atmospheres (981 MPa) condition at 40 deg. C for 10 min. Agarose gel electrophoresis and scanning electron microscope observation revealed that the PVA-DNA nanoparticles with average diameter of about 200 nm were formed. Using PVA of higher Mw and degree of saponifications, the amount of nanoparticles formed increased. The driving force of nanoparticle formation was the hydrogen bonding between DNA and PVA. In order to apply the PVA-DNA nanoparticles for gene delivery, the cytotoxicity and the cellular uptake of them were investigated using Raw264 cell lines. The cell viability was not influenced whether the presence of the PVA-DNA nanoparticles. Further, the nanoparticles internalized into cells were observed by fluorescent microscope. These results indicates that the PVA-DNA nanoparticles prepared by UHP technology showed be useful as drug carrier, especially for gene delivery
Directory of Open Access Journals (Sweden)
Maaike A de Jong
Full Text Available This study investigates the genetic diversity, population structure and demographic history of the afrotropical butterfly Bicyclus anynana using mitochondrial DNA (mtDNA. Samples from six wild populations covering most of the species range from Uganda to South Africa were compared for the cytochrome c oxidase subunit gene (COI. Molecular diversity indices show overall high mtDNA diversity for the populations, but low nucleotide divergence between haplotypes. Our results indicate relatively little geographic population structure among the southern populations, especially given the extensive distributional range and an expectation of limited gene flow between populations. We implemented neutrality tests to assess signatures of recent historical demographic events. Tajima's D test and Fu's F(S test both suggested recent population growth for the populations. The results were only significant for the southernmost populations when applying Tajima's D, but Fu's F(S indicated significant deviations from neutrality for all populations except the one closest to the equator. Based on our own findings and those from pollen and vegetation studies, we hypothesize that the species range of B. anynana was reduced to equatorial refugia during the last glacial period, and that the species expanded southwards during the past 10.000 years. These results provide crucial background information for studies of phenotypic and molecular adaptation in wild populations of B. anynana.
Triple negative breast cancers have a reduced expression of DNA repair genes.
Directory of Open Access Journals (Sweden)
Enilze Ribeiro
Full Text Available DNA repair is a key determinant in the cellular response to therapy and tumor repair status could play an important role in tailoring patient therapy. Our goal was to evaluate the mRNA of 13 genes involved in different DNA repair pathways (base excision, nucleotide excision, homologous recombination, and Fanconi anemia in paraffin embedded samples of triple negative breast cancer (TNBC compared to luminal A breast cancer (LABC. Most of the genes involved in nucleotide excision repair and Fanconi Anemia pathways, and CHK1 gene were significantly less expressed in TNBC than in LABC. PARP1 levels were higher in TNBC than in LABC. In univariate analysis high level of FANCA correlated with an increased overall survival and event free survival in TNBC; however multivariate analyses using Cox regression did not confirm FANCA as independent prognostic factor. These data support the evidence that TNBCs compared to LABCs harbour DNA repair defects.
Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan
2015-10-01
The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.
DNA barcoding for species assignment: the case of Mediterranean marine fishes.
Directory of Open Access Journals (Sweden)
Monica Landi
Full Text Available DNA barcoding enhances the prospects for species-level identifications globally using a standardized and authenticated DNA-based approach. Reference libraries comprising validated DNA barcodes (COI constitute robust datasets for testing query sequences, providing considerable utility to identify marine fish and other organisms. Here we test the feasibility of using DNA barcoding to assign species to tissue samples from fish collected in the central Mediterranean Sea, a major contributor to the European marine ichthyofaunal diversity.A dataset of 1278 DNA barcodes, representing 218 marine fish species, was used to test the utility of DNA barcodes to assign species from query sequences. We tested query sequences against 1 a reference library of ranked DNA barcodes from the neighbouring North East Atlantic, and 2 the public databases BOLD and GenBank. In the first case, a reference library comprising DNA barcodes with reliability grades for 146 fish species was used as diagnostic dataset to screen 486 query DNA sequences from fish specimens collected in the central basin of the Mediterranean Sea. Of all query sequences suitable for comparisons 98% were unambiguously confirmed through complete match with reference DNA barcodes. In the second case, it was possible to assign species to 83% (BOLD-IDS and 72% (GenBank of the sequences from the Mediterranean. Relatively high intraspecific genetic distances were found in 7 species (2.2%-18.74%, most of them of high commercial relevance, suggesting possible cryptic species.We emphasize the discriminatory power of COI barcodes and their application to cases requiring species level resolution starting from query sequences. Results highlight the value of public reference libraries of reliability grade-annotated DNA barcodes, to identify species from different geographical origins. The ability to assign species with high precision from DNA samples of disparate quality and origin has major utility in several
Shen, Yanjun; Guan, Lihong; Wang, Dengqiang; Gan, Xiaoni
2016-05-01
The Yangtze River is the longest river in China and is divided into upstream and mid-downstream regions by the Three Gorges (the natural barriers of the Yangtze River), resulting in a complex distribution of fish. Dramatic changes to habitat environments may ultimately threaten fish survival; thus, it is necessary to evaluate the genetic diversity and propose protective measures. Species identification is the most significant task in many fields of biological research and in conservation efforts. DNA barcoding, which constitutes the analysis of a short fragment of the mitochondrial cytochrome c oxidase subunit I (COI) sequence, has been widely used for species identification. In this study, we collected 561 COI barcode sequences from 35 fish from the midstream of the Yangtze River. The intraspecific distances of all species were below 2% (with the exception of Acheilognathus macropterus and Hemibarbus maculatus). Nevertheless, all species could be unambiguously identified from the trees, barcoding gaps and taxonomic resolution ratio values. Furthermore, the COI barcode diversity was found to be low (≤0.5%), with the exception of H. maculatus (0.87%), A. macropterus (2.02%) and Saurogobio dabryi (0.82%). No or few shared haplotypes were detected between the upstream and downstream populations for ten species with overall nucleotide diversities greater than 0.00%, which indicated the likelihood of significant population genetic structuring. Our analyses indicated that DNA barcoding is an effective tool for the identification of cyprinidae fish in the midstream of the Yangtze River. It is vital that some protective measures be taken immediately because of the low COI barcode diversity.
Comparative analysis of DNA nanoparticles and AAVs for ocular gene delivery.
Directory of Open Access Journals (Sweden)
Zongchao Han
Full Text Available Gene therapy is a critical tool for the treatment of monogenic retinal diseases. However, the limited vector capacity of the current benchmark delivery strategy, adeno-associated virus (AAV, makes development of larger capacity alternatives, such as compacted DNA nanoparticles (NPs, critical. Here we conduct a side-by-side comparison of self-complementary AAV and CK30PEG NPs using matched ITR plasmids. We report that although AAVs are more efficient per vector genome (vg than NPs, NPs can drive gene expression on a comparable scale and longevity to AAV. We show that subretinally injected NPs do not leave the eye while some of the AAV-injected animals exhibited vector DNA and GFP expression in the visual pathways of the brain from PI-60 onward. As a result, these NPs have the potential to become a successful alternative for ocular gene therapy, especially for the multitude of genes too large for AAV vectors.
Correlation of SHOX2 Gene Amplification and DNA Methylation in Lung Cancer Tumors
International Nuclear Information System (INIS)
Schneider, Katja U; Liebenberg, Volker; Kneip, Christoph; Seegebarth, Anke; Erdogan, Fikret; Rappold, Gudrun; Schmidt, Bernd; Dietrich, Dimo; Fleischhacker, Michael; Leschber, Gunda; Merk, Johannes; Schäper, Frank; Stapert, Henk R; Vossenaar, Erik R; Weickmann, Sabine
2011-01-01
DNA methylation in the SHOX2 locus was previously used to reliably detect lung cancer in a group of critical controls, including 'cytologically negative' samples with no visible tumor cell content, at a high specificity based on the analysis of bronchial lavage samples. This study aimed to investigate, if the methylation correlates with SHOX2 gene expression and/or copy number alterations. An amplification of the SHOX2 gene locus together with the observed tumor-specific hypermethylation might explain the good performance of this marker in bronchial lavage samples. SHOX2 expression, gene copy number and DNA methylation were determined in lung tumor tissues and matched morphologically normal adjacent tissues (NAT) from 55 lung cancer patients. Quantitative HeavyMethyl (HM) real-time PCR was used to detect SHOX2 DNA methylation levels. SHOX2 expression was assayed with quantitative real-time PCR, and copy numbers alterations were measured with conventional real-time PCR and array CGH. A hypermethylation of the SHOX2 locus in tumor tissue as compared to the matched NAT from the same patient was detected in 96% of tumors from a group of 55 lung cancer patients. This correlated highly significantly with the frequent occurrence of copy number amplification (p < 0.0001), while the expression of the SHOX2 gene showed no difference. Frequent gene amplification correlated with hypermethylation of the SHOX2 gene locus. This concerted effect qualifies SHOX2 DNA methylation as a biomarker for lung cancer diagnosis, especially when sensitive detection is needed, i.e. in bronchial lavage or blood samples
The impact of endurance exercise on global and AMPK gene-specific DNA methylation
Energy Technology Data Exchange (ETDEWEB)
King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.; Schmetzer, Julia; Möser, Christine V.; Knothe, Claudia [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany); Resch, Eduard [Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Project Group for Translational Medicine & Pharmacology (TMP), 60596, Frankfurt/Main (Germany); Peil, Johannes [Sports Clinic, Bad Nauheim, MCI GmbH, In der Aue 30-32, 61231, Bad Nauheim (Germany); Geisslinger, Gerd [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany); Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Project Group for Translational Medicine & Pharmacology (TMP), 60596, Frankfurt/Main (Germany); Niederberger, Ellen, E-mail: e.niederberger@em.uni-frankfurt.de [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany)
2016-05-27
Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as well as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.
The impact of endurance exercise on global and AMPK gene-specific DNA methylation
International Nuclear Information System (INIS)
King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.; Schmetzer, Julia; Möser, Christine V.; Knothe, Claudia; Resch, Eduard; Peil, Johannes; Geisslinger, Gerd; Niederberger, Ellen
2016-01-01
Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as well as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.
Mitochondrial DNA depletion syndrome due to mutations in the RRM2B gene.
Bornstein, Belén; Area, Estela; Flanigan, Kevin M; Ganesh, Jaya; Jayakar, Parul; Swoboda, Kathryn J; Coku, Jorida; Naini, Ali; Shanske, Sara; Tanji, Kurenai; Hirano, Michio; DiMauro, Salvatore
2008-06-01
Mitochondrial DNA depletion syndrome (MDS) is characterized by a reduction in mtDNA copy number and has been associated with mutations in eight nuclear genes, including enzymes involved in mitochondrial nucleotide metabolism (POLG, TK2, DGUOK, SUCLA2, SUCLG1, PEO1) and MPV17. Recently, mutations in the RRM2B gene, encoding the p53-controlled ribonucleotide reductase subunit, have been described in seven infants from four families, who presented with various combinations of hypotonia, tubulopathy, seizures, respiratory distress, diarrhea, and lactic acidosis. All children died before 4 months of age. We sequenced the RRM2B gene in three unrelated cases with unexplained severe mtDNA depletion. The first patient developed intractable diarrhea, profound weakness, respiratory distress, and died at 3 months. The other two unrelated patients had a much milder phenotype and are still alive at ages 27 and 36 months. All three patients had lactic acidosis and severe depletion of mtDNA in muscle. Muscle histochemistry showed RRF and COX deficiency. Sequencing the RRM2B gene revealed three missense mutations and two single nucleotide deletions in exons 6, 8, and 9, confirming that RRM2B mutations are important causes of MDS and that the clinical phenotype is heterogeneous and not invariably fatal in infancy.
Qin, Hai-De; Shugart, Yin Yao; Bei, Jin-Xin; Pan, Qing-Hua; Chen, Lina; Feng, Qi-Sheng; Chen, Li-Zhen; Huang, Wei; Liu, Jian Jun; Jorgensen, Timothy J.; Zeng, Yi-Xin; Jia, Wei-Hua
2011-01-01
DNA repair plays a central role in protecting against environmental carcinogenesis, and genetic variants of DNA repair genes have been reported to be associated with several human malignancies. To assess whether DNA gene variants were associated with nasopharyngeal carcinoma (NPC) risk, a candidate gene association study was conducted among the Cantonese population within the Guangdong Province, China --the ethnic group with the highest risk for NPC. A two-stage study design was utilized. In the discovery stage, 676 tagging SNPs covering 88 DNA repair genes were genotyped in a matched case-control study (cases/controls = 755/755). Eleven SNPs with Ptrend Cantonese population (cases/controls = 1,568/1,297). Two of the SNPs (rs927220 and rs11158728) – both in RAD51L1 – remained strongly associated with NPC. The SNP rs927220 had a significant Pcombined of 5.55 × 10−5, with OR = 1.20 (95%CI = 1.10 to 1.30), Bonferroni corrected P = 0.0381. The other SNP (rs11158728), which is in strong LD with rs927220 (r2 = 0.7), had a significant Pcombined of 2.0 × 10−4, Bonferroni corrected P = 0.1372. Gene-environment interaction analysis suggested that the exposures of salted-fish consumption and cigarette smoking had potential interactions with DNA repair gene variations, but need to be further investigated. Our findings support the notion that DNA repair genes, in particular RAD51L1, play a role in NPC etiology and development. PMID:21368091
Luo, Arong; Zhang, Aibing; Ho, Simon Yw; Xu, Weijun; Zhang, Yanzhou; Shi, Weifeng; Cameron, Stephen L; Zhu, Chaodong
2011-01-28
A well-informed choice of genetic locus is central to the efficacy of DNA barcoding. Current DNA barcoding in animals involves the use of the 5' half of the mitochondrial cytochrome oxidase 1 gene (CO1) to diagnose and delimit species. However, there is no compelling a priori reason for the exclusive focus on this region, and it has been shown that it performs poorly for certain animal groups. To explore alternative mitochondrial barcoding regions, we compared the efficacy of the universal CO1 barcoding region with the other mitochondrial protein-coding genes in eutherian mammals. Four criteria were used for this comparison: the number of recovered species, sequence variability within and between species, resolution to taxonomic levels above that of species, and the degree of mutational saturation. Based on 1,179 mitochondrial genomes of eutherians, we found that the universal CO1 barcoding region is a good representative of mitochondrial genes as a whole because the high species-recovery rate (> 90%) was similar to that of other mitochondrial genes, and there were no significant differences in intra- or interspecific variability among genes. However, an overlap between intra- and interspecific variability was still problematic for all mitochondrial genes. Our results also demonstrated that any choice of mitochondrial gene for DNA barcoding failed to offer significant resolution at higher taxonomic levels. We suggest that the CO1 barcoding region, the universal DNA barcode, is preferred among the mitochondrial protein-coding genes as a molecular diagnostic at least for eutherian species identification. Nevertheless, DNA barcoding with this marker may still be problematic for certain eutherian taxa and our approach can be used to test potential barcoding loci for such groups.
Jones, G W; Hooley, P; Farrington, S M; Shawcross, S G; Iwanejko, L A; Strike, P
1999-03-01
Mutations within the sagA gene of Aspergillus nidulans cause sensitisation to DNA-damaging chemicals but have no effect upon spontaneous or damage-induced mutation frequency. The sagA gene was cloned on a 19-kb cosmid-derived fragment by functional complementation of a sagA1 sagC3 double mutant; subsequently, a fragment of the gene was also isolated on a 3.9-kb genomic subclone. Initial sequencing of a small section of the 19-kb fragment allowed the design of primers that were subsequently used in RTPCR experiments to show that this DNA is transcribed. A 277-bp fragment derived from the transcribed region was used to screen an A. nidulans cDNA library, resulting in the isolation of a 1.4-kb partial cDNA clone which had sequence overlap with the genomic sagA fragment. This partial cDNA was incomplete but appeared to contain the whole coding region of sagA. The sagA1 mutant was shown to possess two mutations; a G-T transversion and a+ 1 frameshift due to insertion of a T. causing disruption to the C-terminal region of the SagA protein. Translation of the sagA cDNA predicts a protein of 378 amino acids, which has homology to the Saccharomyces cerevisiae End3 protein and also to certain mammalian proteins capable of causing cell transformation.
DNA polymorphism of HLA class II genes in pauciarticular juvenile rheumatoid arthritis
DEFF Research Database (Denmark)
Morling, N; Friis, J; Fugger, L
1991-01-01
We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) class II genes: HLA-DRB, -DQA, -DQB, DPA, and -DPB in 54 patients with pauciarticular juvenile rheumatoid arthritis (PJRA) and in healthy Danes. The frequencies of DNA fragments a...
The effect of tides on nearshore environmental DNA.
Kelly, Ryan P; Gallego, Ramón; Jacobs-Palmer, Emily
2018-01-01
We can recover genetic information from organisms of all kinds using environmental sampling. In recent years, sequencing this environmental DNA (eDNA) has become a tractable means of surveying many species using water, air, or soil samples. The technique is beginning to become a core tool for ecologists, environmental scientists, and biologists of many kinds, but the temporal resolution of eDNA sampling is often unclear, limiting the ecological interpretations of the resulting datasets. Here, in a temporally and spatially replicated field study using ca. 313 bp of eukaryotic COI mtDNA as a marker, we find that nearshore organismal communities are largely consistent across tides. Our findings suggest that nearshore eDNA from both benthic and planktonic taxa tends to be endogenous to the site and water mass sampled, rather than changing with each tidal cycle. However, where physiochemical water mass characteristics change, we find that the relative contributions of a broad range of organisms to eDNA communities shift in concert.
Directory of Open Access Journals (Sweden)
Stephane Boyer
Full Text Available DNA barcoding remains a challenge when applied to diet analyses, ancient DNA studies, environmental DNA samples and, more generally, in any cases where DNA samples have not been adequately preserved. Because the size of the commonly used barcoding marker (COI is over 600 base pairs (bp, amplification fails when the DNA molecule is degraded into smaller fragments. However, relevant information for specimen identification may not be evenly distributed along the barcoding region, and a shorter target can be sufficient for identification purposes. This study proposes a new, widely applicable, method to compare the performance of all potential 'mini-barcodes' for a given molecular marker and to objectively select the shortest and most informative one. Our method is based on a sliding window analysis implemented in the new R package SPIDER (Species IDentity and Evolution in R. This method is applicable to any taxon and any molecular marker. Here, it was tested on earthworm DNA that had been degraded through digestion by carnivorous landsnails. A 100 bp region of 16 S rDNA was selected as the shortest informative fragment (mini-barcode required for accurate specimen identification. Corresponding primers were designed and used to amplify degraded earthworm (prey DNA from 46 landsnail (predator faeces using 454-pyrosequencing. This led to the detection of 18 earthworm species in the diet of the snail. We encourage molecular ecologists to use this method to objectively select the most informative region of the gene they aim to amplify from degraded DNA. The method and tools provided here, can be particularly useful (1 when dealing with degraded DNA for which only small fragments can be amplified, (2 for cases where no consensus has yet been reached on the appropriate barcode gene, or (3 to allow direct analysis of short reads derived from massively parallel sequencing without the need for bioinformatic consolidation.
Boyer, Stephane; Brown, Samuel D J; Collins, Rupert A; Cruickshank, Robert H; Lefort, Marie-Caroline; Malumbres-Olarte, Jagoba; Wratten, Stephen D
2012-01-01
DNA barcoding remains a challenge when applied to diet analyses, ancient DNA studies, environmental DNA samples and, more generally, in any cases where DNA samples have not been adequately preserved. Because the size of the commonly used barcoding marker (COI) is over 600 base pairs (bp), amplification fails when the DNA molecule is degraded into smaller fragments. However, relevant information for specimen identification may not be evenly distributed along the barcoding region, and a shorter target can be sufficient for identification purposes. This study proposes a new, widely applicable, method to compare the performance of all potential 'mini-barcodes' for a given molecular marker and to objectively select the shortest and most informative one. Our method is based on a sliding window analysis implemented in the new R package SPIDER (Species IDentity and Evolution in R). This method is applicable to any taxon and any molecular marker. Here, it was tested on earthworm DNA that had been degraded through digestion by carnivorous landsnails. A 100 bp region of 16 S rDNA was selected as the shortest informative fragment (mini-barcode) required for accurate specimen identification. Corresponding primers were designed and used to amplify degraded earthworm (prey) DNA from 46 landsnail (predator) faeces using 454-pyrosequencing. This led to the detection of 18 earthworm species in the diet of the snail. We encourage molecular ecologists to use this method to objectively select the most informative region of the gene they aim to amplify from degraded DNA. The method and tools provided here, can be particularly useful (1) when dealing with degraded DNA for which only small fragments can be amplified, (2) for cases where no consensus has yet been reached on the appropriate barcode gene, or (3) to allow direct analysis of short reads derived from massively parallel sequencing without the need for bioinformatic consolidation.
Directory of Open Access Journals (Sweden)
Bekim Sadikovic
Full Text Available Genetic and epigenetic changes contribute to deregulation of gene expression and development of human cancer. Changes in DNA methylation are key epigenetic factors regulating gene expression and genomic stability. Recent progress in microarray technologies resulted in developments of high resolution platforms for profiling of genetic, epigenetic and gene expression changes. OS is a pediatric bone tumor with characteristically high level of numerical and structural chromosomal changes. Furthermore, little is known about DNA methylation changes in OS. Our objective was to develop an integrative approach for analysis of high-resolution epigenomic, genomic, and gene expression profiles in order to identify functional epi/genomic differences between OS cell lines and normal human osteoblasts. A combination of Affymetrix Promoter Tilling Arrays for DNA methylation, Agilent array-CGH platform for genomic imbalance and Affymetrix Gene 1.0 platform for gene expression analysis was used. As a result, an integrative high-resolution approach for interrogation of genome-wide tumour-specific changes in DNA methylation was developed. This approach was used to provide the first genomic DNA methylation maps, and to identify and validate genes with aberrant DNA methylation in OS cell lines. This first integrative analysis of global cancer-related changes in DNA methylation, genomic imbalance, and gene expression has provided comprehensive evidence of the cumulative roles of epigenetic and genetic mechanisms in deregulation of gene expression networks.
Sommariva, Michele; De Cecco, Loris; De Cesare, Michelandrea; Sfondrini, Lucia; Ménard, Sylvie; Melani, Cecilia; Delia, Domenico; Zaffaroni, Nadia; Pratesi, Graziella; Uva, Valentina; Tagliabue, Elda; Balsari, Andrea
2011-10-15
Synthetic oligodeoxynucleotides expressing CpG motifs (CpG-ODN) are a Toll-like receptor 9 (TLR9) agonist that can enhance the antitumor activity of DNA-damaging chemotherapy and radiation therapy in preclinical mouse models. We hypothesized that the success of these combinations is related to the ability of CpG-ODN to modulate genes involved in DNA repair. We conducted an in silico analysis of genes implicated in DNA repair in data sets obtained from murine colon carcinoma cells in mice injected intratumorally with CpG-ODN and from splenocytes in mice treated intraperitoneally with CpG-ODN. CpG-ODN treatment caused downregulation of DNA repair genes in tumors. Microarray analyses of human IGROV-1 ovarian carcinoma xenografts in mice treated intraperitoneally with CpG-ODN confirmed in silico findings. When combined with the DNA-damaging drug cisplatin, CpG-ODN significantly increased the life span of mice compared with individual treatments. In contrast, CpG-ODN led to an upregulation of genes involved in DNA repair in immune cells. Cisplatin-treated patients with ovarian carcinoma as well as anthracycline-treated patients with breast cancer who are classified as "CpG-like" for the level of expression of CpG-ODN modulated DNA repair genes have a better outcome than patients classified as "CpG-untreated-like," indicating the relevance of these genes in the tumor cell response to DNA-damaging drugs. Taken together, the findings provide evidence that the tumor microenvironment can sensitize cancer cells to DNA-damaging chemotherapy, thereby expanding the benefits of CpG-ODN therapy beyond induction of a strong immune response.
Directory of Open Access Journals (Sweden)
Stéphanie Cornen
Full Text Available Breast cancers (BCs of the luminal B subtype are estrogen receptor-positive (ER+, highly proliferative, resistant to standard therapies and have a poor prognosis. To better understand this subtype we compared DNA copy number aberrations (CNAs, DNA promoter methylation, gene expression profiles, and somatic mutations in nine selected genes, in 32 luminal B tumors with those observed in 156 BCs of the other molecular subtypes. Frequent CNAs included 8p11-p12 and 11q13.1-q13.2 amplifications, 7q11.22-q34, 8q21.12-q24.23, 12p12.3-p13.1, 12q13.11-q24.11, 14q21.1-q23.1, 17q11.1-q25.1, 20q11.23-q13.33 gains and 6q14.1-q24.2, 9p21.3-p24,3, 9q21.2, 18p11.31-p11.32 losses. A total of 237 and 101 luminal B-specific candidate oncogenes and tumor suppressor genes (TSGs presented a deregulated expression in relation with their CNAs, including 11 genes previously reported associated with endocrine resistance. Interestingly, 88% of the potential TSGs are located within chromosome arm 6q, and seven candidate oncogenes are potential therapeutic targets. A total of 100 candidate oncogenes were validated in a public series of 5,765 BCs and the overexpression of 67 of these was associated with poor survival in luminal tumors. Twenty-four genes presented a deregulated expression in relation with a high DNA methylation level. FOXO3, PIK3CA and TP53 were the most frequent mutated genes among the nine tested. In a meta-analysis of next-generation sequencing data in 875 BCs, KCNB2 mutations were associated with luminal B cases while candidate TSGs MDN1 (6q15 and UTRN (6q24, were mutated in this subtype. In conclusion, we have reported luminal B candidate genes that may play a role in the development and/or hormone resistance of this aggressive subtype.
Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong
2014-06-01
To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.
International Nuclear Information System (INIS)
Vandegehuchte, Michiel B.; De Coninck, Dieter; Vandenbrouck, Tine; De Coen, Wim M.; Janssen, Colin R.
2010-01-01
A reduced level of DNA methylation has recently been described in both Zn-exposed and non-exposed offspring of Daphnia magna exposed to Zn. The hypothesis examined in this study is that DNA hypomethylation has an effect on gene transcription. A second hypothesis is that accumulative epigenetic effects can affect gene transcription in non-exposed offspring from parents with an exposure history of more than one generation. Transcriptional gene regulation was studied with a cDNA microarray. In the exposed and non-exposed hypomethylated daphnids, a large proportion of common genes were similarly up- or down-regulated, indicating a possible effect of the DNA hypomethylation. Two of these genes can be mechanistically involved in DNA methylation reduction. The similar transcriptional regulation of two and three genes in the F 0 and F 1 exposed daphnids on one hand and their non-exposed offspring on the other hand, could be the result of a one-generation temporary transgenerational epigenetic effect, which was not accumulative. - Zn-induced DNA hypomethylation is related to gene transcription in Daphnia magna and Zn exposure potentially induced limited temporary transgenerational effects on gene transcription.
Energy Technology Data Exchange (ETDEWEB)
Morris, D.; Knox, D.; Lavoie, J.; Lemon, J.; Boreham, D. [McMaster Univ., Hamilton, Ontario (Canada)
2005-07-01
'Full text:' Gamma radiation acts via the indirect effect to damage cells by producing reactive oxygen species (ROS). These ROS are capable damaging macromolecules and, altering signal pathways and gene transcription. Cells have evolved enzymes and mechanisms to scavenge ROS and repair oxidative damage. Microarrays allow the survey of the gene transcription activity of thousands of genes simultaneously. Messenger RNA is extracted from cells, hybridized with the complementary DNA (cDNA) of a microarray chip, and examined with a chip reader. Affymetrix microarray chips have been produced by the CSCHAH in Winnipeg containing 26000 murine genes. Groups of female mice have been exposed to low dose whole body chronic gamma radiation exposures of 0,50,100, and 120 mGy, corresponding to 15,30,60, and 75 weeks, respectively. MRNA from mice brain tissue has been extracted, isolated, converted to cDNA and labeled. Gene expression in each irradiated mouse was compared to the pooled expression of the control mice. Analysis of gene expression levels are performed with microarray analytical software, Array Pro by Media Cybernetics, and powerful statistical software, BRB microarray tools. Differences in gene expressions, focusing on genes for cytokines, DNA repair mechanisms, immuno-modulators, apoptosis pathways, and enzymatic anti-oxidant systems, are being examined and will be reported. (author)
Nonparametric testing for DNA copy number induced differential mRNA gene expression
van Wieringen, W.N.; van de Wiel, M.A.
2009-01-01
The central dogma of molecular biology relates DNA with mRNA. Array CGH measures DNA copy number and gene expression microarrays measure the amount of mRNA. Methods that integrate data from these two platforms may uncover meaningful biological relationships that further our understanding of cancer.
Energy Technology Data Exchange (ETDEWEB)
Qiao Yawei; Spitz, Margaret R.; Guo Zhaozheng; Hadeyati, Mohammad; Grossman, Lawrence; Kraemer, Kenneth H.; Wei Qingyi
2002-11-30
As DNA repair plays an important role in genetic susceptibility to cancer, assessment of the DNA repair phenotype is critical for molecular epidemiological studies of cancer. In this report, we compared use of the luciferase (luc) reporter gene in a host-cell reactivation (HCR) (LUC) assay of repair of ultraviolet (UV) damage to DNA to use of the chloramphenicol (cat) gene-based HCR (CAT) assay we used previously for case-control studies. We performed both the assays on cryopreserved lymphocytes from 102 healthy non-Hispanic white subjects. There was a close correlation between DNA repair capacity (DRC) as measured by the LUC and CAT assays. Although these two assays had similar variation, the LUC assay was faster and more sensitive. We also analyzed the relationship between DRC and the subjects' previously determined genotypes for four polymorphisms of two nucleotide-excision repair (NER) genes (in intron 9 of xeroderma pigmentosum (XP) C and exons 6, 10 and 23 of XPD) and one polymorphism of a base-excision repair gene in exon 10 of X-ray complementing group 1 (XRCC1). The DRC was significantly lower in subjects homozygous for one or more polymorphisms of the two NER genes than in subjects with other genotypes (P=0.010). In contrast, the polymorphic XRCC1 allele had no significant effect on DRC. These results suggest that the post-UV LUC assay measures NER phenotype and that polymorphisms of XPC and XPD genes modulate DRC. For population studies of the DNA repair phenotype, many samples need to be evaluated, and so the LUC assay has several advantages over the CAT assay: the LUC assay was more sensitive, had less variation, was not radioactive, was easier to perform, and required fewer cryopreserved cells. These features make the LUC-based HCR assay suitable for molecular epidemiological studies.
Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng
2018-06-29
The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.
DNA-damaging agents stimulate gene expression at specific loci in Escherichia coli
Energy Technology Data Exchange (ETDEWEB)
Kenyon, C.J.; Walker, G.C.
1988-05-01
Operon fusions in Escherichia coli were obtained that showed increased beta-galactosidase expression in response to treatment with the DNA-damaging agent mitomycin C. These fusions were generated by using the Mud(ApR, lac) vector to insert the lactose structural genes randomly into the bacterial chromosome. Induction of beta-galactosidase in these strains, which carried fusions of lac to these din (damage-inducible) loci, was (i) triggered by UV light as well as by mitomycin C and (ii) abolished by either a recA- or a lexA- mutation. Similar characteristics of induction were observed when the lactose genes were fused to a prophage lambda promoter by using Mud(ApR, lac). These results indicate that E. coli contains a set of genes that, like prophage lambda genes, are expressed in response to DNA-damaging agents and regulated by the recA and lexA gene products. These din genes map at five bacterial loci. One din::Mud(ApR, lac) insertion results in a UV-sensitive phenotype and may be within the uvrA transcriptional unit.
Tarcz, Sebastian
2013-01-01
Paramecium novaurelia Beale and Schneller, 1954, was first found in Scotland and is known to occur mainly in Europe, where it is the most common species of the P. aurelia complex. In recent years, two non-European localities have been described: Turkey and the United States of America. This article presents the analysis of intraspecific variability among 25 strains of P. novaurelia with the application of ribosomal and mitochondrial loci (ITS1-5.8S-ITS2, 5' large subunit rDNA (5'LSU rDNA) and cytochrome c oxidase subunit 1 (COI) mtDNA). The mean distance observed for all of the studied P. novaurelia sequence pairs was p=0.008/0.016/0.092 (ITS1-5.8S-ITS2/5'LSU rDNA/COI). Phylogenetic trees (NJ/MP/BI) based on a comparison of all of the analysed sequences show that the studied strains of P. novaurelia form a distinct clade, separate from the P. caudatum outgroup, and are divided into two clusters (A and B) and two branches (C and D). The occurrence of substantial genetic differentiation within P. novaurelia, confirmed by the analysed DNA fragments, indicates a rapid evolution of particular species within the Paramecium genus. Copyright © 2012 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Patrycja Zagata
2014-08-01
Full Text Available The aim of this study is an identification of Paramecium bursaria syngens originating from different geographical locations and proving the correlation between distributions and belonging to any of five syngens. Ten strains of Paramecium bursaria belonging to five different syngens and strain of Paramecium multimicronucleatum were investigated using molecular marker — mitochondrial cytochrome c oxidase subunit I (COI. According to results, obtained in this study, using phylogenetic methods like Neighbor Joining (NJ and Maximum Likelihood (ML, relationship between analyzing strains through their clustering in clusters and correlation between strains belonging to any syngen and syngen’s distribution was confirmed. Phylograms constructed using NJ and ML methods revealed strains’ grouping in five clusters. Results which were obtained revealed usefulness of COI as a biomarker, which is important in identification of Paramecium bursaria syngens. This reports to a great potential of COI as a molecular marker and obtaining dependable results through combination of molecular methods with classical ones.
Use of mitochondrial COI gene for the identification of family Salticidae and Lycosidae of spiders.
Naseem, Sajida; Tahir, Hafiz Muhammad
2018-01-01
In recent years, DNA barcoding has become quite popular for molecular identification of species because it is simple, quick and an affordable method. Present study was conducted to identify spiders of most abundant families, i.e. Salticidae and Lycosidae from citrus orchards in Sargodha district using DNA barcoding. A total of 160 specimens were subjected to DNA barcoding but, sequences up to 600 bp were recovered for 156 specimens. This molecular approach proved helpful to assign the exact taxon to those specimens which were misidentified through morphological characters in the study. We were succeeded to discriminate six species of Lycosidae and nine species of Salticidae through DNA barcoding. Results revealed the presence of clear barcode gap (discontinuity in intra- and inter-specific divergences) for members of both families. Furthermore, the maximum intra-specific divergence was less than NN (nearest neighbour) distance for all species. This suggested the reliability of DNA barcoding for spider's identification up to species level. We got 98% success in our study. It is concluded from present study that DNA barcoding is more reliable tool especially for immature spiders, when morphological characters are ambiguous.
Palomera-Sanchez, Zoraya; Watson, Gregory W; Wong, Carmen P; Beaver, Laura M; Williams, David E; Dashwood, Roderick H; Ho, Emily
2017-09-01
Androgen receptor (AR) is a transcription factor involved in normal prostate physiology and prostate cancer (PCa) development. 3,3'-Diindolylmethane (DIM) is a promising phytochemical agent against PCa that affects AR activity and epigenetic regulators in PCa cells. However, whether DIM suppresses PCa via epigenetic regulation of AR target genes is unknown. We assessed epigenetic regulation of AR target genes in LNCaP PCa cells and showed that DIM treatment led to epigenetic suppression of AR target genes involved in DNA repair (PARP1, MRE11, DNA-PK). Decreased expression of these genes was accompanied by an increase in repressive chromatin marks, loss of AR occupancy and EZH2 recruitment to their regulatory regions. Decreased DNA repair gene expression was associated with an increase in DNA damage (γH2Ax) and up-regulation of genomic repeat elements LINE1 and α-satellite. Our results suggest that DIM suppresses AR-dependent gene transcription through epigenetic modulation, leading to DNA damage and genome instability in PCa cells. Published by Elsevier Inc.
Energy Technology Data Exchange (ETDEWEB)
Fortes, F.P. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Kuasne, H. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Marchi, F.A. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Programa Inter-Institucional em Bioinformtica, Instituto de Matemtica e Estatstica, Universidade So Paulo, So Paulo, SP (Brazil); Miranda, P.M. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Rogatto, S.R. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Achatz, M.I. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Oncogentica, A.C. Camargo Cancer Center, So Paulo, SP (Brazil)
2015-04-28
Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.
Directory of Open Access Journals (Sweden)
Van Lun Low
Full Text Available The population genetic structure of Simulium tani was inferred from mitochondria-encoded sequences of cytochrome c oxidase subunits I (COI and II (COII along an elevational gradient in Cameron Highlands, Malaysia. A statistical parsimony network of 71 individuals revealed 71 haplotypes in the COI gene and 43 haplotypes in the COII gene; the concatenated sequences of the COI and COII genes revealed 71 haplotypes. High levels of genetic diversity but low levels of genetic differentiation were observed among populations of S. tani at five elevations. The degree of genetic diversity, however, was not in accordance with an altitudinal gradient, and a Mantel test indicated that elevation did not have a limiting effect on gene flow. No ancestral haplotype of S. tani was found among the populations. Pupae with unique structural characters at the highest elevation showed a tendency to form their own haplotype cluster, as revealed by the COII gene. Tajima's D, Fu's Fs, and mismatch distribution tests revealed population expansion of S. tani in Cameron Highlands. A strong correlation was found between nucleotide diversity and the levels of dissolved oxygen in the streams where S. tani was collected.
Nunes, Vera L; Mendes, Raquel; Marabuto, Eduardo; Novais, Bruno M; Hertach, Thomas; Quartau, José A; Seabra, Sofia G; Paulo, Octávio S; Simões, Paula C
2014-01-01
DNA barcodes have great potential to assist in species identification, especially when high taxonomical expertise is required. We investigated the utility of the 5' mitochondrial cytochrome c oxidase I (COI) region to discriminate between 13 European cicada species. These included all nine species currently recognized under the genus Tettigettalna, from which seven are endemic to the southern Iberian Peninsula. These cicadas have species-specific male calling songs but are morphologically very similar. Mean COI divergence between congeners ranged from 0.4% to 10.6%, but this gene was proven insufficient to determine species limits within genus Tettigettalna because a barcoding gap was absent for several of its species, that is, the highest intraspecific distance exceeded the lowest interspecific distance. The genetic data conflicted with current taxonomic classification for T. argentata and T. mariae. Neighbour-joining and Bayesian analyses revealed that T. argentata is geographically structured (clades North and South) and might constitute a species complex together with T. aneabi and T. mariae. The latter diverges very little from the southern clade of T. argentata and shares with it its most common haplotype. T. mariae is often in sympatry with T. argentata but it remains unclear whether introgression or incomplete lineage sorting may be responsible for the sharing of haplotypes. T. helianthemi and T. defauti also show high intraspecific variation that might signal hidden cryptic diversity. These taxonomic conflicts must be re-evaluated with further studies using additional genes and extensive morphological and acoustic analyses. © 2013 John Wiley & Sons Ltd.
G. Roux-Morabito; N.E. Gillette; A. Roques; L. Dormont; J. Stein; F.A.H. Sperling
2008-01-01
Coneworms of the genus Dioryctria Zeller include several serious pests of conifer seeds that are notoriously difficult to distinguish as species. We surveyed mitochondrial DNA variation within the abietella species group by sequencing 451 bp of cytochrome oxidase subunit 1 (COI) and 572 bp of cytochrome oxidase subunit 2 (COII...
Hepatitis B virus DNA integration and transactivation of cellular genes
Directory of Open Access Journals (Sweden)
Vijay Kumar
2007-02-01
Full Text Available
Chronic hepatitis B virus (HBV infection is etiologically related to human hepatocellular carcinoma (HCC. Most HCCs contain integrated HBV DNA in hepatocyte, suggesting that the integration may be involved in carcinogenesis. Available data on the integrants from human hepatocellular carcinomas seem to represent primary integrants as well as the products of secondary rearrangements. By means of structural analyses of the possible primary integrants, it has been observed that the replication intermediates of the viral genome are the preferred substrates for integration. The integrated HBV DNA and the target cellular DNA are invariably associated with deletions, possibly reflecting the substrate for, and the mechanism of, the integration reaction. The host DNA sequences as well as the target site of integration in chromosomes are selected randomly suggesting that HBV DNA integration should bring about random mutagenic effects. Analysis of the samples recovered from hepatocellular carcinomas show that the integrated HBV DNA can mediate secondary rearrangements of chromosomes, such as translocations, inversions, deletions and (possibly amplifications. The integration of HBV DNA into the host genome occurs at early steps of clonal tumor expansion. The integration has been shown in a number of cases to affect a variety of cancer-related genes and to exert insertional mutagenesis. However, in contrast to the woodchuck model, in which specific HBV-DNA integration is detectable in most cases, insertional activation or inactivation of cellular genes appears to be a rare event in man. The discovery of transactivating functions exerted by HBx and truncated HBs(urface proteins supports the notion that these could be relevant to hepatocarcinogenesis as these transactivator sequences have been found in a large number of HCC tumors or hepatoma-derived cell lines. The HBx
Minson, A C; Darby, G K; Wildy, P
1979-11-01
Two independently derived cell lines which carry the herpes simplex type 2 thymidine kinase gene have been examined for the presence of HSV-2-specific DNA sequences. Both cell lines contained 1 to 3 copies per cell of a sequence lying within map co-ordinates 0.2 to 0.4 of the HSV-2 genome. Revertant cells, which contained no detectable thymidine kinase, did not contain this DNA sequence. The failure of EcoR1-restricted HSV-2 DNA to act as a donor of the thymidine kinase gene in transformation experiments suggests that the gene lies close to the EcoR1 restriction site within this sequence at a map position of approx. 0.3. The HSV-2 kinase gene is therefore approximately co-linear with the HSV-1 gene.
The campaign to DNA barcode all fishes, FISH-BOL.
Ward, R D; Hanner, R; Hebert, P D N
2009-02-01
FISH-BOL, the Fish Barcode of Life campaign, is an international research collaboration that is assembling a standardized reference DNA sequence library for all fishes. Analysis is targeting a 648 base pair region of the mitochondrial cytochrome c oxidase I (COI) gene. More than 5000 species have already been DNA barcoded, with an average of five specimens per species, typically vouchers with authoritative identifications. The barcode sequence from any fish, fillet, fin, egg or larva can be matched against these reference sequences using BOLD; the Barcode of Life Data System (http://www.barcodinglife.org). The benefits of barcoding fishes include facilitating species identification, highlighting cases of range expansion for known species, flagging previously overlooked species and enabling identifications where traditional methods cannot be applied. Results thus far indicate that barcodes separate c. 98 and 93% of already described marine and freshwater fish species, respectively. Several specimens with divergent barcode sequences have been confirmed by integrative taxonomic analysis as new species. Past concerns in relation to the use of fish barcoding for species discrimination are discussed. These include hybridization, recent radiations, regional differentiation in barcode sequences and nuclear copies of the barcode region. However, current results indicate these issues are of little concern for the great majority of specimens.
International Nuclear Information System (INIS)
Du Zeji; Wang Mingsuo
1998-12-01
Deinococcus radiodurans (Dr) possesses a prominent ability to repair DNA injury induced by various DNA-damaging agents including mitomycin C (MC), ultraviolet light (UV) and ionizing radiation. A DNA repair mutant Dr KH3111 is a streptomycin resistant (Sm R ) derivative of KH311 which is generated by treatment with nitrosoguanidine and is sensitive to MC, 8-trimethyl-psoralen, UV and γ-ray irradiation. Gene affected by a mutation in the mutant is identified and its nucleotide sequence is determined. A complete open reading frame (ORF) which encompassed the KH3111 mutation region is found and tentatively designated as orf144b. The deduced amino acid (aa) sequence of orf144b consists of 284 aa and has no significant homology to other known proteins. The exact KH3111 mutation site is one nucleotide altered (G to A) in the sequence of orf144b in the mutant. The KH3111 mutation causes the substitution of Gly for Glu at aa position 149 of Orf144b. Survival measurements of a revertant KH3112 which was produced by transforming with DNA containing a part of the orf144b gene of KD8301 showed that the resistances to MC, UV and γ-ray in the revertant were fully restored at a level equal to the wild type. Thus, the orf144b gene required for the multiple-DNA-damaging agent resistance of Dr was designated with the name of pprA (Pleiotropic gene promoting DNA repair). This new gene can express in E. coli at very high level, and make the host E. coli resistant to MC, UV and γ-ray. The pprA gene does not express in normal Dr, but it can be induced to express by treatment with MC, UV and γ-ray. It was thought that the PprA polypeptide is a cytoplasmic protein because of the absence of characteristics found in the aa sequence of membrane proteins
Directory of Open Access Journals (Sweden)
Leclerc Xavier
2009-04-01
Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.
Gene activation by induced DNA rearrangements
International Nuclear Information System (INIS)
Schnipper, L.E.; Chan, V.; Sedivy, J.; Jat, P.; Sharp, P.A.
1989-01-01
A murine cell line (EN/NIH) containing the retroviral vector ZIPNeoSV(x)1 that was modified by deletion of the enhancer elements in the viral long terminal repeats has been used as an assay system to detect induced DNA rearrangements that result in activation of a transcriptionally silent reporter gene encoded by the viral genome. The spontaneous frequency of G418 resistance is less than 10(-7), whereas exposure to the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) or the combination of UV irradiation plus TPA resulted in the emergence of drug resistant cell lines at a frequency of 5 per 10(6) and 67 per 10(6) cells, respectively. In several of the cell lines that were analyzed a low level of amplification of one of the two parental retroviral integrants was observed, whereas in others no alteration in the region of the viral genome was detected. To determine the effect of the SV40 large T antigen on induced DNA rearrangements, EN/NIH cells were transfected with a temperature sensitive (ts) mutant of SV40 T. Transfectants were maintained at the permissive temperature (33 degrees C) for varying periods of time (1-5 days) in order to vary SV40 T antigen exposure, after which they were shifted to 39.5 degrees C for selection in G418. The frequency of emergence of drug resistant cell clones increased with duration of exposure to large T antigen (9-52 per 10(6) cells over 1-5 days, respectively), and all cell lines analyzed demonstrated DNA rearrangements in the region of the neo gene. A novel 18-kilobase pair XbaI fragment was cloned from one cell line which revealed the presence of a 2.0-kilobase pair EcoRI segment containing an inverted duplication which hybridized to neo sequences. It is likely that the observed rearrangement was initiated by the specific binding of large T antigen to the SV40 origin of replication encoded within the viral genome
Chang, Hao; Ren, Ke-feng; Zhang, He; Wang, Jin-lei; Wang, Bai-liang; Ji, Jian
2015-02-01
Vascular gene-eluting stents (GES) is a promising strategy for treatment of cardiovascular disease. Very recently, we have proved that the (protamine sulfate/plasmid DNA encoding hepatocyte growth factor) (PrS/HGF-pDNA) multilayer can serve as a powerful tool for enhancing competitiveness of endothelial cell over smooth muscle cell, which opens perspectives for the regulation of intercellular competitiveness in the field of interventional therapy. However, before the gene multilayer films could be used in vascular stents for real clinical application, the preservation of gene bioactivity during the industrial sterilization and the hemocompatibility of film should be taken into account. Actually, both are long been ignored issues in the field of gene coating for GES. In this study, we demonstrate that the (PrS/HGF-pDNA) multilayer film exhibits the good gene-protecting abilities, which is confirmed by using the industrial sterilizations (gamma irradiation and ethylene oxide) and a routine storage condition (dry state at 4°C for 30 days). Furthermore, hemocompatible measurements (such as platelet adhesion and whole blood coagulation) and antibacterial assays (bacteria adhesion and growth inhibition) indicate the good anticoagulation and antibacterial properties of the (PrS/HGF-pDNA) multilayer film. The in vivo preliminary data of angiography and histological analysis suggest that the (PrS/HGF-pDNA) multilayer coated stent can reduce the in-stent restenosis. This work reveals that the (PrS/HGF-pDNA) multilayer film could be a promising candidate as coating for GES, which is of great potential in future clinic application. © 2014 Wiley Periodicals, Inc.
Energy Technology Data Exchange (ETDEWEB)
Hoon Byeon, Jeong, E-mail: jbyeon@purdue.edu [Department of Chemistry, Purdue University, West Lafayette, Indiana 47907 (United States); Kim, Jang-Woo, E-mail: jwkim@hoseo.edu [Department of Digital Display Engineering, Hoseo University, Asan 336-795 (Korea, Republic of)
2014-02-03
Nanoscale plasmid DNA (pDNA)/polyethyleneimine (PEI) complexes were fabricated in the aerosol state using a nebulization system consisting of a collison atomizer and a cool-walled diffusion dryer. The aerosol fabricated nanoscale complexes were collected and employed to determine fundamental properties of the complexes, such as size, structure, surface charge, and in vitro gene transfection efficiency and cytotoxicity. The results showed that mass ratio between pDNA and PEI should be optimized to enhance gene transfection efficiency without a significant loss of cell viability. These findings may support practical advancements in the field of nonviral gene delivery.
Directory of Open Access Journals (Sweden)
Daniéla C Calado
2008-12-01
Full Text Available Nucleotide sequences of the internal transcribed spacer 2 (ITS2 rDNA and partial sequences of the cytochrome coxidase subunit I (COI mtDNA and white gene nDNA were obtained from specimens of Anopheles nuneztovari A collected in Macapá (state of Amapá, Óbidos, Prainha and Almeirim (state of Pará, Itacoatiara and Parintins (state of Amazonas, Brazil, and compared with previously published sequences of A. nuneztovari s.l. Results of the Bayesian phylogenetic analyses performed using either COI or combined ITS2, COI and white gene sequences suggest that An. nuneztovari B/C is distinct from specimens obtained in the Amazonas/Solimões River basin. Anopheles goeldii, currently in synonymy with An. nuneztovari, was described from individuals collected in Belterra (= Fordlândia in the Tapajós River, state of Pará, Southern Amazonas River. Morphological comparisons of the characteristics of the male genitalia indicated that An. nuneztovari A and An. goeldii are similar but distinct from An. nuneztovariB/C by the apex of the aedeagus. In considering the results of the phylogenetic analyses and morphological comparisons, An. goeldii is resurrected from synonymy with An. nuneztovari. Additionally, Anopheles dunhamiis reported for the first time in Parintins. This species can be distinguished from An. goeldiiby characters of the male genitalia and molecular data.
Methamphetamine and HIV-Tat alter murine cardiac DNA methylation and gene expression
Energy Technology Data Exchange (ETDEWEB)
Koczor, Christopher A., E-mail: ckoczor@emory.edu; Fields, Earl; Jedrzejczak, Mark J.; Jiao, Zhe; Ludaway, Tomika; Russ, Rodney; Shang, Joan; Torres, Rebecca A.; Lewis, William
2015-11-01
This study addresses the individual and combined effects of HIV-1 and methamphetamine (N-methyl-1-phenylpropan-2-amine, METH) on cardiac dysfunction in a transgenic mouse model of HIV/AIDS. METH is abused epidemically and is frequently associated with acquisition of HIV-1 infection or AIDS. We employed microarrays to identify mRNA differences in cardiac left ventricle (LV) gene expression following METH administration (10 d, 3 mg/kg/d, subcutaneously) in C57Bl/6 wild-type littermates (WT) and Tat-expressing transgenic (TG) mice. Arrays identified 880 differentially expressed genes (expression fold change > 1.5, p < 0.05) following METH exposure, Tat expression, or both. Using pathway enrichment analysis, mRNAs encoding polypeptides for calcium signaling and contractility were altered in the LV samples. Correlative DNA methylation analysis revealed significant LV DNA methylation changes following METH exposure and Tat expression. By combining these data sets, 38 gene promoters (27 related to METH, 11 related to Tat) exhibited differences by both methods of analysis. Among those, only the promoter for CACNA1C that encodes L-type calcium channel Cav1.2 displayed DNA methylation changes concordant with its gene expression change. Quantitative PCR verified that Cav1.2 LV mRNA abundance doubled following METH. Correlative immunoblots specific for Cav1.2 revealed a 3.5-fold increase in protein abundance in METH LVs. Data implicate Cav1.2 in calcium dysregulation and hypercontractility in the murine LV exposed to METH. They suggest a pathogenetic role for METH exposure to promote LV dysfunction that outweighs Tat-induced effects. - Highlights: • HIV-1 Tat and methamphetamine (METH) alter cardiac gene expression and epigenetics. • METH impacts gene expression or epigenetics more significantly than Tat expression. • METH alters cardiac mitochondrial function and calcium signaling independent of Tat. • METH alters DNA methylation, expression, and protein abundance of
Methamphetamine and HIV-Tat alter murine cardiac DNA methylation and gene expression
International Nuclear Information System (INIS)
Koczor, Christopher A.; Fields, Earl; Jedrzejczak, Mark J.; Jiao, Zhe; Ludaway, Tomika; Russ, Rodney; Shang, Joan; Torres, Rebecca A.; Lewis, William
2015-01-01
This study addresses the individual and combined effects of HIV-1 and methamphetamine (N-methyl-1-phenylpropan-2-amine, METH) on cardiac dysfunction in a transgenic mouse model of HIV/AIDS. METH is abused epidemically and is frequently associated with acquisition of HIV-1 infection or AIDS. We employed microarrays to identify mRNA differences in cardiac left ventricle (LV) gene expression following METH administration (10 d, 3 mg/kg/d, subcutaneously) in C57Bl/6 wild-type littermates (WT) and Tat-expressing transgenic (TG) mice. Arrays identified 880 differentially expressed genes (expression fold change > 1.5, p < 0.05) following METH exposure, Tat expression, or both. Using pathway enrichment analysis, mRNAs encoding polypeptides for calcium signaling and contractility were altered in the LV samples. Correlative DNA methylation analysis revealed significant LV DNA methylation changes following METH exposure and Tat expression. By combining these data sets, 38 gene promoters (27 related to METH, 11 related to Tat) exhibited differences by both methods of analysis. Among those, only the promoter for CACNA1C that encodes L-type calcium channel Cav1.2 displayed DNA methylation changes concordant with its gene expression change. Quantitative PCR verified that Cav1.2 LV mRNA abundance doubled following METH. Correlative immunoblots specific for Cav1.2 revealed a 3.5-fold increase in protein abundance in METH LVs. Data implicate Cav1.2 in calcium dysregulation and hypercontractility in the murine LV exposed to METH. They suggest a pathogenetic role for METH exposure to promote LV dysfunction that outweighs Tat-induced effects. - Highlights: • HIV-1 Tat and methamphetamine (METH) alter cardiac gene expression and epigenetics. • METH impacts gene expression or epigenetics more significantly than Tat expression. • METH alters cardiac mitochondrial function and calcium signaling independent of Tat. • METH alters DNA methylation, expression, and protein abundance of
Mapping of gene transcripts by nuclease protection assays and cDNA primer extension
International Nuclear Information System (INIS)
Calzone, F.J.; Britten, R.J.; Davidson, E.J.
1987-01-01
An important problem often faced in the molecular characterization of genes is the precise mapping of those genomic sequences transcribed into RNA. This requires identification of the genomic site initiating gene transcription, the location of genomic sequences removed from the primary gene transcript during RNA processing, and knowledge of sequences terminating the processed gene transcript. The objective of the protocols described here is the generation of transcription maps utilizing relatively uncharacterized gene fragments. The basic approach is hybridization of a single-stranded DNA probe with cellular RNA, followed by treatment with a single-strand-specific nuclease that does not attack DNA-RNA hybrids, in order to destroy any unreacted probe sequences. Thus the probe sequences included in the hybrid duplexes are protected from nuclease digestion. The sizes of the protected probe fragments determined by gel electrophoresis correspond to the lengths of the hybridized sequence elements
Singh, Kamaleshwar P; Treas, Justin; Tyagi, Tulika; Gao, Weimin
2012-03-01
Prolonged exposure to elevated levels of estrogen is a risk factor for breast cancer. Though increased cell growth and loss of DNA repair capacity is one of the proposed mechanisms for estrogen-induced cancers, the mechanism through which estrogen induces cell growth and decreases DNA repair capacity is not clear. DNA hypermethylation is known to inactivate DNA repair genes and apoptotic response in cancer cells. Therefore, the objective of this study was to determine the role of DNA hypermethylation in estrogen-induced cell growth and regulation of DNA repair genes expression in breast cancer cells. To achieve this objective, the estrogen-responsive MCF-7 cells either pretreated with 5-aza-2-deoxycytidine (5-aza-dC) or untreated (as control) were exposed to 17 beta-estradiol (E2), and its effect on cell growth and expression of DNA repair genes were measured. The result revealed that 5-aza-dC abrogates the E2-induced growth in MCF-7 cells. An increased expression of OGG1, MSH4, and MLH1 by 5-aza-dC treatment alone, suggest the DNA hypermethylation as a potential cause for decreased expression of these genes in MCF-7 cells. The decreased expression of ERCC1, XPC, OGG1, and MLH1 by E2 alone and its restoration by co-treatment with 5-aza-dC further suggest that E2 reduces the expression of these DNA repair genes potentially through promoter hypermethylation. Reactivation of mismatch repair (MMR) gene MLH1 and abrogation of E2-induced cell growth by 5-aza-dC treatment suggest that estrogen causes increased growth in breast cancer cells potentially through the inhibition of MMR-mediated apoptotic response. In summary, this study suggests that estrogen increases cell growth and decreases the DNA repair capacity in breast cancer cells, at least in part, through epigenetic mechanism. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Assembly of a biocompatible triazole-linked gene by one-pot click-DNA ligation
Kukwikila, Mikiembo; Gale, Nittaya; El-Sagheer, Afaf H.; Brown, Tom; Tavassoli, Ali
2017-11-01
The chemical synthesis of oligonucleotides and their enzyme-mediated assembly into genes and genomes has significantly advanced multiple scientific disciplines. However, these approaches are not without their shortcomings; enzymatic amplification and ligation of oligonucleotides into genes and genomes makes automation challenging, and site-specific incorporation of epigenetic information and/or modified bases into large constructs is not feasible. Here we present a fully chemical one-pot method for the assembly of oligonucleotides into a gene by click-DNA ligation. We synthesize the 335 base-pair gene that encodes the green fluorescent protein iLOV from ten functionalized oligonucleotides that contain 5ʹ-azide and 3ʹ-alkyne units. The resulting click-linked iLOV gene contains eight triazoles at the sites of chemical ligation, and yet is fully biocompatible; it is replicated by DNA polymerases in vitro and encodes a functional iLOV protein in Escherichia coli. We demonstrate the power and potential of our one-pot gene-assembly method by preparing an epigenetically modified variant of the iLOV gene.
Directory of Open Access Journals (Sweden)
Olson Matthew S
2010-01-01
Full Text Available Abstract Background Although rapid changes in copy number and gene order are common within plant mitochondrial genomes, associated patterns of gene transcription are underinvestigated. Previous studies have shown that the gynodioecious plant species Silene vulgaris exhibits high mitochondrial diversity and occasional paternal inheritance of mitochondrial markers. Here we address whether variation in DNA molecular markers is correlated with variation in transcription of mitochondrial genes in S. vulgaris collected from natural populations. Results We analyzed RFLP variation in two mitochondrial genes, cox1 and atp1, in offspring of ten plants from a natural population of S. vulgaris in Central Europe. We also investigated transcription profiles of the atp1 and cox1 genes. Most DNA haplotypes and transcription profiles were maternally inherited; for these, transcription profiles were associated with specific mitochondrial DNA haplotypes. One individual exhibited a pattern consistent with paternal inheritance of mitochondrial DNA; this individual exhibited a transcription profile suggestive of paternal but inconsistent with maternal inheritance. We found no associations between gender and transcript profiles. Conclusions Specific transcription profiles of mitochondrial genes were associated with specific mitochondrial DNA haplotypes in a natural population of a gynodioecious species S. vulgaris. Our findings suggest the potential for a causal association between rearrangements in the plant mt genome and transcription product variation.
Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong
2010-01-01
Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.
Liu, Qian
2010-07-01
Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.
Directory of Open Access Journals (Sweden)
Sasha J. Rose
2016-12-01
Full Text Available Extracellular DNA (eDNA is an integral biofilm matrix component of numerous pathogens, including nontuberculous mycobacteria (NTM. Cell lysis is the source of eDNA in certain bacteria, but the source of eDNA remains unidentified for NTM, as well as for other eDNA-containing bacterial species. In this study, conditions affecting eDNA export were examined, and genes involved with the eDNA export mechanism were identified. After a method for monitoring eDNA in real time in undisturbed biofilms was established, different conditions affecting eDNA were investigated. Bicarbonate positively influenced eDNA export in a pH-independent manner in Mycobacterium avium, M. abscessus, and M. chelonae. The surface-exposed proteome of M. avium in eDNA-containing biofilms revealed abundant carbonic anhydrases. Chemical inhibition of carbonic anhydrases with ethoxzolamide significantly reduced eDNA export. An unbiased transposon mutant library screen for eDNA export in M. avium identified many severely eDNA-attenuated mutants, including one not expressing a unique FtsK/SpoIIIE-like DNA-transporting pore, two with inactivation of carbonic anhydrases, and nine with inactivation of genes belonging to a unique genomic region, as well as numerous mutants involved in metabolism and energy production. Complementation of nine mutants that included the FtsK/SpoIIIE and carbonic anhydrase significantly restored eDNA export. Interestingly, several attenuated eDNA mutants have mutations in genes encoding proteins that were found with the surface proteomics, and many more mutations are localized in operons potentially encoding surface proteins. Collectively, our data strengthen the evidence of eDNA export being an active mechanism that is activated by the bacterium responding to bicarbonate.
DNA mutation motifs in the genes associated with inherited diseases.
Directory of Open Access Journals (Sweden)
Michal Růžička
Full Text Available Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs rarely associated with mutations (coldspots and frequently associated with mutations (hotspots exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.
Culyba, Matthew J; Kubiak, Jeffrey M; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M
2018-06-01
Biochemical pathways are often genetically encoded as simple transcription regulation networks, where one transcription factor regulates the expression of multiple genes in a pathway. The relative timing of each promoter's activation and shut-off within the network can impact physiology. In the DNA damage repair pathway (known as the SOS response) of Escherichia coli, approximately 40 genes are regulated by the LexA repressor. After a DNA damaging event, LexA degradation triggers SOS gene transcription, which is temporally separated into subsets of 'early', 'middle', and 'late' genes. Although this feature plays an important role in regulating the SOS response, both the range of this separation and its underlying mechanism are not experimentally defined. Here we show that, at low doses of DNA damage, the timing of promoter activities is not separated. Instead, timing differences only emerge at higher levels of DNA damage and increase as a function of DNA damage dose. To understand mechanism, we derived a series of synthetic SOS gene promoters which vary in LexA-operator binding kinetics, but are otherwise identical, and then studied their activity over a large dose-range of DNA damage. In distinction to established models based on rapid equilibrium assumptions, the data best fit a kinetic model of repressor occupancy at promoters, where the drop in cellular LexA levels associated with higher doses of DNA damage leads to non-equilibrium binding kinetics of LexA at operators. Operators with slow LexA binding kinetics achieve their minimal occupancy state at later times than operators with fast binding kinetics, resulting in a time separation of peak promoter activity between genes. These data provide insight into this remarkable feature of the SOS pathway by demonstrating how a single transcription factor can be employed to control the relative timing of each gene's transcription as a function of stimulus dose.
DEFF Research Database (Denmark)
Sonne, Si Brask; Yadav, Rachita; Yin, Guangliang
2017-01-01
The present study aimed to identify genes exhibiting concomitant obesity-dependent changes in DNA methylation and gene expression in adipose tissues in the mouse using diet-induced obese (DIO) C57BL/6J and genetically obese ob/ob mice as models. Mature adipocytes were isolated from epididymal...... and inguinal adipose tissues of ob/ob and DIO C57BL/6J mice. DNA methylation was analyzed by MeDIP-sequencing and gene expression by microarray analysis. The majority of differentially methylated regions (DMRs) were hypomethylated in obese mice. Global methylation of long interspersed elements indicated......57BL/6J mice occurred primarily in exons, whereas inguinal adipocytes of ob/ob mice exhibited a higher enrichment of DMRs in promoter regions than in other regions of the genome, suggesting an influence of leptin on DNA methylation in inguinal adipocytes. We observed altered methylation...
Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter
International Nuclear Information System (INIS)
Dávalos-Salas, Mercedes; Furlan-Magaril, Mayra; González-Buendía, Edgar; Valdes-Quezada, Christian; Ayala-Ortega, Erandi; Recillas-Targa, Félix
2011-01-01
Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb) gene promoter in different tumoral cell lines. To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing
Directory of Open Access Journals (Sweden)
Regiane de Fátima Travensolo
2009-06-01
Full Text Available DNA Microarray was developed to monitor the expression of many genes from Xylella fastidiosa, allowing the side by-side comparison of two situations in a single experiment. The experiments were performed using X. fastidiosa cells grown in two culture media: BCYE and XDM2. The primers were synthesized, spotted onto glass slides and the array was hybridized against fluorescently labeled cDNAs. The emitted signals were quantified, normalized and the data were statistically analyzed to verify the differentially expressed genes. According to the data, 104 genes were differentially expressed in XDM2 and 30 genes in BCYE media. The present study showed that DNA microarray technique efficiently differentiate the expressed genes under different conditions.DNA Microarray foi desenvolvida para monitorar a expressão de muitos genes de Xylella fastidiosa, permitindo a comparação de duas situações distintas em um único experimento. Os experimentos foram feitos utilizando células de X. fastidiosa cultivada em dois meios de cultura: BCYE e XDM2. Pares de oligonucleotídeos iniciadores foram sintetizados, depositados em lâminas de vidro e o arranjo foi hibridizado contra cDNAs marcados fluorescentemente. Os sinais emitidos foram quantificados, normalizados e os dados foram estatisticamente analisados para verificar os genes diferencialmente expressos. De acordo com nossos dados, 104 genes foram diferencialmente expressos para o meio de cultura XDM2 e 30 genes para o BCYE. No presente estudo, nós demonstramos que a técnica de DNA microarrays eficientemente diferencia genes expressos sob diferentes condições de cultivo.
Leshinsky-Silver, E; Michelson, M; Cohen, S; Ginsberg, M; Sadeh, M; Barash, V; Lerman-Sagie, T; Lev, D
2008-07-01
Isolated mitochondrial myopathies (IMM) are either due to primary defects in mtDNA, in nuclear genes that control mtDNA abundance and structure such as thymidine kinase 2 (TK2), or due to CoQ deficiency. Defects in the TK2 gene have been found to be associated with mtDNA depletion attributed to a depleted mitochondrial dNTP pool in non-dividing cells. We report an unusual case of IMM, homozygous for the H90N mutation in the TK2 gene but unlike other cases with the same mutation, does not demonstrate mtDNA depletion. The patient's clinical course is relatively mild and a muscle biopsy showed ragged red muscle fibers with a mild decrease in complexes I and an increase in complexes IV and II activities. This report extends the phenotypic expression of TK2 defects and suggests that all patients who present with an IMM even with normal quantities of mtDNA should be screened for TK2 mutations.
Directory of Open Access Journals (Sweden)
Yu-Hoon Kim
2014-01-01
Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.
International Nuclear Information System (INIS)
Wilding, Craig S.; Relton, Caroline L.; Rees, Gwen S.; Tarone, Robert E.; Whitehouse, Caroline A.; Tawn, E. Janet
2005-01-01
Polymorphic variation in DNA repair genes was examined in a group of retired workers from the British Nuclear Fuels plc facility at Sellafield in relation to previously determined translocation frequencies in peripheral blood lymphocytes. Variation at seven polymorphisms in four genes involved in the base excision repair (XRCC1 R194W, R399Q and a [AC] n microsatellite in the 3' UTR) and double strand break repair (XRCC3 T241M and a [AC] n microsatellite in intron 3 of XRCC3, XRCC4 I134T, and a GACTAn microsatellite located 120kb 5' of XRCC5) pathways was determined for 291 retired radiation workers who had received cumulative occupational external radiation doses of between 0 and 1873mSv. When the interaction between radiation dose and each DNA repair gene polymorphism was examined in relation to translocation frequency there was no evidence for any of the polymorphisms studied influencing the response to occupational exposure. A positive interaction observed between genotype (individuals with at least one allele >=20 repeat units) at a microsatellite locus in the XRCC3 gene and smoking status should be interpreted cautiously because interactions were investigated for seven polymorphisms and two exposures. Nonetheless, further research is warranted to examine whether this DNA repair gene variant might be associated with a sub-optimal repair response to smoking-induced DNA damage and hence an increased frequency of translocations
Corruption of the intra-gene DNA methylation architecture is a hallmark of cancer.
Bartlett, Thomas E; Zaikin, Alexey; Olhede, Sofia C; West, James; Teschendorff, Andrew E; Widschwendter, Martin
2013-01-01
Epigenetic processes--including DNA methylation--are increasingly seen as having a fundamental role in chronic diseases like cancer. It is well known that methylation levels at particular genes or loci differ between normal and diseased tissue. Here we investigate whether the intra-gene methylation architecture is corrupted in cancer and whether the variability of levels of methylation of individual CpGs within a defined gene is able to discriminate cancerous from normal tissue, and is associated with heterogeneous tumour phenotype, as defined by gene expression. We analysed 270985 CpGs annotated to 18272 genes, in 3284 cancerous and 681 normal samples, corresponding to 14 different cancer types. In doing so, we found novel differences in intra-gene methylation pattern across phenotypes, particularly in those genes which are crucial for stem cell biology; our measures of intra-gene methylation architecture are a better determinant of phenotype than measures based on mean methylation level alone (K-S test [Formula: see text] in all 14 diseases tested). These per-gene methylation measures also represent a considerable reduction in complexity, compared to conventional per-CpG beta-values. Our findings strongly support the view that intra-gene methylation architecture has great clinical potential for the development of DNA-based cancer biomarkers.
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
Coordinate regulation of stromelysin and collagenase genes determined with cDNA probes
International Nuclear Information System (INIS)
Frisch, S.M.; Clark, E.J.; Werb, Z.
1987-01-01
Secreted proteinases are required for tumor metastasis, angiogenesis, and tissue remodeling during wound healing and embryonic growth. Thus, the regulation of the genes of secreted proteinases may serve as an interesting model for growth-controlled genes in general. The authors studied the genes of the secreted proteinases stromelysin and collagenase by using molecularly cloned cDNAs from each proteinase. Stromelysin cDNA was cloned by differential screening of a total cDNA library from rabbit synovial cells treated with phorbol 12-myristate 13-acetate, which yielded a clone of 1.2 kilobase pairs; collagenase cDNA was obtained by cloning reverse transcripts of anti-collagenase-immunoadsorbed polysomal mRNA, which yielded a clone of 0.8 kilobase pairs. Stromelysin and collagenase mRNA species of 2.2 and 2.4 kilobases, respectively, were detected on hybridization blots of RNA from phorbol 12-myristate 13-acetate-treated but not untreated rabbit synovial cells. Expression of stromelysin mRNA was also induced in rabbit alveolar macrophages and rabbit brain capillary endothelial cells treated with phorbol 12-myristate 13-acetate. Stromelysin and collagenase mRNA were both induced by phorbol 12-myristate 13-acetate and cytochalasin B at a constant ratio of the two gene products; this suggest coordinate regulation. The fact that induction was blocked after inhibition of protein synthesis by cycloheximide implicates an indirect signal transduction pathway that requires new protein synthesis
A novel Listeria monocytogenes-based DNA delivery system for cancer gene therapy.
LENUS (Irish Health Repository)
van Pijkeren, Jan Peter
2012-01-31
Bacteria-mediated transfer of plasmid DNA to mammalian cells (bactofection) has been shown to have significant potential as an approach to express heterologous proteins in various cell types. This is achieved through entry of the entire bacterium into cells, followed by release of plasmid DNA. In a murine model, we show that Listeria monocytogenes can invade and spread in tumors, and establish the use of Listeria to deliver genes to tumors in vivo. A novel approach to vector lysis and release of plasmid DNA through antibiotic administration was developed. Ampicillin administration facilitated both plasmid transfer and safety control of vector. To further improve on the gene delivery system, we selected a Listeria monocytogenes derivative that is more sensitive to ampicillin, and less pathogenic than the wild-type strain. Incorporation of a eukaryotic-transcribed lysin cassette in the plasmid further increased bacterial lysis. Successful gene delivery of firefly luciferase to growing tumors in murine models and to patient breast tumor samples ex vivo was achieved. The model described encompasses a three-phase treatment regimen, involving (1) intratumoral administration of vector followed by a period of vector spread, (2) systemic ampicillin administration to induce vector lysis and plasmid transfer, and (3) systemic administration of combined moxifloxacin and ampicillin to eliminate systemic vector. For the first time, our results reveal the potential of Listeria monocytogenes for in vivo gene delivery.
The role of DNA barcodes in understanding and conservation of mammal diversity in southeast Asia.
Directory of Open Access Journals (Sweden)
Charles M Francis
Full Text Available BACKGROUND: Southeast Asia is recognized as a region of very high biodiversity, much of which is currently at risk due to habitat loss and other threats. However, many aspects of this diversity, even for relatively well-known groups such as mammals, are poorly known, limiting ability to develop conservation plans. This study examines the value of DNA barcodes, sequences of the mitochondrial COI gene, to enhance understanding of mammalian diversity in the region and hence to aid conservation planning. METHODOLOGY AND PRINCIPAL FINDINGS: DNA barcodes were obtained from nearly 1900 specimens representing 165 recognized species of bats. All morphologically or acoustically distinct species, based on classical taxonomy, could be discriminated with DNA barcodes except four closely allied species pairs. Many currently recognized species contained multiple barcode lineages, often with deep divergence suggesting unrecognized species. In addition, most widespread species showed substantial genetic differentiation across their distributions. Our results suggest that mammal species richness within the region may be underestimated by at least 50%, and there are higher levels of endemism and greater intra-specific population structure than previously recognized. CONCLUSIONS: DNA barcodes can aid conservation and research by assisting field workers in identifying species, by helping taxonomists determine species groups needing more detailed analysis, and by facilitating the recognition of the appropriate units and scales for conservation planning.
Liu, Yunlong; Wu, Haiping; Zhou, Qiang; Song, Qinxin; Rui, Jianzhong; Zou, Bingjie; Zhou, Guohua
2017-06-15
Aberrations of gene methylation in stool DNA (sDNA) is an effective biomarker for non-invasive colorectal cancer diagnosis. However, it is challenging to accurately quantitate the gene methylation levels in sDNA due to the low abundance and degradation of sDNA. In this study, a digital quantification strategy was proposed by combining emulsion PCR (emPCR) with hydrogel immobilized bead-array. The assay includes following steps: bisulfite conversion of sDNA, pre-amplification by PCR with specific primers containing 5' universal sequences, emPCR of pre-amplicons with beaded primers to achieve single-molecular amplification and identification of hydrogel embedding beads coated with amplicons. The sensitivity and the specificity of the method are high enough to pick up 0.05% methylated targets from unmethylated DNA background. The successful detection of hypermethylated vimentin gene in clinical stool samples suggests that the proposed method should be a potential tool for non-invasive colorectal cancer screening. Copyright © 2016 Elsevier B.V. All rights reserved.
A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.
Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M
2017-11-17
The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.
Diversity of marine planktonic ostracods in South China Sea: a DNA taxonomy approach.
Xu, Lei; Wang, Lianggen; Ning, Jiajia; Li, Hong; Ji, Yingying; Du, Feiyan
2018-04-19
Ostracods (Crustacea, Ostracoda) are small bivalved crustaceans, contributing over 200 described species to the marine zooplankton community. They are widely distributed and are relatively abundant components of the mesozooplankton, playing an important role in the transport of organic matter to deep layers. However, identification of ostracods based on micro-morphological characters is extremely difficult and time-consuming. Previous fragmentary taxonomic studies of ostracods in the South China Sea (SCA), were based solely on morphology. Here, by analysing the mitochondrial COI gene, we explore the taxa across the SCA using molecular tools for the first time. Our results show that sequence divergence among species varies within a large range, from 12.93% to 35.82%. Sixteen of the taxonomic units recovered by DNA taxonomy agree well with morphology, but Paraconchoecia oblonga, Conchoecia magna and Halocypris brevirostris split into two clades each, each of which contains cryptic species.
DNA probe labeling with digoxigenin-dUTP and its application in gene diagnosis
International Nuclear Information System (INIS)
Liu Guoyang
1992-01-01
DNA probe labeling by the randomly primed incorporation of digoxigenin-dUTP is reported. The sensitivity of color reaction and hybridization were 32 fg and 200 fg, respectively, and both were specific for the target. Single-copy and multi-copy gene fragments among 2 μg human genomic DNA were detected by β IVS II, Fr 3-42 and 3'HVR labeled with digoxigenin-dUTP. The results were consistent with a radioactive control assay. This method has been successfully used in the gene diagnosis of adult polycystic kidney disease
CDKL5 is a brain MeCP2 target gene regulated by DNA methylation.
Carouge, Delphine; Host, Lionel; Aunis, Dominique; Zwiller, Jean; Anglard, Patrick
2010-06-01
Rett syndrome and its "early-onset seizure" variant are severe neurodevelopmental disorders associated with mutations within the MECP2 and the CDKL5 genes. Antidepressants and drugs of abuse induce the expression of the epigenetic factor MeCP2, thereby influencing chromatin remodeling. We show that increased MeCP2 levels resulted in the repression of Cdkl5 in rat brain structures in response to cocaine, as well as in cells exposed to serotonin, or overexpressing MeCP2. In contrast, Cdkl5 was induced by siRNA-mediated knockdown of Mecp2 and by DNA-methyltransferase inhibitors, demonstrating its regulation by MeCP2 and by DNA methylation. Cdkl5 gene methylation and its methylation-dependent binding to MeCP2 were increased in the striatum of cocaine-treated rats. Our data demonstrate that Cdkl5 is a MeCP2-repressed target gene providing a link between genes the mutation of which generates overlapping symptoms. They highlight DNA methylation changes as a potential mechanism participating in the long-term plasticity triggered by pharmacological agents.
Cloning of the PYR3 gene of Ustilago maydis and its use in DNA transformation
Energy Technology Data Exchange (ETDEWEB)
Banks, G.R.; Taylor, S.Y. (National Institute for Medical Research, London (England))
1988-12-01
The Ustilago maydis PYR3 gene encoding dihydroorotase activity was cloned by direct complementation of Escherichia coli pyrC mutations. PYR3 transformants of E. coli pyrC mutants expressed homologous transcripts of a variety of sizes and regained dihydroorotase activity. PYR3 also complemented Saccharomyces cerevisiae ura4 mutations, and again multiple transcripts were expressed in transformants, and enzyme activity was regained. A 1.25-kilobase poly(rA)+ PYR3 transcript was detected in U. maydis itself. Linear DNA carrying the PYR3 gene transformed a U. maydis pyr3-1 pyrimidine auxotroph to prototrophy. Hybridization analysis revealed that three different types of transformants could be generated, depending on the structure of the transforming DNA used. The first type involved exchange of chromosomal mutant gene sequences with the cloned wild-type plasmid sequences. A second type had integrated linear transforming DNA at the chromosomal PYR3 locus, probably via a single crossover event. The third type had integrated transforming DNA sequences at multiple sites in the U. maydis genome. In the last two types, tandemly reiterated copies of the transforming DNA were found to have been integrated. All three types had lost the sensitivity of the parental pyr3-1 mutant to UV irradiation. They had also regained dihydroorotase activity, although its level did not correlate with the PYR3 gene copy number.
Development and validation of an integrated DNA walking strategy to detect GMO expressing cry genes.
Fraiture, Marie-Alice; Vandamme, Julie; Herman, Philippe; Roosens, Nancy H C
2018-06-27
Recently, an integrated DNA walking strategy has been proposed to prove the presence of GMO via the characterisation of sequences of interest, including their transgene flanking regions and the unnatural associations of elements in their transgenic cassettes. To this end, the p35S, tNOS and t35S pCAMBIA elements have been selected as key targets, allowing the coverage of most of GMO, EU authorized or not. In the present study, a bidirectional DNA walking method anchored on the CryAb/c genes is proposed with the aim to cover additional GMO and additional sequences of interest. The performance of the proposed bidirectional DNA walking method anchored on the CryAb/c genes has been evaluated in a first time for its feasibility using several GM events possessing these CryAb/c genes. Afterwards, its sensitivity has been investigated through low concentrations of targets (as low as 20 HGE). In addition, to illustrate its applicability, the entire workflow has been tested on a sample mimicking food/feed matrices analysed in GMO routine analysis. Given the successful assessment of its performance, the present bidirectional DNA walking method anchored on the CryAb/c genes can easily be implemented in GMO routine analysis by the enforcement laboratories and allows completing the entire DNA walking strategy in targeting an additional transgenic element frequently found in GMO.
Schneider, Dominik; Wemheuer, Franziska; Pfeiffer, Birgit; Wemheuer, Bernd
2017-01-01
Microbial communities play an important role in marine ecosystem processes. Although the number of studies targeting marker genes such as the 16S rRNA gene has been increased in the last few years, the vast majority of marine diversity is rather unexplored. Moreover, most studies focused on the entire bacterial community and thus disregarded active microbial community players. Here, we describe a detailed protocol for the simultaneous extraction of DNA and RNA from marine water samples and for the generation of cDNA from the isolated RNA which can be used as a universal template in various marker gene studies.
International Nuclear Information System (INIS)
Lohrer, H.
1987-01-01
The presented paper describes experiments concerning the alteration of radiosensitivity of eucaryotic cells after gene transfer. Ionizing radiation (γ- or X-ray) induces DNA single- or double strand breaks, which are religated by an unknown repair system. Repair deficient cells are highly sensitive to ionizing radiation. In the experiments described, cells from a patient with the heritable disease Ataxia telangiectasia were used as well as two X-ray sensitive CHO mutant cell lines. After gene transfer of an intact human DNA repair gene or a metallothionein gene the cells should regain radioresistance. (orig.) [de
Directory of Open Access Journals (Sweden)
Ma G
2013-03-01
Full Text Available Guilei Ma,1,# Yong Wang,1,# Ilia Fishbein,2 Mei Yu,1 Linhua Zhang,1 Ivan S Alferiev,2 Jing Yang,1 Cunxian Song,1 Robert J Levy2 1Institute of Biomedical Engineering, Chinese Academy of Medical Sciences and Peking Union Medical College, Tianjin, People's Republic of China; 2Children's Hospital of Philadelphia, Abramson Research Building, Philadelphia, PA, USA #These authors contributed equally to this work Purpose: To investigate the anchoring of plasmid DNA/anti-DNA antibody/cationic lipid tri-complex (DAC micelles onto bisphosphonate-modified 316 L coronary stents for cardiovascular site-specific gene delivery. Methods: Stents were first modified with polyallylamine bisphosphonate (PAA-BP, thereby enabling the retention of a PAA-BP molecular monolayer that permits the anchoring (via vector-binding molecules of DAC micelles. DAC micelles were then chemically linked onto the PAA-BP-modified stents by using N-succinimidyl-3-(2-pyridyldithiol-propionate (SPDP as a crosslinker. Rhodamine-labeled DNA was used to assess the anchoring of DAC micelles, and radioactive-labeled antibody was used to evaluate binding capacity and stability. DAC micelles (encoding green fluorescent protein were tethered onto the PAA-BP-modified stents, which were assessed in cell culture. The presence of a PAA-BP molecular monolayer on the steel surface was confirmed by X-ray photoelectron spectroscopy and atomic force microscope analysis. Results: The anchoring of DAC micelles was generally uniform and devoid of large-scale patches of defects. Isotopic quantification confirmed that the amount of antibody chemically linked on the stents was 17-fold higher than that of the physical adsorbed control stents and its retention time was also significantly longer. In cell culture, numerous green fluorescent protein-positive cells were found on the PAA-BP modified stents, which demonstrated high localization and efficiency of gene delivery. Conclusion: The DAC micelle
Birla, Bhagyashree S; Chou, Hui-Hsien
2015-01-01
Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.
Directory of Open Access Journals (Sweden)
Bhagyashree S Birla
Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.
DEFF Research Database (Denmark)
Samuelsson, Frederik; Nejsum, Peter; Raundrup, Katrine
2013-01-01
as a zoonosis infecting humans. In February 2012, concurrent with the hunting of muskoxen, we examined carcasses for muscle and tissue parasites, and recorded warble larvae infestations. DNA extracted from samples of larvae was amplified targeting 579. bp of the COI gene, and subsequently sequenced...
Directory of Open Access Journals (Sweden)
Ramesh C. Gupta
2008-03-01
Full Text Available DNA damage is a pre-requisite for the initiation of cancer and agents that reduce this damage are useful in cancer prevention. In this study, we evaluated the ability of whole berries and berry phytochemical, ellagic acid to reduce endogenous oxidative DNA damage. Ellagic acid was selected based on > 95% inhibition of 8-oxodeoxyguosine (8-oxodG and other unidentified oxidative DNA adducts induced by 4-hydroxy-17B;-estradiol and CuCl2 in vitro. Inhibition of the latter occurred at lower concentrations (10 u(microM than that for 8-oxodG (100 u(microM. In the in vivo study, female CD-1 mice (n=6 were fed either a control diet or diet supplemented with ellagic acid (400 ppm and dehydrated berries (5% w/w with varying ellagic acid contents -- blueberry (low, strawberry (medium and red raspberry (high, for 3 weeks. Blueberry and strawberry diets showed moderate reductions in endogenous DNA adducts (25%. However, both red raspberry and ellagic acid diets showed a significant reduction of 59% (p < 0.001 and 48% (p < 0.01, respectively. Both diets also resulted in a 3-8 fold over-expression of genes involved in DNA repair such as xeroderma pigmentosum group A complementing protein (XPA, DNA excision repair protein (ERCC5 and DNA ligase III (DNL3. These results suggest that red raspberry and ellagic acid reduce endogenous oxidative DNA damage by mechanisms which may involve increase in DNA repair.
Rathinam, T; Gadde, U; Chapman, H D
2015-07-01
Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.
Application of DNA chips in the analysis of gene mutation in HBV
International Nuclear Information System (INIS)
Wang Yongzhong; Ruan Lihua; Zhou Guoping; Wu Guoxiang; Chen Min
2005-01-01
Objective: To investigate the clinical applicability of DNA chips for analysis of gene mutation in HBV. Methods: Serum HBV DNA from 47 patients with viral hepatitis type B was amplified with PCR. Possible gene mutations were searched for in site 1896 of pre-C section, sites 1762,1764 of BCP section and sites 528, 552 of P section with DNA chip method based upon membrane coloration. Results: In the 32 patients without lamivudine treatment, the results were as follows: (1) 6 specimens with HBsAg + , HBeAg + , HBeAb - , no mutations observed. (2) 13 specimens with HBsAg + , HBeAg - , HBeAb + , mutations at site 1896, pre- C 4 cases, mutations at sites 1762,1764, BCP 11 cases. (3) 13 specimens with HBsAg + , HBeAg + , HBeAb + , mutations at site 1896 pre -C 4 cases, mutations at sites 1762,1764 BCP 13 cases. In the 15 patients after 48 weeks treatment with lamivudine but remained HBV DNA positive, mutations were observed at: site 1896 pre-C, 5 cases, sites 1762,1764 BCP, 6 cases, site 528 P section, 2 cases, site 552 P section, YVDD 4 cases, YIDD 7 cases. Conclusion: Mutations at sites 1896, 1762,1764 were more frequent in patients with HBeAb + and were related to the negative expression of HBeAg, Mutations at 1762,1764 BCP were closely related to the changes of HBeAg/HBeAb. P section mutations were only observed after lamivadine treatment and were related to resistance against the drug. DNA chip method based upon membrane coloration for detection of gene mutation was expedient and specific and worth popularization. (authors)
Failla, A J; Vasquez, A A; Hudson, P; Fujimoto, M; Ram, J L
2016-02-01
Establishing reliable methods for the identification of benthic chironomid communities is important due to their significant contribution to biomass, ecology and the aquatic food web. Immature larval specimens are more difficult to identify to species level by traditional morphological methods than their fully developed adult counterparts, and few keys are available to identify the larval species. In order to develop molecular criteria to identify species of chironomid larvae, larval and adult chironomids from Western Lake Erie were subjected to both molecular and morphological taxonomic analysis. Mitochondrial cytochrome c oxidase I (COI) barcode sequences of 33 adults that were identified to species level by morphological methods were grouped with COI sequences of 189 larvae in a neighbor-joining taxon-ID tree. Most of these larvae could be identified only to genus level by morphological taxonomy (only 22 of the 189 sequenced larvae could be identified to species level). The taxon-ID tree of larval sequences had 45 operational taxonomic units (OTUs, defined as clusters with >97% identity or individual sequences differing from nearest neighbors by >3%; supported by analysis of all larval pairwise differences), of which seven could be identified to species or 'species group' level by larval morphology. Reference sequences from the GenBank and BOLD databases assigned six larval OTUs with presumptive species level identifications and confirmed one previously assigned species level identification. Sequences from morphologically identified adults in the present study grouped with and further classified the identity of 13 larval OTUs. The use of morphological identification and subsequent DNA barcoding of adult chironomids proved to be beneficial in revealing possible species level identifications of larval specimens. Sequence data from this study also contribute to currently inadequate public databases relevant to the Great Lakes region, while the neighbor
Xu, Dongdong; Li, Sanlei; Lou, Bao; Zhang, Yurong; Zhan, Wei; Shi, Huilai
2012-07-01
Japanese flounder is one of the most important commercial species in China; however, information on the genetic background of natural populations in China seas is scarce. The lack of genetic data has hampered fishery management and aquaculture development programs for this species. In the present study, we have analyzed the genetic diversity in natural populations of Japanese flounder sampled from the Yellow Sea (Qingdao population, QD) and East China Sea (Zhoushan population, ZS) using 10 polymorphic microsatellite loci and cytochrome c oxidase subunit I (COI) sequencing data. A total of 68 different alleles were observed over 10 microsatellite loci. The total number of alleles per locus ranged from 2 to 9, and the number of genotypes per locus ranged from 3 to 45. The observed heterozygosity and expected heterozygosity in QD were 0.733 and 0.779, respectively, and in ZS the heterozygosity values were 0.708 and 0.783, respectively. Significant departures from Hardy-Weinberg equilibrium were observed in 7 of the 10 microsatellite loci in each of the two populations. The COI sequencing analysis revealed 25 polymorphic sites and 15 haplotypes in the two populations. The haplotype diversity and nucleotide diversity in the QD population were 0.746±0.072 8 and 0.003 34±0.001 03 respectively, and in ZS population the genetic diversity values were 0.712±0.047 0 and 0.003 18±0.000 49, respectively. The microsatellite data ( F st =0.048 7, P <0.001) and mitochondrial DNA data ( F st =0.128, P <0.001) both revealed significant genetic differentiation between the two populations. The information on the genetic variation and differentiation in Japanese flounder obtained in this study could be used to set up suitable guidelines for the management and conservation of this species, as well as for managing artificial selection programs. In future studies, more geographically diverse stocks should be used to obtain a deeper understanding of the population structure of Japanese
Directory of Open Access Journals (Sweden)
Vining Kelly J
2012-01-01
Full Text Available Abstract Background DNA cytosine methylation is an epigenetic modification that has been implicated in many biological processes. However, large-scale epigenomic studies have been applied to very few plant species, and variability in methylation among specialized tissues and its relationship to gene expression is poorly understood. Results We surveyed DNA methylation from seven distinct tissue types (vegetative bud, male inflorescence [catkin], female catkin, leaf, root, xylem, phloem in the reference tree species black cottonwood (Populus trichocarpa. Using 5-methyl-cytosine DNA immunoprecipitation followed by Illumina sequencing (MeDIP-seq, we mapped a total of 129,360,151 36- or 32-mer reads to the P. trichocarpa reference genome. We validated MeDIP-seq results by bisulfite sequencing, and compared methylation and gene expression using published microarray data. Qualitative DNA methylation differences among tissues were obvious on a chromosome scale. Methylated genes had lower expression than unmethylated genes, but genes with methylation in transcribed regions ("gene body methylation" had even lower expression than genes with promoter methylation. Promoter methylation was more frequent than gene body methylation in all tissues except male catkins. Male catkins differed in demethylation of particular transposable element categories, in level of gene body methylation, and in expression range of genes with methylated transcribed regions. Tissue-specific gene expression patterns were correlated with both gene body and promoter methylation. Conclusions We found striking differences among tissues in methylation, which were apparent at the chromosomal scale and when genes and transposable elements were examined. In contrast to other studies in plants, gene body methylation had a more repressive effect on transcription than promoter methylation.
The Tyrosyl-DNA Phosphodiesterase 1β (Tdp1β Gene Discloses an Early Response to Abiotic Stresses
Directory of Open Access Journals (Sweden)
Maria Elisa Sabatini
2017-11-01
Full Text Available Tyrosyl-DNA phosphodiesterase 1 (Tdp1 is involved in DNA repair pathways as it mends the topoisomerase I—DNA covalent complexes. In plants, a small Tdp1 gene family, composed by Tdp1α and Tdp1β genes, was identified, but the roles of these genes in abiotic stress responses are not fully understood. To investigate their specific stress response patterns, the present study made use of bioinformatic and molecular tools to look into the Tdp1β gene function, so far described only in the plant kingdom, and compare it with Tdp1α gene coding for the canonical, highly conserved α isoform. The expression profiles of Tdp1α and Tdp1β genes were examined under abiotic stress conditions (cold, heat, high osmolarity, salt, and UV-B in two model species, Arabidopsis thaliana and Medicago truncatula. The two isoforms of topoisomerase I (TOP1α and TOP1β were also taken into consideration in view of their known roles in DNA metabolism and cell proliferation. Data relative to gene expression in Arabidopsis were retrieved from the AtGenExpress microarray dataset, while quantitative Real-Time PCR was carried out to evaluate the stress response in M. truncatula cell cultures. These analyses revealed that Tdp1β gene expression was enhanced during the first hour of treatment, whereas Tdp1α enhanced expression succeeded at subsequent timepoints. In agreement with the gene-specific responses to abiotic stress conditions, the promoter regions of Tdp1α and Tdp1β genes are well equipped with stress-related cis-elements. An in-depth bioinformatic characterization of the HIRAN motif, a distinctive feature of the Tdp1β protein, showed its wide distribution in chromatin remodeling and DNA repair proteins. The reported data suggests that Tdp1β functions in the early response to abiotic stresses.
Ju, Yuman; Song, Na; Chen, Guobao; Sun, Dianrong; Han, Zhiqiang; Gao, Tianxiang
2017-06-01
A new record ponyfish, Deveximentum megalolepis Mochizuki and Hayashi, 1989, was documented based on its morphological characteristics and DNA barcode. Fifty specimens were collected from Beibu Gulf of China and identified as D. megalolepis by morphological characterization. The coloration, meristic traits, and morphometric measurements were consistent with previously published records. In general, it is a silver-white, laterally compressed and deep bodied ponyfish with 6-9 rows of scales on cheek; scale rows above lateral line 6-8; scale rows below lateral line 14-17. Mitochondrial cytochrome oxidase I subunit (COI) gene fragment was sequenced for phylogenetic analysis. There is no sequence variation of COI gene between the specimens collected in this study. The genetic distances between D. megalolepis and other congeneric species range from 3.6% to 14.0%, which were greater than the threshold for fish species delimitation. The COI sequence analysis also supported the validity of D. megalolepis at genetic level. However, the genetic distance between Chinese and Philippine individuals was about 1.2% and they formed two lineages in gene tree, which may be caused by the geographical distance.
Directory of Open Access Journals (Sweden)
Nikul Patel
2012-01-01
Full Text Available The role of aberrant DNA methylation in Ewing sarcoma is not completely understood. The methylation status of 503 genes in 52 formalin-fixed paraffin-embedded EWS tumors and 3 EWS cell lines was compared to human mesenchymal stem cell primary cultures (hMSCs using bead chip methylation analysis. Relative expression of methylated genes was assessed in 5-Aza-2-deoxycytidine-(5-AZA-treated EWS cell lines and in a cohort of primary EWS samples and hMSCs by gene expression and quantitative RT-PCR. 129 genes demonstrated statistically significant hypermethylation in EWS tumors compared to hMSCs. Thirty-six genes were profoundly methylated in EWS and unmethylated in hMSCs. 5-AZA treatment of EWS cell lines resulted in upregulation of expression of hundreds of genes including 162 that were increased by at least 2-fold. The expression of 19 of 36 candidate hypermethylated genes was increased following 5-AZA. Analysis of gene expression from an independent cohort of tumors confirmed decreased expression of six of nineteen hypermethylated genes (AXL, COL1A1, CYP1B1, LYN, SERPINE1, and VCAN. Comparing gene expression and DNA methylation analyses proved to be an effective way to identify genes epigenetically regulated in EWS. Further investigation is ongoing to elucidate the role of these epigenetic alterations in EWS pathogenesis.
Directory of Open Access Journals (Sweden)
Cui Guan
Full Text Available The honey bee has a well-organized system of division of labour among workers. Workers typically progress through a series of discrete behavioural castes as they age, and this has become an important case study for exploring how dynamic changes in gene expression can influence behaviour. Here we applied both digital gene expression analysis and methyl DNA immunoprecipitation analysis to nurse, forager and reverted nurse bees (nurses that have returned to the nursing state after a period spent foraging from the same colony in order to compare the outcomes of these different forms of genomic analysis. A total of 874 and 710 significantly differentially expressed genes were identified in forager/nurse and reverted nurse/forager comparisons respectively. Of these, 229 genes exhibited reversed directions of gene expression differences between the forager/nurse and reverted nurse/forager comparisons. Using methyl-DNA immunoprecipitation combined with high-throughput sequencing (MeDIP-seq we identified 366 and 442 significantly differentially methylated genes in forager/nurse and reverted nurse/forager comparisons respectively. Of these, 165 genes were identified as differentially methylated in both comparisons. However, very few genes were identified as both differentially expressed and differentially methylated in our comparisons of nurses and foragers. These findings confirm that changes in both gene expression and DNA methylation are involved in the nurse and forager behavioural castes, but the different analytical methods reveal quite distinct sets of candidate genes.
National Research Council Canada - National Science Library
Inouye, L
2004-01-01
...) to develop cDNA array-based assays that map gene expression from contaminant exposures. Results substantiate that distinct gene expression profiles exist for major contaminant classes such as PARs, PCBs, and PCDD/Fs...
Li, Junjie; Chen, Qixian; Zha, Zengshi; Li, Hui; Toh, Kazuko; Dirisala, Anjaneyulu; Matsumoto, Yu; Osada, Kensuke; Kataoka, Kazunori; Ge, Zhishen
2015-07-10
Simultaneous achievement of prolonged retention in blood circulation and efficient gene transfection activity in target tissues has always been a major challenge hindering in vivo applications of nonviral gene vectors via systemic administration. Herein, we constructed novel rod-shaped ternary polyplex micelles (TPMs) via complexation between the mixed block copolymers of poly(ethylene glycol)-b-poly{N'-[N-(2-aminoethyl)-2-aminoethyl]aspartamide} (PEG-b-PAsp(DET)) and poly(N-isopropylacrylamide)-b-PAsp(DET) (PNIPAM-b-PAsp(DET)) and plasmid DNA (pDNA) at room temperature, exhibiting distinct temperature-responsive formation of a hydrophobic intermediate layer between PEG shells and pDNA cores through facile temperature increase from room temperature to body temperature (~37 °C). As compared with binary polyplex micelles of PEG-b-PAsp(DET) (BPMs), TPMs were confirmed to condense pDNA into a more compact structure, which achieved enhanced tolerability to nuclease digestion and strong counter polyanion exchange. In vitro gene transfection results demonstrated TPMs exhibiting enhanced gene transfection efficiency due to efficient cellular uptake and endosomal escape. Moreover, in vivo performance evaluation after intravenous injection confirmed that TPMs achieved significantly prolonged blood circulation, high tumor accumulation, and promoted gene expression in tumor tissue. Moreover, TPMs loading therapeutic pDNA encoding an anti-angiogenic protein remarkably suppressed tumor growth following intravenous injection into H22 tumor-bearing mice. These results suggest TPMs with PEG shells and facilely engineered intermediate barrier to inner complexed pDNA have great potentials as systemic nonviral gene vectors for cancer gene therapy. Copyright © 2015 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Yunyan Kang
2017-05-01
Full Text Available The DnaJ proteins which function as molecular chaperone played critical roles in plant growth and development and response to heat stress (HS and also called heat shock protein 40 based on molecular weight. However, little was reported on this gene family in pepper. Recently, the release of the whole pepper genome provided an opportunity for identifying putative DnaJ homologous. In this study, a total of 76 putative pepper DnaJ genes (CaDnaJ01 to CaDnaJ76 were identified using bioinformatics methods and classified into five groups by the presence of the complete three domains (J-domain, zinc finger domain, and C-terminal domain. Chromosome mapping suggested that segmental duplication and tandem duplication were occurred in evolution. The multiple stress-related cis-elements were found in the promoter region of these CaDnaJ genes, which indicated that the CaDnaJs might be involved in the process of responding to complex stress conditions. In addition, expression profiles based on RNA-seq showed that the 47 CaDnaJs were expressed in at least one tissue tested. The result implied that they could be involved in the process of pepper growth and development. qRT-PCR analysis found that 80.60% (54/67 CaDnaJs were induced by HS, indicated that they could participated in pepper response to high temperature treatments. In conclusion, all these results would provide a comprehensive basis for further analyzing the function of CaDnaJ members and be also significant for elucidating the evolutionary relationship in pepper.
DNA barcoding of freshwater ichthyoplankton in the Neotropics as a tool for ecological monitoring.
Frantine-Silva, W; Sofia, S H; Orsi, M L; Almeida, F S
2015-09-01
Quantifying and classifying ichthyoplankton is one of the most effective ways of monitoring the recruitment process in fishes. However, correctly identifying the fish based on morphological characters is extremely difficult, especially in the early stages of development. We examined ichthyoplankton from tributaries and reservoirs along the middle stretch of the Paranapanema River, one of the areas most impacted by hydroelectric projects in the Neotropics. Matching DNA sequences of the COI gene (628-648 bp) allowed us to identify 99.25% of 536 samples of eggs (293) and larvae (243) subjected to BOLD-IDS similarity analysis with a species-level threshold of 1.3%. The results revealed 37 species in 27 genera, 15 families and four orders, some 23.8% of documented fish species in the Paranapanema River. Molecular identification meant that we could include data from egg samples that accounted for about 30% of the species richness observed. The results in this study confirm the efficacy of DNA barcoding in identifying Neotropical ichthyoplankton and show how the data produced provide valuable information for preparing plans for conserving and managing inland waters. © 2015 John Wiley & Sons Ltd.
Using DNA barcoding to track seafood mislabeling in Los Angeles restaurants.
Willette, Demian A; Simmonds, Sara E; Cheng, Samantha H; Esteves, Sofia; Kane, Tonya L; Nuetzel, Hayley; Pilaud, Nicholas; Rachmawati, Rita; Barber, Paul H
2017-10-01
Seafood mislabeling is common in both domestic and international markets. Studies on seafood fraud often report high rates of mislabeling (e.g., >70%), but these studies have been limited to a single sampling year, which means it is difficult to assess the impact of stricter governmental truth-in-labeling regulations. We used DNA barcoding to assess seafood labeling in 26 sushi restaurants in Los Angeles over 4 years. Seafood from 3 high-end grocery stores were also sampled (n = 16) in 2014. We ordered 9 common sushi fish from menus, preserved tissue samples in 95% ethanol, extracted the genomic DNA, amplified and sequenced a portion of the mtDNA COI gene, and identified the resulting sequence to known fish sequences from the National Center for Biotechnology Information nucleotide database. We compared DNA results with the U.S. Food and Drug Administration (FDA) list of acceptable market names and retail names. We considered sushi-sample labels that were inconsistent with FDA names mislabeled. Sushi restaurants had a consistently high percentage of mislabeling (47%; 151 of 323) from 2012 to 2015, yet mislabeling was not homogenous across species. Halibut, red snapper, yellowfin tuna, and yellowtail had consistently high (15%). All sampled sushi restaurants had at least one case of mislabeling. Mislabeling of sushi-grade fish from high-end grocery stores was also identified in red snapper, yellowfin tuna, and yellowtail, but at a slightly lower frequency (42%) than sushi restaurants. Despite increased regulatory measures and media attention, we found seafood mislabeling continues to be prevalent. © 2017 Society for Conservation Biology.
Pfeiler, Edward; Nazario-Yepiz, Nestor O.; Pérez-Gálvez, Fernan; Chávez-Mora, Cristina Alejandra; Laclette, Mariana Ramírez Loustalot; Rendón-Salinas, Eduardo
2017-01-01
Abstract Population genetic variation and demographic history in Danaus plexippus (L.), from Mexico were assessed based on analyses of mitochondrial cytochrome c oxidase subunit I (COI; 658 bp) and subunit II (COII; 503 bp) gene segments and 7 microsatellite loci. The sample of 133 individuals included both migratory monarchs, mainly from 4 overwintering sites within the Monarch Butterfly Biosphere Reserve (MBBR) in central Mexico (states of Michoacán and México), and a nonmigratory population from Irapuato, Guanajuato. Haplotype (h) and nucleotide (π) diversities were relatively low, averaging 0.466 and 0.00073, respectively, for COI, and 0.629 and 0.00245 for COII. Analysis of molecular variance of the COI data set, which included additional GenBank sequences from a nonmigratory Costa Rican population, showed significant population structure between Mexican migratory monarchs and nonmigratory monarchs from both Mexico and Costa Rica, suggesting limited gene flow between the 2 behaviorally distinct groups. Interestingly, while the COI haplotype frequencies of the nonmigratory populations differed from the migratory, they were similar to each other, despite the great physical distance between them. Microsatellite analyses, however, suggested a lack of structure between the 2 groups, possibly owing to the number of significant deviations from Hardy–Weinberg equilibrium resulting from heterzoygote deficiencies found for most of the loci. Estimates of demographic history of the combined migratory MBBR monarch population, based on the mismatch distribution and Bayesian skyline analyses of the concatenated COI and COII data set (n = 89) suggested a population expansion dating to the late Pleistocene (~35000–40000 years before present) followed by a stable effective female population size (Nef) of about 6 million over the last 10000 years. PMID:28003372
Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long
2006-11-17
The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (Pprotection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (Pprotected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.
Analysis of variants in DNA damage signalling genes in bladder cancer
Directory of Open Access Journals (Sweden)
Bishop D Timothy
2008-07-01
Full Text Available Abstract Background Chemicals from occupational exposure and components of cigarette smoke can cause DNA damage in bladder urothelium. Failure to repair DNA damage by DNA repair proteins may result in mutations leading to genetic instability and the development of bladder cancer. Immunohistochemistry studies have shown DNA damage signal activation in precancerous bladder lesions which is lost on progression, suggesting that the damage signalling mechanism acts as a brake to further tumorigenesis. Single nucleotide polymorphisms (SNPs in DSB signalling genes may alter protein function. We hypothesized that SNPs in DSB signalling genes may modulate predisposition to bladder cancer and influence the effects of environmental exposures. Methods We recruited 771 cases and 800 controls (573 hospital-based and 227 population-based from a previous case-control study and interviewed them regarding their smoking habits and occupational history. DNA was extracted from a peripheral blood sample and genotyping of 24 SNPs in MRE11, NBS1, RAD50, H2AX and ATM was undertaken using an allelic discrimination method (Taqman. Results Smoking and occupational dye exposure were strongly associated with bladder cancer risk. Using logistic regression adjusting for age, sex, smoking and occupational dye exposure, there was a marginal increase in risk of bladder cancer for an MRE11 3'UTR SNP (rs2155209, adjusted odds ratio 1.54 95% CI (1.13–2.08, p = 0.01 for individuals homozygous for the rare allele compared to those carrying the common homozygous or heterozygous genotype. However, in the hospital-based controls, the genotype distribution for this SNP deviated from Hardy-Weinberg equilibrium. None of the other SNPs showed an association with bladder cancer and we did not find any significant interaction between any of these polymorphisms and exposure to smoking or dye exposure. Conclusion Apart from a possible effect for one MRE11 3'UTR SNP, our study does not support
Craspedacusta sowerbii, Lankester 1880 – population dispersal analysis using COI and ITS sequences
Directory of Open Access Journals (Sweden)
Franz BRÜMMER
2009-02-01
Full Text Available Craspedacusta sowerbii (Hydrozoa, Limnomedusae, Olindiidae is a freshwater jellyfish, which was discovered in England in 1880. Although thought to originate in South America, it became obvious that the species is native to the Yangtze River system in China. It has spread from China into lakes all over the world. Many different species, variations and sub-species have been described based on morphological characters. Specimens discovered in North America were described as separate species, as morphological differences appeared to be significant compared to European specimens. Even within Europe, differences were assumed to be obvious. Up to this point, three valid species are published; others are considered by various scientists to be true species as well, but mostly are recognized as variations. To obtain further insight into population dynamics of C. sowerbii as well as molecular information on the species itself, sequences of internal transcribed spacers (ITS and cytochrome oxidase subunit I (COI have been used to analyze specimens collected in Germany and Austria. These sequences have been compared to sequences published of different Chinese Craspedacusta species and variations. In addition, morphological descriptions were compared. For the COI sequences, we found uniformity throughout the complete set of samples. However, no comparisons could be made, as no data had been published on COI of Chinese specimens. ITS1, 5.8S and ITS2, including partial 18S and 28S, sequences, were almost uniform within the German populations, showing only minor base pair exchanges. However, comparisons to Chinese organisms indicated, that the investigated sequences of C. sowerbii from Germany and Austria are similar, although not identical in morphology, to Craspedacusta sowerbii var. kiatingi from China. Overall our data support the assumption that there are three valid species, with the possibility of C. ziguiensis being a fourth one, and several
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-03-01
Research is conducted concerning the possibility of anti-gene engineering basic to the application of DNA (deoxyribonucleic acid) drugs capable of serving as functional DNAs to the control of the expression of industrially useful substance producing genes or of anomalous genes and concerning the possibility of novel industry creation on the strength of the said engineering. The specific research items are described below. Technical seeds are investigated relating to the tissue- and cell-specific drug delivery system for the expression of the molecular device function of the DNA drug. Concerning molecular target technologies such as the anti-sense method, possibilities are studied of utilizing the currently available technical seeds for the eventual creation of novel industries. Concerning novel designing methods utilizing genome information such as SNPs (single nucleotide polymorphisms), investigations are conducted to determine if they would help novel technology development and novel material development. The domestic state is surveyed in relation to DNA drugs, and possibilities are investigated of novel substance production and novel medicine creation with the aid of anti-gene engineering. (NEDO)
Molecular genetic analysis of a vaccinia virus gene with an essential role in DNA replication
International Nuclear Information System (INIS)
Evans, E.V.A.
1989-01-01
The poxvirus, vaccinia, is large DNA virus which replicates in the cytoplasma of the host cell. The virus is believed to encode most or all of the functions required for the temporally regulated transcription and replication of its 186 kilobase genome. Physical and genetic autonomy from the host make vaccinia a useful eukaryotic organism in which to study replication genes and proteins, using a combination of biochemical and genetic techniques. Essential viral functions for replication are identified by conditional lethal mutants that fail to synthesize DNA at the non-permissive temperatures. One such group contains the non-complementing alleles ts17, ts24, ts69 (WR strain). Studies were undertaken to define the phenotype of ts mutants, and to identify and characterize the affected gene and protein. Mutant infection was essentially normal at 32 degree C, but at 39 degree C the mutants did not incorporate 3 H-thymidine into nascent viral DNA or synthesize late viral proteins. If mutant cultures were shifted to non-permissive conditions at the height of replication, DNA synthesis was halted rapidly, implying that the mutants are defective in DNA elongation. The gene affected in the WR mutants and in ts6389, a DNA-minus mutant of the IHD strain, was mapped by marker rescue and corresponds to open reading frame 5 (orfD5) of the viral HindIII D fragment
Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco
2017-07-01
We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.
Review: Clinical aspects of hereditary DNA Mismatch repair gene mutations
Sijmons, Rolf H.; Hofstra, Robert M. W.
Inherited mutations of the DNA Mismatch repair genes MLH1, MSH2, MSH6 and PMS2 can result in two hereditary tumor syndromes: the adult-onset autosomal dominant Lynch syndrome, previously referred to as Hereditary Non-Polyposis Colorectal Cancer (HNPCC) and the childhood-onset autosomal recessive
Polymorphisms in human DNA repair genes and head and neck ...
Indian Academy of Sciences (India)
Abstract. Genetic polymorphisms in some DNA repair proteins are associated with a number of malignant transformations like head and ... Such studies may benefit from analysis of multiple genes or polymorphisms and from the ... low survival and high morbidity when diagnosed in advanced ...... racial and/or ethnic cohort.
Hu, X.; Guo, Z.; Pang, T.; Li, Q.; Afink, G.; Pontén, J.
2000-01-01
BACKGROUND: The human MLH1 gene (hMLH1) is one of the DNA mismatch repair genes. Defects in these genes are believed to be the underlying cause of microsatellite instability (MSI). MSI has been demonstrated in many human cancers such as colon cancer and some female-specific tumors. The hMLH1 gene
Oral Gene Application Using Chitosan-DNA Nanoparticles Induces Transferable Tolerance
Ensminger, Stephan M.; Spriewald, Bernd M.
2012-01-01
Oral tolerance is a promising approach to induce unresponsiveness to various antigens. The development of tolerogenic vaccines could be exploited in modulating the immune response in autoimmune disease and allograft rejection. In this study, we investigated a nonviral gene transfer strategy for inducing oral tolerance via antigen-encoding chitosan-DNA nanoparticles (NP). Oral application of ovalbumin (OVA)-encoding chitosan-DNA NP (OVA-NP) suppressed the OVA-specific delayed-type hypersensitivity (DTH) response and anti-OVA antibody formation, as well as spleen cell proliferation following OVA stimulation. Cytokine expression patterns following OVA stimulation in vitro showed a shift from a Th1 toward a Th2/Th3 response. The OVA-NP-induced tolerance was transferable from donor to naïve recipient mice via adoptive spleen cell transfer and was mediated by CD4+CD25+ T cells. These findings indicate that nonviral oral gene transfer can induce regulatory T cells for antigen-specific immune modulation. PMID:22933401
Solovyeva, Evgeniya N; Dunayev, Evgeniy N; Nazarov, Roman A; Mehdi Radjabizadeh; Poyarkov, Nikolay A
2018-01-01
The morphological and genetic variation of a wide-ranging Secret Toad-headed agama, Phrynocephalus mystaceus that inhabits sand deserts of south-eastern Europe, Middle East, Middle Asia, and western China is reviewed. Based on the morphological differences and high divergence in COI (mtDNA) gene sequences a new subspecies of Ph. mystaceus is described from Khorasan Razavi Province in Iran. Partial sequences of COI mtDNA gene of 31 specimens of Ph. mystaceus from 17 localities from all major parts of species range were analyzed. Genetic distances show a deep divergence between Ph. mystaceus khorasanus ssp. n. from Khorasan Razavi Province and all other populations of Ph. mystaceus . The new subspecies can be distinguished from other populations of Ph. mystaceus by a combination of several morphological features. Molecular and morphological analyses do not support the validity of other Ph. mystaceus subspecies described from Middle Asia and Caspian basin. Geographic variations in the Ph. mystaceus species complex and the status of previously described subspecies were discussed.
Gómez-Herreros, Fernando; Zagnoli-Vieira, Guido; Ntai, Ioanna; Martínez-Macías, María Isabel; Anderson, Rhona M; Herrero-Ruíz, Andrés; Caldecott, Keith W
2017-08-10
DNA double-strand breaks (DSBs) induced by abortive topoisomerase II (TOP2) activity are a potential source of genome instability and chromosome translocation. TOP2-induced DNA double-strand breaks are rejoined in part by tyrosyl-DNA phosphodiesterase 2 (TDP2)-dependent non-homologous end-joining (NHEJ), but whether this process suppresses or promotes TOP2-induced translocations is unclear. Here, we show that TDP2 rejoins DSBs induced during transcription-dependent TOP2 activity in breast cancer cells and at the translocation 'hotspot', MLL. Moreover, we find that TDP2 suppresses chromosome rearrangements induced by TOP2 and reduces TOP2-induced chromosome translocations that arise during gene transcription. Interestingly, however, we implicate TDP2-dependent NHEJ in the formation of a rare subclass of translocations associated previously with therapy-related leukemia and characterized by junction sequences with 4-bp of perfect homology. Collectively, these data highlight the threat posed by TOP2-induced DSBs during transcription and demonstrate the importance of TDP2-dependent non-homologous end-joining in protecting both gene transcription and genome stability.DNA double-strand breaks (DSBs) induced by topoisomerase II (TOP2) are rejoined by TDP2-dependent non-homologous end-joining (NHEJ) but whether this promotes or suppresses translocations is not clear. Here the authors show that TDP2 suppresses chromosome translocations from DSBs introduced during gene transcription.
Directory of Open Access Journals (Sweden)
Robert Blakemore
2010-03-01
Full Text Available A neotype is designated for the large and ecologically interesting species of Japanese earthworm, Drawida hattamimizu Hatai, 1930. Its morphological redescription is unambiguously combined with the neotype’s sequence of the Cytochrome Oxidase I (COI locus of the mitochondrial DNA, the first time an earthworm species’ type has been thus profiled. Probably it is an introduced exotic rather than a translocated native, with a patchy distribution that appears only partly defined in Japan where it is both a restricted and an endangered listed species. Brief comparison of sympatric Drawida japonica (Michaelsen, 1892 to the type-species Drawida barwelli (Beddard, 1886 – and this latter from Shiga appears as a new record for Japan – allows the diagnosis of Drawida Michaelsen, 1900 to be amended slightly. The contentious issue of molecular ‘cryptic species’ is queried in relation to the lack of molecular data from type-specimens, the unique name-bearing references employed in zoological nomenclature. Without such reference, neither eco-taxonomic nor genomic studies of earthworm taxa can progress. In this regard, questions are raised concerning the molecular identities and provisional divergences of cosmopolitan generotypes Allolobophora chlorotica chlorotica (Savigny, 1826, the Aporrectodea caliginosa (Savigny, 1826 species-complex sensu Blakemore (2002, and of ecotoxicological standard test-species icon Eisenia fetida fetida (Savigny, 1826. Resurrection of their respective synonyms is mooted. Resolution of relationships within and between earthworm genera and families without DNA testing of the representative type-species and type-genera is flagged as another crucial concern.
International Nuclear Information System (INIS)
Sung, Hye Youn; Choi, Eun Nam; Ahn Jo, Sangmee; Oh, Seikwan; Ahn, Jung-Hyuck
2011-01-01
Highlights: ► Genome-wide DNA methylation pattern in Alzheimer’s disease model cell line. ► Integrated analysis of CpG methylation and mRNA expression profiles. ► Identify three Swedish mutant target genes; CTIF, NXT2 and DDR2 gene. ► The effect of Swedish mutation on alteration of DNA methylation and gene expression. -- Abstract: The Swedish mutation of amyloid precursor protein (APP-sw) has been reported to dramatically increase beta amyloid production through aberrant cleavage at the beta secretase site, causing early-onset Alzheimer’s disease (AD). DNA methylation has been reported to be associated with AD pathogenesis, but the underlying molecular mechanism of APP-sw-mediated epigenetic alterations in AD pathogenesis remains largely unknown. We analyzed genome-wide interplay between promoter CpG DNA methylation and gene expression in an APP-sw-expressing AD model cell line. To identify genes whose expression was regulated by DNA methylation status, we performed integrated analysis of CpG methylation and mRNA expression profiles, and identified three target genes of the APP-sw mutant; hypomethylated CTIF (CBP80/CBP20-dependent translation initiation factor) and NXT2 (nuclear exporting factor 2), and hypermethylated DDR2 (discoidin domain receptor 2). Treatment with the demethylating agent 5-aza-2′-deoxycytidine restored mRNA expression of these three genes, implying methylation-dependent transcriptional regulation. The profound alteration in the methylation status was detected at the −435, −295, and −271 CpG sites of CTIF, and at the −505 to −341 region in the promoter of DDR2. In the promoter region of NXT2, only one CpG site located at −432 was differentially unmethylated in APP-sw cells. Thus, we demonstrated the effect of the APP-sw mutation on alteration of DNA methylation and subsequent gene expression. This epigenetic regulatory mechanism may contribute to the pathogenesis of AD.
Park, Jin-Sup; Frost, Jennifer M; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S; Fischer, Robert L; Choi, Yeonhee
2017-02-21
The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation.
Koczor, Christopher A; Ludlow, Ivan; Hight, Robert S; Jiao, Zhe; Fields, Earl; Ludaway, Tomika; Russ, Rodney; Torres, Rebecca A; Lewis, William
2015-11-01
MDMA (ecstasy) is an illicit drug that stimulates monoamine neurotransmitter release and inhibits reuptake. MDMA's acute cardiotoxicity includes tachycardia and arrhythmia which are associated with cardiomyopathy. MDMA acute cardiotoxicity has been explored, but neither long-term MDMA cardiac pathological changes nor epigenetic changes have been evaluated. Microarray analyses were employed to identify cardiac gene expression changes and epigenetic DNA methylation changes. To identify permanent MDMA-induced pathogenetic changes, mice received daily 10- or 35-day MDMA, or daily 10-day MDMA followed by 25-day saline washout (10 + 25 days). MDMA treatment caused differential gene expression (p 1.5) in 752 genes following 10 days, 558 genes following 35 days, and 113 genes following 10-day MDMA + 25-day saline washout. Changes in MAPK and circadian rhythm gene expression were identified as early as 10 days. After 35 days, circadian rhythm genes (Per3, CLOCK, ARNTL, and NPAS2) persisted to be differentially expressed. MDMA caused DNA hypermethylation and hypomethylation that was independent of gene expression; hypermethylation of genes was found to be 71% at 10 days, 68% at 35 days, and 91% at 10 + 25 days washout. Differential gene expression paralleled DNA methylation in 22% of genes at 10-day treatment, 17% at 35 days, and 48% at 10 + 25 days washout. We show here that MDMA induced cardiac epigenetic changes in DNA methylation where hypermethylation predominated. Moreover, MDMA induced gene expression of key elements of circadian rhythm regulatory genes. This suggests a fundamental organism-level event to explain some of the etiologies of MDMA dysfunction in the heart. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Energy Technology Data Exchange (ETDEWEB)
Hjort, K.; Bergstrom, M.; Adesina, M.F.; Jansson, J.K.; Smalla, K.; Sjoling, S.
2009-09-01
Soil that is suppressive to disease caused by fungal pathogens is an interesting source to target for novel chitinases that might be contributing towards disease suppression. In this study we screened for chitinase genes, in a phytopathogen-suppressive soil in three ways: (1) from a metagenomic library constructed from microbial cells extracted from soil, (2) from directly extracted DNA and (3) from bacterial isolates with antifungal and chitinase activities. Terminal-restriction fragment length polymorphism (T-RFLP) of chitinase genes revealed differences in amplified chitinase genes from the metagenomic library and the directly extracted DNA, but approximately 40% of the identified chitinase terminal-restriction fragments (TRFs) were found in both sources. All of the chitinase TRFs from the isolates were matched to TRFs in the directly extracted DNA and the metagenomic library. The most abundant chitinase TRF in the soil DNA and the metagenomic library corresponded to the TRF{sup 103} of the isolate, Streptomyces mutomycini and/or Streptomyces clavifer. There were good matches between T-RFLP profiles of chitinase gene fragments obtained from different sources of DNA. However, there were also differences in both the chitinase and the 16S rRNA gene T-RFLP patterns depending on the source of DNA, emphasizing the lack of complete coverage of the gene diversity by any of the approaches used.
Alba, Rob; Fei, Zhangjun; Payton, Paxton; Liu, Yang; Moore, Shanna L; Debbie, Paul; Cohn, Jonathan; D'Ascenzo, Mark; Gordon, Jeffrey S; Rose, Jocelyn K C; Martin, Gregory; Tanksley, Steven D; Bouzayen, Mondher; Jahn, Molly M; Giovannoni, Jim
2004-09-01
Gene expression profiling holds tremendous promise for dissecting the regulatory mechanisms and transcriptional networks that underlie biological processes. Here we provide details of approaches used by others and ourselves for gene expression profiling in plants with emphasis on cDNA microarrays and discussion of both experimental design and downstream analysis. We focus on methods and techniques emphasizing fabrication of cDNA microarrays, fluorescent labeling, cDNA hybridization, experimental design, and data processing. We include specific examples that demonstrate how this technology can be used to further our understanding of plant physiology and development (specifically fruit development and ripening) and for comparative genomics by comparing transcriptome activity in tomato and pepper fruit.
International Nuclear Information System (INIS)
Zhu Yi; Qian Yaping; Tang Xiaowen; Wang Jindan; Yang Li; Liao Zhisu; Li Ronghua; Ji Jinzhang; Li Zhiyuan; Chen Jianfu; Choo, Daniel I.; Lu Jianxin; Guan Minxin
2006-01-01
We report here the clinical, genetic, and molecular characterization of two Chinese families with aminoglycoside induced and non-syndromic hearing impairment. Clinical and genetic evaluations revealed the variable severity and age-of-onset in hearing impairment in these families. Strikingly, there were extremely low penetrances of hearing impairment in these Chinese families. Sequence analysis of the complete mitochondrial genomes in these pedigrees showed the distinct sets of mtDNA polymorphism, in addition to the identical G7444A mutation associated with hearing loss. Indeed, the G7444A mutation in the CO1 gene and the precursor of tRNA Ser(UCN) gene is present in homoplasmy only in the maternal lineage of those pedigrees but not other members of these families and 164 Chinese controls. Their mitochondrial genomes belong to the Eastern Asian haplogroups C5a and D4a, respectively. In fact, the occurrence of the G7444A mutation in these several genetically unrelated subjects affected by hearing impairment strongly indicates that this mutation is involved in the pathogenesis of hearing impairment. However, there was the absence of other functionally significant mtDNA mutations in two Chinese pedigrees carrying the G7444A mutation. Therefore, nuclear modifier gene(s) or aminoglycoside(s) may play a role in the phenotypic expression of the deafness-associated G7444A mutation in these Chinese pedigrees
Directory of Open Access Journals (Sweden)
Ribal María
2008-06-01
Full Text Available Abstract Background An accurate gene expression quantification using TaqMan Arrays (TA could be limited by the low RNA quantity obtained from some clinical samples. The novel cDNA preamplification system, the TaqMan PreAmp Master Mix kit (TPAMMK, enables a multiplex preamplification of cDNA targets and therefore, could provide a sufficient amount of specific amplicons for their posterior analysis on TA. Findings A multiplex preamplification of 47 genes was performed in 22 samples prior to their analysis by TA, and relative gene expression levels of non-preamplified (NPA and preamplified (PA samples were compared. Overall, the mean cycle threshold (CT decrement in the PA genes was 3.85 (ranging from 2.07 to 5.01. A high correlation (r between the gene expression measurements of NPA and PA samples was found (mean r = 0.970, ranging from 0.937 to 0.994; p Conclusion We demonstrate that cDNA preamplification using the TPAMMK before TA analysis is a reliable approach to simultaneously measure gene expression of multiple targets in a single sample. Moreover, this procedure was validated in genes from degraded RNA samples and low abundance expressed genes. This combined methodology could have wide applications in clinical research, where scarce amounts of degraded RNA are usually obtained and several genes need to be quantified in each sample.
New polymorphisms of Xeroderma Pigmentosum DNA repair genes in myelodysplastic syndrome.
Santiago, Sabrina Pinheiro; Junior, Howard Lopes Ribeiro; de Sousa, Juliana Cordeiro; de Paula Borges, Daniela; de Oliveira, Roberta Taiane Germano; Farias, Izabelle Rocha; Costa, Marília Braga; Maia, Allan Rodrigo Soares; da Nóbrega Ito, Mayumi; Magalhães, Silvia Maria Meira; Pinheiro, Ronald Feitosa
2017-07-01
The association between Xeroderma Pigmentosum DNA repair genes (XPA rs1800975, XPC rs2228000, XPD rs1799793 and XPF rs1800067) polymorphisms and myelodysplastic syndrome (MDS) have not been reported. To assess the functional role between these polymorphisms and MDS, we evaluated 189 samples stratified in two groups: 95 bone marrow samples from MDS patients and 94 from healthy elderly volunteers used as controls. Genotypes for all polymorphisms were identified in DNA samples in an allelic discrimination experiment by real-time polymerase chain reaction (qPCR). We also studied the mRNA expression of XPA and XPC genes to evaluate if its polymorphisms were functional in 53 RNAm MDS patients by qPCR methodologies. To the rs2228000 polymorphism, the CT and TT polymorphic genotype were associated with increased odds ratio (OR) of more profound cytopenia (hemoglobin and neutrophils count). To the rs1799793 polymorphism, we found that the GG homozygous wild-type genotype was associated with a decreased chance of developing MDS. We observed low expression of XPA in younger patients, in hypoplastic MDS and patients with abnormal karyotype when presented AG or AA polymorphic genotypes. We also found that there was a statistically significant interaction between the presence of micromegakaryocyte on down regulation of XPC regarding the CT heterozygous genotype of the rs1800975 polymorphism. Our results suggest that new functional polymorphisms of Xeroderma Pigmentosum DNA repair genes in MDS are related to its pathogenesis and prognosis. Copyright © 2017 Elsevier Ltd. All rights reserved.
Raya-González, Javier; Pelagio-Flores, Ramón; López-Bucio, José
2012-09-15
Jasmonic acid (JA) regulates a broad range of plant defense and developmental responses. COI1 has been recently found to act as JA receptor. In this report, we show that low micromolar concentrations of JA inhibited primary root (PR) growth and promoted lateral root (LR) formation in Arabidopsis wild-type (WT) seedlings. It was observed that the coi1-1 mutant was less sensitive to JA on pericycle cell activation to induce lateral root primordia (LRP) formation and presented alterations in lateral root positioning and lateral root emergence on bends. To investigate JA-auxin interactions important for remodeling of root system (RS) architecture, we tested the expression of auxin-inducible markers DR5:uidA and BA3:uidA in WT and coi1-1 seedlings in response to indole-3-acetic acid (IAA) and JA and analyzed the RS architecture of a suite of auxin-related mutants under JA treatments. We found that JA did not affect DR5:uidA and BA3:uidA expression in WT and coi1-1 seedlings. Our data also showed that PR growth inhibition in response to JA was likely independent of auxin signaling and that the induction of LRP required ARF7, ARF19, SLR, TIR1, AFB2, AFB3 and AXR1 loci. We conclude that JA regulation of postembryonic root development involves both auxin-dependent and independent mechanisms. Copyright © 2012 Elsevier GmbH. All rights reserved.
Isolating human DNA repair genes using rodent-cell mutants
International Nuclear Information System (INIS)
Thompson, L.H.; Weber, C.A.; Brookman, K.W.; Salazar, E.P.; Stewart, S.A.; Mitchell, D.L.
1987-01-01
The DNA repair systems of rodent and human cells appear to be at least as complex genetically as those in lower eukaryotes and bacteria. The use of mutant lines of rodent cells as a means of identifying human repair genes by functional complementation offers a new approach toward studying the role of repair in mutagenesis and carcinogenesis. In each of six cases examined using hybrid cells, specific human chromosomes have been identified that correct CHO cell mutations affecting repair of damage from uv or ionizing radiations. This finding suggests that both the repair genes and proteins may be virtually interchangeable between rodent and human cells. Using cosmid vectors, human repair genes that map to chromosome 19 have cloned as functional sequences: ERCC2 and XRCC1. ERCC1 was found to have homology with the yeast excision repair gene RAD10. Transformants of repair-deficient cell lines carrying the corresponding human gene show efficient correction of repair capacity by all criteria examined. 39 refs., 1 fig., 1 tab
Dynamic regulation of cerebral DNA repair genes by psychological stress
DEFF Research Database (Denmark)
Forsberg, Kristin; Aalling, Nadia; Wörtwein, Gitta
2015-01-01
Neuronal genotoxic insults from oxidative stress constitute a putative molecular link between stress and depression on the one hand, and cognitive dysfunction and dementia risk on the other. Oxidative modifications to DNA are repaired by specific enzymes; a process that plays a critical role...... restraint stress (6h/day) or daily handling (controls), and sacrificed after 1, 7 or 21 stress sessions. The mRNA expression of seven genes (Ogg1, Ape1, Ung1, Neil1, Xrcc1, Ercc1, Nudt1) involved in the repair of oxidatively damaged DNA was determined by quantitative real time polymerase chain reaction...
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Chang, Dong Kyung; Metzgar, David; Wills, Christopher; Boland, C. Richard
2003-01-01
All "minor" components of the human DNA mismatch repair (MMR) system-MSH3, MSH6, PMS2, and the recently discovered MLH3-contain mononucleotide microsatellites in their coding sequences. This intriguing finding contrasts with the situation found in the major components of the DNA MMR system-MSH2 and MLH1-and, in fact, most human genes. Although eukaryotic genomes are rich in microsatellites, non-triplet microsatellites are rare in coding regions. The recurring presence of exonal mononucleotide repeat sequences within a single family of human genes would therefore be considered exceptional.
Control of radiation sensitivity of mammalian cells. Regulation of expression of DNA repair genes
International Nuclear Information System (INIS)
Yoshida, Kayo; Morita, Takashi
2003-01-01
This review describes authors' investigations concerning regulation of expression of DNA repair genes for the purpose of control of radiosensitivity of mammalian cells for cancer radiotherapy. One of their experiments concerns the enhancement of sensitivity to radiation and anti-tumor agents by suppressing the expression of mammalian Rad51 gene which playing a central role in recombination repair against DNA double-strand break, by RNA interference (RNAi). Described are the mode of action of RNAi, mechanism of suppression of Rad51 gene expression by it, enhancing effect in radiosensitivity, stable suppression and enhancement by hairpin RNA and its possible usefulness in cancer therapy. The other concerns the histone H2AX gene, which delivering the repair signal post phosphorylation in chromatin against the double-strand break. Experimental results of suppression of the histone H2AX gene by tet-off system, enhancement of radiosensitivity by the suppression and functional recovery by the gene transfer are described, and the radiosensitivity can be thus artificially controlled by tetracycline in authors' F9 2AX (tet/tet) cells. (N.I.)
Czech Academy of Sciences Publication Activity Database
Farkas, S. A.; Vymetálková, Veronika; Vodičková, Ludmila; Vodička, Pavel; Torbjörn, K. N.
2014-01-01
Roč. 6, č. 2 (2014), s. 179-191 ISSN 1750-1911 R&D Projects: GA ČR GPP304/11/P715; GA ČR(CZ) GAP304/12/1585; GA MZd NT14329 Institutional support: RVO:68378041 Keywords : CpG * DNA repair genes * sporadic colorectal cancer Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.649, year: 2014
Directory of Open Access Journals (Sweden)
Jochen Gohlke
Full Text Available Crown gall tumors develop after integration of the T-DNA of virulent Agrobacterium tumefaciens strains into the plant genome. Expression of the T-DNA-encoded oncogenes triggers proliferation and differentiation of transformed plant cells. Crown gall development is known to be accompanied by global changes in transcription, metabolite levels, and physiological processes. High levels of abscisic acid (ABA in crown galls regulate expression of drought stress responsive genes and mediate drought stress acclimation, which is essential for wild-type-like tumor growth. An impact of epigenetic processes such as DNA methylation on crown gall development has been suggested; however, it has not yet been investigated comprehensively. In this study, the methylation pattern of Arabidopsis thaliana crown galls was analyzed on a genome-wide scale as well as at the single gene level. Bisulfite sequencing analysis revealed that the oncogenes Ipt, IaaH, and IaaM were unmethylated in crown galls. Nevertheless, the oncogenes were susceptible to siRNA-mediated methylation, which inhibited their expression and subsequently crown gall growth. Genome arrays, hybridized with methylated DNA obtained by immunoprecipitation, revealed a globally hypermethylated crown gall genome, while promoters were rather hypomethylated. Mutants with reduced non-CG methylation developed larger tumors than the wild-type controls, indicating that hypermethylation inhibits plant tumor growth. The differential methylation pattern of crown galls and the stem tissue from which they originate correlated with transcriptional changes. Genes known to be transcriptionally inhibited by ABA and methylated in crown galls became promoter methylated upon treatment of A. thaliana with ABA. This suggests that the high ABA levels in crown galls may mediate DNA methylation and regulate expression of genes involved in drought stress protection. In summary, our studies provide evidence that epigenetic processes
International Nuclear Information System (INIS)
Knight, G.B.; Gudas, J.M.; Pardee, A.B.
1987-01-01
Induction of thymidine kinase parallels the onset of DNA synthesis. To investigate the transcriptional regulation of the thymidine kinase gene, the authors have examined whether specific nuclear factors interact in a cell-cycle-dependent manner with sequences upstream of this gene. Two inverted CCAAT boxes near the transcriptional initiation sites were observed to form complexes with nuclear DNA-binding proteins. The nature of the complexes changes dramatically as the cells approach DNA synthesis and correlates well with the previously reported transcriptional increase of the thymidine kinase gene
Zebrafish: swimming towards a role for fanconi genes in DNA repair.
Scata, Kimberly A; El-Deiry, Wafik S
2004-06-01
The zebrafish, Danio rerio, has become a favorite model organism for geneticists and developmental biologists. Recently cancer biologists have turned to this tiny fish to help them unravel the mysteries of conserved pathways such as the Fanconi Anemia (FA) pathway. Although a relatively rare disease, the genes involved in FA are part of a large network of DNA damage response/repair genes. Liu and colleagues have recapitulated some of the clinical manifestations of human FA by knocking down the zebrafish FANC-D2 gene thereby providing a new model for probing the underlying causes of these phenotypes.
Appleyard, Greg D; Forsyth, George W; Kiehlbauch, Laura M; Sigfrid, Kristen N; Hanik, Heather L J; Quon, Anita; Loewen, Matthew E; Grahn, Bruce H
2006-05-01
To investigate the molecular basis of inherited retinal dysplasia in miniature Schnauzers. Retina and retinal pigment epithelial tissues were collected from canine subjects at the age of 3 weeks. Total RNA isolated from these tissues was reverse transcribed to make representative cDNA pools that were compared for differences in gene expression by using a subtractive hybridization technique referred to as representational difference analysis (RDA). Expression differences identified by RDA were confirmed and quantified by real-time reverse-transcription PCR. Mitochondrial morphology from leukocytes and skeletal muscle of normal and affected miniature Schnauzers was examined by transmission electron microscopy. RDA screening of retinal pigment epithelial cDNA identified differences in mRNA transcript coding for two mitochondrial (mt) proteins--cytochrome oxidase subunit 1 and NADH dehydrogenase subunit 6--in affected dogs. Contrary to expectations, these identified sequences did not contain mutations. Based on the implication of mt-DNA-encoded proteins by the RDA experiments we used real-time PCR to compare the relative amounts of mt-DNA template in white blood cells from normal and affected dogs. White blood cells of affected dogs contained less than 30% of the normal amount of two specific mtDNA sequences, compared with the content of the nuclear-encoded glyceraldehyde-3-phosphate dehydrogenase (GA-3-PDH) reference gene. Retina and RPE tissue from affected dogs had reduced mRNA transcript levels for the two mitochondrial genes detected in the RDA experiment. Transcript levels for another mtDNA-encoded gene as well as the nuclear-encoded mitochondrial Tfam transcription factor were reduced in these tissues in affected dogs. Mitochondria from affected dogs were reduced in number and size and were unusually electron dense. Reduced levels of nuclear and mitochondrial transcripts in the retina and RPE of miniature Schnauzers affected with retinal dysplasia suggest that
Novianty, E.; Kartikasari, L. R.; Lee, J. H.; Cahyadi, M.
2017-04-01
Meat based food products have a big opportunity to mix and adulterated with other meats. Muslim communities are prohibited to consume pork-containing product or other pig derivatives in food. Therefore, the high sensitivity, fast, cheap and accurate approach is needed to detect pig contamination in raw meat and meat-processed product such as meatball. The aim of this study was to identify pork contamination in meatball using genetic marker of mitochondrial DNA cytochrome b gene by duplex-PCR. Samples were prepared and designed by following the proportions 0, 1, 5, 10, 25% of pork in meatballs, respectively. The DNA genome was extracted from meatballs and polymerase chain reaction (PCR) was performed using species specific primer to isolate mt-DNA cytochrome b gene. The results showed that the DNA genome was successfully isolated from pork, beef, and contaminated meatballs. Furthermore, 2% agarose gels was able to visualize of duplex-PCR to identify pork contamination in meatballs up to very small proportion (1%). It can be concluded that duplex-PCR of mt-DNA cytochrome b gene was very sensitive to identify pork contamination in meatball with the presence of specific 398 bp DNA band.
DEFF Research Database (Denmark)
Løbner-Olesen, Anders; Slominska-Wojewodzka, Monika; Hansen, Flemming G.
2008-01-01
Background: Initiation of chromosome replication in E. coli requires the DnaA and DnaC proteins and conditionally-lethal dnaA and dnaC mutants are often used to synchronize cell populations. Methodology/Principal Findings: DNA microarrays were used to measure mRNA steady-state levels in initiatio......C genes was increased at the non-permissive temperature in the respective mutant strains indicating auto-regulation of both genes. Induction of the SOS regulon was observed in dnaC2 cells at 38 degrees C and 42 degrees C. Flow cytometric analysis revealed that dnaC2 mutant cells at non......-permissive temperature had completed the early stages of chromosome replication initiation. Conclusion/Significance: We suggest that in dnaC2 cells the SOS response is triggered by persistent open-complex formation at oriC and/or by arrested forks that require DnaC for replication restart....
Energy Technology Data Exchange (ETDEWEB)
Ameer, Syeda Shegufta [Department of Laboratory Medicine, Division of Occupational and Environmental Medicine, Lund University, Lund (Sweden); Engström, Karin [Department of Laboratory Medicine, Division of Occupational and Environmental Medicine, Lund University, Lund (Sweden); Institute of Environmental Medicine, Unit of Metals & Health, Karolinska Institutet, Stockholm (Sweden); Hossain, Mohammad Bakhtiar [Department of Laboratory Medicine, Division of Occupational and Environmental Medicine, Lund University, Lund (Sweden); Concha, Gabriela [Science Department, Risk Benefit Assessment Unit, National Food Agency, Uppsala (Sweden); Vahter, Marie [Institute of Environmental Medicine, Unit of Metals & Health, Karolinska Institutet, Stockholm (Sweden); Broberg, Karin, E-mail: Karin.broberg@ki.se [Institute of Environmental Medicine, Unit of Metals & Health, Karolinska Institutet, Stockholm (Sweden)
2017-04-15
Background: Exposure to inorganic arsenic increases the risk of cancer and non-malignant diseases. Inefficient arsenic metabolism is a marker for susceptibility to arsenic toxicity. Arsenic may alter gene expression, possibly by altering DNA methylation. Objectives: To elucidate the associations between arsenic exposure, gene expression, and DNA methylation in peripheral blood, and the modifying effects of arsenic metabolism. Methods: The study participants, women from the Andes, Argentina, were exposed to arsenic via drinking water. Arsenic exposure was assessed as the sum of arsenic metabolites in urine (U-As), using high performance liquid-chromatography hydride-generation inductively-coupled-plasma-mass-spectrometry, and arsenic metabolism efficiency was assessed by the urinary fractions (%) of the individual metabolites. Genome-wide gene expression (N = 80 women) and DNA methylation (N = 93; 80 overlapping with gene expression) in peripheral blood were measured using Illumina DirectHyb HumanHT-12 v4.0 and Infinium Human-Methylation 450K BeadChip, respectively. Results: U-As concentrations, ranging 10–1251 μg/L, was associated with decreased gene expression: 64% of the top 1000 differentially expressed genes were down-regulated with increasing U-As. U-As was also associated with hypermethylation: 87% of the top 1000 CpGs were hypermethylated with increasing U-As. The expression of six genes and six individual CpG sites were significantly associated with increased U-As concentration. Pathway analyses revealed enrichment of genes related to cell death and cancer. The pathways differed somewhat depending on arsenic metabolism efficiency. We found no overlap between arsenic-related gene expression and DNA methylation for individual genes. Conclusions: Increased arsenic exposure was associated with lower gene expression and hypermethylation in peripheral blood, but with no evident overlap. - Highlights: • Women exposed to inorganic arsenic were studied for
Maternal intake of methyl-group donors affects DNA methylation of metabolic genes in infants.
Pauwels, Sara; Ghosh, Manosij; Duca, Radu Corneliu; Bekaert, Bram; Freson, Kathleen; Huybrechts, Inge; Langie, Sabine A S; Koppen, Gudrun; Devlieger, Roland; Godderis, Lode
2017-01-01
Maternal nutrition during pregnancy and infant nutrition in the early postnatal period (lactation) are critically involved in the development and health of the newborn infant. The Maternal Nutrition and Offspring's Epigenome (MANOE) study was set up to assess the effect of maternal methyl-group donor intake (choline, betaine, folate, methionine) on infant DNA methylation. Maternal intake of dietary methyl-group donors was assessed using a food-frequency questionnaire (FFQ). Before and during pregnancy, we evaluated maternal methyl-group donor intake through diet and supplementation (folic acid) in relation to gene-specific ( IGF2 DMR, DNMT1 , LEP , RXRA ) buccal epithelial cell DNA methylation in 6 months old infants ( n = 114) via pyrosequencing. In the early postnatal period, we determined the effect of maternal choline intake during lactation (in mothers who breast-fed for at least 3 months) on gene-specific buccal DNA methylation ( n = 65). Maternal dietary and supplemental intake of methyl-group donors (folate, betaine, folic acid), only in the periconception period, was associated with buccal cell DNA methylation in genes related to growth ( IGF2 DMR), metabolism ( RXRA ), and appetite control ( LEP ). A negative association was found between maternal folate and folic acid intake before pregnancy and infant LEP (slope = -1.233, 95% CI -2.342; -0.125, p = 0.0298) and IGF2 DMR methylation (slope = -0.706, 95% CI -1.242; -0.107, p = 0.0101), respectively. Positive associations were observed for maternal betaine (slope = 0.875, 95% CI 0.118; 1.633, p = 0.0241) and folate (slope = 0.685, 95% CI 0.245; 1.125, p = 0.0027) intake before pregnancy and RXRA methylation. Buccal DNMT1 methylation in the infant was negatively associated with maternal methyl-group donor intake in the first and second trimester of pregnancy and negatively in the third trimester. We found no clear association between maternal choline intake
Directory of Open Access Journals (Sweden)
Koji Hashimoto
2016-05-01
Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond
Comparing the DNA hypermethylome with gene mutations in human colorectal cancer.
Directory of Open Access Journals (Sweden)
Kornel E Schuebel
2007-09-01
Full Text Available We have developed a transcriptome-wide approach to identify genes affected by promoter CpG island DNA hypermethylation and transcriptional silencing in colorectal cancer. By screening cell lines and validating tumor-specific hypermethylation in a panel of primary human colorectal cancer samples, we estimate that nearly 5% or more of all known genes may be promoter methylated in an individual tumor. When directly compared to gene mutations, we find larger numbers of genes hypermethylated in individual tumors, and a higher frequency of hypermethylation within individual genes harboring either genetic or epigenetic changes. Thus, to enumerate the full spectrum of alterations in the human cancer genome, and to facilitate the most efficacious grouping of tumors to identify cancer biomarkers and tailor therapeutic approaches, both genetic and epigenetic screens should be undertaken.
Song, Minyan; He, Yanghua; Zhou, Huangkai; Zhang, Yi; Li, Xizhi; Yu, Ying
2016-07-14
Subclinical mastitis is a widely spread disease of lactating cows. Its major pathogen is Staphylococcus aureus (S. aureus). In this study, we performed genome-wide integrative analysis of DNA methylation and transcriptional expression to identify candidate genes and pathways relevant to bovine S. aureus subclinical mastitis. The genome-scale DNA methylation profiles of peripheral blood lymphocytes in cows with S. aureus subclinical mastitis (SA group) and healthy controls (CK) were generated by methylated DNA immunoprecipitation combined with microarrays. We identified 1078 differentially methylated genes in SA cows compared with the controls. By integrating DNA methylation and transcriptome data, 58 differentially methylated genes were shared with differently expressed genes, in which 20.7% distinctly hypermethylated genes showed down-regulated expression in SA versus CK, whereas 14.3% dramatically hypomethylated genes showed up-regulated expression. Integrated pathway analysis suggested that these genes were related to inflammation, ErbB signalling pathway and mismatch repair. Further functional analysis revealed that three genes, NRG1, MST1 and NAT9, were strongly correlated with the progression of S. aureus subclinical mastitis and could be used as powerful biomarkers for the improvement of bovine mastitis resistance. Our studies lay the groundwork for epigenetic modification and mechanistic studies on susceptibility of bovine mastitis.
Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru
2018-01-01
Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score ([Formula: see text]) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing [Formula: see text] >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of [Formula: see text] (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 ([Formula: see text] = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). We confirmed the existence of cis-regulated ASM around
Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru
2018-01-01
Background Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. Methods CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score (ΔRAS¯) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing ΔRAS¯ >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. Results We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of ΔRAS¯ (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 (ΔRAS¯ = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). Conclusions We confirmed the existence of cis-regulated ASM around IBD
Directory of Open Access Journals (Sweden)
Youxiong Que
2012-01-01
Full Text Available Erianthus arundinaceum is a wild relative species of sugarcane. The aim of this research was to demonstrate the feasibility of cDNA-SRAP for differential gene expression and to explore the molecular mechanism of drought resistance in E. arundinaceum. cDNA-SRAP technique, for the first time, was applied in the analysis of differential gene expression in E. arundinaceum under drought stress. In total, eight differentially expressed genes with length of 185–427 bp were successfully isolated (GenBank Accession numbers: EU071770, EU071772, EU071774, EU071776, EU071777, EU071779, EU071780, and EU071781. Based on their homologies with genes in GenBank, these genes were assumed to encode ribonuclease III, vacuolar protein, ethylene insensitive protein, aerobactin biosynthesis protein, photosystem II protein, glucose transporter, leucine-rich repeat protein, and ammonia monooxygenase. Real-time PCR analysis on the expression profiling of gene (EU071774 encoding ethylene-insensitive protein and gene (EU071781 encoding ammonia monooxygenase revealed that the expression of these two genes was upregulated both by PEG and ABA treatments, suggesting that they may involve in the drought resistance of E. arundinaceum. This study constitutes the first report of genes activated in E. arundinaceum by drought stress and opens up the application of cDNA-SRAP in differential gene expression analysis in E. arundinaceum under certain stress conditions.
Ito, Katsura; Nishikawa, Hiroshi; Shimada, Takuji; Ogawa, Kohei; Minamiya, Yukio; Tomoda, Masafumi; Nakahira, Kengo; Kodama, Rika; Fukuda, Tatsuya; Arakawa, Ryo
2011-01-01
Pilophorus typicus (Distant) (Heteroptera: Miridae) is a predatory bug occurring in East, Southeast, and South Asia. Because the active stages of P. typicus prey on various agricultural pest insects and mites, this species is a candidate insect as an indigenous natural enemy for use in biological control programs. However, the mass releasing of introduced natural enemies into agricultural fields may incur the risk of affecting the genetic integrity of species through hybridization with a local population. To clarify the genetic characteristics of the Japanese populations of P. typicus two portions of the mitochondrial DNA, the cytochrome oxidase subunit I (COI) (534 bp) and the cytochrome B (cytB) (217 bp) genes, were sequenced for 64 individuals collected from 55 localities in a wide range of Japan. Totals of 18 and 10 haplotypes were identified for the COI and cytB sequences, respectively (25 haplotypes over regions). Phylogenetic analysis using the maximum likelihood method revealed the existence of two genetically distinct groups in P. typicus in Japan. These groups were distributed in different geographic ranges: one occurred mainly from the Pacific coastal areas of the Kii Peninsula, the Shikoku Island, and the Ryukyu Islands; whereas the other occurred from the northern Kyushu district to the Kanto and Hokuriku districts of mainland Japan. However, both haplotypes were found in a single locality of the southern coast of the Shikoku Island. COI phylogeny incorporating other Pilophorus species revealed that these groups were only recently differentiated. Therefore, use of a certain population of P. typicus across its distribution range should be done with caution because genetic hybridization may occur.
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an
Directory of Open Access Journals (Sweden)
Montgomery Elizabeth A
2006-12-01
Full Text Available Abstract Background Somatic mutations of mitochondrial DNA (mtDNA are common in many human cancers. We have described an oligonucleotide microarray ("MitoChip" for rapid sequencing of the entire mitochondrial genome (Zhou et al, J Mol Diagn 2006, facilitating the analysis of mtDNA mutations in preneoplastic lesions. We examined 14 precancerous lesions, including seven Barrett esophagus biopsies, with or without associated dysplasia; four colorectal adenomas; and three inflammatory colitis-associated dysplasia specimens. In all cases, matched normal tissues from the corresponding site were obtained as germline control. MitoChip analysis was performed on DNA obtained from cryostat-embedded specimens. Results A total of 513,639 bases of mtDNA were sequenced in the 14 samples, with 490,224 bases (95.4% bases assigned by the automated genotyping software. All preneoplastic lesions examined demonstrated at least one somatic mtDNA sequence alteration. Of the 100 somatic mtDNA alterations observed in the 14 cases, 27 were non-synonymous coding region mutations (i.e., resulting in an amino acid change, 36 were synonymous, and 37 involved non-coding mtDNA. Overall, somatic alterations most commonly involved the COI, ND4 and ND5 genes. Notably, somatic mtDNA alterations were observed in preneoplastic lesions of the gastrointestinal tract even in the absence of histopathologic evidence of dysplasia, suggesting that the mitochondrial genome is susceptible at the earliest stages of multistep cancer progression. Conclusion Our findings further substantiate the rationale for exploring the mitochondrial genome as a biomarker for the early diagnosis of cancer, and confirm the utility of a high-throughput array-based platform for this purpose from a clinical applicability standpoint.
Ros, V.I.D.; Breeuwer, J.A.J.
2007-01-01
The past 15 years have witnessed a number of molecular studies that aimed to resolve issues of species delineation and phylogeny of mites in the family Tetranychidae. The central part of the mitochondrial COI region has frequently been used for investigating intra- and interspecific variation. All
de Cambiaire, Jean-Charles; Otis, Christian; Lemieux, Claude; Turmel, Monique
2006-01-01
Background The phylum Chlorophyta contains the majority of the green algae and is divided into four classes. While the basal position of the Prasinophyceae is well established, the divergence order of the Ulvophyceae, Trebouxiophyceae and Chlorophyceae (UTC) remains uncertain. The five complete chloroplast DNA (cpDNA) sequences currently available for representatives of these classes display considerable variability in overall structure, gene content, gene density, intron content and gene order. Among these genomes, that of the chlorophycean green alga Chlamydomonas reinhardtii has retained the least ancestral features. The two single-copy regions, which are separated from one another by the large inverted repeat (IR), have similar sizes, rather than unequal sizes, and differ radically in both gene contents and gene organizations relative to the single-copy regions of prasinophyte and ulvophyte cpDNAs. To gain insights into the various changes that underwent the chloroplast genome during the evolution of chlorophycean green algae, we have sequenced the cpDNA of Scenedesmus obliquus, a member of a distinct chlorophycean lineage. Results The 161,452 bp IR-containing genome of Scenedesmus features single-copy regions of similar sizes, encodes 96 genes, i.e. only two additional genes (infA and rpl12) relative to its Chlamydomonas homologue and contains seven group I and two group II introns. It is clearly more compact than the four UTC algal cpDNAs that have been examined so far, displays the lowest proportion of short repeats among these algae and shows a stronger bias in clustering of genes on the same DNA strand compared to Chlamydomonas cpDNA. Like the latter genome, Scenedesmus cpDNA displays only a few ancestral gene clusters. The two chlorophycean genomes share 11 gene clusters that are not found in previously sequenced trebouxiophyte and ulvophyte cpDNAs as well as a few genes that have an unusual structure; however, their single-copy regions differ
Directory of Open Access Journals (Sweden)
Li Xin
2012-07-01
Full Text Available Abstract Background DNA methylation plays important biological roles in plants and animals. To examine the rice genomic methylation landscape and assess its functional significance, we generated single-base resolution DNA methylome maps for Asian cultivated rice Oryza sativa ssp. japonica, indica and their wild relatives, Oryza rufipogon and Oryza nivara. Results The overall methylation level of rice genomes is four times higher than that of Arabidopsis. Consistent with the results reported for Arabidopsis, methylation in promoters represses gene expression while gene-body methylation generally appears to be positively associated with gene expression. Interestingly, we discovered that methylation in gene transcriptional termination regions (TTRs can significantly repress gene expression, and the effect is even stronger than that of promoter methylation. Through integrated analysis of genomic, DNA methylomic and transcriptomic differences between cultivated and wild rice, we found that primary DNA sequence divergence is the major determinant of methylational differences at the whole genome level, but DNA methylational difference alone can only account for limited gene expression variation between the cultivated and wild rice. Furthermore, we identified a number of genes with significant difference in methylation level between the wild and cultivated rice. Conclusions The single-base resolution methylomes of rice obtained in this study have not only broadened our understanding of the mechanism and function of DNA methylation in plant genomes, but also provided valuable data for future studies of rice epigenetics and the epigenetic differentiation between wild and cultivated rice.
[Principles for molecular identification of traditional Chinese materia medica using DNA barcoding].
Chen, Shi-Lin; Yao, Hui; Han, Jian-Ping; Xin, Tian-Yi; Pang, Xiao-Hui; Shi, Lin-Chun; Luo, Kun; Song, Jing-Yuan; Hou, Dian-Yun; Shi, Shang-Mei; Qian, Zhong-Zhi
2013-01-01
Since the research of molecular identification of Chinese Materia Medica (CMM) using DNA barcode is rapidly developing and popularizing, the principle of this method is approved to be listed in the Supplement of the Pharmacopoeia of the People's Republic of China. Based on the study on comprehensive samples, the DNA barcoding systems have been established to identify CMM, i.e. ITS2 as a core barcode and psbA-trnH as a complementary locus for identification of planta medica, and COI as a core barcode and ITS2 as a complementary locus for identification of animal medica. This article introduced the principle of molecular identification of CMM using DNA barcoding and its drafting instructions. Furthermore, its application perspective was discussed.
Ino, Kosuke; Kawasumi, Tamayo; Ito, Akira; Honda, Hiroyuki
2008-05-01
Modification of cellular functions by overexpression of genes is being increasingly practiced for tissue engineering. In the present study, we investigated whether transfection efficiency could be enhanced by magnetofection that involves the use of plasmid DNA (pDNA)/magnetite cationic liposomes (MCLs) complexes (pDNA/MCL) and magnetic force. The transfection efficiencies of the magnetofection technique by pDNA/MCL in fibroblasts and keratinocytes using reporter genes were 36- and 10-fold higher, respectively, than those of a lipofection technique by cationic liposomes. Moreover, in vitro construction of three-dimensional (3D) tissues is an important challenge. We recently proposed a novel technique termed "magnetic force-based tissue engineering" (Mag-TE) to produce 3D tissues. Since the fibroblasts after magnetofection incorporated both magnetite nanoparticles and pDNA, we investigated whether multilayered heterotypic cell sheets expressing transgene could be fabricated by Mag-TE. First, the fibroblasts were seeded onto an ultra-low attachment culture plate. When a magnet was placed under the plate, the cells accumulated at the bottom of the culture plate. After 24 h of culture, the transgene-expressing cells formed a multilayered cell sheet-like structure. These results indicated that MCLs are a potent biomanipulation tool for both gene transfer and 3D tissue construction, suggesting that these techniques are useful for tissue engineering. Copyright 2007 Wiley Periodicals, Inc.
Cloning of low dose radiation induced gene RIG1 by RACE based on non-cloned cDNA library
International Nuclear Information System (INIS)
Luo Ying; Sui Jianli; Tie Yi; Zhang Yuanping; Zhou Pingkun; Sun Zhixian
2001-01-01
Objective: To obtain full-length cDNA of radiation induced new gene RIG1 based on its EST fragment. Methods: Based on non-cloned cDNA library, enhanced nested RACE PCR and biotin-avidin labelled probe for magnetic bead purification was used to obtain full-length cDNA of RIG1. Results: About 1 kb of 3' end of RIG1 gene was successfully cloned by this set of methods and cloning of RIG1 5' end is proceeding well. Conclusion: The result is consistent with the design of experiment. This set of protocol is useful for cloning of full-length gene based on EST fragment
DNA Nanotechnology for Precise Control over Drug Delivery and Gene Therapy.
Angell, Chava; Xie, Sibai; Zhang, Liangfang; Chen, Yi
2016-03-02
Nanomedicine has been growing exponentially due to its enhanced drug targeting and reduced drug toxicity. It uses the interactions where nanotechnological components and biological systems communicate with each other to facilitate the delivery performance. At this scale, the physiochemical properties of delivery systems strongly affect their capacities. Among current delivery systems, DNA nanotechnology shows many advantages because of its unprecedented engineering abilities. Through molecular recognition, DNA nanotechnology can be used to construct a variety of nanostructures with precisely controllable size, shape, and surface chemistry, which can be appreciated in the delivery process. In this review, different approaches that are currently used for the construction of DNA nanostructures are reported. Further, the utilization of these DNA nanostructures with the well-defined parameters for the precise control in drug delivery and gene therapy is discussed. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Trichloroethylene-induced gene expression and DNA methylation changes in B6C3F1 mouse liver.
Directory of Open Access Journals (Sweden)
Yan Jiang
Full Text Available Trichloroethylene (TCE, widely used as an organic solvent in the industry, is a common contaminant in air, soil, and water. Chronic TCE exposure induced hepatocellular carcinoma in mice, and occupational exposure in humans was suggested to be associated with liver cancer. To understand the role of non-genotoxic mechanism(s for TCE action, we examined the gene expression and DNA methylation changes in the liver of B6C3F1 mice orally administered with TCE (0, 100, 500 and 1000 mg/kg b.w. per day for 5 days. After 5 days TCE treatment at a dose level of 1000 mg/kg b.w., a total of 431 differentially expressed genes were identified in mouse liver by microarray, of which 291 were up-regulated and 140 down-regulated. The expression changed genes were involved in key signal pathways including PPAR, proliferation, apoptosis and homologous recombination. Notably, the expression level of a number of vital genes involved in the regulation of DNA methylation, such as Utrf1, Tet2, DNMT1, DNMT3a and DNMT3b, were dysregulated. Although global DNA methylation change was not detected in the liver of mice exposed to TCE, the promoter regions of Cdkn1a and Ihh were found to be hypo- and hypermethylated respectively, which correlated negatively with their mRNA expression changes. Furthermore, the gene expression and DNA methylation changes induced by TCE were dose dependent. The overall data indicate that TCE exposure leads to aberrant DNA methylation changes, which might alter the expression of genes involved in the TCE-induced liver tumorgenesis.
Wang, Yongming; Lin, Xiuyun; Dong, Bo; Wang, Yingdian; Liu, Bao
2004-01-01
RAPD (randomly amplified polymorphic DNA) and ISSR (inter-simple sequence repeat) fingerprinting on HpaII/MspI-digested genomic DNA of nine elite japonica rice cultivars implies inter-cultivar DNA methylation polymorphism. Using both DNA fragments isolated from RAPD or ISSR gels and selected low-copy sequences as probes, methylation-sensitive Southern blot analysis confirms the existence of extensive DNA methylation polymorphism in both genes and DNA repeats among the rice cultivars. The cultivar-specific methylation patterns are stably maintained, and can be used as reliable molecular markers. Transcriptional analysis of four selected sequences (RdRP, AC9, HSP90 and MMR) on leaves and roots from normal and 5-azacytidine-treated seedlings of three representative cultivars shows an association between the transcriptional activity of one of the genes, the mismatch repair (MMR) gene, and its CG methylation patterns.
Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes
Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.
2011-01-01
vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289
Molecular organization of the 5S rDNA gene type II in elasmobranchs.
Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian
2016-01-01
The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.
International Nuclear Information System (INIS)
Yu, Shuangying; Tang, Song; Mayer, Gregory D.; Cobb, George P.; Maul, Jonathan D.
2015-01-01
Highlights: • Interactive effects of UVB radiation-pesticide co-exposures were examined in frogs. • Responses included induction of DNA photo-adducts and DNA damage and repair genes. • Elevated DNA adduct levels occurred for co-exposures compared to UVB alone. • One mechanism is that pesticides may alter nuclear excision repair gene expression. - Abstract: Pesticide use and ultraviolet-B (UVB) radiation have both been suggested to adversely affect amphibians; however, little is known about their interactive effects. One potential adverse interaction could involve pesticide-induced dysregulation of DNA repair pathways, resulting in greater numbers of DNA photo-adducts from UVB exposure. In the present study, we investigated the interactive effects of UVB radiation and two common pesticides (endosulfan and α-cypermethrin) on induction of DNA photo-adducts and expression of DNA damage and repair related genes in African clawed frog (Xenopus laevis) embryos. We examined 13 genes that are, collectively, involved in stress defense, cell cycle arrest, nucleotide excision repair (NER), base excision repair, mismatch repair, DNA repair regulation, and apoptosis. We exposed X. laevis embryos to 0, 25, and 50 μg/L endosulfan or 0, 2.5, and 5.0 μg/L α-cypermethrin for 96 h, with environmentally relevant exposures of UVB radiation during the last 7 h of the 96 h exposure. We measured the amount of cyclobutane pyrimidine dimers (CPDs) and mRNA abundance of the 13 genes among treatments including control, pesticide only, UVB only, and UVB and pesticide co-exposures. Each of the co-exposure scenarios resulted in elevated CPD levels compared to UVB exposure alone, suggesting an inhibitory effect of endosulfan and α-cypermethrin on CPD repair. This is attributed to results indicating that α-cypermethrin and endosulfan reduced mRNA abundance of XPA and HR23B, respectively, to levels that may affect the initial recognition of DNA lesions. In contrast, both pesticides
International Nuclear Information System (INIS)
Oliveri, D.R.
1989-01-01
The ability to repair X-irradiation induced single-strand DNA breaks was examined in mutagen-sensitive mutants of Drosophila melanogaster. This analysis demonstrated that examined stocks possess a normal capacity to repair X-ray induced single-strand breaks. One of the mutants in this study, mei-41, has been shown to be involved in a number of DNA metabolizing functions. A molecular characterization of this mutant is presented. A cDNA hybridizing to genomic DNA both proximal and distal to a P element inducing a mei-41 mutation was isolated from both embryonic and adult female recombinant lambda phage libraries. A 2.2 kilobase embryonic cDNA clone was sequenced; the sequence of an open reading frame was identified which would predict a protein of 384 amino acids with a molecular weight of 43,132 daltons. An examination of homologies to sequences in protein and nucleic acid data bases revealed no sequences with significant homology to mei-41, however, two potential Zinc-finger domains were identified. Analysis of RNA hybridizing to the embryonic cDNA demonstrated the existence of a major 2.2 kilobase transcript expressed primarily in embryos and adult flies. An examination of the transcription of this gene in mei-41 mutants revealed significant variation from wild-type, an indication that the embryonic cDNA does represent a mei-41 transcript. Expression in tissues from adult animals demonstrated that the 2.2 kilobase RNA is expressed primarily in reproductive tissues. A 3.8kb transcript is the major species of RNA in the adult head and thorax. Evidence is presented which implies that expression of the mei-41 gene is strongly induced by exposure of certain cells to mutagens
Zhang, Ye; Rohde, Larry; Wu, Honglu
Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have demonstrated that genes with up-regulated expression induced by IR may play important roles in DNA damage sensing, cell cycle checkpoint and chromosomal repair, the relationship between the regulation of gene expression by IR and its impact on cytogenetic responses to ionizing radiation has not been systematically studied. Here, the expression of 25 genes selected based on their transcriptional changes in response to IR or from their known DNA repair roles were individually knocked down by siRNA transfection in human fibroblast cells. Chromosome aberrations (CA) and micronuclei (MN) formation were measured as the cytogenetic endpoints. Our results showed that the yields of MN and/or CA formation were significantly increased by suppressed expression of some of the selected genes in DSB and other DNA repair pathways. Knocked-down expression of other genes showed significant impact on cell cycle progression, possibly because of severe impairment of DNA damage repair. Of these 11 genes that affected the cytogenetic response, 9 were up-regulated in the cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulating the biological consequences after IR. Failure to express these IR-responsive genes, such as by gene mutation, could seriously change the outcome of the post IR scenario and lead to carcinogenesis.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
International Nuclear Information System (INIS)
Taira, M.; Yoshida, T.; Miyagawa, K.; Sakamoto, H.; Terada, M.; Sugimura, T.
1987-01-01
The hst gene was originally identified as a transforming gene in DNAs from human stomach cancers and from a noncancerous portion of stomach mucosa by DNA-mediated transfection assay using NIH3T3 cells. cDNA clones of hst were isolated from the cDNA library constructed from poly(A) + RNA of a secondary transformant induced by the DNA from a stomach cancer. The sequence analysis of the hst cDNA revealed the presence of two open reading frames. When this cDNA was inserted into an expression vector containing the simian virus 40 promoter, it efficiently induced the transformation of NIH3T3 cells upon transfection. It was found that one of the reading frames, which coded for 206 amino acids, was responsible for the transforming activity
DNA damage-responsive Drosophila melanogaster gene is also induced by heat shock
International Nuclear Information System (INIS)
Vivino, A.A.; Smith, M.D.; Minton, K.W.
1986-01-01
A gene isolated by screening Drosophila melanogaster tissue culture cells for DNA damage regulation was also found to be regulated by heat shock. After UV irradiation or heat shock, induction is at the transcriptional level and results in the accumulation of a 1.0-kilobase polyadenylated transcript. The restriction map of the clone bears no resemblance to the known heat shock genes, which are shown to be uninduced by UV irradiation
Directory of Open Access Journals (Sweden)
Olivier J Becherel
2013-04-01
Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.
Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.
Directory of Open Access Journals (Sweden)
Jason A Hilton
Full Text Available Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision, up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption
Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.
Hilton, Jason A; Meeks, John C; Zehr, Jonathan P
2016-01-01
Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in
Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes
International Nuclear Information System (INIS)
Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van
2003-01-01
The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Rangel-Salazar, Rubén; Wickström-Lindholm, Marie; Aguilar-Salinas, Carlos A; Alvarado-Caudillo, Yolanda; Døssing, Kristina B V; Esteller, Manel; Labourier, Emmanuel; Lund, Gertrud; Nielsen, Finn C; Rodríguez-Ríos, Dalia; Solís-Martínez, Martha O; Wrobel, Katarzyna; Wrobel, Kazimierz; Zaina, Silvio
2011-11-25
We previously showed that a VLDL- and LDL-rich mix of human native lipoproteins induces a set of repressive epigenetic marks, i.e. de novo DNA methylation, histone 4 hypoacetylation and histone 4 lysine 20 (H4K20) hypermethylation in THP-1 macrophages. Here, we: 1) ask what gene expression changes accompany these epigenetic responses; 2) test the involvement of candidate factors mediating the latter. We exploited genome expression arrays to identify target genes for lipoprotein-induced silencing, in addition to RNAi and expression studies to test the involvement of candidate mediating factors. The study was conducted in human THP-1 macrophages. Native lipoprotein-induced de novo DNA methylation was associated with a general repression of various critical genes for macrophage function, including pro-inflammatory genes. Lipoproteins showed differential effects on epigenetic marks, as de novo DNA methylation was induced by VLDL and to a lesser extent by LDL, but not by HDL, and VLDL induced H4K20 hypermethylation, while HDL caused H4 deacetylation. The analysis of candidate factors mediating VLDL-induced DNA hypermethylation revealed that this response was: 1) surprisingly, mediated exclusively by the canonical maintenance DNA methyltransferase DNMT1, and 2) independent of the Dicer/micro-RNA pathway. Our work provides novel insights into epigenetic gene regulation by native lipoproteins. Furthermore, we provide an example of DNMT1 acting as a de novo DNA methyltransferase independently of canonical de novo enzymes, and show proof of principle that de novo DNA methylation can occur independently of a functional Dicer/micro-RNA pathway in mammals.
Germline stem cell gene PIWIL2 mediates DNA repair through relaxation of chromatin.
Directory of Open Access Journals (Sweden)
De-Tao Yin
Full Text Available DNA damage response (DDR is an intrinsic barrier of cell to tumorigenesis initiated by genotoxic agents. However, the mechanisms underlying the DDR are not completely understood despite of extensive investigation. Recently, we have reported that ectopic expression of germline stem cell gene PIWIL2 is associated with tumor stem cell development, although the underlying mechanisms are largely unknown. Here we show that PIWIL2 is required for the repair of DNA-damage induced by various types of genotoxic agents. Upon ultraviolet (UV irradiation, silenced PIWIL2 gene in normal human fibroblasts was transiently activated after treatment with UV light. This activation was associated with DNA repair, because Piwil2-deficienct mouse embryonic fibroblasts (mili(-/- MEFs were defective in cyclobutane pyrimidine dimers (CPD repair after UV treatment. As a result, the UV-treated mili(-/- MEFs were more susceptible to apoptosis, as characterized by increased levels of DNA damage-associated apoptotic proteins, such as active caspase-3, cleaved Poly (ADP-ribose polymerase (PARP and Bik. The impaired DNA repair in the mili(-/- MEFs was associated with the reductions of histone H3 acetylation and chromatin relaxation, although the DDR pathway downstream chromatin relaxation appeared not to be directly affected by Piwil2. Moreover, guanine-guanine (Pt-[GG] and double strand break (DSB repair were also defective in the mili(-/- MEFs treated by genotoxic chemicals Cisplatin and ionizing radiation (IR, respectively. The results indicate that Piwil2 can mediate DNA repair through an axis of Piwil2 → histone acetylation → chromatin relaxation upstream DDR pathways. The findings reveal a new role for Piwil2 in DNA repair and suggest that Piwil2 may act as a gatekeeper against DNA damage-mediated tumorigenesis.
Akram, Zertashia; Riaz, Sadaf; Kayani, Mahmood Akhtar; Jahan, Sarwat; Ahmad, Malik Waqar; Ullah, Muhammad Abaid; Wazir, Hizbullah; Mahjabeen, Ishrat
2018-01-16
Oxidative stress and DNA damage are considered as possible mechanisms involved in lead toxicity. To test this hypothesis, DNA damage and expression variations of aminolevulinic acid dehydratase (ALAD), superoxide dismutase 2 (SOD2), and 8-oxoguanine DNA glycosylase 2a (OGG1-2a) genes was studied in a cohort of 100 exposed workers and 100 controls with comet assay and real-time polymerse chain reaction (PCR). Results indicated that increased number of comets was observed in exposed workers versus controls (p gene.
Zhang, Ai-bing; Feng, Jie; Ward, Robert D; Wan, Ping; Gao, Qiang; Wu, Jun; Zhao, Wei-zhong
2012-01-01
Species identification via DNA barcodes is contributing greatly to current bioinventory efforts. The initial, and widely accepted, proposal was to use the protein-coding cytochrome c oxidase subunit I (COI) region as the standard barcode for animals, but recently non-coding internal transcribed spacer (ITS) genes have been proposed as candidate barcodes for both animals and plants. However, achieving a robust alignment for non-coding regions can be problematic. Here we propose two new methods (DV-RBF and FJ-RBF) to address this issue for species assignment by both coding and non-coding sequences that take advantage of the power of machine learning and bioinformatics. We demonstrate the value of the new methods with four empirical datasets, two representing typical protein-coding COI barcode datasets (neotropical bats and marine fish) and two representing non-coding ITS barcodes (rust fungi and brown algae). Using two random sub-sampling approaches, we demonstrate that the new methods significantly outperformed existing Neighbor-joining (NJ) and Maximum likelihood (ML) methods for both coding and non-coding barcodes when there was complete species coverage in the reference dataset. The new methods also out-performed NJ and ML methods for non-coding sequences in circumstances of potentially incomplete species coverage, although then the NJ and ML methods performed slightly better than the new methods for protein-coding barcodes. A 100% success rate of species identification was achieved with the two new methods for 4,122 bat queries and 5,134 fish queries using COI barcodes, with 95% confidence intervals (CI) of 99.75-100%. The new methods also obtained a 96.29% success rate (95%CI: 91.62-98.40%) for 484 rust fungi queries and a 98.50% success rate (95%CI: 96.60-99.37%) for 1094 brown algae queries, both using ITS barcodes.
Directory of Open Access Journals (Sweden)
Ai-bing Zhang
Full Text Available Species identification via DNA barcodes is contributing greatly to current bioinventory efforts. The initial, and widely accepted, proposal was to use the protein-coding cytochrome c oxidase subunit I (COI region as the standard barcode for animals, but recently non-coding internal transcribed spacer (ITS genes have been proposed as candidate barcodes for both animals and plants. However, achieving a robust alignment for non-coding regions can be problematic. Here we propose two new methods (DV-RBF and FJ-RBF to address this issue for species assignment by both coding and non-coding sequences that take advantage of the power of machine learning and bioinformatics. We demonstrate the value of the new methods with four empirical datasets, two representing typical protein-coding COI barcode datasets (neotropical bats and marine fish and two representing non-coding ITS barcodes (rust fungi and brown algae. Using two random sub-sampling approaches, we demonstrate that the new methods significantly outperformed existing Neighbor-joining (NJ and Maximum likelihood (ML methods for both coding and non-coding barcodes when there was complete species coverage in the reference dataset. The new methods also out-performed NJ and ML methods for non-coding sequences in circumstances of potentially incomplete species coverage, although then the NJ and ML methods performed slightly better than the new methods for protein-coding barcodes. A 100% success rate of species identification was achieved with the two new methods for 4,122 bat queries and 5,134 fish queries using COI barcodes, with 95% confidence intervals (CI of 99.75-100%. The new methods also obtained a 96.29% success rate (95%CI: 91.62-98.40% for 484 rust fungi queries and a 98.50% success rate (95%CI: 96.60-99.37% for 1094 brown algae queries, both using ITS barcodes.
DNA polymorphism of HLA class II genes in systemic lupus erythematosus
DEFF Research Database (Denmark)
Cowland, J B; Andersen, V; Halberg, P
1994-01-01
We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) genes: HLA-DRB, -DQA, -DQB, -DPB in 24 Danish patients with systemic lupus erythematosus (SLE) and in 102 healthy Danes. A highly significant increase of the frequency of the DR3...
Moody, Michael L; Rieseberg, Loren H
2012-07-01
The annual sunflowers (Helianthus sect. Helianthus) present a formidable challenge for phylogenetic inference because of ancient hybrid speciation, recent introgression, and suspected issues with deep coalescence. Here we analyze sequence data from 11 nuclear DNA (nDNA) genes for multiple genotypes of species within the section to (1) reconstruct the phylogeny of this group, (2) explore the utility of nDNA gene trees for detecting hybrid speciation and introgression; and (3) test an empirical method of hybrid identification based on the phylogenetic congruence of nDNA gene trees from tightly linked genes. We uncovered considerable topological heterogeneity among gene trees with or without three previously identified hybrid species included in the analyses, as well as a general lack of reciprocal monophyly of species. Nonetheless, partitioned Bayesian analyses provided strong support for the reciprocal monophyly of all species except H. annuus (0.89 PP), the most widespread and abundant annual sunflower. Previous hypotheses of relationships among taxa were generally strongly supported (1.0 PP), except among taxa typically associated with H. annuus, apparently due to the paraphyly of the latter in all gene trees. While the individual nDNA gene trees provided a useful means for detecting recent hybridization, identification of ancient hybridization was problematic for all ancient hybrid species, even when linkage was considered. We discuss biological factors that affect the efficacy of phylogenetic methods for hybrid identification.
A DNA-based registry for all animal species: the barcode index number (BIN system.
Directory of Open Access Journals (Sweden)
Sujeevan Ratnasingham
Full Text Available Because many animal species are undescribed, and because the identification of known species is often difficult, interim taxonomic nomenclature has often been used in biodiversity analysis. By assigning individuals to presumptive species, called operational taxonomic units (OTUs, these systems speed investigations into the patterning of biodiversity and enable studies that would otherwise be impossible. Although OTUs have conventionally been separated through their morphological divergence, DNA-based delineations are not only feasible, but have important advantages. OTU designation can be automated, data can be readily archived, and results can be easily compared among investigations. This study exploits these attributes to develop a persistent, species-level taxonomic registry for the animal kingdom based on the analysis of patterns of nucleotide variation in the barcode region of the cytochrome c oxidase I (COI gene. It begins by examining the correspondence between groups of specimens identified to a species through prior taxonomic work and those inferred from the analysis of COI sequence variation using one new (RESL and four established (ABGD, CROP, GMYC, jMOTU algorithms. It subsequently describes the implementation, and structural attributes of the Barcode Index Number (BIN system. Aside from a pragmatic role in biodiversity assessments, BINs will aid revisionary taxonomy by flagging possible cases of synonymy, and by collating geographical information, descriptive metadata, and images for specimens that are likely to belong to the same species, even if it is undescribed. More than 274,000 BIN web pages are now available, creating a biodiversity resource that is positioned for rapid growth.
MIWI2 as an Effector of DNA Methylation and Gene Silencing in Embryonic Male Germ Cells
Directory of Open Access Journals (Sweden)
Kanako Kojima-Kita
2016-09-01
Full Text Available During the development of mammalian embryonic germ cells, global demethylation and de novo DNA methylation take place. In mouse embryonic germ cells, two PIWI family proteins, MILI and MIWI2, are essential for the de novo DNA methylation of retrotransposons, presumably through PIWI-interacting RNAs (piRNAs. Although piRNA-associated MIWI2 has been reported to play critical roles in the process, its molecular mechanisms have remained unclear. To identify the mechanism, transgenic mice were produced; they contained a fusion protein of MIWI2 and a zinc finger (ZF that recognized the promoter region of a type A LINE-1 gene. The ZF-MIWI2 fusion protein brought about DNA methylation, suppression of the type A LINE-1 gene, and a partial rescue of the impaired spermatogenesis of MILI-null mice. In addition, ZF-MIWI2 was associated with the proteins involved in DNA methylation. These data indicate that MIWI2 functions as an effector of de novo DNA methylation of the retrotransposon.
Histone gene expression remains coupled to DNA synthesis during in vitro cellular senescence
International Nuclear Information System (INIS)
Zambetti, G.; Stein, G.; Stein, J.; Dell'Orco, R.
1987-01-01
Despite a decrease in the extent to which confluent monolayers of late compared to early passage CF3 human diploid fibroblasts can be stimulated to proliferate, the time course of DNA synthesis onset is similar regardless of the in vitro age of the cells. A parallel and stoichiometric relationship is maintained between the rate of DNA synthesis and the cellular levels of histone mRNA independent of the age of the cell cultures. Furthermore, DNA synthesis and cellular histone mRNA levels decline in a coordinate manner after inhibition of DNA replication by hydroxyurea treatment. These results indicate that while the proliferative activity of human diploid fibroblasts decreases with passage in culture, those cells that retain the ability to proliferate continue to exhibit a tight coupling of DNA replication and histone gene expression
International Nuclear Information System (INIS)
Zhou Pingkun; Sui Jianli
2002-01-01
Objective: To clone a novel low dose radiation-induced gene (LRIGx) and study its function as well as its transcriptional changes after irradiation. Methods: Its cDNA was obtained by DDRT-PCR and RACE techniques. Northern blot hybridization was used to investigate the gene transcription. Bioinformatics was employed to analysis structure and function of this gene. Results: LRIGx cDNA was cloned. The sequence of LRIGx was identical to a DNA clone located in human chromosome 20 q 11.2-12 Bioinformatics analysis predicted an encoded protein with a conserved helicase domain. Northern analysis revealed a ∼8.5 kb transcript which was induced after 0.2 Gy as well as 0.02 Gy irradiation, and the transcript level was increased 5 times at 4 h after 0.2 Gy irradiation. The induced level of LRIGx transcript by 2.0 Gy high dose was lower than by 0.2 Gy. Conclusion: A novel low dose radiation-induced gene has been cloned. It encodes a protein with a conserved helicase domain that could involve in DNA metabolism in the cellular process of radiation response
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.