Are lesions induced by ionizing radiation direct blocks to DNA chain elongation
International Nuclear Information System (INIS)
Painter, R.B.
1983-01-01
Ionizing radiation blocks DNA chain elongation in normal diploid fibroblasts but not in fibroblasts from patients with ataxia-telangiectasia, even though there are no differences in the damage induced between the two cell types. This difference suggests that radiation-induced lesions in DNA are not themselves blocks to chain elongation in ataxia cells and raises the possibility that in normal cells a mediator exists between DNA damage and chain termination
Energy Technology Data Exchange (ETDEWEB)
Ben-Hur, E [Israel Atomic Energy Commission, Beersheba. Nuclear Research Center-Negev; Hagan, M P [Armed Forces Radiobiology Research Inst., Bethesda, MD (USA)
1984-05-01
Chinese hamster fibroblasts were pulse labelled with 5-bromodeoxyuridine and exposed at time intervals (Tsub(i)) to near-ultraviolet (U.V.A.) light in the presence of a bisbenzimidazole derivative (Hoechst 33342). The sensitivity of the cells in terms of colony forming ability fluctuated depending on Tsub(i). Inhibition of DNA synthesis also depended on Tsub(i) and was maximal when Tsub(i)=O. Using the alkaline elution technique it was shown that the effect of a large dose of light was to inhibit both initiation and elongation of DNA chains. These effects were most pronounced for Tsub(i)=O. It is concluded that DNA damage in an active replicon can inhibit initiation of new replicons and that damage localized behind the replication fork can retard elongation of nascent DNA chains. This effect on chain elongation decreases with increased distance of the damage from the replication fork.
Cytological evidence for DNA chain elongation after UV irradiation in the S phase
International Nuclear Information System (INIS)
Minka, D.F.; Nath, J.
1981-01-01
Human cells irradiated with UV light synthesize lower molecular weight DNA than unirradiated cells. This reduction in molecular weight is greater in xeroderma pigmentosum (XP) cells than in normal cells. The molecular weight of DNA is further reduced by the addition of caffeine to XP cells. By several hours after irradiation, DNA fragments are barely detectable. Cells from excision-proficient and excision-deficient XP patients were studied autoradiographically to produce cytological evidence of DNA chain elongation. Replicate cultures with and without caffeine were synchronized and irradiated with UV light during the S phase. Caffeine was removed in G2, and the cells were labeled with 3 H-thymidine. Results showed significantly increased labeling during G2 of excision-deficient XP cells. Labeling was dependent on the time of irradiation and presence of caffeine. The XP variant cells had no increase in labeling for any irradiation time
Lassner, M W; Lardizabal, K; Metz, J G
1996-02-01
beta-Ketoacyl-coenzyme A (CoA) synthase (KCS) catalyzes the condensation of malonyl-CoA with long-chain acyl-CoA. This reaction is the initial step of the microsomal fatty acyl-CoA elongation pathway responsible for formation of very long chain fatty acids (VLCFAs, or fatty acids with chain lengths > 18 carbons). Manipulation of this pathway is significant for agriculture, because it is the basis of conversion of high erucic acid rapeseed into canola. High erucic acid rapeseed oil, used as an industrial feedstock, is rich in VLCFAs, whereas the edible oil extracted from canola is essentially devoid of VLCFAs. Here, we report the cloning of a cDNA from developing jojoba embryos involved in microsomal fatty acid elongation. The jojoba cDNA is homologous to the recently cloned Arabidopsis FATTY ACID ELONGATION1 (FAE1) gene that has been suggested to encode KCS. We characterize the jojoba enzyme and present biochemical data indicating that the jojoba cDNA does indeed encode KCS. Transformation of low erucic acid rapeseed with the jojoba cDNA restored KCS activity to developing embryos and altered the transgenic seed oil composition to contain high levels of VLCFAs. The data reveal the key role KCS plays in determining the chain lengths of fatty acids found in seed oils.
Methanol as an alternative electron donor in chain elongation for butyrate and caproate formation
Chen, W.S.; Ye, Y.; Steinbusch, K.J.J.; Strik, D.P.B.T.B.; Buisman, C.J.N.
2016-01-01
Chain elongation is an emerging mixed culture biotechnology converting acetate into valuable biochemicals by using ethanol as an external electron donor. In this study we proposed to test another potential electron donor, methanol, in chain elongation. Methanol can be produced through the thermochemical conversion of lignocellulosic biowaste. Use of methanol in chain elongation integrates the lignocellulosic feedstocks and the thermochemical platform technologies into chain elongation. After ...
Interplay between DNA supercoiling and transcription elongation.
Ma, Jie; Wang, Michelle
2014-01-01
Transcription-coupled DNA supercoiling has been shown to be an important regulator of transcription that is broadly present in the cell. Here we review experimental work which shows that RNA polymerase is a powerful torsional motor that can alter DNA topology and structure, and DNA supercoiling in turn directly affects transcription elongation.
Promoting chain elongation in mixed culture acidification reactors by addition of ethanol
International Nuclear Information System (INIS)
Grootscholten, T.I.M.; Kinsky dal Borgo, F.; Hamelers, H.V.M.; Buisman, C.J.N.
2013-01-01
In this research we investigate a microbial production process to produce medium chain fatty acids (MCFAs) based on the organic fraction of municipal solid waste (OFMSW). In this microbial production process, called chain elongation, bacteria produce medium chain fatty acids (MCFAs) from ethanol and volatile fatty acids (VFAs). MCFAs could be used as new biomass based building blocks for the chemical and fuel industry. The objective of this article is to investigate whether chain elongation can be promoted during acidification of OFMSW by addition of ethanol. The results show that chain elongation can be promoted during acidification of OFMSW by addition of ethanol. However, the hydrolysis rate and the carboxylic acid yield of the OFMSW in reactors with ethanol additions were lower than the hydrolysis rate and the carboxylic acid yield than in reactors without ethanol additions. Further research is required to determine whether a combined chain elongation and acidification reactor or a separated reactor system is more advantageous for MCFA production from OFMSW. -- Highlights: ► Production of medium chain fatty acids from municipal solid waste and ethanol. ► Insight in production of caproate and consumption of in-situ produced ethanol. ► Ethanol additions reduced propionate, butyrate and valerate concentrations. ► Ethanol additions hardly reduced acetate concentrations. ► Hydrolysis rate was lower in experiments with ethanol additions
Significant enhancement by biochar of caproate production via chain elongation.
Liu, Yuhao; He, Pinjing; Shao, Liming; Zhang, Hua; Lü, Fan
2017-08-01
In this study, biochar was introduced into a chain elongation system to enhance the bioproduction of caproate and caprylate. The concentration of caproate increased to 21.1 g/L upon the addition of biochar, which is the highest level of caproate reported for such a system to date when ethanol was used as electron donor. The addition of biochar created a tougher system with more stable microorganism community structure for chain elongation, in which no obvious inhibition by products or substrates was observed, moreover, the lag phase was reduced 2.3-fold compared to the system without biochar. These reinforcement effect of biochar are attributed to the enhanced conductivity due to the significant enrichment of functional microorganisms via the microbial network surrounding smaller biochar particles, and via the adsorption on the rough surfaces or pores of larger particles, which facilitated electron transfer. Higher amounts of extracellular polymer substances and higher conductivity induced by biochar could contribute to the reinforcement effect in chain elongation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Methanol as an alternative electron donor in chain elongation for butyrate and caproate formation
Chen, W.S.; Ye, Y.; Steinbusch, K.J.J.; Strik, D.P.B.T.B.; Buisman, C.J.N.
2016-01-01
Chain elongation is an emerging mixed culture biotechnology converting acetate into valuable biochemicals by using ethanol as an external electron donor. In this study we proposed to test another potential electron donor, methanol, in chain elongation. Methanol can be produced through the
The effect of heat and radiation on the initiation and elongation processes of DNA synthesis
International Nuclear Information System (INIS)
Davies, R.C.; Bowden, G.T.; Cress, A.E.
1983-01-01
The pH step alkaline elution and alkaline sucrose gradient techniques were utilized to evaluate alterations in DNA replication (initiation and elongation) induced by heat and low dose X-irradiation in synchronized Chinese hamster ovary cells. The initiation and elongation processes of DNA synthesis were radioresistant at the G 1 /S boundary (4 hours after mitosis) while in mid S phase (9 hours after mitosis) DNA initiation and elongation were sensitive to X-irradiation. The initiation and elongation processes of DNA synthesis which were radiation resistant at the G 1 /S boundary could be inhibited by a hyperthermia treatment (43 0 C for 1 hour beginning at 4 hours after mitosis). The impairment of initiation in the heated cells was maintained through late S phase while that of elongation was reversible as judged by full recovery at 15 hours after mitosis. These data suggest that the known synergistic lethality of heat and radiation may be mediated by an impairment of initiation of DNA synthesis. (author)
Stochastic model of template-directed elongation processes in biology.
Schilstra, Maria J; Nehaniv, Chrystopher L
2010-10-01
We present a novel modular, stochastic model for biological template-based linear chain elongation processes. In this model, elongation complexes (ECs; DNA polymerase, RNA polymerase, or ribosomes associated with nascent chains) that span a finite number of template units step along the template, one after another, with semaphore constructs preventing overtaking. The central elongation module is readily extended with modules that represent initiation and termination processes. The model was used to explore the effect of EC span on motor velocity and dispersion, and the effect of initiation activator and repressor binding kinetics on the overall elongation dynamics. The results demonstrate that (1) motors that move smoothly are able to travel at a greater velocity and closer together than motors that move more erratically, and (2) the rate at which completed chains are released is proportional to the occupancy or vacancy of activator or repressor binding sites only when initiation or activator/repressor dissociation is slow in comparison with elongation. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.
Definitive evidence for Ufd2-catalyzed elongation of the ubiquitin chain through Lys48 linkage
International Nuclear Information System (INIS)
Saeki, Yasushi; Tayama, Yoko; Toh-e, Akio; Yokosawa, Hideyoshi
2004-01-01
Saccharomyces cerevisiae Ufd2 is a ubiquitin chain elongation factor in the ubiquitin fusion degradation (UFD) pathway and functions in stress tolerance. A recent study has suggested that the mammalian Ufd2 homologue UFD2a catalyzes formation of Lys27- and Lys33-linked polyubiquitin chains rather than the Lys48-linked chain, but the linkage type of the polyubiquitin chain formed by yeast Ufd2 remains unclear. To determine the property of Ufd2, we reconstituted the UFD pathway using purified enzymes from yeast. Direct determination of the ubiquitin chain linkage type in polyubiquitinated UFD substrates by MALDI-TOF mass spectrometry revealed that Ufd2 catalyzes elongation of the ubiquitin chain through Lys48 linkage
Topological and metric properties of linear and circular DNA chains in nano-slits and nano-channels
Orlandini, Enzo; Micheletti, Cristian
2014-03-01
Motivated by recent advancements in single DNA molecule experiments, based on nanofluidic devices, we investigate numerically the metric and topological properties of a modelof open and circular DNA chains confined inside nano-slits and nano-channles. The results reveal an interesting characterization of the metric crossover behaviour in terms of the abundance, type and length of occuring knots. In particular we find that the knotting probability is nonmonotonic for increasing confinement and can be largely enhanced or suppressed, compared to the bulk case, by simply varying the slit or channel trasversal dimension. The observed knot population consists of knots that are far simpler than for DNA chains in spherical (i.e. cavities or capsids) confinement. These results suggest that nanoslits and nanochannels can be properly designed to produce open DNA chains hosting simple knots or to sieve DNA rings according to their knotted state. Finally we discuss the implications that the presence of knots may have on the dynamical properties of confined DNA chains such as chain elongation, injection/ejection processes and entanglement relaxation. We acknowledge financial support from the Italian ministry of education, grant PRIN 2010HXAW77.
Chain elongation and cyclization in type III PKS DpgA.
Wu, Hai-Chen; Li, Yi-San; Liu, Yu-Chen; Lyu, Syue-Yi; Wu, Chang-Jer; Li, Tsung-Lin
2012-04-16
Chain elongation and cyclization of precursors of dihydroxyphenylacetyl-CoA (DPA-CoA) catalyzed by the bacterial type III polyketide synthase DpgA were studied. Two labile intermediates, di- and tri-ketidyl-CoA (DK- and TK-CoA), were proposed and chemically synthesized. In the presence of DpgABD, each of these with [(13)C(3)]malonyl-CoA (MA-CoA) was able to form partially (13)C-enriched DPA-CoA. By NMR and MS analysis, the distribution of (13)C atoms in the partially (13)C-enriched DPA-CoA shed light on how the polyketide chain elongates and cyclizes in the DpgA-catalyzed reaction. Polyketone intermediates elongate in a manner different from that which had been believed: two molecules of DK-CoA, or one DK-CoA plus one acetoacetyl-CoA (AA-CoA), but not two molecules of AA-CoA can form one molecule of DPA-CoA. As a result, polyketidyl-CoA serves as both the starter and extender, whereas polyketone-CoA without the terminal carboxyl group can only act as an extender. The terminal carboxyl group is crucial for the cyclization that likely takes place on CoA. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nanostructures via DNA scaffold metallization
Ning, C.; Zinchenko, A.; Baigl, D.; Pyshkina, O.; Sergeyev, V.; Endo, Kazunaka; Yoshikawa, K.
2005-01-01
The critical role of polymers in process of noble metals nanostructures formation is well known, however, the use of DNA chain template in this process is yet largely unknown. In this study we demonstrate different ways of silver deposition on DNA template and report the influence of silver nanostructures formation on DNA conformational state. Metallization of DNA chain proceeds by two different scenarios depending on DNA conformation. If DNA chain is unfolded (elongated) chain, silver reduct...
Directory of Open Access Journals (Sweden)
Mark Roghair
2018-04-01
Full Text Available Introduction: Medium chain fatty acids (MCFAs, such as n-caproate, are potential valuable platform chemicals. MCFAs can be produced from low-grade organic residues by anaerobic reactor microbiomes through two subsequent biological processes: hydrolysis combined with acidogenesis and chain elongation. Continuous chain elongation with organic residues becomes effective when the targeted MCFA(s are produced at high concentrations and rates, while excessive ethanol oxidation and base consumption are limited. The objective of this study was to develop an effective continuous chain elongation process with hydrolyzed and acidified food waste and additional ethanol.Results: We fed acidified food waste (AFW and ethanol to an anaerobic reactor while operating the reactor at long (4 d and at short (1 d hydraulic retention time (HRT. At long HRT, n-caproate was continuously produced (5.5 g/L/d at an average concentration of 23.4 g/L. The highest n-caproate concentration was 25.7 g/L which is the highest reported n-caproate concentration in a chain elongation process to date. Compared to short HRT (7.1 g/L n-caproate at 5.6 g/L/d, long HRT resulted in 6.2 times less excessive ethanol oxidation. This led to a two times lower ethanol consumption and a two times lower base consumption per produced MCFA at long HRT compared to short HRT.Conclusions: Chain elongation from AFW and ethanol is more effective at long HRT than at short HRT not only because it results in a higher concentration of MCFAs but also because it leads to a more efficient use of ethanol and base. The HRT did not influence the n-caproate production rate. The obtained n-caproate concentration is more than twice as high as the maximum solubility of n-caproic acid in water which is beneficial for its separation from the fermentation broth. This study does not only set the record on the highest n-caproate concentration observed in a chain elongation process to date, it notably demonstrates that
International Nuclear Information System (INIS)
Zurlo, J.; Mignano, J.E.; Eustice, D.C.; Poirier, M.C.; Yager, J.D.
1986-01-01
One objective of this study was to determine the effects of N-hydroxy-2-acetylaminofluorene (N-OH-AAF) treatment on DNA synthesis in regenerating rat liver. It was found that N-OH-AAF caused a dose-dependent inhibition of [ 3 H]thymidine incorporation into liver DNA. This inhibition was followed by a gradual, but incomplete recovery. The second objective of the study was to determine the effects of DNA damage on the size distribution and elongation of nascent hepatocyte DNA. Hepatocytes, which have been shown to demonstrate a pattern of inhibition and subsequent recovery of DNA synthesis following UV irradiation similar to that seen in vivo upon treatment with N-OH-AAF were cultured. The size distribution of nascent DNA after UV irradiation was determined by pH step gradient alkaline elution analysis. The results show that UV irradiation caused a dose-dependent decrease in the size distribution of nascent DNA suggesting an inhibition of elongation. The results show that resumption of DNA synthesis and nascent strand elongation occur on damaged templates. These observations along with previous studies support the idea that DNA damage leading to inhibition of DNA synthesis may induce SOS-type processes which if mutagenic may play a role in the initiation of carcinogenesis. (Auth.)
Chain elongation suppression of cyclic block copolymers in lamellar microphase-separated bulk
Matsushita, Y; Iwata, H; Asari, T; Uchida, T; ten Brinke, G; Takano, A
2004-01-01
Chain elongation suppression of cyclic block copolymers in microphase-separated bulk was determined quantitatively. Solvent-cast and annealed films are confirmed to show alternating lamellar structure and their microdomain spacing D increases with increasing total molecular weight M according to the
International Nuclear Information System (INIS)
Wong, R.S.; Dewey, W.C.
1982-01-01
Heat treatment of Chinese hamster ovary cells at 45.5 degrees C for 15 minutes resulted in the inhibition of both the replicon initiation and the DNA elongation processes. Analysis of the DNA made after treatment showed that for up to 30 minutes after hyperthermia, there was a significant increase (45-80% above control level) in the amount of labeled DNA less than or equal to 40S in size and having a distinct peak of 20S. Therefore, elongation of 20S molecules into larger molecules was inhibited or slowed down. These small molecules did not accumulate when recovery times were longer than 30 minutes. The DNA made after 120 and 240 minutes postheat incubation was larger than control size and indicated that, although replicon initiation was still inhibited, elongation between replicons into 120S molecules could take place. However, their subsequent elongation into parental-size molecules was inhibited. The same delay in DNA elongation seen in cells examined immediately after treatment was still observed in cells heated and allowed to recover for 30 minutes. Also, after 30 minutes of recovery, heated cells still had more newly synthesized DNA in the single-stranded fraction than did control cells, which indicates that DNA elongation within a replicon is delayed for at least 30 minutes after heating. Furthermore, at 4 hours after heating, the inhibition of elongation of clusters of replicons into parental molecules prevailed
DNA Double Strand Break Response and Limited Repair Capacity in Mouse Elongated Spermatids
Directory of Open Access Journals (Sweden)
Emad A. Ahmed
2015-12-01
Full Text Available Spermatids are extremely sensitive to genotoxic exposures since during spermiogenesis only error-prone non homologous end joining (NHEJ repair pathways are available. Hence, genomic damage may accumulate in sperm and be transmitted to the zygote. Indirect, delayed DNA fragmentation and lesions associated with apoptotic-like processes have been observed during spermatid elongation, 27 days after irradiation. The proliferating spermatogonia and early meiotic prophase cells have been suggested to retain a memory of a radiation insult leading later to this delayed fragmentation. Here, we used meiotic spread preparations to localize phosphorylate histone H2 variant (γ-H2AX foci marking DNA double strand breaks (DSBs in elongated spermatids. This technique enabled us to determine the background level of DSB foci in elongated spermatids of RAD54/RAD54B double knockout (dko mice, severe combined immunodeficiency SCID mice, and poly adenosine diphosphate (ADP-ribose polymerase 1 (PARP1 inhibitor (DPQ-treated mice to compare them with the appropriate wild type controls. The repair kinetics data and the protein expression patterns observed indicate that the conventional NHEJ repair pathway is not available for elongated spermatids to repair the programmed and the IR-induced DSBs, reflecting the limited repair capacity of these cells. However, although elongated spermatids express the proteins of the alternative NHEJ, PARP1-inhibition had no effect on the repair kinetics after IR, suggesting that DNA damage may be passed onto sperm. Finally, our genetic mutant analysis suggests that an incomplete or defective meiotic recombinational repair of Spo11-induced DSBs may lead to a carry-over of the DSB damage or induce a delayed nuclear fragmentation during the sensitive programmed chromatin remodeling occurring in elongated spermatids.
Mcm10 regulates DNA replication elongation by stimulating the CMG replicative helicase.
Lõoke, Marko; Maloney, Michael F; Bell, Stephen P
2017-02-01
Activation of the Mcm2-7 replicative DNA helicase is the committed step in eukaryotic DNA replication initiation. Although Mcm2-7 activation requires binding of the helicase-activating proteins Cdc45 and GINS (forming the CMG complex), an additional protein, Mcm10, drives initial origin DNA unwinding by an unknown mechanism. We show that Mcm10 binds a conserved motif located between the oligonucleotide/oligosaccharide fold (OB-fold) and A subdomain of Mcm2. Although buried in the interface between these domains in Mcm2-7 structures, mutations predicted to separate the domains and expose this motif restore growth to conditional-lethal MCM10 mutant cells. We found that, in addition to stimulating initial DNA unwinding, Mcm10 stabilizes Cdc45 and GINS association with Mcm2-7 and stimulates replication elongation in vivo and in vitro. Furthermore, we identified a lethal allele of MCM10 that stimulates initial DNA unwinding but is defective in replication elongation and CMG binding. Our findings expand the roles of Mcm10 during DNA replication and suggest a new model for Mcm10 function as an activator of the CMG complex throughout DNA replication. © 2017 Lõoke et al.; Published by Cold Spring Harbor Laboratory Press.
Medium-chain fatty acids undergo elongation before β-oxidation in fibroblasts
International Nuclear Information System (INIS)
Jones, Patricia M.; Butt, Yasmeen; Messmer, Bette; Boriak, Richard; Bennett, Michael J.
2006-01-01
Although mitochondrial fatty acid β-oxidation (FAO) is considered to be well understood, further elucidation of the pathway continues through evaluation of patients with FAO defects. The FAO pathway can be examined by measuring the 3-hydroxy-fatty acid (3-OHFA) intermediates. We present a unique finding in the study of this pathway: the addition of medium-chain fatty acids to the culture media of fibroblasts results in generation of 3-OHFAs which are two carbons longer than the precursor substrate. Cultured skin fibroblasts from normal and LCHAD-deficient individuals were grown in media supplemented with various chain-length fatty acids. The cell-free medium was analyzed for 3-OHFAs by stable-isotope dilution gas-chromatography/mass-spectrometry. Our finding suggests that a novel carbon chain-length elongation process precedes the oxidation of medium-chain fatty acids. This previously undescribed metabolic step may have important implications for the metabolism of medium-chain triglycerides, components in the dietary treatment of a number of disorders
Direct current hopping conductance along DNA chain
Institute of Scientific and Technical Information of China (English)
Ma Song-Shan; Xu Hui; Liu Xiao-Liang; Li Ming-Jun
2007-01-01
This paper proposes a model of direct current(DC) electron hopping transport in DNA,in which DNA is considered as a binary one-dimensional disordered system.To quantitatively study the DC conductivity in DNA,it numerically calculates the DC conductivity of DNA chains with difierent parameter values.The result shows that the DC conductivity of DNA chain increases with the increase of temperature.And the conductivity of DNA chain is depended on the probability P.which represents the degree of compositional disorder in a DNA sequence to some extent.For P<0.5,the conductivity of DNA chain decreases with the increase of P,while for P≥0.5,the conductivity increases with the increase of p.The DC conductivity in DNA chain also varies with the change of the electric field,it presents non-Ohm's law conductivity characteristics.
Liu, Yuhao; Lü, Fan; Shao, Liming; He, Pinjing
2016-10-01
The objective of the study was to investigate whether the ratio of ethanol to acetate affects yield and product structure in chain elongation initiated by unacclimatized mixed cultures. The effect of varying the substrate concentration, while maintaining the same ratio of alcohol to acid, was also investigated. With a high substrate concentration, an alcohol to acid ratio >2:1 provided sufficient electron donor capacity for the chain elongation reaction. With an ethanol to acetate ratio of 3:1 (300mM total carbon), the highest n-caproate concentration (3033±98mg/L) was achieved during the stable phase of the reaction. A lower substrate concentration (150mM total carbon) gave a lower yield of products and led to reduced carbon transformation efficiency compared with other reaction conditions. The use of unacclimatized inoculum in chain elongation can produce significant amounts of odd-carbon-number carboxylates as a result of protein hydrolysis. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Fox, M.; Bloomfield, M.E.; Hopkins, J.; Boyle, J.M.
1983-01-01
DNA repair after u.v., N-methyl-N-nitrosourea (MNU) and ethylmethane sulphonate (EMS) in Chinese hamster V79 cells and the mutagen sensitive derivative V79/79 was investigated by measurement of five parameters: production of strand breaks in template DNA, incorporation of [ 3 H]TdR, semi-conservative and repair synthesis, molecular weights of pulse labelled DNA after mutagen exposure (nascent synthesis) and molecular weights of DNA pulse labelled and chased after mutagen exposure (elongation and ligation). Equal template strand breakage was evident in both cell lines immediately after MNU and EMS exposure and by 4-5 h after MNU the extent of fragmentation was greater in V79/79 cells. After u.v. irradiation template fragmentation was evident in V79/79 but not in V79 cells, even though V79/79 cells failed to excise cyclobutane dimers and repair synthesis was demonstrable in V79 cells but not in V79/79 cells after exposure to all three mutagens. The rate of incorporation of [ 3 H]TdR during semi-conservative DNA synthesis was inhibited equally in a dose dependent manner after u.v. and MNU exposure; incorporation by V79/79 cells was inhibited to a greater extent than by V79 cells after EMS exposure. Nascent DNA synthesis was suppressed more in V79/79 cells than in V79 cells after u.v. but to similar extents in both cell lines after MNU and EMS treatment. Pulse chase experiments indicated a lower rate of elongation of nascent DNA in V79/79 cells after MNU and u.v. exposure but little difference was detectable after EMS
The effect of purine phosphonomethoxyalkyl derivatives on DNA synthesis in Cho Chinese hamster cells
Energy Technology Data Exchange (ETDEWEB)
Stetina, R [Institute of Experimental Medicine, Laboratory of Developmental Toxicology, Academy of Sciences of Czech Republic, 51783 Olesnice v Orlickych horach (Czech Republic); Votruba, I; Holy, A; Merta, A [Institute of Organic Chemistry and Biochemistry, Academy of Sciences of Czech Republic (Czech Republic)
1994-12-31
The inhibition of incorporation of {sup 3}H-thymidine and the changes of the rate of nascent DNA chain elongation were investigated in Cho Chinese hamster cells treated with (S)-(3-hydroxy-2-phosphonomethoxypropyl) (HPMP) and N-(2-phosphonomethoxyethyl) (PME) derivatives of adenine (A), guanine (G) and 2,6-diaminopurine (DAP). No direct correlation was observed in PME and HPMP derivatives between cytotoxicity, inhibition of {sup 3}H-thymidine incorporation and inhibition of nascent DNA chain elongation. The highest cytotoxicity and inhibition of DNA synthesis were caused by PMEG. The limited extent of inhibition of DNA elongation was encountered in the case of HPMPG and HPMPA. With PMEA, weak inhibition of elongation of DNA was observed only after a prolonged exposure (6 h). None of the investigated drugs induced DNA breaks. (author) 4 figs., 23 refs.
Engineering of methionine chain elongation part of glucoraphanin pathway in E. coli
DEFF Research Database (Denmark)
Mirza, Nadia Muhammad Akram; Crocoll, Christoph; Olsen, Carl Erik
2016-01-01
The methionine-derived glucosinolate glucoraphanin is associated with the health-promoting properties of broccoli. This has developed a strong interest in producing this compound in high amounts from a microbial source. Glucoraphanin synthesis starts with a five-gene chain elongation pathway...
Motion of Knots in DNA Stretched by Elongational Fields
Klotz, Alexander R.; Soh, Beatrice W.; Doyle, Patrick S.
2018-05-01
Knots in DNA occur in biological systems, serve as a model system for polymer entanglement, and affect the efficacy of modern genomics technologies. We study the motion of complex knots in DNA by stretching molecules with a divergent electric field that provides an elongational force. We demonstrate that the motion of knots is nonisotropic and driven towards the closest end of the molecule. We show for the first time experimentally that knots can go from a mobile to a jammed state by varying an applied strain rate, and that this jamming is reversible. We measure the mobility of knots as a function of strain rate, demonstrating the conditions under which knots can be driven towards the ends of the molecule and untied.
Dual RING E3 Architectures Regulate Multiubiquitination and Ubiquitin Chain Elongation by APC/C.
Brown, Nicholas G; VanderLinden, Ryan; Watson, Edmond R; Weissmann, Florian; Ordureau, Alban; Wu, Kuen-Phon; Zhang, Wei; Yu, Shanshan; Mercredi, Peter Y; Harrison, Joseph S; Davidson, Iain F; Qiao, Renping; Lu, Ying; Dube, Prakash; Brunner, Michael R; Grace, Christy R R; Miller, Darcie J; Haselbach, David; Jarvis, Marc A; Yamaguchi, Masaya; Yanishevski, David; Petzold, Georg; Sidhu, Sachdev S; Kuhlman, Brian; Kirschner, Marc W; Harper, J Wade; Peters, Jan-Michael; Stark, Holger; Schulman, Brenda A
2016-06-02
Protein ubiquitination involves E1, E2, and E3 trienzyme cascades. E2 and RING E3 enzymes often collaborate to first prime a substrate with a single ubiquitin (UB) and then achieve different forms of polyubiquitination: multiubiquitination of several sites and elongation of linkage-specific UB chains. Here, cryo-EM and biochemistry show that the human E3 anaphase-promoting complex/cyclosome (APC/C) and its two partner E2s, UBE2C (aka UBCH10) and UBE2S, adopt specialized catalytic architectures for these two distinct forms of polyubiquitination. The APC/C RING constrains UBE2C proximal to a substrate and simultaneously binds a substrate-linked UB to drive processive multiubiquitination. Alternatively, during UB chain elongation, the RING does not bind UBE2S but rather lures an evolving substrate-linked UB to UBE2S positioned through a cullin interaction to generate a Lys11-linked chain. Our findings define mechanisms of APC/C regulation, and establish principles by which specialized E3-E2-substrate-UB architectures control different forms of polyubiquitination. Copyright © 2016 Elsevier Inc. All rights reserved.
DNA damage regulates alternative splicing through changes in POL II elongation
International Nuclear Information System (INIS)
Munoz, M.J.; Perez Santangelo, M.S.; De la Mata, M.; Kornblihtt, A.R.
2008-01-01
Many apoptotic genes are regulated via alternative splicing (AS) but little is known about the mechanisms controlling AS in stress situations derived from DNA damage. Here we show that ultraviolet (UV) radiation affects co-transcriptional, but not post transcriptional, AS through a systemic mechanism involving a CDK-9-dependent hyper phosphorylation of RNA polymerase II carboxy terminal domain (CTD) and a subsequent and unprecedented inhibition of transcriptional elongation, estimated in vivo and in real time by FRAP. To mimic this hyper phosphorylation we used CTD mutants with serines 2 or 5 substituted by glutamic acids and found that they not only display lower elongation rates but duplicate the effects of UV light on AS in the absence of irradiation. Consistently, substitution of the serines with alanines prevents the UV effect on splicing. These results represent the first in vivo proof of modulation of elongation in response to an environmental signal, affecting in turn the kinetic coupling between transcription and splicing. (authors)
Tucci, Sara; Behringer, Sidney; Spiekerkoetter, Ute
2015-11-01
An even medium-chain triglyceride (MCT)-based diet is the mainstay of treatment in very long-chain acyl-CoA dehydrogenase (VLCAD) deficiency (VLCADD). Previous studies with magnetic resonance spectroscopy have shown an impact of MCT on the average fatty acid chain length in abdominal fat. We therefore assume that medium-chain fatty acids (MCFAs) are elongated and accumulate in tissue as long-chain fatty acids. In this study, we explored the hepatic effects of long-term supplementation with MCT or triheptanoin, an odd-chain C7-based triglyceride, in wild-type and VLCAD-deficient (VLCAD(-/-) ) mice after 1 year of supplementation as compared with a control diet. The de novo biosynthesis and elongation of fatty acids, and peroxisomal β-oxidation, were quantified by RT-PCR. This was followed by a comprehensive analysis of hepatic and cardiac fatty acid profiles by GC-MS. Long-term application of even and odd MCFAs strongly induced de novo biosynthesis and elongation of fatty acids in both wild-type and VLCAD(-/-) mice, leading to an alteration of the hepatic fatty acid profiles. We detected de novo-synthesized and elongated fatty acids, such as heptadecenoic acid (C17:1n9), eicosanoic acid (C20:1n9), erucic acid (C22:1n9), and mead acid (C20:3n9), that were otherwise completely absent in mice under control conditions. In parallel, the content of monounsaturated fatty acids was massively increased. Furthermore, we observed strong upregulation of peroxisomal β-oxidation in VLCAD(-/-) mice, especially when they were fed an MCT diet. Our data raise the question of whether long-term MCFA supplementation represents the most efficient treatment in the long term. Studies on the hepatic toxicity of triheptanoin are still ongoing. © 2015 FEBS.
Aphidicolin-induced nuclear elongation in tobacco BY-2 cells.
Yasuhara, Hiroki; Kitamoto, Kazuki
2014-05-01
Plant nuclei are known to differentiate into various shapes within a single plant. However, little is known about the mechanisms of nuclear morphogenesis. We found that nuclei of tobacco BY-2 cells were highly elongated on long-term treatment with 5 mg l⁻¹ aphidicolin, an inhibitor of DNA polymerase α. In aphidicolin-treated cells, the nuclear length was correlated with the cell length. During culture in the presence of aphidicolin, the nuclei were elongated in parallel with cell elongation. Nuclear elongation was inhibited by the inhibition of cell elongation with 2,6-dichlorobenzonitrile, a cellulose synthesis inhibitor. However, cell elongation induced in the auxin-depleted medium in the absence of aphidicolin did not cause nuclear elongation, indicating that cell elongation alone is not sufficient for nuclear elongation. Treatment with either latrunculin B or propyzamide inhibited the aphidicolin-induced nuclear elongation, indicating that both actin filaments and microtubules (MTs) are required for nuclear elongation. Observations using BY-YTHCLR2 cells, in which actin filaments, MTs and nuclei were simultaneously visualized, revealed that the longitudinally arranged MT bundles associated with the nucleus play an important role in nuclear elongation, and that actin filaments affect the formation of these MT bundles. In aphidicolin-treated cells, the nuclear DNA contents of the elongated nuclei exceeded 4C, and the nuclear length was highly correlated with the nuclear DNA content. In cells treated with 50 mg l⁻¹ aphidicolin, cells were elongated and nucleus-associated longitudinal MT bundles were formed, but the nuclear DNA contents did not exceed 4C and the nuclei did not elongate. These results indicate that an increase in the nuclear DNA content above 4C is also required for nuclear elongation.
Low fermentation pH is a trigger to alcohol production, but a killer to chain elongation
Directory of Open Access Journals (Sweden)
Ramon eGanigué
2016-05-01
Full Text Available Gasification of organic wastes coupled to syngas fermentation allows the recovery of carbon in the form of commodity chemicals, such as carboxylates and biofuels. Acetogenic bacteria ferment syngas to mainly two-carbon compounds, although a few strains can also synthesize four-, and six-carbon molecules. In general, longer carbon chain products have a higher biotechnological (and commercial value due to their higher energy content and their lower water solubility. However, de-novo synthesis of medium-chain products from syngas is quite uncommon in bacteria. An alternative to de-novo synthesis is bioproduction of short-chain products (C2 and C4, and their subsequent elongation to C4, C6 or C8 through reversed β-oxidation metabolism. This two-step synergistic approach has been successfully applied for the production of up to C8 compounds, although, the accumulation of alcohols in these mixed cultures remained below detection limits. The present work investigates the production of higher alcohols from syngas by open mixed cultures (OMC. A syngas-fermenting community was enriched from sludge of an anaerobic digester for a period of 110 days in a lab-scale reactor. At the end of this period, stable production of ethanol and butanol was obtained. C6 compounds were only transiently produced at the beginning of the enrichment phase, during which Clostridium kluyveri, a bacterium able to carry out carbon chain elongation, was detected in the community. Further experiments showed pH as a critical parameter to maintain chain elongation activity in the co-culture. Production of C6 compounds was recovered by preventing fermentation pH to decrease below pH 4.5-5. Finally, experiments showed maximal production of C6 compounds (0.8 g/L and alcohols (1.7 g/L of ethanol, 1.1 g/L of butanol and 0.6 g/L of hexanol at pH 4.8. In conclusion, low fermentation pH is critical for the production of alcohols, although detrimental to C. kluyveri. Fine control of
International Nuclear Information System (INIS)
Kaufmann, W.K.; Cleaver, J.E.
1981-01-01
The inhibition of DNA replication in ultraviolet-irradiated human fibroblasts was characterized by quantitative analysis of radiation-induced alterations in the steady-state distribution of sizes of pulse-labeled, nascent DNA. Low, noncytotoxic fluences rapidly produced an inhibition of DNA synthesis in half-replicon-size replication intermediates. With time, the inhibition produced by low fluences spread progressively to include multi-replicon-size intermediates. The results indicate that ultraviolet radiation inhibits the initiation of DNA synthesis in replicons. Higher cytotoxic fluences inhibited DNA synthesis in operating replicons. Xeroderma pigmentosum fibroblasts with deficiencies in DNA excision repair exhibited an inhibition of replicon initiation after low radiation fluences, indicating the effect was not solely dependent upon operation of the nucleotidyl excision repair pathway. Owing to their inability to remove pyrimidine dimers ahead of DNA growing points, the repair-deficient cells also were more sensitive than normal cells to the ultraviolet-induced inhibition of chain elongation. Xeroderma pigmentosum cells belonging to the variant class were even more sensitive to inhibition of chain elongation despite their ability to remove pyrimidine dimers. The analysis suggested that normal and repair-deficient human fibroblasts either are able to rapidly bypass certain dimers or these dimers are not recognized by the chain elongation machinery. (author)
Ubiquitylation and degradation of elongating RNA polymerase II
DEFF Research Database (Denmark)
Wilson, Marcus D; Harreman, Michelle; Svejstrup, Jesper Q
2013-01-01
During its journey across a gene, RNA polymerase II has to contend with a number of obstacles to its progression, including nucleosomes, DNA-binding proteins, DNA damage, and sequences that are intrinsically difficult to transcribe. Not surprisingly, a large number of elongation factors have....... In this review, we describe the mechanisms and factors responsible for the last resort mechanism of transcriptional elongation. This article is part of a Special Issue entitled: RNA polymerase II Transcript Elongation....
DNA-binding proteins essential for protein-primed bacteriophage ø29 DNA replication
Directory of Open Access Journals (Sweden)
Margarita Salas
2016-08-01
Full Text Available Bacillus subtilis phage Φ29 has a linear, double-stranded DNA 19 kb long with an inverted terminal repeat of 6 nucleotides and a protein covalently linked to the 5’ ends of the DNA. This protein, called terminal protein (TP, is the primer for the initiation of replication, a reaction catalyzed by the viral DNA polymerase at the two DNA ends. The DNA polymerase further elongates the nascent DNA chain in a processive manner, coupling strand displacement with elongation. The viral protein p5 is a single-stranded DNA binding protein (SSB that binds to the single strands generated by strand displacement during the elongation process. Viral protein p6 is a double-stranded DNA binding protein (DBP that preferentially binds to the origins of replication at the Φ29 DNA ends and is required for the initiation of replication. Both SSB and DBP are essential for Φ29 DNA amplification. This review focuses on the role of these phage DNA-binding proteins in Φ29 DNA replication both in vitro and in vivo, as well as on the implication of several B. subtilis DNA-binding proteins in different processes of the viral cycle. We will revise the enzymatic activities of the Φ29 DNA polymerase: TP-deoxynucleotidylation, processive DNA polymerization coupled to strand displacement, 3’-5’ exonucleolysis and pyrophosphorolysis. The resolution of the Φ29 DNA polymerase structure has shed light on the translocation mechanism and the determinants responsible for processivity and strand displacement. These two properties have made Φ29 DNA polymerase one of the main enzymes used in the current DNA amplification technologies. The determination of the structure of Φ29 TP revealed the existence of three domains: the priming domain, where the primer residue Ser232, as well as Phe230, involved in the determination of the initiating nucleotide, are located, the intermediate domain, involved in DNA polymerase binding, and the N-terminal domain, responsible for DNA binding
International Nuclear Information System (INIS)
Fox, M.; Bloomfield, M.E.; Hopkins, J.; Boyle, J.M.
1983-01-01
DNA repair after u.v., N-methyl-N-nitrosourea (MNU) and ethylmethane sulphonate (EMS) in Chinese hamster V79 cells and the mutagen sensitive derivative V79/79 was investigated. Equal template strand breakage was evident in both cell lines immediately after MNU and EMS exposure and by 4-5 h after MNU the extent of fragmentation was greater in V79/79 cells. After u.v. irradiation template fragmentation was evident in V79/79 but not in V79 cells, even though V79/79 cells failed to excise cyclobutane dimers and repair synthesis was demonstrable in V79 cells but not in V79/79 cells after exposure to all three mutagens. The rate of incorporation of [ 3 H]TdR during semi-conservative DNA synthesis was inhibited equally in a dose dependent manner after u.v. and MNU exposure; incorporation by V79/79 cells was inhibited to a greater extent than by V79 cells after EMS exposure. Nascent DNA synthesis was suppressed more in V79/79 cells than in V79 cells after u.v. but to similar extents in both cell lines after MNU and EMS treatment. Pulse chase experiments indicated a lower rate of elongation of nascent DNA in V79/79 cells after MNU and u.v. exposure but little difference was detectable after EMS. (author)
Altered minor-groove hydrogen bonds in DNA block transcription elongation by T7 RNA polymerase.
Tanasova, Marina; Goeldi, Silvan; Meyer, Fabian; Hanawalt, Philip C; Spivak, Graciela; Sturla, Shana J
2015-05-26
DNA transcription depends upon the highly efficient and selective function of RNA polymerases (RNAPs). Modifications in the template DNA can impact the progression of RNA synthesis, and a number of DNA adducts, as well as abasic sites, arrest or stall transcription. Nonetheless, data are needed to understand why certain modifications to the structure of DNA bases stall RNA polymerases while others are efficiently bypassed. In this study, we evaluate the impact that alterations in dNTP/rNTP base-pair geometry have on transcription. T7 RNA polymerase was used to study transcription over modified purines and pyrimidines with altered H-bonding capacities. The results suggest that introducing wobble base-pairs into the DNA:RNA heteroduplex interferes with transcriptional elongation and stalls RNA polymerase. However, transcriptional stalling is not observed if mismatched base-pairs do not H-bond. Together, these studies show that RNAP is able to discriminate mismatches resulting in wobble base-pairs, and suggest that, in cases of modifications with minor steric impact, DNA:RNA heteroduplex geometry could serve as a controlling factor for initiating transcription-coupled DNA repair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kniss, Andreas; Schuetz, Denise; Kazemi, Sina; Pluska, Lukas; Spindler, Philipp E; Rogov, Vladimir V; Husnjak, Koraljka; Dikic, Ivan; Güntert, Peter; Sommer, Thomas; Prisner, Thomas F; Dötsch, Volker
2018-02-06
Ubiquitination is the most versatile posttranslational modification. The information is encoded by linkage type as well as chain length, which are translated by ubiquitin binding domains into specific signaling events. Chain topology determines the conformational space of a ubiquitin chain and adds an additional regulatory layer to this ubiquitin code. In particular, processes that modify chain length will be affected by chain conformations as they require access to the elongation or cleavage sites. We investigated conformational distributions in the context of chain elongation and disassembly using pulsed electron-electron double resonance spectroscopy in combination with molecular modeling. Analysis of the conformational space of diubiquitin revealed conformational selection or remodeling as mechanisms for chain recognition during elongation or hydrolysis, respectively. Chain elongation to tetraubiquitin increases the sampled conformational space, suggesting that a high intrinsic flexibility of K48-linked chains may contribute to efficient proteasomal degradation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Orimoto, Yuuichi, E-mail: orimoto.yuuichi.888@m.kyushu-u.ac.jp [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Aoki, Yuriko [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Japan Science and Technology Agency, CREST, 4-1-8 Hon-chou, Kawaguchi, Saitama 332-0012 (Japan)
2016-07-14
An automated property optimization method was developed based on the ab initio O(N) elongation (ELG) method and applied to the optimization of nonlinear optical (NLO) properties in DNA as a first test. The ELG method mimics a polymerization reaction on a computer, and the reaction terminal of a starting cluster is attacked by monomers sequentially to elongate the electronic structure of the system by solving in each step a limited space including the terminal (localized molecular orbitals at the terminal) and monomer. The ELG-finite field (ELG-FF) method for calculating (hyper-)polarizabilities was used as the engine program of the optimization method, and it was found to show linear scaling efficiency while maintaining high computational accuracy for a random sequenced DNA model. Furthermore, the self-consistent field convergence was significantly improved by using the ELG-FF method compared with a conventional method, and it can lead to more feasible NLO property values in the FF treatment. The automated optimization method successfully chose an appropriate base pair from four base pairs (A, T, G, and C) for each elongation step according to an evaluation function. From test optimizations for the first order hyper-polarizability (β) in DNA, a substantial difference was observed depending on optimization conditions between “choose-maximum” (choose a base pair giving the maximum β for each step) and “choose-minimum” (choose a base pair giving the minimum β). In contrast, there was an ambiguous difference between these conditions for optimizing the second order hyper-polarizability (γ) because of the small absolute value of γ and the limitation of numerical differential calculations in the FF method. It can be concluded that the ab initio level property optimization method introduced here can be an effective step towards an advanced computer aided material design method as long as the numerical limitation of the FF method is taken into account.
International Nuclear Information System (INIS)
Orimoto, Yuuichi; Aoki, Yuriko
2016-01-01
An automated property optimization method was developed based on the ab initio O(N) elongation (ELG) method and applied to the optimization of nonlinear optical (NLO) properties in DNA as a first test. The ELG method mimics a polymerization reaction on a computer, and the reaction terminal of a starting cluster is attacked by monomers sequentially to elongate the electronic structure of the system by solving in each step a limited space including the terminal (localized molecular orbitals at the terminal) and monomer. The ELG-finite field (ELG-FF) method for calculating (hyper-)polarizabilities was used as the engine program of the optimization method, and it was found to show linear scaling efficiency while maintaining high computational accuracy for a random sequenced DNA model. Furthermore, the self-consistent field convergence was significantly improved by using the ELG-FF method compared with a conventional method, and it can lead to more feasible NLO property values in the FF treatment. The automated optimization method successfully chose an appropriate base pair from four base pairs (A, T, G, and C) for each elongation step according to an evaluation function. From test optimizations for the first order hyper-polarizability (β) in DNA, a substantial difference was observed depending on optimization conditions between “choose-maximum” (choose a base pair giving the maximum β for each step) and “choose-minimum” (choose a base pair giving the minimum β). In contrast, there was an ambiguous difference between these conditions for optimizing the second order hyper-polarizability (γ) because of the small absolute value of γ and the limitation of numerical differential calculations in the FF method. It can be concluded that the ab initio level property optimization method introduced here can be an effective step towards an advanced computer aided material design method as long as the numerical limitation of the FF method is taken into account.
On the decrease of ultimate elongation of gum elastomer by irradiation
International Nuclear Information System (INIS)
Ito, Masayuki
1986-01-01
The reason why the ultimate elongation of gum elastomer decreases by irradiation was studied. The sample used is tetrafluoroethylenepropylene copolymer vulcanized which is a heat resistant elastomer. The sample was irradiated by a electron beam at room temperature. Cross-linking predominate in the operation. (Case 1) Scission predominant condition (Case 2) was given by irradiation of Co-60 γ ray at 100 deg C. Alternative irradiation of γ ray and electron beam under above condition can keep the original cross-linking density by the appropriate choice of each of the doses. (Case 3) The three cases mentioned above involve all of the cases of radiation induced aging of elastomers. Therefor, the following explanation for three cases shows the reason why the ultimate elongation of gum elastomer decreases by irradiation. Case 1. Cross-linking predominant condition. Ultimate elongation is proportional to -0.5 power of the dose. This fact can be explicable by the model of Buche, i.e. the breaking of a short chain causes another to break and that so on throughout the whole sample. Case 2. Chain scission predominant condition. Ultimate elongation increases by irradiation for a certain dose. This fact can understand by the model of Buche. But from a certain dose ultimate elongation does not increase. In the period the structure of the sample turned to be the same structure as the low molecular weight amorphose polymer vulcanized. Case 3. Rate of cross-linking and scission is the same. The average chain length does not chainge in the condition. But the distribution of chain length became wider and wider by irradiation. The increase of short chain result the decrease in ultimate elongation. (author)
International Nuclear Information System (INIS)
Cook, H.W.; Spence, M.W.
1987-01-01
Recent research in various biological systems has revived interest in interactions between the (n-6) and (n-3) essential fatty acids. We have utilized cultured glioma cells to show that linolenic acid, 18:3(n-3), is rapidly desaturated and chain elongated; 20:5(n-3) is the major product and accumulates almost exclusively in phospholipids. We examined effects of various (n-6), (n-3), (n-9) and (n-7) fatty acids at 40 microM concentration on desaturation and chain elongation processes using [1- 14 C]18:3(n-3) as substrate. In general, monoenoic fatty acids were without effect. The (n-6) fatty acids (18:2, 18:3, 20:3, 20:4 and 22:4) had little effect on total product formed. There was a shift of labeled product to triacylglycerol, and in phospholipids, slightly enhanced conversion of 20:5 to 22:5 was evident. In contrast, 22:6(n-3) was inhibitory, whereas 20:3(n-3) and 20:5(n-3) had much less effect. At concentrations less than 75 microM, all acids were inhibitory. Most products were esterified to phosphatidylcholine, but phosphatidylethanolamine also contained a major portion of 20:5 and 22:5. We provide a condensed overview of how the (n-6) and (n-3) fatty acids interact to modify relative rates of desaturation and chain elongation, depending on the essential fatty acid precursor. Thus, the balance between these dietary acids can markedly influence enzymes providing crucial membrane components and substrates for biologically active oxygenated derivatives
Development of two dimensional electrophoresis method using single chain DNA
International Nuclear Information System (INIS)
Ikeda, Junichi; Hidaka, So
1998-01-01
By combining a separation method due to molecular weight and a method to distinguish difference of mono-bases, it was aimed to develop a two dimensional single chain DNA labeled with Radioisotope (RI). From electrophoretic pattern difference of parent and variant strands, it was investigated to isolate the root module implantation control gene. At first, a Single Strand Conformation Polymorphism (SSCP) method using concentration gradient gel was investigated. As a result, it was formed that intervals between double chain and single chain DNAs expanded, but intervals of both single chain DNAs did not expand. On next, combination of non-modified acrylic amide electrophoresis method and Denaturing Gradient-Gel Electrophoresis (DGGE) method was examined. As a result, hybrid DNA developed by two dimensional electrophoresis arranged on two lines. But, among them a band of DNA modified by high concentration of urea could not be found. Therefore, in this fiscal year's experiments, no preferable result could be obtained. By the used method, it was thought to be impossible to detect the differences. (G.K.)
DEFF Research Database (Denmark)
Wewer, U M; Gerecke, D R; Durkin, M E
1994-01-01
or other known laminin genes. Immunostaining showed that the beta 2 chain is localized to the smooth muscle basement membranes of the arteries, while the homologous beta 1 chain is confined to the subendothelial basement membranes. The beta 2 chain was found in the basement membranes of ovarian carcinomas......Overlapping cDNA clones that encode the full-length human laminin beta 2 chain, formerly called the S chain, were isolated. The cDNA of 5680 nt contains a 5391-nt open reading frame encoding 1797 amino acids. At the amino terminus is a 32-amino-acid signal peptide that is followed by the mature...... beta 2 chain polypeptide of 1765 amino acids with a calculated molecular mass of 192,389 Da. The human beta 2 chain is predicted to have all of the seven structural domains typical of the beta chains of laminin, including the short cysteine-rich alpha region. The amino acid sequence of human beta 2...
DEFF Research Database (Denmark)
Kalia, A.; Jalava, T.; Nieminen, P.
1992-01-01
Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...
Studies on the mechanism of replication of adenovirus DNA. IV. Discontinuous DNA chain propagation
Vlak, J.M.; Rozijn, Th.H.; Sussenbach, J.S.
The replication of adenovirus type 5 DNA occurs by discontinuous chain propagation via short pieces of DNA. These pieces accumulate if the infected cells are treated with hydroxyurea. They have a sedimentation coefficient of 11 S corresponding to a molecular weight of about 700,000, and they contain
Kinetics and mechanism of DNA repair
International Nuclear Information System (INIS)
Meldrum, R.A.; Wharton, C.W.; Shall, S.
1990-01-01
Experiments are described in which the feasibility of using caged dideoxy and other nucleoside triphosphate analogues for trapping breaks induced by u.v. radiation damage to mammalian cell DNA is evaluated. These nucleotide analogues that have a photolabile 1-(2-nitrophenyl)ethyl-protecting group attached to the γ-phosphate are placed in situ by permeabilizing cells by exposure to hypo-osmotic medium. The nucleoside triphosphate is released by a 351 nm u.v. laser pulse whence it may incorporate in the growing chain of DNA induced by the excision-repair process and terminate chain elongation. If the photoreleased dideoxynucleoside trisphosphate is isotopically labelled in the α-phosphate position the break is trapped and labelled. Incorporation of radioactivity into trichloroacetic acid insoluble material in these experiments confirms their potential for use in studies of the kinetics of mammalian cell DNA repair. (author)
UVB DNA dosimeters analyzed by polymerase chain reactors
International Nuclear Information System (INIS)
Yoshida, Hiroko; Regan, J.D.; Florida Inst. of Tech., Melbourne, FL
1997-01-01
Purified bacteriophage λ DNA was dried on a UV-transparent polymer film and served as a UVB dosimeter for personal and ecological applications. Bacteriophage λ DNA was chosen because it is commercially available and inexpensive, and its entire sequence is known. Each dosimeter contained two sets of DNA sandwiched between UV-transparent polymer films, one exposed to solar radiation (experimental) and another protected from UV radiation by black paper (control). The DNA dosimeter was then analyzed by a polymerase chain reaction (PCR) that amplifies a 500 base pair specific region of λ DNA. Photoinduced damage in DNA blocks polymerase from synthesizing a new strand; therefore, the amount of amplified product in UV-exposed DNA was reduced from that found in control DNA. The dried λ DNA dosimeter is compact, robust, safe and transportable, stable over long storage times and provides the total UVB dose integrated over the exposure time. (author)
International Nuclear Information System (INIS)
Jiang Yang-Wei; Zhang Lin-Xi; Ran Shi-Yong; He Lin-Li; Wang Xiang-Hong
2015-01-01
Using molecular dynamics simulations and atomic force microscopy (AFM), we study the decondensation process of DNA chains induced by multivalent cations at high salt concentrations in the presence of short cationic chains in solutions. The typical simulation conformations of DNA chains with varying salt concentrations for multivalent cations imply that the concentration of salt cations and the valence of multivalent cations have a strong influence on the process of DNA decondensation. The DNA chains are condensed in the absence of salt or at low salt concentrations, and the compacted conformations of DNA chains become loose when a number of cations and anions are added into the solution. It is explicitly demonstrated that cations can overcompensate the bare charge of the DNA chains and weaken the attraction interactions between the DNA chains and short cationic chains at high salt concentrations. The condensation-decondensation transitions of DNA are also experimentally observed in mixing spermidine with λ-phage DNA at different concentrations of NaCl/MgCl 2 solutions. (paper)
Synchronization of DNA array replication kinetics
Manturov, Alexey O.; Grigoryev, Anton V.
2016-04-01
In the present work we discuss the features of the DNA replication kinetics at the case of multiplicity of simultaneously elongated DNA fragments. The interaction between replicated DNA fragments is carried out by free protons that appears at the every nucleotide attachment at the free end of elongated DNA fragment. So there is feedback between free protons concentration and DNA-polymerase activity that appears as elongation rate dependence. We develop the numerical model based on a cellular automaton, which can simulate the elongation stage (growth of DNA strands) for DNA elongation process with conditions pointed above and we study the possibility of the DNA polymerases movement synchronization. The results obtained numerically can be useful for DNA polymerase movement detection and visualization of the elongation process in the case of massive DNA replication, eg, under PCR condition or for DNA "sequencing by synthesis" sequencing devices evaluation.
Twist–radial normal mode analysis in double-stranded DNA chains
International Nuclear Information System (INIS)
Torrellas, Germán; Maciá, Enrique
2012-01-01
We study the normal modes of a duplex DNA chain at low temperatures. We consider the coupling between the hydrogen-bond radial oscillations and the twisting motion of each base pair within the Peyrard–Bishop–Dauxois model. The coupling is mediated by the stacking interaction between adjacent base pairs along the helix. We explicitly consider different mass values for different nucleotides, extending previous works. We disclose several resonance conditions of interest, determined by the fine-tuning of certain model parameters. The role of these dynamical effects on the DNA chain charge transport properties is discussed.
Energy Technology Data Exchange (ETDEWEB)
Meldrum, R.A.; Wharton, C.W. (Birmingham Univ. (UK). Dept. of Biochemistry); Shall, S. (Sussex Univ., Brighton (UK). School of Biological Sciences)
1990-03-15
Experiments are described in which the feasibility of using caged dideoxy and other nucleoside triphosphate analogues for trapping breaks induced by u.v. radiation damage to mammalian cell DNA is evaluated. These nucleotide analogues that have a photolabile 1-(2-nitrophenyl)ethyl-protecting group attached to the {gamma}-phosphate are placed in situ by permeabilizing cells by exposure to hypo-osmotic medium. The nucleoside triphosphate is released by a 351 nm u.v. laser pulse whence it may incorporate in the growing chain of DNA induced by the excision-repair process and terminate chain elongation. If the photoreleased dideoxynucleoside trisphosphate is isotopically labelled in the {alpha}-phosphate position the break is trapped and labelled. Incorporation of radioactivity into trichloroacetic acid insoluble material in these experiments confirms their potential for use in studies of the kinetics of mammalian cell DNA repair. (author).
Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G
The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,
Transcription elongation. Heterogeneous tracking of RNA polymerase and its biological implications.
Imashimizu, Masahiko; Shimamoto, Nobuo; Oshima, Taku; Kashlev, Mikhail
2014-01-01
Regulation of transcription elongation via pausing of RNA polymerase has multiple physiological roles. The pausing mechanism depends on the sequence heterogeneity of the DNA being transcribed, as well as on certain interactions of polymerase with specific DNA sequences. In order to describe the mechanism of regulation, we introduce the concept of heterogeneity into the previously proposed alternative models of elongation, power stroke and Brownian ratchet. We also discuss molecular origins and physiological significances of the heterogeneity.
DEFF Research Database (Denmark)
Makarova, Olga; Contaldo, Nicoletta; Paltrinieri, Samanta
2012-01-01
Background Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from...... different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf) gene for phytoplasma identification is reported. Methodology....../Principal Findings We designed a new set of primers and amplified a 420–444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX). Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed...
On DNA codes from a family of chain rings
Directory of Open Access Journals (Sweden)
Elif Segah Oztas
2017-01-01
Full Text Available In this work, we focus on reversible cyclic codes which correspond to reversible DNA codes or reversible-complement DNA codes over a family of finite chain rings, in an effort to extend what was done by Yildiz and Siap in [20]. The ring family that we have considered are of size $2^{2^k}$, $k=1,2, \\cdots$ and we match each ring element with a DNA $2^{k-1}$-mer. We use the so-called $u^2$-adic digit system to solve the reversibility problem and we characterize cyclic codes that correspond to reversible-complement DNA-codes. We then conclude our study with some examples.
Mutual interdependence of splicing and transcription elongation.
Brzyżek, Grzegorz; Świeżewski, Szymon
2015-01-01
Transcription and splicing are intrinsically linked, as splicing needs a pre-mRNA substrate to commence. The more nuanced view is that the rate of transcription contributes to splicing regulation. On the other hand there is accumulating evidence that splicing has an active role in controlling transcription elongation by DNA-dependent RNA polymerase II (RNAP II). We briefly review those mechanisms and propose a unifying model where splicing controls transcription elongation to provide an optimal timing for successive rounds of splicing.
Directory of Open Access Journals (Sweden)
Garrett P League
Full Text Available BACKGROUND: Crumbs (Crb, a cell polarity gene, has been shown to provide a positional cue for the extension of the apical membrane domain, adherens junction (AJ, and rhabdomere along the growing proximal-distal axis during Drosophila photoreceptor morphogenesis. In developing Drosophila photoreceptors, a stabilized microtubule structure was discovered and its presence was linked to polarity protein localization. It was therefore hypothesized that the microtubules may provide trafficking routes for the polarity proteins during photoreceptor morphogenesis. This study has examined whether Kinesin heavy chain (Khc, a subunit of the microtubule-based motor Kinesin-1, is essential in polarity protein localization in developing photoreceptors. METHODOLOGY/PRINCIPAL FINDINGS: Because a genetic interaction was found between crb and khc, Crb localization was examined in the developing photoreceptors of khc mutants. khc was dispensable during early eye differentiation and development. However, khc mutant photoreceptors showed a range of abnormalities in the apical membrane domain depending on the position along the proximal-distal axis in pupal photoreceptors. The khc mutant showed a progressive mislocalization in the apical domain along the distal-proximal axis during rhabdomere elongation. The khc mutation also led to a similar progressive defect in the stabilized microtubule structures, strongly suggesting that Khc is essential for microtubule structure and Crb localization during distal to proximal rhabdomere elongation in pupal morphogenesis. This role of Khc in apical domain control was further supported by khc's gain-of-function phenotype. Khc overexpression in photoreceptors caused disruption of the apical membrane domain and the stabilized microtubules in the developing photoreceptors. CONCLUSIONS/SIGNIFICANCE: In summary, we examined the role of khc in the regulation of the apical Crb domain in developing photoreceptors. Since the rhabdomeres in
Song, Luna; Zhang, Yonghua; Li, Junling; Gao, Qiang; Qi, Honglan; Zhang, Chengxiao
2016-04-01
An enzyme-free signal amplification-based assay for DNA detection was developed using fluorescent hairpin DNA probes coupled with hybridization chain reaction (HCR). The hairpin DNAs were designed to contain abasic sites in the stem moiety. Non-covalent labeling of the hairpin DNAs was achieved when a fluorescent ligand was bound to the abasic sites through hydrogen bonding with the orphan cytosine present on the complementary strand, accompanied by quench of ligand fluorescence. As a result, the resultant probes, the complex formed between the hairpin DNA and ligand, showed almost no fluorescence. Upon hybridization with target DNA, the probe underwent a dehybridization of the stem moiety containing an abasic site. The release of ligand from the abasic site to the solution resulted in an effective fluorescent enhancement, which can be used as a signal. Compared with a sensing system without HCR, a 20-fold increase in the sensitivity was achieved using the sensing system with HCR. The fluorescent intensity of the sensing system increased with the increase in target DNA concentration from 0.5 nM to 100 nM. A single mismatched target ss-DNA could be effectively discriminated from complementary target DNA. Genotyping of a G/C single-nucleotide polymorphism of polymerase chain reaction (PCR) products was successfully demonstrated with the sensing system. Therefore, integrating HCR strategy with non-covalent labeling of fluorescent hairpin DNA probes provides a sensitive and cost-effective DNA assay. © The Author(s) 2016.
International Nuclear Information System (INIS)
Zhuang, Junyang; Fu, Libing; Xu, Mingdi; Yang, Huanghao; Chen, Guonan; Tang, Dianping
2013-01-01
Graphical abstract: -- Highlights: •A new signal-on metallobioassay was developed for detection of nucleic acids. •Target-triggered long-range self-assembled DNA nanostructures are used for amplification of electronic signal. •Hybridization chain reaction is utilized for construction of long-range DNA nanostructures. -- Abstract: Methods based on metal nanotags have been developed for metallobioassay of nucleic acids, but most involve complicated labeling or stripping procedures and are unsuitable for routine use. Herein, we report the proof-of-concept of a novel and label-free metallobioassay for ultrasensitive electronic determination of human immunodeficiency virus (HIV)-related gene fragments at an ultralow concentration based on target-triggered long-range self-assembled DNA nanostructures and DNA-based hybridization chain reaction (HCR). The signal is amplified by silver nanotags on the DNA duplex. The assay mainly consists of capture probe, detection probe, and two different DNA hairpins. In the presence of target DNA, the capture probe immobilized on the sensor sandwiches target DNA with the 3′ end of detection probe. Another exposed part of detection probe at the 5′ end opens two alternating DNA hairpins in turn, and propagates a chain reaction of hybridization events to form a nicked double-helix. Finally, numerous silver nanotags are immobilized onto the long-range DNA nanostructures, each of which produces a strong electronic signal within the applied potentials. Under optimal conditions, the target-triggered long-range DNA nanostructures present good electrochemical behaviors for the detection of HIV DNA at a concentration as low as 0.5 fM. Importantly, the outstanding sensitivity can make this approach a promising scheme for development of next-generation DNA sensors without the need of enzyme labeling or fluorophore labeling
cDNA cloning and primary structure analysis of invariant chain in ...
African Journals Online (AJOL)
cDNA cloning and primary structure analysis of invariant chain in Chinese Pengze crucian carp. X Liu, W Yu, J Li, F Chen, S Liu, C Wu, J Xu. Abstract. Invariant chain (Ii) plays an important role in MHC class II molecules assembly and exogenous peptide presentation in vertebrates. Although mammalian Ii has been ...
Escherichia coli DnaE Polymerase Couples Pyrophosphatase Activity to DNA Replication.
Directory of Open Access Journals (Sweden)
Fabio Lapenta
Full Text Available DNA Polymerases generate pyrophosphate every time they catalyze a step of DNA elongation. This elongation reaction is generally believed as thermodynamically favoured by the hydrolysis of pyrophosphate, catalyzed by inorganic pyrophosphatases. However, the specific action of inorganic pyrophosphatases coupled to DNA replication in vivo was never demonstrated. Here we show that the Polymerase-Histidinol-Phosphatase (PHP domain of Escherichia coli DNA Polymerase III α subunit features pyrophosphatase activity. We also show that this activity is inhibited by fluoride, as commonly observed for inorganic pyrophosphatases, and we identified 3 amino acids of the PHP active site. Remarkably, E. coli cells expressing variants of these catalytic residues of α subunit feature aberrant phenotypes, poor viability, and are subject to high mutation frequencies. Our findings indicate that DNA Polymerases can couple DNA elongation and pyrophosphate hydrolysis, providing a mechanism for the control of DNA extension rate, and suggest a promising target for novel antibiotics.
Harmey, Judith H.; Harmey, Matthew A.
1993-01-01
We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...
Seco, Elena M.
2017-01-01
Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448
Rapid quantification of semen hepatitis B virus DNA by real-time polymerase chain reaction
Qian, Wei-Ping; Tan, Yue-Qiu; Chen, Ying; Peng, Ying; Li, Zhi; Lu, Guang-Xiu; Lin, Marie C.; Kung, Hsiang-Fu; He, Ming-Ling; Shing, Li-Ka
2005-01-01
AIM: To examine the sensitivity and accuracy of real-time polymerase chain reaction (PCR) for the quantification of hepatitis B virus (HBV) DNA in semen. METHODS: Hepatitis B viral DNA was isolated from HBV carriers’ semen and sera using phenol extraction method and QIAamp DNA blood mini kit (Qiagen, Germany). HBV DNA was detected by conventional PCR and quantified by TaqMan technology-based real-time PCR (quantitative polymerase chain reaction (qPCR)). The detection threshold was 200 copies of HBV DNA for conventional PCR and 10 copies of HBV DNA for real time PCR per reaction. RESULTS: Both methods of phenol extraction and QIAamp DNA blood mini kit were suitable for isolating HBV DNA from semen. The value of the detection thresholds was 500 copies of HBV DNA per mL in the semen. The viral loads were 7.5 × 107 and 1.67 × 107 copies of HBV DNA per mL in two HBV infected patients’ sera, while 2.14 × 105 and 3.02 × 105 copies of HBV DNA per mL in the semen. CONCLUSION: Real-time PCR is a more sensitive and accurate method to detect and quantify HBV DNA in the semen. PMID:16149152
Discrete persistent-chain model for protein binding on DNA.
Lam, Pui-Man; Zhen, Yi
2011-04-01
We describe and solve a discrete persistent-chain model of protein binding on DNA, involving an extra σ(i) at a site i of the DNA. This variable takes the value 1 or 0, depending on whether or not the site is occupied by a protein. In addition, if the site is occupied by a protein, there is an extra energy cost ɛ. For a small force, we obtain analytic expressions for the force-extension curve and the fraction of bound protein on the DNA. For higher forces, the model can be solved numerically to obtain force-extension curves and the average fraction of bound proteins as a function of applied force. Our model can be used to analyze experimental force-extension curves of protein binding on DNA, and hence deduce the number of bound proteins in the case of nonspecific binding. ©2011 American Physical Society
ELOVL4 protein preferentially elongates 20:5n3 to very long chain PUFAs over 20:4n6 and 22:6n3[S
Yu, Man; Benham, Aaron; Logan, Sreemathi; Brush, R. Steven; Mandal, Md Nawajes A.; Anderson, Robert E.; Agbaga, Martin-Paul
2012-01-01
We hypothesized that reduction/loss of very long chain PUFAs (VLC-PUFAs) due to mutations in the ELOngase of very long chain fatty acid-4 (ELOVL4) protein contributes to retinal degeneration in autosomal dominant Stargardt-like macular dystrophy (STGD3) and age-related macular degeneration; hence, increasing VLC-PUFA in the retina of these patients could provide some therapeutic benefits. Thus, we tested the efficiency of elongation of C20-C22 PUFA by the ELOVL4 protein to determine which substrates are the best precursors for biosynthesis of VLC-PUFA. The ELOVL4 protein was expressed in pheochromocytoma cells, while green fluorescent protein-expressing and nontransduced cells served as controls. The cells were treated with 20:5n3, 22:6n3, and 20:4n6, either individually or in equal combinations. Both transduced and control cells internalized and elongated the supplemented FAs to C22-C26 precursors. Only ELOVL4-expressing cells synthesized C28-C38 VLC-PUFA from these precursors. In general, 20:5n3 was more efficiently elongated to VLC-PUFA in the ELOVL4-expressing cells, regardless of whether it was in combination with 22:6n3 or with 20:4n6. In each FA treatment group, C34 and C36 VLC-PUFAs were the predominant VLC-PUFAs in the ELOVL4-expressing cells. In summary, 20:5n3, followed by 20:4n6, seems to be the best precursor for boosting the synthesis of VLC-PUFA by ELOVL4 protein. PMID:22158834
Interaction of gold nanoparticles with Pfu DNA polymerase and effect on polymerase chain reaction.
Sun, L-P; Wang, S; Zhang, Z-W; Ma, Y-Y; Lai, Y-Q; Weng, J; Zhang, Q-Q
2011-03-01
The interaction of gold nanoparticles with Pfu DNA polymerase has been investigated by a number of biological, optical and electronic spectroscopic techniques. Polymerase chain reaction was performed to show gold nanoparticles' biological effect. Ultraviolet-visible and circular dichroism spectra analysis were applied to character the structure of Pfu DNA polymerase after conjugation with gold nanoparticles. X-ray photoelectron spectroscopy was used to investigate the bond properties of the polymerase-gold nanoparticles complex. The authors demonstrate that gold nanoparticles do not affect the amplification efficiency of polymerase chain reaction using Pfu DNA polymerase, and Pfu DNA polymerase displays no significant changes of the secondary structure upon interaction with gold nanoparticles. The adsorption of Pfu DNA polymerase to gold nanoparticles is mainly through Au-NH(2) bond and electrostatic interaction. These findings may have important implications regarding the safety issue as gold nanoparticles are widely used in biomedical applications.
Tailored fatty acid synthesis via dynamic control of fatty acid elongation
Energy Technology Data Exchange (ETDEWEB)
Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA
2013-07-09
Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.
Haghighi, Fatemeh; Galfalvy, Hanga; Chen, Sean; Huang, Yung-Yu; Cooper, Thomas B; Burke, Ainsley K; Oquendo, Maria A; Mann, J John; Sublette, M Elizabeth
2015-01-01
Polyunsaturated fatty acid (PUFA) status has been associated with neuropsychiatric disorders, including depression and risk of suicide. Long-chain PUFAs (LC-PUFAs) are obtained in the diet or produced by sequential desaturation and elongation of shorter-chain precursor fatty acids linoleic acid (LA, 18:2n-6) and α-linolenic acid (ALA, 18:3n-3). We compared DNA methylation patterns in genes involved in LC-PUFA biosynthesis in major depressive disorder (MDD) with (n = 22) and without (n = 39) history of suicide attempt, and age- and sex-matched healthy volunteers (n = 59). Plasma levels of selected PUFAs along the LC-PUFA biosynthesis pathway were determined by transesterification and gas chromatography. CpG methylation levels for the main human LC-PUFA biosynthetic genes, fatty acid desaturases 1 (Fads1) and 2 (Fads2), and elongation of very long-chain fatty acids protein 5 (Elovl5), were assayed by bisulfite pyrosequencing. Associations between PUFA levels and diagnosis or suicide attempt status did not survive correction for multiple testing. However, MDD diagnosis and suicide attempts were significantly associated with DNA methylation in Elovl5 gene regulatory regions. Also the relative roles of PUFA levels and DNA methylation with respect to diagnostic and suicide attempt status were determined by least absolute shrinkage and selection operator logistic regression analyses. We found that PUFA associations with suicide attempt status were explained by effects of Elovl5 DNA methylation within the regulatory regions. The observed link between plasma PUFA levels, DNA methylation, and suicide risk may have implications for modulation of disease-associated epigenetic marks by nutritional intervention.
Directory of Open Access Journals (Sweden)
Fatemeh eHaghighi
2015-04-01
Full Text Available Polyunsaturated fatty acid (PUFA status has been associated with neuropsychiatric disorders, including depression and risk of suicide. Long-chain PUFAs (LC-PUFAs are obtained in the diet or produced by sequential desaturation and elongation of shorter-chain precursor fatty acids linoleic acid (LA, 18:2n-6 and α-linolenic acid (ALA, 18:3n-3. We compared DNA methylation patterns in genes involved in LC-PUFA biosynthesis in major depressive disorder (MDD with (n=22 and without (n=39 history of suicide attempt, and age- and sex-matched healthy volunteers (n=59. Plasma levels of selected PUFAs along the LC-PUFA biosynthesis pathway were determined by transesterification and gas chromatography. CpG methylation levels for the main human LC-PUFA biosynthetic genes, fatty acid desaturases 1 (Fads1 and 2 (Fads2, and elongation of very long chain fatty acids protein 5 (Elovl5, were assayed by bisulfite pyrosequencing. Associations between PUFA levels and diagnosis or suicide attempt status did not survive correction for multiple testing. However, MDD diagnosis and suicide attempts were significantly associated with DNA methylation in Elovl5 gene regulatory regions. Also the relative roles of PUFA levels and DNA methylation with respect to diagnostic and suicide attempt status were determined by least absolute shrinkage and selection operator (LASSO logistic regression analyses. We found that PUFA associations with suicide attempt status were explained by effects of Elovl5 DNA methylation within the regulatory regions. The observed link between plasma PUFA levels, DNA methylation, and suicide risk may have implications for modulation of disease-associated epigenetic marks by nutritional intervention.
DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.
Guthrie, J N; Moriarty, D J; Blackall, L L
2000-12-15
A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.
Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions
Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory
1989-04-01
The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.
Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G
2004-01-30
A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.
Twist-stretch profiles of DNA chains
Zoli, Marco
2017-06-01
Helical molecules change their twist number under the effect of a mechanical load. We study the twist-stretch relation for a set of short DNA molecules modeled by a mesoscopic Hamiltonian. Finite temperature path integral techniques are applied to generate a large ensemble of possible configurations for the base pairs of the sequence. The model also accounts for the bending and twisting fluctuations between adjacent base pairs along the molecules stack. Simulating a broad range of twisting conformation, we compute the helix structural parameters by averaging over the ensemble of base pairs configurations. The method selects, for any applied force, the average twist angle which minimizes the molecule’s free energy. It is found that the chains generally over-twist under an applied stretching and the over-twisting is physically associated to the contraction of the average helix diameter, i.e. to the damping of the base pair fluctuations. Instead, assuming that the maximum amplitude of the bending fluctuations may decrease against the external load, the DNA molecule first over-twists for weak applied forces and then untwists above a characteristic force value. Our results are discussed in relation to available experimental information albeit for kilo-base long molecules.
Transcription arrest caused by long nascent RNA chains
DEFF Research Database (Denmark)
Bentin, Thomas; Cherny, Dmitry; Larsen, H Jakob
2004-01-01
on transcription. Using phage T3 RNA polymerase (T3 RNAP) and covalently closed circular (cccDNA) DNA templates that did not contain any strong termination signal, transcription was severely inhibited after a short period of time. Less than approximately 10% residual transcriptional activity remained after 10 min......The transcription process is highly processive. However, specific sequence elements encoded in the nascent RNA may signal transcription pausing and/or termination. We find that under certain conditions nascent RNA chains can have a strong and apparently sequence-independent inhibitory effect...... of incubation. The addition of RNase A almost fully restored transcription in a dose dependent manner. Throughout RNase A rescue, an elongation rate of approximately 170 nt/s was maintained and this velocity was independent of RNA transcript length, at least up to 6 kb. Instead, RNase A rescue increased...
Elongator complex is required for long-term olfactory memory formation in Drosophila.
Yu, Dinghui; Tan, Ying; Chakraborty, Molee; Tomchik, Seth; Davis, Ronald L
2018-04-01
The evolutionarily conserved Elongator Complex associates with RNA polymerase II for transcriptional elongation. Elp3 is the catalytic subunit, contains histone acetyltransferase activity, and is associated with neurodegeneration in humans. Elp1 is a scaffolding subunit and when mutated causes familial dysautonomia. Here, we show that elp3 and elp1 are required for aversive long-term olfactory memory in Drosophila RNAi knockdown of elp3 in adult mushroom bodies impairs long-term memory (LTM) without affecting earlier forms of memory. RNAi knockdown with coexpression of elp3 cDNA reverses the impairment. Similarly, RNAi knockdown of elp1 impairs LTM and coexpression of elp1 cDNA reverses this phenotype. The LTM deficit in elp3 and elp1 knockdown flies is accompanied by the abolishment of a LTM trace, which is registered as increased calcium influx in response to the CS+ odor in the α-branch of mushroom body neurons. Coexpression of elp1 or elp3 cDNA rescues the memory trace in parallel with LTM. These data show that the Elongator complex is required in adult mushroom body neurons for long-term behavioral memory and the associated long-term memory trace. © 2018 Yu et al.; Published by Cold Spring Harbor Laboratory Press.
Statics and dynamics of DNA knotting
Orlandini, Enzo
2018-02-01
Knots and entanglement in polymers and biopolymers such as DNA and proteins constitute a timely topic that spans various scientific disciplines ranging from physics to chemistry, biology and mathematics. Although in the past many advancements have been made in understanding the equilibrium knotting probability and knot complexity of long polymer chains in solutions, many questions have been addressed in recent years by both experimental and theoretical means—for instance, how the knotting probability depends on the quality of the solvent, the elastic properties of the molecule and its degree of confinement. How knots form, evolve and eventually disappear in a fluctuating chain. Are the equilibrium and non-equilibrium properties of knotted molecules affected by the knot swelling/shrinking dynamics? Moreover, thanks to the great advance in nanotechnology and micromanipulation techniques, nowadays knots can be ‘manually’ tied in a single DNA molecule, followed during their motion along the chains, forced to pass through nanopores, or stretched by external forces or elongational flows. All these experimental approaches allow access to new information on the interplay of topology and polymer physics, and this has opened new perspectives in the field. Here, we provide an overview of the current knowledge of this topic, stressing the main results obtained, including the recent developments in experimental and computational approaches. Since almost all experiments on knotting involve DNA, the review will be mainly focused on the topological properties of this fascinating and biologically relevant molecule.
Archaeal RNA polymerase arrests transcription at DNA lesions.
Gehring, Alexandra M; Santangelo, Thomas J
2017-01-01
Transcription elongation is not uniform and transcription is often hindered by protein-bound factors or DNA lesions that limit translocation and impair catalysis. Despite the high degree of sequence and structural homology of the multi-subunit RNA polymerases (RNAP), substantial differences in response to DNA lesions have been reported. Archaea encode only a single RNAP with striking structural conservation with eukaryotic RNAP II (Pol II). Here, we demonstrate that the archaeal RNAP from Thermococcus kodakarensis is sensitive to a variety of DNA lesions that pause and arrest RNAP at or adjacent to the site of DNA damage. DNA damage only halts elongation when present in the template strand, and the damage often results in RNAP arresting such that the lesion would be encapsulated with the transcription elongation complex. The strand-specific halt to archaeal transcription elongation on modified templates is supportive of RNAP recognizing DNA damage and potentially initiating DNA repair through a process akin to the well-described transcription-coupled DNA repair (TCR) pathways in Bacteria and Eukarya.
International Nuclear Information System (INIS)
Takamiya, Mari; Sakurai, Masaaki; Teranishi, Fumie; Ikeda, Tomoko; Kamiyama, Tsutomu; Asai, Akira
2016-01-01
A high-throughput RapidFire mass spectrometry assay is described for elongation of very long-chain fatty acids family 6 (Elovl6). Elovl6 is a microsomal enzyme that regulates the elongation of C12-16 saturated and monounsaturated fatty acids. Elovl6 may be a new therapeutic target for fat metabolism disorders such as obesity, type 2 diabetes, and nonalcoholic steatohepatitis. To identify new Elovl6 inhibitors, we developed a high-throughput fluorescence screening assay in 1536-well format. However, a number of false positives caused by fluorescent interference have been identified. To pick up the real active compounds among the primary hits from the fluorescence assay, we developed a RapidFire mass spectrometry assay and a conventional radioisotope assay. These assays have the advantage of detecting the main products directly without using fluorescent-labeled substrates. As a result, 276 compounds (30%) of the primary hits (921 compounds) in a fluorescence ultra-high-throughput screening method were identified as common active compounds in these two assays. It is concluded that both methods are very effective to eliminate false positives. Compared with the radioisotope method using an expensive 14 C-labeled substrate, the RapidFire mass spectrometry method using unlabeled substrates is a high-accuracy, high-throughput method. In addition, some of the hit compounds selected from the screening inhibited cellular fatty acid elongation in HEK293 cells expressing Elovl6 transiently. This result suggests that these compounds may be promising lead candidates for therapeutic drugs. Ultra-high-throughput fluorescence screening followed by a RapidFire mass spectrometry assay was a suitable strategy for lead discovery against Elovl6. - Highlights: • A novel assay for elongation of very-long-chain fatty acids 6 (Elovl6) is proposed. • RapidFire mass spectrometry (RF-MS) assay is useful to select real screening hits. • RF-MS assay is proved to be beneficial because of
Meyerson, Nicholas R; Zhou, Ligang; Guo, Yusong R; Zhao, Chen; Tao, Yizhi J; Krug, Robert M; Sawyer, Sara L
2017-11-08
TRIM25 is an E3 ubiquitin ligase that activates RIG-I to promote the antiviral interferon response. The NS1 protein from all strains of influenza A virus binds TRIM25, although not all virus strains block the interferon response, suggesting alternative mechanisms for TRIM25 action. Here we present a nuclear role for TRIM25 in specifically restricting influenza A virus replication. TRIM25 inhibits viral RNA synthesis through a direct mechanism that is independent of its ubiquitin ligase activity and the interferon pathway. This activity can be inhibited by the viral NS1 protein. TRIM25 inhibition of viral RNA synthesis results from its binding to viral ribonucleoproteins (vRNPs), the structures containing individual viral RNA segments, the viral polymerase, and multiple viral nucleoproteins. TRIM25 binding does not inhibit initiation of capped-RNA-primed viral mRNA synthesis by the viral polymerase. Rather, the onset of RNA chain elongation is inhibited because TRIM25 prohibits the movement of RNA into the polymerase complex. Copyright © 2017 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Olga Makarova
Full Text Available Phytoplasmas are bacterial phytopathogens responsible for significant losses in agricultural production worldwide. Several molecular markers are available for identification of groups or strains of phytoplasmas. However, they often cannot be used for identification of phytoplasmas from different groups simultaneously or are too long for routine diagnostics. DNA barcoding recently emerged as a convenient tool for species identification. Here, the development of a universal DNA barcode based on the elongation factor Tu (tuf gene for phytoplasma identification is reported.We designed a new set of primers and amplified a 420-444 bp fragment of tuf from all 91 phytoplasmas strains tested (16S rRNA groups -I through -VII, -IX through -XII, -XV, and -XX. Comparison of NJ trees constructed from the tuf barcode and a 1.2 kbp fragment of the 16S ribosomal gene revealed that the tuf tree is highly congruent with the 16S rRNA tree and had higher inter- and intra- group sequence divergence. Mean K2P inter-/intra- group divergences of the tuf barcode did not overlap and had approximately one order of magnitude difference for most groups, suggesting the presence of a DNA barcoding gap. The use of the tuf barcode allowed separation of main ribosomal groups and most of their subgroups. Phytoplasma tuf barcodes were deposited in the NCBI GenBank and Q-bank databases.This study demonstrates that DNA barcoding principles can be applied for identification of phytoplasmas. Our findings suggest that the tuf barcode performs as well or better than a 1.2 kbp fragment of the 16S rRNA gene and thus provides an easy procedure for phytoplasma identification. The obtained sequences were used to create a publicly available reference database that can be used by plant health services and researchers for online phytoplasma identification.
Local stability perturbation in DNA structure induced by chain discontinuities
International Nuclear Information System (INIS)
Jorcano, J.L.; Mingot, F.; Davila, C.A.
1976-01-01
The thermal dependence of parameter ''h'' (number of base pairs broken near to internucleotide breaks) is studied. At 25degC, 0,2 M Na + and pH 7, the ''h'' value is about 12. Far from DNA melting temperature, ''h'' is not dependent upon ionic strength and it depends very little on temperature. This behavior suggests a non cooperative, entropically driven chain unzipping from terminals. Near melting temperature, ''h'' shows a thermal dependence asymptotic to Tm, and correlated with DNA composition. It seems to correspond to the cooperative denaturation. ''h'' values have been calculated from double and single break probabilities evaluated from hydrodynamically determined molecular weight distributions. (author)
Knotting dynamics of DNA chains of different length confined in nanochannels
International Nuclear Information System (INIS)
Suma, Antonio; Micheletti, Cristian; Orlandini, Enzo
2015-01-01
Langevin dynamics simulations are used to characterize the typical mechanisms governing the spontaneous tying, untying and the dynamical evolution of knots in coarse-grained models of DNA chains confined in nanochannels. In particular we focus on how these mechanisms depend on the chain contour length, L c , at a fixed channel width D = 56 nm corresponding to the onset of the Odijk scaling regime where chain backfoldings and hence knots are disfavoured but not suppressed altogether. We find that the lifetime of knots grows significantly with L c , while that of unknots varies to a lesser extent. The underlying kinetic mechanisms are clarified by analysing the evolution of the knot position along the chain. At the considered confinement, in fact, knots are typically tied by local backfoldings of the chain termini where they are eventually untied after a stochastic motion along the chain. Consequently, the lifetime of unknots is mostly controlled by backfoldings events at the chain ends, which is largely independent of L c . The lifetime of knots, instead, increases significantly with L c because knots can, on average, travel farther along the chain before being untied. The observed interplay of knots and unknots lifetimes underpins the growth of the equilibrium knotting probability of longer and longer chains at fixed channel confinement. (paper)
International Nuclear Information System (INIS)
Licastro, F.; Sarafian, T.; Verity, A.M.; Walford, R.L.
1985-01-01
The effects of hydroxyurea, aphidicolin and dideoxythymidine on UV-induced DNA repair of mouse neuronal granular cells were studied. Aphidicolin, which is considered a specific inhibitor of polymerase-alpha, decreased spontaneous DNA synthesis by 93% and totally suppressed DNA repair. Dideoxythymidine, an inhibitor of polymerase-beta, was more potent in decreasing scheduled DNA synthesis than aphidicolin, and also completely blocked the UV-induced DNA repair. Hydroxyurea, a specific inhibitor of ribonucleotide reductase, inhibited scheduled DNA synthesis, but unscheduled DNA synthesis after UV irradiation was always well detectable. Our data suggest that in neuronal cells from 5 to 10 days old mice both polymerases-alpha and -beta are required for both DNA synthesis and repair. These two enzymes may act jointly in filling up the gaps along the DNA molecule and elongating the DNA chain
Focke, Felix; Haase, Ilka; Fischer, Markus
2011-01-26
Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.
International Nuclear Information System (INIS)
Brewer, E.N.; Nygaard, O.F.; Kuncio, G.
1978-01-01
Isolated nuclei and intact plasmodia of Physarum contain a heat-stable stimulator of nuclear DNA replication. This substance has been purified extensively and found to contain both protein and carbohydrate. The molecular weight, estimated by gel filtration, is ca. 30,000 d. The purified material does not exhibit DNA polymerase or DNase activity, and does not stimulate DNA polymerase activity per se. In the presence of the stimulatory factor, DNA chain elongation occurs at an elevated rate, and continues for a longer time than in its absence, but G 2 nuclei are not stimulated to initiate DNA synthesis. Double-strand breaks in nuclear DNA of irradiated plasmodia are repaired in vitro to a greater extent following nuclear isolation during G 2 , and the DNA of unirradiated plasmodia is less susceptible to double-strand breakage during cell-free nuclear incubation, than is the DNA of S-phase nuclei. This correlation suggests a common basis for both observations, for example an increase in deoxyribonuclease activity or a decrease in DNA ligase activity during the S period. This, in turn, may account for the cell cycle-dependent sensitivity of this organism, in terms of mitotic delay, to ionizing radiation
cDNA cloning and characterization of Type I procollagen alpha1 chain in the skate Raja kenojei.
Hwang, Jae-Ho; Yokoyama, Yoshihiro; Mizuta, Shoshi; Yoshinaka, Reiji
2006-05-01
A full-length cDNA of the Type I procollagen alpha1 [pro-alpha1(I)] chain (4388 bp), coding for 1463 amino acid residues in the total length, was determined by RACE PCR using a cDNA library constructed from 4-week embryo of the skate Raja kenojei. The helical region of the skate pro-alpha1(I) chain consisted of 1014 amino acid residues - the same as other fibrillar collagen alpha chains from higher vertebrates. Comparison on denaturation temperatures of Type I collagens from the skate, rainbow trout (Oncorhynchus mykiss) and rat (Rattus norvegicus) revealed that the number of Gly-Pro-Pro and Gly-Gly in the alpha1(I) chains could be directly related to the thermal stability of the helix. The expression property of the skate pro-alpha1(I) chain mRNA and phylogenetic analysis with other vertebrate pro-alpha1(I) chains suggested that skate pro-alpha1(I) chain could be a precursor form of the skate Type I collagen alpha1 chain. The present study is the first evidence for the primary structure of full-length pro-alpha1(I) chain in an elasmobranch.
International Nuclear Information System (INIS)
Xiong Gang; Wang, X.R.
2005-01-01
The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor
Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin
2016-08-24
A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.
The generation of radiolabeled DNA and RNA probes with polymerase chain reaction
International Nuclear Information System (INIS)
Schowalter, D.B.; Sommer, S.S.
1989-01-01
By including a radioactive triphosphate during polymerase chain reaction (PCR), probes of very high specific activity can be generated. The advantages of PCR labeling include (1) uniform labeling with a specific activity of 5 X 10(9) cpm/micrograms or higher (sensitivity of detection: 0.028 pg of target DNA per 24 h); (2) ease of regulation of both the specific activity and the amount of labeled probe produced; (3) efficient labeling of fragments less than 500 bp; (4) efficient incorporation over a wide range of input DNA template; (5) labeling with subnanogram amounts of input DNA; and (6) direct labeling of genomic DNA. The minimal amount of input DNA allows a virtually unlimited number of PCR labeling reactions to be performed on DNA generated by one amplification under the previously described nonlabeling conditions. This obviates the need for CsCl gradients or other large scale methods of DNA preparation. The above advantages except for the very high specific activity can also be achieved by transcript labeling after an amplification where one or both of PCR primers contain a phage promoter sequence
Tailored fatty acid synthesis via dynamic control of fatty acid elongation
Torella, Joseph P.; Ford, Tyler J.; Kim, Scott N.; Chen, Amanda M.; Way, Jeffrey C.; Silver, Pamela A.
2013-01-01
Medium-chain fatty acids (MCFAs, 4–12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even- and odd-chain–length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired. PMID:23798438
Liew, C C; Jandreski, M A
1986-01-01
A cDNA clone, pVHC1, was isolated from a Syrian hamster heart cDNA library and was compared to the rat alpha (pCMHC21) and beta (pCMHC5) ventricular myosin heavy chain cDNA clones. The DNA sequence and amino acid sequence deducted from the DNA show more homology with pCMHC21 than pCMHC5. This indicates that pVHC1 is an alpha ventricular myosin heavy chain cDNA clone. However, even though pVHC1 shows a high degree of nucleotide and amino acid conservation with the rat myosin heavy chain sequen...
Lee, Sung G.; Lipmann, Fritz
1977-01-01
Dissociation of the multienzymes of tyrocidine synthesis by prolonged incubation of crude extracts of Bacillus brevis (Dubos strain, ATCC 8185) has yielded, on Sephadex G-100 chromatography, two fractions of amino acid activating subunits, a larger one of 70,000 daltons and a smaller one of 90,000 daltons; the latter was a complex consisting of the 70,000 dalton subunit and the pantetheine-carrying protein of about 20,000 daltons. When it dissociated, the intermediate enzyme, which activates three amino acids, contained two-thirds of the subunits in the 70,000 dalton and one-third in the 90,000 dalton fraction; the heavy enzyme, which activates six amino acids, contained five-sixths of the subunits in the former fraction and one-sixth in the latter. Both fractions showed ATP-PPi exchange with all amino acids that are activated by the respective polyenzymes. With proline as an example, the 70,000 dalton subunit exhibited a single low-affinity binding site, which should correspond to the peripheral thiol acceptor site, whereas the 90,000 dalton subunit showed both a low-affinity binding site and an additional high-affinity site for proline; the high-affinity site is attributed to the pantetheine present on the pantetheine-carrying protein, and suggests that amino acids are translocated from the peripheral SH to the pantetheine-carrying moiety during chain elongation. This was confirmed by the observation that the 90,000 dalton complex, when incubated with the light enzyme in the presence of phenylalanine and proline, produced DPhe-Pro dipeptide that cyclized into DPhe-Pro diketopiperazine, but the 70,000 dalton activating subunit, when similarly incubated, did not. After subunit dissociation, however, no further elongation occurred after the transfer from phenylalanine to proline. Images PMID:196286
DEFF Research Database (Denmark)
Clausing, Emanuel; Mayer, Andreas; Chanarat, Sittinan
2010-01-01
Multiple DNA-associated processes such as DNA repair, replication, and recombination are crucial for the maintenance of genome integrity. Here, we show a novel interaction between the transcription elongation factor Bur1-Bur2 and replication protein A (RPA), the eukaryotic single-stranded DNA......-binding protein with functions in DNA repair, recombination, and replication. Bur1 interacted via its C-terminal domain with RPA, and bur1-¿C mutants showed a deregulated DNA damage response accompanied by increased sensitivity to DNA damage and replication stress as well as increased levels of persisting Rad52...... foci. Interestingly, the DNA damage sensitivity of an rfa1 mutant was suppressed by bur1 mutation, further underscoring a functional link between these two protein complexes. The transcription elongation factor Bur1-Bur2 interacts with RPA and maintains genome integrity during DNA replication stress....
Culture-Negative Endocarditis Diagnosed Using 16S DNA Polymerase Chain Reaction
Directory of Open Access Journals (Sweden)
Stephen Duffett
2012-01-01
Full Text Available 16S DNA polymerase chain reaction (PCR is a molecular amplification technique that can be used to identify bacterial pathogens in culture-negative endocarditis. Bacterial DNA can be isolated from surgically excised valve tissue or from blood collected in EDTA vials. Use of this technique is particularly helpful in identifying the bacterial pathogen in cases of culture-negative endocarditis. A case involving a 48-year-old man who presented with severe aortic regurgitation and a four-month prodrome of low-grade fever is reported. Blood and valve tissue cultures following valve replacement were negative. A valve tissue sample was sent for investigation with 16S DNA PCR, which successfully identified Streptococcus salivarius and was interpreted as the true diagnosis. A review of the literature suggests that 16S DNA PCR from valve tissue is a more sensitive diagnostic test than culture. It is also extremely specific, based on a sequence match of at least 500 base pairs.
An Equatorial Contractile Mechanism Drives Cell Elongation but not Cell Division
Denker, Elsa; Bhattachan, Punit; Deng, Wei; Mathiesen, Birthe T.; Jiang, Di
2014-01-01
Cell shape changes and proliferation are two fundamental strategies for morphogenesis in animal development. During embryogenesis of the simple chordate Ciona intestinalis, elongation of individual notochord cells constitutes a crucial stage of notochord growth, which contributes to the establishment of the larval body plan. The mechanism of cell elongation is elusive. Here we show that although notochord cells do not divide, they use a cytokinesis-like actomyosin mechanism to drive cell elongation. The actomyosin network forming at the equator of each notochord cell includes phosphorylated myosin regulatory light chain, α-actinin, cofilin, tropomyosin, and talin. We demonstrate that cofilin and α-actinin are two crucial components for cell elongation. Cortical flow contributes to the assembly of the actomyosin ring. Similar to cytokinetic cells, membrane blebs that cause local contractions form at the basal cortex next to the equator and participate in force generation. We present a model in which the cooperation of equatorial actomyosin ring-based constriction and bleb-associated contractions at the basal cortex promotes cell elongation. Our results demonstrate that a cytokinesis-like contractile mechanism is co-opted in a completely different developmental scenario to achieve cell shape change instead of cell division. We discuss the occurrences of actomyosin rings aside from cell division, suggesting that circumferential contraction is an evolutionally conserved mechanism to drive cell or tissue elongation. PMID:24503569
International Nuclear Information System (INIS)
Johanson, K.J.; Rydberg, B.
1977-01-01
DNA chain growth has been studied in small intestinal crypt cells of the mouse in vivo using a sensitive method. The method was designed primarily to study radiation-induced DNA-breaks and their repair; but since there were breaks in DNA at the replicating fork, it was also possible to study DNA chain growth after a 3 H-thymidine pulse. It was found that DNA chain growth was not depressed by 200 rad of 60 Co γ-radiation. This finding supports the hypothesis that irradiation interferes mainly with the initiation of new replicons in mammalian cells affecting DNA chain growth only at higher doses. Hydroxyurea at sufficient dosage, however, depressed or even stopped DNA chain growth in mouse crypt cells in vivo. (author)
DEFF Research Database (Denmark)
Yue, Yanan; Jin, Fan; Deng, Rui
2011-01-01
Our revisit of the complexation between DNA and polyethylenimine (PEI) by using a combination of laser light scattering and gel electrophoresis confirms that nearly all the DNA chains are complexed with PEI to form polyplexes when the molar ratio of nitrogen from PEI to phosphate from DNA (N:P) r...
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
Shear and elongational rheology of photo-oxidative degraded HDPE and LLDPE
Wagner, Manfred Hermann; Zheng, Wang; Wang, Peng; Talamante, Sebastián Ramos; Narimissa, Esmaeil
2017-05-01
The effect of photo-oxidative degradation of high-density polyethylene (HDPE) and linear low-density polyethylene (LLDPE) was investigated by linear and non-linear rheological measurements. The linear-viscoelastic rheological measurements were performed at different temperatures, while the elongational viscosity was measured at 170°C and at different strain rates. The rheological data are indicative of structural changes caused by photo-oxidative degradation including formation of long-chain branches (LCB), cross-linking, and chain scission, and they revealed a cyclic and continuing competition between chain scission and LCB/gel formation. These findings are supported by additional FTIR measurements and direct measurements of the gel content of the degraded samples.
DEFF Research Database (Denmark)
Helmig, Sarah Wendelbo; Gothelf, Kurt Vesterager
2017-01-01
transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins - of which one is immobilized in specific points along tracks on DNA origami structures - are polymerized to form a continuous DNA duplex, which is visible using atomic force...... microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred >200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another...
cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)
International Nuclear Information System (INIS)
Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.; Tanaka, K.
1986-01-01
MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the β-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonal monospecific antibody. Single-stranded [ 32 P]labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting
Directory of Open Access Journals (Sweden)
Trioso Purnawarman
2014-04-01
Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.
Espinoza-Herrera, Shirly J; Gaur, Vineet; Suo, Zucai; Carey, Paul R
2013-07-23
Y-Family DNA polymerases are known to bypass DNA lesions in vitro and in vivo. Sulfolobus solfataricus DNA polymerase (Dpo4) was chosen as a model Y-family enzyme for investigating the mechanism of DNA synthesis in single crystals. Crystals of Dpo4 in complexes with DNA (the binary complex) in the presence or absence of an incoming nucleotide were analyzed by Raman microscopy. (13)C- and (15)N-labeled d*CTP, or unlabeled dCTP, were soaked into the binary crystals with G as the templating base. In the presence of the catalytic metal ions, Mg(2+) and Mn(2+), nucleotide incorporation was detected by the disappearance of the triphosphate band of dCTP and the retention of *C modes in the crystal following soaking out of noncovalently bound C(or *C)TP. The addition of the second coded base, thymine, was observed by adding cognate dTTP to the crystal following a single d*CTP addition. Adding these two bases caused visible damage to the crystal that was possibly caused by protein and/or DNA conformational change within the crystal. When d*CTP is soaked into the Dpo4 crystal in the absence of Mn(2+) or Mg(2+), the primer extension reaction did not occur; instead, a ternary protein·template·d*CTP complex was formed. In the Raman difference spectra of both binary and ternary complexes, in addition to the modes of d(*C)CTP, features caused by ring modes from the template/primer bases being perturbed and from the DNA backbone appear, as well as features from perturbed peptide and amino acid side chain modes. These effects are more pronounced in the ternary complex than in the binary complex. Using standardized Raman intensities followed as a function of time, the C(*C)TP population in the crystal was maximal at ∼20 min. These remained unchanged in the ternary complex but declined in the binary complexes as chain incorporation occurred.
Product differentiation by analysis of DNA melting curves during the polymerase chain reaction.
Ririe, K M; Rasmussen, R P; Wittwer, C T
1997-02-15
A microvolume fluorometer integrated with a thermal cycler was used to acquire DNA melting curves during polymerase chain reaction by fluorescence monitoring of the double-stranded DNA specific dye SYBR Green I. Plotting fluorescence as a function of temperature as the thermal cycler heats through the dissociation temperature of the product gives a DNA melting curve. The shape and position of this DNA melting curve are functions of the GC/AT ratio, length, and sequence and can be used to differentiate amplification products separated by less than 2 degrees C in melting temperature. Desired products can be distinguished from undesirable products, in many cases eliminating the need for gel electrophoresis. Analysis of melting curves can extend the dynamic range of initial template quantification when amplification is monitored with double-stranded DNA specific dyes. Complete amplification and analysis of products can be performed in less than 15 min.
Information management in DNA replication modeled by directional, stochastic chains with memory
Arias-Gonzalez, J. Ricardo
2016-11-01
Stochastic chains represent a key variety of phenomena in many branches of science within the context of information theory and thermodynamics. They are typically approached by a sequence of independent events or by a memoryless Markov process. Stochastic chains are of special significance to molecular biology, where genes are conveyed by linear polymers made up of molecular subunits and transferred from DNA to proteins by specialized molecular motors in the presence of errors. Here, we demonstrate that when memory is introduced, the statistics of the chain depends on the mechanism by which objects or symbols are assembled, even in the slow dynamics limit wherein friction can be neglected. To analyze these systems, we introduce a sequence-dependent partition function, investigate its properties, and compare it to the standard normalization defined by the statistical physics of ensembles. We then apply this theory to characterize the enzyme-mediated information transfer involved in DNA replication under the real, non-equilibrium conditions, reproducing measured error rates and explaining the typical 100-fold increase in fidelity that is experimentally found when proofreading and edition take place. Our model further predicts that approximately 1 kT has to be consumed to elevate fidelity in one order of magnitude. We anticipate that our results are necessary to interpret configurational order and information management in many molecular systems within biophysics, materials science, communication, and engineering.
Chromatin Constrains the Initiation and Elongation of DNA Replication.
Devbhandari, Sujan; Jiang, Jieqing; Kumar, Charanya; Whitehouse, Iestyn; Remus, Dirk
2017-01-05
Eukaryotic chromosomal DNA is faithfully replicated in a complex series of cell-cycle-regulated events that are incompletely understood. Here we report the reconstitution of DNA replication free in solution with purified proteins from the budding yeast Saccharomyces cerevisiae. The system recapitulates regulated bidirectional origin activation; synthesis of leading and lagging strands by the three replicative DNA polymerases Pol α, Pol δ, and Pol ε; and canonical maturation of Okazaki fragments into continuous daughter strands. We uncover a dual regulatory role for chromatin during DNA replication: promoting origin dependence and determining Okazaki fragment length by restricting Pol δ progression. This system thus provides a functional platform for the detailed mechanistic analysis of eukaryotic chromosome replication. Copyright © 2017 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Nie Leng; Gao Lizeng; Yan Xiyun; Wang Taihong
2007-01-01
Functionalized tetrapodal ZnO nanostructures are tested in plasmid DNA experiments (1) as a solid-phase adsorbent for plasmid DNA purification (2) as improving reagents in a polymerase chain reaction (PCR) and (3) as novel carriers for gene delivery. The amino-modification, the tetrapod-like shape of the nanostructure and its high biocompatibility all contribute to measurements showing promise for applications. A sol-gel method is used for silica coating and amino-modification. Plasmid DNA is purified through reversible conjugations of amino-modified ZnO tetrapods with DNA. Also, as additional reagents, functionalized tetrapods are shown to improve the amount of PCR product. For transfection, ZnO tetrapods provide some protection against deoxyribonuclease cleavage of plasmid DNA and deliver plasmid DNA into cells with little cytotoxicity
Elongation of exogenous fatty acids by the bioluminescent bacterium Vibrio harveyi
Energy Technology Data Exchange (ETDEWEB)
Byers, D.M.
1989-01-01
Bioluminescent bacteria require myristic acid (C14:0) to produce the myristaldehyde substrate of the light-emitting luciferase reaction. Since both endogenous and exogenous C14:0 can be used for this purpose, the metabolism of exogenous fatty acids by luminescent bacteria has been investigated. Both Vibrio harveyi and Vibrio fischeri incorporated label from (1-14C)myristic acid (C14:0) into phospholipid acyl chains as well as into CO2. In contrast, Photobacterium phosphoreum did not exhibit phospholipid acylation or beta-oxidation using exogenous fatty acids. Unlike Escherichia coli, the two Vibrio species can directly elongate fatty acids such as octanoic (C8:0), lauric (C12:0), and myristic acid, as demonstrated by radio-gas liquid chromatography. The induction of bioluminescence in late exponential growth had little effect on the ability of V. harveyi to elongate fatty acids, but it did increase the amount of C14:0 relative to C16:0 labeled from (14C)C8:0. This was not observed in a dark mutant of V. harveyi that is incapable of supplying endogenous C14:0 for luminescence. Cerulenin preferentially decreased the labeling of C16:0 and of unsaturated fatty acids from all 14C-labeled fatty acid precursors as well as from (14C)acetate, suggesting that common mechanisms may be involved in elongation of fatty acids from endogenous and exogenous sources. Fatty acylation of the luminescence-related synthetase and reductase enzymes responsible for aldehyde synthesis exhibited a chain-length preference for C14:0, which also was indicated by reverse-phase thin-layer chromatography of the acyl groups attached to these enzymes. The ability of V. harveyi to activate and elongate exogenous fatty acids may be related to an adaptive requirement to metabolize intracellular C14:0 generated by the luciferase reaction during luminescence development.
Elongation of exogenous fatty acids by the bioluminescent bacterium Vibrio harveyi
International Nuclear Information System (INIS)
Byers, D.M.
1989-01-01
Bioluminescent bacteria require myristic acid (C14:0) to produce the myristaldehyde substrate of the light-emitting luciferase reaction. Since both endogenous and exogenous C14:0 can be used for this purpose, the metabolism of exogenous fatty acids by luminescent bacteria has been investigated. Both Vibrio harveyi and Vibrio fischeri incorporated label from [1-14C]myristic acid (C14:0) into phospholipid acyl chains as well as into CO2. In contrast, Photobacterium phosphoreum did not exhibit phospholipid acylation or beta-oxidation using exogenous fatty acids. Unlike Escherichia coli, the two Vibrio species can directly elongate fatty acids such as octanoic (C8:0), lauric (C12:0), and myristic acid, as demonstrated by radio-gas liquid chromatography. The induction of bioluminescence in late exponential growth had little effect on the ability of V. harveyi to elongate fatty acids, but it did increase the amount of C14:0 relative to C16:0 labeled from [14C]C8:0. This was not observed in a dark mutant of V. harveyi that is incapable of supplying endogenous C14:0 for luminescence. Cerulenin preferentially decreased the labeling of C16:0 and of unsaturated fatty acids from all 14C-labeled fatty acid precursors as well as from [14C]acetate, suggesting that common mechanisms may be involved in elongation of fatty acids from endogenous and exogenous sources. Fatty acylation of the luminescence-related synthetase and reductase enzymes responsible for aldehyde synthesis exhibited a chain-length preference for C14:0, which also was indicated by reverse-phase thin-layer chromatography of the acyl groups attached to these enzymes. The ability of V. harveyi to activate and elongate exogenous fatty acids may be related to an adaptive requirement to metabolize intracellular C14:0 generated by the luciferase reaction during luminescence development
Evaluation of the Branched-Chain DNA Assay for Measurement of RNA in Formalin-Fixed Tissues
Knudsen, Beatrice S.; Allen, April N.; McLerran, Dale F.; Vessella, Robert L.; Karademos, Jonathan; Davies, Joan E.; Maqsodi, Botoul; McMaster, Gary K.; Kristal, Alan R.
2008-01-01
We evaluated the branched-chain DNA (bDNA) assay QuantiGene Reagent System to measure RNA in formalin-fixed, paraffin-embedded (FFPE) tissues. The QuantiGene Reagent System does not require RNA isolation, avoids enzymatic preamplification, and has a simple workflow. Five selected genes were measured by bDNA assay; quantitative polymerase chain reaction (qPCR) was used as a reference method. Mixed-effect statistical models were used to partition the overall variance into components attributable to xenograft, sample, and assay. For FFPE tissues, the coefficients of reliability were significantly higher for the bDNA assay (93–100%) than for qPCR (82.4–95%). Correlations between qPCRFROZEN, the gold standard, and bDNAFFPE ranged from 0.60 to 0.94, similar to those from qPCRFROZEN and qPCRFFPE. Additionally, the sensitivity of the bDNA assay in tissue homogenates was 10-fold higher than in purified RNA. In 9- to 13-year-old blocks with poor RNA quality, the bDNA assay allowed the correct identification of the overexpression of known cancer genes. In conclusion, the QuantiGene Reagent System is considerably more reliable, reproducible, and sensitive than qPCR, providing an alternative method for the measurement of gene expression in FFPE tissues. It also appears to be well suited for the clinical analysis of FFPE tissues with diagnostic or prognostic gene expression biomarker panels for use in patient treatment and management. PMID:18276773
Energy Technology Data Exchange (ETDEWEB)
Boiteux, S.; Laval, J. (Institut Gustave-Roussy, 94 - Villejuif (France))
After treatment of poly(dC) by the simple alkylating agent (/sup 3/H)dimethylsulfate, 90 percent of the radioactivity cochromatographed with 3-methylcytosine and 10 percent with 5-methylcytosine which is the normally occurring methylated base. In order to study the influence of 3-methylcytosine on DNA replication, untreated and MDS-treated poly(dC) were used as templates for E. coli DNA polymerase I. The alkylation of poly(dC) inhibits DNA chain elongation, and does not induce any mispairing under high fidelity conditions. The alteration of DNA polymerase I fidelity by manganese ions allows some replication of 3-methylcytosine which mispairs with either dAMP or dTMP. Our results suggest that 3-methylcytosine could be responsible, at least partially, for killing and the mutagenesis observed after cell treatment by alkylating agents.
Impaired rate of microsomal fatty acid elongation in undernourished neonatal rat brain
International Nuclear Information System (INIS)
Yeh, Y.Y.
1986-01-01
Hypomyelination caused by undernourishment in characterized by low concentrations of myelin lipids and marked reduction in lignocerate (C/sub 24:0/) and nervonate (C/sub 24:1/) moiety of cerebroside and sulfatide. Since microsomal elongation is the major source of long chain (22 to 24 carbons) fatty acids in the brain, the effect of neonatal undernourishment on acyl elongation was investigated. Undernourishment of suckling rats were induced after birth by restricting maternal dietary intake to 40% of that consumed by dams fed ad libitum. Neonates suckled by the normally fed dams served as controls. Microsomal elongation was measured as nmol from [2- 14 C] malonyl CoA incorporated/h per mg of protein. At 19 days of age, rates of behenoyl CoA (C/sub 22:0/) and erucoyl CoA (C/sub 22:1/) elongation in whole brain of undernourished neonates were 30-40% lower than that of the control, whereas the elongation rates of acyl CoA 16, 18 and 20 carbons in length either saturated or monounsaturated were similar in both groups. Undernourishment had no effect on cytoplasmic de novo fatty acid synthesis from acetyl CoA. If there are multiple elongation factors, the results indicate that the depressed activity of elongating enzyme(s) for C/sub 22:0/ and C/sub 22:1/ is an important contributing factor in lowering S/sub 24:0/ and C/sub 24:1/ content in cerebroside and sulfatide. This impairment may be a specific lesion leading to hypomyelination in undernourished rats
Lan, Feifei; Liang, Linlin; Zhang, Yan; Li, Li; Ren, Na; Yan, Mei; Ge, Shenguang; Yu, Jinghua
2017-11-01
In this work, a chemiluminescence-driven collapsible greeting card-like photoelectrochemical lab-on-paper device (GPECD) with hollow channel was demonstrated, in which target-triggering cascade DNA amplification strategy was ingeniously introduced. The GPECD had the functions of reagents storage and signal collection, and the change of configuration could control fluidic path, reaction time and alterations in electrical connectivity. In addition, three-dimentional reduced graphene oxide affixed Au flower was in situ grown on paper cellulose fiber for achieving excellent conductivity and biocompatibility. The cascade DNA amplification strategy referred to the cyclic formation of target analog chain and its trigger action to hybridization chain reaction (HCR), leading to the formation of numerous hemin/G-quadruplex DNA mimic enzyme with the presence of hemin. Subjected to the catalysis of hemin/G-quadruplex, the strong chemiluminiscence of luminol-H 2 O 2 system was obtained, which then was used as internal light source to excite photoactive materials realizing the simplification of instrument. In this analyzing process, thrombin served as proof-of-concept, and the concentration of target was converted into the DNA signal output by the specific recognition of aptamer-protein and target analog chain recycling. The target analog chain was produced in quantity with the presence of target, which further triggered abundant HCR and introduced hemin/G-quadruplex into the system. The photocurrent signal was obtained after the nitrogen-doped carbon dots sensitized ZnO was stimulated by chemiluminescence. The proposed GPECD exhibited excellent specificity and sensitivity toward thrombin with a detection limit of 16.7 fM. This judiciously engineered GPECD paved a luciferous way for detecting other protein with trace amounts in bioanalysis and clinical biomedicine.
Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid
2017-01-01
Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
Directory of Open Access Journals (Sweden)
Samira Mohammadi
2017-01-01
Full Text Available Background: Nontuberculous mycobacteria (NTM are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.
International Nuclear Information System (INIS)
Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.
1988-01-01
Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases
International Nuclear Information System (INIS)
Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong
2012-01-01
Highlights: ► Genomic DNA quantification were performed using a quantum dot-labeled Alu sequence. ► This probe provided PCR-free determination of human genomic DNA. ► Qdot-labeled Alu probe-hybridized genomic DNAs had a 2.5-femtogram detection limit. ► Qdot-labeled Alu sequence was used to assess DNA samples for human identification. - Abstract: Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.
APOBEC3G inhibits elongation of HIV-1 reverse transcripts.
Directory of Open Access Journals (Sweden)
Kate N Bishop
2008-12-01
Full Text Available APOBEC3G (A3G is a host cytidine deaminase that, in the absence of Vif, restricts HIV-1 replication and reduces the amount of viral DNA that accumulates in cells. Initial studies determined that A3G induces extensive mutation of nascent HIV-1 cDNA during reverse transcription. It has been proposed that this triggers the degradation of the viral DNA, but there is now mounting evidence that this mechanism may not be correct. Here, we use a natural endogenous reverse transcriptase assay to show that, in cell-free virus particles, A3G is able to inhibit HIV-1 cDNA accumulation not only in the absence of hypermutation but also without the apparent need for any target cell factors. We find that although reverse transcription initiates in the presence of A3G, elongation of the cDNA product is impeded. These data support the model that A3G reduces HIV-1 cDNA levels by inhibiting synthesis rather than by inducing degradation.
International Nuclear Information System (INIS)
Han, N.S.; Robyt, J.F.
1998-01-01
The biosynthesis of Acetobacter xylinum ATCC 10821 cellulose has been studied with resting cells and a membrane preparation using 14 C-pulse and chase reactions, with d-glucose and UDPGlc, respectively. Cellulose was biosynthesized from UDPGlc, and it was found to be tightly associated with both the cells and the membrane. The cellulose chains could be released from the cells and the membrane preparation by treating at pH 2, 100 C for 20 min. The cellulose chains that were released from the pulse and pulse-chase reactions were purified and separated from any low molecular weight substances by gel chromatography on Bio-Gel P4. They were then reduced with sodium borohydride and hydrolyzed with 4 M trifluoroacetic acid at 121 C for 2 h. Labeled products from the acid hydrolyzates were separated by paper chromatography and found to be d-glucose and d-glucitol. The amount of radioactivity in the products was determined by liquid scintillation counting. It was found that the pulsed products from the resting cells gave a ratio of d-[ 14 C]glucitol to d-[ 14 C]glucose of 1:11, and after chasing, the ratio decreased to 1:36. The pulsed products from the membrane gave a ratio of d-[ 14 C]glucitol to d-[ 14 C]glucose of 1:12, and after chasing for 5 min the ratio decreased to 1:43, and after 10 min, the ratio decreased to 1:66. These results show that the labeled d-glucitol obtained from the reducing end of the cellulose chain is chased into the interior of the cellulose chain during synthesis, showing that the cellulose chain is elongated from the reducing end. An insertion mechanism for the synthesis of cellulose from UDPGlc is proposed that involves lipid pyrophosphate glycosyl intermediates and three membrane enzymes: lipid phosphate:UDPGlc phosphotransferase, cellulose synthase, and lipid pyrophosphate phosphohydrolase. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)
Helmig, Sarah; Gothelf, Kurt Vesterager
2017-10-23
Signal transfer is central to the controlled exchange of information in biology and advanced technologies. Therefore, the development of reliable, long-range signal transfer systems for artificial nanoscale assemblies is of great scientific interest. We have designed such a system for the signal transfer between two connected DNA nanostructures, using the hybridization chain reaction (HCR). Two sets of metastable DNA hairpins, one of which is immobilized at specific points along tracks on DNA origami structures, are polymerized to form a continuous DNA duplex, which is visible using atomic force microscopy (AFM). Upon addition of a designed initiator, the initiation signal is efficiently transferred more than 200 nm from a specific location on one origami structure to an end point on another origami structure. The system shows no significant loss of signal when crossing from one nanostructure to another and, therefore, has the potential to be applied to larger multi-component DNA assemblies. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
International Nuclear Information System (INIS)
Shen Cenchao; Yang Wenjuan; Ji Qiaoli; Zhang Zhizhou; Maki, Hisaji; Dong Anjie
2009-01-01
Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.
International Nuclear Information System (INIS)
Wlodek, D.
1983-01-01
A review of the knowledge of radiation effects on cell membranes and DNA and of repair mechanisms of radiation lesions is given. Investigations of properties of plasma membranes in L5178Y-S and L5178Y-R cells (surface charge, fluidity, transport of amino acids) indicate that there is no direct connection between membrane lesions and reproductive death. It was also found that in irradiated cells of both L5178Y-strains the rate of DNA chain elongation is the same, similarly as the amount of the initial DNA lesions and the rate of repair processes. Difference in the level of DNA synthesis inhibition is not proportional to the lethal effect. The results are also reported point to the difference between L5178Y-S and L5178Y-R cells in susceptibility of post-irradiation DNA synthesis to factors modifying chromatin conformation, such as inhibitors of (ADP-ribose) n polymerase. 221 refs. (author)
Directory of Open Access Journals (Sweden)
Eric Aeby
2016-12-01
Full Text Available Oxidative damage of telomeres can promote cancer, cardiac failure, and muscular dystrophy. Specific mechanisms protecting telomeres from oxidative damage have not been described. We analyzed telomeric chromatin composition during the cell cycle and show that the antioxidant enzyme peroxiredoxin 1 (PRDX1 is enriched at telomeres during S phase. Deletion of the PRDX1 gene leads to damage of telomeric DNA upon oxidative stress, revealing a protective function of PRDX1 against oxidative damage at telomeres. We also show that the oxidized nucleotide 8-oxo-2′deoxyguanosine-5′-triphosphate (8oxodGTP causes premature chain termination when incorporated by telomerase and that some DNA substrates terminating in 8oxoG prevent extension by telomerase. Thus, PRDX1 safeguards telomeres from oxygen radicals to counteract telomere damage and preserve telomeric DNA for elongation by telomerase.
Elongational flow of polymer melts at constant strain rate, constant stress and constant force
Wagner, Manfred H.; Rolón-Garrido, Víctor H.
2013-04-01
Characterization of polymer melts in elongational flow is typically performed at constant elongational rate or rarely at constant tensile stress conditions. One of the disadvantages of these deformation modes is that they are hampered by the onset of "necking" instabilities according to the Considère criterion. Experiments at constant tensile force have been performed even more rarely, in spite of the fact that this deformation mode is free from necking instabilities and is of considerable industrial relevance as it is the correct analogue of steady fiber spinning. It is the objective of the present contribution to present for the first time a full experimental characterization of a long-chain branched polyethylene melt in elongational flow. Experiments were performed at constant elongation rate, constant tensile stress and constant tensile force by use of a Sentmanat Extensional Rheometer (SER) in combination with an Anton Paar MCR301 rotational rheometer. The accessible experimental window and experimental limitations are discussed. The experimental data are modelled by using the Wagner I model. Predictions of the steady-start elongational viscosity in constant strain rate and creep experiments are found to be identical, albeit only by extrapolation of the experimental data to Hencky strains of the order of 6. For constant stress experiments, a minimum in the strain rate and a corresponding maximum in the elongational viscosity is found at a Hencky strain of the order of 3, which, although larger than the steady-state value, follows roughly the general trend of the steady-state elongational viscosity. The constitutive analysis also reveals that constant tensile force experiments indicate a larger strain hardening potential than seen in constant elongation rate or constant tensile stress experiments. This may be indicative of the effect of necking under constant elongation rate or constant tensile stress conditions according to the Considère criterion.
International Nuclear Information System (INIS)
Ockey, C.H.
1983-01-01
Replicon behavior in radiosensitive Ataxia telangiectasia (A-T) fibroblasts and mouse lymphoma L5178Y (LS) cells was studied by DNA fiber autoradiography. LS cells, irradiated at 13 Gy, showed a similar reduction in rate of DNA chain growth and initiation of replicons as did resistant (LR) cells. A progressive increase in the intensity of [ 3 H]TdR labeling of many replicons was observed after irradition in the LS cells, but not in LR cells. This indicated a reduced or absent endogenous dTTP supply after irradiation in the LS cells, implicating a defect in nucleoside precursor production. Irradiated normal human and A-T cells did not show this effect. After 2 Gy, the frequency of initiation of replicons into synthesis was temporarily reduced in the normal human but not in the A-T cells. After 20 Gy, the rate of DNA chain growth was preferentially reduced in the normal human cells, but an increase was observed in the A-T cells. This increased rate could be explained in terms of a normal supply of complexes involved in chain elongation being distributed over a reduced number of initiated replicon clusters in the A-T cells
Proton-Fueled, Reversible DNA Hybridization Chain Assembly for pH Sensing and Imaging.
Liu, Lan; Liu, Jin-Wen; Huang, Zhi-Mei; Wu, Han; Li, Na; Tang, Li-Juan; Jiang, Jian-Hui
2017-07-05
Design of DNA self-assembly with reversible responsiveness to external stimuli is of great interest for diverse applications. We for the first time develop a pH-responsive, fully reversible hybridization chain reaction (HCR) assembly that allows sensitive sensing and imaging of pH in living cells. Our design relies on the triplex forming sequences that form DNA triplex with toehold regions under acidic conditions and then induce a cascade of strand displacement and DNA assembly. The HCR assembly has shown dynamic responses in physiological pH ranges with excellent reversibility and demonstrated the potential for in vitro detection and live-cell imaging of pH. Moreover, this method affords HCR assemblies with highly localized fluorescence responses, offering advantages of improving sensitivity and better selectivity. The proton-fueled, reversible HCR assembly may provide a useful approach for pH-related cell biology study and disease diagnostics.
Xu, Liang; Wang, Wei; Chong, Jenny; Shin, Ji Hyun; Xu, Jun; Wang, Dong
2016-01-01
Accurate genetic information transfer is essential for life. As a key enzyme involved in the first step of gene expression, RNA polymerase II (Pol II) must maintain high transcriptional fidelity while it reads along DNA template and synthesizes RNA transcript in a stepwise manner during transcription elongation. DNA lesions or modifications may lead to significant changes in transcriptional fidelity or transcription elongation dynamics. In this review, we will summarize recent progress towards understanding the molecular basis of RNA Pol II transcriptional fidelity control and impacts of DNA lesions and modifications on Pol II transcription elongation. PMID:26392149
Kudo, Naomi; Toyama, Tomoaki; Mitsumoto, Atsushi; Kawashima, Yoichi
2003-05-01
Regulation of palmitoyl-CoA chain elongation (PCE) and its contribution to oleic acid formation were investigated in rat liver in comparison with stearoyl-CoA desaturase (SCD). Hepatic PCE activity was induced by the administration of 20% wt/vol glucose or fructose in the drinking water of normal rats. In streptozotocin-induced diabetic rats, the activities of both PCE and SCD were suppressed, and fructose, but not glucose, feeding caused an increase in the activities of both enzymes. Treatment of normal rats with clofibric acid in combination with carbohydrate further increased PCE, but not SCD, activity. FA analysis of hepatic lipids revealed that the proportion of oleic acid (18:1 n-9) increased upon administration of carbohydrate or clofibric acid. The treatment of rats with clofibric acid in combination with carbohydrate greatly increased the proportion of 18:1 n-9. A significant correlation was observed between PCE activity and the hepatic proportion of 18:1 n-9 (r2 = 0.874, P 0.05). Taken together, these results suggest that carbohydrate induces PCE as well as SCD activity to increase the hepatic 18:1 content in rat liver, and the increased PCE activity seems to be responsible for the further increase in 18:1 n-9 when carbohydrate is administered in combination with clofibric acid.
Mezquita, C; Teng, C S
1978-01-01
To probe the structural change in the genome of the differentiating germ cell of the maturing rooster testis, the chromatin from nuclei at various stages of differentiation were transcribed with prokaryotic RNA polymerase from Escherichia coli or with eukaryotic RNA polymerase II from wheat germ. The transcription was performed under conditions of blockage of RNA chain reinitiation in vitro with rifampicin or rifampicin AF/013. With the E. coli enzyme, the changes in (1) the titration curve for the enzyme-chromatin interaction, (2) the number of initiation sites, (3) the rate of elongation of RNA chains, and (4) the kinetics of the formation of stable initiation complexes revealed the unmasking of DNA in elongated spermatids and the masking of DNA in spermatozoa. In both cases the stability of the DNA duplex in the initiation region for RNA synthesis greatly increased. In contrast with the E. coli enzyme, the wheat-germ RNA polymerase II was relatively inefficient at transcribing chromatin of elongated spermatids. Such behaviour can be predicted if unmasked double-stranded DNA is present in elongated spermatids. PMID:346018
Energy Technology Data Exchange (ETDEWEB)
Ockey, C.H.
1982-04-01
DNA fibre autoradiography, after incorporation of high specific activity /sup 3/H-thymidine and /sup 3/H-deoxycytidine, has been used to investigate repair in DNA fibres from single cells following UV, or methyl-methane sulphonate (MMS) treatment. Asynchronously growing human fibroblasts, leucocytes, and HeLa cells at different phases of the cell cycle have been investigated. Isotope incorporation in repair could be differentiated from that involved in replication by the distribution and density of silver grains along the DNA fibres. Grain distribution due to repair was continuous over long stretches of the fibres and was at a low density, occasionally interspersed with short slightly denser segments. Replication labelling on the other hand, was dense and usually in short tandem segments. Repair labelling was of a similar overall density in fibres from a single cell, but differed in intensity from cell to cell. In mutagen treated Go (leucocytes) of G/sub 1/ (HeLa cells), repair labelling was not increased by the presence of the DNA inhibitors, hydroxyurea (HU) or 5-fluorodeoxyuridine (FUdR). Repair was not detectable in S cells however without the use of these inhibitors to reduce endogenous nucleoside production. FUdR enhanced the repair labelling in S cells only slightly, while HU increased it beyond that observed in UV irradiated, HU treated, G/sub 1/ cells. The intensity of repair labelling in fibres from mutagen treated S cells appears to be proportional to the degree of reduction of DNA chain elongation in replicons.
APOBEC3G inhibits HIV-1 RNA elongation by inactivating the viral trans-activation response element.
Nowarski, Roni; Prabhu, Ponnandy; Kenig, Edan; Smith, Yoav; Britan-Rosich, Elena; Kotler, Moshe
2014-07-29
Deamination of cytidine residues in viral DNA is a major mechanism by which APOBEC3G (A3G) inhibits vif-deficient human immunodeficiency virus type 1 (HIV-1) replication. dC-to-dU transition following RNase-H activity leads to viral cDNA degradation, production of non-functional proteins, formation of undesired stop codons and decreased viral protein synthesis. Here, we demonstrate that A3G provides an additional layer of defense against HIV-1 infection dependent on inhibition of proviral transcription. HIV-1 transcription elongation is regulated by the trans-activation response (TAR) element, a short stem-loop RNA structure required for elongation factors binding. Vif-deficient HIV-1-infected cells accumulate short viral transcripts and produce lower amounts of full-length HIV-1 transcripts due to A3G deamination of the TAR apical loop cytidine, highlighting the requirement for TAR loop integrity in HIV-1 transcription. We further show that free single-stranded DNA (ssDNA) termini are not essential for A3G activity and a gap of CCC motif blocked with juxtaposed DNA or RNA on either or 3'+5' ends is sufficient for A3G deamination. These results identify A3G as an efficient mutator and that deamination of (-)SSDNA results in an early block of HIV-1 transcription. Copyright © 2014 Elsevier Ltd. All rights reserved.
Qian, Yong; Wang, Chunyan; Gao, Fenglei
2015-01-15
A new strategy to combine Zn(2+) assistant DNA recycling followed with hybridization chain reaction dual amplification was designed for highly sensitive electrochemical detection of target DNA. A gold electrode was used to immobilize molecular beacon (MB) as the recognition probe and perform the amplification procedure. In the presence of the target DNA, the hairpin probe 1 was opened, and the DNAzyme was liberated from the caged structure. The activated DNAzyme hybridized with the MB and catalyzed its cleavage in the presence of Zn(2+) cofactor and resulting in a free DNAzyme strand. Finally, each target-induced activated DNAzyme underwent many cycles triggering the cleavage of MB, thus forming numerous MB fragments. The MB fragments triggered the HCR and formed a long double-helix DNA structure. Because both H1 and H2 were labeled by biotin, a lot of SA-ALP was captured on the electrode surface, thus catalyzing a silver deposition process for electrochemical stripping analysis. This novel cascade signal amplification strategy can detect target DNA down to the attomolar level with a dynamic range spanning 6 orders of magnitude. This highly sensitive and specific assay has a great potential to become a promising DNA quantification method in biomedical research and clinical diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Madhuri Mandal
2012-10-01
Full Text Available Here DNA has been used as templating and self-assembling reagent to grow the chain like nanostructure. We have designed the composite in such a fashion that we obtained optical and magnetic properties together in a single biological material. Optical properties characterized by UV–visible absorption, Circular Dichroism (CD and their analysis show no denaturization of DNA. Transmission electron micrographs (TEM indicate formation of chain like structure of the nanoparticles. Particles were functionalized with folic acid for labeling and treatment of cancer cell.
RNA polymerase gate loop guides the nontemplate DNA strand in transcription complexes.
NandyMazumdar, Monali; Nedialkov, Yuri; Svetlov, Dmitri; Sevostyanova, Anastasia; Belogurov, Georgiy A; Artsimovitch, Irina
2016-12-27
Upon RNA polymerase (RNAP) binding to a promoter, the σ factor initiates DNA strand separation and captures the melted nontemplate DNA, whereas the core enzyme establishes interactions with the duplex DNA in front of the active site that stabilize initiation complexes and persist throughout elongation. Among many core RNAP elements that participate in these interactions, the β' clamp domain plays the most prominent role. In this work, we investigate the role of the β gate loop, a conserved and essential structural element that lies across the DNA channel from the clamp, in transcription regulation. The gate loop was proposed to control DNA loading during initiation and to interact with NusG-like proteins to lock RNAP in a closed, processive state during elongation. We show that the removal of the gate loop has large effects on promoter complexes, trapping an unstable intermediate in which the RNAP contacts with the nontemplate strand discriminator region and the downstream duplex DNA are not yet fully established. We find that although RNAP lacking the gate loop displays moderate defects in pausing, transcript cleavage, and termination, it is fully responsive to the transcription elongation factor NusG. Together with the structural data, our results support a model in which the gate loop, acting in concert with initiation or elongation factors, guides the nontemplate DNA in transcription complexes, thereby modulating their regulatory properties.
Acetylcholine promotes the emergence and elongation of lateral roots of Raphanus sativus.
Sugiyama, Kou-ichi; Tezuka, Takafumi
2011-10-01
Radish (Raphanus sativus L.) was grown on four layers of paper towel moistened with distilled water with and without acetylcholine (ACh) for five days in the dark after sowing. ACh at 1 nM promoted the growth (emergence and elongation) of lateral roots of radish plants, but had no effect on the stems and main roots. Moreover, ACh enhanced the dry weight of roots [main (primary) + lateral roots]. Neostigmine, an inhibitor of acetylcholinesterase (AChE) also promoted the emergence and elongation of lateral roots, and atropine, a competitive inhibitor of ACh receptor, suppressed the emergence and elongation. ACh suppressed the activity of AChE and increased the amount of proteins and pyridine nucleotides (NAD and NADH) in the roots of the seedlings. It also increased the activities of NAD-forming enzymes [NAD synthetase and ATP-nicotinamide mononucleotide (ATP-NMN) adenyltransferase], and enhanced the amount of DNA in the roots of the seedlings. The relationship between ACh and the emergence and growth of lateral roots was discussed from a biochemical viewpoint.
Development of a real time polymerase chain reaction for quantitation of Schistosoma mansoni DNA
Directory of Open Access Journals (Sweden)
Ana Lisa do Vale Gomes
2006-10-01
Full Text Available This report describes the development of a SYBR Green I based real time polymerase chain reaction (PCR protocol for detection on the ABI Prism 7000 instrument. Primers targeting the gene encoding the SSU rRNA were designed to amplify with high specificity DNA from Schistosoma mansoni, in a real time quantitative PCR system. The limit of detection of parasite DNA for the system was 10 fg of purified genomic DNA, that means less than the equivalent to one parasite cell (genome ~580 fg DNA. The efficiency was 0.99 and the correlation coefficient (R² was 0.97. When different copy numbers of the target amplicon were used as standards, the assay could detect at least 10 copies of the specific target. The primers used were designed to amplify a 106 bp DNA fragment (Tm 83ºC. The assay was highly specific for S. mansoni, and did not recognize DNA from closely related non-schistosome trematodes. The real time PCR allowed for accurate quantification of S. mansoni DNA and no time-consuming post-PCR detection of amplification products by gel electrophoresis was required. The assay is potentially able to quantify S. mansoni DNA (and indirectly parasite burden in a number of samples, such as snail tissue, serum and feces from patients, and cercaria infested water. Thus, these PCR protocols have potential to be used as tools for monitoring of schistosome transmission and quantitative diagnosis of human infection.
Loads applied to fixations for chain stretching
Energy Technology Data Exchange (ETDEWEB)
Ahrens, K; Brychta, P
1985-06-01
The chains of scraper chain conveyors must be pre-stretched during standstill in order to compensate the elongations occurring during operation. They require frequent retensiening in order to meet the varying operational requirements. During tensioning, the chains are fixed in a point in the top run by means of fixation elements. The authors present a method for calculating the retaining force needed in the fixations. There are three different initial conditions of the chain before trensioning: Tensionsfree chain, pretensioned chain (stressed chain), slack chain. In all three cases, it is important to find out whether or nor the tensioning drive reaches full speed. The method of calculation is illustrated by the example of a scraper chain conveyor; it enables the establishment of rules for tensioning without damaging the chain and is a good basis for the dimensioning of new types of fixation elements.
Huang, Shar-yin N.; Murai, Junko; Dalla Rosa, Ilaria; Dexheimer, Thomas S.; Naumova, Alena; Gmeiner, William H.; Pommier, Yves
2013-01-01
Chain-terminating nucleoside analogs (CTNAs) that cause stalling or premature termination of DNA replication forks are widely used as anticancer and antiviral drugs. However, it is not well understood how cells repair the DNA damage induced by these drugs. Here, we reveal the importance of tyrosyl–DNA phosphodiesterase 1 (TDP1) in the repair of nuclear and mitochondrial DNA damage induced by CTNAs. On investigating the effects of four CTNAs—acyclovir (ACV), cytarabine (Ara-C), zidovudine (AZT) and zalcitabine (ddC)—we show that TDP1 is capable of removing the covalently linked corresponding CTNAs from DNA 3′-ends. We also show that Tdp1−/− cells are hypersensitive and accumulate more DNA damage when treated with ACV and Ara-C, implicating TDP1 in repairing CTNA-induced DNA damage. As AZT and ddC are known to cause mitochondrial dysfunction, we examined whether TDP1 repairs the mitochondrial DNA damage they induced. We find that AZT and ddC treatment leads to greater depletion of mitochondrial DNA in Tdp1−/− cells. Thus, TDP1 seems to be critical for repairing nuclear and mitochondrial DNA damage caused by CTNAs. PMID:23775789
Synthesis of Elongated Microcapsules
Li, Wenyan; Buhrow, Jerry; Calle, Luz M.
2011-01-01
One of the factors that influence the effectiveness of self-healing in functional materials is the amount of liquid healing agents that can be delivered to the damaged area. The use of hollow tubes or fibers and the more sophisticated micro-vascular networks has been proposed as a way to increase the amount of healing agents that can be released when damage is inflicted. Although these systems might be effective in some specific applications, they are not practical for coatings applications. One possible practical way to increase the healing efficiency is to use microcapsules with high-aspect-ratios, or elongated microcapsules. It is understood that elongated microcapsules will be more efficient because they can release more healing agent than a spherical microcapsule when a crack is initiated in the coating. Although the potential advantage of using elongated microcapsules for self healing applications is clear, it is very difficult to make elongated microcapsules from an emulsion system because spherical microcapsules are normally formed due to the interfacial tension between the dispersed phase and the continuous phase. This paper describes the two methods that have been developed by the authors to synthesize elongated microcapsules. The first method involves the use of an emulsion with intermediate stability and the second involves the application of mechanical shear conditions to the emulsion.
Energy Technology Data Exchange (ETDEWEB)
Shi, Yun-bo
1988-03-01
This thesis consists of three main parts and totally eight chapters. In Part I, The author will present studies on the photochemistry of psoralen-DNA adducts, specifically, the wavelength dependencies for the photoreversals of thymidine-HMT (4'-hydroxymethyl-4, 5', 8-trimenthylpsoralen) monoadducts and diadduct and the same adducts incorporated in DNA helices and the wavelength dependecies for the photocrossslinking of thymidine-HMT monoadducts in double-stranded helices. In Part II, The author will report some biological effects of psoralen-DNA adducts, i.e., the effects on double-stranded DNA stability, DNA structure, and transcription by E. coli and T7 RNA polymerases. Finally, The author will focus on the applications of psoralen-DNA photochemistry to investigation of protein-DNA interaction during transcription, which includes the interaction of E. coli and T7 RNA polymerases with DNA in elongation complexes arrested at specific psoralen-DNA adduct sites as revealed by DNase I footprinting experiments. 123 refs., 52 figs., 12 tabs.
International Nuclear Information System (INIS)
Shi, Yun-bo.
1988-03-01
This thesis consists of three main parts and totally eight chapters. In Part I, The author will present studies on the photochemistry of psoralen-DNA adducts, specifically, the wavelength dependencies for the photoreversals of thymidine-HMT (4'-hydroxymethyl-4, 5', 8-trimenthylpsoralen) monoadducts and diadduct and the same adducts incorporated in DNA helices and the wavelength dependecies for the photocrossslinking of thymidine-HMT monoadducts in double-stranded helices. In Part II, The author will report some biological effects of psoralen-DNA adducts, i.e., the effects on double-stranded DNA stability, DNA structure, and transcription by E. coli and T7 RNA polymerases. Finally, The author will focus on the applications of psoralen-DNA photochemistry to investigation of protein-DNA interaction during transcription, which includes the interaction of E. coli and T7 RNA polymerases with DNA in elongation complexes arrested at specific psoralen-DNA adduct sites as revealed by DNase I footprinting experiments. 123 refs., 52 figs., 12 tabs
Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon
2014-01-01
The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069
Krokan, H; Eriksen, A
1977-02-01
Addition of methyl glyoxal bis(guanylhydrazone) to HeLa S3 suspension cultures resulted in increased putrescine levels and decreased spermidine and spermine levels preceding a drop in incorporation of [3H]thymidine, [3H]uridine and [14C]leucine into macromolecules. When putrescine, spermidine, spermine or cadaverine was added simultaneously with methyl glyoxal bis(guanylhydrazone), the drug had no detectable effect on the synthesis of macromolecules. In nuclei isolated from cells treated with methyl glyoxal bis(guanylhydrazone) the reduction in the rate of DNA synthesis was equal to the reduction of [3H]thymidine incorporation in the corresponding whole cells. The capability of the nuclei to synthesize DNA could not be restored by adding spermidine or spermine to the system in vitro. The rate of DNA chain elongation was only reduced slightly by methyl glyoxal bis(guanylhydrazone) indicating that decreased levels of spermidine and spermine lead to a decrease in the number of replication units active in DNA synthesis within each cell.
Elongational viscosity of narrow molar mass distribution polystyrene
DEFF Research Database (Denmark)
Bach, Anders; Almdal, Kristoffer; Rasmussen, Henrik Koblitz
2003-01-01
Transient and steady elongational viscosity has been measured for two narrow molar mass distribution polystyrene melts of molar masses 200 000 and 390 000 by means of a filament stretching rheometer. Total Hencky strains of about five have been obtained. The transient elongational viscosity rises...... above the linear viscoelastic prediction at intermediate strains, indicating strain hardening. The steady elongational viscosities are monotone decreasing functions of elongation rate. At elongation rates larger than the inverse reptation time, the steady elongational viscosity scales linearly...
Real-time ligation chain reaction for DNA quantification and identification on the FO-SPR.
Knez, Karel; Spasic, Dragana; Delport, Filip; Lammertyn, Jeroen
2015-05-15
Different assays have been developed in the past years to meet point-of-care diagnostic tests requirements for fast and sensitive quantification and identification of targets. In this paper, we developed the ligation chain reaction (LCR) assay on the Fiber Optic Surface Plasmon Resonance (FO-SPR) platform, which enabled simultaneous quantification and cycle-to-cycle identification of DNA during amplification. The newly developed assay incorporated FO-SPR DNA melting assay, previously developed by our group. This required establishment of several assay parameters, including buffer ionic strength and thermal ramping speed as these parameters both influence the ligation enzyme performance and the hybridization yield of the gold nanoparticles (Au NPs) on the FO-SPR sensor. Quantification and identification of DNA targets was achieved over a wide concentration range with a calibration curve spanning 7 orders of magnitude and LOD of 13.75 fM. Moreover, the FO-SPR LCR assay could discriminate single nucleotide polymorphism (SNPs) without any post reaction analysis, featuring thus all the essential requirements of POC tests. Copyright © 2014 Elsevier B.V. All rights reserved.
Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage
International Nuclear Information System (INIS)
Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M.; Savva, D.; Walker, C.
1998-01-01
The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)
Application of the arbitrarily primed polymerase chain reaction for the detection of DNA damage
Energy Technology Data Exchange (ETDEWEB)
Atienzar, F.; Evenden, A.; Jha, A.; Depledge, M. [University of Plymouth (United Kingdom). Environmental Research Centre; Child, P. [ADAS Boxworth (United Kingdom); Savva, D.; Walker, C. [University of Reading (United Kingdom). School of Animal and Microbial Sciences
1998-07-01
The technique of arbitrarily primed polymerase chain reaction (AP-PCR) shows potential as a selective and sensitive assay for the detection of xenobiotic-induced DNA damage. Problems, however, may occur in AP-PCR, diminishing its discriminative abilities. These problems include the presence of spurious amplification products in non-template-containing negative control reactions, and a lack of reproducibility amongst amplification patterns. Experiments designed to remove contaminated nucleic acids by ultraviolet (UV) treatment indicated that spurious bands are the result of aberrant primer-induced polymerisation, an event shown to be influenced by the concentration of deoxynucleotide triphosphates (dNTP) present in the reaction mixtures. Optimisation of dNTP concentration from 0.22 to 0.33 MM resulted in clear negative controls and highly reproducible amplification patterns with all DNA templates. As an example of the application of the method, in the present study, the macroalga Palmaria palmata (Rhodophyta) was exposed to UV A and B radiations. The study shows that the AP-PCR method can detect DNA damage and may be useful in detecting such damage following exposure of cells to xenobiotics. (author)
Chao, Jie; Li, Zhenhua; Li, Jing; Peng, Hongzhen; Su, Shao; Li, Qian; Zhu, Changfeng; Zuo, Xiaolei; Song, Shiping; Wang, Lianhui; Wang, Lihua
2016-07-15
Microarrays of biomolecules hold great promise in the fields of genomics, proteomics, and clinical assays on account of their remarkably parallel and high-throughput assay capability. However, the fluorescence detection used in most conventional DNA microarrays is still limited by sensitivity. In this study, we have demonstrated a novel universal and highly sensitive platform for fluorescent detection of sequence specific DNA at the femtomolar level by combining dextran-coated microarrays with hybridization chain reaction (HCR) signal amplification. Three-dimensional dextran matrix was covalently coated on glass surface as the scaffold to immobilize DNA recognition probes to increase the surface binding capacity and accessibility. DNA nanowire tentacles were formed on the matrix surface for efficient signal amplification by capturing multiple fluorescent molecules in a highly ordered way. By quantifying microscopic fluorescent signals, the synergetic effects of dextran and HCR greatly improved sensitivity of DNA microarrays, with a detection limit of 10fM (1×10(5) molecules). This detection assay could recognize one-base mismatch with fluorescence signals dropped down to ~20%. This cost-effective microarray platform also worked well with samples in serum and thus shows great potential for clinical diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.
Angers, M; Cloutier, J F; Castonguay, A; Drouin, R
2001-08-15
Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.
Elongational viscosity of multiarm (Pom-Pom) polystyrene
DEFF Research Database (Denmark)
Nielsen, Jens Kromann; Rasmussen, Henrik K.; Almdal, Kristoffer
2006-01-01
-Pom was estimated to have 2.5 arms on average, while the estimate is 3.3 for the asymmetric star. The molar mass of each arm is about 27 kg/mol. The melts were characterized in the linear viscoelastic regime and in non-linear elongational rheometry. The transient elongational viscosity for the Pom-Pom molecule...... it corresponds well with an estimate of the maximum stretchability of the backbone. Time-strain separability was not observed for the 'Asymmetric star' molecule at the elongation rates investigated. The transient elongational viscosity for the 'Pom-Pom' molecule went through a reproducible maximum...... in the viscosity at the highest elongational rate....
Designing a Polymerase Chain Reaction Device Working with Radiation and Convection Heat Transfer
Madadelahi, M.; Kalan, K.; Shamloo, A.
2018-05-01
Gene proliferation is vital for infectious and genetic diseases diagnosis from a blood sample, even before birth. In addition, DNA sequencing, genetic finger-print analyzing, and genetic mutation detecting can be mentioned as other procedures requiring gene reproduction. Polymerase chain reaction, briefly known as PCR, is a convenient and effective way to accomplish this task; where the DNA containing sample faces three temperature phases alternatively. These phases are known as denaturation, annealing, and elongation/extension which in this study -regarding the type of the primers and the target DNA sequence- are set to occur at 95, 58, and 72 degrees of Celsius. In this study, a PCR device has been designed and fabricated which uses radiation and convection heat transfer at the same time to set and control the mentioned thermal sections. A 300W incandescent light bulb able to immediately turn off and on along with two 8×8 cm DC fans, controlled by a microcontroller as well as PID and PD controller codes are used to monitor the applied thermal cycles. In designing the controller codes it has been concerned that they not only control the temperature over the set-points as well as possible, but also increase the temperature variation rate between each two phases. The temperature data were plotted and DNA samples were used to assess the device function.
Effect of magnetism and light sp-dopants on chain creation in Ir and Pt break junctions
International Nuclear Information System (INIS)
Di Napoli, S; Thiess, A; Blügel, S; Mokrousov, Y
2014-01-01
Applying the generalization of the model for chain formation in break-junctions (Di Napoli et al 2012 J. Phys.: Condens. Matter 24 135501), we study the effect of light impurities on the energetics and elongation properties of Pt and Ir chains. Our model enables us to develop a tool ideal for detailed analysis of impurity-assisted chain formation, in which zigzag bonds play an important role. In particular we focus on H (s-like) and O (p-like) impurities and assume, for simplicity, that the presence of impurity atoms in experiments results in a ..M-X-M-X-... (M: metal, X: impurity) chain structure in between the metallic leads. Feeding our model with material-specific parameters from systematic full-potential first-principles calculations, we find that the presence of such impurities strongly affects the binding properties of the chains. We find that, while both types of impurities enhance the probability of chains being elongated, the s-like impurities lower the chain's stability. We also analyze the effect of magnetism and spin-orbit interaction on the growth properties of the chains. (paper)
Bayesian clustering of DNA sequences using Markov chains and a stochastic partition model.
Jääskinen, Väinö; Parkkinen, Ville; Cheng, Lu; Corander, Jukka
2014-02-01
In many biological applications it is necessary to cluster DNA sequences into groups that represent underlying organismal units, such as named species or genera. In metagenomics this grouping needs typically to be achieved on the basis of relatively short sequences which contain different types of errors, making the use of a statistical modeling approach desirable. Here we introduce a novel method for this purpose by developing a stochastic partition model that clusters Markov chains of a given order. The model is based on a Dirichlet process prior and we use conjugate priors for the Markov chain parameters which enables an analytical expression for comparing the marginal likelihoods of any two partitions. To find a good candidate for the posterior mode in the partition space, we use a hybrid computational approach which combines the EM-algorithm with a greedy search. This is demonstrated to be faster and yield highly accurate results compared to earlier suggested clustering methods for the metagenomics application. Our model is fairly generic and could also be used for clustering of other types of sequence data for which Markov chains provide a reasonable way to compress information, as illustrated by experiments on shotgun sequence type data from an Escherichia coli strain.
Energy Technology Data Exchange (ETDEWEB)
Lee, Ai Cheng; Dai, Ziyu; Chen, Baowei; Wu, Hong; Wang, Jun; Zhang, Aiguo; Zhang, Lurong; Lim, Tit-Meng; Lin, Yuehe
2008-12-01
We describe a novel electrochemical branched-DNA (bDNA) assay for polymerase chain reaction (PCR)-free detection and quantification of p185 BCR-ABL leukemia fusion transcript in the population of messenger RNA (mRNA) extracted from cell lines. The bDNA amplifier carrying high loading of alkaline phosphatase (ALP) tracers was used to amplify targets signal. The targets were captured on microplate well surfaces through cooperative sandwich hybridization prior to the labeling of bDNA. The activity of captured ALP was monitored by square-wave voltammetric (SWV) analysis of the electroactive enzymatic product in the presence of 1-napthyl-phosphate. The specificity and sensitivity of assay enabled direct detection of target transcript in as little as 4.6 ng mRNA without PCR amplification. In combination with the use of a well-quantified standard, the electrochemical bDNA assay was capable of direct use for a PCR-free quantitative analysis of target transcript in total mRNA population. The approach thus provides a simple, sensitive, accurate and quantitative tool alternate to the RQ-PCR for early disease diagnosis.
Direct quantification of fungal DNA from soil substrate using real-time PCR.
Filion, Martin; St-Arnaud, Marc; Jabaji-Hare, Suha H
2003-04-01
Detection and quantification of genomic DNA from two ecologically different fungi, the plant pathogen Fusarium solani f. sp. phaseoli and the arbuscular mycorrhizal fungus Glomus intraradices, was achieved from soil substrate. Specific primers targeting a 362-bp fragment from the SSU rRNA gene region of G. intraradices and a 562-bp fragment from the F. solani f. sp. phaseoli translation elongation factor 1 alpha gene were used in real-time polymerase chain reaction (PCR) assays conjugated with the fluorescent SYBR(R) Green I dye. Standard curves showed a linear relation (r(2)=0.999) between log values of fungal genomic DNA of each species and real-time PCR threshold cycles and were quantitative over 4-5 orders of magnitude. Real-time PCR assays were applied to in vitro-produced fungal structures and sterile and non-sterile soil substrate seeded with known propagule numbers of either fungi. Detection and genomic DNA quantification was obtained from the different treatments, while no amplicon was detected from non-seeded non-sterile soil samples, confirming the absence of cross-reactivity with the soil microflora DNA. A significant correlation (Pgenomic DNA of F. solani f. sp. phaseoli or G. intraradices detected and the number of fungal propagules present in seeded soil substrate. The DNA extraction protocol and real-time PCR quantification assay can be performed in less than 2 h and is adaptable to detect and quantify genomic DNA from other soilborne fungi.
DEFF Research Database (Denmark)
Jensen, T G; Andresen, B S; Bross, P
1992-01-01
An effective EBV-based expression system for eucaryotic cells has been developed and used for the study of the mitochondrial enzyme medium-chain acyl-CoA dehydrogenase (MCAD). 1325 bp of PCR-generated MCAD cDNA, containing the entire coding region, was placed between the SV40 early promoter...... and polyadenylation signals in the EBV-based vector. Both wild-type MCAD cDNA and cDNA containing the prevalent disease-causing mutation A to G at position 985 of the MCAD cDNA were tested. In transfected COS-7 cells, the steady state amount of mutant MCAD protein was consistently lower than the amount of wild......-type human enzyme. The enzyme activity in extracts from cells harbouring the wild-type MCAD cDNA was dramatically higher than in the controls (harbouring the vector without the MCAD gene) while only a slightly higher activity was measured with the mutant MCAD. The mutant MCAD present behaves like wild...
Effect of arsenite on the DNA repair of UV-irradiated Chinese hamster ovary cells
International Nuclear Information System (INIS)
Lee-Chen, S.F.; Yu, C.T.; Jan, K.Y.
1992-01-01
Arsenite, an ubiquitous human carcinogen, has been shown to enhance the cytotoxicity, mutagenicity and clastogenicity of UV light in mammalian cells. Arsenite may exert its co-genotoxic effects by inhibiting DNA repair. Results from alkaline sucrose gradient sedimentation show that arsenite did not accumulate UV-induced DNA strand breaks in Chinese hamster ovary (CHO) K1 cells as aphidicolin plus hydroxyurea (HU) did. These data indicate that arsenite did not inhibit the activity of DNA polymerase α in UV repair. Treatment with arsenite before UV irradiation slightly reduced the DNA strand breaks accumulated by cytosine β-D-arabinofuranoside (AraC) plus HU. This effect implies that arsenite only slightly inhibited the incision of UV-induced DNA adducts. The low molecular weight DNA accumulated by post-UV incubation with AraC plus HU shifted to high molecular weight upon the incubation of cells in drug-free medium, but this shifting was prohibited by the presence of arsenite. This suggests that arsenite inhibited the rejoining of DNA strand breaks. When a pulse-chase labelling procedure was applied on UV-irradiated cells, the chain elongation of nascent DNA was strongly inhibited by post-incubation with arsenite. These data show that arsenite inhibited post-replication repair in UV-irradiated cells. Therefore, the steps inhibited by arsenite in UV-induced cells. Therefore, the steps inhibited by arsenite in UV-induced DNA repair in CHO K1 cells are different from human fibroblasts. (author)
Effect of arsenite on the DNA repair of UV-irradiated Chinese hamster ovary cells
Energy Technology Data Exchange (ETDEWEB)
Lee-Chen, S.F.; Yu, C.T.; Jan, K.Y. (Academia Sinica, Taipei, (Taiwan). Institute of Zoology)
1992-01-01
Arsenite, an ubiquitous human carcinogen, has been shown to enhance the cytotoxicity, mutagenicity and clastogenicity of UV light in mammalian cells. Arsenite may exert its co-genotoxic effects by inhibiting DNA repair. Results from alkaline sucrose gradient sedimentation show that arsenite did not accumulate UV-induced DNA strand breaks in Chinese hamster ovary (CHO) K1 cells as aphidicolin plus hydroxyurea (HU) did. These data indicate that arsenite did not inhibit the activity of DNA polymerase [alpha] in UV repair. Treatment with arsenite before UV irradiation slightly reduced the DNA strand breaks accumulated by cytosine [beta]-D-arabinofuranoside (AraC) plus HU. This effect implies that arsenite only slightly inhibited the incision of UV-induced DNA adducts. The low molecular weight DNA accumulated by post-UV incubation with AraC plus HU shifted to high molecular weight upon the incubation of cells in drug-free medium, but this shifting was prohibited by the presence of arsenite. This suggests that arsenite inhibited the rejoining of DNA strand breaks. When a pulse-chase labelling procedure was applied on UV-irradiated cells, the chain elongation of nascent DNA was strongly inhibited by post-incubation with arsenite. These data show that arsenite inhibited post-replication repair in UV-irradiated cells. Therefore, the steps inhibited by arsenite in UV-induced cells. Therefore, the steps inhibited by arsenite in UV-induced DNA repair in CHO K1 cells are different from human fibroblasts. (author).
Two-stage medium chain fatty acid (MCFA) production from municipal solid waste and ethanol
Grootscholten, T.I.M.; Strik, D.P.B.T.B.; Steinbusch, K.J.J.; Buisman, C.J.N.; Hamelers, B.
2014-01-01
Chain elongation is an anaerobic fermentation that produces medium chain fatty acids (MCFAs) from volatile fatty acids and ethanol. These MCFAs can be used as biochemical building blocks for fuel production and other chemical processes. Producing MCFAs from the organic fraction of municipal solid
Eukaryotic DNA Replication Fork.
Burgers, Peter M J; Kunkel, Thomas A
2017-06-20
This review focuses on the biogenesis and composition of the eukaryotic DNA replication fork, with an emphasis on the enzymes that synthesize DNA and repair discontinuities on the lagging strand of the replication fork. Physical and genetic methodologies aimed at understanding these processes are discussed. The preponderance of evidence supports a model in which DNA polymerase ε (Pol ε) carries out the bulk of leading strand DNA synthesis at an undisturbed replication fork. DNA polymerases α and δ carry out the initiation of Okazaki fragment synthesis and its elongation and maturation, respectively. This review also discusses alternative proposals, including cellular processes during which alternative forks may be utilized, and new biochemical studies with purified proteins that are aimed at reconstituting leading and lagging strand DNA synthesis separately and as an integrated replication fork.
Stretching chimeric DNA: A test for the putative S-form
Whitelam, Stephen; Pronk, Sander; Geissler, Phillip L.
2008-11-01
Double-stranded DNA "overstretches" at a pulling force of about 65 pN, increasing in length by a factor of 1.7. The nature of the overstretched state is unknown, despite its considerable importance for DNA's biological function and technological application. Overstretching is thought by some to be a force-induced denaturation and by others to consist of a transition to an elongated, hybridized state called S-DNA. Within a statistical mechanical model, we consider the effect upon overstretching of extreme sequence heterogeneity. "Chimeric" sequences possessing halves of markedly different AT composition elongate under fixed external conditions via distinct, spatially segregated transitions. The corresponding force-extension data vary with pulling rate in a manner that depends qualitatively and strikingly upon whether the hybridized S-form is accessible. This observation implies a test for S-DNA that could be performed in experiment.
New discoveries linking transcription to DNA repair and damage tolerance pathways.
Cohen, Susan E; Walker, Graham C
2011-01-01
In Escherichia coli, the transcription elongation factor NusA is associated with all elongating RNA polymerases where it functions in transcription termination and antitermination. Here, we review our recent results implicating NusA in the recruitment of DNA repair and damage tolerance mechanisms to sites of stalled transcription complexes.
Thermodynamic and hydration effects for the incorporation of a cationic 3-aminopropyl chain into DNA
Soto, Ana Maria; Kankia, Besik I.; Dande, Prasad; Gold, Barry; Marky, Luis A.
2002-01-01
The introduction of cationic 5-(ω-aminoalkyl)-2′-deoxypyrimidines into duplex DNA has been shown to induce DNA bending. In order to understand the energetic and hydration contributions for the incorporation of a cationic side chain in DNA a combination of spectroscopy, calorimetry and density techniques were used. Specifically, the temperature unfolding and isothermal formation was studied for a pair of duplexes with sequence d(CGTAGUCG TGC)/d(GCACGACTACG), where U represents 2′-deoxyuridine (‘control’) or 5-(3-aminopropyl)-2′-deoxyuridine (‘modified’). Continuous variation experiments confirmed 1:1 stoichiometries for each duplex and the circular dichroism spectra show that both duplexes adopted the B conformation. UV and differential scanning calorimetry melting experiments reveal that each duplex unfolds in two-state transitions. In low salt buffer, the ‘modified’ duplex is more stable and unfolds with a lower endothermic heat and lower release of counterion and water. This electrostatic stabilization is entropy driven and disappears at higher salt concentrations. Complete thermodynamic profiles at 15°C show that the favorable formation of each duplex results from the compensation of a favorable exothermic heat with an unfavorable entropy contribution. However, the isothermal profiles yielded a differential enthalpy of 8.8 kcal/mol, which is 4.3 kcal/mol higher than the differential enthalpy observed in the unfolding profiles. This indicates that the presence of the aminopropyl chain induces an increase in base stacking interactions in the modified single strand and a decrease in base stacking interactions in the modified duplex. Furthermore, the formation of the ‘control’ duplex releases water while the ‘modified’ duplex takes up water. Relative to the control duplex, formation of the modified duplex at 15°C yielded a marginal differential ΔG° term, positive ΔΔHITC–Δ(TΔS) compensation, negative ΔΔV and a net release of
Plant cell wall polysaccharide analysis during cell elongation
DEFF Research Database (Denmark)
Guo, Xiaoyuan
Plant cell walls are complex structures whose composition and architecture are important to various cellular activities. Plant cell elongation requires a high level of rearrangement of the cell wall polymers to enable cell expansion. However, the cell wall polysaccharides dynamics during plant cell...... elongation is poorly understood. This PhD project aims to elucidate the cell wall compositional and structural change during cell elongation by using Comprehensive Microarray Polymer Profiling (CoMPP), microscopic techniques and molecular modifications of cell wall polysaccharide. Developing cotton fibre......, pea and Arabidopsis thaliana were selected as research models to investigate different types of cell elongation, developmental elongation and tropism elongation. A set of comprehensive analysis covering 4 cotton species and 11 time points suggests that non-cellulosic polysaccharides contribute...
Siqueira, José F; Rôças, Isabela N; Andrade, Arnaldo F B; de Uzeda, Milton
2003-02-01
A 16S rDNA-based polymerase chain reaction (PCR) method was used to detect Peptostreptococcus micros in primary root canal infections. Samples were collected from 50 teeth having carious lesions, necrotic pulps, and different forms of periradicular diseases. DNA extracted from the samples was amplified using the PCR assay, which yielded a specific fragment of P. micros 16S rDNA. P. micros was detected in 6 of 22 root canals associated with asymptomatic chronic periradicular lesions (27.3%), 2 of 8 teeth with acute apical periodontitis (25%), and 6 of 20 cases of acute periradicular abscess (30%). In general, P. micros was found in 14 of 50 cases (28%). There was no correlation between the presence of P. micros and the occurrence of symptoms. Findings suggested that P. micros can be involved in the pathogenesis of different forms of periradicular lesions.
van Belkum, A.; Duim, B.; Regelink, A.; Möller, L.; Quint, W.; van Alphen, L.
1994-01-01
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
VANBELKUM, A; DUIM, B; REGELINK, A; MOLLER, L; QUINT, W; VANALPHEN, L
Non-capsulate strains of Haemophilus influenzae were genotyped by analysis of variable DNA segments obtained by amplification of genomic DNA with the polymerase chain reaction (PCR fingerprinting). Discrete fragments of 100-2000 bp were obtained. The reproducibility of the procedure was assessed by
Arutiunian, A V; Ivanova, M A; Kurliand, D I; Kapshin, Iu S; Landa, S B; Poshekhonov, S T; Drobchenko, E A; Shevelev, I V
2011-01-01
Changes in the rigidity of the polymetric chain of phage lambda double-strand DNA have been studied by laser correlation spectroscopy. It was shown that, as the ionic strength increases, the effect of the screening of the hydrodynamic interaction of the links of the polymeric chain specific for polymeric coils arises in a DNA solution. It is assumed that the screening occurs when the threshold of the overlapping of DNA coils is achieved. The overlapping of coils is the result of a previously observed significant rise of DNA coil size from abnormally small DNA coils in low ionic strength buffers (about 10(-2) M Na+ or less) to maximum possible large coils in the 5SSC and 5SSC-like buffers. Further analysis of the far interlink interactions in linear lambda phage DNA coils in similar buffers at pH 7 and 4 confirms the earlier proposal about the role of H+ ions in the appearance of abnormally small DNA coils. The abnormal decrease in the DNA coil size in low ionic strength buffers is not a specific feature of lambda phage DNA only.
Translational Control of Cell Division by Elongator
Directory of Open Access Journals (Sweden)
Fanelie Bauer
2012-05-01
Full Text Available Elongator is required for the synthesis of the mcm5s2 modification found on tRNAs recognizing AA-ending codons. In order to obtain a global picture of the role of Elongator in translation, we used reverse protein arrays to screen the fission yeast proteome for translation defects. Unexpectedly, this revealed that Elongator inactivation mainly affected three specific functional groups including proteins implicated in cell division. The absence of Elongator results in a delay in mitosis onset and cytokinesis defects. We demonstrate that the kinase Cdr2, which is a central regulator of mitosis and cytokinesis, is under translational control by Elongator due to the Lysine codon usage bias of the cdr2 coding sequence. These findings uncover a mechanism by which the codon usage, coupled to tRNA modifications, fundamentally contributes to gene expression and cellular functions.
Supercoil Formation During DNA Melting
Sayar, Mehmet; Avsaroglu, Baris; Kabakcioglu, Alkan
2009-03-01
Supercoil formation plays a key role in determining the structure-function relationship in DNA. Biological and technological processes, such as protein synthesis, polymerase chain reaction, and microarrays relys on separation of the two strands in DNA, which is coupled to the unwinding of the supercoiled structure. This problem has been studied theoretically via Peyrard-Bishop and Poland-Scheraga type models, which include a simple representation of the DNA structural properties. In recent years, computational models, which provide a more realtistic representaion of DNA molecule, have been used to study the melting behavior of short DNA chains. Here, we will present a new coarse-grained model of DNA which is capable of simulating sufficiently long DNA chains for studying the supercoil formation during melting, without sacrificing the local structural properties. Our coarse-grained model successfully reproduces the local geometry of the DNA molecule, such as the 3'-5' directionality, major-minor groove structure, and the helical pitch. We will present our initial results on the dynamics of supercoiling during DNA melting.
Directory of Open Access Journals (Sweden)
I. Smeenk
2000-07-01
Full Text Available From blood collected from 94 cattle at 12 locations in the eastern and northeastern areas of Zimbabwe, DNA was extracted and analysed by polymerase chain reaction with primers previously reported to be specific for Babesia bigemina and Babesia bovis. Overall, DNA of Babesia bigemina was detected in the blood of 33/94 (35 % cattle and DNA from B. bovis was detected in 27/58 (47 % of cattle. The prevalence of DNA of B. bigemina was significantly higher in young animals (<2 years (23/46 than in animals over 2 years of age (10/48; (chi2 = 8.77; P < 0.01 %. Although tick sampling was not thorough, Boophilus decoloratus could be collected at 7/9 sites sampled and Boophilus microplus at 4/9 sites. Of the 20 B. decoloratus allowed to oviposit before PCR analysis, 1 (5 % contained DNA that could be amplified with primers for B. bigemina while 12 (60 % were positive with primers for B. bovis. Of the B. microplus allowed to oviposit, 11/16 (69 % were positive for B. bovis DNAby PCR and 2/16 (12 % were positive for B. bigemina.
Motif finding in DNA sequences based on skipping nonconserved positions in background Markov chains.
Zhao, Xiaoyan; Sze, Sing-Hoi
2011-05-01
One strategy to identify transcription factor binding sites is through motif finding in upstream DNA sequences of potentially co-regulated genes. Despite extensive efforts, none of the existing algorithms perform very well. We consider a string representation that allows arbitrary ignored positions within the nonconserved portion of single motifs, and use O(2(l)) Markov chains to model the background distributions of motifs of length l while skipping these positions within each Markov chain. By focusing initially on positions that have fixed nucleotides to define core occurrences, we develop an algorithm to identify motifs of moderate lengths. We compare the performance of our algorithm to other motif finding algorithms on a few benchmark data sets, and show that significant improvement in accuracy can be obtained when the sites are sufficiently conserved within a given sample, while comparable performance is obtained when the site conservation rate is low. A software program (PosMotif ) and detailed results are available online at http://faculty.cse.tamu.edu/shsze/posmotif.
Novel scenario of the folding transition of a single chain
International Nuclear Information System (INIS)
Yoshikawa, Kenichi; Yoshinaga, Natsuhiko
2005-01-01
Unique characteristics of a single polymer chain with the effects of stiffness and charge are discussed. It has been well established that a flexible polymer chain undergoes a continuous transition from an elongated coil to a compact globule, corresponding to the transition between disordered gas-like and disordered liquid-like states. Here, we will show that a semiflexible chain exhibits a discrete transition from coil to compact states, corresponding to a disorder-order transition to an ordered crystalline state. We will propose a novel strategy to obtain various kinds of nano-ordered structures from single chains connecting a pair of chains of different stiffness. We will also discuss the effect of charge, putting emphasis on intramolecular segregation in a single polyelectrolyte chain
Trade studies of plasma elongation for next-step tokamaks
International Nuclear Information System (INIS)
Galambos, J.D.; Strickler, D.J.; Peng, Y.K.M.; Reid, R.L.
1988-09-01
The effect of elongation on minimum-cost devices is investigated for elongations ranging from 2 to 3. The analysis, carried out with the TETRA tokamak systems code, includes the effects of elongation on both physics (plasma beta limit) and engineering (poloidal field coil currents) issues. When ignition is required, the minimum cost occurs for elongations from 2.3 to 2.9, depending on the plasma energy confinement scaling used. Scalings that include favorable plasma current dependence and/or degradation with fusion power tend to have minimum cost at higher elongation (2.5-2.9); scalings that depend primarily on size result in lower elongation (/approximately/2.3) for minimum cost. For design concepts that include steady-state current-driven operation, minimum cost occurs at an elongation of 2.3. 12 refs., 13 figs
Phutikanit, Nawapen; Suwimonteerabutr, Junpen; Harrison, Dion; D'Occhio, Michael; Carroll, Bernie; Techakumphu, Mongkol
2010-01-01
Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR) assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR) to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII). The native genomic ...
Donczew, Magdalena; Mackiewicz, Paweł; Wróbel, Agnieszka; Flärdh, Klas; Zakrzewska-Czerwińska, Jolanta
2016-01-01
In unicellular bacteria, the ParA and ParB proteins segregate chromosomes and coordinate this process with cell division and chromosome replication. During sporulation of mycelial Streptomyces, ParA and ParB uniformly distribute multiple chromosomes along the filamentous sporogenic hyphal compartment, which then differentiates into a chain of unigenomic spores. However, chromosome segregation must be coordinated with cell elongation and multiple divisions. Here, we addressed the question of whether ParA and ParB are involved in the synchronization of cell-cycle processes during sporulation in Streptomyces. To answer this question, we used time-lapse microscopy, which allows the monitoring of growth and division of single sporogenic hyphae. We showed that sporogenic hyphae stop extending at the time of ParA accumulation and Z-ring formation. We demonstrated that both ParA and ParB affect the rate of hyphal extension. Additionally, we showed that ParA promotes the formation of massive nucleoprotein complexes by ParB. We also showed that FtsZ ring assembly is affected by the ParB protein and/or unsegregated DNA. Our results indicate the existence of a checkpoint between the extension and septation of sporogenic hyphae that involves the ParA and ParB proteins. PMID:27248800
International Nuclear Information System (INIS)
Rudnicka, L.; Diaz, A.; Varga, J.; Jimenez, S.A.; Christiano, A.; Uitto, J.
1995-01-01
Quantification of gene expression is of increasing interest in many medical sciences. Methods based on reverse transcription-polymerase chain reactions (RT-PCRs) are timesaving and require only very small amounts of RNA. A limiting factor, however, is the significant fluctuation in the efficacy of reverse transcription as well in the polymerase chain reactions. Various external and internal standards have been suggested for correcting these fluctuations. We describe a novel way of creating an internal standard for assessing the expression of type VII collagen in human cells. The total RNA of a patient with hereditary 'epidermilysis bulosa dystrophica' associated with a homozygous T to A point mutation in type VII collagen gene was reverse transcribed and a 382bp fragment of type VII collagen cDNA containing the mutation was amplified. The mutated cDNA, unlike normal type VII collagen cDNA could be cleaved by 'Ear I' endonuclease into 244bp and 138bp fragments. Semiquantitative PCR was performed with the mutated cDNA as internal standard and the studied cDNA sample in the same tube in the presence of α 32 P-labelled dCTP. The reaction was followed by 'Ear I' digestion, electrophoresis on a polyacrylamide gel and exposure to a X-ray film. In conclusion, we describe a timesaving method for creating internal standards for semiquantitative RT-PCR. (author). 12 refs, 3 figs
Elongational viscosity of monodisperse and bidisperse polystyrene melts
DEFF Research Database (Denmark)
Nielsen, Jens Kromann; Rasmussen, Henrik K.; Hassager, Ole
2006-01-01
The start-up and steady uniaxial elongational viscosity have been measured for two monodisperse polystyrene melts with molecular weights of 52 and 103 kg/mole, and for three bidisperse polystyrene melts. The monodisperse melts show a maximum in the steady elongational viscosity vs. the elongational...
Evidence for DNA repair after ultraviolet irradiation of Petunia hybrida pollen
International Nuclear Information System (INIS)
Jackson, J.F.; Linskens, H.F.; Katholieke Universiteit Nijmegen; Katholike Universiteit Nijmegen
1978-01-01
Ultraviolet irradiation of Petunia hybrida pollen led to an unscheduled labelling of pollen DNA by 3 H-thymidine during the early stages of germination. Hydroxyurea increased this DNA labelling, while added boron, required absolutely for pollen germination, tube elongation and tube generative cell mitosis, was not needed for this repair-like DNA synthesis. (orig.) [de
International Nuclear Information System (INIS)
Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet
2004-01-01
The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)
International Nuclear Information System (INIS)
Olsen, I.; Herbert, L.; Harris, G.; Cramp, W.A.; Hesslewood, I.P.; Parker, J.
1978-01-01
We have investigated the post-irradiation synthesis of DNA in a lymphoid cell line (LDV) obtained from normal human peripheral blood and maintained in culture. For doses up to Gy (1 kilorad) the repair of DNA damage in these cells was rapid and complete. However, when DNA strand elongation was assayed in apparently fully repaired cells the new DNA was grossly abnormal. Hydroxapathie chromatography was used to examine lesions in prelabelled DNA as well as strand elongation. Because of the sensitivity of this technique we have been able to show that the repair process is error prone. (orig.) [de
Effect of γ-irradiated DNA on the activity of DNA polymerase
International Nuclear Information System (INIS)
Leadon, S.A.; Ward, J.F.
1981-01-01
A cell-free assay was developed to measure the effect of γ-irradiated DNA template on the ability of DNA polymerase to copy unirradiated template. Doses as low as 1 krad were able to decrease (approx. 15%) the activity of both bacterial and mammalian DNA polymerases in the assay. The percentage of polymerase activity decreased as the dose received by the template increased. The reduction in DNA polymerase activity was shown to be due to an inhibition of the enzyme by the irradiated DNA. Irradiated poly(dA-dT) was more effective in reducing polymerase activity than calf thymus DNA. Thus the polymerase-inhibition site(s) appears to be associated with base damage, specifically adenine or thymine. Using a free-radical scavenger, OH radicals were found to be involved in producing the damage sites. The interaction between irradiated DNA and DNA polymerase was found to be specific for the enzyme and not for other proteins present in the assay. The inhibition of DNA polymerase occurred prior to or during the initiation of DNA synthesis rather than after initiation of synthesis, i.e., during elongation
DNA markers as a tool for genetic traceability of primary product in agri-food chains
Directory of Open Access Journals (Sweden)
Daria Scarano
2012-11-01
Full Text Available The agri-food components of the Made in Italy are well known all over the world, therefore they may significantly contribute to the Italian economy. However, also owing to a large number of cases of improper labelling, the Italian agro-food industry faces an ever-increasing competition. For this reason, there is a decline of consumers’ confidence towards food production systems and safety controls. To prevent erroneous classification of products and to protect consumers from false instore information, it is important to develop and validate techniques that are able to detect mislabelling at any stage of the food-chain. This paper describes some examples of genetic traceability of primary products in some important plant food chains such as durum wheat, olive and tomato, based on DNA analysis both of raw material and of processed food (pasta, olive oil, and peeled tomato.
Energy Technology Data Exchange (ETDEWEB)
Yoon, Jeongha; Kim, Jinseong; Baig, Chunggi, E-mail: cbaig@unist.ac.kr [Department of Chemical Engineering, School of Energy and Chemical Engineering, Ulsan National Institute of Science and Technology (UNIST), Ulsan 689-798 (Korea, Republic of)
2016-07-15
We present detailed results for the structural and rheological properties of unknotted and unconcatenated ring polyethylene (PE) melts under shear and elongation flows via direct atomistic nonequilibrium molecular dynamics simulations. Short (C{sub 78}H{sub 156}) and long (C{sub 400}H{sub 800}) ring PE melts were subjected to planar Couette flow (PCF) and planar elongational flow (PEF) across a wide range of strain rates from linear to highly nonlinear flow regimes. The results are analyzed in detail through a direct comparison with those of the corresponding linear polymers. We found that, in comparison to their linear analogs, ring melts possess rather compact chain structures at or near the equilibrium state and exhibit a considerably lesser degree of structural deformation with respect to the applied flow strength under both PCF and PEF. The large structural resistance of ring polymers against an external flow field is attributed to the intrinsic closed-loop configuration of the ring and the topological constraint of nonconcatenation between ring chains in the melt. As a result, there appears to be a substantial discrepancy between ring and linear systems in terms of their structural and rheological properties such as chain orientation, the distribution of chain dimensions, viscosity, flow birefringence, hydrostatic pressure, the pair correlation function, and potential interaction energies. The findings and conclusions drawn in this work would be a useful guide in future exploration of the characteristic dynamical and relaxation mechanisms of ring polymers in bulk or confined systems under flowing conditions.
Monroig, Óscar; de Llanos, Rosa; Varó, Inmaculada; Hontoria, Francisco; Tocher, Douglas R; Puig, Sergi; Navarro, Juan C
2017-03-21
Polyunsaturated fatty acids (PUFAs) have been acknowledged as essential nutrients for cephalopods but the specific PUFAs that satisfy the physiological requirements are unknown. To expand our previous investigations on characterisation of desaturases and elongases involved in the biosynthesis of PUFAs and hence determine the dietary PUFA requirements in cephalopods, this study aimed to investigate the roles that a stearoyl-CoA desaturase (Scd) and an elongation of very long-chain fatty acid 4 (Elovl4) protein play in the biosynthesis of essential fatty acids (FAs). Our results confirmed the Octopus vulgaris Scd is a ∆9 desaturase with relatively high affinity towards saturated FAs with ≥ C 18 chain lengths. Scd was unable to desaturate 20:1 n- 15 ( ∆5 20:1) suggesting that its role in the biosynthesis of non-methylene interrupted FAs (NMI FAs) is limited to the introduction of the first unsaturation at ∆9 position. Interestingly, the previously characterised ∆5 fatty acyl desaturase was indeed able to convert 20:1 n- 9 ( ∆11 20:1) to ∆5,11 20:2, an NMI FA previously detected in octopus nephridium. Additionally, Elovl4 was able to mediate the production of 24:5 n- 3 and thus can contribute to docosahexaenoic acid (DHA) biosynthesis through the Sprecher pathway. Moreover, the octopus Elovl4 was confirmed to play a key role in the biosynthesis of very long-chain (>C 24 ) PUFAs.
Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E
2001-04-01
Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.
Cho, J M; Kimball, A P
1982-08-15
9-beta-D-Arabinofuranosyl-6-mercaptopurine (ara-6-MP) was used to affinity-label wheat germ DNA-dependent RNA polymerase II (or B) (nucleosidetriphosphate:RNA nucleotidyltransferase, EC 2.7.7.6). This nucleoside analogue was found to be a competitive inhibitor with respect to [3H]UMP incorporation. Natural substrates protected the enzyme from inactivation by ara-6-MP when the enzyme was preincubated with excess concentrations of substrates, suggesting that the inhibitor binds at the elongation subsite. The inhibitor bound the catalytic center of the enzyme with a stoichiometry of 0.6:1. The sulfhydryl reagent, dithiothreitol, reversed the inhibition by ara-6-MP, suggesting that the 6-thiol group of the inhibitor was interacting closely with an essential cysteine residue in the catalytic center of the enzyme. Chromatographic analysis of the pronase-digestion products of the RNA polymerase II-ara-6-MP complex also showed that ara-6-MP had bound a cysteine residue. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of the denatured [6-35S]ara-6-MP-labeled RNA polymerase II revealed that over 80% of the radioactivity was associated with the IIb subunit of the enzyme.
International Nuclear Information System (INIS)
Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.
1989-01-01
Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions
Observation of hairpin defects in a nematic main-chain polyester
Li, M. H.; Brûlet, A.; Davidson, P.; Keller, P.; Cotton, J. P.
1993-04-01
The conformation of a main-chain liquid crystalline polyester in its oriented nematic phase has been determined by small-angle neutron scattering. The data are fitted by a model of rigid cylinder with orientational fluctuations. For a low degree of polymerization (~9) the chain is almost completely elongated in the direction of the nematic field. For a polymer 3 times longer, the existence of two hairpins is shown at high temperature; this number decreases with decreasing temperature.
Regulation of palmitoyl-CoA chain elongation by clofibric acid in the liver of Zucker fa/fa rats.
Toyama, Tomoaki; Kudo, Naomi; Mitsumoto, Atsushi; Kawashima, Yoichi
2005-05-01
The regulation of palmitoyl-CoA chain elongation (PCE) by clofibric acid [2-(4-chlorophenoxy)-2-methylpropionic acid] was investigated in comparison with stearoyl-CoA desaturase (SCD) in the liver of obese Zucker fa/fa rats. The proportion of oleic acid in the hepatic lipids of Zucker obese rats is 2.7 times higher than that of lean littermates. The activities of PCE and SCD in the liver of Zucker obese rats were markedly higher than in lean rats, and the hepatic uptake of 2-deoxyglucose (2-DG) was also higher in Zucker obese rats compared with lean rats. The increased activities of SCD and PCE in Zucker obese rats were due to the enhanced expression of mRNA of both SCD1 and rat FA elongase 2 (rELO2), but not SCD2 or rELO1. The proportion of oleic acid in the liver was significantly increased by the administration of clofibric acid to Zucker obese rats, and the hepatic PCE activity and rELO2 mRNA expression, but not the SCD activity or SCD1 mRNA expression, were increased in response to clofibric acid treatment. By contrast, the activities of both PCE and SCD and the mRNA expression of SCD1 and rELO2 in the liver were increased by the treatment of Zucker lean rats with clofibric acid. Multiple regression analysis, which was performed to determine the relationships involving PCE activity, SCD activity, and the proportion of oleic acid, revealed that the three parameters were significantly correlated and that the standardized partial regression coefficient of PCE was higher than that of SCD. These results indicate that oleic acid is synthesized by the concerted action of PCE and SCD and that PCE plays a crucial role in the formation of oleic acid when Zucker fa/fa rats are given clofibric acid.
Fahrimal, Y; Goff, W L; Jasmer, D P
1992-01-01
Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551
ATFL elongation after Brostrom procedure: a biomechanical investigation.
Kirk, Kevin L; Campbell, John T; Guyton, Gregory P; Parks, Brent G; Schon, Lew C
2008-11-01
Elongation of ligaments during early mobilization after reconstruction may be associated with decreased stability. We evaluated elongation of the anterior talofibular ligament (ATFL) before and after lateral ligament reconstruction within a physiologic range of motion with protected and unprotected, isolated dorsiflexion/plantarflexion range of motion. Six fresh frozen cadaver legs were used with the ATFL meticulously dissected. A differential variable reluctance transducer (DVRT) was spaced to span the course of the ATFL using consistent placement points based on previous reports. Elongation was measured in a load frame with protected motion of 30 degrees plantarflexion and 10 degrees dorsiflexion for the intact and sectioned ATFL and for the repaired specimen with and without protected motion. The proximal DVRT anchor point was detached for sectioning and repair of the ATFL and replaced at the same position. Testing was 1000 cycles at 1 Hz for the repaired protected specimen and 10 cycles at 1 Hz for all other stages. Initial elongation in the unprotected, repaired group was significantly higher than initial elongation in the intact (p ankle after lateral ankle ligament reconstruction was not associated with elongation of the ATFL. The ATFL elongated significantly by comparison without protected dorsiflexion/plantarflexion. The study provides biomechanical support for the safety of early protected dorsiflexion/plantarflexion range of motion after Broström reconstruction.
In vitro transcription of a torsionally constrained template
DEFF Research Database (Denmark)
Bentin, Thomas; Nielsen, Peter E
2002-01-01
of torsionally constrained DNA by free RNAP. We asked whether or not a newly synthesized RNA chain would limit transcription elongation. For this purpose we developed a method to immobilize covalently closed circular DNA to streptavidin-coated beads via a peptide nucleic acid (PNA)-biotin conjugate in principle...
Charge transport in polyguanine-polycytosine DNA molecules
International Nuclear Information System (INIS)
Wei, J H; Chan, K S
2007-01-01
A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules
Stability of tokamaks with elongated cross section
International Nuclear Information System (INIS)
An, C.H.; Bateman, G.
1978-08-01
Fixed boundary n = 1 MHD instabilities are studied computationally as a function of diamagnetism (β/sub pol/) and current profile in elongated toroidal equilibria (1 2) or a diamagnetic plasma (β/sub pol/ > 1) with only a mildly elongated cross section
Cornelissen, M. T.; van den Tweel, J. G.; Struyk, A. P.; Jebbink, M. F.; Briët, M.; van der Noordaa, J.; ter Schegget, J. T.
1989-01-01
The localization of human papillomavirus type 16 (HPV-16) DNA throughout the cervix uteri of women with cervical intraepithelial neoplasia (CIN) was studied by utilizing the polymerase chain reaction technique directly on histologically defined sections of paraffin-embedded cervical tissue obtained
Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.
Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal
2014-05-01
Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.
A pea chloroplast translation elongation factor that is regulated by abiotic factors
International Nuclear Information System (INIS)
Singh, B.N.; Mishra, R.N.; Agarwal, Pradeep K.; Goswami, Mamta; Nair, Suresh; Sopory, S.K.; Reddy, M.K.
2004-01-01
We report the cloning and characterization of both the cDNA (tufA) and genomic clones encoding for a chloroplast translation elongation factor (EF-Tu) from pea. The analysis of the deduced amino acids of the cDNA clone reveals the presence of putative transit peptide sequence and four GTP binding domains and two EF-Tu signature motifs in the mature polypeptide region. Using in vivo immunostaining followed by confocal microscopy pea EF-Tu was localized to chloroplast. The steady state transcript level of pea tufA was high in leaves and not detectable in roots. The expression of this gene is stimulated by light. The differential expression of this gene in response to various abiotic stresses showed that it is down-regulated in response to salinity and ABA and up-regulated in response to low temperature and salicylic acid treatment. These results indicate that regulation of pea tufA may have an important role in plant adaptation to environmental stresses
High n ballooning modes in highly elongated tokamaks
International Nuclear Information System (INIS)
An, C.H.; Bateman, G.
1980-02-01
An analytic study of stability against high n ballooning modes in highly elongated axisymmetric plasmas is presented and compared with computational results. From the equation for the marginal pressure gradient, it is found that the local shear plays an important role on the stability of elongated and shifted plasma, and that high elongation deteriorates the stability by decreasing the stabilizing effects of field line bending and local shear. The net contribution of the local shear to stability decreases with elongation and shift for strongly ballooning modes (eigenfunctions strongly localized near the outer edge of the toroidal flux surfaces) but increases for interchange modes (eigenfunctions more uniform along the flux surfaces). The computational study of high n ballooning modes in a highly elongated plasma reveals that lowering the aspect ratio and broadening the pressure profile enhance the marginal beta for β/sub p/ less than unity but severely reduce the marginal beta for β/sub p/ larger than unity
Elongator Plays a Positive Role in Exogenous NAD-Induced Defense Responses in Arabidopsis.
An, Chuanfu; Ding, Yezhang; Zhang, Xudong; Wang, Chenggang; Mou, Zhonglin
2016-05-01
Extracellular NAD is emerging as an important signal molecule in animal cells, but its role in plants has not been well-established. Although it has been shown that exogenous NAD(+) activates defense responses in Arabidopsis, components in the exogenous NAD(+)-activated defense pathway remain to be fully discovered. In a genetic screen for mutants insensitive to exogenous NAD(+) (ien), we isolated a mutant named ien2. Map-based cloning revealed that IEN2 encodes ELONGATA3 (ELO3)/AtELP3, a subunit of the Arabidopsis Elongator complex, which functions in multiple biological processes, including histone modification, DNA (de)methylation, and transfer RNA modification. Mutations in the ELO3/AtELP3 gene compromise exogenous NAD(+)-induced expression of pathogenesis-related (PR) genes and resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola ES4326, and transgenic expression of the coding region of ELO3/AtELP3 in elo3/Atelp3 restores NAD(+) responsiveness to the mutant plants, demonstrating that ELO3/AtELP3 is required for exogenous NAD(+)-induced defense responses. Furthermore, mutations in genes encoding the other five Arabidopsis Elongator subunits (ELO2/AtELP1, AtELP2, ELO1/AtELP4, AtELP5, and AtELP6) also compromise exogenous NAD(+)-induced PR gene expression and resistance to P. syringae pv. maculicola ES4326. These results indicate that the Elongator complex functions as a whole in exogenous NAD(+)-activated defense signaling in Arabidopsis.
International Nuclear Information System (INIS)
Gokahmetoglu, S.; Deniz, E.
2007-01-01
To compare the real-time (RT) and qualitative (Q) polymerase chain reaction (PCR) assays for detection of Cytomegalovirus (CMV) DNA. The study took place in the Department of Microbiology, Erciyes University, Kayseri and in Iontek Laboratory, Istanbul, Turkey, from August to December 2006. One hundred and seven clinical specimens from 67 patients were included in the study. Cytomegalovirus DNA was investigated using RT-PCR kit (Fluorion Iontek, Turkey) and Q-PCR kit (Fluorion Iontek, Turkey). Deoxyribonucleic acid sequencing was applied to the samples that yielded discrepant results in both assays. Mac Nema's Chi Square test was used for statistical analysis. Of the specimens, 27 were found positive with both assays: 9 with only RT-PCR, and 11 with only Q-PCR assay. Both assays were found negative in 60 of the specimens. There was a good agreement between the 2 assays in 87(81.3%) of the specimens. There was no statistical significant difference between the assays (p>0.05). Two of the 11 samples that RT-PCR negative Q-PCR positive, and 3 of 9 samples that RT-PCR positive Q-PCR negative were found to be CMV DNA positive by DNA sequencing. A good level of concordance between RT-PCR and Q-PCR assays for CMV DNA detection has been found. (author)
Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J
2016-01-01
Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis. © The American Society of Tropical Medicine and Hygiene.
Francisco, Joel Celio; Dai, Qian; Luo, Zhuojuan; Wang, Yan; Chong, Roxanne Hui-Heng; Tan, Yee Joo; Xie, Wei; Lee, Guan-Huei; Lin, Chengqi
2017-10-01
Chronic hepatitis B virus (HBV) infection can lead to liver cirrhosis and hepatocellular carcinoma. HBV reactivation during or after chemotherapy is a potentially fatal complication for cancer patients with chronic HBV infection. Transcription of HBV is a critical intermediate step of the HBV life cycle. However, factors controlling HBV transcription remain largely unknown. Here, we found that different P-TEFb complexes are involved in the transcription of the HBV viral genome. Both BRD4 and the super elongation complex (SEC) bind to the HBV genome. The treatment of bromodomain inhibitor JQ1 stimulates HBV transcription and increases the occupancy of BRD4 on the HBV genome, suggesting the bromodomain-independent recruitment of BRD4 to the HBV genome. JQ1 also leads to the increased binding of SEC to the HBV genome, and SEC is required for JQ1-induced HBV transcription. These findings reveal a novel mechanism by which the HBV genome hijacks the host P-TEFb-containing complexes to promote its own transcription. Our findings also point out an important clinical implication, that is, the potential risk of HBV reactivation during therapy with a BRD4 inhibitor, such as JQ1 or its analogues, which are a potential treatment for acute myeloid leukemia. Copyright © 2017 American Society for Microbiology.
Binding of transcription termination protein nun to nascent RNA and template DNA.
Watnick, R S; Gottesman, M E
1999-12-17
The amino-terminal arginine-rich motif of coliphage HK022 Nun binds phage lambda nascent transcript, whereas the carboxyl-terminal domain interacts with RNA polymerase (RNAP) and blocks transcription elongation. RNA binding is inhibited by zinc (Zn2+) and stimulated by Escherichia coli NusA. To study these interactions, the Nun carboxyl terminus was extended by a cysteine residue conjugated to a photochemical cross-linker. The carboxyl terminus contacted NusA and made Zn2+-dependent intramolecular contacts. When Nun was added to a paused transcription elongation complex, it cross-linked to the DNA template. Nun may arrest transcription by anchoring RNAP to DNA.
You, Zhiying; De Falco, Mariarosaria; Kamada, Katsuhiko; Pisani, Francesca M.; Masai, Hisao
2013-01-01
The Mini-chromosome maintenance (Mcm) proteins are essential as central components for the DNA unwinding machinery during eukaryotic DNA replication. DNA primase activity is required at the DNA replication fork to synthesize short RNA primers for DNA chain elongation on the lagging strand. Although direct physical and functional interactions between helicase and primase have been known in many prokaryotic and viral systems, potential interactions between helicase and primase have not been explored in eukaryotes. Using purified Mcm and DNA primase complexes, a direct physical interaction is detected in pull-down assays between the Mcm2∼7 complex and the hetero-dimeric DNA primase composed of the p48 and p58 subunits. The Mcm4/6/7 complex co-sediments with the primase and the DNA polymerase α-primase complex in glycerol gradient centrifugation and forms a Mcm4/6/7-primase-DNA ternary complex in gel-shift assays. Both the Mcm4/6/7 and Mcm2∼7 complexes stimulate RNA primer synthesis by DNA primase in vitro. However, primase inhibits the Mcm4/6/7 helicase activity and this inhibition is abolished by the addition of competitor DNA. In contrast, the ATP hydrolysis activity of Mcm4/6/7 complex is not affected by primase. Mcm and primase proteins mutually stimulate their DNA-binding activities. Our findings indicate that a direct physical interaction between primase and Mcm proteins may facilitate priming reaction by the former protein, suggesting that efficient DNA synthesis through helicase-primase interactions may be conserved in eukaryotic chromosomes. PMID:23977294
Directory of Open Access Journals (Sweden)
Zhiying You
Full Text Available The Mini-chromosome maintenance (Mcm proteins are essential as central components for the DNA unwinding machinery during eukaryotic DNA replication. DNA primase activity is required at the DNA replication fork to synthesize short RNA primers for DNA chain elongation on the lagging strand. Although direct physical and functional interactions between helicase and primase have been known in many prokaryotic and viral systems, potential interactions between helicase and primase have not been explored in eukaryotes. Using purified Mcm and DNA primase complexes, a direct physical interaction is detected in pull-down assays between the Mcm2~7 complex and the hetero-dimeric DNA primase composed of the p48 and p58 subunits. The Mcm4/6/7 complex co-sediments with the primase and the DNA polymerase α-primase complex in glycerol gradient centrifugation and forms a Mcm4/6/7-primase-DNA ternary complex in gel-shift assays. Both the Mcm4/6/7 and Mcm2~7 complexes stimulate RNA primer synthesis by DNA primase in vitro. However, primase inhibits the Mcm4/6/7 helicase activity and this inhibition is abolished by the addition of competitor DNA. In contrast, the ATP hydrolysis activity of Mcm4/6/7 complex is not affected by primase. Mcm and primase proteins mutually stimulate their DNA-binding activities. Our findings indicate that a direct physical interaction between primase and Mcm proteins may facilitate priming reaction by the former protein, suggesting that efficient DNA synthesis through helicase-primase interactions may be conserved in eukaryotic chromosomes.
Abscisic Acid Stimulates Elongation of Excised Pea Root Tips
Gaither, Douglas H.; Lutz, Donald H.; Forrence, Leonard E.
1975-01-01
Excised Pisum sativum L. root tips were incubated in a pH 5.2 sucrose medium containing abscisic acid. Elongation growth was inhibited by 100 μm abscisic acid. However, decreasing the abscisic acid concentration caused stimulation of elongation, the maximum response (25% to 30%) occurring at 1 μm abscisic acid. Prior to two hours, stimulation of elongation by 1 μm abscisic acid was not detectable. Increased elongation did not occur in abscisic acid-treated root tips of Lens culinaris L., Phaseolus vulgaris L., or Zea mays L. PMID:16659198
Directory of Open Access Journals (Sweden)
Carroll Bernie
2010-03-01
Full Text Available Abstract Background The purpose of this study was to apply an arbitrarily primed methylation sensitive polymerase chain reaction (PCR assay called Amplified Methylation Polymorphism Polymerase Chain Reaction (AMP PCR to investigate the methylation profiles of somatic and germ cells obtained from Holstein bulls. Methods Genomic DNA was extracted from sperm, leukocytes and fibroblasts obtained from three bulls and digested with a methylation sensitive endonuclease (HpaII. The native genomic and enzyme treated DNA samples were used as templates in an arbitrarily primed-PCR assay with 30 sets of single short oligonucleotide primer. The PCR products were separated on silver stained denaturing polyacrylamide gels. Three types of PCR markers; digestion resistant-, digestion sensitive-, and digestion dependent markers, were analyzed based on the presence/absence polymorphism of the markers between the two templates. Results Approximately 1,000 PCR markers per sample were produced from 27 sets of primer and most of them (>90% were digestion resistant markers. The highest percentage of digestion resistant markers was found in leukocytic DNA (94.8% and the lowest in fibroblastic DNA (92.3%, P ≤ 0.05. Spermatozoa contained a higher number of digestion sensitive markers when compared with the others (3.6% vs. 2.2% and 2.6% in leukocytes and fibroblasts respectively, P ≤ 0.05. Conclusions The powerfulness of the AMP PCR assay was the generation of methylation-associated markers without any prior knowledge of the genomic sequence. The data obtained from different primers provided an overview of genome wide DNA methylation content in different cell types. By using this technique, we found that DNA methylation profile is tissue-specific. Male germ cells were hypomethylated at the HpaII locations when compared with somatic cells, while the chromatin of the well-characterized somatic cells was heavily methylated when compared with that of the versatile somatic
Zeppa, Pio; Sosa Fernandez, Laura Virginia; Cozzolino, Immacolata; Ronga, Valentina; Genesio, Rita; Salatiello, Maria; Picardi, Marco; Malapelle, Umberto; Troncone, Giancarlo; Vigliar, Elena
2012-12-25
The human immunoglobulin heavy-chain (IGH) locus at chromosome 14q32 is frequently involved in different translocations of non-Hodgkin lymphoma (NHL), and the detection of any breakage involving the IGH locus should identify a B-cell NHL. The split-signal IGH fluorescence in situ hybridization-chromogenic in situ hybridization (FISH-CISH) DNA probe is a mixture of 2 fluorochrome-labeled DNAs: a green one that binds the telomeric segment and a red one that binds the centromeric segment, both on the IGH breakpoint. In the current study, the authors tested the capability of the IGH FISH-CISH DNA probe to detect IGH translocations and diagnose B-cell lymphoproliferative processes on cytological samples. Fifty cytological specimens from cases of lymphoproliferative processes were tested using the split-signal IGH FISH-CISH DNA probe and the results were compared with light-chain assessment by flow cytometry (FC), IGH status was tested by polymerase chain reaction (PCR), and clinicohistological data. The signal score produced comparable results on FISH and CISH analysis and detected 29 positive, 15 negative, and 6 inadequate cases; there were 29 true-positive cases (66%), 9 true-negative cases (20%), 6 false-negative cases (14%), and no false-positive cases (0%). Comparing the sensitivity of the IGH FISH-CISH DNA split probe with FC and PCR, the highest sensitivity was obtained by FC, followed by FISH-CISH and PCR. The split-signal IGH FISH-CISH DNA probe is effective in detecting any translocation involving the IGH locus. This probe can be used on different samples from different B-cell lymphoproliferative processes, although it is not useful for classifying specific entities. Cancer (Cancer Cytopathol) 2012;. © 2012 American Cancer Society. Copyright © 2012 American Cancer Society.
Pavlov, Andrey R; Pavlova, Nadejda V; Kozyavkin, Sergei A; Slesarev, Alexei I
2012-03-13
We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases [Pavlov, A. R., et al. (2002) Proc. Natl. Acad. Sci. U.S.A.99, 13510-13515]. The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various sequence-nonspecific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting helix-hairpin-helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of Topo V HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105 °C by maintaining processivity of DNA synthesis at high temperatures. We found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding of templates to DNA polymerases.
Pavlov, Andrey R.; Pavlova, Nadejda V.; Kozyavkin, Sergei A.; Slesarev, Alexei I.
2012-01-01
We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases (Pavlov et. al., (2002) Proc. Natl. Acad. Sci. USA 99, 13510–13515). The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various non-specific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting Helix-hairpin-Helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species, but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of TopoV HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105°C by maintaining processivity of DNA synthesis at high temperatures. We also found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding templates to DNA polymerases. PMID:22320201
Planar Elongation Measurements on Soft Elastomers
DEFF Research Database (Denmark)
Jensen, Mette Krog; Skov, Anne Ladegaard; Rasmussen, Henrik K.
2009-01-01
A new fixture to the filament stretch rheometer (FSR) has been developed to measure planar elongation of soft polymeric networks. To validate this new technique, soft polymeric networks of poly(propyleneoxide) (PPO) were investigated during deformation.......A new fixture to the filament stretch rheometer (FSR) has been developed to measure planar elongation of soft polymeric networks. To validate this new technique, soft polymeric networks of poly(propyleneoxide) (PPO) were investigated during deformation....
David E. Schreiber; Karen J. Garner; James M. Slavicek
1997-01-01
Gypsy moths originating in Asia have recently been introduced into North America, making it necessary to develop markers for distinguishing the Asian strain from the established North American population. We have identified 3 randomly amplified polymorphic DNA-polymerase chain reaction generated (RAPD-PCR) markers which are specific for either Asian or North American...
DNA damage mediated transcription arrest: Step back to go forward.
Mullenders, Leon
2015-12-01
The disturbance of DNA helix conformation by bulky DNA damage poses hindrance to transcription elongating due to stalling of RNA polymerase at transcription blocking lesions. Stalling of RNA polymerase provokes the formation of R-loops, i.e. the formation of a DNA-RNA hybrid and a displaced single stranded DNA strand as well as displacement of spliceosomes. R-loops are processed into DNA single and double strand breaks by NER factors depending on TC-NER factors leading to genome instability. Moreover, stalling of RNA polymerase induces a strong signal for cell cycle arrest and apoptosis. These toxic and mutagenic effects are counteracted by a rapid recruitment of DNA repair proteins to perform transcription coupled nucleotide excision repair (TC-NER) to remove the blocking DNA lesions and to restore transcription. Recent studies have highlighted the role of backtracking of RNA polymerase to facilitate TC-NER and identified novel factors that play key roles in TC-NER and in restoration of transcription. On the molecular level these factors facilitate stability of the repair complex by promotion and regulation of various post-translational modifications of NER factors and chromatin substrate. In addition, the continuous flow of new factors that emerge from screening assays hints to several regulatory levels to safeguard the integrity of transcription elongation after disturbance by DNA damage that have yet to be explored. Copyright © 2015 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Kurihara, Hiroyuki; Shinkai, Masashige; Nagamune, Teruyuki
2004-01-01
We developed a novel method for creating repetitive DNA libraries using overlap elongation PCR, and prepared a DNA library encoding repetitive Arg-Gly-Asp (RGD) cell adhesive motifs. We obtained various length DNAs encoding repetitive RGD from a short monomer DNA (18 bp) after a thermal cyclic reaction without a DNA template for amplification, and isolated DNAs encoding 2, 21, and 43 repeats of the RGD motif. We cloned these DNAs into a protein expression vector and overexpressed them as thioredoxin fusion proteins: RGD2, RGD21, and RGD43, respectively. The solubility of RGD43 in water was low and it formed a fibrous precipitate in water. Scanning electron microscopy revealed that RGD43 formed a branched 3D-network structure in the solid state. To evaluate the function of the cell adhesive motifs in RGD43, mouse fibroblast cells were cultivated on the RGD43 scaffold. The fibroblast cells adhered to the RGD43 scaffold and extended long filopodia
Actin and myosin contribute to mammalian mitochondrial DNA maintenance
Reyes, A.; He, J.; Mao, C. C.; Bailey, L. J.; Di Re, M.; Sembongi, H.; Kazak, L.; Dzionek, K.; Holmes, J. B.; Cluett, T. J.; Harbour, M. E.; Fearnley, I. M.; Crouch, R. J.; Conti, M. A.; Adelstein, R. S.; Walker, J. E.; Holt, I. J.
2011-01-01
Mitochondrial DNA maintenance and segregation are dependent on the actin cytoskeleton in budding yeast. We found two cytoskeletal proteins among six proteins tightly associated with rat liver mitochondrial DNA: non-muscle myosin heavy chain IIA and β-actin. In human cells, transient gene silencing of MYH9 (encoding non-muscle myosin heavy chain IIA), or the closely related MYH10 gene (encoding non-muscle myosin heavy chain IIB), altered the topology and increased the copy number of mitochondrial DNA; and the latter effect was enhanced when both genes were targeted simultaneously. In contrast, genetic ablation of non-muscle myosin IIB was associated with a 60% decrease in mitochondrial DNA copy number in mouse embryonic fibroblasts, compared to control cells. Gene silencing of β-actin also affected mitochondrial DNA copy number and organization. Protease-protection experiments and iodixanol gradient analysis suggest some β-actin and non-muscle myosin heavy chain IIA reside within human mitochondria and confirm that they are associated with mitochondrial DNA. Collectively, these results strongly implicate the actomyosin cytoskeleton in mammalian mitochondrial DNA maintenance. PMID:21398640
Halogenated auxins affect microtubules and root elongation in Lactuca sativa
Zhang, N.; Hasenstein, K. H.
2000-01-01
We studied the effect of 4,4,4-trifluoro-3-(indole-3-)butyric acid (TFIBA), a recently described root growth stimulator, and 5,6-dichloro-indole-3-acetic acid (DCIAA) on growth and microtubule (MT) organization in roots of Lactuca sativa L. DCIAA and indole-3-butyric acid (IBA) inhibited root elongation and depolymerized MTs in the cortex of the elongation zone, inhibited the elongation of stele cells, and promoted xylem maturation. Both auxins caused the plane of cell division to shift from anticlinal to periclinal. In contrast, TFIBA (100 micromolar) promoted elongation of primary roots by 40% and stimulated the elongation of lateral roots, even in the presence of IBA, the microtubular inhibitors oryzalin and taxol, or the auxin transport inhibitor naphthylphthalamic acid. However, TFIBA inhibited the formation of lateral root primordia. Immunostaining showed that TFIBA stabilized MTs orientation perpendicular to the root axis, doubled the cortical cell length, but delayed xylem maturation. The data indicate that the auxin-induced inhibition of elongation and swelling of roots results from reoriented phragmoplasts, the destabilization of MTs in elongating cells, and promotion of vessel formation. In contrast, TFIBA induced promotion of root elongation by enhancing cell length, prolonging transverse MT orientation, delaying cell and xylem maturation.
Energy Technology Data Exchange (ETDEWEB)
Jiang, Zhenzhou, E-mail: jiangcpu@yahoo.com.cn; Bao, Qingli, E-mail: bao_ql@126.com; Sun, Lixin, E-mail: slxcpu@126.com; Huang, Xin, E-mail: huangxinhx66@sohu.com; Wang, Tao, E-mail: wangtao1331@126.com; Zhang, Shuang, E-mail: cat921@sina.com; Li, Han, E-mail: hapo1101@163.com; Zhang, Luyong, E-mail: lyzhang@cpu.edu.cn
2013-01-15
This report describes an investigation of the pathological mechanism of acute renal failure caused by toxic tubular necrosis after treatment with aristolochic acid I (AAI) in Sprague–Dawley (SD) rats. The rats were gavaged with AAI at 0, 5, 20, or 80 mg/kg/day for 7 days. The pathologic examination of the kidneys showed severe acute tubular degenerative changes primarily affecting the proximal tubules. Supporting these results, we detected significantly increased concentrations of blood urea nitrogen (BUN) and creatinine (Cr) in the rats treated with AAI, indicating damage to the kidneys. Ultrastructural examination showed that proximal tubular mitochondria were extremely enlarged and dysmorphic with loss and disorientation of their cristae. Mitochondrial function analysis revealed that the two indicators for mitochondrial energy metabolism, the respiratory control ratio (RCR) and ATP content, were reduced in a dose-dependent manner after AAI treatment. The RCR in the presence of substrates for complex I was reduced more significantly than in the presence of substrates for complex II. In additional experiments, the activity of respiratory complex I, which is partly encoded by mitochondrial DNA (mtDNA), was more significantly impaired than that of respiratory complex II, which is completely encoded by nuclear DNA (nDNA). A real-time PCR assay revealed a marked reduction of mtDNA in the kidneys treated with AAI. Taken together, these results suggested that mtDNA depletion and respiratory chain defects play critical roles in the pathogenesis of kidney injury induced by AAI, and that the same processes might contribute to aristolochic acid-induced nephrotoxicity in humans. -- Highlights: ► AAI-induced acute renal failure in rats and the proximal tubule was the target. ► Tubular mitochondria were morphologically aberrant in ultrastructural examination. ► AAI impair mitochondrial bioenergetic function and mtDNA replication.
Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V
2015-12-01
The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.
Directory of Open Access Journals (Sweden)
Suzana Makpol
2011-01-01
Full Text Available This study determined the molecular mechanisms of tocotrienol-rich fraction (TRF in preventing cellular senescence of human diploid fibroblasts (HDFs. Primary culture of HDFs at various passages were incubated with 0.5 mg/mL TRF for 24 h. Telomere shortening with decreased telomerase activity was observed in senescent HDFs while the levels of damaged DNA and number of cells in G0/G1 phase were increased and S phase cells were decreased. Incubation with TRF reversed the morphology of senescent HDFs to resemble that of young cells with decreased activity of SA-β-gal, damaged DNA, and cells in G0/G1 phase while cells in the S phase were increased. Elongated telomere length and restoration of telomerase activity were observed in TRF-treated senescent HDFs. These findings confirmed the ability of tocotrienol-rich fraction in preventing HDFs cellular ageing by restoring telomere length and telomerase activity, reducing damaged DNA, and reversing cell cycle arrest associated with senescence.
Hierarchically assembled DNA origami tubules with reconfigurable chirality
International Nuclear Information System (INIS)
Chen, Haorong; Cha, Tae-Gon; Pan, Jing; Choi, Jong Hyun
2013-01-01
The dynamic reconfiguration of a hierarchically assembled tubular structure is demonstrated using the DNA origami technique. Short cylindrical DNA origami monomers are synthesized and linked into elongated tubules, which can then be disassembled via toehold-mediated strand displacement. The disassembled subunits are subsequently linked into tubules of a different chirality. The reconfiguration is performed with the subunits carrying dumbbell hairpin DNA oligonucleotides or gold nanoparticles (AuNPs). The reconfiguration of higher order origami structures presented here is useful for constructing dynamic nanostructures that exceed the size limit of single DNA origami and may facilitate the study of molecular or particle interactions by tuning their relative distance and organization. (paper)
Rapid establishment of polymerase chain reaction-restriction ...
African Journals Online (AJOL)
2012-03-30
Mar 30, 2012 ... genome using polymerase chain reaction (PCR) has made it possible to explore organelle DNA diversity for taxonomic and phylogenetic purposes. Because of its uniparental mode of inheritance and its low mutation rate related to the nuclear genome, chloroplast DNA (cpDNA) is considered to be an ideal ...
In vitro transcription of a torsionally constrained template
DEFF Research Database (Denmark)
Bentin, Thomas; Nielsen, Peter E
2002-01-01
RNA polymerase (RNAP) and the DNA template must rotate relative to each other during transcription elongation. In the cell, however, the components of the transcription apparatus may be subject to rotary constraints. For instance, the DNA is divided into topological domains that are delineated...... of torsionally constrained DNA by free RNAP. We asked whether or not a newly synthesized RNA chain would limit transcription elongation. For this purpose we developed a method to immobilize covalently closed circular DNA to streptavidin-coated beads via a peptide nucleic acid (PNA)-biotin conjugate in principle...... constrained. We conclude that transcription of a natural bacterial gene may proceed with high efficiency despite the fact that newly synthesized RNA is entangled around the template in the narrow confines of torsionally constrained supercoiled DNA....
Amy L. Ross-Davis; John W. Hanna; Mee-Sook Kim; Ned B. Klopfenstein
2012-01-01
The translation elongation factor-1 alpha gene was used to examine the phylogenetic relationships among 30 previously characterized isolates representing ten North American Armillaria species: A. solidipes (=A. ostoyae), A. gemina, A. calvescens, A. sinapina, A. mellea, A. gallica, A. nabsnona, North American biological species X, A. cepistipes, and A. tabescens. The...
Energy Technology Data Exchange (ETDEWEB)
Qiu, Jiong; Longcope, Dana W. [Department of Physics, Montana State University, Bozeman MT (United States); Cassak, Paul A. [Department of Physics and Astronomy, West Virginia University, Morgantown WV (United States); Priest, Eric R. [School of Mathematics and Statistics, University of St. Andrews, Fife KY16 9SS, Scotland (United Kingdom)
2017-03-20
We present an analysis of the apparent elongation motion of flare ribbons along the polarity inversion line (PIL), as well as the shear of flare loops in several two-ribbon flares. Flare ribbons and loops spread along the PIL at a speed ranging from a few to a hundred km s{sup −1}. The shear measured from conjugate footpoints is consistent with the measurement from flare loops, and both show the decrease of shear toward a potential field as a flare evolves and ribbons and loops spread along the PIL. Flares exhibiting fast bidirectional elongation appear to have a strong shear, which may indicate a large magnetic guide field relative to the reconnection field in the coronal current sheet. We discuss how the analysis of ribbon motion could help infer properties in the corona where reconnection takes place.
Mitochondrial DNA repair and aging
Energy Technology Data Exchange (ETDEWEB)
Mandavilli, Bhaskar S.; Santos, Janine H.; Van Houten, Bennett
2002-11-30
The mitochondrial electron transport chain plays an important role in energy production in aerobic organisms and is also a significant source of reactive oxygen species that damage DNA, RNA and proteins in the cell. Oxidative damage to the mitochondrial DNA is implicated in various degenerative diseases, cancer and aging. The importance of mitochondrial ROS in age-related degenerative diseases is further strengthened by studies using animal models, Caenorhabditis elegans, Drosophila and yeast. Research in the last several years shows that mitochondrial DNA is more susceptible to various carcinogens and ROS when compared to nuclear DNA. DNA damage in mammalian mitochondria is repaired by base excision repair (BER). Studies have shown that mitochondria contain all the enzymes required for BER. Mitochondrial DNA damage, if not repaired, leads to disruption of electron transport chain and production of more ROS. This vicious cycle of ROS production and mtDNA damage ultimately leads to energy depletion in the cell and apoptosis.
Mitochondrial DNA repair and aging
International Nuclear Information System (INIS)
Mandavilli, Bhaskar S.; Santos, Janine H.; Van Houten, Bennett
2002-01-01
The mitochondrial electron transport chain plays an important role in energy production in aerobic organisms and is also a significant source of reactive oxygen species that damage DNA, RNA and proteins in the cell. Oxidative damage to the mitochondrial DNA is implicated in various degenerative diseases, cancer and aging. The importance of mitochondrial ROS in age-related degenerative diseases is further strengthened by studies using animal models, Caenorhabditis elegans, Drosophila and yeast. Research in the last several years shows that mitochondrial DNA is more susceptible to various carcinogens and ROS when compared to nuclear DNA. DNA damage in mammalian mitochondria is repaired by base excision repair (BER). Studies have shown that mitochondria contain all the enzymes required for BER. Mitochondrial DNA damage, if not repaired, leads to disruption of electron transport chain and production of more ROS. This vicious cycle of ROS production and mtDNA damage ultimately leads to energy depletion in the cell and apoptosis
International Nuclear Information System (INIS)
Claesson-Welsh, L.; Eriksson, A.; Moren, A.; Severinsson, L.; Ek, B.; Ostman, A.; Betsholtz, C.; Heldin, C.H.
1988-01-01
The structure of the human receptor for platelet-derived growth factor (PDGF) has been deduced through cDNA cloning. A 5.45-kilobase-pair cDNA clone predicts a 1,106-amino-acid polypeptide, including the cleavable signal sequence. The overall amino acid sequence similarity with the murine PDGFR receptor is 85%. After transcription of the cDNA and translation in vitro, a PDGR receptor antiserum was used to immunoprecipitate a product of predicted size, which also could be phosphorylated in vitro. Stable introduction of the cDNA into Chinese hamster ovary (CHO) cells led to the expression of a 190-kilodalton component, which was immunoprecipitated by the PDGF receptor antiserum; this most probably represents the mature PDGF receptor. Binding assays with different /sup 125/I-labeled dimeric forms of PDGF A and B chains showed that the PDGFR receptor expressed in CHO cells bound PDGF-BB and, to a lesser extent, PDGF-AB, but not PDGF-AA
Eron, Joseph J.; Gorczyca, Paul; Kaplan, Joan C.; D'Aquila, Richard T.
1992-04-01
Polymerase chain reaction (PCR) DNA quantitation (PDQ) susceptibility testing rapidly and directly measures nucleoside sensitivity of human immunodeficiency virus type 1 (HIV-1) isolates. PCR is used to quantitate the amount of HIV-1 DNA synthesized after in vitro infection of peripheral blood mononuclear cells. The relative amounts of HIV-1 DNA in cell lysates from cultures maintained at different drug concentrations reflect drug inhibition of virus replication. The results of PDQ susceptibility testing of 2- or 3-day cultures are supported by assays measuring HIV-1 p24 antigen production in supernatants of 7- or 10-day cultures. DNA sequence analyses to identify mutations in the reverse transcriptase gene that cause resistance to 3'-azido-3'-deoxythymidine also support the PDQ results. With the PDQ method, both infectivity titration and susceptibility testing can be performed on supernatants from primary cultures of peripheral blood mononuclear cells. PDQ susceptibility testing should facilitate epidemiologic studies of the clinical significance of drug-resistant HIV-1 isolates.
Strategic role of the ubiquitin-dependent segregase p97 (VCP or Cdc48) in DNA replication.
Ramadan, Kristijan; Halder, Swagata; Wiseman, Katherine; Vaz, Bruno
2017-02-01
Genome amplification (DNA synthesis) is one of the most demanding cellular processes in all proliferative cells. The DNA replication machinery (also known as the replisome) orchestrates genome amplification during S-phase of the cell cycle. Genetic material is particularly vulnerable to various events that can challenge the replisome during its assembly, activation (firing), progression (elongation) and disassembly from chromatin (termination). Any disturbance of the replisome leads to stalling of the DNA replication fork and firing of dormant replication origins, a process known as DNA replication stress. DNA replication stress is considered to be one of the main causes of sporadic cancers and other pathologies related to tissue degeneration and ageing. The mechanisms of replisome assembly and elongation during DNA synthesis are well understood. However, once DNA synthesis is complete, the process of replisome disassembly, and its removal from chromatin, remains unclear. In recent years, a growing body of evidence has alluded to a central role in replisome regulation for the ubiquitin-dependent protein segregase p97, also known as valosin-containing protein (VCP) in metazoans and Cdc48 in lower eukaryotes. By orchestrating the spatiotemporal turnover of the replisome, p97 plays an essential role in DNA replication. In this review, we will summarise our current knowledge about how p97 controls the replisome from replication initiation, to elongation and finally termination. We will also further examine the more recent findings concerning the role of p97 and how mutations in p97 cofactors, also known as adaptors, cause DNA replication stress induced genomic instability that leads to cancer and accelerated ageing. To our knowledge, this is the first comprehensive review concerning the mechanisms involved in the regulation of DNA replication by p97.
Elongational viscosity of photo-oxidated LDPE
Rolón-Garrido, Víctor H.; Wagner, Manfred H.
2014-05-01
Sheets of low-density polyethylene (LDPE) were photo-oxidatively treated at room temperature, and subsequently characterized rheologically in the melt state by shear and uniaxial extensional experiments. For photo-oxidation, a xenon lamp was used to irradiate the samples for times between 1 day and 6 weeks. Linear-viscoelastic characterization was performed in a temperature range of 130 to 220°C to obtain the master curve at 170°C, the reference temperature at which the elongational viscosities were measured. Linear viscoelasticity is increasingly affected by increasing photo-oxidation due to crosslinking of LDPE, as corroborated by an increasing gel fraction as determined by a solvent extraction method. The elongational measurements reveal a strong enhancement of strain hardening until a saturation level is achieved. The elongational data are analyzed in the frame work of two constitutive equations, the rubber-like liquid and the molecular stress function models. Within the experimental window, timedeformation separability is confirmed for all samples, independent of the degree of photo-oxidation.
Superimposed Code Theoretic Analysis of Deoxyribonucleic Acid (DNA) Codes and DNA Computing
2010-01-01
DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research addresses how the...Acid dsDNA double stranded DNA MOSAIC Mobile Stream Processing Cluster PCR Polymerase Chain Reaction RAM Random Access Memory ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ...are 5′→3′ and strands with strikethrough are 3′→5′. A dsDNA duplex formed between a strand and its reverse complement is called a
DNA electrophoresis through microlithographic arrays
International Nuclear Information System (INIS)
Sevick, E.M.; Williams, D.R.M.
1996-01-01
Electrophoresis is one of the most widely used techniques in biochemistry and genetics for size-separating charged molecular chains such as DNA or synthetic polyelectrolytes. The separation is achieved by driving the chains through a gel with an external electric field. As a result of the field and the obstacles that the medium provides, the chains have different mobilities and are physically separated after a given process time. The macroscopically observed mobility scales inversely with chain size: small molecules move through the medium quickly while larger molecules move more slowly. However, electrophoresis remains a tool that has yet to be optimised for most efficient size separation of polyelectrolytes, particularly large polyelectrolytes, e.g. DNA in excess of 30-50 kbp. Microlithographic arrays etched with an ordered pattern of obstacles provide an attractive alternative to gel media and provide wider avenues for size separation of polyelectrolytes and promote a better understanding of the separation process. Its advantages over gels are (1) the ordered array is durable and can be re-used, (2) the array morphology is ordered and can be standardized for specific separation, and (3) calibration with a marker polyelectrolyte is not required as the array is reproduced to high precision. Most importantly, the array geometry can be graduated along the chip so as to expand the size-dependent regime over larger chain lengths and postpone saturation. In order to predict the effect of obstacles upon the chain-length dependence in mobility and hence, size separation, we study the dynamics of single chains using theory and simulation. We present recent work describing: 1) the release kinetics of a single DNA molecule hooked around a point, frictionless obstacle and in both weak and strong field limits, 2) the mobility of a chain impinging upon point obstacles in an ordered array of obstacles, demonstrating the wide range of interactions possible between the chain and
Diender, M.; Stams, A.J.M.; Machado de Sousa, D.Z.
2016-01-01
Background
Synthesis gas, a mixture of CO, H2, and CO2, is a promising renewable feedstock for bio-based production of organic chemicals. Production of medium-chain fatty acids can be performed via chain elongation, utilizing acetate and ethanol as main substrates. Acetate and ethanol are main
Bilateral elongated styloid process: Its anatomical, embryological and clinical implications
Bagoji Ishwar B, Hadimani Gavishiddappa A, Patil Balasaheb G, Bannur Balappa M,Ambadasu B
2013-01-01
The styloid process is a slender, elongated, cylindrical bony projection from temporal bone. It normally varies in length from 2 cm to 3 cm. During a routine demonstration of skull for MBBS students we found the bilateral elongated styloid process in dry human skull. The length of elongation measured on the right and left side was 6.0 & 5.9 cms respectively. Such abnormal elongation of the styloid process may cause compression on a number of vital vessels and nerves related to it, producing i...
The fork and the kinase: a DNA replication tale from a CHK1 perspective.
González Besteiro, Marina A; Gottifredi, Vanesa
2015-01-01
Replication fork progression is being continuously hampered by exogenously introduced and naturally occurring DNA lesions and other physical obstacles. Checkpoint kinase 1 (Chk1) is activated at replication forks that encounter damaged DNA. Subsequently, Chk1 inhibits the initiation of new replication factories and stimulates the firing of dormant origins (those in the vicinity of stalled forks). Chk1 also avoids fork collapse into DSBs (double strand breaks) and promotes fork elongation. At the molecular level, the current model considers stalled forks as the site of Chk1 activation and the nucleoplasm as the location where Chk1 phosphorylates target proteins. This model certainly serves to explain how Chk1 modulates origin firing, but how Chk1 controls the fate of stalled forks is less clear. Interestingly, recent reports demonstrating that Chk1 phosphorylates chromatin-bound proteins and even holds kinase-independent functions might shed light on how Chk1 contributes to the elongation of damaged DNA. Indeed, such findings have unveiled a puzzling connection between Chk1 and DNA lesion bypass, which might be central to promoting fork elongation and checkpoint attenuation. In summary, Chk1 is a multifaceted and versatile signaling factor that acts at ongoing forks and replication origins to determine the extent and quality of the cellular response to replication stress. Copyright © 2014 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Safford, R.; de Silva, J.; Lucas, C.
1987-01-01
Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH
Uniaxial Elongational viscosity of bidisperse polystyrene melts
DEFF Research Database (Denmark)
Nielsen, Jens Kromann; Rasmussen, Henrik K.; Hassager, Ole
2006-01-01
The startup and steady uniaxial elongational viscosity have been measured for three bidisperse polystyrene (PS) melts, consisting of blends of monodisperse PS with molecular weights of 52 kg/mole or 103 kg/mole and 390 kg/mole. The bidisperse melts have a maximum in the steady elongational...... viscosity, of up to a factor of 7 times the Trouton limit of 3 times the zero-shear viscosity....
Using dynamic input allocation for elongation control at FTU
International Nuclear Information System (INIS)
Boncagni, L.; Galeani, S.; Granucci, G.; Varano, G.; Vitale, V.; Zaccarian, L.
2010-01-01
In this paper we exploit the dynamic allocation scheme for input redundant control systems proposed in to achieve elongation control on FTU (Frascati Tokamak Upgrade). The scheme first serves as a means for regulating the current in the F coils. Then, due to the quasi-static relationship between the plasma elongation and the F coils current, elongation control is achieved by suitably generalizing the allocation scheme. Both simulation and experimental results are reported.
Cai, Wei; Xie, Shunbi; Zhang, Jin; Tang, Dianyong; Tang, Ying
2017-12-15
In this work, an electrochemical impedance biosensor for high sensitive detection of Hg 2+ was presented by coupling with Hg 2+ -induced activation of Mg 2+ -specific DNAzyme (Mg 2+ -DNAzyme) for target cycling and hybridization chain reaction (HCR) assembled DNA hydrogel for signal amplification. Firstly, we synthesized two different copolymer chains P1 and P2 by modifying hairpin DNA H3 and H4 with acrylamide polymer, respectively. Subsequently, Hg 2+ was served as trigger to activate the Mg 2+ -DNAzyme for selectively cleavage ribonucleobase-modified substrate in the presence of Mg 2+ . The partial substrate strand could dissociate from DNAzyme structure, and hybridize with capture probe H1 to expose its concealed sequence for further hybridization. With the help of the exposed sequence, the HCR between hairpin DNA H3 and H4 in P1 and P2 was initiated, and assembled a layer of DNA cross-linked hydrogel on the electrode surface. The formed non-conductive DNA hydrogel film could greatly hinder the interfacial electronic transfer which provided a possibility for us to construct a high sensitive impedance biosensor for Hg 2+ detection. Under the optimal conditions, the impedance biosensor showed an excellent sensitivity and selectivity toward Hg 2+ in a concentration range of 0.1pM - 10nM with a detection limit of 0.042pM Moreover, the real sample analysis reveal that the proposed biosensor is capable of discriminating Hg 2+ ions in reliable and quantitative manners, indicating this method has a promising potential for preliminary application in routine tests. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Santosh, Mogurampelly; Maiti, Prabal K
2009-01-01
When pulled along the axis, double-strand DNA undergoes a large conformational change and elongates by roughly twice its initial contour length at a pulling force of about 70 pN. The transition to this highly overstretched form of DNA is very cooperative. Applying a force perpendicular to the DNA axis (unzipping), double-strand DNA can also be separated into two single-stranded DNA, this being a fundamental process in DNA replication. We study the DNA overstretching and unzipping transition using fully atomistic molecular dynamics (MD) simulations and argue that the conformational changes of double-strand DNA associated with either of the above mentioned processes can be viewed as force induced DNA melting. As the force at one end of the DNA is increased the DNA starts melting abruptly/smoothly above a critical force depending on the pulling direction. The critical force f m , at which DNA melts completely decreases as the temperature of the system is increased. The melting force in the case of unzipping is smaller compared to the melting force when the DNA is pulled along the helical axis. In the case of melting through unzipping, the double-strand separation has jumps which correspond to the different energy minima arising due to sequence of different base pairs. The fraction of Watson-Crick base pair hydrogen bond breaking as a function of force does not show smooth and continuous behavior and consists of plateaus followed by sharp jumps.
Measurement and analysis of pressure tube elongation in the Douglas Point reactor
International Nuclear Information System (INIS)
Causey, A.R.; MacEwan, S.R.; Jamieson, H.C.; Mitchell, A.B.
1980-02-01
Elongations of zirconium alloy pressure tubes in CANDU reactors, which occur as a result of neutron-irradiation-induced creep and growth, have been measured over the past 6 years, and the consequences of thses elongations have recently been analysed. Elongation rates, previously deduced from extensive measurements of elongations of cold-worked Zircaloy-2 pressure tubes in the Pickering reactors, have been modified to apply to the pressure tubes in the Douglas Point (DP) reactor by taking into account measured diffences in texture and dislocation density. Using these elongation rates, and structural data unique to the DP reactor, the analysis predicts elongation behaviour which is in good agreement with pressure tube elongations measured during the ten years of reactor operation. (Auth)
Kiss, S; Zsikla, V; Frank, A; Willi, N; Cathomas, G
2016-04-01
Helicobacter-negative gastritis has been increasingly reported. Molecular techniques as the polymerase chain reaction (PCR) may detect bacterial DNA in histologically negative gastritis. To evaluate of Helicobacter PCR in gastric biopsies for the daily diagnostics of Helicobacter-negative gastritis. Over a 5-year period, routine biopsies with chronic gastritis reminiscent of Helicobacter infection, but negative by histology, were tested by using a H. pylori specific PCR. Subsequently, PCR-negative samples were re-evaluated using PCR for other Helicobacter species. Of the 9184 gastric biopsies, 339 (3.7%) with histological-negative gastritis and adequate material were forwarded to PCR analysis for H. pylori and 146 (43.1%) revealed a positive result. In 193 H. pylori DNA-negative biopsies, re-analysis using PCR primers for other Helicobacter species, revealed further 23 (11.9%) positive biopsies, including 4 (2.1%) biopsies with H. heilmannii sensu lato. PCR-positive biopsies showed a higher overall inflammatory score, more lymphoid follicles/aggregates and neutrophils (P gastritis. © 2016 John Wiley & Sons Ltd.
Discrete breathers dynamic in a model for DNA chain with a finite stacking enthalpy
Gninzanlong, Carlos Lawrence; Ndjomatchoua, Frank Thomas; Tchawoua, Clément
2018-04-01
The nonlinear dynamics of a homogeneous DNA chain based on site-dependent finite stacking and pairing enthalpies is studied. A new variant of extended discrete nonlinear Schrödinger equation describing the dynamics of modulated wave is derived. The regions of discrete modulational instability of plane carrier waves are studied, and it appears that these zones depend strongly on the phonon frequency of Fourier's mode. The staggered/unstaggered discrete breather (SDB/USDB) is obtained straightforwardly without the staggering transformation, and it is demonstrated that SDBs are less unstable than USDB. The instability of discrete multi-humped SDB/USDB solution does not depend on the number of peaks of the discrete breather (DB). By using the concept of Peierls-Nabarro energy barrier, it appears that the low-frequency DBs are more mobile.
Andersen, Stephen J; Candry, Pieter; Basadre, Thais; Khor, Way Cern; Roume, Hugo; Hernandez-Sanabria, Emma; Coma, Marta; Rabaey, Korneel
2015-01-01
Volatile fatty acids (VFA) are building blocks for the chemical industry. Sustainable, biological production is constrained by production and recovery costs, including the need for intensive pH correction. Membrane electrolysis has been developed as an in situ extraction technology tailored to the direct recovery of VFA from fermentation while stabilizing acidogenesis without caustic addition. A current applied across an anion exchange membrane reduces the fermentation broth (catholyte, water reduction: H2O + e(-) → ½ H2 + OH(-)) and drives carboxylate ions into a clean, concentrated VFA stream (anolyte, water oxidation: H2O → 2e(-) + 2 H(+) + O2). In this study, we fermented thin stillage to generate a mixed VFA extract without chemical pH control. Membrane electrolysis (0.1 A, 3.22 ± 0.60 V) extracted 28 ± 6 % of carboxylates generated per day (on a carbon basis) and completely replaced caustic control of pH, with no impact on the total carboxylate production amount or rate. Hydrogen generated from the applied current shifted the fermentation outcome from predominantly C2 and C3 VFA (64 ± 3 % of the total VFA present in the control) to majority of C4 to C6 (70 ± 12 % in the experiment), with identical proportions in the VFA acid extract. A strain related to Megasphaera elsdenii (maximum abundance of 57 %), a bacteria capable of producing mid-chain VFA at a high rate, was enriched by the applied current, alongside a stable community of Lactobacillus spp. (10 %), enabling chain elongation of VFA through lactic acid. A conversion of 30 ± 5 % VFA produced per sCOD fed (60 ± 10 % of the reactive fraction) was achieved, with a 50 ± 6 % reduction in suspended solids likely by electro-coagulation. VFA can be extracted directly from a fermentation broth by membrane electrolysis. The electrolytic water reduction products are utilized in the fermentation: OH(-) is used for pH control without added chemicals, and H2 is
Nuclear starburst activity induced by elongated bulges in spiral galaxies
Kim, Eunbin; Kim, Sungsoo S.; Choi, Yun-Young; Lee, Gwang-Ho; de Grijs, Richard; Lee, Myung Gyoon; Hwang, Ho Seong
2018-06-01
We study the effects of bulge elongation on the star formation activity in the centres of spiral galaxies using the data from the Sloan Digital Sky Survey Data Release 7. We construct a volume-limited sample of face-on spiral galaxies with Mr nuclear starbursts using the fibre specific star formation rates derived from the SDSS spectra. We find a statistically significant correlation between bulge elongation and nuclear starbursts in the sense that the fraction of nuclear starbursts increases with bulge elongation. This correlation is more prominent for fainter and redder galaxies, which exhibit higher ratios of elongated bulges. We find no significant environmental dependence of the correlation between bulge elongation and nuclear starbursts. These results suggest that non-axisymmetric bulges can efficiently feed the gas into the centre of galaxies to trigger nuclear starburst activity.
Diversity Analysis of the Immunoglobulin M Heavy Chain Gene in ...
African Journals Online (AJOL)
A full-length cDNA encoding the immunoglobulin (IgM) heavy chain gene of Nile tilapia was successfully cloned using the 5' and 3' RACE techniques. The complete cDNA of the Nile tilapia IgM heavy chain gene is 1,921 bp in length and has an open reading frame (ORF) of 1,740 bp, which corresponds to 580 amino acid ...
Energy Technology Data Exchange (ETDEWEB)
Riabchenko, N I
1979-01-01
Consideration is given to the effects of ionizing radiation on the structure of DNA. Physical and chemical methods of determining radiation damage to the primary (polynucleotide chain and nitrogenous base) and secondary (helical) structure of DNA are discussed, and the effects of ionizing radiation on deoxyribonucleoprotein complexes are considered. The radiolysis of DNA in vitro and in bacterial and mammalian cells is examined and cellular mechanisms for the repair of radiation-damaged DNA are considered, taking into account single-strand and double-strand breaks, gamma-radiation damage and deoxyribonucleoprotein-membrane complex damage. Postradiation DNA degradation in bacteria and lymphatic cells is also discussed.
Kobayashi, Kaori; Guilliam, Thomas A; Tsuda, Masataka; Yamamoto, Junpei; Bailey, Laura J; Iwai, Shigenori; Takeda, Shunichi; Doherty, Aidan J; Hirota, Kouji
2016-08-02
PrimPol is a DNA damage tolerance enzyme possessing both translesion synthesis (TLS) and primase activities. To uncover its potential role in TLS-mediated IgVλ hypermutation and define its interplay with other TLS polymerases, PrimPol(-/-) and PrimPol(-/-)/Polη(-/-)/Polζ (-/-) gene knockouts were generated in avian cells. Loss of PrimPol had no significant impact on the rate of hypermutation or the mutation spectrum of IgVλ. However, PrimPol(-/-) cells were sensitive to methylmethane sulfonate, suggesting that it may bypass abasic sites at the IgVλ segment by repriming DNA synthesis downstream of these sites. PrimPol(-/-) cells were also sensitive to cisplatin and hydroxyurea, indicating that it assists in maintaining / restarting replication at a variety of lesions. To accurately measure the relative contribution of the TLS and primase activities, we examined DNA damage sensitivity in PrimPol(-/-) cells complemented with polymerase or primase-deficient PrimPol. Polymerase-defective, but not primase-deficient, PrimPol suppresses the hypersensitivity of PrimPol(-/-) cells. This indicates that its primase, rather than TLS activity, is pivotal for DNA damage tolerance. Loss of TLS polymerases, Polη and Polζ has an additive effect on the sensitivity of PrimPol(-/-) cells. Moreover, we found that PrimPol and Polη-Polζ redundantly prevented cell death and facilitated unperturbed cell cycle progression. PrimPol(-/-) cells also exhibited increased sensitivity to a wide variety of chain-terminating nucleoside analogs (CTNAs). PrimPol could perform close-coupled repriming downstream of CTNAs and oxidative damage in vitro. Together, these results indicate that PrimPol's repriming activity plays a central role in reinitiating replication downstream from CTNAs and other specific DNA lesions.
Scatter factor corrections for elongated fields
International Nuclear Information System (INIS)
Higgins, P.D.; Sohn, W.H.; Sibata, C.H.; McCarthy, W.A.
1989-01-01
Measurements have been made to determine scatter factor corrections for elongated fields of Cobalt-60 and for nominal linear accelerator energies of 6 MV (Siemens Mevatron 67) and 18 MV (AECL Therac 20). It was found that for every energy the collimator scatter factor varies by 2% or more as the field length-to-width ratio increases beyond 3:1. The phantom scatter factor is independent of which collimator pair is elongated at these energies. For 18 MV photons it was found that the collimator scatter factor is complicated by field-size-dependent backscatter into the beam monitor
Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.
Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki
2011-11-04
A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
FtsZ-Dependent Elongation of a Coccoid Bacterium
Directory of Open Access Journals (Sweden)
Ana R. Pereira
2016-09-01
Full Text Available A mechanistic understanding of the determination and maintenance of the simplest bacterial cell shape, a sphere, remains elusive compared with that of more complex shapes. Cocci seem to lack a dedicated elongation machinery, and a spherical shape has been considered an evolutionary dead-end morphology, as a transition from a spherical to a rod-like shape has never been observed in bacteria. Here we show that a Staphylococcus aureus mutant (M5 expressing the ftsZG193D allele exhibits elongated cells. Molecular dynamics simulations and in vitro studies indicate that FtsZG193D filaments are more twisted and shorter than wild-type filaments. In vivo, M5 cell wall deposition is initiated asymmetrically, only on one side of the cell, and progresses into a helical pattern rather than into a constricting ring as in wild-type cells. This helical pattern of wall insertion leads to elongation, as in rod-shaped cells. Thus, structural flexibility of FtsZ filaments can result in an FtsZ-dependent mechanism for generating elongated cells from cocci.
Influence of Gradual Elongation to the Patella Tendon Insertion in Rabbits
Directory of Open Access Journals (Sweden)
Hirotaka Mutsuzaki
2014-08-01
Full Text Available The purpose of this study was to examine the histological changes at the patella tendon (PT insertion site under gradual elongation in rabbits. Gradual elongation of the PT was performed using external fixation for 4 weeks, with a lengthening speed of 0.5 mm/day (elongation group; n = 24. Rabbits in the sham group underwent the same surgical procedure without gradual elongation (sham group; n = 24. Eight animals were sacrificed 1, 2 and 4 weeks after surgery in each group, respectively. Average thicknesses of stained glycosaminoglycan (GAGs areas by Safranin-O staining in the total cartilage layer and the uncalcified fibrocartilage layer in the elongation group were significantly higher than that in the sham group at 4 weeks (p < 0.05 and that in the intact PT group (n = 6, p < 0.05. In the elongation group, the peak in the average thicknesses of the stained GAGs areas in the total cartilage layer and the uncalcified fibrocartilage layer were observed at 4 weeks. Gradual elongation of PT insertion significantly affected the increase in the average thicknesses of the stained GAGs areas in the cartilage layer especially in the uncalcified fibrocartilage layer at 4 weeks in rabbits. Clinically, insertions of tendon and ligament can extend during gradual elongation using external fixation more than 4 weeks after the operation.
Tree-shoot elongation patterns in a gamma-irradiated northern forest community
International Nuclear Information System (INIS)
Buech, R.R.; Salmonson, B.J.
1977-01-01
Shoot elongation in the upper crowns of seven tree species was studied in a gamma-irradiated northern forest community near Rhinelander, Wis. Observations on the pattern and duration of shoot elongation are presented for the irradiation (1972) and postirradiation (1973) growing seasons. The gymnosperm Abies balsamea was the most radiosensitive species. Significant alteration in pattern and duration was observed in 1973 at exposure rates of 4 to 25 r/20-hr day; 31 r/20-hr day was lethal. At the other extreme, 116 r/20-hr day produced no significant effects on Acer saccharum shoot elongation pattern or duration. Acer rubrum, Betula papyrifera, Populus tremuloides, Quercus rubra, and Tilia americana were intermediate in radiosensitivity. Observed responses to radiation were alteration in the elongation pattern, suppression of internodal elongation, and death. Effects of the 1972 growing-season exposure were most obvious in the subsequent growing seasons. Retardation of initial elongation was characteristic of all species. Cessation of elongation was variable, even within species (e.g., P. tremuloides). The results suggest that bud differentiation and morphology and dependency on food reserves contributed to the lag in manifestation of radiation damage. The resultant crown characteristics are described and explained
Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription
Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.
2016-01-01
Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002
A Micro Polymerase Chain Reaction Module for Integrated and Portable DNA Analysis Systems
Directory of Open Access Journals (Sweden)
Elisa Morganti
2011-01-01
Full Text Available This work deals with the design, fabrication, and thermal characterization of a disposable miniaturized Polymerase Chain Reaction (PCR module that will be integrated in a portable and fast DNA analysis system. It is composed of two independent parts: a silicon substrate with embedded heater and thermometers and a PDMS (PolyDiMethylSiloxane chamber reactor as disposable element; the contact between the two parts is assured by a mechanical clamping obtained using a Plastic Leaded Chip Carrier (PLCC. This PLCC is also useful, avoid the PCR mix evaporation during the thermal cycles. Finite Element Analysis was used to evaluate the thermal requirements of the device. The thermal behaviour of the device was characterized revealing that the temperature can be controlled with a precision of ±0.5°C. Different concentrations of carbon nanopowder were mixed to the PDMS curing agent in order to increase the PDMS thermal conductivity and so the temperature control accuracy.
Photocleavage of DNA: irradiation of quinone-containing reagents converts supercoiled to linear DNA
International Nuclear Information System (INIS)
Kock, T.; Schuster, G.B.; Ropp, J.D.; Sligar, S.G.
1993-01-01
Irradiation (350 nm) of air-saturated solutions of reagents containing an anthraquinone group linked to quaternary alkyl ammonium groups converts supercoiled DNA to circular and to linear DNA. Generation of linear DNA does not occur by accumulation of numerous single-strand cuts but by coincident-site double-strand cleavage of DNA. Irradiation forms the triplet state of the anthraquinone, which reacts either by hydrogen atom abstraction from a sugar of DNA or by electron transfer from a base of the DNA. Subsequent reactions result in chain scission. The quinone is apparently reformed after this sequence and reirradiation leads to double-strand cleavage. (Author)
Oates, A C; Wollberg, P; Achen, M G; Wilks, A F
1998-08-28
The polymerase chain reaction (PCR), with cDNA as template, has been widely used to identify members of protein families from many species. A major limitation of using cDNA in PCR is that detection of a family member is dependent on temporal and spatial patterns of gene expression. To circumvent this restriction, and in order to develop a technique that is broadly applicable we have tested the use of genomic DNA as PCR template to identify members of protein families in an expression-independent manner. This test involved amplification of DNA encoding protein tyrosine kinase (PTK) genes from the genomes of three animal species that are well known development models; namely, the mouse Mus musculus, the fruit fly Drosophila melanogaster, and the nematode worm Caenorhabditis elegans. Ten PTK genes were identified from the mouse, 13 from the fruit fly, and 13 from the nematode worm. Among these kinases were 13 members of the PTK family that had not been reported previously. Selected PTKs from this screen were shown to be expressed during development, demonstrating that the amplified fragments did not arise from pseudogenes. This approach will be useful for the identification of many novel members of gene families in organisms of agricultural, medical, developmental and evolutionary significance and for analysis of gene families from any species, or biological sample whose habitat precludes the isolation of mRNA. Furthermore, as a tool to hasten the discovery of members of gene families that are of particular interest, this method offers an opportunity to sample the genome for new members irrespective of their expression pattern.
Cloning and characterization of the complementary DNA for the B chain of normal human serum C1q.
Reid, K B; Bentley, D R; Wood, K J
1984-09-06
Normal human C1q is a serum glycoprotein of 460 kDa containing 18 polypeptide chains (6A, 6B, 6C) each 226 amino acids long and each containing an N-terminal collagen-like domain and a C-terminal globular domain. Two unusual forms of C1q have been described: a genetically defective form, which has a molecular mass of approximately 160 kDa and is found in the sera of homozygotes for the defect who show a marked susceptibility to immune complex related disease; a fibroblast form, shown to be synthesized and secreted, in vitro, with a molecular mass of about 800 kDa and with chains approximately 16 kDa greater than those of normal C1q. A higher than normal molecular mass form of C1q has also been described in human colostrum and a form of C1q has been claimed to represent one of the types of Fc receptor on guinea-pig macrophages. To initiate studies, at the genomic level, on these various forms of C1q, and to investigate the possible relation between the C1q genes and the procollagen genes, the complementary DNA corresponding to the B chain of normal C1q has been cloned and characterized.
DEFF Research Database (Denmark)
Andresen, B S; Bross, P; Vianey-Saban, C
1996-01-01
Very-long-chain acyl-CoA dehydrogenase (VLCAD) is one of four straight-chain acyl-CoA dehydrogenase (ACD) enzymes, which are all nuclear encoded mitochondrial flavoproteins catalyzing the initial step in fatty acid beta-oxidation. We have used the very fast, Rapid Amplification of cDNA Ends (RACE...
Twist-writhe partitioning in a coarse-grained DNA minicircle model
Sayar, Mehmet; Avşaroǧlu, Barış; Kabakçıoǧlu, Alkan
2010-04-01
Here we present a systematic study of supercoil formation in DNA minicircles under varying linking number by using molecular-dynamics simulations of a two-bead coarse-grained model. Our model is designed with the purpose of simulating long chains without sacrificing the characteristic structural properties of the DNA molecule, such as its helicity, backbone directionality, and the presence of major and minor grooves. The model parameters are extracted directly from full-atomistic simulations of DNA oligomers via Boltzmann inversion; therefore, our results can be interpreted as an extrapolation of those simulations to presently inaccessible chain lengths and simulation times. Using this model, we measure the twist/writhe partitioning in DNA minicircles, in particular its dependence on the chain length and excess linking number. We observe an asymmetric supercoiling transition consistent with experiments. Our results suggest that the fraction of the linking number absorbed as twist and writhe is nontrivially dependent on chain length and excess linking number. Beyond the supercoiling transition, chains of the order of one persistence length carry equal amounts of twist and writhe. For longer chains, an increasing fraction of the linking number is absorbed by the writhe.
Twisting short dsDNA with applied tension
Zoli, Marco
2018-02-01
The twisting deformation of mechanically stretched DNA molecules is studied by a coarse grained Hamiltonian model incorporating the fundamental interactions that stabilize the double helix and accounting for the radial and angular base pair fluctuations. The latter are all the more important at short length scales in which DNA fragments maintain an intrinsic flexibility. The presented computational method simulates a broad ensemble of possible molecule conformations characterized by a specific average twist and determines the energetically most convenient helical twist by free energy minimization. As this is done for any external load, the method yields the characteristic twist-stretch profile of the molecule and also computes the changes in the macroscopic helix parameters i.e. average diameter and rise distance. It is predicted that short molecules under stretching should first over-twist and then untwist by increasing the external load. Moreover, applying a constant load and simulating a torsional strain which over-twists the helix, it is found that the average helix diameter shrinks while the molecule elongates, in agreement with the experimental trend observed in kilo-base long sequences. The quantitative relation between percent relative elongation and superhelical density at fixed load is derived. The proposed theoretical model and computational method offer a general approach to characterize specific DNA fragments and predict their macroscopic elastic response as a function of the effective potential parameters of the mesoscopic Hamiltonian.
Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa
2016-07-26
DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.
Development of a mixed culture chain elongation process based on municipal solid waste and ethanol
Grootscholten, T.I.M.
2013-01-01
Keywords: mixed culture fermentation; Carboxylates; Caproate; Heptanoate; ethanol; OFMSW
To reduce dependence on oil, alternative fuel and chemical production processes are investigates. In this thesis, we investigated the production of medium chain fatty acids (MCFAs) using an anaerobic
Evolution and Allometry of Calcaneal Elongation in Living and Extinct Primates
Boyer, Doug M.; Seiffert, Erik R.; Gladman, Justin T.; Bloch, Jonathan I.
2013-01-01
Specialized acrobatic leaping has been recognized as a key adaptive trait tied to the origin and subsequent radiation of euprimates based on its observed frequency in extant primates and inferred frequency in extinct early euprimates. Hypothesized skeletal correlates include elongated tarsal elements, which would be expected to aid leaping by allowing for increased rates and durations of propulsive acceleration at takeoff. Alternatively, authors of a recent study argued that pronounced distal calcaneal elongation of euprimates (compared to other mammalian taxa) was related primarily to specialized pedal grasping. Testing for correlations between calcaneal elongation and leaping versus grasping is complicated by body size differences and associated allometric affects. We re-assess allometric constraints on, and the functional significance of, calcaneal elongation using phylogenetic comparative methods, and present an evolutionary hypothesis for the evolution of calcaneal elongation in primates using a Bayesian approach to ancestral state reconstruction (ASR). Results show that among all primates, logged ratios of distal calcaneal length to total calcaneal length are inversely correlated with logged body mass proxies derived from the area of the calcaneal facet for the cuboid. Results from phylogenetic ANOVA on residuals from this allometric line suggest that deviations are explained by degree of leaping specialization in prosimians, but not anthropoids. Results from ASR suggest that non-allometric increases in calcaneal elongation began in the primate stem lineage and continued independently in haplorhines and strepsirrhines. Anthropoid and lorisid lineages show stasis and decreasing elongation, respectively. Initial increases in calcaneal elongation in primate evolution may be related to either development of hallucal-grasping or a combination of grasping and more specialized leaping behaviors. As has been previously suggested, subsequent increases in calcaneal
QTL analysis of internode elongation in response to gibberellin in deepwater rice
Nagai, Keisuke; Kondo, Yuma; Kitaoka, Takuya; Noda, Tomonori; Kuroha, Takeshi; Angeles-Shim, Rosalyn B.; Yasui, Hideshi; Yoshimura, Atsushi; Ashikari, Motoyuki
2014-01-01
Gibberellin (GA) is a plant hormone that has important roles in numerous plant developmental phases. Rice plants known as deepwater rice respond to flooding by elongating their internodes to avoid anoxia. Previous studies reported that GA is essential for internode elongation in deepwater rice. Quantitative trait locus (QTL) analyses identified QTLs regulating internode elongation in response to deepwater conditions. However, the interaction between internode elongation and regulators of GA s...
Linear ubiquitin chain induces apoptosis and inhibits tumor growth.
Qin, Zhoushuai; Jiang, Wandong; Wang, Guifen; Sun, Ying; Xiao, Wei
2018-01-01
Ubiquitination of proliferating cell nuclear antigen (PCNA) plays an important role in DNA damage response. Ectopic expression of PCNA fused at either terminus with ubiquitin (Ub) lacking two C-terminal glycine residues induces translesion DNA synthesis which resembles synthesis mediated by PCNA monoubiquitination. PCNA fused with Ub containing the C-terminal Gly residues at the C-terminus can be further polyubiquitinated in a Gly-dependent manner, which inhibits cell proliferation and induces ATR-dependent replication checkpoint. In this study, we surprisingly found that PCNA fused to a head-to-tail linear Ub chain induces apoptosis in a Ub chain length-dependent manner. Further investigation revealed that the apoptotic effect is actually induced by the linear Ub chain independently from PCNA, as the Ub chain fused to GFP or an epitope tag still efficiently induces apoptosis. It is revealed that the artificial linear Ub chain differs from endogenously encoded linear Ub chains in that its Ubs contain a Ub-G76S substitution, making the Ub chain resistant to cleavage by deubiquitination enzymes. We demonstrated in this study that ectopic expression of the artificial Ub chain alone in cultured human cancer cells is sufficient to inhibit tumor growth in a xenograft mouse model, making the linear Ub chain a putative anti-cancer agent.
Ayano, Madoka; Kani, Takahiro; Kojima, Mikiko; Sakakibara, Hitoshi; Kitaoka, Takuya; Kuroha, Takeshi; Angeles-Shim, Rosalyn B; Kitano, Hidemi; Nagai, Keisuke; Ashikari, Motoyuki
2014-10-01
Under flooded conditions, the leaves and internodes of deepwater rice can elongate above the water surface to capture oxygen and prevent drowning. Our previous studies showed that three major quantitative trait loci (QTL) regulate deepwater-dependent internode elongation in deepwater rice. In this study, we investigated the age-dependent internode elongation in deepwater rice. We also investigated the relationship between deepwater-dependent internode elongation and the phytohormone gibberellin (GA) by physiological and genetic approach using a QTL pyramiding line (NIL-1 + 3 + 12). Deepwater rice did not show internode elongation before the sixth leaf stage under deepwater condition. Additionally, deepwater-dependent internode elongation occurred on the sixth and seventh internodes during the sixth leaf stage. These results indicate that deepwater rice could not start internode elongation until the sixth leaf stage. Ultra-performance liquid chromatography tandem mass-spectrometry (UPLC-MS/MS) method for the phytohormone contents showed a deepwater-dependent GA1 and GA4 accumulation in deepwater rice. Additionally, a GA inhibitor abolished deepwater-dependent internode elongation in deepwater rice. On the contrary, GA feeding mimicked internode elongation under ordinary growth conditions. However, mutations in GA biosynthesis and signal transduction genes blocked deepwater-dependent internode elongation. These data suggested that GA biosynthesis and signal transduction are essential for deepwater-dependent internode elongation in deepwater rice. © 2014 The Authors. Plant, Cell & Environment published by John Wiley & Sons Ltd.
The Caenorhabditis elegans Elongator complex regulates neuronal alpha-tubulin acetylation.
Directory of Open Access Journals (Sweden)
Jachen A Solinger
2010-01-01
Full Text Available Although acetylated alpha-tubulin is known to be a marker of stable microtubules in neurons, precise factors that regulate alpha-tubulin acetylation are, to date, largely unknown. Therefore, a genetic screen was employed in the nematode Caenorhabditis elegans that identified the Elongator complex as a possible regulator of alpha-tubulin acetylation. Detailed characterization of mutant animals revealed that the acetyltransferase activity of the Elongator is indeed required for correct acetylation of microtubules and for neuronal development. Moreover, the velocity of vesicles on microtubules was affected by mutations in Elongator. Elongator mutants also displayed defects in neurotransmitter levels. Furthermore, acetylation of alpha-tubulin was shown to act as a novel signal for the fine-tuning of microtubules dynamics by modulating alpha-tubulin turnover, which in turn affected neuronal shape. Given that mutations in the acetyltransferase subunit of the Elongator (Elp3 and in a scaffold subunit (Elp1 have previously been linked to human neurodegenerative diseases, namely Amyotrophic Lateral Sclerosis and Familial Dysautonomia respectively highlights the importance of this work and offers new insights to understand their etiology.
Directory of Open Access Journals (Sweden)
Barbara Dariš
2018-02-01
Full Text Available Background. To determine the relationship between sperm morphological abnormalities, DNA fragmentation and fertilization rate in IVF and ICSI. Methods. Sperm samples from 10 IVF and 20 ICSI cycles were analyzed. Morphology was assessed according to strict criteria, and DNA fragmentation was measured by terminal deoxynucleotidyl transferase (TdT-mediated fluorescein-dUTP nick end labelling (TUNEL using a flow cytometry. Results. There was a significant difference in the amount of morphological abnormalities between sperm samples with low (< 20 % and high (≥ 20 % degree of DNA fragmentation. The percentages of amorphous heads (10 vs. 4 % and overall head abnormalities (42 vs. 30 % were significantly higher in sperm samples with elevated degree of DNA fragmentation. No correlation was found between sperm DNA fragmentation and fertilization rate after IVF and ICSI. When the predominant morphological abnormality in sperm samples was determined, a negative correlation was found between the percentage of spermatozoa with elongated heads and fertilization rate in ICSI (r = –0.45, P < 0.05. The fertilization rate after IVF was lower in the case of acrosomal abnormalities (35.3 %, compared to the cases of other predominant morphological abnormalities. Conclusions. Head abnormalities, especially amorphous heads, are related to elevated degree of DNA fragmentation. Predominant abnormal form in sperm samples, such as elongated heads and acrosomal abnormalities, may affect fertilization in ART.
International Nuclear Information System (INIS)
Livneh, Z.
1986-01-01
Replication of UV-irradiated oligodeoxynucleotide-primed single-stranded phi X174 DNA with Escherichia coli DNA polymerase III holoenzyme in the presence of single-stranded DNA-binding protein was investigated. The extent of initiation of replication on the primed single-stranded DNA was not altered by the presence of UV-induced lesions in the DNA. The elongation step exhibited similar kinetics when either unirradiated or UV-irradiated templates were used. Inhibition of the 3'----5' proofreading exonucleolytic activity of the polymerase by dGMP or by a mutD mutation did not increase bypass of pyrimidine photodimers, and neither did purified RecA protein influence the extent of photodimer bypass as judged by the fraction of full length DNA synthesized. Single-stranded DNA-binding protein stimulated bypass since in its absence the fraction of full length DNA decreased 5-fold. Termination of replication at putative pyrimidine dimers involved dissociation of the polymerase from the DNA, which could then reinitiate replication at other available primer templates. Based on these observations a model for SOS-induced UV mutagenesis is proposed
Incorporation of a cationic aminopropyl chain in DNA hairpins: thermodynamics and hydration
Soto, Ana Maria; Kankia, Besik I.; Dande, Prasad; Gold, Barry; Marky, Luis A.
2001-01-01
We report on the physicochemical effects resulting from incorporating a 5-(3-aminopropyl) side chain onto a 2′-deoxyuridine (dU) residue in a short DNA hairpin. A combination of spectroscopy, calorimetry, density and ultrasound techniques were used to investigate both the helix–coil transition of a set of hairpins with the following sequence: d(GCGACTTTTTGNCGC) [N = dU, deoxythymidine (dT) or 5-(3-aminopropyl)-2′-deoxyuridine (dU*)], and the interaction of each hairpin with Mg2+. All three molecules undergo two-state transitions with melting temperatures (TM) independent of strand concentration that indicates their intramolecular hairpin formation. The unfolding of each hairpin takes place with similar TM values of 64–66°C and similar thermodynamic profiles. The unfavorable unfolding free energies of 6.4–6.9 kcal/mol result from the typical compensation of unfavorable enthalpies, 36–39 kcal/mol, and favorable entropies of ∼110 cal/mol. Furthermore, the stability of each hairpin increases as the salt concentration increases, the TM-dependence on salt yielded slopes of 2.3–2.9°C, which correspond to counterion releases of 0.53 (dU and dT) and 0.44 (dU*) moles of Na+ per mole of hairpin. Absolute volumetric and compressibility measurements reveal that all three hairpins have similar hydration levels. The electrostatic interaction of Mg2+ with each hairpin yielded binding affinities in the order: dU > dT > dU*, and a similar release of 2–4 electrostricted water molecules. The main result is that the incorporation of the cationic 3-aminopropyl side chain in the major groove of the hairpin stem neutralizes some local negative charges yielding a hairpin molecule with lower charge density. PMID:11522834
International Nuclear Information System (INIS)
Davydova, E.K.
1987-01-01
One of the proteins participating in the process of elongation of polypeptide chains - elongation factor 2 (EF-2) - can be ADP-ribosylated at a unique amino acid residue - diphthamide. Since the ADP-ribosylation of EF-2 at dipthamide leads to a loss of affinity of the factor for RNA while the presence of RNA inhibits the ADP-ribosylation reaction, it seemed probable to the authors that diphthamide participated directly in the binding of EF-2 to DNA. The experiments presented in this article showed that this was not the case: diphthamide and the RNA-binding site are situated on different domains of EF-2. Thus, ADP-ribosylation of factor EF-2 in one domain leads to a loss of the ability to bind to RNA in the other. The authors investigated the mutual arrangement of diphthamide and the RNA-binding site on the EF-2 molecule by preparing a factor from rabbit reticulocytes and subjecting it to proteolytic digestion with elastase. The factor was incubated with elastase for 15 min at 37 0 C at an enzyme:substrate ratio of 1:100 in buffer solution containing 20 mM Tris-HCl, pH 7.6, 10 mM KCl, 1 mM MgCl 2 , and 2 mM dithiothreitol. The reaction was stopped by adding para-methylsulfonyl fluoride to 50 micro-M. The authors obtained a preparation as a result of proteolysis and applied it on a column with RNA-Sepharose and separated into two fractions: RNA-binding and without affinity for RNA. The initial preparation and its fractions were subjected to exhaustive ADP-ribosylation in the presence of diphtheria toxin and [U- 14 C] nicotinaide adenine dinucleotide ([ 14 C]NAD) (296 mCi/mmole). The samples were analyzed electrophoretically in a polyacrylamide gel gradient in the presence of sodium dodecyl sulfate. For the detection of [ 14 C] ADP-ribosylated components, the gels were dried and exposed with RM-V x-ray film
Theory of high-force DNA stretching and overstretching.
Storm, C; Nelson, P C
2003-05-01
Single-molecule experiments on single- and double-stranded DNA have sparked a renewed interest in the force versus extension of polymers. The extensible freely jointed chain (FJC) model is frequently invoked to explain the observed behavior of single-stranded DNA, but this model does not satisfactorily describe recent high-force stretching data. We instead propose a model (the discrete persistent chain) that borrows features from both the FJC and the wormlike chain, and show that it resembles the data more closely. We find that most of the high-force behavior previously attributed to stretch elasticity is really a feature of the corrected entropic elasticity; the true stretch compliance of single-stranded DNA is several times smaller than that found by previous authors. Next we elaborate our model to allow coexistence of two conformational states of DNA, each with its own stretch and bend elastic constants. Our model is computationally simple and gives an excellent fit through the entire overstretching transition of nicked, double-stranded DNA. The fit gives the first value for the bend stiffness of the overstretched state. In particular, we find the effective bend stiffness for DNA in this state to be about 12 nm k(B)T, a value quite different from either the B-form or single-stranded DNA.
Mitochondrial DNA Depletion in Respiratory Chain–Deficient Parkinson Disease Neurons
Rygiel, Karolina A.; Hepplewhite, Philippa D.; Morris, Christopher M.; Picard, Martin; Turnbull, Doug M.
2016-01-01
Objective To determine the extent of respiratory chain abnormalities and investigate the contribution of mtDNA to the loss of respiratory chain complexes (CI–IV) in the substantia nigra (SN) of idiopathic Parkinson disease (IPD) patients at the single‐neuron level. Methods Multiple‐label immunofluorescence was applied to postmortem sections of 10 IPD patients and 10 controls to quantify the abundance of CI–IV subunits (NDUFB8 or NDUFA13, SDHA, UQCRC2, and COXI) and mitochondrial transcription factors (TFAM and TFB2M) relative to mitochondrial mass (porin and GRP75) in dopaminergic neurons. To assess the involvement of mtDNA in respiratory chain deficiency in IPD, SN neurons, isolated with laser‐capture microdissection, were assayed for mtDNA deletions, copy number, and presence of transcription/replication‐associated 7S DNA employing a triplex real‐time polymerase chain reaction (PCR) assay. Results Whereas mitochondrial mass was unchanged in single SN neurons from IPD patients, we observed a significant reduction in the abundances of CI and II subunits. At the single‐cell level, CI and II deficiencies were correlated in patients. The CI deficiency concomitantly occurred with low abundances of the mtDNA transcription factors TFAM and TFB2M, which also initiate transcription‐primed mtDNA replication. Consistent with this, real‐time PCR analysis revealed fewer transcription/replication‐associated mtDNA molecules and an overall reduction in mtDNA copy number in patients. This effect was more pronounced in single IPD neurons with severe CI deficiency. Interpretation Respiratory chain dysfunction in IPD neurons not only involves CI, but also extends to CII. These deficiencies are possibly a consequence of the interplay between nDNA and mtDNA‐encoded factors mechanistically connected via TFAM. ANN NEUROL 2016;79:366–378 PMID:26605748
Transition zone cells reach G2 phase before initiating elongation in maize root apex
Directory of Open Access Journals (Sweden)
M. Victoria Alarcón
2017-06-01
Full Text Available Root elongation requires cell divisions in the meristematic zone and cell elongation in the elongation zone. The boundary between dividing and elongating cells is called the transition zone. In the meristem zone, initial cells are continuously dividing, but on the basal side of the meristem cells exit the meristem through the transition zone and enter in the elongation zone, where they stop division and rapidly elongate. Throughout this journey cells are accompanied by changes in cell cycle progression. Flow cytometry analysis showed that meristematic cells are in cycle, but exit when they enter the elongation zone. In addition, the percentage of cells in G2 phase (4C strongly increased from the meristem to the elongation zone. However, we did not observe remarkable changes in the percentage of cells in cell cycle phases along the entire elongation zone. These results suggest that meristematic cells in maize root apex stop the cell cycle in G2 phase after leaving the meristem.
Adenylate cyclase regulates elongation of mammalian primary cilia
International Nuclear Information System (INIS)
Ou, Young; Ruan, Yibing; Cheng, Min; Moser, Joanna J.; Rattner, Jerome B.; Hoorn, Frans A. van der
2009-01-01
The primary cilium is a non-motile microtubule-based structure that shares many similarities with the structures of flagella and motile cilia. It is well known that the length of flagella is under stringent control, but it is not known whether this is true for primary cilia. In this study, we found that the length of primary cilia in fibroblast-like synoviocytes, either in log phase culture or in quiescent state, was confined within a range. However, when lithium was added to the culture to a final concentration of 100 mM, primary cilia of synoviocytes grew beyond this range, elongating to a length that was on average approximately 3 times the length of untreated cilia. Lithium is a drug approved for treating bipolar disorder. We dissected the molecular targets of this drug, and observed that inhibition of adenylate cyclase III (ACIII) by specific inhibitors mimicked the effects of lithium on primary cilium elongation. Inhibition of GSK-3β by four different inhibitors did not induce primary cilia elongation. ACIII was found in primary cilia of a variety of cell types, and lithium treatment of these cell types led to their cilium elongation. Further, we demonstrate that different cell types displayed distinct sensitivities to the lithium treatment. However, in all cases examined primary cilia elongated as a result of lithium treatment. In particular, two neuronal cell types, rat PC-12 adrenal medulla cells and human astrocytes, developed long primary cilia when lithium was used at or close to the therapeutic relevant concentration (1-2 mM). These results suggest that the length of primary cilia is controlled, at least in part, by the ACIII-cAMP signaling pathway.
Adenylate cyclase regulates elongation of mammalian primary cilia
Energy Technology Data Exchange (ETDEWEB)
Ou, Young; Ruan, Yibing; Cheng, Min; Moser, Joanna J. [Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Calgary, 3330 Hospital Drive NW, Calgary, Alberta, T2N 4N1 (Canada); Rattner, Jerome B. [Department of Cell Biology and Anatomy, Faculty of Medicine, University of Calgary, 3330 Hospital Drive NW, Calgary, Alberta, T2N 4N1 (Canada); Hoorn, Frans A. van der, E-mail: fvdhoorn@ucalgary.ca [Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Calgary, 3330 Hospital Drive NW, Calgary, Alberta, T2N 4N1 (Canada)
2009-10-01
The primary cilium is a non-motile microtubule-based structure that shares many similarities with the structures of flagella and motile cilia. It is well known that the length of flagella is under stringent control, but it is not known whether this is true for primary cilia. In this study, we found that the length of primary cilia in fibroblast-like synoviocytes, either in log phase culture or in quiescent state, was confined within a range. However, when lithium was added to the culture to a final concentration of 100 mM, primary cilia of synoviocytes grew beyond this range, elongating to a length that was on average approximately 3 times the length of untreated cilia. Lithium is a drug approved for treating bipolar disorder. We dissected the molecular targets of this drug, and observed that inhibition of adenylate cyclase III (ACIII) by specific inhibitors mimicked the effects of lithium on primary cilium elongation. Inhibition of GSK-3{beta} by four different inhibitors did not induce primary cilia elongation. ACIII was found in primary cilia of a variety of cell types, and lithium treatment of these cell types led to their cilium elongation. Further, we demonstrate that different cell types displayed distinct sensitivities to the lithium treatment. However, in all cases examined primary cilia elongated as a result of lithium treatment. In particular, two neuronal cell types, rat PC-12 adrenal medulla cells and human astrocytes, developed long primary cilia when lithium was used at or close to the therapeutic relevant concentration (1-2 mM). These results suggest that the length of primary cilia is controlled, at least in part, by the ACIII-cAMP signaling pathway.
Anti-DNA antibodies: Sequencing, cloning, and expression
Energy Technology Data Exchange (ETDEWEB)
Barry, M.M.
1992-01-01
To gain some insight into the mechanism of systemic lupus erythematosus, and the interactions involved in proteins binding to DNA four anti-DNA antibodies have been investigated. Two of the antibodies, Hed 10 and Jel 242, have previously been prepared from female NZB/NZW mice which develop an autoimmune disease resembling human SLE. The remaining two antibodies, Jel 72 and Jel 318, have previously been produced via immunization of C57BL/6 mice. The isotypes of the four antibodies investigated in this thesis were determined by an enzyme-linked-immunosorbent assay. All four antibodies contained [kappa] light chains and [gamma]2a heavy chains except Jel 318 which contains a [gamma]2b heavy chain. The complete variable regions of the heavy and light chains of these four antibodies were sequenced from their respective mRNAs. The gene segments and variable gene families expressed in each antibody were identified. Analysis of the genes used in the autoimmune anti-DNA antibodies and those produced by immunization indicated no obvious differences to account for their different origins. Examination of the amino acid residues present in the complementary-determining regions of these four antibodies indicates a preference for aromatic amino acids. Jel 72 and Jel 242 contain three arginine residues in the third complementary-determining region. A single-chain Fv and the variable region of the heavy chain of Hed 10 were expressed in Escherichia coli. Expression resulted in the production of a 26,000 M[sub r] protein and a 15,000 M[sub r] protein. An immunoblot indicated that the 26,000 M[sub r] protein was the Fv for Hed 10, while the 15,000 M[sub r] protein was shown to bind poly (dT). The contribution of the heavy chain to DNA binding was assessed.
Sawai, Megumi; Uchida, Yukiko; Ohno, Yusuke; Miyamoto, Masatoshi; Nishioka, Chieko; Itohara, Shigeyoshi; Sassa, Takayuki; Kihara, Akio
2017-09-15
Differences among fatty acids (FAs) in chain length and number of double bonds create lipid diversity. FA elongation proceeds via a four-step reaction cycle, in which the 3-hydroxyacyl-CoA dehydratases (HACDs) HACD1-4 catalyze the third step. However, the contribution of each HACD to 3-hydroxyacyl-CoA dehydratase activity in certain tissues or in different FA elongation pathways remains unclear. HACD1 is specifically expressed in muscles and is a myopathy-causative gene. Here, we generated Hacd1 KO mice and observed that these mice had reduced body and skeletal muscle weights. In skeletal muscle, HACD1 mRNA expression was by far the highest among the HACDs However, we observed only an ∼40% reduction in HACD activity and no changes in membrane lipid composition in Hacd1 -KO skeletal muscle, suggesting that some HACD activities are redundant. Moreover, when expressed in yeast, both HACD1 and HACD2 participated in saturated and monounsaturated FA elongation pathways. Disruption of HACD2 in the haploid human cell line HAP1 significantly reduced FA elongation activities toward both saturated and unsaturated FAs, and HACD1 HACD2 double disruption resulted in a further reduction. Overexpressed HACD3 exhibited weak activity in saturated and monounsaturated FA elongation pathways, and no activity was detected for HACD4. We therefore conclude that HACD1 and HACD2 exhibit redundant activities in a wide range of FA elongation pathways, including those for saturated to polyunsaturated FAs, with HACD2 being the major 3-hydroxyacyl-CoA dehydratase. Our findings are important for furthering the understanding of the molecular mechanisms in FA elongation and diversity. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Oostra, R. J.; van Galen, M. J.; Bolhuis, P. A.; Bleeker-Wagemakers, E. M.; van den Bogert, C.
1995-01-01
The electron transfer activity of Complex I of the respiratory chain and Complex I-linked ATP synthesis were investigated in leukocytes of four males affected by Leber hereditary optic neuropathy and a mutation in the ND6 gene at nucleotide position 14,484 of mtDNA. The electron transfer activity in
Directory of Open Access Journals (Sweden)
Tuti Susanti Legiastuti
2013-04-01
Full Text Available Yellow leaf curl disease, caused by a member of Begomovirus (Geminiviridae, is one of important diseases of chilli pepper in Indonesia. Exploration of endophytic fungi was initiated in order to find biological control agents for an alternative control strategies of this disease. Isolates of endophytic fungi were collected from chilli pepper growing area in Sleman, Yogyakarta and further identification using molecular technique involving polymerase chain reaction (PCR and DNA sequencing was performed. DNA fragments of ±500 bp were successfully amplified from 10 fungal isolates by PCR using primer pair ITS1/ITS4, but only 8 DNA sequences was obtained for further genetic analysis. Based on BLASTN analysis the endophytic fungi were identified as having the highest similarity with Pleosporaceae sp. (98% for H1 isolate, Cercospora nicotianae (100% for H5 isolate, ercospora piaropi (98% for H11 isolate, Guignardia mangiferae (99% for H16 isolate, Geomyces pannorum 95% for H17 isolate, Diaporthe phaseoloru (99% for H18 isolate, Dothideomycete sp. (100% for K3 isolate, and Alternaria longissima (99% for K10 isolate. Key words: Begomovirus, chillipepper, DNA sequencing, polymerase chain reaction
Film dosimetry of small elongated electron beams for treatment planning
International Nuclear Information System (INIS)
Niroomand-Rad, A.
1989-01-01
The characteristics of 5, 7, 10, 12, 15, and 18 Mev electron beams for small elongated fields of dimensions L x W (where L=1, 2, 3, 4, 5, and 10 cm; and W=1, 2, 3, 4, 5, and 10 cm) have been studied. Film dosimetry and parallel-plate ion chamber measurements have been used to obtain various dose parameters. Selective results of a series of systematic measurements for central axis depth dose data, uniformity index, field flatness, and relative output factors of small elongated electron beams are reported. The square-root method is employed to predict the beam data of small elongated electron fields from corresponding small square electron fields using film dosimetry. The single parameter area/perimeter radio A/P is used to characterize the relative output factors of elongated electron beams. It is our conclusion that for clinical treatment planning square-root method may be applied with caution in determining the beam characteristics of small elongated electron fields from film dosimetry. The calculated and estimated relative output factors from square-root method and A/P ratio are in good agreement and show agreement to within 1% with the measured film values
Reversibility of partial denaturation of DNA
International Nuclear Information System (INIS)
Acuna, M.I.; Mingot, F.; Davila, C.A.
1976-01-01
The recovery of hypochromicity in a partially denatured DNA sample when salt concentration is suddenly increased at a intermediate stage of the thermal transition is studied. The results of CsCl gradient analysis, PEG/DEX partition analysis, behaviour in a new thermal transition hydrodynamic properties and transforming ability, support the view that the process is an intramolecular double chain denaturation. The degree of denaturation irreversibility is dependent on single chain molecular weight of DNA (discontinuities denisty) and upon the helicity value at which salt concentration jump is performed. Both dependences are formally interpreted according to Elton's model for base distribution in DNA. Kinetically the process behaves as being an hydrodynamically limited rewinding. (author)
Schalbetter, Stephanie A; Mansoubi, Sahar; Chambers, Anna L; Downs, Jessica A; Baxter, Jonathan
2015-08-18
Faithful genome duplication and inheritance require the complete resolution of all intertwines within the parental DNA duplex. This is achieved by topoisomerase action ahead of the replication fork or by fork rotation and subsequent resolution of the DNA precatenation formed. Although fork rotation predominates at replication termination, in vitro studies have suggested that it also occurs frequently during elongation. However, the factors that influence fork rotation and how rotation and precatenation may influence other replication-associated processes are unknown. Here we analyze the causes and consequences of fork rotation in budding yeast. We find that fork rotation and precatenation preferentially occur in contexts that inhibit topoisomerase action ahead of the fork, including stable protein-DNA fragile sites and termination. However, generally, fork rotation and precatenation are actively inhibited by Timeless/Tof1 and Tipin/Csm3. In the absence of Tof1/Timeless, excessive fork rotation and precatenation cause extensive DNA damage following DNA replication. With Tof1, damage related to precatenation is focused on the fragile protein-DNA sites where fork rotation is induced. We conclude that although fork rotation and precatenation facilitate unwinding in hard-to-replicate contexts, they intrinsically disrupt normal chromosome duplication and are therefore restricted by Timeless/Tipin.
Directory of Open Access Journals (Sweden)
Hangarter Roger P
2007-07-01
Full Text Available Abstract Background Proper development of plastids in embryo and seedling tissues is critical for plant development. During germination, plastids develop to perform many critical functions that are necessary to establish the seedling for further growth. A growing body of work has demonstrated that components of the plastid transcription and translation machinery must be present and functional to establish the organelle upon germination. Results We have identified Arabidopsis thaliana mutants in a gene that encodes a plastid-targeted elongation factor G (SCO1 that is essential for plastid development during embryogenesis since two T-DNA insertion mutations in the coding sequence (sco1-2 and sco1-3 result in an embryo-lethal phenotype. In addition, a point mutation allele (sco1-1 and an allele with a T-DNA insertion in the promoter (sco1-4 of SCO1 display conditional seedling-lethal phenotypes. Seedlings of these alleles exhibit cotyledon and hypocotyl albinism due to improper chloroplast development, and normally die shortly after germination. However, when germinated on media supplemented with sucrose, the mutant plants can produce photosynthetically-active green leaves from the apical meristem. Conclusion The developmental stage-specific phenotype of the conditional-lethal sco1 alleles reveals differences in chloroplast formation during seedling germination compared to chloroplast differentiation in cells derived from the shoot apical meristem. Our identification of embryo-lethal mutant alleles in the Arabidopsis elongation factor G indicates that SCO1 is essential for plant growth, consistent with its predicted role in chloroplast protein translation.
Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L
1997-05-02
Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.
International Nuclear Information System (INIS)
Khmelinskaia, Alena; Franquelim, Henri G; Petrov, Eugene P; Schwille, Petra
2016-01-01
DNA origami is a state-of-the-art technology that enables the fabrication of nano-objects with defined shapes, to which functional moieties, such as lipophilic anchors, can be attached with a nanometre scale precision. Although binding of DNA origami to lipid membranes has been extensively demonstrated, the specific requirements necessary for membrane attachment are greatly overlooked. Here, we designed a set of amphipathic rectangular-shaped DNA origami structures with varying placement and number of chol-TEG anchors used for membrane attachment. Single- and multiple-cholesteryl-modified origami nanostructures were produced and studied in terms of their membrane localization, density and dynamics. We show that the positioning of at least two chol-TEG moieties near the corners is essential to ensure efficient membrane binding of large DNA nanostructures. Quantitative fluorescence correlation spectroscopy data further confirm that increasing the number of corner-positioned chol-TEG anchors lowers the dynamics of flat DNA origami structures on freestanding membranes. Taken together, our approach provides the first evidence of the importance of the location in addition to the number of hydrophobic moieties when rationally designing minimal DNA nanostructures with controlled membrane binding. (paper)
A Double Polymerase Chain Reaction Method for Detecting African ...
African Journals Online (AJOL)
Keywords: African swine fever, Swine vesicular disease, Polymerase chain reaction, Recombinant plasmids ... included 5 μL of 10×Pfu DNA polymerase buffer,. 1 μL of Pfu DNA .... Garcia-Barreno B, Sanz A, Nogal ML, Vinuela E,. Enjuanes L.
Single gene retrieval from thermally degraded DNA
Indian Academy of Sciences (India)
To simulate single gene retrieval from ancient DNA, several related factors have been investigated. By monitoring a 889 bp polymerase chain reaction (PCR) product and genomic DNA degradation, we find that heat and oxygen (especially heat) are both crucial factors influencing DNA degradation. The heat influence ...
Biogenesis and the growth of DNA-like polymer chains: a computer simulation
International Nuclear Information System (INIS)
Herrmann, H.J.; Tsallis, C.
1987-01-01
We study, through computer simulation, a crucial step of Biogenesis, namely the growth of self-replicating codified DNA-like polymers starting from a mixture of oligomers. We have adopted the growth scheme that has been recently proposed by Ferreira and Tsallis which incorporates usual ideas of autocatalysis through complementary pairs and within which a central role is played by the hydrogen-like links (characterized by the probabilities p AT and p CG of chemical bonding of the A-T and C-G pairs respectively) between the two chains of the growing polymer. We find that the average equilibrium polymeric length ξ diverges, for any fixed ratio (1-p AT )/(1-p sub (CG)), as ξ ∝ 1/r1-p AT . Selection of patterns may happen at all stages and in particular at chemical equilibrium. Selection occurs via two different mechanisms: (i) away from the critical point p AT = p CG = 1 if p AT ≠ p CG ; (ii) both on and away from the critical point if the initial concentrations of nucleotides (A, T, C and G or their precursors) are different. (author) [pt
Molecular characterization of medium-chain acyl-CoA dehydrogenase (MCAD) deficiency
DEFF Research Database (Denmark)
Gregersen, N; Andresen, B S; Bross, P
1991-01-01
. All clones sequenced from the patient exhibited a single base substitution from adenine (A) to guanine (G) at position 985 in the MCAD cDNA as the only consistent base-variation compared with control cDNA. In contrast, the parents contained cDNA with the normal and the mutated sequence, revealing......A series of experiments has established the molecular defect in the medium-chain acyl-coenzyme A (CoA) dehydrogenase (MCAD) gene in a family with MCAD deficiency. Demonstration of intra-mitochondrial mature MCAD indistinguishable in size (42.5-kDa) from control MCAD, and of mRNA with the correct...... size of 2.4 kb, indicated a point-mutation in the coding region of the MCAD gene to be disease-causing. Consequently, cloning and DNA sequencing of polymerase chain reaction (PCR) amplified complementary DNA (cDNA) from messenger RNA of fibroblasts from the patient and family members were performed...
Dna fingerprinting - review paper
Blundell, Renald
2006-01-01
Before the Polymerase Chain Reaction (PCR) was established, DNA fingerprinting technology has relied for years on Restriction Fragment Length Polymorphism (RFLP) and Variable Number of Tandom Repeats (VNTR) analysis, a very efficient technique but quite laborious and not suitable for high throughput mapping. Since its, development, PCR has provided a new and powerful tool for DNA fingerprinting.
RYBP Is a K63-Ubiquitin-Chain-Binding Protein that Inhibits Homologous Recombination Repair
Directory of Open Access Journals (Sweden)
Mohammad A.M. Ali
2018-01-01
Full Text Available Summary: Ring1-YY1-binding protein (RYBP is a member of the non-canonical polycomb repressive complex 1 (PRC1, and like other PRC1 members, it is best described as a transcriptional regulator. However, several PRC1 members were recently shown to function in DNA repair. Here, we report that RYBP preferentially binds K63-ubiquitin chains via its Npl4 zinc finger (NZF domain. Since K63-linked ubiquitin chains are assembled at DNA double-strand breaks (DSBs, we examined the contribution of RYBP to DSB repair. Surprisingly, we find that RYBP is K48 polyubiquitylated by RNF8 and rapidly removed from chromatin upon DNA damage by the VCP/p97 segregase. High expression of RYBP competitively inhibits recruitment of BRCA1 repair complex to DSBs, reducing DNA end resection and homologous recombination (HR repair. Moreover, breast cancer cell lines expressing high endogenous RYBP levels show increased sensitivity to DNA-damaging agents and poly ADP-ribose polymerase (PARP inhibition. These data suggest that RYBP negatively regulates HR repair by competing for K63-ubiquitin chain binding. : Ali et al. find that RYBP binds K63-linked ubiquitin chains and is removed from DNA damage sites. This K63-ubiquitin binding allows RYBP to hinder the recruitment of BRCA1 and Rad51 to DNA double-strand breaks, thus inhibiting homologous recombination repair. Accordingly, cancer cells expressing high RYBP are more sensitive to DNA-damaging therapies. Keywords: DNA damage response, homologous recombination, ubiquitylation, RYBP, polycomb proteins, double-strand break repair, chromatin, histone modification
Proteins mediating DNA loops effectively block transcription.
Vörös, Zsuzsanna; Yan, Yan; Kovari, Daniel T; Finzi, Laura; Dunlap, David
2017-07-01
Loops are ubiquitous topological elements formed when proteins simultaneously bind to two noncontiguous DNA sites. While a loop-mediating protein may regulate initiation at a promoter, the presence of the protein at the other site may be an obstacle for RNA polymerases (RNAP) transcribing a different gene. To test whether a DNA loop alters the extent to which a protein blocks transcription, the lac repressor (LacI) was used. The outcome of in vitro transcription along templates containing two LacI operators separated by 400 bp in the presence of LacI concentrations that produced both looped and unlooped molecules was visualized with scanning force microscopy (SFM). An analysis of transcription elongation complexes, moving for 60 s at an average of 10 nt/s on unlooped DNA templates, revealed that they more often surpassed LacI bound to the lower affinity O2 operator than to the highest affinity Os operator. However, this difference was abrogated in looped DNA molecules where LacI became a strong roadblock independently of the affinity of the operator. Recordings of transcription elongation complexes, using magnetic tweezers, confirmed that they halted for several minutes upon encountering a LacI bound to a single operator. The average pause lifetime is compatible with RNAP waiting for LacI dissociation, however, the LacI open conformation visualized in the SFM images also suggests that LacI could straddle RNAP to let it pass. Independently of the mechanism by which RNAP bypasses the LacI roadblock, the data indicate that an obstacle with looped topology more effectively interferes with transcription. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.
Uni-axial Elongational Viscosity of Linear and Branched polymer melts
DEFF Research Database (Denmark)
Hassager, Ole; Nielsen, Jens Kromann; Rasmussen, Henrik Koblitz
2005-01-01
About 40 years ago interest in the measurement of elongational viscosity of polymer melts started to grow. Here we present measurements of transient (and steady) uni-axial elongational viscosity, using the FSR, of the following melts: Four narrow MMD polystyrene (PS) samples with weight......-average molar mass Mw in the range of 50k to 390k. Three different bi-disperse samples, mixed from the narrow MMD PS. Two low-density polyethylene (LDPE) melts (Lupolen 1840D and 3020D). A steady-state viscosity was kept for 1-2.5 Hencky strain units in all measurements.The measurements on the bi-disperse PS...... melts have demonstrated that both the transient and steady elongational viscosity is quite sensitive to polydispersity. Bi-disperse PS resembles the behaviour of mono-disperse melts only at elongational rates larger then the inverse of maximal time constant of the smallest molecule. As observed in Boger...
Rapid and inexpensive method for isolating plasmid DNA
International Nuclear Information System (INIS)
Aljanabi, S. M.; Al-Awadi, S. J.; Al-Kazaz, A. A.; Baghdad Univ.
1997-01-01
A small-scale and economical method for isolating plasmid DNA from bacteria is described. The method provides DNA of suitable quality for most DNA manipulation techniques. This DNA can be used for restriction endonuclease digestion, southern blot hybridization, nick translation and end labeling of DNA probes, Polymerase Chain Reaction (PCR) -based techniques, transformation, DNA cycle-sequencing, and Chain-termination method for DNA sequencing. The entire procedure is adapted to 1.5 ml microfuge tubes and takes approximately 30 mins. The DNA isolated by this method has the same purity produced by CTAB and cesium chloride precipitation and purification procedures respectively. The two previous methods require many hours to obtain the final product and require the use of very expensive equipment as ultracentrifuge. This method is well suited for the isolation of plasmid DNA from a large number of bacterial samples and in a very short time and low cost in laboratories where chemicals, expensive equipment and finance are limited factors in conducting molecular research. (authors). 11refs. 11refs
Resistance to DNA denaturation in irradiated Chinese hamster V79 fibroblasts is linked to cell shape
International Nuclear Information System (INIS)
Olive, P.L.; Vanderbyl, S.; MacPhail, S.H.
1991-01-01
Exponentially growing Chinese hamster V79-171b lung fibroblasts seeded at high density on plastic (approximately 7 x 10(3) cells/cm2) flatten, elongate, and produce significant amounts of extracellular fibronectin. When lysed in weak alkali/high salt, the rate of DNA denaturation following exposure to ionizing radiation is exponential. Conversely, cells plated at low density (approximately 7 x 10(2) cells/cm2) on plastic are more rounded 24 h later, produce little extracellular fibronectin, and display unusual DNA denaturation kinetics after X-irradiation. DNA in these cells resists denaturation, as though constraints to DNA unwinding have developed. Cell doubling time and distribution of cells in the growth cycle are identical for both high and low density cultures as is cell survival in response to radiation damage. The connection between DNA conformation and cell shape was examined further in low density cultures grown in conditioned medium. Under these conditions, cells at low density were able to elongate, and DNA denaturation of low density cultures was identical to that of high density cultures. Conversely, cytochalasin D, which interferes with actin polymerization causing cells to round up and release fibronectin, allowed development of constraints in high density cultures. These results suggest that DNA conformation is sensitive to changes in cell shape which result when cells are grown in different environments. However, these changes in DNA conformation detected by the DNA unwinding assay do not appear to play a direct role in radiation-induced cell killing
DNA-based identification and phylogeny of North American Armillaria species
Amy L. Ross-Davis; John W. Hanna; Ned B. Klopfenstein
2011-01-01
Because Armillaria species display different ecological behaviors across diverse forest ecosystems, it is critical to identify Armillaria species accurately for any assessment of forest health. To further develop DNA-based identification methods, partial sequences of the translation elongation factor-1 alpha (EF-1α) gene were used to examine the phylogenetic...
Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard
2013-05-30
Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.
Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease
Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.
2018-04-01
We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.
International Nuclear Information System (INIS)
Jatzkowski, M.; Zimmer, K.
1994-01-01
The phenomenon of stem elongation by far red irradiation was shown with Argyranthemum frutescens 'Silver Leaf'. Stem elongation was promoted by incandescent lighting (mainly far red) during the day and night period. More intense reactions were observed with the isolated application during the nighttime. Reaction was strongly modified by the point of time the application took place. No effect could be shown by lighting with incandescent lamps for two hours during the daytime given within the first six hours of the main light period. During the nighttime two hours of lighting (incandescent lamps) promoted stem elongation atany point of time, especially in the middle of the dark period
DNA confinement in nanochannels: physics and biological applications
DEFF Research Database (Denmark)
Reisner, Walter; Pedersen, Jonas Nyvold; Austin, Robert H
2012-01-01
in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense...... direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined...... biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100μm range. (Some...
A Novel Image Encryption Algorithm Based on DNA Subsequence Operation
Directory of Open Access Journals (Sweden)
Qiang Zhang
2012-01-01
Full Text Available We present a novel image encryption algorithm based on DNA subsequence operation. Different from the traditional DNA encryption methods, our algorithm does not use complex biological operation but just uses the idea of DNA subsequence operations (such as elongation operation, truncation operation, deletion operation, etc. combining with the logistic chaotic map to scramble the location and the value of pixel points from the image. The experimental results and security analysis show that the proposed algorithm is easy to be implemented, can get good encryption effect, has a wide secret key's space, strong sensitivity to secret key, and has the abilities of resisting exhaustive attack and statistic attack.
Scattering phaseshift formulas for mesons and baryons in elongated boxes
Lee, Frank X.; Alexandru, Andrei
2018-03-01
We derive Lüscher phaseshift formulas for two-particle states in boxes elongated in one of the dimensions. Such boxes offer a cost-effective way of varying the relative momentum of the particles. Boosted states in the elongated direction, which allow wider access to energies, are also considered. The formulas for the various scenarios (moving and zero-momentum states in cubic and elongated boxes) are compared and relations between them are clarified. The results are applicable to a wide set of meson-meson and meson-baryon elastic scattering processes, with the two-particle system having equal or unequal masses.
Discontinuation of orthokeratology on eyeball elongation (DOEE).
Cho, P; Cheung, S W
2017-04-01
To evaluate and compare changes in axial elongation, over a 14-month period, in subjects who discontinued and then resumed ortho-k lens wear with those who continued to wear their lenses or spectacles following a 2-year myopia control study. This single masked, prospective study recruited subjects who had just completed a 2-year myopia control study. Ortho-k subjects were classified as Group OKc, in which subjects continued ortho-k lens wear for the duration of the study; or Group OKd in which subjects discontinued lens wear for seven months and wore single-vision spectacles (Phase I) and then resumed ortho-k lens wear for another seven months (Phase II). Spectacle-wearing control subjects from the initial myopia control study continued wearing spectacles as control subjects. Axial lengths were measured at scheduled visits using the IOLMaster. Thirteen, 16, and 15 Control, OKc, and OKd subjects, aged 8-14 years, respectively completed the study. Significant increase in axial elongation was found in OKd subjects only in Phase I but not in Phase II. On resuming lens wear, in Phase II, the rate of axial elongation was no longer significantly different from those of the Control or OKc subjects. Stopping ortho-k lens wear at or before the age of 14 years led to a more rapid increase in axial length; comparable to those wearing spectacles during the initial 2-year myopia control study, but greater than the Control and OKc group in this study. Axial elongation slowed again with resumed lens wear after six months. Copyright © 2016 British Contact Lens Association. Published by Elsevier Ltd. All rights reserved.
Viscosity overshoot in the start-up of uniaxial elongation of low density polyethylene melts
DEFF Research Database (Denmark)
Rasmussen, Henrik K.; Nielsen, Jens Kromann; Bach, Anders
2005-01-01
The transient uniaxial elongational viscosity of BASF Lupolen 1840D and 3020D melts has been measured on a filament stretch rheometer up to Hencky strains of 6-7. The elongational viscosity of both melts was measured at 130 degrees C within a broad range of elongational rates. At high elongation ...
Photo-oxidation of LDPE: Effects on elongational viscosity
Rolón-Garrido, Víctor H.; Wagner, Manfred H.
2013-04-01
Sheets of low-density polyethylene (LDPE) were photo-oxidatively treated at room temperature, and subsequently characterized rheologically in the melt state by shear and uniaxial extensional experiments. For photo-oxidation, a xenon lamp was used to irradiate the samples for times between 1 day and 6 weeks. Linear-viscoelastic characterization was performed in a temperature range of 130 to 220°C to obtain the master curve at 170°C, the reference temperature at which the elongational viscosities were measured. Linear viscoelasticity is increasingly affected by increasing photo-oxidation due to crosslinking of LDPE, as corroborated by an increasing gel fraction as determined by a solvent extraction method. The elongational measurements reveal a strong enhancement of strain hardening until a saturation level is achieved. The elongational data are analyzed in the frame work of two constitutive equations, the rubber-like liquid and the molecular stress function models. Within the experimental window, time-deformation separability is confirmed for all samples, independent of the degree of photo-oxidation.
Bilateral elongated styloid process: Its anatomical, embryological and clinical implications
Directory of Open Access Journals (Sweden)
Bagoji Ishwar B, Hadimani Gavishiddappa A, Patil Balasaheb G, Bannur Balappa M,Ambadasu B
2013-04-01
Full Text Available The styloid process is a slender, elongated, cylindrical bony projection from temporal bone. It normally varies in length from 2 cm to 3 cm. During a routine demonstration of skull for MBBS students we found the bilateral elongated styloid process in dry human skull. The length of elongation measured on the right and left side was 6.0 & 5.9 cms respectively. Such abnormal elongation of the styloid process may cause compression on a number of vital vessels and nerves related to it, producing inflammatory changes that include continuous chronic pain in the pharyngeal region. Mechanical stresses stretching the second brachial arch during fetal development probably induce variable involvement of Reichert’s cartilage in morphogenesis of the styloid process. It is important that clinicians especially dentists and otolaryngologists are aware of the natural variations of the styloid process and do not consider the styloid process with a length of 30 mm as an abnormality or as an anomaly.
Photochemistry of DNA containing iodinated cytosine
Energy Technology Data Exchange (ETDEWEB)
Rahn, R O; Stafford, R S [Oak Ridge National Lab., TN (USA)
1979-10-01
Irradiation at 313 nm of compounds containing iodinated cytosine moieties results in the photolysis of iodine. Photolysis occurs with a quantum yield of 0.022-0.024 for 5-iododeoxycytidine and 5-iododeoxycytidine monophosphate, and 0.004-0.008 for iodinated DNA as well as for iodinated polycytidylate. Photodegradation of the cytosine moiety occurs when air is present during irradiation, presumably due to the reaction of oxygen with the cytosyl radical formed when iodine is lost. This oxygen promoted photodegradation destroys the cytosine chromophore and is complete in the monomers but occurs to only a limited extent in the polymers. In the absence of oxygen or in the presence of ethanol, photodegradation is prevented and the loss of iodine leads exclusively to the formation of the cytosine chromophore. In DNA, the loss of iodine is accompanied by the formation of sugar damage and/or chain breaks. As measured by sedimentation in alkaline sucrose gradients, approximately one break is made for every six iodines lost in denatured DNA. The frequency of chain breakage per iodine photolyzed is reduced 2-fold in renatured DNA. Analysis in neutral gradients suggests that half of the breaks observed in alkali are alkali-labile bonds. Both ethanol and cysteamine reduce the number of chain breaks in alkali by approximately 3-fold.
Quantitation of Human Papillomavirus DNA in Plasma of Oropharyngeal Carcinoma Patients
International Nuclear Information System (INIS)
Cao Hongbin; Banh, Alice; Kwok, Shirley; Shi Xiaoli; Wu, Simon; Krakow, Trevor; Khong, Brian; Bavan, Brindha; Bala, Rajeev; Pinsky, Benjamin A.; Colevas, Dimitrios; Pourmand, Nader; Koong, Albert C.; Kong, Christina S.; Le, Quynh-Thu
2012-01-01
Purpose: To determine whether human papillomavirus (HPV) DNA can be detected in the plasma of patients with HPV-positive oropharyngeal carcinoma (OPC) and to monitor its temporal change during radiotherapy. Methods and Materials: We used polymerase chain reaction to detect HPV DNA in the culture media of HPV-positive SCC90 and VU147T cells and the plasma of SCC90 and HeLa tumor-bearing mice, non-tumor-bearing controls, and those with HPV-negative tumors. We used real-time quantitative polymerase chain reaction to quantify the plasma HPV DNA in 40 HPV-positive OPC, 24 HPV-negative head-and-neck cancer patients and 10 non-cancer volunteers. The tumor HPV status was confirmed by p16 INK4a staining and HPV16/18 polymerase chain reaction or HPV in situ hybridization. A total of 14 patients had serial plasma samples for HPV DNA quantification during radiotherapy. Results: HPV DNA was detectable in the plasma samples of SCC90- and HeLa-bearing mice but not in the controls. It was detected in 65% of the pretreatment plasma samples from HPV-positive OPC patients using E6/7 quantitative polymerase chain reaction. None of the HPV-negative head-and-neck cancer patients or non-cancer controls had detectable HPV DNA. The pretreatment plasma HPV DNA copy number correlated significantly with the nodal metabolic tumor volume (assessed using 18 F-deoxyglucose positron emission tomography). The serial measurements in 14 patients showed a rapid decline in HPV DNA that had become undetectable at radiotherapy completion. In 3 patients, the HPV DNA level had increased to a discernable level at metastasis. Conclusions: Xenograft studies indicated that plasma HPV DNA is released from HPV-positive tumors. Circulating HPV DNA was detectable in most HPV-positive OPC patients. Thus, plasma HPV DNA might be a valuable tool for identifying relapse.
Induced effect of irradiated exogenous DNA on wheat
International Nuclear Information System (INIS)
Li Zhongjie; Sun Guangzu; Wang Guangjin
1996-01-01
Irradiated exogenous DNA introduced into wheat can give rise to break of DNA-chain and damage of part of alkali radicals. Introducing exogenous DNA irradiated by γ rays could increase Do fructification rate and decrease seed size and plumpness. These tendencies became obvious with dose increase. In comparison with control DNA, introducing DNA irradiated could raise evidently mutagenic effect of pollen tube pathway technique
Le Guen, Tangui; Jullien, Laurent; Schertzer, Mike; Lefebvre, Axelle; Kermasson, Laetitia; de Villartay, Jean-Pierre; Londoño-Vallejo, Arturo; Revy, Patrick
2013-12-01
RTEL1 (regulator of telomere length helicase 1) is a DNA helicase that has been identified more than 10 years ago. Many works since, mainly in the nematode Caenorhabditis elegans and the mouse, have highlighted its role in chromosomal stability, maintenance of telomere length, and DNA repair. Recently, four laboratories have characterized RTEL1 mutations in patients with dyskeratosis congenita (DC) and Hoyeraal-Hreidarsson (HH) syndrome, a rare and severe variant of DC. We here summarize the current knowledge on RTEL1 and discuss the possible other functions that RTEL1 could play. © 2013 médecine/sciences – Inserm.
Energy Technology Data Exchange (ETDEWEB)
Ramzi, A
1994-06-01
Small Angle Neutron Scattering gives access to concentration fluctuations of mobile labeled polymer chains embedded in a polymer network. At rest they appear progressively larger than for random mixing, with increasing ratio. Under uniaxial stretching, they decrease towards ideal mixing along the direction perpendicular to stretching, and can grow strongly along the parallel one, including the zero scattering vector q limit. This gives rise to intensity contours with double-winged patterns, in the shape of the figure `8`, or of `butterfly`. Random crosslinking and end-linking of monodisperse chains have both been studied. The strength of the `butterfly` effect increases with the molecular weight of the free chains, the crosslinking ratio, the network heterogeneity, and the elongation ratio. Eventually, the signal collapses on an `asymptotic` function I(q), of increasing correlation length with the elongation ratio. Deformation appears heterogeneous, maximal for soft areas, where the mobile chains localize preferentially. This could be due to spontaneous fluctuations, or linked to frozen fluctuations of the crosslink density. However, disagreement with the corresponding theoretical expressions makes it necessary to account for the spatial correlations of crosslink density, and their progressive unscreening as displayed by the asymptotic behavior. Networks containing pending labeled chains and free labeled stars lead to more precise understanding of the diffusion of free species and the heterogeneity of the deformation. It seems that the latter occurs even without diffusion for heterogeneous enough networks. In extreme cases (of the crosslinking parameters), the spatial correlations display on apparent fractal behavior, of dimensions 2 to 2.5, which is discussed here in terms of random clusters. 200 refs., 95 figs., 21 tabs., 10 appends.
Adherens junction distribution mechanisms during cell-cell contact elongation in Drosophila.
Directory of Open Access Journals (Sweden)
Gabrielle Goldenberg
Full Text Available During Drosophila gastrulation, amnioserosa (AS cells flatten and spread as an epithelial sheet. We used AS morphogenesis as a model to investigate how adherens junctions (AJs distribute along elongating cell-cell contacts in vivo. As the contacts elongated, total AJ protein levels increased along their length. However, genetically blocking this AJ addition indicated that it was not essential for maintaining AJ continuity. Implicating other remodeling mechanisms, AJ photobleaching revealed non-directional lateral mobility of AJs along the elongating contacts, as well as local AJ removal from the membranes. Actin stabilization with jasplakinolide reduced AJ redistribution, and live imaging of myosin II along elongating contacts revealed fragmented, expanding and contracting actomyosin networks, suggesting a mechanism for lateral AJ mobility. Actin stabilization also increased total AJ levels, suggesting an inhibition of AJ removal. Implicating AJ removal by endocytosis, clathrin endocytic machinery accumulated at AJs. However, dynamin disruption had no apparent effect on AJs, suggesting the involvement of redundant or dynamin-independent mechanisms. Overall, we propose that new synthesis, lateral diffusion, and endocytosis play overlapping roles to populate elongating cell-cell contacts with evenly distributed AJs in this in vivo system.
(R)-β-lysine-modified elongation factor P functions in translation elongation
DEFF Research Database (Denmark)
Bullwinkle, Tammy J; Zou, S Betty; Rajkovic, Andrei
2013-01-01
Post-translational modification of bacterial elongation factor P (EF-P) with (R)-β-lysine at a conserved lysine residue activates the protein in vivo and increases puromycin reactivity of the ribosome in vitro. The additional hydroxylation of EF-P at the same lysine residue by the YfcM protein has......-(β)-lysyl-EF-P showed 30% increased puromycin reactivity but no differences in dipeptide synthesis rates when compared with the β-lysylated form. Unlike disruption of the other genes required for EF-P modification, deletion of yfcM had no phenotypic consequences in Salmonella. Taken together, our findings indicate...
Status of the tube elongation problem as of June 1976
International Nuclear Information System (INIS)
Alexander, W.K.
1976-01-01
It was discovered in May of 1971 that the N Reactor process tubes had apparently increased in length by as much as one inch. Preliminary observations and measurements led to the tentative conclusion that this observed elongation was linear with accumulated tube exposure and also that it was related in some manner to the tube fabrication process. It appeared that the observed elongation was approximately proportional to the degree of cold work retained in the finished tubes. This latter conclusion was based on the observation that those tubes with approximately 17-18 percent cold work had elongated only about half as much as the standard 30-percent-cold-worked tubes. It was immediately recognized that if such elongation was to continue unchecked it could pose a limit to reactor life since total possible tube expansion, from all causes, is limited to 1.75 inches by nozzle design considerations as shown in Figure 1. Thermal and hydraulic expansion were calculated to total approximately 0.75 inches which left only one inch available to accommodate tube growth or creep. Since discovery of this phenomenon, an extensive measurements program has been carried out to evaluate the extent and rate of tube elongation. Two corrective approaches have been developed and a small number of tubes were modified by each method during the 1976 summer outage. During the 1974, 1975 and 1976 Summer Outages, measurements were made on all tubes to determine the clearance remaining between the nozzle keys and the gas packing ring. These readings not only give an overall picture of the extent of elongation, but also provide immediate data indicating which tubes are about out of clearance. The report presents an evaluation of the measurements taken to date
Williams, James A; Ofner, Susan; Batteiger, Byron E; Fortenberry, J Dennis; Van Der Pol, Barbara
2014-03-01
To avoid positive results attributable to residual DNA, the Centers for Disease Control and Prevention recommends avoiding repeat testing with nucleic-acid based tests within 3 weeks after treatment of chlamydial (Chlamydia trachomatis [CT]) or gonococcal (Neisseria gonorrhoeae [GC]) infection. We retrospectively analyzed the duration of detectable DNA from a longitudinal cohort of adolescent women after diagnosis and treatment of infection with CT, GC, or Trichomonas vaginalis (TV). Vaginal swabs were obtained weekly from young women for up to 12 weeks (observation period) after treatment of CT, GC and TV infections. Swabs were tested using a commercially available first generation nucleic acid amplification test (NAAT) for CT and GC, and a laboratory developed NAAT for TV. Kaplan-Meier statistics were used to estimate median time to the first negative DNA-based polymerase chain reaction (PCR) result. Observation periods were available for analysis for 195, 82 and 102 treatments for CT, GC, and TV infection, respectively. Median time to a first negative PCR result for CT, GC, and TV was 9 (range 0-84), 6 (0-76), and 7 (0-84) days, and by day 21, 89%, 95%, and 85% were negative, respectively. Data from this retrospective analysis indicate that greater than 85% of these young women did not have detectable CT, GC, or TV DNA by day 21 post-treatment. This data may be useful to clinicians for patient management and post-treatment testing purposes.
Rhizome elongation and seagrass clonal growth
Marbà, N.; Duarte, C.M.
1998-01-01
A compilation of published and original data on rhizome morphometry, horizontal and vertical elongation rates and branching patterns for 27 seagrass species developing in 192 seagrass stands allowed an examination of the variability of seagrass rhizome and clonal growth programmes across and within
DNA origami-based nanoribbons: assembly, length distribution, and twist
Energy Technology Data Exchange (ETDEWEB)
Jungmann, Ralf; Scheible, Max; Kuzyk, Anton; Pardatscher, Guenther; Simmel, Friedrich C [Lehrstuhl fuer Bioelektronik, Physik-Department and ZNN/WSI, Technische Universitaet Muenchen, Am Coulombwall 4a, 85748 Garching (Germany); Castro, Carlos E, E-mail: simmel@ph.tum.de [Labor fuer Biomolekulare Nanotechnologie, Physik-Department and ZNN/WSI, Technische Universitaet Muenchen, Am Coulombwall 4a, 85748 Garching (Germany)
2011-07-08
A variety of polymerization methods for the assembly of elongated nanoribbons from rectangular DNA origami structures are investigated. The most efficient method utilizes single-stranded DNA oligonucleotides to bridge an intermolecular scaffold seam between origami monomers. This approach allows the fabrication of origami ribbons with lengths of several micrometers, which can be used for long-range ordered arrangement of proteins. It is quantitatively shown that the length distribution of origami ribbons obtained with this technique follows the theoretical prediction for a simple linear polymerization reaction. The design of flat single layer origami structures with constant crossover spacing inevitably results in local underwinding of the DNA helix, which leads to a global twist of the origami structures that also translates to the nanoribbons.
DNA origami-based nanoribbons: assembly, length distribution, and twist
International Nuclear Information System (INIS)
Jungmann, Ralf; Scheible, Max; Kuzyk, Anton; Pardatscher, Guenther; Simmel, Friedrich C; Castro, Carlos E
2011-01-01
A variety of polymerization methods for the assembly of elongated nanoribbons from rectangular DNA origami structures are investigated. The most efficient method utilizes single-stranded DNA oligonucleotides to bridge an intermolecular scaffold seam between origami monomers. This approach allows the fabrication of origami ribbons with lengths of several micrometers, which can be used for long-range ordered arrangement of proteins. It is quantitatively shown that the length distribution of origami ribbons obtained with this technique follows the theoretical prediction for a simple linear polymerization reaction. The design of flat single layer origami structures with constant crossover spacing inevitably results in local underwinding of the DNA helix, which leads to a global twist of the origami structures that also translates to the nanoribbons.
Winners and losers in the complex web of global supply chains.
Glendon, Lee
2013-01-01
This paper discusses how supply chain, risk and business continuity professionals can collaboratively address the consequences of increasing supply chain complexity in order to deliver both resilient and sustainable supply chains. The paper identifies the key drivers of complexity supported by recent case examples, including the equine DNA scandal and the Rana Plaza tragedy in Bangladesh.
Amphiregulin Antibody and Reduction of Axial Elongation in Experimental Myopia
Directory of Open Access Journals (Sweden)
Wen Jun Jiang
2017-03-01
Full Text Available To examine the mechanism of ocular axial elongation in myopia, guinea pigs (age: 2–3 weeks which either underwent unilateral or bilateral lens-induced myopization (group 1 or which were primarily myopic at baseline (group 2 received unilateral intraocular injections of amphiregulin antibody (doses: 5, 10, or 15 μg three times in intervals of 9 days. A third group of emmetropic guinea pigs got intraocular unilateral injections of amphiregulin (doses: 0.25, 0.50 or 1.00 ng, respectively. In each group, the contralateral eyes received intraocular injections of Ringer's solution. In intra-animal inter-eye comparison and intra-eye follow-up comparison in groups 1 and 2, the study eyes as compared to the contralateral eyes showed a dose-dependent reduction in axial elongation. In group 3, study eyes and control eyes did not differ significantly in axial elongation. Immunohistochemistry revealed amphiregulin labelling at the retinal pigment epithelium in eyes with lens-induced myopization and Ringer's solution injection, but not in eyes with amphiregulin antibody injection. Intraocular injections of amphiregulin-antibody led to a reduction of lens-induced axial myopic elongation and of the physiological eye enlargement in young guinea pigs. In contrast, intraocularly injected amphiregulin in a dose of ≤1 ng did not show a significant effect. Amphiregulin may be one of several essential molecular factors for axial elongation.
The elastic theory of a single DNA molecule
Indian Academy of Sciences (India)
methods and Monte Carlo simulations to understand the entropic elasticity, ... DNA; elastic theory; stacking interaction; supercoiling; hairpin-coil transition. .... the probability distribution of t and ϕ along the DNA chain [14,15], is governed by.
Nakazaki, Yuta; Tsuyama, Takashi; Azuma, Yutaro; Takahashi, Mikiko; Tada, Shusuke
2017-09-02
The initiation of DNA replication is strictly regulated by multiple mechanisms to ensure precise duplication of chromosomes. In higher eukaryotes, activity of the Cdt1 protein is temporally regulated during the cell cycle, and deregulation of Cdt1 induces DNA re-replication. In previous studies, we showed that excess Cdt1 inhibits DNA replication by suppressing progression of replication forks in Xenopus egg extracts. Here, we investigated the functional regions of Cdt1 that are required for the inhibition of DNA replication. We constructed a series of N-terminally or C-terminally deleted mutants of Cdt1 and examined their inhibitory effects on DNA replication in Xenopus egg extracts. Our results showed that the region spanning amino acids (a. a.) 255-620 is required for efficient inhibition of DNA replication, and that, within this region, a. a. 255-289 have a critical role in inhibition. Moreover, one of the Cdt1 mutants, Cdt1 R285A, was compromised with respect to the licensing activity but still inhibited DNA replication. This result suggests that Cdt1 has an unforeseen function in the negative regulation of DNA replication, and that this function is located within a molecular region that is distinct from those required for the licensing activity. Copyright © 2017 Elsevier Inc. All rights reserved.
From nucleotides to DNA analysis by a SERS substrate of a self similar chain of silver nanospheres
Coluccio, M L
2015-11-01
In this work we realized a device of silver nanostructures designed so that they have a great ability to sustain the surface-enhanced Raman scattering effect. The nanostructures were silver self-similar chains of three nanospheres, having constant ratios between their diameters and between their reciprocal distances. They were realized by electron beam lithography, to write the pattern, and by silver electroless deposition technique, to fill it with the metal. The obtained device showed the capability to increase the Raman signal coming from the gap between the two smallest nanospheres (whose size is around 10 nm) and so it allows the detection of biomolecules fallen into this hot spot. In particular, oligonucleotides with 6 DNA bases, deposited on these devices with a drop coating method, gave a Raman spectrum characterized by a clear fingerprint coming from the hot spot and, with the help of a fitting method, also oligonucleotides of 9 bases, which are less than 3 nm long, were resolved. In conclusion the silver nanolens results in a SERS device able to measure all the molecules, or part of them, held into the hot spot of the nanolenses, and thus it could be a future instrument with which to analyze DNA portions.
Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II
B. Steurer (Barbara); J.A. Marteijn (Jurgen)
2016-01-01
textabstractThe faithful transcription of eukaryotic genes by RNA polymerase II (RNAP2) is crucial for proper cell function and tissue homeostasis. However, transcription-blocking DNA lesions of both endogenous and environmental origin continuously challenge the progression of elongating RNAP2. The
International Nuclear Information System (INIS)
Ramzi, A.
1994-06-01
Small Angle Neutron Scattering gives access to concentration fluctuations of mobile labeled polymer chains embedded in a polymer network. At rest they appear progressively larger than for random mixing, with increasing ratio. Under uniaxial stretching, they decrease towards ideal mixing along the direction perpendicular to stretching, and can grow strongly along the parallel one, including the zero scattering vector q limit. This gives rise to intensity contours with double-winged patterns, in the shape of the figure '8', or of 'butterfly'. Random crosslinking and end-linking of monodisperse chains have both been studied. The strength of the 'butterfly' effect increases with the molecular weight of the free chains, the crosslinking ratio, the network heterogeneity, and the elongation ratio. Eventually, the signal collapses on an 'asymptotic' function I(q), of increasing correlation length with the elongation ratio. Deformation appears heterogeneous, maximal for soft areas, where the mobile chains localize preferentially. This could be due to spontaneous fluctuations, or linked to frozen fluctuations of the crosslink density. However, disagreement with the corresponding theoretical expressions makes it necessary to account for the spatial correlations of crosslink density, and their progressive unscreening as displayed by the asymptotic behavior. Networks containing pending labeled chains and free labeled stars lead to more precise understanding of the diffusion of free species and the heterogeneity of the deformation. It seems that the latter occurs even without diffusion for heterogeneous enough networks. In extreme cases (of the crosslinking parameters), the spatial correlations display on apparent fractal behavior, of dimensions 2 to 2.5, which is discussed here in terms of random clusters. 200 refs., 95 figs., 21 tabs., 10 appends
Eukaryotic elongation factor 2 controls TNF-α translation in LPS-induced hepatitis
González-Terán, Bárbara; Cortés, José R.; Manieri, Elisa; Matesanz, Nuria; Verdugo, ρngeles; Rodríguez, María E.; González-Rodríguez, ρgueda; Valverde, ρngela; Martín, Pilar; Davis, Roger J.; Sabio, Guadalupe
2012-01-01
Bacterial LPS (endotoxin) has been implicated in the pathogenesis of acute liver disease through its induction of the proinflammatory cytokine TNF-α. TNF-α is a key determinant of the outcome in a well-established mouse model of acute liver failure during septic shock. One possible mechanism for regulating TNF-α expression is through the control of protein elongation during translation, which would allow rapid cell adaptation to physiological changes. However, the regulation of translational elongation is poorly understood. We found that expression of p38γ/δ MAPK proteins is required for the elongation of nascent TNF-α protein in macrophages. The MKK3/6-p38γ/δ pathway mediated an inhibitory phosphorylation of eukaryotic elongation factor 2 (eEF2) kinase, which in turn promoted eEF2 activation (dephosphorylation) and subsequent TNF-α elongation. These results identify a new signaling pathway that regulates TNF-α production in LPS-induced liver damage and suggest potential cell-specific therapeutic targets for liver diseases in which TNF-α production is involved. PMID:23202732
Barcoding the food chain: from Sanger to high-throughput sequencing.
Littlefair, Joanne E; Clare, Elizabeth L
2016-11-01
Society faces the complex challenge of supporting biodiversity and ecosystem functioning, while ensuring food security by providing safe traceable food through an ever-more-complex global food chain. The increase in human mobility brings the added threat of pests, parasites, and invaders that further complicate our agro-industrial efforts. DNA barcoding technologies allow researchers to identify both individual species, and, when combined with universal primers and high-throughput sequencing techniques, the diversity within mixed samples (metabarcoding). These tools are already being employed to detect market substitutions, trace pests through the forensic evaluation of trace "environmental DNA", and to track parasitic infections in livestock. The potential of DNA barcoding to contribute to increased security of the food chain is clear, but challenges remain in regulation and the need for validation of experimental analysis. Here, we present an overview of the current uses and challenges of applied DNA barcoding in agriculture, from agro-ecosystems within farmland to the kitchen table.
Building block synthesis using the polymerase chain assembly method.
Marchand, Julie A; Peccoud, Jean
2012-01-01
De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).
Strigolactones Stimulate Internode Elongation Independently of Gibberellins1[C][W
de Saint Germain, Alexandre; Ligerot, Yasmine; Dun, Elizabeth A.; Pillot, Jean-Paul; Ross, John J.; Beveridge, Christine A.; Rameau, Catherine
2013-01-01
Strigolactone (SL) mutants in diverse species show reduced stature in addition to their extensive branching. Here, we show that this dwarfism in pea (Pisum sativum) is not attributable to the strong branching of the mutants. The continuous supply of the synthetic SL GR24 via the root system using hydroponics can restore internode length of the SL-deficient rms1 mutant but not of the SL-response rms4 mutant, indicating that SLs stimulate internode elongation via RMS4. Cytological analysis of internode epidermal cells indicates that SLs control cell number but not cell length, suggesting that SL may affect stem elongation by stimulating cell division. Consequently, SLs can repress (in axillary buds) or promote (in the stem) cell division in a tissue-dependent manner. Because gibberellins (GAs) increase internode length by affecting both cell division and cell length, we tested if SLs stimulate internode elongation by affecting GA metabolism or signaling. Genetic analyses using SL-deficient and GA-deficient or DELLA-deficient double mutants, together with molecular and physiological approaches, suggest that SLs act independently from GAs to stimulate internode elongation. PMID:23943865
International Nuclear Information System (INIS)
Nakabeppu, Y.; Sekiguchi, M.
1981-01-01
T4 endonuclease, which is involved in repair of uv-damaged DNA, has been purified to apparent physical homogeneity. Incubation of uv-irradiated poly(dA).poly(dT) with the purified enzyme preparations resulted in production of alkali-labile apyrimidinic sites, followed by formation of nicks in the polymer. By performing a limited reaction with T4 endonuclease V at pH 8.5, irradiated polymer was converted to an intermediate form that carried a large number of alkali-labile sites but only a few nicks. The intermediate was used as substrate for the assay of apurinic/apyrimidinic DNA endonuclease activity. The two activities, a pyrimidine dimer DNA glycosylase and an apurinic/apyrimidinic DNA endonuclease, were copurified and found in enzyme preparations that contained only a 16,000-dalton polypeptide. These results strongly suggested that a DNA glycosylase specific for pyrimidine dimers and an apurinic/apyrimidinic DNA endonuclease reside in a single polypeptide chain coded by the denV gene of bacteriophage T4
Burnett, Benjamin J; Altman, Roger B; Ferrao, Ryan; Alejo, Jose L; Kaur, Navdep; Kanji, Joshua; Blanchard, Scott C
2013-05-10
Aminoacyl-tRNA (aa-tRNA) enters the ribosome in a ternary complex with the G-protein elongation factor Tu (EF-Tu) and GTP. EF-Tu·GTP·aa-tRNA ternary complex formation and decay rates are accelerated in the presence of the nucleotide exchange factor elongation factor Ts (EF-Ts). EF-Ts directly facilitates the formation and disassociation of ternary complex. This system demonstrates a novel function of EF-Ts. Aminoacyl-tRNA enters the translating ribosome in a ternary complex with elongation factor Tu (EF-Tu) and GTP. Here, we describe bulk steady state and pre-steady state fluorescence methods that enabled us to quantitatively explore the kinetic features of Escherichia coli ternary complex formation and decay. The data obtained suggest that both processes are controlled by a nucleotide-dependent, rate-determining conformational change in EF-Tu. Unexpectedly, we found that this conformational change is accelerated by elongation factor Ts (EF-Ts), the guanosine nucleotide exchange factor for EF-Tu. Notably, EF-Ts attenuates the affinity of EF-Tu for GTP and destabilizes ternary complex in the presence of non-hydrolyzable GTP analogs. These results suggest that EF-Ts serves an unanticipated role in the cell of actively regulating the abundance and stability of ternary complex in a manner that contributes to rapid and faithful protein synthesis.
Abe, Kensuke; Ohno, Yusuke; Sassa, Takayuki; Taguchi, Ryo; Çalışkan, Minal; Ober, Carole; Kihara, Akio
2013-12-20
Very long-chain fatty acids (VLCFAs, chain length >C20) exist in tissues throughout the body and are synthesized by repetition of the fatty acid (FA) elongation cycle composed of four successive enzymatic reactions. In mammals, the TER gene is the only gene encoding trans-2-enoyl-CoA reductase, which catalyzes the fourth reaction in the FA elongation cycle. The TER P182L mutation is the pathogenic mutation for nonsyndromic mental retardation. This mutation substitutes a leucine for a proline residue at amino acid 182 in the TER enzyme. Currently, the mechanism by which the TER P182L mutation causes nonsyndromic mental retardation is unknown. To understand the effect of this mutation on the TER enzyme and VLCFA synthesis, we have biochemically characterized the TER P182L mutant enzyme using yeast and mammalian cells transfected with the TER P182L mutant gene and analyzed the FA elongation cycle in the B-lymphoblastoid cell line with the homozygous TER P182L mutation (TER(P182L/P182L) B-lymphoblastoid cell line). We have found that TER P182L mutant enzyme exhibits reduced trans-2-enoyl-CoA reductase activity and protein stability, thereby impairing VLCFA synthesis and, in turn, altering the sphingolipid profile (i.e. decreased level of C24 sphingomyelin and C24 ceramide) in the TER(P182L/P182L) B-lymphoblastoid cell line. We have also found that in addition to the TER enzyme-catalyzed fourth reaction, the third reaction in the FA elongation cycle is affected by the TER P182L mutation. These findings provide new insight into the biochemical defects associated with this genetic mutation.
International Nuclear Information System (INIS)
Sharma, Ajeet K; Chowdhury, Debashish
2013-01-01
A DNA polymerase (DNAP) replicates a template DNA strand. It also exploits the template as the track for its own motor-like mechanical movement. In the polymerase mode it elongates the nascent DNA by one nucleotide in each step. However, whenever it commits an error by misincorporating an incorrect nucleotide, it can switch to an exonuclease mode. In the latter mode it excises the wrong nucleotide before switching back to its polymerase mode. We develop a stochastic kinetic model of DNA replication that mimics an in vitro experiment where single-stranded DNA, subjected to a mechanical tension F, is converted to double-stranded DNA by a single DNAP. The F-dependence of the average rate of replication, which depends on the rates of both polymerase and exonuclease activities of the DNAP, is in good qualitative agreement with the corresponding experimental results. We introduce nine novel distinct conditional dwell times of a DNAP. Using the method of first-passage times, we also derive the exact analytical expressions for the probability distributions of these conditional dwell times. The predicted F-dependences of these distributions are, in principle, accessible to single-molecule experiments. (paper)
Quantification and presence of human ancient DNA in burial place ...
African Journals Online (AJOL)
Quantification and presence of human ancient DNA in burial place remains of Turkey using real time polymerase chain reaction. ... A published real-time PCR assay, which allows for the combined analysis of nuclear or ancient DNA and mitochondrial DNA, was modified. This approach can be used for recovering DNA from ...
Shark Ig light chain junctions are as diverse as in heavy chains.
Fleurant, Marshall; Changchien, Lily; Chen, Chin-Tung; Flajnik, Martin F; Hsu, Ellen
2004-11-01
We have characterized a small family of four genes encoding one of the three nurse shark Ig L chain isotypes, called NS5. All NS5 cDNA sequences are encoded by three loci, of which two are organized as conventional clusters, each consisting of a V and J gene segment that can recombine and one C region exon; the third contains a germline-joined VJ in-frame and the fourth locus is a pseudogene. This is the second nurse shark L chain type where both germline-joined and split V-J organizations have been found. Since there are only two rearranging Ig loci, it was possible for the first time to examine junctional diversity in defined fish Ig genes, comparing productive vs nonproductive rearrangements. N region addition was found to be considerably more extensive in length and in frequency than any other vertebrate L chain so far reported and rivals that in H chain. We put forth the speculation that the unprecedented efficiency of N region addition (87-93% of NS5 sequences) may be a result not only of simultaneous H and L chain rearrangement in the shark but also of processing events that afford greater accessibility of the V or J gene coding ends to terminal deoxynucleotidyltransferase.
Proteome analysis of dissected barley seed tissue during germination and radicle elongation
DEFF Research Database (Denmark)
Bønsager, Birgit Christine
2007-01-01
at the protein or the DNA level. In addition, germination of barley seeds is of interest for the brewing industry since this process corresponds to the steeping process that starts the industrial malting. In the present study a proteomics approach was employed to understand the initial changes in the water...... soluble protein composition of the barley seed upon imbibition and the following events that occur until to 72 h post imbibition (PI). 2D gel electrophoresis of proteins extracted from dissected barley seeds tissues during germination (0-24 h) and the subsequent radicle elongation (24-72 h) describes...... spatio-temporal variations in the protein patterns. Seeds from 8 time points (0, 4, 12, 24, 36, 52, 60, and 72 h PI) were dissected into embryo, aleurone layer and endosperm and small scale protein extractions enabled us to obtain good resolution 2D gels. The 2D gels were compared between the time points...
Analysis of cracking potential and micro-elongation of linerboard
Directory of Open Access Journals (Sweden)
Supattra Panthai
2016-11-01
Full Text Available Folding cracks of linerboards in relation to their micro-elongation and the forming conditions were studied using an industrial linerboard machine with a top former. The experiments consisted of the study of various forming conditions by manipulating the jet/wire speed ratio to produce linerboard with differences in fiber structures that were related to the cracked and uncracked products. The results showed that changes to the jet/wire speed ratio of about 0.01–0.02 to improve the tested folding endurance in the machine direction potentially produced folding cracks in the linerboard, which indicated an ambiguous interpretation of the foldability tests. The delaminated cracked layers were found to have a high folding endurance and tensile strength, while the decrease in the micro-elongation formulated in this study was found to be related to cracking. A lower micro-elongation of about 350–500 μm/N·g was found in a range of products with folding cracks.
Directory of Open Access Journals (Sweden)
Jyoti Gupta
Full Text Available We earlier demonstrated the immunoprophylactic efficacy of recombinant heavy chain myosin (Bm-Myo of Brugia malayi (B. malayi in rodent models. In the current study, further attempts have been made to improve this efficacy by employing alternate approaches such as homologous DNA (pcD-Myo and heterologous DNA/protein prime boost (pcD-Myo+Bm-Myo in BALB/c mouse model. The gene bm-myo was cloned in a mammalian expression vector pcDNA 3.1(+ and protein expression was confirmed in mammalian Vero cell line. A significant degree of protection (79.2%±2.32 against L3 challenge in pcD-Myo+Bm-Myo immunized group was observed which was much higher than that exerted by Bm-Myo (66.6%±2.23 and pcD-Myo (41.6%±2.45. In the heterologous immunized group, the percentage of peritoneal leukocytes such as macrophages, neutrophils, B cells and T cells marginally increased and their population augmented further significantly following L3 challenge. pcD-Myo+Bm-Myo immunization elicited robust cellular and humoral immune responses as compared to pcD-Myo and Bm-Myo groups as evidenced by an increased accumulation of CD4+, CD8+ T cells and CD19+ B cells in the mouse spleen and activation of peritoneal macrophages. Though immunized animals produced antigen-specific IgG antibodies and isotypes, sera of mice receiving pcD-Myo+Bm-Myo or Bm-Myo developed much higher antibody levels than other groups and there was profound antibody-dependent cellular adhesion and cytotoxicity (ADCC to B. malayi infective larvae (L3. pcD-Myo+Bm-Myo as well as Bm-Myo mice generated a mixed T helper cell phenotype as evidenced by the production of both pro-inflammatory (IL-2, IFN-γ and anti-inflammatory (IL-4, IL-10 cytokines. Mice receiving pcD-Myo on contrary displayed a polarized pro-inflammatory immune response. The findings suggest that the priming of animals with DNA followed by protein booster generates heightened and mixed pro- and anti-inflammatory immune responses that are capable of
Somatic DNA recombination yielding circular DNA and deletion of a genomic region in embryonic brain
International Nuclear Information System (INIS)
Maeda, Toyoki; Chijiiwa, Yoshiharu; Tsuji, Hideo; Sakoda, Saburo; Tani, Kenzaburo; Suzuki, Tomokazu
2004-01-01
In this study, a mouse genomic region is identified that undergoes DNA rearrangement and yields circular DNA in brain during embryogenesis. External region-directed inverse polymerase chain reaction on circular DNA extracted from late embryonic brain tissue repeatedly detected DNA of this region containing recombination joints. Wide-range genomic PCR and digestion-circularization PCR analysis showed this region underwent recombination accompanied with deletion of intervening sequences, including the circularized regions. This region was mapped by fluorescence in situ hybridization to C1 on mouse chromosome 16, where no gene and no physiological DNA rearrangement had been identified. DNA sequence in the region has segmental homology to an orthologous region on human chromosome 3q.13. These observations demonstrated somatic DNA recombination yielding genomic deletions in brain during embryogenesis
Directory of Open Access Journals (Sweden)
Peter Fonjungo
2013-05-01
Full Text Available Background: Early diagnosis of infants infected with HIV (EID and early initiation of treatment significantly reduces the rate of disease progression and mortality. One of the challengesto identification of HIV-1-infected infants is availability and/or access to quality molecular laboratory facilities which perform molecular virologic assays suitable for accurate identificationof the HIV status of infants. Method: We conducted a joint site assessment and designed laboratories for the expansion of DNA polymerase chain reaction (PCR testing based on dried blood spot (DBS for EID insix regions of Ethiopia. Training of appropriate laboratory technologists and development of required documentation including standard operating procedures (SOPs was carried out. The impact of the expansion of EID laboratories was assessed by the number of tests performed as well as the turn-around time. Results: DNA PCR for EID was introduced in 2008 in six regions. From April 2006 to April 2008, a total of 2848 infants had been tested centrally at the Ethiopian Health and Nutrition Research Institute (EHNRI in Addis Ababa, and which was then the only laboratory with the capability to perform EID; 546 (19.2% of the samples were positive. By November 2010, EHNRI and the six laboratories had tested an additional 16 985 HIV-exposed infants, of which 1915 (11.3% were positive. The median turn-around time for test results was 14 days (range 14−21 days. Conclusion: Expansion of HIV DNA PCR testing facilities that can provide quality and reliable results is feasible in resource-limited settings. Regular supervision and monitoring for quality assurance of these laboratories is essential to maintain accuracy of testing.
Use of DNA markers in forest tree improvement research
D.B. Neale; M.E. Devey; K.D. Jermstad; M.R. Ahuja; M.C. Alosi; K.A. Marshall
1992-01-01
DNA markers are rapidly being developed for forest trees. The most important markers are restriction fragment length polymorphisms (RFLPs), polymerase chain reaction- (PCR) based markers such as random amplified polymorphic DNA (RAPD), and fingerprinting markers. DNA markers can supplement isozyme markers for monitoring tree improvement activities such as; estimating...
A Herpesviral Immediate Early Protein Promotes Transcription Elongation of Viral Transcripts.
Fox, Hannah L; Dembowski, Jill A; DeLuca, Neal A
2017-06-13
Herpes simplex virus 1 (HSV-1) genes are transcribed by cellular RNA polymerase II (RNA Pol II). While four viral immediate early proteins (ICP4, ICP0, ICP27, and ICP22) function in some capacity in viral transcription, the mechanism by which ICP22 functions remains unclear. We observed that the FACT complex (comprised of SSRP1 and Spt16) was relocalized in infected cells as a function of ICP22. ICP22 was also required for the association of FACT and the transcription elongation factors SPT5 and SPT6 with viral genomes. We further demonstrated that the FACT complex interacts with ICP22 throughout infection. We therefore hypothesized that ICP22 recruits cellular transcription elongation factors to viral genomes for efficient transcription elongation of viral genes. We reevaluated the phenotype of an ICP22 mutant virus by determining the abundance of all viral mRNAs throughout infection by transcriptome sequencing (RNA-seq). The accumulation of almost all viral mRNAs late in infection was reduced compared to the wild type, regardless of kinetic class. Using chromatin immunoprecipitation sequencing (ChIP-seq), we mapped the location of RNA Pol II on viral genes and found that RNA Pol II levels on the bodies of viral genes were reduced in the ICP22 mutant compared to wild-type virus. In contrast, the association of RNA Pol II with transcription start sites in the mutant was not reduced. Taken together, our results indicate that ICP22 plays a role in recruiting elongation factors like the FACT complex to the HSV-1 genome to allow for efficient viral transcription elongation late in viral infection and ultimately infectious virion production. IMPORTANCE HSV-1 interacts with many cellular proteins throughout productive infection. Here, we demonstrate the interaction of a viral protein, ICP22, with a subset of cellular proteins known to be involved in transcription elongation. We determined that ICP22 is required to recruit the FACT complex and other transcription
Endogenous abscisic acid as a key switch for natural variation in flooding-induced shoot elongation.
Chen, Xin; Pierik, Ronald; Peeters, Anton J M; Poorter, Hendrik; Visser, Eric J W; Huber, Heidrun; de Kroon, Hans; Voesenek, Laurentius A C J
2010-10-01
Elongation of leaves and stem is a key trait for survival of terrestrial plants during shallow but prolonged floods that completely submerge the shoot. However, natural floods at different locations vary strongly in duration and depth, and, therefore, populations from these locations are subjected to different selection pressure, leading to intraspecific variation. Here, we identified the signal transduction component that causes response variation in shoot elongation among two accessions of the wetland plant Rumex palustris. These accessions differed 2-fold in petiole elongation rates upon submergence, with fast elongation found in a population from a river floodplain and slow elongation in plants from a lake bank. Fast petiole elongation under water consumes carbohydrates and depends on the (inter)action of the plant hormones ethylene, abscisic acid, and gibberellic acid. We found that carbohydrate levels and dynamics in shoots did not differ between the fast and slow elongating plants, but that the level of ethylene-regulated abscisic acid in petioles, and hence gibberellic acid responsiveness of these petioles explained the difference in shoot elongation upon submergence. Since this is the exact signal transduction level that also explains the variation in flooding-induced shoot elongation among plant species (namely, R. palustris and Rumex acetosa), we suggest that natural selection results in similar modification of regulatory pathways within and between species.
Experimental results on elongation control using dynamic input allocation at FTU
International Nuclear Information System (INIS)
Varano, G.; Boncagni, L.; Galeani, S.; Granucci, G.; Vitale, V.; Zaccarian, L.
2011-01-01
We report on the experimental results related to a recently proposed control scheme for the regulation of plasma elongation using the poloidal field coils available at FTU, already used for the horizontal position control. The proposed technique allows to realize elongation regulation as a secondary task using the same poloidal coils.
Protein Self-Assembly and Protein-Induced DNA Morphologies
Mawhinney, Matthew T.
The ability of biomolecules to associate into various structural configurations has a substantial impact on human physiology. The synthesis of protein polypeptide chains using the information encoded by DNA is mediated through the use of regulatory proteins, known as transcription factors. Some transcription factors perform function by inducing local curvature in deoxyribonucleic acid (DNA) strands, the mechanisms of which are not entirely known. An important architectural protein, eleven zinc finger CTCF (11 ZF CTCF) is involved in genome organization and hypothesized to mediate DNA loop formation. Direct evidence for these CTCF-induced DNA loops has yet to be observed. In this thesis, the effect of 11 ZF CTCF on DNA morphology is examined using atomic force microscopy, a powerful technique for visualizing biomolecules with nanometer resolution. The presence of CTCF is revealed to induce a variety of morphologies deviating from the relaxed state of control DNA samples, including compact circular complexes, meshes, and networks. Images reveal quasi-circular DNA/CTCF complexes consistent with a single DNA molecule twice wrapped around the protein. The structures of DNA and proteins are highly important for operations in the cell. Structural irregularities may lead to a variety of issues, including more than twenty human pathologies resulting from aberrant protein misfolding into amyloid aggregates of elongated fibrils. Insulin deficiency and resistance characterizing type 2 diabetes often requires administration of insulin. Injectable and inhalable delivery methods have been documented to result in the deposition of amyloid fibrils. Oligomers, soluble multiprotein assemblies, are believed to play an important role in this process. Insulin aggregation under physiological conditions is not well understood and oligomers have not yet been fully characterized. In this thesis, in vitro insulin aggregation at acidic and neutral pH is explored using a variety of techniques
Examining multi-component DNA-templated nanostructures as imaging agents
Jaganathan, Hamsa
2011-12-01
Magnetic resonance imaging (MRI) is the leading non-invasive tool for disease imaging and diagnosis. Although MRI exhibits high spatial resolution for anatomical features, the contrast resolution is low. Imaging agents serve as an aid to distinguish different types of tissues within images. Gadolinium chelates, which are considered first generation designs, can be toxic to health, while ultra-small, superparamagnetic nanoparticles (NPs) have low tissue-targeting efficiency and rapid bio-distribution, resulting to an inadequate detection of the MRI signal and enhancement of image contrast. In order to improve the utility of MRI agents, the challenge in composition and structure needs to be addressed. One-dimensional (1D), superparamagnetic nanostructures have been reported to enhance magnetic and in vivo properties and therefore has a potential to improve contrast enhancement in MRI images. In this dissertation, the structure of 1D, multi-component NP chains, scaffolded on DNA, were pre-clinically examined as potential MRI agents. First, research was focused on characterizing and understanding the mechanism of proton relaxation for DNA-templated NP chains using nuclear magnetic resonance (NMR) spectrometry. Proton relaxation and transverse relaxivity were higher in multi-component NP chains compared to disperse NPs, indicating the arrangement of NPs on a 1D structure improved proton relaxation sensitivity. Second, in vitro evaluation for potential issues in toxicity and contrast efficiency in tissue environments using a 3 Tesla clinical MRI scanner was performed. Cell uptake of DNA-templated NP chains was enhanced after encapsulating the nanostructure with layers of polyelectrolytes and targeting ligands. Compared to dispersed NPs, DNA-templated NP chains improved MRI contrast in both the epithelial basement membrane and colon cancer tumors scaffolds. The last part of the project was focused on developing a novel MRI agent that detects changes in DNA methylation
Energy Technology Data Exchange (ETDEWEB)
Orimoto, Yuuichi; Xie, Peng; Liu, Kai [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Yamamoto, Ryohei [Department of Molecular and Material Sciences, Interdisciplinary Graduate School of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Imamura, Akira [Hiroshima Kokusai Gakuin University, 6-20-1 Nakano, Aki-ku, Hiroshima 739-0321 (Japan); Aoki, Yuriko, E-mail: aoki.yuriko.397@m.kyushu-u.ac.jp [Department of Material Sciences, Faculty of Engineering Sciences, Kyushu University, 6-1 Kasuga-Park, Fukuoka 816-8580 (Japan); Japan Science and Technology Agency, CREST, 4-1-8 Hon-chou, Kawaguchi, Saitama 332-0012 (Japan)
2015-03-14
An Elongation-counterpoise (ELG-CP) method was developed for performing accurate and efficient interaction energy analysis and correcting the basis set superposition error (BSSE) in biosystems. The method was achieved by combining our developed ab initio O(N) elongation method with the conventional counterpoise method proposed for solving the BSSE problem. As a test, the ELG-CP method was applied to the analysis of the DNAs’ inter-strands interaction energies with respect to the alkylation-induced base pair mismatch phenomenon that causes a transition from G⋯C to A⋯T. It was found that the ELG-CP method showed high efficiency (nearly linear-scaling) and high accuracy with a negligibly small energy error in the total energy calculations (in the order of 10{sup −7}–10{sup −8} hartree/atom) as compared with the conventional method during the counterpoise treatment. Furthermore, the magnitude of the BSSE was found to be ca. −290 kcal/mol for the calculation of a DNA model with 21 base pairs. This emphasizes the importance of BSSE correction when a limited size basis set is used to study the DNA models and compare small energy differences between them. In this work, we quantitatively estimated the inter-strands interaction energy for each possible step in the transition process from G⋯C to A⋯T by the ELG-CP method. It was found that the base pair replacement in the process only affects the interaction energy for a limited area around the mismatch position with a few adjacent base pairs. From the interaction energy point of view, our results showed that a base pair sliding mechanism possibly occurs after the alkylation of guanine to gain the maximum possible number of hydrogen bonds between the bases. In addition, the steps leading to the A⋯T replacement accompanied with replications were found to be unfavorable processes corresponding to ca. 10 kcal/mol loss in stabilization energy. The present study indicated that the ELG-CP method is promising for
Evaluation of a new HTLV-I/II polymerase chain reaction
Vrielink, H.; Zaaijer, H. L.; Cuypers, H. T.; van der Poel, C. L.; Woerdeman, M.; Lelie, P. N.; Winkel, C.; Reesink, H. W.
1997-01-01
AIM: Evaluation of a qualitative HTLV-I/II DNA polymerase chain reaction (PCR) test for the detection of HTLV-I/II DNA (Roche Diagnostic Systems, Branchburg, N.J., USA) in various panels. METHODS: The panels consisted of fresh EDTA blood samples from blood donors who were anti-HTLV-I/II ELISA
DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present
Directory of Open Access Journals (Sweden)
Cheng-Yao eChen
2014-06-01
Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.
Effects of ionizing radiations on DNA replication in cultured mammalian cells
International Nuclear Information System (INIS)
Makino, F.; Okada, S.
1975-01-01
The dose-response curve of [ 3 H] thymidine incorporation into the acid-insoluble fraction of cultured mammalian cells, grown in the presence of 10 -4 M cold thymidine, is different from that of incorporation in the absence of cold thymidine. For quantitative estimation of net DNA synthesis in nonirradiated and irradiated cells, two methods were used: isolation of newly synthesized BUdR-labeled DNA by CsCl gradient centrifugation and a fluorometric estimation of DNA content in the synchronized population. Both methods showed that the depression of [ 3 H]thymidine incorporation in the presence of cold thymidine reflected a depression of net DNA synthesis. Radiosensitive steps in DNA synthesis were examined by the use of alkaline sucrose gradient centrifugation. The rate of replication along the DNA strands was inhibited to a lesser extent than that of over-all DNA synthesis. The labeling patterns of DNA exposed to [ 3 H]thymidine for 20 min indicated that ionizing radiation preferentially interfered with the formation of small-size 3 H-labeled DNA pieces. These results suggest that the initiation of DNA replication is more radiosensitive than the elongation of DNA strands whose replication has already been initiated. (U.S.)
Mechanisms for radiation damage in DNA
International Nuclear Information System (INIS)
Sevilla, M.D.
1985-07-01
Radiation damage to DNA results from the direct interaction of radiation with DNA where positive ions, electrons and excited states are formed in the DNA, and the indirect effect where radical species formed in the surrounding medium by the radiation attack the DNA. The primary mechanism proposed for radiation damage, by the direct effect, is that positive and negative ions formed within the DNA strand migrate through the stacked DNA bases. The ions can then recombine, react with the DNA bases most likely to react by protonation of the anion and deprotonation or hydroxylation of the cation or transfer out of the DNA chain to the surrounding histone protein. This work as aimed at understanding the possible reactions of the DNA base ion radicals, as well as their initial distribution in the DNA strand. 31 refs
DNA isolation from rat tail or ear
Cuppen, E.
2010-01-01
This protocol describes a rapid procedure for isolating DNA from rat tail or ear punches. The simplest version of the protocol can be scaled for use in 96-well (deep-well) plates. The quality of the DNA is sufficient for any polymerase chain reaction (PCR)-based genotyping approach.
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
Gradual nerve elongation affects nerve cell bodies and neuro-muscular junctions.
Kazuo Ikeda, K I; Masaki Matsuda, M M; Daisuke Yamauchi, D Y; Katsuro Tomita, K T; Shigenori Tanaka, S T
2005-07-01
The purpose of this study is to clarify the reactions of the neuro-muscular junction and nerve cell body to gradual nerve elongation. The sciatic nerves of Japanese white rabbits were lengthened by 30 mm in increments of 0.8 mm/day, 2.0 mm/day and 4.0 mm/day. A scanning electron microscopic examination showed no degenerative change at the neuro-muscular junction, even eight weeks after elongation in the 4-mm group. Hence, neuro-muscular junction is not critical for predicting damage from gradual nerve elongation. There were no axon reaction cells in the 0.8-mm group, a small amount in the 2-mm group, and a large amount in the 4-mm group. The rate of growth associated protein-43 positive nerve cells was significant in the 4-mm group. Hence, the safe speed for nerve cells appeared to be 0.8-mm/day, critical speed to be 2.0-mm/day, and dangerous speed to be 4.0-mm/day in this elongation model.
Both DNA Polymerases δ and ε Contact Active and Stalled Replication Forks Differently
Yu, Chuanhe; Gan, Haiyun
2017-01-01
ABSTRACT Three DNA polymerases, polymerases α, δ, and ε (Pol α, Pol δ, and Pol ε), are responsible for eukaryotic genome duplication. When DNA replication stress is encountered, DNA synthesis stalls until the stress is ameliorated. However, it is not known whether there is a difference in the association of each polymerase with active and stalled replication forks. Here, we show that each DNA polymerase has a distinct pattern of association with active and stalled replication forks. Pol α is enriched at extending Okazaki fragments of active and stalled forks. In contrast, although Pol δ contacts the nascent lagging strands of active and stalled forks, it binds to only the matured (and not elongating) Okazaki fragments of stalled forks. Pol ε has greater contact with the nascent single-stranded DNA (ssDNA) of the leading strand on active forks than on stalled forks. We propose that the configuration of DNA polymerases at stalled forks facilitates the resumption of DNA synthesis after stress removal. PMID:28784720
Jiang, Yangwei; Zhang, Dong; Zhang, Yaoyang; Deng, Zhenyu; Zhang, Linxi
2014-05-28
The adsorption-desorption transition of DNA in DNA-dendrimer solutions is observed when high-valence anions, such as hexavalent anions, are added to the DNA-dendrimer solutions. In the DNA-dendrimer solutions with low-valence anions, dendrimers bind tightly with the V-shaped double-stranded DNA. When high-valence anions, such as pentavalent or hexavalent anions, are added to the DNA-dendrimer solutions, the double-stranded DNA chains can be stretched straightly and the dendrimers are released from the double-stranded DNA chains. In fact, adding high-valence anions to the solutions can change the charge spatial distribution in the DNA-dendrimer solutions, and weaken the electrostatic interactions between the positively charged dendrimers and the oppositely charged DNA chains. Adsorption-desorption transition of DNA is induced by the overcharging of dendrimers. This investigation is capable of helping us understand how to control effectively the release of DNA in gene/drug delivery because an effective gene delivery for dendrimers includes non-covalent DNA-dendrimer binding and the effective release of DNA in gene therapy.
Directory of Open Access Journals (Sweden)
Sahar Mehrabani khasraghi
2016-05-01
Full Text Available Introduction: In recent years, it was demonstrated that there is a clear association between the complicated course of colorectal cancer (CRC and the presence of herpes viruses. Despite a great number of published reports, the exact pathogenic role of herpes viruses remains unclear in these patients. The purpose of this study is to explore the prevalence of herpes simplex virus (HSV and cytomegalovirus (CMV in patients with CRC and polyp in comparison with healthy subjects using the polymerase chain reaction (PCR method. Methods: In this case-control study, 15 biopsies of patients with CRC and 20 colorectal polyp sample were selected. From each patient, two tissue samples were obtained: one sample from malignant tissue, and the other from normal colorectal tissue in an area located 15 cm away from the malignant tissue. Furthermore, 35 samples from healthy people as controls were selected. After DNA extraction, PCR was used to determine HSV and CMV genomes by specific primers. A statistical analysis was performed using the chi-square test. Results: Five CRC patients (33.3% had HSV DNA detected in both the malignant and the matched normal tissue. Five CRC patients (33.3% and seven polyp patients (35.0% had CMV DNA detected in both the malignant and the matched normal tissue. HSV DNA was found in 20% and CMV DNA in 37.1% of samples from healthy people as a control group. Thus, no significant association was observed between the prevalence of HSV and CMV, and an incidence of CRC and polyps according to the location of the samples as compared with the control group. Conclusion: The findings demonstrated that there is no direct molecular evidence to support the association between HSV and CMV and human colorectal malignancies. However, the results from this study do not exclude a possible oncogenic role of these viruses in the neoplastic development of colon cells.
Saitoh, Aya; Takase, Tomoyuki; Kitaki, Hiroyuki; Miyazaki, Yuji; Kiyosue, Tomohiro
2015-01-01
Elongation of hypocotyl cells has been studied as a model for elucidating the contribution of cellular expansion to plant organ growth. ZEITLUPE (ZTL) or LOV KELCH PROTEIN1 (LKP1) is a positive regulator of warmth-induced hypocotyl elongation under white light in Arabidopsis, although the molecular mechanisms by which it promotes hypocotyl cell elongation remain unknown. Microarray analysis showed that 134 genes were upregulated and 204 genes including 15 auxin-inducible genes were downregulated in the seedlings of 2 ztl T-DNA insertion mutants grown under warm conditions with continuous white light. Application of a polar auxin transport inhibitor, an auxin antagonist or an auxin biosynthesis inhibitor inhibited hypocotyl elongation of control seedlings to the level observed with the ztl mutant. Our data suggest the involvement of auxin and auxin-inducible genes in ZTL-mediated hypocotyl elongation.
Cladding axial elongation models for FRAP-T6
International Nuclear Information System (INIS)
Shah, V.N.; Carlson, E.R.; Berna, G.A.
1983-01-01
This paper presents a description of the cladding axial elongation models developed at the Idaho National Engineering Laboratory (INEL) for use by the FRAP-T6 computer code in analyzing the response of fuel rods during reactor transients in light water reactors (LWR). The FRAP-T6 code contains models (FRACAS-II subcode) that analyze the structural response of a fuel rod including pellet-cladding-mechanical-interaction (PCMI). Recently, four models were incorporated into FRACAS-II to calculate cladding axial deformation: (a) axial PCMI, (b) trapped fuel stack, (c) fuel relocation, and (d) effective fuel thermal expansion. Comparisons of cladding axial elongation measurements from two experiments with the corresponding FRAP-T6 calculations are presented
Directory of Open Access Journals (Sweden)
Markakis Marios
2012-11-01
Full Text Available Abstract Background Along the root axis of Arabidopsis thaliana, cells pass through different developmental stages. In the apical meristem repeated cycles of division increase the numbers of cells. Upon leaving the meristem, these cells pass the transition zone where they are physiologically and mechanically prepared to undergo subsequent rapid elongation. During the process of elongation epidermal cells increase their length by 300% in a couple of hours. When elongation ceases, the cells acquire their final size, shape and functions (in the differentiation zone. Ethylene administered as its precursor 1-aminocyclopropane-1-carboxylic acid (ACC is capable of inhibiting elongation in a concentration-dependent way. Using a microarray analysis, genes and/or processes involved in this elongation arrest are identified. Results Using a CATMA-microarray analysis performed on control and 3h ACC-treated roots, 240 differentially expressed genes were identified. Quantitative Real-Time RT-PCR analysis of the 10 most up and down regulated genes combined with literature search confirmed the accurateness of the analysis. This revealed that inhibition of cell elongation is, at least partly, caused by restricting the events that under normal growth conditions initiate elongation and by increasing the processes that normally stop cellular elongation at the end of the elongation/onset of differentiation zone. Conclusions ACC interferes with cell elongation in the Arabidopsis thaliana roots by inhibiting cells from entering the elongation process and by immediately stimulating the formation of cross-links in cell wall components, diminishing the remaining elongation capacity. From the analysis of the differentially expressed genes, it becomes clear that many genes identified in this response, are also involved in several other kind of stress responses. This suggests that many responses originate from individual elicitors, but that somewhere in the downstream
Directory of Open Access Journals (Sweden)
Camila Ximenes
2014-12-01
Full Text Available The Global Program for the Elimination of Lymphatic Filariasis (GPELF aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2 and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2, which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.
Direct non transcriptional role of NF-Y in DNA replication.
Benatti, Paolo; Belluti, Silvia; Miotto, Benoit; Neusiedler, Julia; Dolfini, Diletta; Drac, Marjorie; Basile, Valentina; Schwob, Etienne; Mantovani, Roberto; Blow, J Julian; Imbriano, Carol
2016-04-01
NF-Y is a heterotrimeric transcription factor, which plays a pioneer role in the transcriptional control of promoters containing the CCAAT-box, among which genes involved in cell cycle regulation, apoptosis and DNA damage response. The knock-down of the sequence-specific subunit NF-YA triggers defects in S-phase progression, which lead to apoptotic cell death. Here, we report that NF-Y has a critical function in DNA replication progression, independent from its transcriptional activity. NF-YA colocalizes with early DNA replication factories, its depletion affects the loading of replisome proteins to DNA, among which Cdc45, and delays the passage from early to middle-late S phase. Molecular combing experiments are consistent with a role for NF-Y in the control of fork progression. Finally, we unambiguously demonstrate a direct non-transcriptional role of NF-Y in the overall efficiency of DNA replication, specifically in the DNA elongation process, using a Xenopus cell-free system. Our findings broaden the activity of NF-Y on a DNA metabolism other than transcription, supporting the existence of specific TFs required for proper and efficient DNA replication. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.
Segmentation of elongated structures in medical images
Staal, Jozef Johannes
2004-01-01
The research described in this thesis concerns the automatic detection, recognition and segmentation of elongated structures in medical images. For this purpose techniques have been developed to detect subdimensional pointsets (e.g. ridges, edges) in images of arbitrary dimension. These
Theory of high-force DNA stretching and overstretching
Storm, C.; Nelson, P.
2003-01-01
Single-molecule experiments on single- and double-stranded DNA have sparked a renewed interest in the force versus extension of polymers. The extensible freely jointed chain (FJC) model is frequently invoked to explain the observed behavior of single-stranded DNA, but this model does not
Koppelman, M H G M; van Swieten, P; Cuijpers, H T M
2011-06-01
European regulations require testing of manufacturing plasma for parvovirus B19 (B19) DNA to limit the load of this virus to a maximum acceptable level of 10 IU/µL. To meet this requirement, most manufacturers introduced a test algorithm to identify and eliminate high-load donations before making large manufacturing pools of plasma units. Sanquin screens all donations using a commercial assay from Roche and an in-house assay. Between 2006 and 2009, 6.2 million donations were screened using two different polymerase chain reaction (PCR) assays targeting B19 DNA. Donations with B19 DNA loads of greater than 1 × 10(6) IU/mL showing significant differences in viral load between the two assays were further analyzed by sequencing analysis. A total of 396 donations with B19 DNA loads of greater than 1 × 10(6) IU/mL were identified. Fifteen samples (3.8%) had discordant test results; 10 samples (2.5%) were underquantified by the Roche assay, two samples (0.5%) were underquantified by the in-house assay, and three samples (0.8%) were not detected by the Roche assay. Sequencing analysis revealed mismatches in primer and probe-binding regions. Phylogenetic analysis showed that 12 samples were B19 Genotype 1. The three samples not detected by the Roche assay were B19 Genotype 2. This study shows that 3.8% of the viremic B19 DNA-positive donations are not quantified correctly by the Roche or in-house B19 DNA assays. B19 Genotype 1 isolates showing incorrect test results are more common than B19 Genotype 2 or 3 isolates. Newly designed B19 PCR assays for blood screening should preferably have multiplexed formats targeting multiple regions of the B19 genome. © 2010 American Association of Blood Banks.
Calculations of the resonant response of carbon nanotubes to binding of DNA
International Nuclear Information System (INIS)
Zheng Meng; Ke Changhong; Eom, Kilho
2009-01-01
We theoretically study the dynamical response of carbon nanotubes (CNTs) to the binding of DNA in an aqueous environment by considering two major interactions in DNA helical binding to the CNT side surface: adhesion between DNA nucleobases and CNT surfaces and electrostatic interactions between negative charges on DNA backbones. The equilibrium DNA helical wrapping angle is obtained using the minimum potential energy method. Our results show that the preferred DNA wrapping angle in the equilibrium binding to CNT is dependent on both DNA length and DNA base. The equilibrium wrapping angle for a poly(dT) chain is larger than a comparable poly(dA) chain as a result of dT in a homopolymer chain having a higher effective binding energy to CNT than dA. Our results also interestingly reveal a sharp transition in the wrapping angle-DNA length profile for both homopolymers, implying that the equilibrium helical wrapping configuration does not exist for a certain range of wrapping angles. Furthermore, the resonant response of the DNA-CNT complex is analysed based on the variational method with a Hamiltonian which takes into account the CNT bending energy as well as DNA-CNT interactions. The closed-form analytical solution for predicting the resonant frequency of the DNA-CNT complex is presented. Our results show that the hydrodynamic loading on the oscillating CNT in aqueous environments has profound impacts on the resonance behaviour of DNA-CNT complexes. Our results suggest that detection of DNA molecules using CNT resonators based on DNA-CNT interactions through frequency measurements should be conducted in media with low hydrodynamic loading on CNTs. Our theoretical framework provides a fundamental principle for label-free detection using CNT resonators based on DNA-CNT interactions.
Balk, P A; de Boer, A D
1999-09-01
Many bulbous plants need a low-temperature treatment for flowering. Cold, for example, affects the elongation of the stalk, thereby influencing the quality of the cut flower. How the elongation of the stalk is promoted by cold and which physiological and biochemical mechanisms are involved have remained obscure. As invertase has been shown to be involved in the cold-induced elongation of the flower stalks of tulips (Lambrechts et al., 1994, Plant Physiol 104: 515-520), we further characterized this enzyme by cloning the cDNA and analysing its expression in various tissues of the tulip (Tulipa gesneriana L. cv. Apeldoorn) stalk. In addition, the role of sucrose synthase was investigated. Since turgor pressure is an important force driving cell elongation, the role of a water-channel protein (gammaTIP) was studied in relation to these two enzymes. The mRNA level of the invertase found was substantially up-regulated as a result of cold treatment. Analysis of the amino acid sequence of this invertase revealed the presence of a vacuolar targeting signal. Two different forms of sucrose synthase were found, the expression of one of them appeared to be restricted to the vascular tissue while the other form was present in the surrounding tissue. Both sucrose synthases were present in the stalk during the entire period of bulb storage and after planting, but their activities declined during stalk elongation. The expression of the gammaTIP gene was restricted mainly to the vascular tissue and its expression profile was identical to that of invertase. Simultaneous expression of invertase and gammaTIP possibly leads to an increase in osmotic potential and vacuolar water uptake, thus providing a driving force for stretching the stalk cells.
Modifying and adapting a plant-based DNA extraction protocol for ...
African Journals Online (AJOL)
... a 100 apparently healthy individuals residing in Calabar. The modified DNA procedure yielded good quality genomic DNA which was used in carrying out allele specific polymerase chain reaction which also yielded good quality amplicons. This method is simple and suitable for the extraction of DNA from human red cell.
DNA motif alignment by evolving a population of Markov chains.
Bi, Chengpeng
2009-01-30
Deciphering cis-regulatory elements or de novo motif-finding in genomes still remains elusive although much algorithmic effort has been expended. The Markov chain Monte Carlo (MCMC) method such as Gibbs motif samplers has been widely employed to solve the de novo motif-finding problem through sequence local alignment. Nonetheless, the MCMC-based motif samplers still suffer from local maxima like EM. Therefore, as a prerequisite for finding good local alignments, these motif algorithms are often independently run a multitude of times, but without information exchange between different chains. Hence it would be worth a new algorithm design enabling such information exchange. This paper presents a novel motif-finding algorithm by evolving a population of Markov chains with information exchange (PMC), each of which is initialized as a random alignment and run by the Metropolis-Hastings sampler (MHS). It is progressively updated through a series of local alignments stochastically sampled. Explicitly, the PMC motif algorithm performs stochastic sampling as specified by a population-based proposal distribution rather than individual ones, and adaptively evolves the population as a whole towards a global maximum. The alignment information exchange is accomplished by taking advantage of the pooled motif site distributions. A distinct method for running multiple independent Markov chains (IMC) without information exchange, or dubbed as the IMC motif algorithm, is also devised to compare with its PMC counterpart. Experimental studies demonstrate that the performance could be improved if pooled information were used to run a population of motif samplers. The new PMC algorithm was able to improve the convergence and outperformed other popular algorithms tested using simulated and biological motif sequences.
Food Fish Identification from DNA Extraction through Sequence Analysis
Hallen-Adams, Heather E.
2015-01-01
This experiment exposed 3rd and 4th y undergraduates and graduate students taking a course in advanced food analysis to DNA extraction, polymerase chain reaction (PCR), and DNA sequence analysis. Students provided their own fish sample, purchased from local grocery stores, and the class as a whole extracted DNA, which was then subjected to PCR,…
Vautrin, Sonia; Zhang, David
2007-01-01
A species-specific endogenous reference gene system was developed for polymerase chain reaction (PCR)-based analysis in common wheat (Triticum aestivum L.) by targeting the ALMT1 gene, an aluminium-activated malate transporter. The primers and probe were elaborated for real-time PCR-based qualitative and quantitative assay. The size of amplified product is 95 base pairs. The specificity was assessed on 17 monocot and dicot plant species. The established real-time PCR assay amplified only T. aestivum-derived DNA; no amplification occurred on other phylogenetically related species, including durum wheat (T. durum). The robustness of the system was tested on the DNA of 15 common wheat cultivars using 20 000 genomic copies per PCR the mean cycle threshold (Ct) values of 24.02 +/- 0.251 were obtained. The absolute limits of detection and quantification of the real-time PCR assay were estimated to 2 and 20 haploid genome copies of common wheat, respectively. The linearity was experimentally validated on 2-fold serial dilutions of DNA from 650 to 20 000 haploid genome copies. All these results show that the real-time PCR assay developed on the ALMT1 gene is suitable to be used as an endogenous reference gene for PCR-based specific detection and quantification of T. aestivum-derived DNA in various applications, in particular for the detection and quantification of genetically modified materials in common wheat.
Cloning and expression of recombinant, functional ricin B chain
International Nuclear Information System (INIS)
Chang, M.S.; Russell, D.W.; Uhr, J.W.; Vitetta, E.S.
1987-01-01
The cDNA encoding the B chain of the plant toxin ricin has been cloned and expressed in monkey kidney COS-M6 cells. The recombinant B chain was detected by labeling the transfected cells with [ 35 S]methionine and [ 35 S]-cysteine and demonstrating the secretion of a protein with a M/sub r/ of 30,000-32,000 that was not present in the medium of mock-transfected COS-M6 cells. This protein was specifically immunoprecipitated by an anti-ricin or anti-B-chain antibody and the amount of recombinant B chain secreted by the COS-M6 cells was determined by a radioimmunoassay. Virtually all of the recombinant B chain formed active ricin when mixed with native A chain; it could also bind to the galactose-containing glycoprotein asialofetuin as effectively as native B chain.These results indicate that the vast majority of recombinant B chains secreted into the medium of the COS-M6 cells retain biological function
Molecular architecture of the recombinant human MCM2-7 helicase in complex with nucleotides and DNA
DEFF Research Database (Denmark)
Boskovic, Jasminka; Bragado-Nilsson, Elisabeth; Saligram Prabhakar, Bhargav
2016-01-01
DNA replication is a key biological process that involves different protein complexes whose assembly is rigorously regulated in a successive order. One of these complexes is a replicative hexameric helicase, the MCM complex, which is essential for the initiation and elongation phases of replicati...
Programmed self-assembly of DNA/RNA for biomedical applications
Wang, Pengfei
Three self-assembly strategies were utilized for assembly of novel functional DNA/RNA nanostructures. RNA-DNA hybrid origami method was developed to fabricate nano-objects (ribbon, rectangle, and triangle) with precisely controlled geometry. Unlike conventional DNA origami which use long DNA single strand as scaffold, a long RNA single strand was used instead, which was folded by short DNA single strands (staples) into prescribed objects through sequence specific hybridization between RNA and DNA. Single stranded tiles (SST) and RNA-DNA hybrid origami were utilized to fabricate a variety of barcode-like nanostructures with unique patterns by expanding a plain rectangle via introducing spacers (10-bp dsDNA segment) between parallel duplexes. Finally, complex 2D array and 3D polyhedrons with multiple patterns within one structure were assembled from simple DNA motifs. Two demonstrations of biomedical applications of DNA nanotechnology were presented. Firstly, lambda-DNA was used as template to direct the fabrication of multi-component magnetic nanoparticle chains. Nuclear magnetic relaxation (NMR) characterization showed superb magnetic relaxativity of the nanoparticle chains which have large potential to be utilized as MRI contrast agents. Secondly, DNA nanotechnology was introduced into the conformational study of a routinely used catalytic DNAzyme, the RNA-cleaving 10-23 DNAzyme. The relative angle between two flanking duplexes of the catalytic core was determined (94.8°), which shall be able to provide a clue to further understanding of the cleaving mechanism of this DNAzyme from a conformational perspective.
Zella, D; Cavicchini, A; Cattaneo, E; Cimarelli, A; Bertazzoni, U
1995-02-01
The detection of proviral DNA by Polymerase Chain Reaction (PCR) is regarded as an important tool in the diagnosis of HIV-1 infection, specially among adults at risk of AIDS and children born to seropositive mothers. However, application of PCR in routine testing is hampered by the need to use radioactive probes. In this study, a non-radioactive test based on a microtiter plate (DNA Enzyme ImmunoAssay, DEIA) was used for the detection of proviral sequences of HIV-1 in peripheral blood cells of different patients. The results of the PCR-DEIA assay were compared to those obtained by liquid hybridization (PCR-LH), virus isolation (VI) and Western blot (WB). The study population included 92 patients belonging to three different groups: seropositive subjects with a well-defined clinical status and WB profile; adults at risk of infection with negative or indeterminate WB; children born to seropositive mothers with still unestablished HIV-1 infection. In the seropositive subjects, both PCR-LH and PCR-DEIA confirmed infection and gave the same results as WB. In adults at risk of infection, PCR with both methods anticipated the seroconversion in one patient with indeterminate WB and confirmed the absence of infection among seronegative and other indeterminate patients. In children born to seropositive mothers, both PCR systems as well as VI permitted an early diagnosis of infection, as confirmed by the clinical follow-up. This study has shown that in subjects at risk of AIDS and in children born to seropositive mothers, the non-isotopic DEIA method presents the same sensitivity and specificity for the detection of HIV-1 infection as the radioactive procedure. The DEIA method appears to be particularly useful for the detection of PCR products in routine diagnostic analyses.
Dutta Pal, Gopa; Paul, Somnath; Bardhan, Munmun; De, Asish; Ganguly, Tapan
2017-06-05
UV-vis absorption, steady state and time resolved fluorescence and absorption spectroscopic investigations demonstrate that the short chain dyad MNTMA when combined with gold-silver core-shell (Au@Ag) nanocomposite , forms elongated conformers in the excited state whereas for the dyad - Ag (spherical) system the majority of dyads remains in a folded conformation. In the dyad-core-shell nanocomposite system, energy wasting charge recombination rate slows down primarily due to elongated conformation and thus it may be anticipated that this hybrid nanocomposite system may serve as a better light energy conversion device. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
O'Donnell, Kerry; Gueidan, C; Sink, S
2009-01-01
We constructed a two-locus database, comprising partial translation elongation factor (EF-1alpha) gene sequences and nearly full-length sequences of the nuclear ribosomal intergenic spacer region (IGS rDNA) for 850 isolates spanning the phylogenetic breadth of the Fusarium oxysporum species compl...... of the IGS rDNA sequences may be non-orthologous. We also evaluated enniatin, fumonisin and moniliformin mycotoxin production in vitro within a phylogenetic framework....
Experimental and mathematical methods for representing relative surface elongation of the ACL
Pioletti, D. P.; Heegaard, J. H.; Rakotomanana, R. L.; Leyvraz, P. F.; Blankevoort, L.
1995-01-01
The common approach to assess the stabilizing role of the ACL in the knee has been to measure the elongation of a few marked fibers in the ligament. A comparison of the relative elongation (RE) of these marked fibers between different specimens and studies is delicate due to the difficulty of
Pathological mechanisms underlying single large‐scale mitochondrial DNA deletions
Rocha, Mariana C.; Rosa, Hannah S.; Grady, John P.; Blakely, Emma L.; He, Langping; Romain, Nadine; Haller, Ronald G.; Newman, Jane; McFarland, Robert; Ng, Yi Shiau; Gorman, Grainne S.; Schaefer, Andrew M.; Tuppen, Helen A.; Taylor, Robert W.
2018-01-01
Objective Single, large‐scale deletions in mitochondrial DNA (mtDNA) are a common cause of mitochondrial disease. This study aimed to investigate the relationship between the genetic defect and molecular phenotype to improve understanding of pathogenic mechanisms associated with single, large‐scale mtDNA deletions in skeletal muscle. Methods We investigated 23 muscle biopsies taken from adult patients (6 males/17 females with a mean age of 43 years) with characterized single, large‐scale mtDNA deletions. Mitochondrial respiratory chain deficiency in skeletal muscle biopsies was quantified by immunoreactivity levels for complex I and complex IV proteins. Single muscle fibers with varying degrees of deficiency were selected from 6 patient biopsies for determination of mtDNA deletion level and copy number by quantitative polymerase chain reaction. Results We have defined 3 “classes” of single, large‐scale deletion with distinct patterns of mitochondrial deficiency, determined by the size and location of the deletion. Single fiber analyses showed that fibers with greater respiratory chain deficiency harbored higher levels of mtDNA deletion with an increase in total mtDNA copy number. For the first time, we have demonstrated that threshold levels for complex I and complex IV deficiency differ based on deletion class. Interpretation Combining genetic and immunofluorescent assays, we conclude that thresholds for complex I and complex IV deficiency are modulated by the deletion of complex‐specific protein‐encoding genes. Furthermore, removal of mt‐tRNA genes impacts specific complexes only at high deletion levels, when complex‐specific protein‐encoding genes remain. These novel findings provide valuable insight into the pathogenic mechanisms associated with these mutations. Ann Neurol 2018;83:115–130 PMID:29283441
Theory and applications of the polymerase chain reaction.
Remick, D G; Kunkel, S L; Holbrook, E A; Hanson, C A
1990-04-01
The polymerase chain reaction (PCR) is a newly developed molecular biology technique that can significantly amplify DNA or RNA. The process consists of repetitive cycles of specific DNA synthesis, defined by short stretches of preselected DNA. With each cycle, there is a doubling of the final, desired DNA product such that a million-fold amplification is possible. This powerful method has numerous applications in diagnostic pathology, especially in the fields of microbiology, forensic science, and hematology. The PCR may be used to directly detect viral DNA, which may facilitate the diagnosis of acquired immune deficiency syndrome (AIDS) or other viral diseases. PCR amplification of DNA allows detection of specific sequences from extremely small samples, such as with forensic material. In hematology, PCR may help in the diagnosis of hemoglobinopathies or of neoplastic disorders by documenting chromosomal translocations. The new PCR opens exciting new avenues for diagnostic pathology using this new technology.
International Nuclear Information System (INIS)
Diao, Y; Hinson, K; Sun, Y; Arsuaga, J
2015-01-01
Kinetoplast DNA (kDNA) is the mitochondrial of DNA of disease causing organisms such as Trypanosoma Brucei (T. Brucei) and Trypanosoma Cruzi (T. Cruzi). In most organisms, KDNA is made of thousands of small circular DNA molecules that are highly condensed and topologically linked forming a gigantic planar network. In our previous work we have developed mathematical and computational models to test the confinement hypothesis, that is that the formation of kDNA minicircle networks is a product of the high DNA condensation achieved in the mitochondrion of these organisms. In these studies we studied three parameters that characterize the growth of the network topology upon confinement: the critical percolation density, the mean saturation density and the mean valence (i.e. the number of mini circles topologically linked to any chosen minicircle). Experimental results on insect-infecting organisms showed that the mean valence is equal to three, forming a structure similar to those found in medieval chain-mails. These same studies hypothesized that this value of the mean valence was driven by the DNA excluded volume. Here we extend our previous work on kDNA by characterizing the effects of DNA excluded volume on the three descriptive parameters. Using computer simulations of polymer swelling we found that (1) in agreement with previous studies the linking probability of two minicircles does not decrease linearly with the distance between the two minicircles, (2) the mean valence grows linearly with the density of minicircles and decreases with the thickness of the excluded volume, (3) the critical percolation and mean saturation densities grow linearly with the thickness of the excluded volume. Our results therefore suggest that the swelling of the DNA molecule, due to electrostatic interactions, has relatively mild implications on the overall topology of the network. Our results also validate our topological descriptors since they appear to reflect the changes in the
Diao, Y.; Hinson, K.; Sun, Y.; Arsuaga, J.
2015-10-01
Kinetoplast DNA (kDNA) is the mitochondrial of DNA of disease causing organisms such as Trypanosoma Brucei (T. Brucei) and Trypanosoma Cruzi (T. Cruzi). In most organisms, KDNA is made of thousands of small circular DNA molecules that are highly condensed and topologically linked forming a gigantic planar network. In our previous work we have developed mathematical and computational models to test the confinement hypothesis, that is that the formation of kDNA minicircle networks is a product of the high DNA condensation achieved in the mitochondrion of these organisms. In these studies we studied three parameters that characterize the growth of the network topology upon confinement: the critical percolation density, the mean saturation density and the mean valence (i.e. the number of mini circles topologically linked to any chosen minicircle). Experimental results on insect-infecting organisms showed that the mean valence is equal to three, forming a structure similar to those found in medieval chain-mails. These same studies hypothesized that this value of the mean valence was driven by the DNA excluded volume. Here we extend our previous work on kDNA by characterizing the effects of DNA excluded volume on the three descriptive parameters. Using computer simulations of polymer swelling we found that (1) in agreement with previous studies the linking probability of two minicircles does not decrease linearly with the distance between the two minicircles, (2) the mean valence grows linearly with the density of minicircles and decreases with the thickness of the excluded volume, (3) the critical percolation and mean saturation densities grow linearly with the thickness of the excluded volume. Our results therefore suggest that the swelling of the DNA molecule, due to electrostatic interactions, has relatively mild implications on the overall topology of the network. Our results also validate our topological descriptors since they appear to reflect the changes in the
Stojković, Marijana Radić; Skugor, Marko; Dudek, Lukasz; Grolik, Jarosław; Eilmes, Julita; Piantanida, Ivo
2014-01-01
An investigation of the interactions of two novel and several known DBTAA-adenine conjugates with double-stranded DNA and RNA has revealed the DNA/RNA groove as the dominant binding site, which is in contrast to the majority of previously studied DBTAA analogues (DNA/RNA intercalators). Only DBTAA-propyladenine conjugates revealed the molecular recognition of AT-DNA by an ICD band pattern > 300 nm, whereas significant ICD bands did not appear for other ds-DNA/RNA. A structure-activity relation for the studied series of compounds showed that the essential structural features for the ICD recognition are a) the presence of DNA-binding appendages (adenine side chain and positively charged side chain) on both DBTAA side chains, and b) the presence of a short propyl linker, which does not support intramolecular aromatic stacking between DBTAA and adenine. The observed AT-DNA-ICD pattern differs from previously reported ss-DNA (poly dT) ICD recognition by a strong negative ICD band at 350 nm, which allows for the dynamic differentiation between ss-DNA (poly dT) and coupled ds-AT-DNA.
Sound propagation in elongated superfluid fermionic clouds
International Nuclear Information System (INIS)
Capuzzi, P.; Vignolo, P.; Federici, F.; Tosi, M. P.
2006-01-01
We use hydrodynamic equations to study sound propagation in a superfluid Fermi gas at zero temperature inside a strongly elongated cigar-shaped trap, with main attention to the transition from the BCS to the unitary regime. First, we treat the role of the radial density profile in the limit of a cylindrical geometry and then evaluate numerically the effect of the axial confinement in a configuration in which a hole is present in the gas density at the center of the trap. We find that in a strongly elongated trap the speed of sound in both the BCS and the unitary regime differs by a factor √(3/5) from that in a homogeneous three-dimensional superfluid. The predictions of the theory could be tested by measurements of sound-wave propagation in a setup such as that exploited by Andrews et al. [Phys. Rev. Lett. 79, 553 (1997)] for an atomic Bose-Einstein condensate
Deng, Shasha; Wei, Ting; Tan, Kunling; Hu, Mingyu; Li, Fang; Zhai, Yunlan; Ye, Shue; Xiao, Yuehua; Hou, Lei; Pei, Yan; Luo, Ming
2016-02-01
Phytosterols play an important role in plant growth and development, including cell division, cell elongation, embryogenesis, cellulose biosynthesis, and cell wall formation. Cotton fiber, which undergoes synchronous cell elongation and a large amount of cellulose synthesis, is an ideal model for the study of plant cell elongation and cell wall biogenesis. The role of phytosterols in fiber growth was investigated by treating the fibers with tridemorph, a sterol biosynthetic inhibitor. The inhibition of phytosterol biosynthesis resulted in an apparent suppression of fiber elongation in vitro or in planta. The determination of phytosterol quantity indicated that sitosterol and campesterol were the major phytosterols in cotton fibers; moreover, higher concentrations of these phytosterols were observed during the period of rapid elongation of fibers. Furthermore, the decrease and increase in campesterol:sitosterol ratio was associated with the increase and decease in speed of elongation, respectively, during the elongation stage. The increase in the ratio was associated with the transition from cell elongation to secondary cell wall synthesis. In addition, a number of phytosterol biosynthetic genes were down-regulated in the short fibers of ligon lintless-1 mutant, compared to its near-isogenic wild-type TM-1. These results demonstrated that phytosterols play a crucial role in cotton fiber development, and particularly in fiber elongation.
Initiation of DNA replication requires actin dynamics and formin activity.
Parisis, Nikolaos; Krasinska, Liliana; Harker, Bethany; Urbach, Serge; Rossignol, Michel; Camasses, Alain; Dewar, James; Morin, Nathalie; Fisher, Daniel
2017-11-02
Nuclear actin regulates transcriptional programmes in a manner dependent on its levels and polymerisation state. This dynamics is determined by the balance of nucleocytoplasmic shuttling, formin- and redox-dependent filament polymerisation. Here, using Xenopus egg extracts and human somatic cells, we show that actin dynamics and formins are essential for DNA replication. In proliferating cells, formin inhibition abolishes nuclear transport and initiation of DNA replication, as well as general transcription. In replicating nuclei from transcriptionally silent Xenopus egg extracts, we identified numerous actin regulators, and disruption of actin dynamics abrogates nuclear transport, preventing NLS (nuclear localisation signal)-cargo release from RanGTP-importin complexes. Nuclear formin activity is further required to promote loading of cyclin-dependent kinase (CDK) and proliferating cell nuclear antigen (PCNA) onto chromatin, as well as initiation and elongation of DNA replication. Therefore, actin dynamics and formins control DNA replication by multiple direct and indirect mechanisms. © 2017 The Authors.
van Aelst, Kara; Saikrishnan, Kayarat; Szczelkun, Mark D
2015-01-01
The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1-2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand brea...
Ribosomal DNA internal transcribed spacer 1 and internal ...
African Journals Online (AJOL)
USER
2010-07-26
Jul 26, 2010 ... in some East Asian countries such as China, Korea and. *Corresponding author. E-mail: soonkwan@kangwon.ac.kr. Tel: +82 33 250 6476. Fax: +82 33 250 6470. Abbreviations: nrDNA, Nuclear ribosomal DNA; ITS, internal transcribed spacer; PCR, polymerase chain reaction; BLAST, basic local alignment ...
International Nuclear Information System (INIS)
Barenfeld, L.S.; Pleskach, N.M.; Bildin, V.N.; Prokofjeva, V.V.; Mikhelson, V.M.
1986-01-01
The rate of DNA synthesis after γ-irradiation was studied either by analysis of the steady-state distribution of daughter [ 3 H]DNA in alkaline sucrose gradients or by direct assay of the amount of [ 3 H]thymidine incorporated into DNA of fibroblasts derived from a normal donor (LCH882) and from Down's syndrome (LCH944), Werner's syndrome (WS1LE) and xeroderma pigmentosum (XP2LE) patients with chromosomal sensitivity to ionizing radiation. Doses of γ-irradiation that markedly inhibited the rate of DNA synthesis in normal human cells caused almost no inhibition of DNA synthesis in the cells from the affected individuals. The radioresistant DNA synthesis in Down's syndrome cells was mainly due to a much lower inhibition of replicon initiation than that in normal cells; these cells were also more resistant to damage that inhibited replicon elongation. Our data suggest that radioresistant DNA synthesis may be an intrinsic feature of all genetic disorders showing increased radiosensitivity in terms of chromosome aberrations. (orig.)
An Actomyosin-Arf-GEF Negative Feedback Loop for Tissue Elongation under Stress.
West, Junior J; Zulueta-Coarasa, Teresa; Maier, Janna A; Lee, Donghoon M; Bruce, Ashley E E; Fernandez-Gonzalez, Rodrigo; Harris, Tony J C
2017-08-07
In response to a pulling force, a material can elongate, hold fast, or fracture. During animal development, multi-cellular contraction of one region often stretches neighboring tissue. Such local contraction occurs by induced actomyosin activity, but molecular mechanisms are unknown for regulating the physical properties of connected tissue for elongation under stress. We show that cytohesins, and their Arf small G protein guanine nucleotide exchange activity, are required for tissues to elongate under stress during both Drosophila dorsal closure (DC) and zebrafish epiboly. In Drosophila, protein localization, laser ablation, and genetic interaction studies indicate that the cytohesin Steppke reduces tissue tension by inhibiting actomyosin activity at adherens junctions. Without Steppke, embryogenesis fails, with epidermal distortions and tears resulting from myosin misregulation. Remarkably, actomyosin network assembly is necessary and sufficient for local Steppke accumulation, where live imaging shows Steppke recruitment within minutes. This rapid negative feedback loop provides a molecular mechanism for attenuating the main tension generator of animal tissues. Such attenuation relaxes tissues and allows orderly elongation under stress. Copyright © 2017 Elsevier Ltd. All rights reserved.
DNA damage by X-rays and their impact on replication processes
International Nuclear Information System (INIS)
Parplys, Ann Christin; Petermann, Eva; Petersen, Cordula; Dikomey, Ekkehard; Borgmann, Kerstin
2012-01-01
Background: Replication-dependent radiosensitization of tumors ranks among the most promising tools for future improvements in tumor therapy. However, cell cycle checkpoint signaling during S phase is a key for maintaining genomic stability after ionizing irradiation allowing DNA damage repair by stabilizing replication forks, inhibiting new origin firing and recruiting DNA repair proteins. As the impact of the different types of DNA damage induced by ionizing radiation on replication fork functionality has not been investigated, this study was performed in tumor cells treated with various agents that induce specific DNA lesions. Methods: U2OS cells were exposed to methyl methanesulfonate (MMS) to induce base damage, low or high concentrations of hydrogen peroxide for the induction of SSBs, Topotecan to induce DSBs at replication, Mitomycin C (MMC) to induce interstrand cross-links or ionizing irradiation to analyze all damages. Chk1 phosphorylation, origin firing and replication fork progression, and cell cycle distribution were analyzed. Results: In our system, the extent of Chk1 phosphorylation was dependent on the type of damage induced and prolonged Chk1 phosphorylation correlated with the inhibition of replication initiation. Ionizing radiation, high concentrations of hydrogen peroxide, and Topotecan affected replication elongation much more strongly that the other agents. Almost all agents induced a slight increase in the S phase population but subsequent G2 arrest was only observed in response to those agents that strongly inhibited replication elongation and caused prolonged Chk1 phosphorylation. Conclusions: Our data suggest that to improve radiotherapy, radiosensitivity in S phase could be increased by combining irradiation with agents that induce secondary DSB or inhibit checkpoint signaling, such as inhibitors of PARP or Chk1.
A Novel Mechanism of Sugar Selection Utilized by a Human X-family DNA Polymerase†
Brown, Jessica A.; Fiala, Kevin A.; Fowler, Jason D.; Sherrer, Shanen M.; Newmister, Sean A.; Dyum, Wade W.; Suo, Zucai
2009-01-01
During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2′-hydroxyl group and the bulky side chain of an active site residue. Here, we demonstrated that human DNA polymerase λ used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2′-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such a steric clash was further demonst...
International Nuclear Information System (INIS)
Meechan, P.J.; Carpenter, J.G.
1986-01-01
Previous work obtained from Chinese hamster V-79 cells indicated that, immediately following exposure, UV-induced lesions acted as blocks to elongation of nascent strands, but gradually lost that ability over a 10 h period after exposure to 10 J/m 2 . The work reported herein attempted to examine possible cell cycle mediated alterations in the recovery of DNA synthesis. Kinetic incorporation of radiolabeled thymidine studies indicated that there may have been a more rapid recover of DNA synthesis in cells irradiated in G 1 or G 2 vs cells irradiated in S phase. DNA fiber autoradiograms prepared from synchronous cells indicated that after irradiation in any phase of the cell cycle, the length of newly synthesized DNA was equal to control lengths 1 h after exposure to 5.0Jm 2 (or 1 h after entering S phase for cells irradiated in G 1 or G 2 ). This observed recovery was not solely due to an excision process. No cell cycle mediated difference in the number of dimers induced or removed as a function of cell cycle position was observed. These results appear to be consistent with a continuum of effects, with initiation effects dominating the response at low fluences, gapped synthesis at intermediate fluences and elongation inhibition at high fluences. The fluences at which each event dominates may be cell-line specific. (author)
Active feedback stabilization of axisymmetric modes in highly elongated tokamak plasmas
International Nuclear Information System (INIS)
Ward, D.J.; Hofmann, F.
1993-07-01
Active feedback stabilization of the vertical instability is studied for highly elongated tokamak plasmas (1≤κ≤3), and evaluated in particular for the TCV configuration. It is shown that the feedback can strongly affect the form of the eigenfunction for these highly elongated equilibria, and this can have detrimental effects on the ability of the feedback system to properly detect and stabilize the plasma. A calculation of the vertical displacement that uses poloidal flux measurements, poloidal magnetic field measurements, and corrections for the vessel eddy currents and active feedback currents was found to be effective even in the cases with the worst deformations of the eigenfunction. We also examine how these deformations affect differently shaped equilibria, and it is seen that the magnitude of the deformation of the eigenfunction is strongly function of the plasma elongation. (author) 15 figs., 13 refs
Dayawansa, Samantha; Zhang, Jun; Shih, Chung-Hsuan; Tharakan, Binu; Huang, Jason H
2016-04-01
Functional data are essential when confirming the efficacy of elongated dorsal root ganglia (DRG) cells as a substitute for autografting. We present the quantitative functional motor, electrophysiological findings of engineered DRG recipients for the first time. Elongated DRG neurons and autografts were transplanted to bridge 1-cm sciatic nerve lesions of Sprague Dawley (SD) rats. Motor recoveries of elongated DRG recipients (n=9), autograft recipients (n=9), unrepaired rats (n=9) and intact rats (n=6) were investigated using the angle board challenge test following 16 weeks of recovery. Electrophysiology studies were conducted to assess the functional recovery at 16 weeks. In addition, elongated DRGs were subjected to histology assessments. At threshold levels (35° angle) of the angle board challenge test, the autograft recipients', DRG recipients' and unrepaired group's performances were equal to each other and were less than the intact group (pDRG recipients' performance was similar to both the intact group and the autograft nerve recipients, and was better (pDRG constructs had intact signal transmission when recorded over the lesion, while the unrepaired rats did not. It was observed that elongated DRG neurons closely resembled an autograft during histological assessments. Performances of autograft and elongated DRG construct recipients were similar. Elongated DRG neurons should be further investigated as a substitute for autografting.
Overexpression of rice LRK1 restricts internode elongation by down-regulating OsKO2.
Yang, Mengfei; Qi, Weiwei; Sun, Fan; Zha, Xiaojun; Chen, Mingluan; Huang, Yunqing; Feng, Yu-Qi; Yang, Jinshui; Luo, Xiaojin
2013-01-01
Rice (Oryza sativa) has the potential to undergo rapid internodal elongation which determines plant height. Gibberellin is involved in internode elongation. Leucine-rich repeat receptor-like kinases (LRR-RLKs) are the largest subfamily of transmembrane receptor-like kinases in plants. LRR-RLKs play important functions in mediating a variety of cellular processes and regulating responses to environmental signals. LRK1, a PSK receptor homolog, is a member of the LRR-RLK family. In the present study, differences in ectopic expression of LRK1 were consistent with extent of rice internode elongation. Analyses of gene expression demonstrated that LRK1 restricts gibberellin biosynthesis during the internode elongation process by down-regulation of the gibberellin biosynthetic gene coding for ent-kaurene oxidase.
International Nuclear Information System (INIS)
Martin, R.F.; d'Cunha, Glenn; Gibbs, Richard; Murray, Vincent; Pardee, Marshall; Allen, B.J.
1988-01-01
125 I atoms can be introduced at specific locations along a defined DNA target molecule, either by site-directed incorporation of an 125 I-labelled deoxynucleotide or by binding of an 125 I-labelled sequence-selective DNA ligand. After allowing accumulation of 125 I decay-induced damage to the DNA, application of DNA sequencing techniques enables positions of strand breaks to be located relative to the site of decay, at a resolution corresponding to the distance between adjacent nucleotides [0.34 nm]. Thus, DNA provides a molecular framework to analyse the extent of damage following [averaged] individual decay events. Results can be compared with energy deposition data generated by computer-simulation methods developed by Charlton et al. The DNA sequencing technique also provides information about the chemical nature of the termini of the DNA chains produced following Auger decay-induced damage. In addition to reviewing the application of this approach to the analysis of 125 I decay induced DNA damage, some more recent results obtained by using 67 Ga are also presented. (author)
Sun, Ying-Jie; Nishikawa, Kaori; Yuda, Hideki; Wang, Yu-Lai; Osaka, Hitoshi; Fukazawa, Nobuna; Naito, Akira; Kudo, Yoshihisa; Wada, Keiji; Aoki, Shunsuke
2006-09-01
With DNA microarrays, we identified a gene, termed Solo, that is downregulated in the cerebellum of Purkinje cell degeneration mutant mice. Solo is a mouse homologue of rat Trio8-one of multiple Trio isoforms recently identified in rat brain. Solo/Trio8 contains N-terminal sec14-like and spectrin-like repeat domains followed by a single guanine nucleotide exchange factor 1 (GEF1) domain, but it lacks the C-terminal GEF2, immunoglobulin-like, and kinase domains that are typical of Trio. Solo/Trio8 is predominantly expressed in Purkinje neurons of the mouse brain, and expression begins following birth and increases during Purkinje neuron maturation. We identified a novel C-terminal membrane-anchoring domain in Solo/Trio8 that is required for enhanced green fluorescent protein-Solo/Trio8 localization to early endosomes (positive for both early-endosome antigen 1 [EEA1] and Rab5) in COS-7 cells and primary cultured neurons. Solo/Trio8 overexpression in COS-7 cells augmented the EEA1-positive early-endosome pool, and this effect was abolished via mutation and inactivation of the GEF domain or deletion of the C-terminal membrane-anchoring domain. Moreover, primary cultured neurons transfected with Solo/Trio8 showed increased neurite elongation that was dependent on these domains. These results suggest that Solo/Trio8 acts as an early-endosome-specific upstream activator of Rho family GTPases for neurite elongation of developing Purkinje neurons.
Investigation on the toxic interaction of typical plasticizers with calf thymus DNA
Energy Technology Data Exchange (ETDEWEB)
Sun, Xiaojing [School of Environmental Science and Engineering, China–America CRC for Environment & Health, Shandong University, 27# Shanda South Road, Jinan 250100, Shandong Province (China); Zong, Wansong, E-mail: gaocz@sdu.edu.cn [College of Population, Resources and Environment, Shandong Normal University, 88# East Wenhua Road, Jinan 250014 (China); Liu, Chunguang; Liu, Yang [School of Environmental Science and Engineering, China–America CRC for Environment & Health, Shandong University, 27# Shanda South Road, Jinan 250100, Shandong Province (China); Gao, Canzhu, E-mail: rutaoliu@sdu.edu.cn [School of Environmental Science and Engineering, China–America CRC for Environment & Health, Shandong University, 27# Shanda South Road, Jinan 250100, Shandong Province (China); Liu, Rutao [School of Environmental Science and Engineering, China–America CRC for Environment & Health, Shandong University, 27# Shanda South Road, Jinan 250100, Shandong Province (China)
2015-05-15
The interactions of typical plasticizers dimethyl phthalate (DMP), diethyl phthalate (DEP) and dibutyl phthalate (DBP) with calf thymus DNA (ctDNA) were investigated by fluorescence spectroscopic techniques and molecular modeling. Experimental results indicated that the characteristic fluorescence intensity of phthalic acid rose with the increase of DNA concentration; while the characteristic fluorescence intensities of plasticizers decreased with the increase of DNA concentration. Experiments on native and denatured DNA determined that plasticizers interacted with DNA both in groove and electrostatic binding mode. The molecular modeling results further illustrated that there is groove binding between them; hydrogen bonding and Van der Waals interactions were the main forces. With the extension of branched-chains, the binding effects between plasticizers and DNA were weakened, which could be related to the increased steric hindrance. - Highlights: • This work established the binding mode of plasticizers with DNA on molecular level. • The mechanism was explored by fluorescence spectroscopic and molecular docking methods. • There are two kinds of binding mode between DMP, DEP, DBP and DNA, electrostatic and groove. • With the branched chain extension, the binding effect of plasticizers and DNA has been weakened.
Stojković, Marijana Radić; Škugor, Marko; Dudek, Łukasz; Grolik, Jarosław; Eilmes, Julita
2014-01-01
Summary An investigation of the interactions of two novel and several known DBTAA–adenine conjugates with double-stranded DNA and RNA has revealed the DNA/RNA groove as the dominant binding site, which is in contrast to the majority of previously studied DBTAA analogues (DNA/RNA intercalators). Only DBTAA–propyladenine conjugates revealed the molecular recognition of AT-DNA by an ICD band pattern > 300 nm, whereas significant ICD bands did not appear for other ds-DNA/RNA. A structure–activity relation for the studied series of compounds showed that the essential structural features for the ICD recognition are a) the presence of DNA-binding appendages (adenine side chain and positively charged side chain) on both DBTAA side chains, and b) the presence of a short propyl linker, which does not support intramolecular aromatic stacking between DBTAA and adenine. The observed AT-DNA-ICD pattern differs from previously reported ss-DNA (poly dT) ICD recognition by a strong negative ICD band at 350 nm, which allows for the dynamic differentiation between ss-DNA (poly dT) and coupled ds-AT-DNA. PMID:25246976
1,8-cineole inhibits both proliferation and elongation of BY-2 cultured tobacco cells.
Yoshimura, Hiroko; Sawai, Yu; Tamotsu, Satoshi; Sakai, Atsushi
2011-03-01
Volatile monoterpenes such as 1,8-cineole inhibit the growth of Brassica campestris seedlings in a dose-dependent manner, and the growth-inhibitory effects are more severe for roots than hypocotyls. The preferential inhibition of root growth may be explained if the compounds inhibit cell proliferation more severely than cell elongation because root growth requires both elongation and proliferation of the constituent cells, whereas hypocotyl growth depends exclusively on elongation of existing cells. In order to examine this possibility, BY-2 suspension-cultured tobacco (Nicotiana tabacum) cells were treated with 1,8-cineole, and the inhibitory effects on cell proliferation and on cell elongation were assessed quantitatively. Treatment with 1,8-cineole lowered both the mitotic index and elongation of the cells in a dose-dependent manner, and the half-maximal inhibitory concentration (IC₅₀) for cell elongation was lower than that for cell proliferation. Moreover, 1,8-cineole also inhibited starch synthesis, with IC₅₀ lower than that for cell proliferation. Thus, the inhibitory effects of 1,8-cineole were not specific to cell proliferation; rather, 1,8-cineole seemed inhibitory to a variety of physiological activities when it was in direct contact with target cells. Based on these results, possible mechanisms for the mode of action of 1,8-cineole and for its preferential inhibition on root growth are discussed.
Park, Yongjin; Yoon, Sang Sun
2011-01-01
Pseudomonas aeruginosa, a gram-negative bacterium of clinical importance, forms more robust biofilm during anaerobic respiration, a mode of growth presumed to occur in abnormally thickened mucus layer lining the cystic fibrosis (CF) patient airway. However, molecular basis behind this anaerobiosis-triggered robust biofilm formation is not clearly defined yet. Here, we identified a morphological change naturally accompanied by anaerobic respiration in P. aeruginosa and investigated its effect on the biofilm formation in vitro. A standard laboratory strain, PAO1 was highly elongated during anaerobic respiration compared with bacteria grown aerobically. Microscopic analysis demonstrated that cell elongation likely occurred as a consequence of defective cell division. Cell elongation was dependent on the presence of nitrite reductase (NIR) that reduces nitrite (NO2 −) to nitric oxide (NO) and was repressed in PAO1 in the presence of carboxy-PTIO, a NO antagonist, demonstrating that cell elongation involves a process to respond to NO, a spontaneous byproduct of the anaerobic respiration. Importantly, the non-elongated NIR-deficient mutant failed to form biofilm, while a mutant of nitrate reductase (NAR) and wild type PAO1, both of which were highly elongated, formed robust biofilm. Taken together, our data reveal a role of previously undescribed cell biological event in P. aeruginosa biofilm formation and suggest NIR as a key player involved in such process. PMID:21267455
Morel, P A; Dorman, J S; Todd, J A; McDevitt, H O; Trucco, M
1988-01-01
One hundred seventy-two members from 27 randomly selected multiple case Caucasian families of patients with insulin-dependent diabetes mellitus (IDDM) were studied at the DNA level to ascertain the reliability of codon 57 of the HLA-DQ beta-chain gene as a disease protection/susceptibility marker. The analysis was carried out by polymerase chain reaction amplification of DNA encoding the first domain of the DQ beta chain and by dot blot analysis of the amplified material with allele-specific ...
Novel DNA lesions generated by the interaction between therapeutic thiopurines and UVA light.
Zhang, Xiaohong; Jeffs, Graham; Ren, Xiaolin; O'Donovan, Peter; Montaner, Beatriz; Perrett, Conal M; Karran, Peter; Xu, Yao-Zhong
2007-03-01
The therapeutic effect of the thiopurines, 6-thioguanine (6-TG), 6-mercaptopurine, and its prodrug azathioprine, depends on the incorporation of 6-TG into cellular DNA. Unlike normal DNA bases, 6-TG absorbs UVA radiation, and UVA-mediated photochemical damage of DNA 6-TG has potentially harmful side effects. When free 6-TG is UVA irradiated in solution in the presence of molecular oxygen, reactive oxygen species are generated and 6-TG is oxidized to guanine-6-sulfonate (G(SO3)) and guanine-6-thioguanine in reactions involving singlet oxygen. This conversion is prevented by antioxidants, including the dietary vitamin ascorbate. DNA G(SO3) is also the major photoproduct of 6-TG in DNA and it can be selectively introduced into DNA or oligonucleotides in vitro by mild chemical oxidation. Thermal stability measurements indicate that G(SO3) does not form stable base pairs with any of the normal DNA bases in duplex oligonucleotides and is a powerful block for elongation by Klenow DNA polymerase in primer extension experiments. In cultured human cells, DNA damage produced by 6-TG and UVA treatment is associated with replication inhibition and provokes a p53-dependent DNA damage response.
Single DNA denaturation and bubble dynamics
International Nuclear Information System (INIS)
Metzler, Ralf; Ambjoernsson, Tobias; Hanke, Andreas; Fogedby, Hans C
2009-01-01
While the Watson-Crick double-strand is the thermodynamically stable state of DNA in a wide range of temperature and salt conditions, even at physiological conditions local denaturation bubbles may open up spontaneously due to thermal activation. By raising the ambient temperature, titration, or by external forces in single molecule setups bubbles proliferate until full denaturation of the DNA occurs. Based on the Poland-Scheraga model we investigate both the equilibrium transition of DNA denaturation and the dynamics of the denaturation bubbles with respect to recent single DNA chain experiments for situations below, at, and above the denaturation transition. We also propose a new single molecule setup based on DNA constructs with two bubble zones to measure the bubble coalescence and extract the physical parameters relevant to DNA breathing. Finally we consider the interplay between denaturation bubbles and selectively single-stranded DNA binding proteins.
DNA interaction with platinum-based cytostatics revealed by DNA sequencing.
Smerkova, Kristyna; Vaculovic, Tomas; Vaculovicova, Marketa; Kynicky, Jindrich; Brtnicky, Martin; Eckschlager, Tomas; Stiborova, Marie; Hubalek, Jaromir; Adam, Vojtech
2017-12-15
The main mechanism of action of platinum-based cytostatic drugs - cisplatin, oxaliplatin and carboplatin - is the formation of DNA cross-links, which restricts the transcription due to the disability of DNA to enter the active site of the polymerase. The polymerase chain reaction (PCR) was employed as a simplified model of the amplification process in the cell nucleus. PCR with fluorescently labelled dideoxynucleotides commonly employed for DNA sequencing was used to monitor the effect of platinum-based cytostatics on DNA in terms of decrease in labeling efficiency dependent on a presence of the DNA-drug cross-link. It was found that significantly different amounts of the drugs - cisplatin (0.21 μg/mL), oxaliplatin (5.23 μg/mL), and carboplatin (71.11 μg/mL) - were required to cause the same quenching effect (50%) on the fluorescent labelling of 50 μg/mL of DNA. Moreover, it was found that even though the amounts of the drugs was applied to the reaction mixture differing by several orders of magnitude, the amount of incorporated platinum, quantified by inductively coupled plasma mass spectrometry, was in all cases at the level of tenths of μg per 5 μg of DNA. Copyright © 2017 Elsevier Inc. All rights reserved.
pix-1 controls early elongation in parallel with mel-11 and let-502 in Caenorhabditis elegans.
Martin, Emmanuel; Harel, Sharon; Nkengfac, Bernard; Hamiche, Karim; Neault, Mathieu; Jenna, Sarah
2014-01-01
Cell shape changes are crucial for metazoan development. During Caenorhabditis elegans embryogenesis, epidermal cell shape changes transform ovoid embryos into vermiform larvae. This process is divided into two phases: early and late elongation. Early elongation involves the contraction of filamentous actin bundles by phosphorylated non-muscle myosin in a subset of epidermal (hypodermal) cells. The genes controlling early elongation are associated with two parallel pathways. The first one involves the rho-1/RHOA-specific effector let-502/Rho-kinase and mel-11/myosin phosphatase regulatory subunit. The second pathway involves the CDC42/RAC-specific effector pak-1. Late elongation is driven by mechanotransduction in ventral and dorsal hypodermal cells in response to body-wall muscle contractions, and involves the CDC42/RAC-specific Guanine-nucleotide Exchange Factor (GEF) pix-1, the GTPase ced-10/RAC and pak-1. In this study, pix-1 is shown to control early elongation in parallel with let-502/mel-11, as previously shown for pak-1. We show that pix-1, pak-1 and let-502 control the rate of elongation, and the antero-posterior morphology of the embryos. In particular, pix-1 and pak-1 are shown to control head, but not tail width, while let-502 controls both head and tail width. This suggests that let-502 function is required throughout the antero-posterior axis of the embryo during early elongation, while pix-1/pak-1 function may be mostly required in the anterior part of the embryo. Supporting this hypothesis we show that low pix-1 expression level in the dorsal-posterior hypodermal cells is required to ensure high elongation rate during early elongation.
Human mitochondrial DNA (mtDNA) types in Malaysia
International Nuclear Information System (INIS)
Lian, L.H.; Koh, C.L.; Lim, M.E.
2000-01-01
Each human cell contains hundreds of mitochondria and thousands of double-stranded circular mtDNA. The delineation of human mtDNA variation and genetics over the past decade has provided unique and often startling insights into human evolution, degenerative diseases, and aging. Each mtDNA of 16,569 base pairs, encodes 13 polypeptides essential to the enzymes of the mitochondrial energy generating pathway, plus the necessary tRNAs and rRNAs. The highly polymorphic noncoding D-(displacement) loop region, also called the control region, is approximately 1.2 kb long. It contains two well-characterized hypervariable (HV-) regions, HV1 and HV2. MtDNA identification is usually based on these sequence differences. According to the TWTGDAM (Technical Working Group for DNA Analysis Methods), the minimum requirement for a mtDNA database for HV1 is from positions 16024 to 16365 and for HV2, from positions 00073 to 00340. The targeted Malaysian population subgroups for this study were mainly the Malays, Chinese, Indians, and indigenous Ibans, Bidayuhs, Kadazan-Dusuns, and Bajaus. Research methodologies undertaken included DNA extraction of samples from unrelated individuals, amplification of the specific regions via the polymerase chain reaction (PCR), and preparation of template DNA for sequencing by using an automated DNA sequencer. Sufficient nucleotide sequence data were generated from the mtDNA analysis. When the sequences were analyzed, sequence variations were found to be caused by nucleotide substitutions, insertions, and deletions. Of the three causes of the sequence variations, nucleotide substitutions (86.1%) accounted for the vast majority of polymorphism. It is noted that transitions (83.5%) were predominant when compared to the significantly lower frequencies of transversions (2.6%). Insertions (0.9%) and deletions (13.0%) were rather rare and found only in HV2. The data generated will also form the basis of a Malaysian DNA sequence database of mtDNA D
Single DNA denaturation and bubble dynamics
DEFF Research Database (Denmark)
Metzler, Ralf; Ambjörnsson, Tobias; Hanke, Andreas
2009-01-01
While the Watson-Crick double-strand is the thermodynamically stable state of DNA in a wide range of temperature and salt conditions, even at physiological conditions local denaturation bubbles may open up spontaneously due to thermal activation. By raising the ambient temperature, titration......, or by external forces in single molecule setups bubbles proliferate until full denaturation of the DNA occurs. Based on the Poland-Scheraga model we investigate both the equilibrium transition of DNA denaturation and the dynamics of the denaturation bubbles with respect to recent single DNA chain experiments...... for situations below, at, and above the denaturation transition. We also propose a new single molecule setup based on DNA constructs with two bubble zones to measure the bubble coalescence and extract the physical parameters relevant to DNA breathing. Finally we consider the interplay between denaturation...
A Herpesviral Immediate Early Protein Promotes Transcription Elongation of Viral Transcripts
Directory of Open Access Journals (Sweden)
Hannah L. Fox
2017-06-01
Full Text Available Herpes simplex virus 1 (HSV-1 genes are transcribed by cellular RNA polymerase II (RNA Pol II. While four viral immediate early proteins (ICP4, ICP0, ICP27, and ICP22 function in some capacity in viral transcription, the mechanism by which ICP22 functions remains unclear. We observed that the FACT complex (comprised of SSRP1 and Spt16 was relocalized in infected cells as a function of ICP22. ICP22 was also required for the association of FACT and the transcription elongation factors SPT5 and SPT6 with viral genomes. We further demonstrated that the FACT complex interacts with ICP22 throughout infection. We therefore hypothesized that ICP22 recruits cellular transcription elongation factors to viral genomes for efficient transcription elongation of viral genes. We reevaluated the phenotype of an ICP22 mutant virus by determining the abundance of all viral mRNAs throughout infection by transcriptome sequencing (RNA-seq. The accumulation of almost all viral mRNAs late in infection was reduced compared to the wild type, regardless of kinetic class. Using chromatin immunoprecipitation sequencing (ChIP-seq, we mapped the location of RNA Pol II on viral genes and found that RNA Pol II levels on the bodies of viral genes were reduced in the ICP22 mutant compared to wild-type virus. In contrast, the association of RNA Pol II with transcription start sites in the mutant was not reduced. Taken together, our results indicate that ICP22 plays a role in recruiting elongation factors like the FACT complex to the HSV-1 genome to allow for efficient viral transcription elongation late in viral infection and ultimately infectious virion production.
Binary self-assembly of highly symmetric DNA nanocages via sticky-end engineering
Institute of Scientific and Technical Information of China (English)
Xiao-Rong Wu; Chen-Wei Wu; Fei Ding; Cheng Tian; Wen Jiang; Cheng-De Mao; Chuan Zhang
2017-01-01
Discrete and symmetric three-dimensional (3D) DNA nanocages have been revoked as excellent candidates for various applications,such as guest component encapsulation and organization (e.g.dye molecules,proteins,inorganic nanoparticles,etc.) to construct new materials and devices.To date,a large variety of DNA nanocages has been synthesized through assembling small individual DNA motifs into predesigned structures in a bottom-up fashion.Most of them rely on the assembly using multiple copies of single type of motifs and a few sophisticated nanostructures have been engineered by co-assembling multi-types of DNA tiles simultaneously.However,the availability of complex DNA nanocages is still limited.Herein,we demonstrate that highly symmetric DNA nanocages consisted of binary DNA pointstar motifs can be easily assembled by deliberately engineering the sticky-end interaction between the component building blocks.As such,DNA nanocages with new geometries,including elongated tetrahedron (E-TET),rhombic dodecahedron (R-DOD),and rhombic triacontahedron (R-TRI) are successfully synthesized.Moreover,their design principle,assembly process,and structural features are revealed by polyacryalmide gel electrophoresis (PAGE),atomic force microscope (AFM) imaging,and cryogenic transmission electron microscope imaging (cryo-TEM) associated with single particle reconstruction.
StpA and Hha stimulate pausing by RNA polymerase by promoting DNA-DNA bridging of H-NS filaments.
Boudreau, Beth A; Hron, Daniel R; Qin, Liang; van der Valk, Ramon A; Kotlajich, Matthew V; Dame, Remus T; Landick, Robert
2018-06-20
In enterobacteria, AT-rich horizontally acquired genes, including virulence genes, are silenced through the actions of at least three nucleoid-associated proteins (NAPs): H-NS, StpA and Hha. These proteins form gene-silencing nucleoprotein filaments through direct DNA binding by H-NS and StpA homodimers or heterodimers. Both linear and bridged filaments, in which NAPs bind one or two DNA segments, respectively, have been observed. Hha can interact with H-NS or StpA filaments, but itself lacks a DNA-binding domain. Filaments composed of H-NS alone can inhibit transcription initiation and, in the bridged conformation, slow elongating RNA polymerase (RNAP) by promoting backtracking at pause sites. How the other NAPs modulate these effects of H-NS is unknown, despite evidence that they help regulate subsets of silenced genes in vivo (e.g. in pathogenicity islands). Here we report that Hha and StpA greatly enhance H-NS-stimulated pausing by RNAP at 20°C. StpA:H-NS or StpA-only filaments also stimulate pausing at 37°C, a temperature at which Hha:H-NS or H-NS-only filaments have much less effect. In addition, we report that both Hha and StpA greatly stimulate DNA-DNA bridging by H-NS filaments. Together, these observations indicate that Hha and StpA can affect H-NS-mediated gene regulation by stimulating bridging of H-NS/DNA filaments.
Transcription of tandemly repetitive DNA: functional roles.
Biscotti, Maria Assunta; Canapa, Adriana; Forconi, Mariko; Olmo, Ettore; Barucca, Marco
2015-09-01
A considerable fraction of the eukaryotic genome is made up of satellite DNA constituted of tandemly repeated sequences. These elements are mainly located at centromeres, pericentromeres, and telomeres and are major components of constitutive heterochromatin. Although originally satellite DNA was thought silent and inert, an increasing number of studies are providing evidence on its transcriptional activity supporting, on the contrary, an unexpected dynamicity. This review summarizes the multiple structural roles of satellite noncoding RNAs at chromosome level. Indeed, satellite noncoding RNAs play a role in the establishment of a heterochromatic state at centromere and telomere. These highly condensed structures are indispensable to preserve chromosome integrity and genome stability, preventing recombination events, and ensuring the correct chromosome pairing and segregation. Moreover, these RNA molecules seem to be involved also in maintaining centromere identity and in elongation, capping, and replication of telomere. Finally, the abnormal variation of centromeric and pericentromeric DNA transcription across major eukaryotic lineages in stress condition and disease has evidenced the critical role that these transcripts may play and the potentially dire consequences for the organism.
Microbial chain elongation based on methanol
Chen, Wei-Shan
2017-01-01
Our society relies heavily on fossil resources to fulfill our energy and commodity demands and this dependence has led to negative economic, environmental and societal consequences. The re-generation rate of fossil resources is much slower than their consumption rate, making these resources a
Evaluation of a Solid Phase DNA Binding Matrix for Downstream PCR Analysis
National Research Council Canada - National Science Library
Bader, Douglas E; Fisher, Glen R; Stratilo, Chad W
2005-01-01
A commercially available solid-phase DNA binding matrix (FTA cards) was evaluated for its ability to capture and release DNA for downstream gene amplification and detection assays using polymerase chain reaction (PCR...
Zhao, Fangzhou; Yu, Chien-Hung; Liu, Yi
2017-08-21
Codon usage biases are found in all eukaryotic and prokaryotic genomes and have been proposed to regulate different aspects of translation process. Codon optimality has been shown to regulate translation elongation speed in fungal systems, but its effect on translation elongation speed in animal systems is not clear. In this study, we used a Drosophila cell-free translation system to directly compare the velocity of mRNA translation elongation. Our results demonstrate that optimal synonymous codons speed up translation elongation while non-optimal codons slow down translation. In addition, codon usage regulates ribosome movement and stalling on mRNA during translation. Finally, we show that codon usage affects protein structure and function in vitro and in Drosophila cells. Together, these results suggest that the effect of codon usage on translation elongation speed is a conserved mechanism from fungi to animals that can affect protein folding in eukaryotic organisms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Derbyshire, Paul; McCann, Maureen C; Roberts, Keith
2007-06-17
Cell elongation is mainly limited by the extensibility of the cell wall. Dicotyledonous primary (growing) cell walls contain cellulose, xyloglucan, pectin and proteins, but little is known about how each polymer class contributes to the cell wall mechanical properties that control extensibility. We present evidence that the degree of pectin methyl-esterification (DE%) limits cell growth, and that a minimum level of about 60% DE is required for normal cell elongation in Arabidopsis hypocotyls. When the average DE% falls below this level, as in two gibberellic acid (GA) mutants ga1-3 and gai, and plants expressing pectin methyl-esterase (PME1) from Aspergillus aculeatus, then hypocotyl elongation is reduced. Low average levels of pectin DE% are associated with reduced cell elongation, implicating PMEs, the enzymes that regulate DE%, in the cell elongation process and in responses to GA. At high average DE% other components of the cell wall limit GA-induced growth.
Directory of Open Access Journals (Sweden)
Derbyshire Paul
2007-06-01
Full Text Available Abstract Background Cell elongation is mainly limited by the extensibility of the cell wall. Dicotyledonous primary (growing cell walls contain cellulose, xyloglucan, pectin and proteins, but little is known about how each polymer class contributes to the cell wall mechanical properties that control extensibility. Results We present evidence that the degree of pectin methyl-esterification (DE% limits cell growth, and that a minimum level of about 60% DE is required for normal cell elongation in Arabidopsis hypocotyls. When the average DE% falls below this level, as in two gibberellic acid (GA mutants ga1-3 and gai, and plants expressing pectin methyl-esterase (PME1 from Aspergillus aculeatus, then hypocotyl elongation is reduced. Conclusion Low average levels of pectin DE% are associated with reduced cell elongation, implicating PMEs, the enzymes that regulate DE%, in the cell elongation process and in responses to GA. At high average DE% other components of the cell wall limit GA-induced growth.
International Nuclear Information System (INIS)
Shwartz, H.; Livneh, Z.
1987-01-01
During in vitro replication of UV-irradiated single-stranded DNA with Escherichia coli DNA polymerase III holoenzyme termination frequently occurs at pyrimidine photodimers. The termination stage is dynamic and characterized by at least three different events: repeated dissociation-reinitiation cycles of the polymerase at the blocked termini; extensive hydrolysis of ATP to ADP and inorganic phosphate; turnover of dNTPs into dNMP. The reinitiation events are nonproductive and are not followed by further elongation. The turnover of dNTPs into dNMPs is likely to result from repeated cycles of insertion of dNMP residues opposite the blocking lesions followed by their excision by the 3'----5' exonucleolytic activity of the polymerase. Although all dNTPs are turned over, there is a preference for dATP, indicating that DNA polymerase III holoenzyme has a preference for inserting a dAMP residue opposite blocking pyrimidine photodimers. We suggest that the inability of the polymerase to bypass photodimers during termination is due to the formation of defective initiation-like complexes with reduced stability at the blocked termini
Stereotypical reaching movements of the octopus involve both bend propagation and arm elongation.
Hanassy, S; Botvinnik, A; Flash, T; Hochner, B
2015-05-13
The bend propagation involved in the stereotypical reaching movement of the octopus arm has been extensively studied. While these studies have analyzed the kinematics of bend propagation along the arm during its extension, possible length changes have been ignored. Here, the elongation profiles of the reaching movements of Octopus vulgaris were assessed using three-dimensional reconstructions. The analysis revealed that, in addition to bend propagation, arm extension movements involve elongation of the proximal part of the arm, i.e., the section from the base of the arm to the propagating bend. The elongations are quite substantial and highly variable, ranging from an average strain along the arm of -0.12 (i.e. shortening) up to 1.8 at the end of the movement (0.57 ± 0.41, n = 64 movements, four animals). Less variability was discovered in an additional set of experiments on reaching movements (0.64 ± 0.28, n = 30 movements, two animals), where target and octopus positions were kept more stationary. Visual observation and subsequent kinematic analysis suggest that the reaching movements can be broadly segregated into two groups. The first group involves bend propagation beginning at the base of the arm and propagating towards the arm tip. In the second, the bend is formed or present more distally and reaching is achieved mainly by elongation and straightening of the segment proximal to the bend. Only in the second type of movements is elongation significantly positively correlated with the distance of the bend from the target. We suggest that reaching towards a target is generated by a combination of both propagation of a bend along the arm and arm elongation. These two motor primitives may be combined to create a broad spectrum of reaching movements. The dynamical model, which recapitulates the biomechanics of the octopus muscular hydrostatic arm, suggests that achieving the observed elongation requires an extremely low ratio of longitudinal to transverse muscle
[Sugar Chain Construction of Functional Natural Products Using Plant Glucosyltransferases].
Mizukami, Hajime
2015-01-01
Plant secondary product glycosyltransferases belong to family 1 of the glycosyltransferase superfamily and mediate the transfer of a glycosyl residue from activated nucleotide sugars to lipophilic small molecules, thus affecting the solubility, stability and pharmacological activities of the sugar-accepting compounds. The biotechnological application of plant glycosyltransferases in glycoside synthesis has attracted attention because enzymatic glycosylation offers several advantages over chemical methods, including (1) avoiding the use of harsh conditions and toxic catalysts, (2) providing strict control of regio-and stereo-selectivity and (3) high efficiency. This review describes the in vivo and in vitro glycosylation of natural organic compounds using glycosyltransferases, focusing on our investigation of enzymatic synthesis of curcumin glycosides. Our current efforts toward functional characterization of some glycosyltransferases involved in the biosynthesis of iridoids and crocin, as well as in the sugar chain elongation of quercetin glucosides, are described. Finally, I describe the relationship of the structure of sugar chains and the intestinal absorption which was investigated using chemoenzymatically synthesized quercetin glycosides.
Directory of Open Access Journals (Sweden)
Qiao Yingjuan
2008-01-01
Full Text Available Abstract Background DNA methylation based techniques are important tools in both clinical diagnostics and therapeutics. But most of these methods only analyze a few CpG sites in a target region. Indeed, difference of site-specific methylation may also lead to a change of methylation density in many cases, and it has been found that the density of methylation is more important than methylation of single CpG site for gene silencing. Results We have developed a novel approach for quantitative analysis of CpG methylation density on the basis of microarray-based hybridization and incorporation of Cy5-dCTP into the Cy3 labeled target DNA by using Taq DNA Polymerase on microarray. The quantification is achieved by measuring Cy5/Cy3 signal ratio which is proportional to methylation density. This methylation-sensitive technique, termed RMEAM (regional methylation elongation assay on microarray, provides several advantages over existing methods used for methylation analysis. It can determine an exact methylation density of the given region, and has potential of high throughput. We demonstrate a use of this method in determining the methylation density of the promoter region of the tumor-related gene MLH1, TERT and MGMT in colorectal carcinoma patients. Conclusion This technique allows for quantitative analysis of regional methylation density, which is the representative of all allelic methylation patterns in the sample. The results show that this technique has the characteristics of simplicity, rapidness, specificity and high-throughput.
Microscopic theory of light-induced deformation in amorphous side-chain azobenzene polymers.
Toshchevikov, V; Saphiannikova, M; Heinrich, G
2009-04-16
We propose a microscopic theory of light-induced deformation of side-chain azobenzene polymers taking into account the internal structure of polymer chains. Our theory is based on the fact that interaction of chromophores with the polarized light leads to the orientation anisotropy of azobenzene macromolecules which is accompanied by the appearance of mechanical stress. It is the first microscopic theory which provides the value of the light-induced stress larger than the yield stress. This result explains a possibility for the inscription of surface relief gratings in glassy side-chain azobenzene polymers. For some chemical architectures, elongation of a sample demonstrates a nonmonotonic behavior with the light intensity and can change its sign (a stretched sample starts to be uniaxially compressed), in agreement with experiments. Using a viscoplastic approach, we show that the irreversible strain of a sample, which remains after the light is switched off, decreases with increasing temperature and can disappear at certain temperature below the glass transition temperature. This theoretical prediction is also confirmed by recent experiments.
A morphospace for reef fishes: elongation is the dominant axis of body shape evolution.
Directory of Open Access Journals (Sweden)
Thomas Claverie
Full Text Available Tropical reef fishes are widely regarded as being perhaps the most morphologically diverse vertebrate assemblage on earth, yet much remains to be discovered about the scope and patterns of this diversity. We created a morphospace of 2,939 species spanning 56 families of tropical Indo-Pacific reef fishes and established the primary axes of body shape variation, the phylogenetic consistency of these patterns, and whether dominant patterns of shape change can be accomplished by diverse underlying changes. Principal component analysis showed a major axis of shape variation that contrasts deep-bodied species with slender, elongate forms. Furthermore, using custom methods to compare the elongation vector (axis that maximizes elongation deformation and the main vector of shape variation (first principal component for each family in the morphospace, we showed that two thirds of the families diversify along an axis of body elongation. Finally, a comparative analysis using a principal coordinate analysis based on the angles among first principal component vectors of each family shape showed that families accomplish changes in elongation with a wide range of underlying modifications. Some groups such as Pomacentridae and Lethrinidae undergo decreases in body depth with proportional increases in all body regions, while other families show disproportionate changes in the length of the head (e.g., Labridae, the trunk or caudal region in all combinations (e.g., Pempheridae and Pinguipedidae. In conclusion, we found that evolutionary changes in body shape along an axis of elongation dominates diversification in reef fishes. Changes in shape on this axis are thought to have immediate implications for swimming performance, defense from gape limited predators, suction feeding performance and access to some highly specialized habitats. The morphological modifications that underlie changes in elongation are highly diverse, suggesting a role for a range of
A Morphospace for Reef Fishes: Elongation Is the Dominant Axis of Body Shape Evolution
Claverie, Thomas; Wainwright, Peter C.
2014-01-01
Tropical reef fishes are widely regarded as being perhaps the most morphologically diverse vertebrate assemblage on earth, yet much remains to be discovered about the scope and patterns of this diversity. We created a morphospace of 2,939 species spanning 56 families of tropical Indo-Pacific reef fishes and established the primary axes of body shape variation, the phylogenetic consistency of these patterns, and whether dominant patterns of shape change can be accomplished by diverse underlying changes. Principal component analysis showed a major axis of shape variation that contrasts deep-bodied species with slender, elongate forms. Furthermore, using custom methods to compare the elongation vector (axis that maximizes elongation deformation) and the main vector of shape variation (first principal component) for each family in the morphospace, we showed that two thirds of the families diversify along an axis of body elongation. Finally, a comparative analysis using a principal coordinate analysis based on the angles among first principal component vectors of each family shape showed that families accomplish changes in elongation with a wide range of underlying modifications. Some groups such as Pomacentridae and Lethrinidae undergo decreases in body depth with proportional increases in all body regions, while other families show disproportionate changes in the length of the head (e.g., Labridae), the trunk or caudal region in all combinations (e.g., Pempheridae and Pinguipedidae). In conclusion, we found that evolutionary changes in body shape along an axis of elongation dominates diversification in reef fishes. Changes in shape on this axis are thought to have immediate implications for swimming performance, defense from gape limited predators, suction feeding performance and access to some highly specialized habitats. The morphological modifications that underlie changes in elongation are highly diverse, suggesting a role for a range of developmental processes
Nonequilibrium Phase Transitions Associated with DNA Replication
2011-02-11
polymerases) catalyzing the growth of a DNA primer strand (the nascent chain of nucleotides complementary to the template strand) based on the Watson ...the fraction (error rate) of monomers for which y, where y is the correct Watson - Crick complementary base of , can be obtained by ¼ X...Nonequilibrium Phase Transitions Associated with DNA Replication Hyung-June Woo* and Anders Wallqvist Biotechnology High Performance Computing
Crowding and hopping in a protein’s diffusive transport on DNA
International Nuclear Information System (INIS)
Koslover, Elena F; Spakowitz, Andrew J; Díaz de la Rosa, Mario
2017-01-01
Diffusion is a ubiquitous phenomenon that impacts virtually all processes that involve random fluctuations, and as such, the foundational work of Smoluchowski has proven to be instrumental in addressing innumerable problems. Here, we focus on a critical biological problem that relies on diffusive transport and is analyzed using a probabilistic treatment originally developed by Smoluchowski. The search of a DNA binding protein for its specific target site is believed to rely on non-specific binding to DNA with transient hops along the chain. In this work, we address the impact of protein crowding along the DNA on the transport of a DNA-binding protein. The crowders dramatically alter the dynamics of the protein while bound to the DNA, resulting in single-file transport that is subdiffusive in nature. However, transient unbinding and hopping results in a long-time behavior (shown to be superdiffusive) that is qualitatively unaffected by the crowding on the DNA. Thus, hopping along the chain mitigates the role that protein crowding has in restricting the translocation dynamics along the chain. The superdiffusion coefficient is influenced by the quantitative values of the effective binding rate, which is influenced by protein crowding. We show that vacancy fraction and superdiffusion coefficient exhibits a non-monotonic relationship under many circumstances. We leverage analytical theory and dynamic Monte Carlo simulations to address this problem. With several additional contributions, the core of our modeling work adopts a reaction-diffusion framework that is based on Smoluchowski’s original work. (paper)
Radiation-induced depression of DNA synthesis in cultured mammalian cells
International Nuclear Information System (INIS)
Povirk, L.F.
1977-01-01
A 313-nm light source was constructed in order to study the mechanisms by which ultraviolet and ionizing radiations inhibit DNA synthesis. It was found that in CHO, MDBK and HeLa cells, grown for one generation in the DNA sensitizer bromodeoxyuridine (BrdUrd), 313-nm light inhibited DNA synthesis with a pattern similar to that of the effect of x-rays on normal cells. A biphasic dose response curve for inhibition of total synthesis was observed, with a sensitive component representing depression of initiation of new replicons and a resistant component representing interference with elongation of replicons already growing at the time of irradiation. Since the BrdUrd plus 313-nm light treatment produces DNA lesions similar to those produced by x-rays (base damage, strand breaks, crosslinks) these results suggest that the effect of x-rays on DNA synthesis is mediated by DNA damage. In experiments with synchronized cells, it was found that in cells in which about half the chromosomes had incorporated BrdUrd, 313-nm light inhibited replication of the BrdUrd-containing DNA, but had no effect on the replication of the unsubstituted DNA in the same cell. Thus the information that DNA is damaged appears to be propagated along the DNA molecule from the sites of damage to the replication initiation sites as some kind of conformational change, possibly a relaxation of superhelical tension. Target theory calculations suggest that a single DNA lesion prevents the initiation of several adjacent replicons
Directory of Open Access Journals (Sweden)
Jennifer R Stevens
Full Text Available Gene transcription is constrained by the nucleosomal nature of chromosomal DNA. This nucleosomal barrier is modulated by FACT, a conserved histone-binding heterodimer. FACT mediates transcription-linked nucleosome disassembly and also nucleosome reassembly in the wake of the RNA polymerase II transcription complex, and in this way maintains the repression of 'cryptic' promoters found within some genes. Here we focus on a novel mutant version of the yeast FACT subunit Spt16 that supplies essential Spt16 activities but impairs transcription-linked nucleosome reassembly in dominant fashion. This Spt16 mutant protein also has genetic effects that are recessive, which we used to show that certain Spt16 activities collaborate with histone acetylation and the activities of a Bur-kinase/Spt4-Spt5/Paf1C pathway that facilitate transcription elongation. These collaborating activities were opposed by the actions of Rpd3S, a histone deacetylase that restores a repressive chromatin environment in a transcription-linked manner. Spt16 activity paralleling that of HirC, a co-repressor of histone gene expression, was also found to be opposed by Rpd3S. Our findings suggest that Spt16, the Bur/Spt4-Spt5/Paf1C pathway, and normal histone abundance and/or stoichiometry, in mutually cooperative fashion, facilitate nucleosome disassembly during transcription elongation. The recessive nature of these effects of the mutant Spt16 protein on transcription-linked nucleosome disassembly, contrasted to its dominant negative effect on transcription-linked nucleosome reassembly, indicate that mutant FACT harbouring the mutant Spt16 protein competes poorly with normal FACT at the stage of transcription-linked nucleosome disassembly, but effectively with normal FACT for transcription-linked nucleosome reassembly. This functional difference is consistent with the idea that FACT association with the transcription elongation complex depends on nucleosome disassembly, and that the
A new building block for DNA network formation by self-assembly and polymerase chain reaction.
Bußkamp, Holger; Keller, Sascha; Robotta, Marta; Drescher, Malte; Marx, Andreas
2014-01-01
The predictability of DNA self-assembly is exploited in many nanotechnological approaches. Inspired by naturally existing self-assembled DNA architectures, branched DNA has been developed that allows self-assembly to predesigned architectures with dimensions on the nanometer scale. DNA is an attractive material for generation of nanostructures due to a plethora of enzymes which modify DNA with high accuracy, providing a toolbox for many different manipulations to construct nanometer scaled objects. We present a straightforward synthesis of a rigid DNA branching building block successfully used for the generation of DNA networks by self-assembly and network formation by enzymatic DNA synthesis. The Y-shaped 3-armed DNA construct, bearing 3 primer strands is accepted by Taq DNA polymerase. The enzyme uses each arm as primer strand and incorporates the branched construct into large assemblies during PCR. The networks were investigated by agarose gel electrophoresis, atomic force microscopy, dynamic light scattering, and electron paramagnetic resonance spectroscopy. The findings indicate that rather rigid DNA networks were formed. This presents a new bottom-up approach for DNA material formation and might find applications like in the generation of functional hydrogels.
Traveling Rocky Roads: The Consequences of Transcription-Blocking DNA Lesions on RNA Polymerase II.
Steurer, Barbara; Marteijn, Jurgen A
2017-10-27
The faithful transcription of eukaryotic genes by RNA polymerase II (RNAP2) is crucial for proper cell function and tissue homeostasis. However, transcription-blocking DNA lesions of both endogenous and environmental origin continuously challenge the progression of elongating RNAP2. The stalling of RNAP2 on a transcription-blocking lesion triggers a series of highly regulated events, including RNAP2 processing to make the lesion accessible for DNA repair, R-loop-mediated DNA damage signaling, and the initiation of transcription-coupled DNA repair. The correct execution and coordination of these processes is vital for resuming transcription following the successful repair of transcription-blocking lesions. Here, we outline recent insights into the molecular consequences of RNAP2 stalling on transcription-blocking DNA lesions and how these lesions are resolved to restore mRNA synthesis. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Tang, Rupei; Palumbo, R Noelle; Nagarajan, Lakshmi; Krogstad, Emily; Wang, Chun
2010-03-03
The development of safe and efficient polymer carriers for DNA vaccine delivery requires mechanistic understanding of structure-function relationship of the polymer carriers and their interaction with antigen-presenting cells. Here we have synthesized a series of diblock copolymers with well-defined chain-length using atom transfer radical polymerization and characterized the influence of polycation chain-length on the physico-chemical properties of the polymer/DNA complexes as well as the interaction with dendritic cells. The copolymers consist of a hydrophilic poly(ethylene glycol) block and a cationic poly(aminoethyl methacrylate) (PAEM) block. The average degree of polymerization (DP) of the PAEM block was varied among 19, 39, and 75, with nearly uniform distribution. With increasing PAEM chain-length, polyplexes formed by the diblock copolymers and plasmid DNA had smaller average particle size and showed higher stability against electrostatic destabilization by salt and heparin. The polymers were not toxic to mouse dendritic cells (DCs) and only displayed chain-length-dependent toxicity at a high concentration (1mg/mL). In vitro gene transfection efficiency and polyplex uptake in DCs were also found to correlate with chain-length of the PAEM block with the longer polymer chain favoring transfection and cellular uptake. The polyplexes induced a modest up-regulation of surface markers for DC maturation that was not significantly dependent on PAEM chain-length. Finally, the polyplex prepared from the longest PAEM block (DP of 75) achieved an average of 20% enhancement over non-condensed anionic dextran in terms of uptake by DCs in the draining lymph nodes 24h after subcutaneous injection into mice. Insights gained from studying such structurally well-defined polymer carriers and their interaction with dendritic cells may contribute to improved design of practically useful DNA vaccine delivery systems. Copyright 2009 Elsevier B.V. All rights reserved.
Methylation effect on the ohmic resistance of a poly-GC DNA-like chain
Energy Technology Data Exchange (ETDEWEB)
Moura, F.A.B.F. de, E-mail: fidelis@fis.ufal.br [Instituto de Física, Universidade Federal de Alagoas, Maceió AL 57072-970 (Brazil); Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, Maceió AL 57072-970 (Brazil); Almeida, M.L. de; Ourique, G.S.; Fulco, U.L.; Albuquerque, E.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil)
2016-10-14
We determine, by using a tight-binding model Hamiltonian, the characteristic current–voltage (IxV) curves of a 5-methylated cytosine single strand poly-GC DNA-like finite segment, considering the methyl groups attached laterally to a random fraction of the cytosine basis. Striking, we found that the methylation significantly impacts the ohmic resistance (R) of the DNA-like segments, indicating that measurements of R can be used as a biosensor tool to probe the presence of anomalous methylation. - Highlights: • Ohmic resistance of finite segments of poly-CG DNA-like segments. • Possibility for the development of biosensor devices. • Methylation effect and electronic transport in DNA-like segments.
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Esquivel-Elizondo, Sofia; Miceli, Joseph; Torres, Cesar I; Krajmalnik-Brown, Rosa
2018-02-01
Medium-chain fatty acids (MCFA) are important biofuel precursors. Carbon monoxide (CO) is a sustainable electron and carbon donor for fatty acid elongation, since it is metabolized to MCFA precursors, it is toxic to most methanogens, and it is a waste product generated in the gasification of waste biomass. The main objective of this work was to determine if the inhibition of methanogenesis through the continuous addition of CO would lead to increased acetate or MCFA production during fermentation of ethanol. The effects of CO partial pressures (P CO ; 0.08-0.3 atm) on methanogenesis, fatty acids production, and the associated microbial communities were studied in batch cultures fed with CO and ethanol. Methanogenesis was partially inhibited at P CO ≥ 0.11 atm. This inhibition led to increased acetate production during the first phase of fermentation (0-19 days). However, a second addition of ethanol (day 19) triggered MCFA production only at P CO ≥ 0.11 atm, which probably occurred through the elongation of acetate with CO-derived ethanol and H 2 :CO 2 . Accordingly, during the second phase of fermentation (days 20-36), the distribution of electrons to acetate decreased at higher P CO , while electrons channeled to MCFA increased. Most probably, Acetobacterium, Clostridium, Pleomorphomonas, Oscillospira, and Blautia metabolized CO to H 2 :CO 2 , ethanol and/or fatty acids, while Peptostreptococcaceae, Lachnospiraceae, and other Clostridiales utilized these metabolites, along with the provided ethanol, for MCFA production. These results are important for biotechnological systems where fatty acids production are preferred over methanogenesis, such as in chain elongation systems and microbial fuel cells. © 2017 Wiley Periodicals, Inc.
Effect of Cisplatin on the Flexibility of Linear DNA
International Nuclear Information System (INIS)
Ji Chao; Zhang Ling-Yun; Hou Xi-Miao; Dou Shuo-Xing; Wang Peng-Ye
2011-01-01
With the aid of an atomic force microscope (AFM), we study the interaction between linear DNA fragment and cisplatin. For different cisplatin concentrations, the AFM used to observe the conformation of DNA has a gradual change. The contour length, the end-to-end distance and the local bend angles of the linear DNA fragment can be accurately measured. The persistence length of DNA interacting with cisplatin is decreased with the increasing cisplatin concentration. Furthermore, it is demonstrated that the local bend angles of DNA chains are increased by the binding interaction of cisplatin. (cross-disciplinary physics and related areas of science and technology)
Dielectrophoresis of gold nanoparticles conjugated to DNA origami structures
Directory of Open Access Journals (Sweden)
Anja Henning-Knechtel
2016-07-01
Full Text Available DNA nanostructures are promising construction materials to bridge the gap between self-assembly of functional molecules and conventional top-down fabrication methods in nanotechnology. Their positioning onto specific locations of a microstructured substrate is an important task towards this aim. Here we study manipulation and positioning of pristine and of gold nanoparticle-conjugated tubular DNA origami structures using ac dielectrophoresis. The dielectrophoretic behavior was investigated employing fluorescence microscopy. For the pristine origami, a significant dielectrophoretic response was found to take place in the megahertz range, whereas, due to the higher polarizability of the metallic nanoparticles, the nanoparticle/DNA hybrid structures required a lower electrical field strength and frequency for a comparable trapping at the edges of the electrode structure. The nanoparticle conjugation additionally resulted in a remarkable alteration of the DNA structure arrangement. The growth of linear, chain-like structures in between electrodes at applied frequencies in the megahertz range was observed. The long-range chain formation is caused by a local, gold nanoparticle-induced field concentration along the DNA nanostructures, which in turn, creates dielectrophoretic forces that enable the observed self-alignment of the hybrid structures.
Galactosylated DNA lipid nanocapsules for efficient hepatocyte targeting.
Morille, M; Passirani, C; Letrou-Bonneval, E; Benoit, J-P; Pitard, B
2009-09-11
The main objective of gene therapy via a systemic pathway is the development of a stable and non-toxic gene vector that can encapsulate and deliver foreign genetic materials into specific cell types with the transfection efficiency of viral vectors. With this objective, DNA complexed with cationic lipids of DOTAP/DOPE was encapsulated into lipid nanocapsules (LNCs) forming nanocarriers (DNA LNCs) with a size suitable for systemic injection (109+/-6 nm). With the goal of increasing systemic delivery, LNCs were stabilised with long chains of poly(ethylene glycol) (PEG), either from a PEG lipid derivative (DSPE-mPEG(2000)) or from an amphiphilic block copolymer (F108). In order to overcome internalisation difficulties encountered with PEG shield, a specific ligand (galactose) was covalently added at the distal end of the PEG chains, in order to provide active targeting of the asialoglycoprotein-receptor present on hepatocytes. This study showed that DNA LNCs were as efficient as positively charged DOTAP/DOPE lipoplexes for transfection. In primary hepatocytes, when non-galactosylated, the two polymers significantly decreased the transfection, probably by creating a barrier around the DNA LNCs. Interestingly, galactosylated F108 coated DNA LNCs led to a 18-fold increase in luciferase expression compared to non-galactosylated ones.
A rapid and low-cost DNA extraction method for isolating ...
African Journals Online (AJOL)
The price of commercial DNA extraction methods makes the routine use of polymerase chain reaction amplification (PCR) based methods rather costly for scientists in developing countries. A guanidium thiocayante-based DNA extraction method was investigated in this study for the isolation of Escherichia coli (E. coli) DNA ...
International Nuclear Information System (INIS)
ArchMiller, M. C.; Cianciosa, M. R.; Ennis, D. A.; Hanson, J. D.; Hartwell, G. J.; Hebert, J. D.; Herfindal, J. L.; Knowlton, S. F.; Ma, X.; Maurer, D. A.; Pandya, M. D.; Traverso, P.
2014-01-01
The passive stability of vertically elongated current-carrying toroidal plasmas has been investigated in the Compact Toroidal Hybrid, a stellarator/tokamak hybrid device. In this experiment, the fractional transform f, defined as the ratio of the imposed external rotational transform from stellarator coils to the total rotational transform, was varied from 0.04 to 0.50, and the elongation κ was varied from 1.4 to 2.2. Plasmas that were vertically unstable were evidenced by motion of the plasma in the vertical direction. Vertical drifts are measured with a set of poloidal field pickup coils. A three chord horizontally viewing interferometer and a soft X-ray diode array confirmed the drifts. Plasmas with low fractional transform and high elongation are the most susceptible to vertical instability, consistent with analytic predictions that the vertical mode in elongated plasmas can be stabilized by the poloidal field of a relatively weak stellarator equilibrium
Kinetic Analysis of the Bypass of a Bulky DNA Lesion Catalyzed by Human Y-family DNA Polymerases
Sherrer, Shanen M.; Sanman, Laura E.; Xia, Cynthia X.; Bolin, Eric R.; Malik, Chanchal K.; Efthimiopoulos, Georgia; Basu, Ashis K.; Suo, Zucai
2012-01-01
1-Nitropyrene (1-NP), a mutagen and potential carcinogen, is the most abundant nitro polyaromatic hydrocarbon in diesel exhaust, which reacts with DNA to form predominantly N-(deoxyguanosin-8-yl)-1-aminopyrene (dGAP). If not repaired, this DNA lesion is presumably bypassed in vivo by any of human Y-family DNA polymerases kappa (hPolκ), iota (hPolτ), eta (hPolη), and Rev1 (hRev1). Our running start assays demonstrated that each of these enzymes was indeed capable of traversing a site-specifically placed dGAP on a synthetic DNA template but hRev1 was stopped after lesion bypass. The time required to bypass 50% of the dGAP sites (t50bypass ) encountered by hPolη, hPolκ and hPolτ was determined to be 2.5 s, 4.1 s, and 106.5 s, respectively. The efficiency order of catalyzing translesion synthesis of dGAP (hPolη > hPolκ > hPolτ >> hRev1) is the same as the order for these human Y-family enzymes to elongate undamaged DNA. Although hPolη bypassed dGAP efficiently, replication by both hPolκ and hPolτ was strongly stalled at the lesion site and at a site immediately downstream from dGAP. By employing pre-steady state kinetic methods, a kinetic basis was established for polymerase pausing at these DNA template sites. Besides efficiency of bypass, the fidelity of those low-fidelity polymerases at these pause sites was also significantly decreased. Thus, if the translesion DNA synthesis of dGAP in vivo is catalyzed by a human Y-family DNA polymerase, e.g. hPolη, the process is certainly mutagenic. PMID:22324639
The high temperature out-of-pile test of LVDT for elongation measurement of fuel pellet
Energy Technology Data Exchange (ETDEWEB)
Son, J. M.; Kim, B. K.; Jo, M. S.; Joo, K. N.; Park, S. J.; Gang, Y. H.; Kim, Y. J. [KAERI, Taejon (Korea, Republic of)
2003-10-01
As a part of the development of instrumentation technologies for the nuclear fuel irradiation test in HANARO(High-flux Advanced Nuclear Application Reactor), the elongation measurement technique of the fuel pellet is being developed using LVDT(Linear Variable Differential Transformer). The well qualified out-of-pile test were needed to understand the LVDT's detail characteristics at high temperature for the detail design of the fuel irradiation instrumented capsule, because LVDT is very sensitive to variation of temperature. Therefore, the high temperature out-of-pile test system for fuel pellet elongation was developed, and this test was performed under the temperature condition between room temperature and 300 .deg. C with increasing the elongation from 0 to 5 mm. The LVDT's high temperature characteristics and temperature sensitivity of LVDT were analyzed through this experiment. Based on the result of this test, the method for the application of LVDT and elongation detector at high temperature was introduced. It is known that the results will be used to predict accurately the elongation of fuel pellet during irradiation test.
A pollen-specific RALF from tomato that regulates pollen tube elongation.
Covey, Paul A; Subbaiah, Chalivendra C; Parsons, Ronald L; Pearce, Gregory; Lay, Fung T; Anderson, Marilyn A; Ryan, Clarence A; Bedinger, Patricia A
2010-06-01
Rapid Alkalinization Factors (RALFs) are plant peptides that rapidly increase the pH of plant suspension cell culture medium and inhibit root growth. A pollen-specific tomato (Solanum lycopersicum) RALF (SlPRALF) has been identified. The SlPRALF gene encodes a preproprotein that appears to be processed and released from the pollen tube as an active peptide. A synthetic SlPRALF peptide based on the putative active peptide did not affect pollen hydration or viability but inhibited the elongation of normal pollen tubes in an in vitro growth system. Inhibitory effects of SlPRALF were detectable at concentrations as low as 10 nm, and complete inhibition was observed at 1 mum peptide. At least 10-fold higher levels of alkSlPRALF, which lacks disulfide bonds, were required to see similar effects. A greater effect of peptide was observed in low-pH-buffered medium. Inhibition of pollen tube elongation was reversible if peptide was removed within 15 min of exposure. Addition of 100 nm SlPRALF to actively growing pollen tubes inhibited further elongation until tubes were 40 to 60 mum in length, after which pollen tubes became resistant to the peptide. The onset of resistance correlated with the timing of the exit of the male germ unit from the pollen grain into the tube. Thus, exogenous SlPRALF acts as a negative regulator of pollen tube elongation within a specific developmental window.
International Nuclear Information System (INIS)
Jung, Nam Young; Bae, Won Jin; Chang, Jeong Ho; Kim, Young Chang; Cho, Yunje
2008-01-01
Mcm10 is a highly conserved nuclear protein that plays a key role in the initiation and elongation processes of DNA replication by providing a physical link between the Mcm2–7 complex and DNA polymerases. In this study, the central domain of human Mcm10 was crystallized using the hanging-drop vapour-diffusion method in the presence of PEG 3350. The initiation of eukaryotic DNA replication requires the tightly controlled assembly of a set of replication factors. Mcm10 is a highly conserved nuclear protein that plays a key role in the initiation and elongation processes of DNA replication by providing a physical link between the Mcm2–7 complex and DNA polymerases. The central domain, which contains the CCCH zinc-binding motif, is most conserved within Mcm10 and binds to DNA and several proteins, including proliferative cell nuclear antigen. In this study, the central domain of human Mcm10 was crystallized using the hanging-drop vapour-diffusion method in the presence of PEG 3350. An X-ray diffraction data set was collected to a resolution of 2.6 Å on a synchrotron beamline. The crystals formed belonged to space group R3, with unit-cell parameters a = b = 99.5, c = 133.0 Å. According to Matthews coefficient calculations, the crystals were predicted to contain six MCM10 central domain molecules in the asymmetric unit
DEFF Research Database (Denmark)
Hobolth, Asger
2008-01-01
-dimensional integrals required in the EM algorithm are estimated using MCMC sampling. The MCMC sampler requires simulation of sample paths from a continuous time Markov process, conditional on the beginning and ending states and the paths of the neighboring sites. An exact path sampling algorithm is developed......The evolution of DNA sequences can be described by discrete state continuous time Markov processes on a phylogenetic tree. We consider neighbor-dependent evolutionary models where the instantaneous rate of substitution at a site depends on the states of the neighboring sites. Neighbor......-dependent substitution models are analytically intractable and must be analyzed using either approximate or simulation-based methods. We describe statistical inference of neighbor-dependent models using a Markov chain Monte Carlo expectation maximization (MCMC-EM) algorithm. In the MCMC-EM algorithm, the high...
Molecular cloning and expression in mammalian cells of ricin B chain
International Nuclear Information System (INIS)
Chang, M.
1987-01-01
In these studies, the cDNA encoding the B chain of ricin has been cloned and expressed in monkey kidney COS-M6 cells. The recombinant B chain was detected by labeling the transfected cells with 35 S-methionine and 35 S-cysteine and demonstrating secretion of a protein with a Mr of 30-32,000 which was not present in the medium of mock-transfected COS-M6 cells. This protein was specifically immunoprecipitated by an anti-ricin or anti-B chain antibody. The amount of recombinant B chain secreted by the COS-M6 cells was determined by radioimmunoassay to be 1-10 ng/ml of media. Virtually all the recombinant B chain formed active ricin when mixed with native A chain; it could also bind as effectively as native B chain to the galactose-containing glycoprotein, asialofetuin. These results indicate that the vast majority of recombinant B chains secreted into the medium of the COS-M6 cells retain biological function
Directory of Open Access Journals (Sweden)
Matthias Tenbusch
Full Text Available BACKGROUND: Targeting antigens encoded by DNA vaccines to dendritic cells (DCs in the presence of adjuvants enhances their immunogenicity and efficacy in mice. METHODOLOGY/PRINCIPAL FINDINGS: To explore the immunogenicity of this approach in non-human primates, we generated a single chain antibody to the antigen uptake receptor DEC-205 expressed on rhesus macaque DCs. DNA vaccines encoding this single chain antibody fused to the SIV capsid protein were delivered to six monkeys each by either intramuscular electroporation or conventional intramuscular injection co-injected or not with poly ICLC, a stabilized poly I: C analogue, as adjuvant. Antibodies to capsid were induced by the DC-targeting and non-targeting control DNA delivered by electroporation while conventional DNA immunization at a 10-fold higher dose of DNA failed to induce detectable humoral immune responses. Substantial cellular immune responses were also observed after DNA electroporation of both DNAs, but stronger responses were induced by the non-targeting vaccine. Conventional immunization with the DC-targeting DNA at a 10-fold higher dose did not give rise to substantial cellular immune responses, neither when co-injected with poly ICLC. CONCLUSIONS/SIGNIFICANCE: The study confirms the potent immunogenicity of DNA vaccines delivered by electroporation. Targeting the DNA via a single chain antibody to DEC-205 expressed by DCs, however, does not improve the immunogenicity of the antigens in non-human primates.
Influence of ovarian muscle contraction and oocyte growth on egg chamber elongation in Drosophila.
Andersen, Darcy; Horne-Badovinac, Sally
2016-04-15
Organs are formed from multiple cell types that make distinct contributions to their shape. The Drosophila egg chamber provides a tractable model to dissect such contributions during morphogenesis. Egg chambers consist of 16 germ cells (GCs) surrounded by a somatic epithelium. Initially spherical, these structures elongate as they mature. This morphogenesis is thought to occur through a 'molecular corset' mechanism, whereby structural elements within the epithelium become circumferentially organized perpendicular to the elongation axis and resist the expansive growth of the GCs to promote elongation. Whether this epithelial organization provides the hypothesized constraining force has been difficult to discern, however, and a role for GC growth has not been demonstrated. Here, we provide evidence for this mechanism by altering the contractile activity of the tubular muscle sheath that surrounds developing egg chambers. Muscle hypo-contraction indirectly reduces GC growth and shortens the egg, which demonstrates the necessity of GC growth for elongation. Conversely, muscle hyper-contraction enhances the elongation program. Although this is an abnormal function for this muscle, this observation suggests that a corset-like force from the egg chamber's exterior could promote its lengthening. These findings highlight how physical contributions from several cell types are integrated to shape an organ. © 2016. Published by The Company of Biologists Ltd.
cDNA encoding a polypeptide including a hevein sequence
Energy Technology Data Exchange (ETDEWEB)
Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.
1993-02-16
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.
Direct DNA extraction method of an obligate parasitic fungus from infected plant tissue.
Liu, L; Wang, C L; Peng, W Y; Yang, J; Lan, M Q; Zhang, B; Li, J B; Zhu, Y Y; Li, C Y
2015-12-28
Powdery mildew and rust fungi are obligate parasites that cannot live without host organisms. They are difficult to culture in synthetic medium in the laboratory. Genomic DNA extraction is one of the basic molecular techniques used to study the genetic structure of populations. In this study, 2 different DNA extraction methods, Chelex-100 and cetyltrimethylammonium bromide (CTAB), were used to extract DNA from euonymus powdery mildew and Puccinia striiformis f. sp Tritici. Polymerase chain reaction was carried out with a race-specific-marker rDNA-internal transcribed spacer sequence. Both DNA extraction methods were compared and analyzed. The results showed that both Chelex-100 and CTAB were effective for extracting genomic DNA from infected plant tissue. However, less DNA was required for the Chelex-100 method than for the CTAB method, and the Chelex-100 method involved fewer steps, was simpler and safer, and did not require organic solvents compared to the CTAB method. DNA quality was evaluated by polymerase chain reaction, and the results showed that genomic DNA extracted using the Chelex-100 method was better than that using CTAB method, and was sufficient for studying the genetic structure of population.
Elongational viscosity of monodisperse and bidisperse polystyrene melts
DEFF Research Database (Denmark)
Nielsen, Jens Kromann; Rasmussen, Henrik Koblitz; Hassager, Ole
2005-01-01
The startup and steady uniaxial elongational viscosity have been measured for two monodisperse polystyrene melts with molecular weights of 52 kg/mole (PS52K) and 103 kg/mole (PS103K), and for three bidisperse polystyrene melts. The bidisperse melts consist of PS103K or PS52K and a monodisperse...... (closed loop proportional regulator) using the laser in such a way that the stretch rate at the neck is kept constant. The rheometer has been described in more detail in (A. Bach, H.K. Rasmussen and O. Hassager, Journal of Rheology, 47 (2003) 429). PS390K show a decrease in the steady viscosity as a power......-law function of the elongational rate (A. Bach, K. Almdal, H.K. Rasmussen and O. Hassager, Macromolecules 36 (2003) 5174). PS52K and PS103K show that the steady viscosity has a maximum that is respectively 100% and 50% above 3 times the zero-shear-rate viscosity. The bidisperse melts show a significant...
Kellis, Eleftherios; Ellinoudis, Athanasios; Kofotolis, Nikolaos
2015-06-01
Although the straight leg raise (SLR) test frequently is used to assess hamstring extensibility in individuals with low back pain (LBP), evidence relating LBP, SLR, and hamstring extensibility remains unclear. The SLR measures the angle between the lifted leg and the horizontal, however, and, as such, it is not a direct measure of the elongation capacity of the hamstrings. To examine the differences in hamstring elongation (quantified via ultrasonography) and SLR score between individuals with LBP and asymptomatic controls and to determine the relationship between hamstring elongation, SLR, and functional disability scores. Cross-sectional study. University laboratory. Forty men and women with chronic LBP (mean ± SD, age 43.51 ± 3.71 years and 40 control subjects (age 45.11 ± 4.01 years) participated in this study. Passive SLR, elongation assessed via ultrasonography, and functional disability. SLR score, elongation of tendinous tissue within the semitendinosus muscle, and Oswestry Disability Index. Two-way analysis of variance tests indicated a significantly lower SLR score and a greater Oswestry score in LBP group compared with control subjects (P hamstring elongation (P > .05). Gender did not have an effect on all dependent measures (P > .05). Hamstring elongation showed a low correlation with SLR score and a minimal correlation with Oswestry score. These results indicate that the SLR score is not determined by hamstring elongation (quantified via ultrasonography). Copyright © 2015 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.
An improved method of DNA extraction from plants for pathogen ...
African Journals Online (AJOL)
Polymerase chain reaction (PCR)-based applications in plant molecular biology and molecular diagnostics for plant pathogens require good quality DNA for reliable and reproducible results. Leaf tissue is often the choice for DNA extraction, but the use of other sources such as tubers, stems, or seeds, is not uncommon.
Methanofullerene elongated nanostructure formation for enhanced organic solar cells
Energy Technology Data Exchange (ETDEWEB)
Reyes-Reyes, M. [Instituto de Investigacion en Comunicacion Optica, Universidad Autonoma de San Luis Potosi, Alvaro Obregon 64, San Luis Potosi (Mexico)], E-mail: reyesm@cactus.iico.uaslp.mx; Lopez-Sandoval, R. [Instituto Potosino de Investigacion Cientifica y Tecnologica, Camino a la presa San Jose 2055, CP 78216. San Luis Potosi (Mexico); Arenas-Alatorre, J. [Instituto de Fisica, UNAM, Apartado Postal 20-364, 01000, Mexico, D.F. (Mexico); Garibay-Alonso, R. [Instituto Potosino de Investigacion Cientifica y Tecnologica, Camino a la presa San Jose 2055, CP 78216. San Luis Potosi (Mexico); Carroll, D.L. [Center for Nanotechnology and Molecular Materials, Department of Physics. Wake Forest University, Winston-Salem NC 27109 (United States); Lastras-Martinez, A. [Instituto de Investigacion en Comunicacion Optica, Universidad Autonoma de San Luis Potosi, Alvaro Obregon 64, San Luis Potosi (Mexico)
2007-11-01
Using transmission electron microscopy (TEM) and Z-contrast imaging we have demonstrated elongated nanostructure formation of fullerene derivative [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) within an organic host through annealing. The annealing provides an enhanced mobility of the PCBM molecules and, with good initial dispersion, allows for the formation of exaggerated grain growth within the polymer host. We have assembled these nanostructures within the regioregular conjugated polymer poly(3-hexylthiophene) (P3HT). This PCBM elongated nanostructure formation maybe responsible for the very high efficiencies observed, at very low loadings of PCBM (1:0.6, polymer to PCBM), in annealed photovoltaics. Moreover, our high resolution TEM and electron energy loss spectroscopy studies clearly show that the PCBM crystals remain crystalline and are unaffected by the 200-keV electron beam.
Methanofullerene elongated nanostructure formation for enhanced organic solar cells
International Nuclear Information System (INIS)
Reyes-Reyes, M.; Lopez-Sandoval, R.; Arenas-Alatorre, J.; Garibay-Alonso, R.; Carroll, D.L.; Lastras-Martinez, A.
2007-01-01
Using transmission electron microscopy (TEM) and Z-contrast imaging we have demonstrated elongated nanostructure formation of fullerene derivative [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) within an organic host through annealing. The annealing provides an enhanced mobility of the PCBM molecules and, with good initial dispersion, allows for the formation of exaggerated grain growth within the polymer host. We have assembled these nanostructures within the regioregular conjugated polymer poly(3-hexylthiophene) (P3HT). This PCBM elongated nanostructure formation maybe responsible for the very high efficiencies observed, at very low loadings of PCBM (1:0.6, polymer to PCBM), in annealed photovoltaics. Moreover, our high resolution TEM and electron energy loss spectroscopy studies clearly show that the PCBM crystals remain crystalline and are unaffected by the 200-keV electron beam
Fast DNA analysis by laser mass spectrometry for human genome analysis
International Nuclear Information System (INIS)
Tang, K.; Taranenko, N. I.; Allman, S. L.; Chang, L. Y.; Chen, C. H.
1995-01-01
Fast DNA sequencing by laser mass spectrometry is possible if the following 3 criteria are met: (1) Size of DNA fragment should be greater than 300 nucleotides. (2) Enough sensitivity to detect DNA produce from polymerases chain reactins (PCR). (3) Higher resolution of mass spectr. So far, the firt 2 criteria are met: If the resolution can be significantly improve, fast DNA sequencing by laser mass spectrometry weil be a reality in the near feature
A Novel Mechanism of Sugar Selection Utilized by a Human X-family DNA Polymerase†
Brown, Jessica A.; Fiala, Kevin A.; Fowler, Jason D.; Sherrer, Shanen M.; Newmister, Sean A.; Dyum, Wade W.; Suo, Zucai
2009-01-01
During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2′-hydroxyl group and the bulky side chain of an active site residue. Here, we demonstrated that human DNA polymerase λ used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2′-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such a steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2′ position. PMID:19900463
Krieger, Fernanda; Cvintal, Tadeu; Bicas, Harley
2004-12-01
To study the different ways of expressing the force-elongation relationship in medial rectus muscles in esotropia with and without muscular restriction. Twenty-nine passive force-elongation curves were obtained without restriction (group I, n = 13) and with restriction (group II, n = 10) by means of a manual pachymeter and a digital dynamometer. In group I, the mean age was 14 years and 7 days and the mean esotropia was 53.88(Delta) while in group II the mean age was 35 years and 5 days and the mean esotropia was 60.5(Delta). Comparisons of structural muscular parameters between groups I and II were made for length (38.69 +/- 0.75 vs. 32.48 +/- 1.84 mm, p elongation relationship, whether normalized or not, followed an exponential curve. The constant c, which represents force when the elongation is zero, remained the same in all curves. In contrast, the constant b, which represents the slope of the curve, showed a significant difference between the two groups only for the curves of force-absolute elongation and tension-absolute elongation. The results imply that the constant b is better for characterizing the difference between the behavior of the medial rectus in esotropia with and without restriction. In addition, the elongation normalization showed that the contractile component is similar between the two groups and, therefore, the classical way of analysis, which does not employ normalization, is appropriate to correlate muscle properties with clinical findings.
Arandjelovic, M; Guschanski, K; Schubert, G; Harris, T R; Thalmann, O; Siedel, H; Vigilant, L
2009-01-01
Many studies in molecular ecology rely upon the genotyping of large numbers of low-quantity DNA extracts derived from noninvasive or museum specimens. To overcome low amplification success rates and avoid genotyping errors such as allelic dropout and false alleles, multiple polymerase chain reaction (PCR) replicates for each sample are typically used. Recently, two-step multiplex procedures have been introduced which drastically increase the success rate and efficiency of genotyping. However, controversy still exists concerning the amount of replication needed for suitable control of error. Here we describe the use of a two-step multiplex PCR procedure that allows rapid genotyping using at least 19 different microsatellite loci. We applied this approach to quantified amounts of noninvasive DNAs from western chimpanzee, western gorilla, mountain gorilla and black and white colobus faecal samples, as well as to DNA from ~100-year-old gorilla teeth from museums. Analysis of over 45 000 PCRs revealed average success rates of > 90% using faecal DNAs and 74% using museum specimen DNAs. Average allelic dropout rates were substantially reduced compared to those obtained using conventional singleplex PCR protocols, and reliable genotyping using low (< 25 pg) amounts of template DNA was possible. However, four to five replicates of apparently homozygous results are needed to avoid allelic dropout when using the lowest concentration DNAs (< 50 pg/reaction), suggesting that use of protocols allowing routine acceptance of homozygous genotypes after as few as three replicates may lead to unanticipated errors when applied to low-concentration DNAs. © 2008 The Authors. Journal compilation © 2008 Blackwell Publishing Ltd.
Counting of oligomers in sequences generated by markov chains for DNA motif discovery.
Shan, Gao; Zheng, Wei-Mou
2009-02-01
By means of the technique of the imbedded Markov chain, an efficient algorithm is proposed to exactly calculate first, second moments of word counts and the probability for a word to occur at least once in random texts generated by a Markov chain. A generating function is introduced directly from the imbedded Markov chain to derive asymptotic approximations for the problem. Two Z-scores, one based on the number of sequences with hits and the other on the total number of word hits in a set of sequences, are examined for discovery of motifs on a set of promoter sequences extracted from A. thaliana genome. Source code is available at http://www.itp.ac.cn/zheng/oligo.c.
Visioli, Giovanna; Conti, Federica D; Gardi, Ciro; Menta, Cristina
2014-04-01
In vitro short-term chronic phytotoxicity germination and root elongation test were applied to test the effects of nickel (Ni) in seed germination and root elongation in six plants species: Cucumis sativus (Cucurbitaceae), Lepidium sativum and Brassica nigra (Brassicaceae), Trifolium alexandrinum and Medicago sativa (Fabaceae), Phacelia tanacetifolia (Boraginaceae). A naturally Ni rich soil was used to compare the results obtained. Unlike root elongation, germination was not affected by Ni in any of the six species tested. EC50 values, calculated on the root elongation, showed that Ni toxicity decreases in the following order: P. tanacetifolia > B. nigra > C. sativus > L. sativum > M. sativa > T. alexandrinum. The test conducted using soil elutriate revealed a significantly lower effect in both seed germination and root elongation when compared to the results obtained using untreated soil. Conversely, the test performed on soil confirmed the high sensitivity of C. sativus, P. tanacetifolia and L. sativum to Ni.
The crystal structure of elongation factor G complexed with GDP, at 2.7 A resolution.
Czworkowski, J; Wang, J; Steitz, T A; Moore, P B
1994-01-01
Elongation factor G (EF-G) catalyzes the translocation step of protein synthesis in bacteria, and like the other bacterial elongation factor, EF-Tu--whose structure is already known--it is a member of the GTPase superfamily. We have determined the crystal structure of EF-G--GDP from Thermus thermophilus. It is an elongated molecule whose large, N-terminal domain resembles the G domain of EF-Tu, except for a 90 residue insert, which covers a surface that is involved in nucleotide exchange in E...
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Non liquid nitrogen-based-method for isolation of DNA from ...
African Journals Online (AJOL)
A simple, efficient, reliable and cost-effective method for isolation of total genomic DNA from fungi, suitable for polymerase chain reaction (PCR) amplification and other molecular applications was described. The main advantages of the method are: (1) does not require the use of liquid nitrogen for preparation of fungi DNA; ...
Yamashita, Yuji; Nishiumi, Shin; Kono, Seishi; Takao, Shintaro; Azuma, Takeshi; Yoshida, Masaru
2017-08-29
Triple-negative breast cancer (TN) is more aggressive than other subtypes of breast cancer and has a lower survival rate. Furthermore, detailed biological information about the disease is lacking. This study investigated characteristics of metabolic pathways in TN. We performed the metabolome analysis of 74 breast cancer tissues and the corresponding normal breast tissues using LC/MS. Furthermore, we classified the breast cancer tissues into ER-positive, PgR-positive, HER2-negative breast cancer (EP+H-) and TN, and then the differences in their metabolic pathways were investigated. The RT-PCR and immunostaining were carried out to examine the expression of ELOVL1, 2, 3, 4, 5, 6, and 7. We identified 142 of hydrophilic metabolites and 278 of hydrophobic lipid metabolites in breast tissues. We found the differences between breast cancer and normal breast tissues in choline metabolism, glutamine metabolism, lipid metabolism, and so on. Most characteristic of comparison between EP+H- and TN were differences in fatty acid metabolism was which were related to the elongation of very long chain fatty acids were detected between TN and EP+H-. Real-time RT-PCR showed that the mRNA expression levels of ELOVL1, 5, and 6 were significantly upregulated by 8.5-, 4.6- and 7.0-fold, respectively, in the TN tumors compared with their levels in the corresponding normal breast tissue samples. Similarly, the mRNA expression levels of ELOVL1, 5, and 6 were also significantly higher in the EP+H- tissues than in the corresponding normal breast tissues (by 4.9-, 3.4-, and 2.1-fold, respectively). The mRNA expression level of ELOVL6 was 2.6-fold higher in the TN tumors than in the EP+H- tumors. During immunostaining, the TN and EP+H- tumors demonstrated stronger ELOVL1 and 6 staining than the corresponding normal breast tissues, but ELOVL5 was not stained strongly in the TN or EP+H- tumors. Furthermore, the TN tumors exhibited stronger ELOVL1 and 6 staining than the EP+H- tumors. Marked
International Nuclear Information System (INIS)
Campos-Nebel, Marcelo de; Larripa, Irene; Gonzalez-Cid, Marcela
2008-01-01
Fludarabine (FLU), an analogue of adenosine, interferes with DNA synthesis and inhibits the chain elongation leading to replication arrest and DNA double strand break (DSB) formation. Mammalian cells use two main pathways of DSB repair to maintain genomic stability: homologous recombination (HR) and non-homologous end joining (NHEJ). The aim of the present work was to evaluate the repair pathways employed in the restoration of DSB formed following replication arrest induced by FLU in mammalian cells. Replication inhibition was induced in human lymphocytes and fibroblasts by FLU. DSB occurred in a dose-dependent manner on early/middle S-phase cells, as detected by γH2AX foci formation. To test whether conservative HR participates in FLU-induced DSB repair, we measured the kinetics of Rad51 nuclear foci formation in human fibroblasts. There was no significant induction of Rad51 foci after FLU treatment. To further confirm these results, we analyzed the frequency of sister chromatid exchanges (SCE) in both human cells. We did not find increased frequencies of SCE after FLU treatment. To assess the participation of NHEJ pathway in the repair of FLU-induced damage, we used two chemical inhibitors of the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), vanillin and wortmannin. Human fibroblasts pretreated with DNA-PKcs inhibitors showed increased levels of chromosome breakages and became more sensitive to cell death. An active role of NHEJ pathway was also suggested from the analysis of Chinese hamster cell lines. XR-C1 (DNA-PKcs-deficient) and XR-V15B (Ku80-deficient) cells showed hypersensitivity to FLU as evidenced by the increased frequency of chromosome aberrations, decreased mitotic index and impaired survival rates. In contrast, CL-V4B (Rad51C-deficient) and V-C8 (Brca2-deficient) cell lines displayed a FLU-resistant phenotype. Together, our results suggest a major role for NHEJ repair in the preservation of genome integrity against FLU-induced DSB
Energy Technology Data Exchange (ETDEWEB)
Campos-Nebel, Marcelo de [Departamento de Genetica, Instituto de Investigaciones Hematologicas Mariano R. Castex, Academia Nacional de Medicina, Buenos Aires (Argentina)], E-mail: mnebel@hematologia.anm.edu.ar; Larripa, Irene; Gonzalez-Cid, Marcela [Departamento de Genetica, Instituto de Investigaciones Hematologicas Mariano R. Castex, Academia Nacional de Medicina, Buenos Aires (Argentina)
2008-11-10
Fludarabine (FLU), an analogue of adenosine, interferes with DNA synthesis and inhibits the chain elongation leading to replication arrest and DNA double strand break (DSB) formation. Mammalian cells use two main pathways of DSB repair to maintain genomic stability: homologous recombination (HR) and non-homologous end joining (NHEJ). The aim of the present work was to evaluate the repair pathways employed in the restoration of DSB formed following replication arrest induced by FLU in mammalian cells. Replication inhibition was induced in human lymphocytes and fibroblasts by FLU. DSB occurred in a dose-dependent manner on early/middle S-phase cells, as detected by {gamma}H2AX foci formation. To test whether conservative HR participates in FLU-induced DSB repair, we measured the kinetics of Rad51 nuclear foci formation in human fibroblasts. There was no significant induction of Rad51 foci after FLU treatment. To further confirm these results, we analyzed the frequency of sister chromatid exchanges (SCE) in both human cells. We did not find increased frequencies of SCE after FLU treatment. To assess the participation of NHEJ pathway in the repair of FLU-induced damage, we used two chemical inhibitors of the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), vanillin and wortmannin. Human fibroblasts pretreated with DNA-PKcs inhibitors showed increased levels of chromosome breakages and became more sensitive to cell death. An active role of NHEJ pathway was also suggested from the analysis of Chinese hamster cell lines. XR-C1 (DNA-PKcs-deficient) and XR-V15B (Ku80-deficient) cells showed hypersensitivity to FLU as evidenced by the increased frequency of chromosome aberrations, decreased mitotic index and impaired survival rates. In contrast, CL-V4B (Rad51C-deficient) and V-C8 (Brca2-deficient) cell lines displayed a FLU-resistant phenotype. Together, our results suggest a major role for NHEJ repair in the preservation of genome integrity against FLU
DNA viewed as an out-of-equilibrium structure
Provata, A.; Nicolis, C.; Nicolis, G.
2014-05-01
The complexity of the primary structure of human DNA is explored using methods from nonequilibrium statistical mechanics, dynamical systems theory, and information theory. A collection of statistical analyses is performed on the DNA data and the results are compared with sequences derived from different stochastic processes. The use of χ2 tests shows that DNA can not be described as a low order Markov chain of order up to r =6. Although detailed balance seems to hold at the level of a binary alphabet, it fails when all four base pairs are considered, suggesting spatial asymmetry and irreversibility. Furthermore, the block entropy does not increase linearly with the block size, reflecting the long-range nature of the correlations in the human genomic sequences. To probe locally the spatial structure of the chain, we study the exit distances from a specific symbol, the distribution of recurrence distances, and the Hurst exponent, all of which show power law tails and long-range characteristics. These results suggest that human DNA can be viewed as a nonequilibrium structure maintained in its state through interactions with a constantly changing environment. Based solely on the exit distance distribution accounting for the nonequilibrium statistics and using the Monte Carlo rejection sampling method, we construct a model DNA sequence. This method allows us to keep both long- and short-range statistical characteristics of the native DNA data. The model sequence presents the same characteristic exponents as the natural DNA but fails to capture spatial correlations and point-to-point details.
DNA viewed as an out-of-equilibrium structure.
Provata, A; Nicolis, C; Nicolis, G
2014-05-01
The complexity of the primary structure of human DNA is explored using methods from nonequilibrium statistical mechanics, dynamical systems theory, and information theory. A collection of statistical analyses is performed on the DNA data and the results are compared with sequences derived from different stochastic processes. The use of χ^{2} tests shows that DNA can not be described as a low order Markov chain of order up to r=6. Although detailed balance seems to hold at the level of a binary alphabet, it fails when all four base pairs are considered, suggesting spatial asymmetry and irreversibility. Furthermore, the block entropy does not increase linearly with the block size, reflecting the long-range nature of the correlations in the human genomic sequences. To probe locally the spatial structure of the chain, we study the exit distances from a specific symbol, the distribution of recurrence distances, and the Hurst exponent, all of which show power law tails and long-range characteristics. These results suggest that human DNA can be viewed as a nonequilibrium structure maintained in its state through interactions with a constantly changing environment. Based solely on the exit distance distribution accounting for the nonequilibrium statistics and using the Monte Carlo rejection sampling method, we construct a model DNA sequence. This method allows us to keep both long- and short-range statistical characteristics of the native DNA data. The model sequence presents the same characteristic exponents as the natural DNA but fails to capture spatial correlations and point-to-point details.
Adiabatic compression of elongated field-reversed configurations
International Nuclear Information System (INIS)
Spencer, R.L.; Tuszewski, M.; Linford, R.K.
1983-01-01
The adiabatic compression of an elongated field-reversed configuration (FRC) is computed by using a one-dimensional approximation. The one-dimensional results are checked against a two-dimensional equilibrium code. For ratios of FRC separatrix length to separatrix radius greater than about ten, the one-dimensional results are accurate within 10%. To this accuracy, the adiabatic compression of FRC's can be described by simple analytic formulas
Rura, Christopher; Stollberg, Mark
2018-01-01
The Astronomical Almanac is an annual publication of the US Naval Observatory (USNO) and contains a wide variety of astronomical data used by astronomers worldwide as a general reference or for planning observations. Included in this almanac are the times of greatest eastern and northern elongations of the natural satellites of the planets, accurate to 0.1 hour UT. The production code currently used to determine elongation times generates X and Y coordinates for each satellite (16 total) in 5 second intervals. This consequentially caused very large data files, and resulted in the program devoted to determining the elongation times to be computationally intensive. To make this program more efficient, we wrote a Python program to fit a cubic spline to data generated with a 6-minute time step. This resulted in elongation times that were found to agree with those determined from the 5 second data currently used in a large number of cases and was tested for 16 satellites between 2017 and 2019. The accuracy of this program is being tested for the years past 2019 and, if no problems are found, the code will be considered for production of this section of The Astronomical Almanac.
Abe, K; Takahashi, H; Suge, H
1998-12-01
We have compared shoot responses of agravitropic rice and barley plants to vertical inversion with those of normal ones. When rice plants were vertically inverted, the main stems of a japonica type of rice, cv. Kamenoo, showed negative gravitropism at nodes 2-15 of both elongated and non-elongated internodes. However, shoots of lazy line of rice, lazy-Kamenoo, bent gravitropically at nodes 11-15 only elongated internodes but not at nodes 2-10 of non-elongated ones. Thus, shoots of Kamenoo responded gravitropically at all stages of growth, whereas shoots of lazy-Kamenoo did not show gravitropic response before heading. In Kamenoo plants, lengths of both leaf-sheath and leaf-blade were shortened by vertical inversion, but those of the vertically inverted plants of lazy-Kamenoo were significantly longer than the plants in an upright position. When agravitropic and normal plants of barley were vertically inverted, the same results as in rice were obtained; elongation of both leaf-sheath and leaf-blade was inhibited in normal barley plants, Chikurin-Ibaragi No. 1, but significantly stimulated in agravitropic plants of serpentina barley. These results suggest that vertical inversion of rice and barley plants enhances the elongation growth of leaves in the absence of tropistic response.
Structure-function relationships of new lipids designed for DNA transfection.
Dittrich, Matthias; Heinze, Martin; Wölk, Christian; Funari, Sergio S; Dobner, Bodo; Möhwald, Helmuth; Brezesinski, Gerald
2011-08-22
Cationic liposome/DNA complexes can be used as nonviral vectors for direct delivery of DNA-based biopharmaceuticals to damaged cells and tissues. To obtain more effective and safer liposome-based gene transfection systems, two cationic lipids with identical head groups but different chain structures are investigated with respect to their in vitro gene-transfer activity, their cell-damaging characteristics, and their physicochemical properties. The gene-transfer activities of the two lipids are very different. Differential scanning calorimetry and synchrotron small- and wide-angle X-ray scattering give valuable structural insight. A subgel-like structure with high packing density and high phase-transition temperature from gel to liquid-crystalline state are found for lipid 7 (N'-2-[(2,6-diamino-1-oxohexyl)amino]ethyl-2,N-bis(hexadecyl)propanediamide) containing two saturated chains. Additionally, an ordered head-group lattice based on formation of a hydrogen-bond network is present. In contrast, lipid 8 (N'-2-[(2,6-diamino-1-oxohexyl)amino]ethyl-2-hexadecyl-N-[(9Z)-octadec-9-enyl]propanediamide) with one unsaturated and one saturated chain shows a lower phase-transition temperature and a reduced packing density. These properties enhance incorporation of the helper lipid cholesterol needed for gene transfection. Both lipids, either pure or in mixtures with cholesterol, form lamellar phases, which are preserved after addition of DNA. However, the system separates into phases containing DNA and phases without DNA. On increasing the temperature, DNA is released and only a lipid phase without intercalated DNA strands is observed. The conversion temperatures are very different in the two systems studied. The important parameter seems to be the charge density of the lipid membranes, which is a result of different solubility of cholesterol in the two lipid membranes. Therefore, different binding affinities of the DNA to the lipid mixtures are achieved. Copyright © 2011
Effects of rare earth oxide nanoparticles on root elongation of plants.
Ma, Yuhui; Kuang, Linglin; He, Xiao; Bai, Wei; Ding, Yayun; Zhang, Zhiyong; Zhao, Yuliang; Chai, Zhifang
2010-01-01
The phytotoxicity of four rare earth oxide nanoparticles, nano-CeO(2), nano-La(2)O(3), nano-Gd(2)O(3) and nano-Yb(2)O(3) on seven higher plant species (radish, rape, tomato, lettuce, wheat, cabbage, and cucumber) were investigated in the present study by means of root elongation experiments. Their effects on root growth varied greatly between different nanoparticles and plant species. A suspension of 2000 mg L(-1) nano-CeO(2) had no effect on the root elongation of six plants, except lettuce. On the contrary, 2000 mg L(-1) suspensions of nano-La(2)O(3), nano-Gd(2)O(3) and nano-Yb(2)O(3) severely inhibited the root elongation of all the seven species. Inhibitory effects of nano-La(2)O(3), nano-Gd(2)O(3), and nano-Yb(2)O(3) also differed in the different growth process of plants. For wheat, the inhibition mainly took place during the seed incubation process, while lettuce and rape were inhibited on both seed soaking and incubation process. The fifty percent inhibitory concentrations (IC(50)) for rape were about 40 mg L(-1) of nano-La(2)O(3), 20mg L(-1) of nano-Gd(2)O(3), and 70 mg L(-1) of nano-Yb(2)O(3), respectively. In the concentration ranges used in this study, the RE(3+) ion released from the nanoparticles had negligible effects on the root elongation. These results are helpful in understanding phytotoxicity of rare earth oxide nanoparticles. Copyright 2009 Elsevier Ltd. All rights reserved.
Morimoto, H; Bonavida, B
1992-09-15
We have reported that diphtheria toxin (DTX) mediates target cell lysis and intranucleosomal DNA fragmentation (apoptosis) and also synergizes with TNF-alpha. In this paper, we examined which step in the pathway of DTX-mediated inhibition of protein synthesis was important for induction of cytolytic activity and for synergy. Using a DTX-sensitive tumor cell line, we first examined the activity of the mutant CRM 197, which does not catalyze the ADP ribosylation of elongation factor-2 (EF-2). CRM 197 was not cytolytic for target cells and did not mediate intranucleosomal DNA fragmentation of viable cells. The failure of CRM 197 to mediate target cell lysis suggested that the catalytic activity of DTX is prerequisite for target cell lysis. This was corroborated by demonstrating that MeSAdo, which blocks the biosynthesis of diphthamide, inhibited DTX-mediated protein synthesis inhibition and also blocked target cell lysis. Furthermore, the addition of nicotinamide, which competes with NAD+ on the DTX action site of EF-2, also blocked DTX-mediated lysis. These findings suggest that ADP-ribosylation of EF-2 may be a necessary step in the pathway leading to target cell lysis. In contrast to the sensitive line, the SKOV-3 tumor cell line is sensitive to protein synthesis inhibition by DTX but is not susceptible to cytolysis and apoptosis by DTX. Thus, protein synthesis inhibition by DTX is not sufficient to mediate target cell lysis. The synergy in cytotoxicity obtained with the combination of DTX and TNF-alpha was examined in order to determine the pathway mediated by DTX in synergy. Like the direct lysis by DTX, synergy was significantly reduced by MeSAdo and by nicotinamide. Furthermore, synergy was not observed with combination of CRM 197 and TNF-alpha. These results demonstrate that, in synergy, DTX may utilize the same pathway required for its cytolytic activity. Pseudomonas aeruginosa exotoxin shared most the properties shown for DTX. Altogether, these findings
Somatic hypermutation and junctional diversification at Ig heavy chain loci in the nurse shark.
Malecek, Karolina; Brandman, Julie; Brodsky, Jennie E; Ohta, Yuko; Flajnik, Martin F; Hsu, Ellen
2005-12-15
We estimate there are approximately 15 IgM H chain loci in the nurse shark genome and have characterized one locus. It consists of one V, two D, and one J germline gene segments, and the constant (C) region can be distinguished from all of the others by a unique combination of restriction endonuclease sites in Cmu2. On the basis of these Cmu2 markers, 22 cDNA clones were selected from an epigonal organ cDNA library from the same individual; their C region sequences proved to be the same up to the polyadenylation site. With the identification of the corresponding germline gene segments, CDR3 from shark H chain rearrangements could be analyzed precisely, for the first time. Considerable diversity was generated by trimming and N addition at the three junctions and by varied recombination patterns of the two D gene segments. The cDNA sequences originated from independent rearrangements events, and most carried both single and contiguous substitutions. The 53 point mutations occurred with a bias for transition changes (53%), whereas the 78 tandem substitutions, mostly 2-4 bp long, do not (36%). The nature of the substitution patterns is the same as for mutants from six loci of two nurse shark L chain isotypes, showing that somatic hypermutation events are very similar at both H and L chain genes in this early vertebrate. The cis-regulatory elements targeting somatic hypermutation must have already existed in the ancestral Ig gene, before H and L chain divergence.
Energy Technology Data Exchange (ETDEWEB)
NONE
2000-03-01
A human genome related project named above was started, and studies were conducted for base sequence determination and function analysis for approximately 10,000 kinds of full-length or long-chain human cDNA clones owned by research organizations in this country. The Institute of Medical Science of University of Tokyo and Helix Research Institute dealt with a full-length human cDNA library constructed by oligo-capping, and determined the base sequences of all specimens in the library. The Kazusa DNA Research Institute determined partial sequences for long-chain clones which are not shorter than 4-5kbp, and determined entire sequences for some bases. The obtained base sequence data were subjected to homology analysis, the base sequences were converted into amino acid sequences, and functions of proteins were predicted. In the analysis of gene functions, ATAC-PCR (adaptor tagged competitive-polymerase chain reaction) was applied to the clones covered by this project, and a database was prepared by use of the results of analyses of frequency-related information. For the preparation of a comprehensive gene expression profile, technologies for cDNA microarray construction were established. (NEDO)
Abscisic Acid Regulates Auxin Homeostasis in Rice Root Tips to Promote Root Hair Elongation
Directory of Open Access Journals (Sweden)
Tao Wang
2017-06-01
Full Text Available Abscisic acid (ABA plays an essential role in root hair elongation in plants, but the regulatory mechanism remains to be elucidated. In this study, we found that exogenous ABA can promote rice root hair elongation. Transgenic rice overexpressing SAPK10 (Stress/ABA-activated protein kinase 10 had longer root hairs; rice plants overexpressing OsABIL2 (OsABI-Like 2 had attenuated ABA signaling and shorter root hairs, suggesting that the effect of ABA on root hair elongation depends on the conserved PYR/PP2C/SnRK2 ABA signaling module. Treatment of the DR5-GUS and OsPIN-GUS lines with ABA and an auxin efflux inhibitor showed that ABA-induced root hair elongation depends on polar auxin transport. To examine the transcriptional response to ABA, we divided rice root tips into three regions: short root hair, long root hair and root tip zones; and conducted RNA-seq analysis with or without ABA treatment. Examination of genes involved in auxin transport, biosynthesis and metabolism indicated that ABA promotes auxin biosynthesis and polar auxin transport in the root tip, which may lead to auxin accumulation in the long root hair zone. Our findings shed light on how ABA regulates root hair elongation through crosstalk with auxin biosynthesis and transport to orchestrate plant development.
Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry
Energy Technology Data Exchange (ETDEWEB)
Werner, James H. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Larson, Erica J. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Goodwin, Peter M. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Ambrose, W. Patrick [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States); Keller, Richard A. [Division of Bioscience, Los Alamos National Laboratory, Mail Stop M888, Los Alamos, New Mexico 87545-0001 (United States)
2000-06-01
We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America.
Effects of fluorescence excitation geometry on the accuracy of DNA fragment sizing by flow cytometry
International Nuclear Information System (INIS)
Werner, James H.; Larson, Erica J.; Goodwin, Peter M.; Ambrose, W. Patrick; Keller, Richard A.
2000-01-01
We report on various excitation geometries used in ultrasensitive flow cytometry that yield a linear relation between the fluorescence intensity measured from individual strained DNA fragments and the lengths of the fragments (in base pairs). This linearity holds for DNA samples that exhibit a wide range of conformations. The variety of DNA conformations leads to a distribution of dipole moment orientations for the dye molecules intercalated into the DNA. It is consequently important to use an excitation geometry such that all dye molecules are detected with similar efficiency. To estimate the conformation and the extent of elongation of the strained fragments in the flow, fluorescence polarization anisotropy and autocorrelation measurements were performed. Significant extension was observed for DNA fragments under the flow conditions frequently used for DNA fragment sizing. Classical calculations of the fluorescence emission collected over a finite solid angle are in agreement with the experimental measurements and have confirmed the relative insensitivity to DNA conformation of an orthogonal excitation geometry. Furthermore, the calculations suggested a modified excitation geometry that has increased our sizing resolution. (c) 2000 Optical Society of America
Differential expression of α-L-arabinofuranosidases during maize (Zea mays L.) root elongation.
Kozlova, Liudmila V; Gorshkov, Oleg V; Mokshina, Natalia E; Gorshkova, Tatyana A
2015-05-01
Specific α- l -arabinofuranosidases are involved in the realisation of elongation growth process in cells with type II cell walls. Elongation growth in a plant cell is largely based on modification of the cell wall. In type II cell walls, the Ara/Xyl ratio is known to decrease during elongation due to the partial removal of Ara residues from glucuronoarabinoxylan. We searched within the maize genome for the genes of all predicted α-L-arabinofuranosidases that may be responsible for such a process and related their expression to the activity of the enzyme and the amount of free arabinose measured in six zones of a growing maize root. Eight genes of the GH51 family (ZmaABFs) and one gene of the GH3 family (ZmaARA-I) were identified. The abundance of ZmaABF1 and 3-6 transcripts was highly correlated with the measured enzymatic activity and free arabinose content that significantly increased during elongation. The transcript abundances also coincided with the pattern of changes in the Ara/Xyl ratio of the xylanase-extractable glucuronoarabinoxylan described in previous studies. The expression of ZmaABF3, 5 and 6 was especially up-regulated during elongation although corresponding proteins are devoid of the catalytic glutamate at the proper position. ZmaABF2 transcripts were specifically enriched in the root cap and meristem. A single ZmaARA-I gene was not expressed as a whole gene but instead as splice variants that encode the C-terminal end of the protein. Changes in the ZmaARA-I transcript level were rather moderate and had no significant correlation with free arabinose content. Thus, elongation growth of cells with type II cell walls is accompanied by the up-regulation of specific and predicted α-L-arabinofuranosidase genes, and the corresponding activity is indeed pronounced and is important for the modification of glucuronoarabinoxylan, which plays a key role in the modification of the cell wall supramolecular organisation.
Towards an understanding of structure-function relationships of elongation factor Tu
DEFF Research Database (Denmark)
Wiborg, O; Andersen, C; Knudsen, Charlotte Rohde
1994-01-01
In light of the recently determined structure of elongation factor Tu, and taking into account chemical studies mapping functional sites, a number of residues have been selected for site-directed mutagenesis studies. Gly94, Gly126, His66, His118, Lys89 and Asp90 have each been point-mutated. Prel......In light of the recently determined structure of elongation factor Tu, and taking into account chemical studies mapping functional sites, a number of residues have been selected for site-directed mutagenesis studies. Gly94, Gly126, His66, His118, Lys89 and Asp90 have each been point...
Two DNA polymerase sliding clamps from the thermophilic archaeon Sulfolobus solfataricus.
De Felice, M; Sensen, C W; Charlebois, R L; Rossi, M; Pisani, F M
1999-08-06
Herein, we report the identification and characterization of two DNA polymerase processivity factors from the thermoacidophilic archaeon Sulfolobus solfataricus. They, referred to as 039p (244 amino acid residues, 27 kDa) and 048p (249 amino acid residues, 27 kDa), present significant primary structure similarity to eukaryotic proliferating cell nuclear antigen (PCNA). We demonstrate that both 039p and 048p form oligomers in solution and are able to substantially activate the synthetic activity of the single-subunit family B DNA polymerase from S. solfataricus (Sso DNA pol B1) on poly(dA)-oligo(dT) as a primer-template. This stimulatory effect is the result of enhanced DNA polymerase processivity, as indicated by the analysis of the elongation products on polyacrylamide gels. Activation of Sso DNA pol B1 synthetic activity was also observed on linear primed single-stranded M13 mp18 DNA as a template. By immunoblot analysis using specific rabbit antisera, 039p and 048p were both detected in the logarithmic and stationary phases of S. solfataricus growth curve. This is the first report of the identification and biochemical characterization of two distinct DNA polymerase processivity factors from the same organism. The significance of these findings for the understanding of the DNA replication process in Archaea is discussed. Copyright 1999 Academic Press.
Millon, Laurence; Larosa, Fabrice; Lepiller, Quentin; Legrand, Faezeh; Rocchi, Steffi; Daguindau, Etienne; Scherer, Emeline; Bellanger, Anne-Pauline; Leroy, Joel; Grenouillet, Frederic
2013-05-01
The aim of our study was to assess the detection of circulating DNA from the most common species of Mucorales for early diagnosis of mucormycosis in at-risk patients. We retrospectively evaluated a combination of 3 quantitative polymerase chain reaction (qPCR) assays using hydrolysis probes targeting Mucor/Rhizopus, Lichtheimia (formerly Absidia), and Rhizomucor for circulating Mucorales detection. Serial serum samples from 10 patients diagnosed with proven mucormycosis (2-9 samples per patient) were analyzed. No cross-reactivity was detected in the 3 qPCR assays using 19 reference strains of opportunistic fungi, and the limit of detection ranged from 3.7 to 15 femtograms/10 µL, depending on the species. DNA from Mucorales was detected in the serum of 9 of 10 patients between 68 and 3 days before mucormycosis diagnosis was confirmed by histopathological examination and/or positive culture. All the qPCR results were concordant with culture and/or PCR-based identification of the causing agents in tissue (Lichtheimia species, Rhizomucor species, and Mucor/Rhizopus species in 4, 3, and 2 patients, respectively). Quantitative PCR was negative in only 1 patient with proven disseminated mucormycosis caused by Lichtheimia species. Our study suggests that using specific qPCR targeting several species of Mucorales according to local ecology to screen at-risk patients could be useful in a clinical setting. The cost and efficacy of this strategy should be evaluated. However, given the human and economic cost of mucormycosis and the need for rapid diagnosis to initiate prompt directed antifungal therapy, this strategy could be highly attractive.
International Nuclear Information System (INIS)
Lee, C.C.; Bowman, B.H.; Yang, F.
1987-01-01
The α 2 -HS-glycoprotein (AHSG) is a plasma protein reported to play roles in bone mineralization and in the immune response. It is composed of two subunits, the A and B chains. Recombinant plasmids containing human cDNA AHSG have been isolated by screening an adult human liver library with a mixed oligonucleotide probe. The cDNA clones containing AHSG inserts span approximately 1.5 kilobase pairs and include the entire AHSG coding sequence, demonstrating that the A and B chains are encoded by a single mRNA transcript. The cDNA sequence predicts an 18-amino-acid signal peptide, followed by the A-chain sequence of AHSG. A heretofore unseen connecting sequence of 40 amino acids was deduced between the A- and B-chain sequences. The connecting sequence demonstrates the unique amino acid doublets and collagen triplets found in the A and B chains; it is not homologous with other reported amino acid sequences. The connecting sequence may be cleaved in a posttranslational step by limited proteolysis before mature AHSG is released into the circulation or may vary in its presence because of alternative processing. The AHSG cDNA was utilized for mapping the AHSG gene to the 3q21→qter region of human chromosome 3. The availability of the AHSG cDNA clone will facilitate the analysis of its genetic control and gene expression during development and bone formation
Epimerization-free C-terminal peptide activation, elongation and cyclization
Popović, S.
2015-01-01
C-terminal peptide activation and cyclization reactions are generally accompanied with epimerization (partial loss of C‐terminal stereointegrity). Therefore, the focus of this thesis was to develop epimerization-free methods for C-terminal peptide activation to enable C-terminal peptide elongation
Adiabatic compression of elongated field-reversed configurations
Energy Technology Data Exchange (ETDEWEB)
Spencer, R.L.; Tuszewski, M.; Linford, R.K.
1983-06-01
The adiabatic compression of an elongated field-reversed configuration (FRC) is computed by using a one-dimensional approximation. The one-dimensional results are checked against a two-dimensional equilibrium code. For ratios of FRC separatrix length to separatrix radius greater than about ten, the one-dimensional results are accurate within 10%. To this accuracy, the adiabatic compression of FRC's can be described by simple analytic formulas.
Cellular aging of mitochondrial DNA-depleted cells
International Nuclear Information System (INIS)
Park, Sun Young; Choi, Bongkun; Cheon, Hwanju; Pak, Youngmi Kim; Kulawiec, Mariola; Singh, Keshav K.; Lee, Myung-Shik
2004-01-01
We have reported that mitochondrial DNA-depleted ρ 0 cells are resistant to cell death. Because aged cells have frequent mitochondrial DNA mutations, the resistance of ρ 0 cells against cell death might be related to the apoptosis resistance of aged cells and frequent development of cancers in aged individuals. We studied if ρ 0 cells have features simulating aged cells. SK-Hep1 hepatoma ρ 0 cells showed typical morphology associated with aging such as increased size and elongated appearance. They had increased senescence-associated β-Gal activity, lipofuscin pigment, and plasminogen activator inhibitor-1 expression. Consistent with their decreased proliferation, the expression of mitotic cyclins was decreased and that of cdk inhibitors was increased. Rb hypophosphorylation and decreased telomerase activity were also noted. Features simulating aged cells were also observed in MDA-MB-435 ρ 0 cells. These results support the mitochondrial theory of aging, and suggest that ρ 0 cells could serve as an in vitro model for aged cells
Liu, Shufeng; Lin, Ying; Liu, Tao; Cheng, Chuanbin; Wei, Wenji; Wang, Li; Li, Feng
2014-06-15
Hybridization chain reaction (HCR) strategy has been well developed for the fabrication of various biosensing platforms for signal amplification. Herein, a novel enzyme-free and label-free ultrasensitive electrochemical DNA biosensing platform for the detection of target DNA and adenosine triphosphate (ATP) was firstly proposed, in which three auxiliary DNA probes were ingeniously designed to construct the dendritic DNA concatamer via HCR strategy and used as hexaammineruthenium(III) chloride (RuHex) carrier for signal amplification. With the developed dendritic DNA concatamer-based signal amplification strategy, the DNA biosensor could achieve an ultrasensitive electrochemical detection of DNA and ATP with a superior detection limit as low as 5 aM and 20 fM, respectively, and also demonstrate a high selectivity for DNA and ATP detection. The currently proposed dendritic DNA concatamer opens a promising direction to construct ultrasensitive DNA biosensing platform for biomolecular detection in bioanalysis and clinical biomedicine, which offers the distinct advantages of simplicity and cost efficiency owing to no need of any kind of enzyme, chemical modification or labeling. Copyright © 2014 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Shavitt, O.; Livneh, Z.
1989-01-01
The cycling time of DNA polymerase III holoenzyme during replication of UV-irradiated single-stranded (ss) DNA was longer than with unirradiated DNA (8 versus 3 min, respectively), most likely due to slow dissociation from lesion-terminated nascent DNA strands. Initiation of elongation on primed ssDNA was not significantly inhibited by the presence of UV lesions as indicated by the identical distribution of replication products synthesized at early and late reaction times and by the identical duration of the initial synthesis bursts on both unirradiated and UV-irradiated DNA templates. When replication was performed with DNA polymerase III* supplemented with increasing quantities of purified beta 2 subunit, the cycling time on UV-irradiated DNA decreased from 14.8 min at 1.7 nM beta 2 down to 6 min at 170 nM beta 2, a concentration in which beta 2 was in large excess over the polymerase. In parallel to the reduction in cycling time, also the bypass frequency of cyclobutane-photodimers decreased with increasing beta 2 concentration, and at 170 nM beta 2, bypass of photodimers was essentially eliminated. It has been shown that polymerase complexes with more than one beta 2 per polymerase molecule were formed at high beta 2 concentrations. It is plausible that polymerase complexes obtained under high beta 2 concentration dissociate from lesion-terminated primers faster than polymerase complexes formed at a low beta 2 concentration. This is expected to favor termination over bypass at pyrimidine photodimers and thus decrease their bypass frequency. These results suggest that the beta 2 subunit might act as a sensor for obstacles to replication caused by DNA damage, and that it terminates elongation at these sites by promoting dissociation. The intracellular concentration of beta 2 was estimated to be 250 nM
Yura, T
1998-02-01
To assess the relationship between the prevalence of lattice degeneration and the types of axial elongation. Nine hundred seventy eyes of 542 highly myopic patients with axial length of 26.00-31.99 mm were evaluated by using A-scan axial length measurements and fundus examinations. Then the prevalence of lattice degeneration was compared between eyes with posterior staphyloma and those without posterior staphyloma. At each axial length, lattice degeneration was more frequent in eyes without posterior staphyloma (the entire eye elongates) than those with posterior staphyloma (only the posterior pole elongates). The difference was statistically significant (plattice degeneration is influenced by the types of axial elongation in high myopic eyes.
Interaction of DNA/nuclear protein/polycation and the terplexes for gene delivery
Energy Technology Data Exchange (ETDEWEB)
Shen Yuan; Pan Shirong; Feng Min; Wen Yuting; Deng Jingjing; Luo Xin; Wu Chuanbin [School of Pharmaceutical Sciences, Sun Yat-sen University, Zhongshan II Road 74, Guangzhou 510080 (China); Peng Hui, E-mail: fengmin@mail.sysu.edu.cn [School of Zhongshan Medicine, Sun Yat-sen University, 74 Zhongshan Road II, Guangzhou 510080 (China)
2010-01-29
Nuclear transport of exogenous DNA is a major barrier to nonviral gene delivery that needs to be addressed in the design of new vectors. In this study, we prepared pDNA/HMGB1/PEG-PEI terplexes to promote nuclear import. HMGB1 in the terplexes was used to assist the transportation of pDNA into the nucleus of cells, since it contained nuclear localization signal (NLS); PEG chains were introduced to stabilize pDNA/vector terplexes and reduce the cytotoxicity. HMGB1/PEG-PEI combined vectors have been investigated specifically for their structure interaction by atomic force microscopy and circular dichroic spectroscopy. The results demonstrated that the HMGB1 molecule could bind with the pDNA chains, but not condense pDNA well. The PEG-PEI further compacted pDNA/HMGB1 complexes into nanosized spherical terplexes. The pDNA delivered by HMGB1/PEG-PEI combined vectors was significantly accumulated in the nucleus of cells, as observed by confocal laser scanning microscopy. The percentage of GFP-transfected cells and VEGF protein expression level induced by HMGB1/PEG-PEI were 2.6-4.9-fold and 1.4-2.8-fold higher, respectively, than that of a common cationic polymer PEI 25 kDa. Therefore, the HMGB1/PEG-PEI combined vector could be used as a versatile vector for promoting exogenous DNA nuclear localization, thereby enhancing its expression.
Song, Wei; Guo, Jun-Tao
2015-01-01
Transcription factors regulate gene expression through binding to specific DNA sequences. How transcription factors achieve high binding specificity is still not well understood. In this paper, we investigated the role of protein flexibility in protein-DNA-binding specificity by comparative molecular dynamics (MD) simulations. Protein flexibility has been considered as a key factor in molecular recognition, which is intrinsically a dynamic process involving fine structural fitting between binding components. In this study, we performed comparative MD simulations on wild-type and F10V mutant P22 Arc repressor in both free and complex conformations. The F10V mutant has lower DNA-binding specificity though both the bound and unbound main-chain structures between the wild-type and F10V mutant Arc are highly similar. We found that the DNA-binding motif of wild-type Arc is structurally more flexible than the F10V mutant in the unbound state, especially for the six DNA base-contacting residues in each dimer. We demonstrated that the flexible side chains of wild-type Arc lead to a higher DNA-binding specificity through forming more hydrogen bonds with DNA bases upon binding. Our simulations also showed a possible conformational selection mechanism for Arc-DNA binding. These results indicate the important roles of protein flexibility and dynamic properties in protein-DNA-binding specificity.
Use of polymerase chain reaction for detection of Chlamydia trachomatis
DEFF Research Database (Denmark)
Østergaard, Lars; Birkelund, Svend; Christiansen, Gunna
1990-01-01
A polymerase chain reaction (PCR) assay was developed for detection of Chlamydia trachomatis DNA. From the published sequence of the common C. trachomatis plasmid, two primer sets were selected. Detection of amplified sequences was done by agarose gel electrophoresis of cleaved or uncleaved...