WorldWideScience

Sample records for dna affects gene

  1. Failure to induce a DNA repair gene, RAD54, in Saccharomyces cerevisiae does not affect DNA repair or recombination phenotypes

    International Nuclear Information System (INIS)

    Cole, G.M.; Mortimer, R.K.

    1989-01-01

    The Saccharomyces cerevisiae RAD54 gene is transcriptionally regulated by a broad spectrum of DNA-damaging agents. Induction of RAD54 by DNA-damaging agents is under positive control. Sequences responsible for DNA damage induction (the DRS element) lie within a 29-base-pair region from -99 to -70 from the most proximal transcription start site. This inducible promoter element is functionally separable from a poly(dA-dT) region immediately downstream which is required for constitutive expression. Deletions which eliminate induction of RAD54 transcription by DNA damage but do not affect constitutive expression have no effect on growth or survival of noninducible strains relative to wild-type strains in the presence of DNA-damaging agents. The DRS element is also not required for homothallic mating type switching, transcriptional induction of RAD54 during meiosis, meiotic recombination, or spontaneous or X-ray-induced mitotic recombination. We find no phenotype for a lack of induction of RAD54 message via the damage-inducible DRS, which raises significant questions about the physiology of DNA damage induction in S. cerevisiae

  2. Low intensity infrared laser affects expression of oxidative DNA repair genes in mitochondria and nucleus

    International Nuclear Information System (INIS)

    Fonseca, A S; Magalhães, L A G; Mencalha, A L; Geller, M; Paoli, F

    2014-01-01

    Practical properties and physical characteristics of low intensity lasers have made possible their application to treat soft tissue diseases. Excitation of intracellular chromophores by red and infrared radiation at low energy fluences with increase of mitochondrial metabolism is the basis of the biostimulation effect but free radicals can be produced. DNA lesions induced by free radicals are repaired by the base excision repair pathway. In this work, we evaluate the expression of POLγ and APEX2 genes related to repair of mitochondrial and nuclear DNA, respectively. Skin and muscle tissue of Wistar rats were exposed to low intensity infrared laser at different fluences. One hour and 24 hours after laser exposure, tissue samples were withdrawn for total RNA extraction, cDNA synthesis, and evaluation of POLγ and APEX2 mRNA expression by real time quantitative polymerase chain reaction. Skin and muscle tissue of Wistar rats exposed to laser radiation show different expression of POLγ and APEX2 mRNA depending of the fluence and time after exposure. Our study suggests that a low intensity infrared laser affects expression of genes involved in repair of oxidative lesions in mitochondrial and nuclear DNA. (paper)

  3. Methods for interpreting lists of affected genes obtained in a DNA microarray experiment

    Directory of Open Access Journals (Sweden)

    Hedegaard Jakob

    2009-07-01

    Full Text Available Abstract Background The aim of this paper was to describe and compare the methods used and the results obtained by the participants in a joint EADGENE (European Animal Disease Genomic Network of Excellence and SABRE (Cutting Edge Genomics for Sustainable Animal Breeding workshop focusing on post analysis of microarray data. The participating groups were provided with identical lists of microarray probes, including test statistics for three different contrasts, and the normalised log-ratios for each array, to be used as the starting point for interpreting the affected probes. The data originated from a microarray experiment conducted to study the host reactions in broilers occurring shortly after a secondary challenge with either a homologous or heterologous species of Eimeria. Results Several conceptually different analytical approaches, using both commercial and public available software, were applied by the participating groups. The following tools were used: Ingenuity Pathway Analysis, MAPPFinder, LIMMA, GOstats, GOEAST, GOTM, Globaltest, TopGO, ArrayUnlock, Pathway Studio, GIST and AnnotationDbi. The main focus of the approaches was to utilise the relation between probes/genes and their gene ontology and pathways to interpret the affected probes/genes. The lack of a well-annotated chicken genome did though limit the possibilities to fully explore the tools. The main results from these analyses showed that the biological interpretation is highly dependent on the statistical method used but that some common biological conclusions could be reached. Conclusion It is highly recommended to test different analytical methods on the same data set and compare the results to obtain a reliable biological interpretation of the affected genes in a DNA microarray experiment.

  4. Differential gene expression in a DNA double-strand-break repair mutant XRS-5 defective in Ku80. Analysis by cDNA microarray

    International Nuclear Information System (INIS)

    Chan, John Y.H.; Chen, Lung-Kun; Chang, Jui-Feng

    2001-01-01

    The ability of cells to rejoin DNA double-strand breaks (DSBs) usually correlates with their radiosensitivity. This correlation has been demonstrated in radiosensitive cells, including the Chinese hamster ovary mutant XRS-5. XRS-5 is defective in a DNA end-binding protein, Ku80, which is a component of a DNA-dependent protein kinase complex used for joining strand breaks. However, Ku80-deficient cells are known to be retarded in cell proliferation and growth as well as other yet to be identified defects. Using custom-made 600-gene cDNA microarray filters, we found differential gene expressions between the wild-type and XRS-5 cells. Defective Ku80 apparently affects the expression of several repair genes, including topoisomerase-I and -IIA, ERCC5, MLH1, and ATM. In contrast, other DNA repair-associated genes, such as GADD45A, EGR1 MDM2 and p53, were not affected. In addition, for large numbers of growth-associated genes, such as cyclins and clks, the growth factors and cytokines were also affected. Down-regulated expression was also found in several categories of seemingly unrelated genes, including apoptosis, angiogenesis, kinase and signaling, phosphatase, stress protein, proto-oncogenes and tumor suppressors, transcription and translation factors. A RT-PCR analysis confirmed that the XRS-5 cells used were defective in Ku80 expression. The diversified groups of genes being affected could mean that Ku80, a multi-functional DNA-binding protein, not only affects DNA repair, but is also involved in transcription regulation. Our data, taken together, indicate that there are specific genes being modulated in Ku80- deficient cells, and that some of the DNA repair pathways and other biological functions are apparently linked, suggesting that a defect in one gene could have global effects on many other processes. (author)

  5. Differential gene expression in a DNA double-strand-break repair mutant XRS-5 defective in Ku80. Analysis by cDNA microarray

    Energy Technology Data Exchange (ETDEWEB)

    Chan, John Y.H.; Chen, Lung-Kun; Chang, Jui-Feng [National Yang Ming Univ., Taipei, Taiwan (China). Inst. of Radiological Sciences] (and others)

    2001-12-01

    The ability of cells to rejoin DNA double-strand breaks (DSBs) usually correlates with their radiosensitivity. This correlation has been demonstrated in radiosensitive cells, including the Chinese hamster ovary mutant XRS-5. XRS-5 is defective in a DNA end-binding protein, Ku80, which is a component of a DNA-dependent protein kinase complex used for joining strand breaks. However, Ku80-deficient cells are known to be retarded in cell proliferation and growth as well as other yet to be identified defects. Using custom-made 600-gene cDNA microarray filters, we found differential gene expressions between the wild-type and XRS-5 cells. Defective Ku80 apparently affects the expression of several repair genes, including topoisomerase-I and -IIA, ERCC5, MLH1, and ATM. In contrast, other DNA repair-associated genes, such as GADD45A, EGR1 MDM2 and p53, were not affected. In addition, for large numbers of growth-associated genes, such as cyclins and clks, the growth factors and cytokines were also affected. Down-regulated expression was also found in several categories of seemingly unrelated genes, including apoptosis, angiogenesis, kinase and signaling, phosphatase, stress protein, proto-oncogenes and tumor suppressors, transcription and translation factors. A RT-PCR analysis confirmed that the XRS-5 cells used were defective in Ku80 expression. The diversified groups of genes being affected could mean that Ku80, a multi-functional DNA-binding protein, not only affects DNA repair, but is also involved in transcription regulation. Our data, taken together, indicate that there are specific genes being modulated in Ku80- deficient cells, and that some of the DNA repair pathways and other biological functions are apparently linked, suggesting that a defect in one gene could have global effects on many other processes. (author)

  6. AQUATIC PLANT SPECIATION AFFECTED BY DIVERSIFYING SELECTION OF ORGANELLE DNA REGIONS(1).

    Science.gov (United States)

    Kato, Syou; Misawa, Kazuharu; Takahashi, Fumio; Sakayama, Hidetoshi; Sano, Satomi; Kosuge, Keiko; Kasai, Fumie; Watanabe, Makoto M; Tanaka, Jiro; Nozaki, Hisayoshi

    2011-10-01

    Many of the genes that control photosynthesis are carried in the chloroplast. These genes differ among species. However, evidence has yet to be reported revealing the involvement of organelle genes in the initial stages of plant speciation. To elucidate the molecular basis of aquatic plant speciation, we focused on the unique plant species Chara braunii C. C. Gmel. that inhabits both shallow and deep freshwater habitats and exhibits habitat-based dimorphism of chloroplast DNA (cpDNA). Here, we examined the "shallow" and "deep" subpopulations of C. braunii using two nuclear DNA (nDNA) markers and cpDNA. Genetic differentiation between the two subpopulations was measured in both nDNA and cpDNA regions, although phylogenetic analyses suggested nuclear gene flow between subpopulations. Neutrality tests based on Tajima's D demonstrated diversifying selection acting on organelle DNA regions. Furthermore, both "shallow" and "deep" haplotypes of cpDNA detected in cultures originating from bottom soils of three deep environments suggested that migration of oospores (dormant zygotes) between the two habitats occurs irrespective of the complete habitat-based dimorphism of cpDNA from field-collected vegetative thalli. Therefore, the two subpopulations are highly selected by their different aquatic habitats and show prezygotic isolation, which represents an initial process of speciation affected by ecologically based divergent selection of organelle genes. © 2011 Phycological Society of America.

  7. Depletion of polycistronic transcripts using short interfering RNAs: cDNA synthesis method affects levels of non-targeted genes determined by quantitative PCR.

    Science.gov (United States)

    Hanning, Jennifer E; Groves, Ian J; Pett, Mark R; Coleman, Nicholas

    2013-05-21

    Short interfering RNAs (siRNAs) are often used to deplete viral polycistronic transcripts, such as those encoded by human papillomavirus (HPV). There are conflicting data in the literature concerning how siRNAs targeting one HPV gene can affect levels of other genes in the polycistronic transcripts. We hypothesised that the conflict might be partly explained by the method of cDNA synthesis used prior to transcript quantification. We treated HPV16-positive cervical keratinocytes with siRNAs targeting the HPV16 E7 gene and used quantitative PCR to compare transcript levels of E7 with those of E6 and E2, viral genes located upstream and downstream of the target site respectively. We compared our findings from cDNA generated using oligo-dT primers alone with those from cDNA generated using a combination of random hexamer and oligo-dT primers. Our data show that when polycistronic transcripts are targeted by siRNAs, there is a period when untranslatable cleaved mRNA upstream of the siRNA binding site remains detectable by PCR, if cDNA is generated using random hexamer primers. Such false indications of mRNA abundance are avoided using oligo-dT primers. The period corresponds to the time taken for siRNA activity and degradation of the cleaved transcripts. Genes downstream of the siRNA binding site are detectable during this interval, regardless of how the cDNA is generated. These data emphasise the importance of the cDNA synthesis method used when measuring transcript abundance following siRNA depletion of polycistronic transcripts. They provide a partial explanation for erroneous reports suggesting that siRNAs targeting HPV E7 can have gene-specific effects.

  8. DNA repair genes

    International Nuclear Information System (INIS)

    Morimyo, Mitsuoki

    1995-01-01

    Fission yeast S. pombe is assumed to be a good model for cloning of human DNA repair genes, because human gene is normally expressed in S. pombe and has a very similar protein sequence to yeast protein. We have tried to elucidate the DNA repair mechanisms of S. pombe as a model system for those of mammals. (J.P.N.)

  9. Maternal intake of methyl-group donors affects DNA methylation of metabolic genes in infants.

    Science.gov (United States)

    Pauwels, Sara; Ghosh, Manosij; Duca, Radu Corneliu; Bekaert, Bram; Freson, Kathleen; Huybrechts, Inge; Langie, Sabine A S; Koppen, Gudrun; Devlieger, Roland; Godderis, Lode

    2017-01-01

    Maternal nutrition during pregnancy and infant nutrition in the early postnatal period (lactation) are critically involved in the development and health of the newborn infant. The Maternal Nutrition and Offspring's Epigenome (MANOE) study was set up to assess the effect of maternal methyl-group donor intake (choline, betaine, folate, methionine) on infant DNA methylation. Maternal intake of dietary methyl-group donors was assessed using a food-frequency questionnaire (FFQ). Before and during pregnancy, we evaluated maternal methyl-group donor intake through diet and supplementation (folic acid) in relation to gene-specific ( IGF2 DMR, DNMT1 , LEP , RXRA ) buccal epithelial cell DNA methylation in 6 months old infants ( n  = 114) via pyrosequencing. In the early postnatal period, we determined the effect of maternal choline intake during lactation (in mothers who breast-fed for at least 3 months) on gene-specific buccal DNA methylation ( n  = 65). Maternal dietary and supplemental intake of methyl-group donors (folate, betaine, folic acid), only in the periconception period, was associated with buccal cell DNA methylation in genes related to growth ( IGF2 DMR), metabolism ( RXRA ), and appetite control ( LEP ). A negative association was found between maternal folate and folic acid intake before pregnancy and infant LEP (slope = -1.233, 95% CI -2.342; -0.125, p  = 0.0298) and IGF2 DMR methylation (slope = -0.706, 95% CI -1.242; -0.107, p  = 0.0101), respectively. Positive associations were observed for maternal betaine (slope = 0.875, 95% CI 0.118; 1.633, p  = 0.0241) and folate (slope = 0.685, 95% CI 0.245; 1.125, p  = 0.0027) intake before pregnancy and RXRA methylation. Buccal DNMT1 methylation in the infant was negatively associated with maternal methyl-group donor intake in the first and second trimester of pregnancy and negatively in the third trimester. We found no clear association between maternal choline intake

  10. Cloning and characterisation of the sagA gene of Aspergillus nidulans: a gene which affects sensitivity to DNA-damaging agents.

    Science.gov (United States)

    Jones, G W; Hooley, P; Farrington, S M; Shawcross, S G; Iwanejko, L A; Strike, P

    1999-03-01

    Mutations within the sagA gene of Aspergillus nidulans cause sensitisation to DNA-damaging chemicals but have no effect upon spontaneous or damage-induced mutation frequency. The sagA gene was cloned on a 19-kb cosmid-derived fragment by functional complementation of a sagA1 sagC3 double mutant; subsequently, a fragment of the gene was also isolated on a 3.9-kb genomic subclone. Initial sequencing of a small section of the 19-kb fragment allowed the design of primers that were subsequently used in RTPCR experiments to show that this DNA is transcribed. A 277-bp fragment derived from the transcribed region was used to screen an A. nidulans cDNA library, resulting in the isolation of a 1.4-kb partial cDNA clone which had sequence overlap with the genomic sagA fragment. This partial cDNA was incomplete but appeared to contain the whole coding region of sagA. The sagA1 mutant was shown to possess two mutations; a G-T transversion and a+ 1 frameshift due to insertion of a T. causing disruption to the C-terminal region of the SagA protein. Translation of the sagA cDNA predicts a protein of 378 amino acids, which has homology to the Saccharomyces cerevisiae End3 protein and also to certain mammalian proteins capable of causing cell transformation.

  11. Differential mitochondrial DNA and gene expression in inherited retinal dysplasia in miniature Schnauzer dogs.

    Science.gov (United States)

    Appleyard, Greg D; Forsyth, George W; Kiehlbauch, Laura M; Sigfrid, Kristen N; Hanik, Heather L J; Quon, Anita; Loewen, Matthew E; Grahn, Bruce H

    2006-05-01

    To investigate the molecular basis of inherited retinal dysplasia in miniature Schnauzers. Retina and retinal pigment epithelial tissues were collected from canine subjects at the age of 3 weeks. Total RNA isolated from these tissues was reverse transcribed to make representative cDNA pools that were compared for differences in gene expression by using a subtractive hybridization technique referred to as representational difference analysis (RDA). Expression differences identified by RDA were confirmed and quantified by real-time reverse-transcription PCR. Mitochondrial morphology from leukocytes and skeletal muscle of normal and affected miniature Schnauzers was examined by transmission electron microscopy. RDA screening of retinal pigment epithelial cDNA identified differences in mRNA transcript coding for two mitochondrial (mt) proteins--cytochrome oxidase subunit 1 and NADH dehydrogenase subunit 6--in affected dogs. Contrary to expectations, these identified sequences did not contain mutations. Based on the implication of mt-DNA-encoded proteins by the RDA experiments we used real-time PCR to compare the relative amounts of mt-DNA template in white blood cells from normal and affected dogs. White blood cells of affected dogs contained less than 30% of the normal amount of two specific mtDNA sequences, compared with the content of the nuclear-encoded glyceraldehyde-3-phosphate dehydrogenase (GA-3-PDH) reference gene. Retina and RPE tissue from affected dogs had reduced mRNA transcript levels for the two mitochondrial genes detected in the RDA experiment. Transcript levels for another mtDNA-encoded gene as well as the nuclear-encoded mitochondrial Tfam transcription factor were reduced in these tissues in affected dogs. Mitochondria from affected dogs were reduced in number and size and were unusually electron dense. Reduced levels of nuclear and mitochondrial transcripts in the retina and RPE of miniature Schnauzers affected with retinal dysplasia suggest that

  12. Multiplex cDNA quantification method that facilitates the standardization of gene expression data

    Science.gov (United States)

    Gotoh, Osamu; Murakami, Yasufumi; Suyama, Akira

    2011-01-01

    Microarray-based gene expression measurement is one of the major methods for transcriptome analysis. However, current microarray data are substantially affected by microarray platforms and RNA references because of the microarray method can provide merely the relative amounts of gene expression levels. Therefore, valid comparisons of the microarray data require standardized platforms, internal and/or external controls and complicated normalizations. These requirements impose limitations on the extensive comparison of gene expression data. Here, we report an effective approach to removing the unfavorable limitations by measuring the absolute amounts of gene expression levels on common DNA microarrays. We have developed a multiplex cDNA quantification method called GEP-DEAN (Gene expression profiling by DCN-encoding-based analysis). The method was validated by using chemically synthesized DNA strands of known quantities and cDNA samples prepared from mouse liver, demonstrating that the absolute amounts of cDNA strands were successfully measured with a sensitivity of 18 zmol in a highly multiplexed manner in 7 h. PMID:21415008

  13. Role of methionine on epigenetic modification of DNA methylation and gene expression in animals

    Directory of Open Access Journals (Sweden)

    Naifeng Zhang

    2018-03-01

    Full Text Available DNA methylation is one of the main epigenetic phenomena affecting gene expression. It is an important mechanism for the development of embryo, growth and health of animals. As a key nutritional factor limiting the synthesis of protein, methionine serves as the precursor of S-adenosylmethionine (SAM in the hepatic one-carbon metabolism. The dietary fluctuation of methionine content can alter the levels of metabolic substrates in one-carbon metabolism, e.g., the SAM, S-adenosylhomocysteine (SAH, and change the expression of genes related to the growth and health of animals by DNA methylation reactions. The ratio of SAM to SAH is called ‘methylation index’ but it should be carefully explained because the complexity of methylation reaction. Alterations of methylation in a specific cytosine-guanine (CpG site, rather than the whole promoter region, might be enough to change gene expression. Aberrant methionine cycle may provoke molecular changes of one-carbon metabolism that results in deregulation of cellular hemostasis and health problems. The importance of DNA methylation has been underscored but the mechanisms of methionine affecting DNA methylation are poorly understood. Nutritional epigenomics provides a promising insight into the targeting epigenetic changes in animals from a nutritional standpoint, which will deepen and expand our understanding of genes, molecules, tissues, and animals in which methionine alteration influences DNA methylation and gene expression. Keywords: Epigenetics, Methionine, DNA methylation, Gene expression, Epigenetic modification

  14. Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.

    Science.gov (United States)

    Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert

    2017-11-30

    Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Promoter DNA hypermethylation and gene repression in undifferentiated Arabidopsis cells.

    Directory of Open Access Journals (Sweden)

    María Berdasco

    Full Text Available Maintaining and acquiring the pluripotent cell state in plants is critical to tissue regeneration and vegetative multiplication. Histone-based epigenetic mechanisms are important for regulating this undifferentiated state. Here we report the use of genetic and pharmacological experimental approaches to show that Arabidopsis cell suspensions and calluses specifically repress some genes as a result of promoter DNA hypermethylation. We found that promoters of the MAPK12, GSTU10 and BXL1 genes become hypermethylated in callus cells and that hypermethylation also affects the TTG1, GSTF5, SUVH8, fimbrin and CCD7 genes in cell suspensions. Promoter hypermethylation in undifferentiated cells was associated with histone hypoacetylation and primarily occurred at CpG sites. Accordingly, we found that the process specifically depends on MET1 and DRM2 methyltransferases, as demonstrated with DNA methyltransferase mutants. Our results suggest that promoter DNA methylation may be another important epigenetic mechanism for the establishment and/or maintenance of the undifferentiated state in plant cells.

  16. Cloning human DNA repair genes

    International Nuclear Information System (INIS)

    Jeggo, P.A.; Carr, A.M.; Lehmann, A.R.

    1994-01-01

    Many human genes involved in the repair of UV damage have been cloned using different procedures and they have been of great value in assisting the understanding of the mechanism of nucleotide excision-repair. Genes involved in repair of ionizing radiation damage have proved more difficult to isolate. Positional cloning has localized the XRCC5 gene to a small region of chromosome 2q33-35, and a series of yeast artificial chromosomes covering this region have been isolated. Very recent work has shown that the XRCC5 gene encodes the 80 kDa subunit of the Ku DNA-binding protein. The Ku80 gene also maps to this region. Studies with fission yeast have shown that radiation sensitivity can result not only from defective DNA repair but also from abnormal cell cycle control following DNA damage. Several genes involved in this 'check-point' control in fission yeast have been isolated and characterized in detail. It is likely that a similar checkpoint control mechanism exists in human cells. (author)

  17. Cloning of Bacteroides fragilis plasmid genes affecting metronidazole resistance and ultraviolet survival in Escherichia coli

    International Nuclear Information System (INIS)

    Wehnert, G.U.; Abratt, V.R.; Goodman, H.J.; Woods, D.R.

    1990-01-01

    Since reduced metronidazole causes DNA damage, resistance to metronidazole was used as a selection method for the cloning of Bacteroides fragilis genes affecting DNA repair mechanisms in Escherichia coli. Genes from B. fragilis Bf-2 were cloned on a recombinant plasmid pMT100 which made E. coli AB1157 and uvrA, B, and C mutant strains more resistant to metronidazole, but more sensitive to far uv irradiation under aerobic conditions. The loci affecting metronidazole resistance and uv sensitivity were linked and located on a 5-kb DNA fragment which originated from the small 6-kb cryptic plasmid pBFC1 present in B. fragilis Bf-2 cells

  18. DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.

    Science.gov (United States)

    Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard

    2003-04-24

    Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.

  19. Quantitative analysis of gene-specific DNA damage in human spermatozoa

    International Nuclear Information System (INIS)

    Sawyer, Dennis E.; Mercer, Belinda G.; Wiklendt, Agnieszka M.; Aitken, R. John

    2003-01-01

    Recent studies have suggested that human spermatozoa are highly susceptible to DNA damage induced by oxidative stress. However, a detailed analysis of the precise nature of this damage and the extent to which it affects the mitochondrial and nuclear genomes has not been reported. To induce DNA damage, human spermatozoa were treated in vitro with hydrogen peroxide (H 2 O 2 ; 0-5 mM) or iron (as Fe(II)SO 4 , 0-500 μM). Quantitative PCR (QPCR) was used to measure DNA damage in individual nuclear genes (hprt, β-pol and β-globin) and mitochondrial DNA. Single strand breaks were also assessed by alkaline gel electrophoresis. H 2 O 2 was found to be genotoxic toward spermatozoa at concentrations as high as 1.25 mM, but DNA damage was not detected in these cells with lower concentrations of H 2 O 2 . The mitochondrial genome of human spermatozoa was significantly (P 2 O 2 -induced DNA damage than the nuclear genome. However, both nDNA and mtDNA in human spermatozoa were significantly (P<0.001) more resistant to damage than DNA from a variety of cell lines of germ cell and myoblastoid origin. Interestingly, significant DNA damage was also not detected in human spermatozoa treated with iron. These studies report, for the first time, quantitative measurements of DNA damage in specific genes of male germ cells, and challenge the commonly held belief that human spermatozoa are particularly vulnerable to DNA damage

  20. Genes with stable DNA methylation levels show higher evolutionary conservation than genes with fluctuant DNA methylation levels.

    Science.gov (United States)

    Zhang, Ruijie; Lv, Wenhua; Luan, Meiwei; Zheng, Jiajia; Shi, Miao; Zhu, Hongjie; Li, Jin; Lv, Hongchao; Zhang, Mingming; Shang, Zhenwei; Duan, Lian; Jiang, Yongshuai

    2015-11-24

    Different human genes often exhibit different degrees of stability in their DNA methylation levels between tissues, samples or cell types. This may be related to the evolution of human genome. Thus, we compared the evolutionary conservation between two types of genes: genes with stable DNA methylation levels (SM genes) and genes with fluctuant DNA methylation levels (FM genes). For long-term evolutionary characteristics between species, we compared the percentage of the orthologous genes, evolutionary rate dn/ds and protein sequence identity. We found that the SM genes had greater percentages of the orthologous genes, lower dn/ds, and higher protein sequence identities in all the 21 species. These results indicated that the SM genes were more evolutionarily conserved than the FM genes. For short-term evolutionary characteristics among human populations, we compared the single nucleotide polymorphism (SNP) density, and the linkage disequilibrium (LD) degree in HapMap populations and 1000 genomes project populations. We observed that the SM genes had lower SNP densities, and higher degrees of LD in all the 11 HapMap populations and 13 1000 genomes project populations. These results mean that the SM genes had more stable chromosome genetic structures, and were more conserved than the FM genes.

  1. Involvement of DNA topoisomerase I in transcription of human ribosomal RNA genes

    International Nuclear Information System (INIS)

    Zhang, H.; Wang, J.C.; Liu, L.F.

    1988-01-01

    Treatment of HeLa cells with a DNA topoisomerase I-specific inhibitor, camptothecin, results in rapid cessation of the synthesis of the 45S rRNA precursor. The inhibition of rRNA synthesis is reversible following drug removal and correlates with the presence of camptothecin-trapped topoisomerase I-DNA abortive complexes, which can be detected as topoisomerase I-linked DNA breaks upon lysis with sodium dodecyl sulfate. These breaks were found to be concentrated within the transcribed region of human rRNA genes. No such sites can be detected in the inactive human rRNA genes in mouse-human hybrid cells, suggesting a preferential association of topoisomerase I with actively transcribed genes. The distribution of RNA polymerase molecules along the transcription unit of human rRNA genes in camptothecin-treated HeLa cells, as assayed by nuclear run-on transcription, shows a graded decrease of the RNA polymerase density toward the 3' end of the transcription unit; the density is minimally affected near the 5' start of the transcription unit. These results suggest that DNA topoisomerase I is normally involved in the elongation step of transcription, especially when the transcripts are long, and that camptothecin interferes with this role

  2. Human DNA repair and recombination genes

    International Nuclear Information System (INIS)

    Thompson, L.H.; Weber, C.A.; Jones, N.J.

    1988-09-01

    Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs

  3. DNA-mediated gene transfer into ataxia-telangiectasia cells

    International Nuclear Information System (INIS)

    Crescenzi, M.; Pulciani, S.; Carbonari, M.; Tedesco, L.; Russo, G.; Gaetano, C.; Fiorilli, M.

    1986-01-01

    The complete description of the genetic lesion(s) underlying the AT mutation might, therefore, highlight not only a DNA-repair pathwa, but also an important aspect of the physiology of lymphocytes. DNA-mediated gene transfer into eukaryotic cells has proved a powerful tool for the molecular cloning of certain mammalian genes. The possibility to clone a given gene using this technology depends, basically, on the availability of a selectable marker associated with the expression of the transfected gene in the recipient cell. Recently, a human DNA repair gene has been cloned in CHO mutant cells by taking advantage of the increased resistance to ultraviolet radiation of the transformants. As a preliminary step toward the molecular cloning of the AT gene(s), the authors have attempted to confer radioresistance to AT cells by transfection with normal human DNA

  4. Molecular genetic analysis of a vaccinia virus gene with an essential role in DNA replication

    International Nuclear Information System (INIS)

    Evans, E.V.A.

    1989-01-01

    The poxvirus, vaccinia, is large DNA virus which replicates in the cytoplasma of the host cell. The virus is believed to encode most or all of the functions required for the temporally regulated transcription and replication of its 186 kilobase genome. Physical and genetic autonomy from the host make vaccinia a useful eukaryotic organism in which to study replication genes and proteins, using a combination of biochemical and genetic techniques. Essential viral functions for replication are identified by conditional lethal mutants that fail to synthesize DNA at the non-permissive temperatures. One such group contains the non-complementing alleles ts17, ts24, ts69 (WR strain). Studies were undertaken to define the phenotype of ts mutants, and to identify and characterize the affected gene and protein. Mutant infection was essentially normal at 32 degree C, but at 39 degree C the mutants did not incorporate 3 H-thymidine into nascent viral DNA or synthesize late viral proteins. If mutant cultures were shifted to non-permissive conditions at the height of replication, DNA synthesis was halted rapidly, implying that the mutants are defective in DNA elongation. The gene affected in the WR mutants and in ts6389, a DNA-minus mutant of the IHD strain, was mapped by marker rescue and corresponds to open reading frame 5 (orfD5) of the viral HindIII D fragment

  5. Identification of Bicarbonate as a Trigger and Genes Involved with Extracellular DNA Export in Mycobacterial Biofilms

    Directory of Open Access Journals (Sweden)

    Sasha J. Rose

    2016-12-01

    Full Text Available Extracellular DNA (eDNA is an integral biofilm matrix component of numerous pathogens, including nontuberculous mycobacteria (NTM. Cell lysis is the source of eDNA in certain bacteria, but the source of eDNA remains unidentified for NTM, as well as for other eDNA-containing bacterial species. In this study, conditions affecting eDNA export were examined, and genes involved with the eDNA export mechanism were identified. After a method for monitoring eDNA in real time in undisturbed biofilms was established, different conditions affecting eDNA were investigated. Bicarbonate positively influenced eDNA export in a pH-independent manner in Mycobacterium avium, M. abscessus, and M. chelonae. The surface-exposed proteome of M. avium in eDNA-containing biofilms revealed abundant carbonic anhydrases. Chemical inhibition of carbonic anhydrases with ethoxzolamide significantly reduced eDNA export. An unbiased transposon mutant library screen for eDNA export in M. avium identified many severely eDNA-attenuated mutants, including one not expressing a unique FtsK/SpoIIIE-like DNA-transporting pore, two with inactivation of carbonic anhydrases, and nine with inactivation of genes belonging to a unique genomic region, as well as numerous mutants involved in metabolism and energy production. Complementation of nine mutants that included the FtsK/SpoIIIE and carbonic anhydrase significantly restored eDNA export. Interestingly, several attenuated eDNA mutants have mutations in genes encoding proteins that were found with the surface proteomics, and many more mutations are localized in operons potentially encoding surface proteins. Collectively, our data strengthen the evidence of eDNA export being an active mechanism that is activated by the bacterium responding to bicarbonate.

  6. Variation of DNA methylation patterns associated with gene expression in rice (Oryza sativa) exposed to cadmium.

    Science.gov (United States)

    Feng, Sheng Jun; Liu, Xue Song; Tao, Hua; Tan, Shang Kun; Chu, Shan Shan; Oono, Youko; Zhang, Xian Duo; Chen, Jian; Yang, Zhi Min

    2016-12-01

    We report genome-wide single-base resolution maps of methylated cytosines and transcriptome change in Cd-exposed rice. Widespread differences were identified in CG and non-CG methylation marks between Cd-exposed and Cd-free rice genomes. There are 2320 non-redundant differentially methylated regions detected in the genome. RNA sequencing revealed 2092 DNA methylation-modified genes differentially expressed under Cd exposure. More genes were found hypermethylated than those hypomethylated in CG, CHH and CHG (where H is A, C or T) contexts in upstream, gene body and downstream regions. Many of the genes were involved in stress response, metal transport and transcription factors. Most of the DNA methylation-modified genes were transcriptionally altered under Cd stress. A subset of loss of function mutants defective in DNA methylation and histone modification activities was used to identify transcript abundance of selected genes. Compared with wide type, mutation of MET1 and DRM2 resulted in general lower transcript levels of the genes under Cd stress. Transcripts of OsIRO2, OsPR1b and Os09g02214 in drm2 were significantly reduced. A commonly used DNA methylation inhibitor 5-azacytidine was employed to investigate whether DNA demethylation affected physiological consequences. 5-azacytidine provision decreased general DNA methylation levels of selected genes, but promoted growth of rice seedlings and Cd accumulation in rice plant. © 2016 John Wiley & Sons Ltd.

  7. Isolation and characterization of the dnaA gene of Rickettsia prowazekii

    International Nuclear Information System (INIS)

    Waite, R.T.; Shaw, E.I.; Winkler, H.H.; Wood, D.G.

    1998-01-01

    The dnaA gene encoding the initiator protein of DNA replication was isolated from the obligate intracellular bacterium, Rickettsia prowazekii. Comparison of the deduced amino acid sequence of R. prowazekii DnaA with other bacterial DnaA proteins revealed extensive similarity. However, the rickettsial sequence is unique in the number of basic lysine residues found within a highly conserved portion of the putative DNA binding region, suggesting that the rickettsial protein may recognize a DNA sequence that differs from the consensus DnaA box sequence identified in other bacteria. Consensus DnaA box sequences, found upstream of many bacterial dnaA genes, were not identified upstream of rickettsial dnaA gene. In addition, gene organization within this region differed from that of other bacteria. The putative start of transcription of the rickettsial dnaA gene was localized to a site 522 nucleotides upstream of the DnaA start codon. Key words: Rickettsia prowazekii; dnaA gene; initiator protein (authors)

  8. DNA Methylation in Inflammatory Genes among Children with Obstructive Sleep Apnea

    OpenAIRE

    Kim, Jinkwan; Bhattacharjee, Rakesh; Khalyfa, Abdelnaby; Kheirandish-Gozal, Leila; Capdevila, Oscar Sans; Wang, Yang; Gozal, David

    2012-01-01

    Background: Pediatric obstructive sleep apnea (OSA) leads to multiple end-organ morbidities that are mediated by the cumulative burden of oxidative stress and inflammation. Because not all children with OSA exhibit increased systemic inflammation, genetic and environmental factors may be affecting patterns of DNA methylation in genes subserving inflammatory functions.

  9. DNA methylation in a Scottish family multiply affected by bipolar disorder and major depressive disorder.

    Science.gov (United States)

    Walker, Rosie May; Christoforou, Andrea Nikie; McCartney, Daniel L; Morris, Stewart W; Kennedy, Nicholas A; Morten, Peter; Anderson, Susan Maguire; Torrance, Helen Scott; Macdonald, Alix; Sussmann, Jessika Elizabeth; Whalley, Heather Clare; Blackwood, Douglas H R; McIntosh, Andrew Mark; Porteous, David John; Evans, Kathryn Louise

    2016-01-01

    Bipolar disorder (BD) is a severe, familial psychiatric condition. Progress in understanding the aetiology of BD has been hampered by substantial phenotypic and genetic heterogeneity. We sought to mitigate these confounders by studying a multi-generational family multiply affected by BD and major depressive disorder (MDD), who carry an illness-linked haplotype on chromosome 4p. Within a family, aetiological heterogeneity is likely to be reduced, thus conferring greater power to detect illness-related changes. As accumulating evidence suggests that altered DNA methylation confers risk for BD and MDD, we compared genome-wide methylation between (i) affected carriers of the linked haplotype (ALH) and married-in controls (MIs), (ii) well unaffected haplotype carriers (ULH) and MI, (iii) ALH and ULH and (iv) all haplotype carriers (LH) and MI. Nominally significant differences in DNA methylation were observed in all comparisons, with differences withstanding correction for multiple testing when the ALH or LH group was compared to the MIs. In both comparisons, we observed increased methylation at a locus in FANCI, which was accompanied by increased FANCI expression in the ALH group. FANCI is part of the Fanconi anaemia complementation (FANC) gene family, which are mutated in Fanconi anaemia and participate in DNA repair. Interestingly, several FANC genes have been implicated in psychiatric disorders. Regional analyses of methylation differences identified loci implicated in psychiatric illness by genome-wide association studies, including CACNB2 and the major histocompatibility complex. Gene ontology analysis revealed enrichment for methylation differences in neurologically relevant genes. Our results highlight altered DNA methylation as a potential mechanism by which the linked haplotype might confer risk for mood disorders. Differences in the phenotypic outcome of haplotype carriers might, in part, arise from additional changes in DNA methylation that converge on

  10. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  11. The phytochemical 3,3'-diindolylmethane decreases expression of AR-controlled DNA damage repair genes through repressive chromatin modifications and is associated with DNA damage in prostate cancer cells.

    Science.gov (United States)

    Palomera-Sanchez, Zoraya; Watson, Gregory W; Wong, Carmen P; Beaver, Laura M; Williams, David E; Dashwood, Roderick H; Ho, Emily

    2017-09-01

    Androgen receptor (AR) is a transcription factor involved in normal prostate physiology and prostate cancer (PCa) development. 3,3'-Diindolylmethane (DIM) is a promising phytochemical agent against PCa that affects AR activity and epigenetic regulators in PCa cells. However, whether DIM suppresses PCa via epigenetic regulation of AR target genes is unknown. We assessed epigenetic regulation of AR target genes in LNCaP PCa cells and showed that DIM treatment led to epigenetic suppression of AR target genes involved in DNA repair (PARP1, MRE11, DNA-PK). Decreased expression of these genes was accompanied by an increase in repressive chromatin marks, loss of AR occupancy and EZH2 recruitment to their regulatory regions. Decreased DNA repair gene expression was associated with an increase in DNA damage (γH2Ax) and up-regulation of genomic repeat elements LINE1 and α-satellite. Our results suggest that DIM suppresses AR-dependent gene transcription through epigenetic modulation, leading to DNA damage and genome instability in PCa cells. Published by Elsevier Inc.

  12. DNA methylation in inflammatory genes among children with obstructive sleep apnea.

    Science.gov (United States)

    Kim, Jinkwan; Bhattacharjee, Rakesh; Khalyfa, Abdelnaby; Kheirandish-Gozal, Leila; Capdevila, Oscar Sans; Wang, Yang; Gozal, David

    2012-02-01

    Pediatric obstructive sleep apnea (OSA) leads to multiple end-organ morbidities that are mediated by the cumulative burden of oxidative stress and inflammation. Because not all children with OSA exhibit increased systemic inflammation, genetic and environmental factors may be affecting patterns of DNA methylation in genes subserving inflammatory functions. DNA from matched children with OSA with and without high levels of high-sensitivity C-reactive protein (hsCRP) were assessed for DNA methylation levels of 24 inflammatory-related genes. Primer-based polymerase chain reaction assays in a case-control setting involving 47 OSA cases and 31 control subjects were conducted to confirm the findings; hsCRP and myeloid-related protein (MRP) 8/14 levels were also assayed. Forkhead box P3 (FOXP3) and interferon regulatory factor 1 (IRF1) showed higher methylation in six children with OSA and high hsCRP levels compared with matched children with OSA and low hsCRP levels (P DNA methylation levels compared with children with OSA and low CRP levels and control subjects. IRF1 did not exhibit significant differences. FOXP3 DNA methylation levels correlated with hsCRP and MRP 8/14 levels and with apnea-hypopnea index (AHI), BMI z score, and apolipoprotein B levels. A stepwise multiple regression model showed that AHI was independently associated with FOXP3 DNA methylation levels (P gene, which regulates expression of T regulatory lymphocytes, is more likely to display increased methylation among children with OSA who exhibit increased systemic inflammatory responses. Thus, epigenetic modifications may constitute an important determinant of inflammatory phenotype in OSA, and FOXP3 DNA methylation levels may provide a potential biomarker for end-organ vulnerability.

  13. Gene assembly via one-pot chemical ligation of DNA promoted by DNA nanostructures

    DEFF Research Database (Denmark)

    Manuguerra, Ilenia; Croce, Stefano; El-Sagheer, Afaf H.

    2018-01-01

    Current gene synthesis methods are driven by enzymatic reactions. Here we report the one-pot synthesis of a chemically-ligated gene from 14 oligonucleotides. The chemical ligation benefits from the highly efficient click chemistry approach templated by DNA nanostructures, and produces modified DNA...

  14. Polymorphisms in metabolism and repair genes affects DNA damage caused by open-cast coal mining exposure.

    Science.gov (United States)

    Espitia-Pérez, Lyda; Sosa, Milton Quintana; Salcedo-Arteaga, Shirley; León-Mejía, Grethel; Hoyos-Giraldo, Luz Stella; Brango, Hugo; Kvitko, Katia; da Silva, Juliana; Henriques, João A P

    2016-09-15

    Increasing evidence suggest that occupational exposure to open-cast coal mining residues like dust particles, heavy metals and Polycyclic Aromatic Hydrocarbons (PAHs) may cause a wide range of DNA damage and genomic instability that could be associated to initial steps in cancer development and other work-related diseases. The aim of our study was to evaluate if key polymorphisms in metabolism genes CYP1A1Msp1, GSTM1Null, GSTT1Null and DNA repair genes XRCC1Arg194Trp and hOGG1Ser326Cys could modify individual susceptibility to adverse coal exposure effects, considering the DNA damage (Comet assay) and micronucleus formation in lymphocytes (CBMN) and buccal mucosa cells (BMNCyt) as endpoints for genotoxicity. The study population is comprised of 200 healthy male subjects, 100 open-cast coal-mining workers from "El Cerrejón" (world's largest open-cast coal mine located in Guajira - Colombia) and 100 non-exposed referents from general population. The data revealed a significant increase of CBMN frequency in peripheral lymphocytes of occupationally exposed workers carrying the wild-type variant of GSTT1 (+) gene. Exposed subjects carrying GSTT1null polymorphism showed a lower micronucleus frequency compared with their positive counterparts (FR: 0.83; P=0.04), while BMNCyt, frequency and Comet assay parameters in lymphocytes: Damage Index (DI) and percentage of DNA in the tail (Tail % DNA) were significantly higher in exposed workers with the GSTM1Null polymorphism. Other exfoliated buccal mucosa abnormalities related to cell death (Karyorrhexis and Karyolysis) were increased in GSTT/M1Null carriers. Nuclear buds were significantly higher in workers carrying the CYP1A1Msp1 (m1/m2, m2/m2) allele. Moreover, BMNCyt frequency and Comet assay parameters were significantly lower in exposed carriers of XRCC1Arg194Trp (Arg/Trp, Trp/Trp) and hOGG1Ser326Cys (Ser/Cys, Cys/Cys), thereby providing new data to the increasing evidence about the protective role of these polymorphisms

  15. Gene transcription profiles, global DNA methylation and potential transgenerational epigenetic effects related to Zn exposure history in Daphnia magna

    International Nuclear Information System (INIS)

    Vandegehuchte, Michiel B.; De Coninck, Dieter; Vandenbrouck, Tine; De Coen, Wim M.; Janssen, Colin R.

    2010-01-01

    A reduced level of DNA methylation has recently been described in both Zn-exposed and non-exposed offspring of Daphnia magna exposed to Zn. The hypothesis examined in this study is that DNA hypomethylation has an effect on gene transcription. A second hypothesis is that accumulative epigenetic effects can affect gene transcription in non-exposed offspring from parents with an exposure history of more than one generation. Transcriptional gene regulation was studied with a cDNA microarray. In the exposed and non-exposed hypomethylated daphnids, a large proportion of common genes were similarly up- or down-regulated, indicating a possible effect of the DNA hypomethylation. Two of these genes can be mechanistically involved in DNA methylation reduction. The similar transcriptional regulation of two and three genes in the F 0 and F 1 exposed daphnids on one hand and their non-exposed offspring on the other hand, could be the result of a one-generation temporary transgenerational epigenetic effect, which was not accumulative. - Zn-induced DNA hypomethylation is related to gene transcription in Daphnia magna and Zn exposure potentially induced limited temporary transgenerational effects on gene transcription.

  16. Correlating Gene-specific DNA Methylation Changes with Expression and Transcriptional Activity of Astrocytic KCNJ10 (Kir4.1).

    Science.gov (United States)

    Nwaobi, Sinifunanya E; Olsen, Michelle L

    2015-09-26

    DNA methylation serves to regulate gene expression through the covalent attachment of a methyl group onto the C5 position of a cytosine in a cytosine-guanine dinucleotide. While DNA methylation provides long-lasting and stable changes in gene expression, patterns and levels of DNA methylation are also subject to change based on a variety of signals and stimuli. As such, DNA methylation functions as a powerful and dynamic regulator of gene expression. The study of neuroepigenetics has revealed a variety of physiological and pathological states that are associated with both global and gene-specific changes in DNA methylation. Specifically, striking correlations between changes in gene expression and DNA methylation exist in neuropsychiatric and neurodegenerative disorders, during synaptic plasticity, and following CNS injury. However, as the field of neuroepigenetics continues to expand its understanding of the role of DNA methylation in CNS physiology, delineating causal relationships in regards to changes in gene expression and DNA methylation are essential. Moreover, in regards to the larger field of neuroscience, the presence of vast region and cell-specific differences requires techniques that address these variances when studying the transcriptome, proteome, and epigenome. Here we describe FACS sorting of cortical astrocytes that allows for subsequent examination of a both RNA transcription and DNA methylation. Furthermore, we detail a technique to examine DNA methylation, methylation sensitive high resolution melt analysis (MS-HRMA) as well as a luciferase promoter assay. Through the use of these combined techniques one is able to not only explore correlative changes between DNA methylation and gene expression, but also directly assess if changes in the DNA methylation status of a given gene region are sufficient to affect transcriptional activity.

  17. DNA sequence responsible for the amplification of adjacent genes.

    Science.gov (United States)

    Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K

    1987-10-01

    A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.

  18. Maternal folate depletion and high-fat feeding from weaning affects DNA methylation and DNA repair in brain of adult offspring.

    Science.gov (United States)

    Langie, Sabine A S; Achterfeldt, Sebastian; Gorniak, Joanna P; Halley-Hogg, Kirstin J A; Oxley, David; van Schooten, Frederik J; Godschalk, Roger W L; McKay, Jill A; Mathers, John C

    2013-08-01

    The mechanisms through which environmental and dietary factors modulate DNA repair are still unclear but may include dysregulation of gene expression due to altered epigenetic markings. In a mouse model, we investigated the effect of maternal folate depletion during pregnancy and lactation, and high-fat feeding from weaning, on base excision repair (BER) and DNA methylation and expression of selected BER-related genes in the brain of adult offspring. While folate depletion did not affect BER activity of the mothers, BER increased in the offspring at weaning (P=0.052). In the long term, as observed in 6-mo-old offspring, the double insult, i.e., maternal low-folate supply and high-fat feeding from weaning, decreased BER activity significantly in the cortex, cerebellum, hippocampus, and subcortical regions (P≤0.017). This fall in BER activity was associated with small changes in methylation or expression of BER-related genes. Maternal folate depletion led to slightly increased oxidative DNA damage levels in subcortical regions of adult offspring, which may increase sensitivity to oxidative stress and predispose to neurological disorders. In summary, our data suggest that low-folate supply during early life may leave an epigenetic mark that can predispose the offspring to further dietary insults, causing adverse effects during adult life.

  19. Epigenetic changes of DNA repair genes in cancer.

    Science.gov (United States)

    Lahtz, Christoph; Pfeifer, Gerd P

    2011-02-01

    'Every Hour Hurts, The Last One Kills'. That is an old saying about getting old. Every day, thousands of DNA damaging events take place in each cell of our body, but efficient DNA repair systems have evolved to prevent that. However, our DNA repair system and that of most other organisms are not as perfect as that of Deinococcus radiodurans, for example, which is able to repair massive amounts of DNA damage at one time. In many instances, accumulation of DNA damage has been linked to cancer, and genetic deficiencies in specific DNA repair genes are associated with tumor-prone phenotypes. In addition to mutations, which can be either inherited or somatically acquired, epigenetic silencing of DNA repair genes may promote tumorigenesis. This review will summarize current knowledge of the epigenetic inactivation of different DNA repair components in human cancer.

  20. The impact of endurance exercise on global and AMPK gene-specific DNA methylation

    Energy Technology Data Exchange (ETDEWEB)

    King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.; Schmetzer, Julia; Möser, Christine V.; Knothe, Claudia [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany); Resch, Eduard [Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Project Group for Translational Medicine & Pharmacology (TMP), 60596, Frankfurt/Main (Germany); Peil, Johannes [Sports Clinic, Bad Nauheim, MCI GmbH, In der Aue 30-32, 61231, Bad Nauheim (Germany); Geisslinger, Gerd [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany); Fraunhofer Institute for Molecular Biology and Applied Ecology (IME), Project Group for Translational Medicine & Pharmacology (TMP), 60596, Frankfurt/Main (Germany); Niederberger, Ellen, E-mail: e.niederberger@em.uni-frankfurt.de [pharmazentrum frankfurt/ZAFES, Institut für Klinische Pharmakologie, Klinikum der Goethe-Universität Frankfurt, Theodor Stern Kai 7, 60590, Frankfurt am Main (Germany)

    2016-05-27

    Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as well as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.

  1. The impact of endurance exercise on global and AMPK gene-specific DNA methylation

    International Nuclear Information System (INIS)

    King-Himmelreich, Tanya S.; Schramm, Stefanie; Wolters, Miriam C.; Schmetzer, Julia; Möser, Christine V.; Knothe, Claudia; Resch, Eduard; Peil, Johannes; Geisslinger, Gerd; Niederberger, Ellen

    2016-01-01

    Alterations in gene expression as a consequence of physical exercise are frequently described. The mechanism of these regulations might depend on epigenetic changes in global or gene-specific DNA methylation levels. The AMP-activated protein kinase (AMPK) plays a key role in maintenance of energy homeostasis and is activated by increases in the AMP/ATP ratio as occurring in skeletal muscles after sporting activity. To analyze whether exercise has an impact on the methylation status of the AMPK promoter, we determined the AMPK methylation status in human blood samples from patients before and after sporting activity in the context of rehabilitation as well as in skeletal muscles of trained and untrained mice. Further, we examined long interspersed nuclear element 1 (LINE-1) as indicator of global DNA methylation changes. Our results revealed that light sporting activity in mice and humans does not alter global DNA methylation but has an effect on methylation of specific CpG sites in the AMPKα2 gene. These regulations were associated with a reduced AMPKα2 mRNA and protein expression in muscle tissue, pointing at a contribution of the methylation status to AMPK expression. Taken together, these results suggest that exercise influences AMPKα2 gene methylation in human blood and eminently in the skeletal muscle of mice and therefore might repress AMPKα2 gene expression. -- Highlights: •AMPK gene methylation increases after moderate endurance exercise in humans and mice. •AMPKα mRNA and protein decrease after moderate endurance exercise in mice. •Global DNA methylation is not affected under the same conditions.

  2. Single gene retrieval from thermally degraded DNA

    Indian Academy of Sciences (India)

    To simulate single gene retrieval from ancient DNA, several related factors have been investigated. By monitoring a 889 bp polymerase chain reaction (PCR) product and genomic DNA degradation, we find that heat and oxygen (especially heat) are both crucial factors influencing DNA degradation. The heat influence ...

  3. DNA Array-Based Gene Profiling

    Science.gov (United States)

    Mocellin, Simone; Provenzano, Maurizio; Rossi, Carlo Riccardo; Pilati, Pierluigi; Nitti, Donato; Lise, Mario

    2005-01-01

    Cancer is a heterogeneous disease in most respects, including its cellularity, different genetic alterations, and diverse clinical behaviors. Traditional molecular analyses are reductionist, assessing only 1 or a few genes at a time, thus working with a biologic model too specific and limited to confront a process whose clinical outcome is likely to be governed by the combined influence of many genes. The potential of functional genomics is enormous, because for each experiment, thousands of relevant observations can be made simultaneously. Accordingly, DNA array, like other high-throughput technologies, might catalyze and ultimately accelerate the development of knowledge in tumor cell biology. Although in its infancy, the implementation of DNA array technology in cancer research has already provided investigators with novel data and intriguing new hypotheses on the molecular cascade leading to carcinogenesis, tumor aggressiveness, and sensitivity to antiblastic agents. Given the revolutionary implications that the use of this technology might have in the clinical management of patients with cancer, principles of DNA array-based tumor gene profiling need to be clearly understood for the data to be correctly interpreted and appreciated. In the present work, we discuss the technical features characterizing this powerful laboratory tool and review the applications so far described in the field of oncology. PMID:15621987

  4. Gene organization in rice revealed by full-length cDNA mapping and gene expression analysis through microarray.

    Directory of Open Access Journals (Sweden)

    Kouji Satoh

    Full Text Available Rice (Oryza sativa L. is a model organism for the functional genomics of monocotyledonous plants since the genome size is considerably smaller than those of other monocotyledonous plants. Although highly accurate genome sequences of indica and japonica rice are available, additional resources such as full-length complementary DNA (FL-cDNA sequences are also indispensable for comprehensive analyses of gene structure and function. We cross-referenced 28.5K individual loci in the rice genome defined by mapping of 578K FL-cDNA clones with the 56K loci predicted in the TIGR genome assembly. Based on the annotation status and the presence of corresponding cDNA clones, genes were classified into 23K annotated expressed (AE genes, 33K annotated non-expressed (ANE genes, and 5.5K non-annotated expressed (NAE genes. We developed a 60mer oligo-array for analysis of gene expression from each locus. Analysis of gene structures and expression levels revealed that the general features of gene structure and expression of NAE and ANE genes were considerably different from those of AE genes. The results also suggested that the cloning efficiency of rice FL-cDNA is associated with the transcription activity of the corresponding genetic locus, although other factors may also have an effect. Comparison of the coverage of FL-cDNA among gene families suggested that FL-cDNA from genes encoding rice- or eukaryote-specific domains, and those involved in regulatory functions were difficult to produce in bacterial cells. Collectively, these results indicate that rice genes can be divided into distinct groups based on transcription activity and gene structure, and that the coverage bias of FL-cDNA clones exists due to the incompatibility of certain eukaryotic genes in bacteria.

  5. Comparing the DNA hypermethylome with gene mutations in human colorectal cancer.

    Directory of Open Access Journals (Sweden)

    Kornel E Schuebel

    2007-09-01

    Full Text Available We have developed a transcriptome-wide approach to identify genes affected by promoter CpG island DNA hypermethylation and transcriptional silencing in colorectal cancer. By screening cell lines and validating tumor-specific hypermethylation in a panel of primary human colorectal cancer samples, we estimate that nearly 5% or more of all known genes may be promoter methylated in an individual tumor. When directly compared to gene mutations, we find larger numbers of genes hypermethylated in individual tumors, and a higher frequency of hypermethylation within individual genes harboring either genetic or epigenetic changes. Thus, to enumerate the full spectrum of alterations in the human cancer genome, and to facilitate the most efficacious grouping of tumors to identify cancer biomarkers and tailor therapeutic approaches, both genetic and epigenetic screens should be undertaken.

  6. A comparison of synthetic oligodeoxynucleotides, DNA fragments and AAV-1 for targeted episomal and chromosomal gene repair

    Directory of Open Access Journals (Sweden)

    Leclerc Xavier

    2009-04-01

    Full Text Available Abstract Background Current strategies for gene therapy of inherited diseases consist in adding functional copies of the gene that is defective. An attractive alternative to these approaches would be to correct the endogenous mutated gene in the affected individual. This study presents a quantitative comparison of the repair efficiency using different forms of donor nucleic acids, including synthetic DNA oligonucleotides, double stranded DNA fragments with sizes ranging from 200 to 2200 bp and sequences carried by a recombinant adeno-associated virus (rAAV-1. Evaluation of each gene repair strategy was carried out using two different reporter systems, a mutated eGFP gene or a dual construct with a functional eGFP and an inactive luciferase gene, in several different cell systems. Gene targeting events were scored either following transient co-transfection of reporter plasmids and donor DNAs, or in a system where a reporter construct was stably integrated into the chromosome. Results In both episomal and chromosomal assays, DNA fragments were more efficient at gene repair than oligonucleotides or rAAV-1. Furthermore, the gene targeting frequency could be significantly increased by using DNA repair stimulating drugs such as doxorubicin and phleomycin. Conclusion Our results show that it is possible to obtain repair frequencies of 1% of the transfected cell population under optimized transfection protocols when cells were pretreated with phleomycin using rAAV-1 and dsDNA fragments.

  7. Dietary selenomethionine increases exon-specific DNA methylation of the p53 gene in rat liver and colon mucosa.

    Science.gov (United States)

    Zeng, Huawei; Yan, Lin; Cheng, Wen-Hsing; Uthus, Eric O

    2011-08-01

    The regulation of site-specific DNA methylation of tumor suppressor genes has been considered as a leading mechanism by which certain nutrients exert their anticancer property. This study was to investigate whether selenium (Se) affects the methylation of globe genomic DNA and the exon-specific p53 gene. Three groups of rats (n = 6-7/group) were fed the AIN-93G basal diet supplemented with 0 [Se deficient (D)], 0.15 [Se adequate (A)], or 4 mg [Se supranutritional (S)] (Se as l-selenomethionine)/kg diet for 104 d, respectively. Rats fed the A or S diet had greater plasma and liver glutathione peroxidase activity, liver thioredoxin reductase activity, and plasma homocysteine concentration than those fed the D diet. However, compared with the A diet, rats fed the S diet did not further increase these Se-dependent enzyme activities or homocysteine concentration. In contrast, Se concentrations in kidney, liver, gastrocnemius muscle, and plasma were increased in a Se-dose-dependent manner. Interestingly, rats fed the S diet had significantly less global liver genomic DNA methylation than those fed the D diet. However, the S diet significantly increased the methylation of the p53 gene (exons 5-8) but not the β-actin gene (exons 2-3) DNA in liver and colon mucosa compared with those fed the D diet. Taken together, long-term Se consumption not only affects selenoprotein enzyme activities, homocysteine, tissue Se concentrations, and global genomic DNA methylation but also increases exon-specific DNA methylation of the p53 gene in a Se-dose-dependent manner in rat liver and colon mucosa.

  8. DNA-dependent protein kinase inhibits AID-induced antibody gene conversion.

    Directory of Open Access Journals (Sweden)

    Adam J L Cook

    2007-04-01

    Full Text Available Affinity maturation and class switching of antibodies requires activation-induced cytidine deaminase (AID-dependent hypermutation of Ig V(DJ rearrangements and Ig S regions, respectively, in activated B cells. AID deaminates deoxycytidine bases in Ig genes, converting them into deoxyuridines. In V(DJ regions, subsequent excision of the deaminated bases by uracil-DNA glycosylase, or by mismatch repair, leads to further point mutation or gene conversion, depending on the species. In Ig S regions, nicking at the abasic sites produced by AID and uracil-DNA glycosylases results in staggered double-strand breaks, whose repair by nonhomologous end joining mediates Ig class switching. We have tested whether nonhomologous end joining also plays a role in V(DJ hypermutation using chicken DT40 cells deficient for Ku70 or the DNA-dependent protein kinase catalytic subunit (DNA-PKcs. Inactivation of the Ku70 or DNA-PKcs genes in DT40 cells elevated the rate of AID-induced gene conversion as much as 5-fold. Furthermore, DNA-PKcs-deficiency appeared to reduce point mutation. The data provide strong evidence that double-strand DNA ends capable of recruiting the DNA-dependent protein kinase complex are important intermediates in Ig V gene conversion.

  9. The dnaN gene codes for the beta subunit of DNA polymerase III holoenzyme of escherichia coli.

    Science.gov (United States)

    Burgers, P M; Kornberg, A; Sakakibara, Y

    1981-09-01

    An Escherichia coli mutant, dnaN59, stops DNA synthesis promptly upon a shift to a high temperature; the wild-type dnaN gene carried in a transducing phage encodes a polypeptide of about 41,000 daltons [Sakakibara, Y. & Mizukami, T. (1980) Mol. Gen. Genet. 178, 541-553; Yuasa, S. & Sakakibara, Y. (1980) Mol. Gen. Genet. 180, 267-273]. We now find that the product of dnaN gene is the beta subunit of DNA polymerase III holoenzyme, the principal DNA synthetic multipolypeptide complex in E. coli. The conclusion is based on the following observations: (i) Extracts from dnaN59 cells were defective in phage phi X174 and G4 DNA synthesis after the mutant cells had been exposed to the increased temperature. (ii) The enzymatic defect was overcome by addition of purified beta subunit but not by other subunits of DNA polymerase III holoenzyme or by other replication proteins required for phi X174 DNA synthesis. (iii) Partially purified beta subunit from the dnaN mutant, unlike that from the wild type, was inactive in reconstituting the holoenzyme when mixed with the other purified subunits. (iv) Increased dosage of the dnaN gene provided by a plasmid carrying the gene raised cellular levels of the beta subunit 5- to 6-fold.

  10. A common mutation in the 5,10-methylenetetrahydrofolate reductase gene affects genomic DNA methylation through an interaction with folate status

    Science.gov (United States)

    Friso, Simonetta; Choi, Sang-Woon; Girelli, Domenico; Mason, Joel B.; Dolnikowski, Gregory G.; Bagley, Pamela J.; Olivieri, Oliviero; Jacques, Paul F.; Rosenberg, Irwin H.; Corrocher, Roberto; Selhub, Jacob

    2002-01-01

    DNA methylation, an essential epigenetic feature of DNA that modulates gene expression and genomic integrity, is catalyzed by methyltransferases that use the universal methyl donor S-adenosyl-l-methionine. Methylenetetrahydrofolate reductase (MTHFR) catalyzes the synthesis of 5-methyltetrahydrofolate (5-methylTHF), the methyl donor for synthesis of methionine from homocysteine and precursor of S-adenosyl-l-methionine. In the present study we sought to determine the effect of folate status on genomic DNA methylation with an emphasis on the interaction with the common C677T mutation in the MTHFR gene. A liquid chromatography/MS method for the analysis of nucleotide bases was used to assess genomic DNA methylation in peripheral blood mononuclear cell DNA from 105 subjects homozygous for this mutation (T/T) and 187 homozygous for the wild-type (C/C) MTHFR genotype. The results show that genomic DNA methylation directly correlates with folate status and inversely with plasma homocysteine (tHcy) levels (P < 0.01). T/T genotypes had a diminished level of DNA methylation compared with those with the C/C wild-type (32.23 vs.62.24 ng 5-methylcytosine/μg DNA, P < 0.0001). When analyzed according to folate status, however, only the T/T subjects with low levels of folate accounted for the diminished DNA methylation (P < 0.0001). Moreover, in T/T subjects DNA methylation status correlated with the methylated proportion of red blood cell folate and was inversely related to the formylated proportion of red blood cell folates (P < 0.03) that is known to be solely represented in those individuals. These results indicate that the MTHFR C677T polymorphism influences DNA methylation status through an interaction with folate status. PMID:11929966

  11. Aberrant DNA methylation of WNT pathway genes in the development and progression of CIMP-negative colorectal cancer.

    Science.gov (United States)

    Galamb, Orsolya; Kalmár, Alexandra; Péterfia, Bálint; Csabai, István; Bodor, András; Ribli, Dezső; Krenács, Tibor; Patai, Árpád V; Wichmann, Barnabás; Barták, Barbara Kinga; Tóth, Kinga; Valcz, Gábor; Spisák, Sándor; Tulassay, Zsolt; Molnár, Béla

    2016-08-02

    The WNT signaling pathway has an essential role in colorectal carcinogenesis and progression, which involves a cascade of genetic and epigenetic changes. We aimed to analyze DNA methylation affecting the WNT pathway genes in colorectal carcinogenesis in promoter and gene body regions using whole methylome analysis in 9 colorectal cancer, 15 adenoma, and 6 normal tumor adjacent tissue (NAT) samples by methyl capture sequencing. Functional methylation was confirmed on 5-aza-2'-deoxycytidine-treated colorectal cancer cell line datasets. In parallel with the DNA methylation analysis, mutations of WNT pathway genes (APC, β-catenin/CTNNB1) were analyzed by 454 sequencing on GS Junior platform. Most differentially methylated CpG sites were localized in gene body regions (95% of WNT pathway genes). In the promoter regions, 33 of the 160 analyzed WNT pathway genes were differentially methylated in colorectal cancer vs. normal, including hypermethylated AXIN2, CHP1, PRICKLE1, SFRP1, SFRP2, SOX17, and hypomethylated CACYBP, CTNNB1, MYC; 44 genes in adenoma vs. NAT; and 41 genes in colorectal cancer vs. adenoma comparisons. Hypermethylation of AXIN2, DKK1, VANGL1, and WNT5A gene promoters was higher, while those of SOX17, PRICKLE1, DAAM2, and MYC was lower in colon carcinoma compared to adenoma. Inverse correlation between expression and methylation was confirmed in 23 genes, including APC, CHP1, PRICKLE1, PSEN1, and SFRP1. Differential methylation affected both canonical and noncanonical WNT pathway genes in colorectal normal-adenoma-carcinoma sequence. Aberrant DNA methylation appears already in adenomas as an early event of colorectal carcinogenesis.

  12. DNA methylation of amino acid transporter genes in the human placenta.

    Science.gov (United States)

    Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K

    2017-12-01

    Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.

  13. Isolating human DNA repair genes using rodent-cell mutants

    International Nuclear Information System (INIS)

    Thompson, L.H.; Weber, C.A.; Brookman, K.W.; Salazar, E.P.; Stewart, S.A.; Mitchell, D.L.

    1987-01-01

    The DNA repair systems of rodent and human cells appear to be at least as complex genetically as those in lower eukaryotes and bacteria. The use of mutant lines of rodent cells as a means of identifying human repair genes by functional complementation offers a new approach toward studying the role of repair in mutagenesis and carcinogenesis. In each of six cases examined using hybrid cells, specific human chromosomes have been identified that correct CHO cell mutations affecting repair of damage from uv or ionizing radiations. This finding suggests that both the repair genes and proteins may be virtually interchangeable between rodent and human cells. Using cosmid vectors, human repair genes that map to chromosome 19 have cloned as functional sequences: ERCC2 and XRCC1. ERCC1 was found to have homology with the yeast excision repair gene RAD10. Transformants of repair-deficient cell lines carrying the corresponding human gene show efficient correction of repair capacity by all criteria examined. 39 refs., 1 fig., 1 tab

  14. DNA Nanotechnology for Precise Control over Drug Delivery and Gene Therapy.

    Science.gov (United States)

    Angell, Chava; Xie, Sibai; Zhang, Liangfang; Chen, Yi

    2016-03-02

    Nanomedicine has been growing exponentially due to its enhanced drug targeting and reduced drug toxicity. It uses the interactions where nanotechnological components and biological systems communicate with each other to facilitate the delivery performance. At this scale, the physiochemical properties of delivery systems strongly affect their capacities. Among current delivery systems, DNA nanotechnology shows many advantages because of its unprecedented engineering abilities. Through molecular recognition, DNA nanotechnology can be used to construct a variety of nanostructures with precisely controllable size, shape, and surface chemistry, which can be appreciated in the delivery process. In this review, different approaches that are currently used for the construction of DNA nanostructures are reported. Further, the utilization of these DNA nanostructures with the well-defined parameters for the precise control in drug delivery and gene therapy is discussed. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. nfi-1 affects behavior and life-span in C. elegans but is not essential for DNA replication or survival

    Directory of Open Access Journals (Sweden)

    Hirono Keiko

    2005-10-01

    Full Text Available Abstract Background The Nuclear Factor I (one (NFI family of transcription/replication factors plays essential roles in mammalian gene expression and development and in adenovirus DNA replication. Because of its role in viral DNA replication NFI has long been suspected to function in host DNA synthesis. Determining the requirement for NFI proteins in mammalian DNA replication is complicated by the presence of 4 NFI genes in mice and humans. Loss of individual NFI genes in mice cause defects in brain, lung and tooth development, but the presence of 4 homologous NFI genes raises the issue of redundant roles for NFI genes in DNA replication. No NFI genes are present in bacteria, fungi or plants. However single NFI genes are present in several simple animals including Drosophila and C. elegans, making it possible to test for a requirement for NFI in multicellular eukaryotic DNA replication and development. Here we assess the functions of the single nfi-1 gene in C. elegans. Results C. elegans NFI protein (CeNFI binds specifically to the same NFI-binding site recognized by vertebrate NFIs. nfi-1 encodes alternatively-spliced, maternally-inherited transcripts that are expressed at the single cell stage, during embryogenesis, and in adult muscles, neurons and gut cells. Worms lacking nfi-1 survive but have defects in movement, pharyngeal pumping and egg-laying and have a reduced life-span. Expression of the muscle gene Ce titin is decreased in nfi-1 mutant worms. Conclusion NFI gene function is not needed for survival in C. elegans and thus NFI is likely not essential for DNA replication in multi-cellular eukaryotes. The multiple defects in motility, egg-laying, pharyngeal pumping, and reduced lifespan indicate that NFI is important for these processes. Reduction in Ce titin expression could affect muscle function in multiple tissues. The phenotype of nfi-1 null worms indicates that NFI functions in multiple developmental and behavioral systems in C

  16. DNA dynamics play a role as a basal transcription factor in the positioning and regulation of gene transcription initiation

    OpenAIRE

    Alexandrov, Boian S.; Gelev, Vladimir; Yoo, Sang Wook; Alexandrov, Ludmil B.; Fukuyo, Yayoi; Bishop, Alan R.; Rasmussen, Kim ?.; Usheva, Anny

    2009-01-01

    We assess the role of DNA breathing dynamics as a determinant of promoter strength and transcription start site (TSS) location. We compare DNA Langevin dynamic profiles of representative gene promoters, calculated with the extended non-linear PBD model of DNA with experimental data on transcription factor binding and transcriptional activity. Our results demonstrate that DNA dynamic activity at the TSS can be suppressed by mutations that do not affect basal transcription factor binding–DNA co...

  17. Multiple controls affect arsenite oxidase gene expression in Herminiimonas arsenicoxydans

    Directory of Open Access Journals (Sweden)

    Coppée Jean-Yves

    2010-02-01

    Full Text Available Abstract Background Both the speciation and toxicity of arsenic are affected by bacterial transformations, i.e. oxidation, reduction or methylation. These transformations have a major impact on environmental contamination and more particularly on arsenic contamination of drinking water. Herminiimonas arsenicoxydans has been isolated from an arsenic- contaminated environment and has developed various mechanisms for coping with arsenic, including the oxidation of As(III to As(V as a detoxification mechanism. Results In the present study, a differential transcriptome analysis was used to identify genes, including arsenite oxidase encoding genes, involved in the response of H. arsenicoxydans to As(III. To get insight into the molecular mechanisms of this enzyme activity, a Tn5 transposon mutagenesis was performed. Transposon insertions resulting in a lack of arsenite oxidase activity disrupted aoxR and aoxS genes, showing that the aox operon transcription is regulated by the AoxRS two-component system. Remarkably, transposon insertions were also identified in rpoN coding for the alternative N sigma factor (σ54 of RNA polymerase and in dnaJ coding for the Hsp70 co-chaperone. Western blotting with anti-AoxB antibodies and quantitative RT-PCR experiments allowed us to demonstrate that the rpoN and dnaJ gene products are involved in the control of arsenite oxidase gene expression. Finally, the transcriptional start site of the aoxAB operon was determined using rapid amplification of cDNA ends (RACE and a putative -12/-24 σ54-dependent promoter motif was identified upstream of aoxAB coding sequences. Conclusion These results reveal the existence of novel molecular regulatory processes governing arsenite oxidase expression in H. arsenicoxydans. These data are summarized in a model that functionally integrates arsenite oxidation in the adaptive response to As(III in this microorganism.

  18. Whole genome DNA methylation: beyond genes silencing

    OpenAIRE

    Tirado-Magallanes, Roberto; Rebbani, Khadija; Lim, Ricky; Pradhan, Sriharsa; Benoukraf, Touati

    2016-01-01

    The combination of DNA bisulfite treatment with high-throughput sequencing technologies has enabled investigation of genome-wide DNA methylation at near base pair level resolution, far beyond that of the kilobase-long canonical CpG islands that initially revealed the biological relevance of this covalent DNA modification. The latest high-resolution studies have revealed a role for very punctual DNA methylation in chromatin plasticity, gene regulation and splicing. Here, we aim to outline the ...

  19. Chronic exposure to microcystin-LR affected mitochondrial DNA maintenance and caused pathological changes of lung tissue in mice

    International Nuclear Information System (INIS)

    Li, Xinxiu; Xu, Lizhi; Zhou, Wei; Zhao, Qingya; Wang, Yaping

    2016-01-01

    Microcystin-LR (MC-LR), an important variant of cyanotoxin family, was frequently encountered in the contaminated aquatic environment and taken as a potent hepatotoxin. However, a little was known on the association between the long-term MC-LR exposure and lung damage. In this study, we investigated the changes of the pulmonary histopathology, mitochondrial DNA (mtDNA) integrity and the expression of mtDNA encoded genes in the mice with chronic exposed to MC-LR at different concentrations (1, 5, 10, 20 and 40 μg/L) for 12 months. Our results showed that the long-term and persistent exposure to MC-LR disturbed the balance of redox system, influenced mtDNA stability, changed the expression of mitochondrial genes in the lung cells. Notably, MC-LR exposure influenced the level of inflammatory cytokines and resulted in thickening of the alveolar septa. In conclusion, chronic exposure to MC-LR affected mtDNA maintenance, and caused lung impairment in mice. - Highlights: • A simulated natural exposure to MC-LR caused the lung pathological changes. • The chronic exposure disturbed the redox system balance of lung tissue cells. • The chronic exposure impaired the mtDNA stability and mitochondria function. • The lung was one of the vulnerable organs to MC-LR exposure in mice. - Long-term exposure to MC-LR in drinking water disturbed the balance of redox system, affected mitochondrial DNA maintenance and caused lung impairment in mice.

  20. Effect of specific enzyme inhibitors on replication, total genome DNA repair and on gene-specific DNA repair after UV irradiation in CHO cells

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.C.; Stevsner, Tinna; Bohr, Vilhelm A. (National Cancer Institute, NIH, Bethesda, MD (USA). Division of Cancer Treatment, Laboratory of Molecular Pharmacology); Mattern, M.R. (Smith Kline Beecham Pharmaceuticals, King of Prussia, PA (USA). Department of Biomolecular Discovery)

    1991-09-01

    The effects were studied of some specific enzyme inhibitors on DNA repair and replication after UV damage in Chinese hamster ovary cells. The DNA repair was studied at the level of the average, overall genome and also in the active dihydrofolate reductase gene. Replication was measured in the overall genome. The inhibitors were tested of DNA poly-merase {alpha} and {delta} (aphidicolin), of poly(ADPr) polymerase (3-aminobenzamide), of ribonucleotide reductase (hydroxyurea), of topo-isomerase I (camptothecin), and of topoisomerase II (merbarone, VP-16). In addition, the effects were tested of the potential topoisomerase I activator, {beta}-lapachone. All of these compounds inhibited genome replication and all topoisomerase inhibitors affected the overall genome repair; {beta}-lapachone stimulated it. None of these compounds had any effect on the gene-specific repair. (author). 36 refs.; 3 figs.; 2 tabs.

  1. Genetic polymorphisms in homologous recombination repair genes in healthy Slovenian population and their influence on DNA damage

    International Nuclear Information System (INIS)

    Goricar, Katja; Erculj, Nina; Zadel, Maja; Dolzan, Vita

    2012-01-01

    Homologous recombination (HR) repair is an important mechanism involved in repairing double-strand breaks in DNA and for maintaining genomic stability. Polymorphisms in genes coding for enzymes involved in this pathway may influence the capacity for DNA repair. The aim of this study was to select tag single nucleotide polymorphisms (SNPs) in specific genes involved in HR repair, to determine their allele frequencies in a healthy Slovenian population and their influence on DNA damage detected with comet assay. In total 373 individuals were genotyped for nine tag SNPs in three genes: XRCC3 722C>T, XRCC3 -316A>G, RAD51 -98G>C, RAD51 -61G>T, RAD51 1522T>G, NBS1 553G>C, NBS1 1197A>G, NBS1 37117C>T and NBS1 3474A>C using competitive allele-specific amplification (KASPar assay). Comet assay was performed in a subgroup of 26 individuals to determine the influence of selected SNPs on DNA damage. We observed that age significantly affected genotype frequencies distribution of XRCC3 -316A>G (P = 0.039) in healthy male blood donors. XRCC3 722C>T (P = 0.005), RAD51 -61G>T (P = 0.023) and NBS1 553G>C (P = 0.008) had a statistically significant influence on DNA damage. XRCC3 722C>T, RAD51 -61G>T and NBS1 553G>C polymorphisms significantly affect the repair of damaged DNA and may be of clinical importance as they are common in Slovenian population

  2. Quantitative DNA methylation analysis of candidate genes in cervical cancer.

    Directory of Open Access Journals (Sweden)

    Erin M Siegel

    Full Text Available Aberrant DNA methylation has been observed in cervical cancer; however, most studies have used non-quantitative approaches to measure DNA methylation. The objective of this study was to quantify methylation within a select panel of genes previously identified as targets for epigenetic silencing in cervical cancer and to identify genes with elevated methylation that can distinguish cancer from normal cervical tissues. We identified 49 women with invasive squamous cell cancer of the cervix and 22 women with normal cytology specimens. Bisulfite-modified genomic DNA was amplified and quantitative pyrosequencing completed for 10 genes (APC, CCNA, CDH1, CDH13, WIF1, TIMP3, DAPK1, RARB, FHIT, and SLIT2. A Methylation Index was calculated as the mean percent methylation across all CpG sites analyzed per gene (~4-9 CpG site per sequence. A binary cut-point was defined at >15% methylation. Sensitivity, specificity and area under ROC curve (AUC of methylation in individual genes or a panel was examined. The median methylation index was significantly higher in cases compared to controls in 8 genes, whereas there was no difference in median methylation for 2 genes. Compared to HPV and age, the combination of DNA methylation level of DAPK1, SLIT2, WIF1 and RARB with HPV and age significantly improved the AUC from 0.79 to 0.99 (95% CI: 0.97-1.00, p-value = 0.003. Pyrosequencing analysis confirmed that several genes are common targets for aberrant methylation in cervical cancer and DNA methylation level of four genes appears to increase specificity to identify cancer compared to HPV detection alone. Alterations in DNA methylation of specific genes in cervical cancers, such as DAPK1, RARB, WIF1, and SLIT2, may also occur early in cervical carcinogenesis and should be evaluated.

  3. DNA methyltransferase 3A gene polymorphism contributes to daily life stress susceptibility

    Directory of Open Access Journals (Sweden)

    Barliana MI

    2017-12-01

    Full Text Available Melisa I Barliana,1,2 Shintya N Amalya,1 Ivan S Pradipta,3 Sofa D Alfian,3 Arif SW Kusuma,1,2 Tiana Milanda,1,4 Rizky Abdulah3,4 1Department of Biological Pharmacy, Biotechnology Pharmacy Laboratory, 2Pharmacy Services Development Research Center, 3Department of Pharmacology and Clinical Pharmacy, Clinical Pharmacy Laboratory, 4Center for Drug Discovery and Product Development, Faculty of Pharmacy, Universitas Padjadjaran, Jatinangor, West Java, Indonesia Abstract: Daily life stress markedly affects the response toward stressful stimuli. DNA methy­lation is one of the factors that regulate this response, and is a normal mechanism of somatic cell growth, but its regulatory gene variations may cause alterations in the stress response. The aim of the present study was to investigate genotypic variants of the DNA methyltransferase 3A (DNMT3A gene in 129 healthy subjects and evaluate its association with daily life stress. Blood samples were collected, and genomic DNA was isolated. DNA was amplified using specific tetra primers for DNMT3A (C/T rs11683424 and visualized following 2% agarose gel electrophoresis. The association of DNMT3A genetic variants with daily life stress was analyzed using the Kessler Psychological Distress Scale (K10. We observed that the distribution of subjects with genotype CC (wild type, CT (heteromutant, and TT (homomutant was 13.95%, 81.4%, and 4.65%, respectively. Genetic variations significantly affected the daily life stress condition (p=0.04 in Indonesian healthy subjects, but most of the subjects with the CT phenotype were classified in a stress condition. Keywords: daily life stressor, DNA methylation, epigenetic, Kessler Psychological Distress Scale (K10, rs11683424, DNMT3A

  4. Expression of protein-coding genes embedded in ribosomal DNA

    DEFF Research Database (Denmark)

    Johansen, Steinar D; Haugen, Peik; Nielsen, Henrik

    2007-01-01

    Ribosomal DNA (rDNA) is a specialised chromosomal location that is dedicated to high-level transcription of ribosomal RNA genes. Interestingly, rDNAs are frequently interrupted by parasitic elements, some of which carry protein genes. These are non-LTR retrotransposons and group II introns that e...... in the nucleolus....

  5. Aberrant DNA methylation in 5'regions of DNA methyltransferase genes in aborted bovine clones

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    High rate of abortion and developmental abnormalities is thought to be closely associated with inefficient epigenetic reprogramming of the transplanted nuclei during bovine cloning.It is known that one of the important mechanisms for epigenetic reprogramming is DNA methylation.DNA methylation is established and maintained by DNA methyltransferases(DNMTs),therefore,it is postulated that the inefficient epigenetic reprogramming of transplanted nuclei may be due to abnormal expression of DNMTs.Since DNA methylation can strongly inhibit gene expression,aberrant DNA methylation of DNMT genes may disturb gene expression.But presently,it is not clear whether the methylation abnormality of DNMT genes is related to developmental failure of somatic cell nuclear transfer embryos.In our study,we analyzed methylation patterns of the 5' regions of four DNMT genes including Dnmt3a,Dnmt3b,Dnmtl and Dnmt2 in four aborted bovine clones.Using bisulfite sequencing method,we found that 3 out of 4 aborted bovine clones(AF1,AF2 and AF3)showed either hypermethylation or hypomethylation in the 5' regions of Dnmt3a and Dnmt3b.indicating that Dnmt3a and Dnmt3b genes are not properly reprogrammed.However,the individual AF4 exhibited similar methylation level and pattern to age-matched in vitro fertilized (IVF)fetuses.Besides,we found that tle 5'regions of Dnmtl and Dnmt2 were nearly completely unmethylated in all normal adults.IVF fetuses,sperm and aborted clones.Together,our results suggest that the aberrant methylation of Dnmt3a and Dnmt3b 5' regions is probably associated with the high abortion of bovine clones.

  6. Molecular cloning and analysis of DNA repair gene from the radioresistant bacterium deinococcus radiodurans

    International Nuclear Information System (INIS)

    Du Zeji; Wang Mingsuo

    1998-12-01

    Deinococcus radiodurans (Dr) possesses a prominent ability to repair DNA injury induced by various DNA-damaging agents including mitomycin C (MC), ultraviolet light (UV) and ionizing radiation. A DNA repair mutant Dr KH3111 is a streptomycin resistant (Sm R ) derivative of KH311 which is generated by treatment with nitrosoguanidine and is sensitive to MC, 8-trimethyl-psoralen, UV and γ-ray irradiation. Gene affected by a mutation in the mutant is identified and its nucleotide sequence is determined. A complete open reading frame (ORF) which encompassed the KH3111 mutation region is found and tentatively designated as orf144b. The deduced amino acid (aa) sequence of orf144b consists of 284 aa and has no significant homology to other known proteins. The exact KH3111 mutation site is one nucleotide altered (G to A) in the sequence of orf144b in the mutant. The KH3111 mutation causes the substitution of Gly for Glu at aa position 149 of Orf144b. Survival measurements of a revertant KH3112 which was produced by transforming with DNA containing a part of the orf144b gene of KD8301 showed that the resistances to MC, UV and γ-ray in the revertant were fully restored at a level equal to the wild type. Thus, the orf144b gene required for the multiple-DNA-damaging agent resistance of Dr was designated with the name of pprA (Pleiotropic gene promoting DNA repair). This new gene can express in E. coli at very high level, and make the host E. coli resistant to MC, UV and γ-ray. The pprA gene does not express in normal Dr, but it can be induced to express by treatment with MC, UV and γ-ray. It was thought that the PprA polypeptide is a cytoplasmic protein because of the absence of characteristics found in the aa sequence of membrane proteins

  7. DnaB gene product-independence of DNA polymerase III-directed repair synthesis in Escherichia coli K-12

    International Nuclear Information System (INIS)

    Billen, D.; Hellermann, G.R.

    1977-01-01

    An investigation has been carried out into the role of dnaB gene product in X-ray-induced repair synthesis carried out by DNA polymerase III in toluene-treated Escherichia coli K-12. A polAl polBlOO dnaB mutant deficient in both DNA polymerase I and II activities was used, and it was shown that the level of X-ray-induced, ATP-dependent, non-conservative DNA synthesis was, unlike semi-conservative DNA synthesis, unaffected by a temperature shift from 30 0 to 42 0 C. The dnaB gene product was not therefore necessary for DNA polymerase III-directed repair synthesis, which occurred in the absence of replicative synthesis. (U.K.)

  8. Factors affecting expression of the recF gene of Escherichia coli K-12.

    Science.gov (United States)

    Sandler, S J; Clark, A J

    1990-01-31

    This report describes four factors which affect expression of the recF gene from strong upstream lambda promoters under temperature-sensitive cIAt2-encoded repressor control. The first factor was the long mRNA leader sequence consisting of the Escherichia coli dnaN gene and 95% of the dnaA gene and lambda bet, N (double amber) and 40% of the exo gene. When most of this DNA was deleted, RecF became detectable in maxicells. The second factor was the vector, pBEU28, a runaway replication plasmid. When we substituted pUC118 for pBEU28, RecF became detectable in whole cells by the Coomassie blue staining technique. The third factor was the efficiency of initiation of translation. We used site-directed mutagenesis to change the mRNA leader, ribosome-binding site and the 3 bp before and after the translational start codon. Monitoring the effect of these mutational changes by translational fusion to lacZ, we discovered that the efficiency of initiation of translation was increased 30-fold. Only an estimated two- or threefold increase in accumulated levels of RecF occurred, however. This led us to discover the fourth factor, namely sequences in the recF gene itself. These sequences reduce expression of the recF-lacZ fusion genes 100-fold. The sequences responsible for this decrease in expression occur in four regions in the N-terminal half of recF. Expression is reduced by some sequences at the transcriptional level and by others at the translational level.

  9. Interactive effects of ultraviolet-B radiation and pesticide exposure on DNA photo-adduct accumulation and expression of DNA damage and repair genes in Xenopus laevis embryos

    International Nuclear Information System (INIS)

    Yu, Shuangying; Tang, Song; Mayer, Gregory D.; Cobb, George P.; Maul, Jonathan D.

    2015-01-01

    Highlights: • Interactive effects of UVB radiation-pesticide co-exposures were examined in frogs. • Responses included induction of DNA photo-adducts and DNA damage and repair genes. • Elevated DNA adduct levels occurred for co-exposures compared to UVB alone. • One mechanism is that pesticides may alter nuclear excision repair gene expression. - Abstract: Pesticide use and ultraviolet-B (UVB) radiation have both been suggested to adversely affect amphibians; however, little is known about their interactive effects. One potential adverse interaction could involve pesticide-induced dysregulation of DNA repair pathways, resulting in greater numbers of DNA photo-adducts from UVB exposure. In the present study, we investigated the interactive effects of UVB radiation and two common pesticides (endosulfan and α-cypermethrin) on induction of DNA photo-adducts and expression of DNA damage and repair related genes in African clawed frog (Xenopus laevis) embryos. We examined 13 genes that are, collectively, involved in stress defense, cell cycle arrest, nucleotide excision repair (NER), base excision repair, mismatch repair, DNA repair regulation, and apoptosis. We exposed X. laevis embryos to 0, 25, and 50 μg/L endosulfan or 0, 2.5, and 5.0 μg/L α-cypermethrin for 96 h, with environmentally relevant exposures of UVB radiation during the last 7 h of the 96 h exposure. We measured the amount of cyclobutane pyrimidine dimers (CPDs) and mRNA abundance of the 13 genes among treatments including control, pesticide only, UVB only, and UVB and pesticide co-exposures. Each of the co-exposure scenarios resulted in elevated CPD levels compared to UVB exposure alone, suggesting an inhibitory effect of endosulfan and α-cypermethrin on CPD repair. This is attributed to results indicating that α-cypermethrin and endosulfan reduced mRNA abundance of XPA and HR23B, respectively, to levels that may affect the initial recognition of DNA lesions. In contrast, both pesticides

  10. Identification of genes involved in DNA replication of the Autographa californica baculovirus

    NARCIS (Netherlands)

    Kool, M.; Ahrens, C. H.; Goldbach, R. W.; Rohrmann, G. F.; Vlak, J. M.

    1994-01-01

    By use of a transient replication assay, nine genes involved in DNA replication were identified in the genome of the Autographa californica baculovirus. Six genes encoding helicase, DNA polymerase, IE-1, LEF-1, LEF-2, and LEF-3 are essential for DNA replication while three genes encoding P35, IE-2,

  11. Identification of DNA repair genes in the human genome

    International Nuclear Information System (INIS)

    Hoeijmakers, J.H.J.; van Duin, M.; Westerveld, A.; Yasui, A.; Bootsma, D.

    1986-01-01

    To identify human DNA repair genes we have transfected human genomic DNA ligated to a dominant marker to excision repair deficient xeroderma pigmentosum (XP) and CHO cells. This resulted in the cloning of a human gene, ERCC-1, that complements the defect of a UV- and mitomycin-C sensitive CHO mutant 43-3B. The ERCC-1 gene has a size of 15 kb, consists of 10 exons and is located in the region 19q13.2-q13.3. Its primary transcript is processed into two mRNAs by alternative splicing of an internal coding exon. One of these transcripts encodes a polypeptide of 297 aminoacids. A putative DNA binding protein domain and nuclear location signal could be identified. Significant AA-homology is found between ERCC-1 and the yeast excision repair gene RAD10. 58 references, 6 figures, 1 table

  12. When gene medication is also genetic modification--regulating DNA treatment.

    Science.gov (United States)

    Foss, Grethe S; Rogne, Sissel

    2007-07-26

    The molecular methods used in DNA vaccination and gene therapy resemble in many ways the methods applied in genetic modification of organisms. In some regulatory regimes, this creates an overlap between 'gene medication' and genetic modification. In Norway, an animal injected with plasmid DNA, in the form of DNA vaccine or gene therapy, currently is viewed as being genetically modified for as long as the added DNA is present in the animal. However, regulating a DNA-vaccinated animal as genetically modified creates both regulatory and practical challenges. It is also counter-intuitive to many biologists. Since immune responses can be elicited also to alter traits, the borderline between vaccination and the modification of properties is no longer distinct. In this paper, we discuss the background for the Norwegian interpretation and ways in which the regulatory challenge can be handled.

  13. The application of DNA microarrays in gene expression analysis.

    Science.gov (United States)

    van Hal, N L; Vorst, O; van Houwelingen, A M; Kok, E J; Peijnenburg, A; Aharoni, A; van Tunen, A J; Keijer, J

    2000-03-31

    DNA microarray technology is a new and powerful technology that will substantially increase the speed of molecular biological research. This paper gives a survey of DNA microarray technology and its use in gene expression studies. The technical aspects and their potential improvements are discussed. These comprise array manufacturing and design, array hybridisation, scanning, and data handling. Furthermore, it is discussed how DNA microarrays can be applied in the working fields of: safety, functionality and health of food and gene discovery and pathway engineering in plants.

  14. DNA context represents transcription regulation of the gene in mouse embryonic stem cells

    Science.gov (United States)

    Ha, Misook; Hong, Soondo

    2016-04-01

    Understanding gene regulatory information in DNA remains a significant challenge in biomedical research. This study presents a computational approach to infer gene regulatory programs from primary DNA sequences. Using DNA around transcription start sites as attributes, our model predicts gene regulation in the gene. We find that H3K27ac around TSS is an informative descriptor of the transcription program in mouse embryonic stem cells. We build a computational model inferring the cell-type-specific H3K27ac signatures in the DNA around TSS. A comparison of embryonic stem cell and liver cell-specific H3K27ac signatures in DNA shows that the H3K27ac signatures in DNA around TSS efficiently distinguish the cell-type specific H3K27ac peaks and the gene regulation. The arrangement of the H3K27ac signatures inferred from the DNA represents the transcription regulation of the gene in mESC. We show that the DNA around transcription start sites is associated with the gene regulatory program by specific interaction with H3K27ac.

  15. Amphibian antimicrobial peptide fallaxin analogue FL9 affects virulence gene expression and DNA replication in Staphylococcus aureus

    DEFF Research Database (Denmark)

    Gottschalk, Sanne; Gottlieb, Caroline Trebbien; Vestergaard, Martin

    2015-01-01

    antimicrobials. In the present study, the analogue FL9, based on the amphibian AMP fallaxin, was studied to elucidate its mode of action and antibacterial activity against the human pathogen Staphylococcus aureus. Our data showed that FL9 may have a dual mode of action against S. aureus. At concentrations around...... and at alkaline pH, while it was compromised by acidic pH and exposure to serum. Furthermore, at subinhibitory concentrations of FL9, S. aureus responded by increasing the expression of two major virulence factor genes, namely the regulatory rnaIII and hla, encoding α-haemolysin. In addition, the S. aureus...... the MIC, FL9 bound DNA, inhibited DNA synthesis and induced the SOS DNA damage response, whereas at concentrations above the MIC the interaction between S. aureus and FL9 led to membrane disruption. The antibacterial activity of the peptide was maintained over a wide range of NaCl and MgCl2 concentrations...

  16. Transfer of Chinese hamster DNA repair gene(s) into repair-deficient human cells (Xeroderma pigmentosum)

    International Nuclear Information System (INIS)

    Karentz, D.; Cleaver, J.E.

    1985-01-01

    Transfer of repair genes by DNA transfection into repair-deficient Xeroderma pigmentosum (XP) cells has thus far been unsuccessful, presenting an obstacle to cloning XP genes. The authors chose an indirect route to transfer repair genes in chromosome fragments. DNA repair-competent (UV resistant) hybrid cell lines were established by PEG-mediated fusions of DNA repair-deficient (UV sensitive) human fibroblasts (XP12RO) with wild type Chinese hamster (CHO) cells (AA8). CHO cells were exposed to 5 Krad X-rays prior to fusions, predisposing hybrid cells to lose CHO chromosome fragments preferentially. Repair-competent hybrids were selected by periodic exposures to UV light. Secondary and tertiary hybrid cell lines were developed by fusion of X-irradiated hybrids to XP12RO. The hybrid cell lines exhibit resistance to UV that is comparable to that of CHO cells and they are proficient at repair replication after UV exposure. Whole cell DNA-DNA hybridizations indicate that the hybrids have greater homology to CHO DNA than is evident between XP12RO and CHO. These observations indicate that CHO DNA sequences which can function in repair of UV-damaged DNA in human cells have been transferred into the genome of the repair-deficient XP12RO cells

  17. A mechanism of gene amplification driven by small DNA fragments.

    Directory of Open Access Journals (Sweden)

    Kuntal Mukherjee

    Full Text Available DNA amplification is a molecular process that increases the copy number of a chromosomal tract and often causes elevated expression of the amplified gene(s. Although gene amplification is frequently observed in cancer and other degenerative disorders, the molecular mechanisms involved in the process of DNA copy number increase remain largely unknown. We hypothesized that small DNA fragments could be the trigger of DNA amplification events. Following our findings that small fragments of DNA in the form of DNA oligonucleotides can be highly recombinogenic, we have developed a system in the yeast Saccharomyces cerevisiae to capture events of chromosomal DNA amplification initiated by small DNA fragments. Here we demonstrate that small DNAs can amplify a chromosomal region, generating either tandem duplications or acentric extrachromosomal DNA circles. Small fragment-driven DNA amplification (SFDA occurs with a frequency that increases with the length of homology between the small DNAs and the target chromosomal regions. SFDA events are triggered even by small single-stranded molecules with as little as 20-nt homology with the genomic target. A double-strand break (DSB external to the chromosomal amplicon region stimulates the amplification event up to a factor of 20 and favors formation of extrachromosomal circles. SFDA is dependent on Rad52 and Rad59, partially dependent on Rad1, Rad10, and Pol32, and independent of Rad51, suggesting a single-strand annealing mechanism. Our results reveal a novel molecular model for gene amplification, in which small DNA fragments drive DNA amplification and define the boundaries of the amplicon region. As DNA fragments are frequently found both inside cells and in the extracellular environment, such as the serum of patients with cancer or other degenerative disorders, we propose that SFDA may be a common mechanism for DNA amplification in cancer cells, as well as a more general cause of DNA copy number variation

  18. PAH-DNA adducts in environmentally exposed population in relation to metabolic and DNA repair gene polymorphisms

    International Nuclear Information System (INIS)

    Binkova, Blanka; Chvatalova, Irena; Lnenickova, Zdena; Milcova, Alena; Tulupova, Elena; Farmer, Peter B.; Sram, Radim J.

    2007-01-01

    Epidemiologic studies indicate that prolonged exposure to particulate air pollution may be associated with increased risk of cardiovascular diseases and cancer in general population. These effects may be attributable to polycyclic aromatic hydrocarbons (PAHs) adsorbed to respirable air particles. It is expected that metabolic and DNA repair gene polymorphisms may modulate individual susceptibility to PAH exposure. This study investigates relationships between exposure to PAHs, polymorphisms of these genes and DNA adducts in group of occupationally exposed policemen (EXP, N = 53, males, aged 22-50 years) working outdoors in the downtown area of Prague and in matched 'unexposed' controls (CON, N = 52). Personal exposure to eight carcinogenic PAHs (c-PAHs) was evaluated by personal samplers during working shift prior to collection of biological samples. Bulky-aromatic DNA adducts were analyzed in lymphocytes by 32 P-postlabeling assay. Polymorphisms of metabolizing (GSTM1, GSTP1, GSTT1, EPHX1, CYP1A1-MspI) and DNA repair (XRCC1, XPD) genes were determined by PCR-based RFLP assays. As potential modifiers and/or cofounders, urinary cotinine levels were analyzed by radioimmunoassay, plasma levels of vitamins A, C, E and folates by HPLC, cholesterol and triglycerides using commercial kits. During the sampling period ambient particulate air pollution was as follows: PM10 32-55 μg/m 3 , PM2.5 27-38 μg/m 3 , c-PAHs 18-22 ng/m 3 ; personal exposure to c-PAHs: 9.7 ng/m 3 versus 5.8 ng/m 3 (P 8 nucleotides versus 0.82 ± 0.23 adducts/10 8 nucleotides, P = 0.065), whereas the level of the B[a]P-'like' adduct was significantly higher in exposed group (0.122 ± 0.036 adducts/10 8 nucleotides versus 0.099 ± 0.035 adducts/10 8 nucleotides, P = 0.003). A significant difference in both the total (P < 0.05) and the B[a]P-'like' DNA adducts (P < 0.01) between smokers and nonsmokers within both groups was observed. A significant positive association between DNA adduct and cotinine

  19. Gene Transfer into the Lung by Nanoparticle Dextran-Spermine/Plasmid DNA Complexes

    Directory of Open Access Journals (Sweden)

    Syahril Abdullah

    2010-01-01

    Full Text Available A novel cationic polymer, dextran-spermine (D-SPM, has been found to mediate gene expression in a wide variety of cell lines and in vivo through systemic delivery. Here, we extended the observations by determining the optimal conditions for gene expression of D-SPM/plasmid DNA (D-SPM/pDNA in cell lines and in the lungs of BALB/c mice via instillation delivery. In vitro studies showed that D-SPM could partially protect pDNA from degradation by nuclease and exhibited optimal gene transfer efficiency at D-SPM to pDNA weight-mixing ratio of 12. In the lungs of mice, the levels of gene expression generated by D-SPM/pDNA are highly dependent on the weight-mixing ratio of D-SPM to pDNA, amount of pDNA in the complex, and the assay time postdelivery. Readministration of the complex at day 1 following the first dosing showed no significant effect on the retention and duration of gene expression. The study also showed that there was a clear trend of increasing size of the complexes as the amount of pDNA was increased, where the sizes of the D-SPM/pDNA complexes were within the nanometer range.

  20. A multiplex branched DNA assay for parallel quantitative gene expression profiling.

    Science.gov (United States)

    Flagella, Michael; Bui, Son; Zheng, Zhi; Nguyen, Cung Tuong; Zhang, Aiguo; Pastor, Larry; Ma, Yunqing; Yang, Wen; Crawford, Kimberly L; McMaster, Gary K; Witney, Frank; Luo, Yuling

    2006-05-01

    We describe a novel method to quantitatively measure messenger RNA (mRNA) expression of multiple genes directly from crude cell lysates and tissue homogenates without the need for RNA purification or target amplification. The multiplex branched DNA (bDNA) assay adapts the bDNA technology to the Luminex fluorescent bead-based platform through the use of cooperative hybridization, which ensures an exceptionally high degree of assay specificity. Using in vitro transcribed RNA as reference standards, we demonstrated that the assay is highly specific, with cross-reactivity less than 0.2%. We also determined that the assay detection sensitivity is 25,000 RNA transcripts with intra- and interplate coefficients of variance of less than 10% and less than 15%, respectively. Using three 10-gene panels designed to measure proinflammatory and apoptosis responses, we demonstrated sensitive and specific multiplex gene expression profiling directly from cell lysates. The gene expression change data demonstrate a high correlation coefficient (R(2)=0.94) compared with measurements obtained using the single-plex bDNA assay. Thus, the multiplex bDNA assay provides a powerful means to quantify the gene expression profile of a defined set of target genes in large sample populations.

  1. Alteration of Gene Expression, DNA Methylation, and Histone Methylation in Free Radical Scavenging Networks in Adult Mouse Hippocampus following Fetal Alcohol Exposure.

    Directory of Open Access Journals (Sweden)

    Eric J Chater-Diehl

    Full Text Available The molecular basis of Fetal Alcohol Spectrum Disorders (FASD is poorly understood; however, epigenetic and gene expression changes have been implicated. We have developed a mouse model of FASD characterized by learning and memory impairment and persistent gene expression changes. Epigenetic marks may maintain expression changes over a mouse's lifetime, an area few have explored. Here, mice were injected with saline or ethanol on postnatal days four and seven. At 70 days of age gene expression microarray, methylated DNA immunoprecipitation microarray, H3K4me3 and H3K27me3 chromatin immunoprecipitation microarray were performed. Following extensive pathway analysis of the affected genes, we identified the top affected gene expression pathway as "Free radical scavenging". We confirmed six of these changes by droplet digital PCR including the caspase Casp3 and Wnt transcription factor Tcf7l2. The top pathway for all methylation-affected genes was "Peroxisome biogenesis"; we confirmed differential DNA methylation in the Acca1 thiolase promoter. Altered methylation and gene expression in oxidative stress pathways in the adult hippocampus suggests a novel interface between epigenetic and oxidative stress mechanisms in FASD.

  2. Alteration of Gene Expression, DNA Methylation, and Histone Methylation in Free Radical Scavenging Networks in Adult Mouse Hippocampus following Fetal Alcohol Exposure.

    Science.gov (United States)

    Chater-Diehl, Eric J; Laufer, Benjamin I; Castellani, Christina A; Alberry, Bonnie L; Singh, Shiva M

    2016-01-01

    The molecular basis of Fetal Alcohol Spectrum Disorders (FASD) is poorly understood; however, epigenetic and gene expression changes have been implicated. We have developed a mouse model of FASD characterized by learning and memory impairment and persistent gene expression changes. Epigenetic marks may maintain expression changes over a mouse's lifetime, an area few have explored. Here, mice were injected with saline or ethanol on postnatal days four and seven. At 70 days of age gene expression microarray, methylated DNA immunoprecipitation microarray, H3K4me3 and H3K27me3 chromatin immunoprecipitation microarray were performed. Following extensive pathway analysis of the affected genes, we identified the top affected gene expression pathway as "Free radical scavenging". We confirmed six of these changes by droplet digital PCR including the caspase Casp3 and Wnt transcription factor Tcf7l2. The top pathway for all methylation-affected genes was "Peroxisome biogenesis"; we confirmed differential DNA methylation in the Acca1 thiolase promoter. Altered methylation and gene expression in oxidative stress pathways in the adult hippocampus suggests a novel interface between epigenetic and oxidative stress mechanisms in FASD.

  3. Gene Therapy for Chronic HBV-Can We Eliminate cccDNA?

    Science.gov (United States)

    Bloom, Kristie; Maepa, Mohube Betty; Ely, Abdullah; Arbuthnot, Patrick

    2018-04-12

    Chronic infection with the hepatitis B virus (HBV) is a global health concern and accounts for approximately 1 million deaths annually. Amongst other limitations of current anti-HBV treatment, failure to eliminate the viral covalently closed circular DNA (cccDNA) and emergence of resistance remain the most worrisome. Viral rebound from latent episomal cccDNA reservoirs occurs following cessation of therapy, patient non-compliance, or the development of escape mutants. Simultaneous viral co-infections, such as by HIV-1, further complicate therapeutic interventions. These challenges have prompted development of novel targeted hepatitis B therapies. Given the ease with which highly specific and potent nucleic acid therapeutics can be rationally designed, gene therapy has generated interest for antiviral application. Gene therapy strategies developed for HBV include gene silencing by harnessing RNA interference, transcriptional inhibition through epigenetic modification of target DNA, genome editing by designer nucleases, and immune modulation with cytokines. DNA-binding domains and effectors based on the zinc finger (ZF), transcription activator-like effector (TALE), and clustered regularly interspaced short palindromic repeat (CRISPR) systems are remarkably well suited to targeting episomal cccDNA. This review discusses recent developments and challenges facing the field of anti-HBV gene therapy, its potential curative significance and the progress towards clinical application.

  4. Isolation and characterization of the human uracil DNA glycosylase gene

    International Nuclear Information System (INIS)

    Vollberg, T.M.; Siegler, K.M.; Cool, B.L.; Sirover, M.A.

    1989-01-01

    A series of anti-human placental uracil DNA glycosylase monoclonal antibodies was used to screen a human placental cDNA library in phage λgt11. Twenty-seven immunopositive plaques were detected and purified. One clone containing a 1.2-kilobase (kb) human cDNA insert was chosen for further study by insertion into pUC8. The resultant recombinant plasmid selected by hybridization a human placental mRNA that encoded a 37-kDa polypeptide. This protein was immunoprecipitated specifically by an anti-human placenta uracil DNA glycosylase monoclonal antibody. RNA blot-hybridization (Northern) analysis using placental poly(A) + RNA or total RNA from four different human fibroblast cell strains revealed a single 1.6-kb transcript. Genomic blots using DNA from each cell strain digested with either EcoRI or PstI revealed a complex pattern of cDNA-hydridizing restriction fragments. The genomic analysis for each enzyme was highly similar in all four human cell strains. In contrast, a single band was observed when genomic analysis was performed with the identical DNA digests with an actin gene probe. During cell proliferation there was an increase in the level of glycosylase mRNA that paralleled the increase in uracil DNA glycosylase enzyme activity. The isolation of the human uracil DNA glycosylase gene permits an examination of the structure, organization, and expression of a human DNA repair gene

  5. Visually Relating Gene Expression and in vivo DNA Binding Data

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Min-Yu; Mackey, Lester; Ker?,; nen, Soile V. E.; Weber, Gunther H.; Jordan, Michael I.; Knowles, David W.; Biggin, Mark D.; Hamann, Bernd

    2011-09-20

    Gene expression and in vivo DNA binding data provide important information for understanding gene regulatory networks: in vivo DNA binding data indicate genomic regions where transcription factors are bound, and expression data show the output resulting from this binding. Thus, there must be functional relationships between these two types of data. While visualization and data analysis tools exist for each data type alone, there is a lack of tools that can easily explore the relationship between them. We propose an approach that uses the average expression driven by multiple of ciscontrol regions to visually relate gene expression and in vivo DNA binding data. We demonstrate the utility of this tool with examples from the network controlling early Drosophila development. The results obtained support the idea that the level of occupancy of a transcription factor on DNA strongly determines the degree to which the factor regulates a target gene, and in some cases also controls whether the regulation is positive or negative.

  6. Sorting through the chaff, nDNA gene trees for phylogenetic inference and hybrid identification of annual sunflowers (Helianthus sect. Helianthus).

    Science.gov (United States)

    Moody, Michael L; Rieseberg, Loren H

    2012-07-01

    The annual sunflowers (Helianthus sect. Helianthus) present a formidable challenge for phylogenetic inference because of ancient hybrid speciation, recent introgression, and suspected issues with deep coalescence. Here we analyze sequence data from 11 nuclear DNA (nDNA) genes for multiple genotypes of species within the section to (1) reconstruct the phylogeny of this group, (2) explore the utility of nDNA gene trees for detecting hybrid speciation and introgression; and (3) test an empirical method of hybrid identification based on the phylogenetic congruence of nDNA gene trees from tightly linked genes. We uncovered considerable topological heterogeneity among gene trees with or without three previously identified hybrid species included in the analyses, as well as a general lack of reciprocal monophyly of species. Nonetheless, partitioned Bayesian analyses provided strong support for the reciprocal monophyly of all species except H. annuus (0.89 PP), the most widespread and abundant annual sunflower. Previous hypotheses of relationships among taxa were generally strongly supported (1.0 PP), except among taxa typically associated with H. annuus, apparently due to the paraphyly of the latter in all gene trees. While the individual nDNA gene trees provided a useful means for detecting recent hybridization, identification of ancient hybridization was problematic for all ancient hybrid species, even when linkage was considered. We discuss biological factors that affect the efficacy of phylogenetic methods for hybrid identification.

  7. AKT phosphorylates H3-threonine 45 to facilitate termination of gene transcription in response to DNA damage

    OpenAIRE

    Lee, Jong-Hyuk; Kang, Byung-Hee; Jang, Hyonchol; Kim, Tae Wan; Choi, Jinmi; Kwak, Sojung; Han, Jungwon; Cho, Eun-Jung; Youn, Hong-Duk

    2015-01-01

    Post-translational modifications of core histones affect various cellular processes, primarily through transcription. However, their relationship with the termination of transcription has remained largely unknown. In this study, we show that DNA damage-activated AKT phosphorylates threonine 45 of core histone H3 (H3-T45). By genome-wide chromatin immunoprecipitation sequencing (ChIP-seq) analysis, H3-T45 phosphorylation was distributed throughout DNA damage-responsive gene loci, particularly ...

  8. Soil DNA extraction procedure influences protist 18S rRNA gene community profiling outcome

    DEFF Research Database (Denmark)

    Santos, Susana S.; Nunes, Ines Marques; Nielsen, Tue K.

    2017-01-01

    Advances in sequencing technologies allow deeper studies of the soil protist diversity and function. However, little attention has been given to the impact of the chosen soil DNA extraction procedure to the overall results. We examined the effect of three acknowledged DNA recovery methods, two...... manual methods (ISOm-11063, GnS-GII) and one commercial kit (MoBio), on soil protist community structures obtained from different sites with different land uses. Results from 18S rRNA gene amplicon sequencing suggest that DNA extraction method significantly affect the replicate homogeneity, the total...... number of operational taxonomic units (OTUs) recovered and the overall taxonomic structure and diversity of soil protist communities. However, DNA extraction effects did not overwhelm the natural variation among samples, as the community data still strongly grouped by geographical location...

  9. A genome-wide study of DNA methylation patterns and gene expression levels in multiple human and chimpanzee tissues.

    Directory of Open Access Journals (Sweden)

    Athma A Pai

    2011-02-01

    Full Text Available The modification of DNA by methylation is an important epigenetic mechanism that affects the spatial and temporal regulation of gene expression. Methylation patterns have been described in many contexts within and across a range of species. However, the extent to which changes in methylation might underlie inter-species differences in gene regulation, in particular between humans and other primates, has not yet been studied. To this end, we studied DNA methylation patterns in livers, hearts, and kidneys from multiple humans and chimpanzees, using tissue samples for which genome-wide gene expression data were also available. Using the multi-species gene expression and methylation data for 7,723 genes, we were able to study the role of promoter DNA methylation in the evolution of gene regulation across tissues and species. We found that inter-tissue methylation patterns are often conserved between humans and chimpanzees. However, we also found a large number of gene expression differences between species that might be explained, at least in part, by corresponding differences in methylation levels. In particular, we estimate that, in the tissues we studied, inter-species differences in promoter methylation might underlie as much as 12%-18% of differences in gene expression levels between humans and chimpanzees.

  10. Candidate genes for cross-resistance against DNA-damaging drugs

    DEFF Research Database (Denmark)

    Wittig, Rainer; Nessling, Michelle; Will, Rainer D

    2002-01-01

    Drug resistance of tumor cells leads to major drawbacks in the treatment of cancer. To identify candidate genes for drug resistance, we compared the expression patterns of the drug-sensitive human malignant melanoma cell line MeWo and three derived sublines with acquired resistance to the DNA...... as several apoptosis-related genes, in particular STK17A and CRYAB. As MPP1 and CRYAB are also among the 14 genes differentially expressed in all three of the drug-resistant sublines, they represent the strongest candidates for resistance against DNA-damaging drugs....

  11. Cytogenetic responses to ionizing radiation exposure of human fibroblasts with knocked-down expressions of various DNA damage signaling genes

    Science.gov (United States)

    Zhang, Ye; Rohde, Larry; Wu, Honglu

    Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have demonstrated that genes with up-regulated expression induced by IR may play important roles in DNA damage sensing, cell cycle checkpoint and chromosomal repair, the relationship between the regulation of gene expression by IR and its impact on cytogenetic responses to ionizing radiation has not been systematically studied. Here, the expression of 25 genes selected based on their transcriptional changes in response to IR or from their known DNA repair roles were individually knocked down by siRNA transfection in human fibroblast cells. Chromosome aberrations (CA) and micronuclei (MN) formation were measured as the cytogenetic endpoints. Our results showed that the yields of MN and/or CA formation were significantly increased by suppressed expression of some of the selected genes in DSB and other DNA repair pathways. Knocked-down expression of other genes showed significant impact on cell cycle progression, possibly because of severe impairment of DNA damage repair. Of these 11 genes that affected the cytogenetic response, 9 were up-regulated in the cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulating the biological consequences after IR. Failure to express these IR-responsive genes, such as by gene mutation, could seriously change the outcome of the post IR scenario and lead to carcinogenesis.

  12. Gene conversion of ribosomal DNA in Nicotiana tabacum is associated with undermethylated, decondensed and probably active gene units.

    Science.gov (United States)

    Lim, K Y; Kovarik, A; Matýăsek, R; Bezdĕk, M; Lichtenstein, C P; Leitch, A R

    2000-06-01

    We examined the structure, intranuclear distribution and activity of ribosomal DNA (rDNA) in Nicotiana sylvestris (2n = 2x = 24) and N. tomentosiformis (2n = 2x = 24) and compared these with patterns in N. tabacum (tobacco, 2n = 4x = 48). We also examined a long-established N. tabacum culture, TBY-2. Nicotiana tabacum is an allotetraploid thought to be derived from ancestors of N. sylvestris (S-genome donor) and N. tomentosiformis (T-genome donor). Nicotiana sylvestris has three rDNA loci, one locus each on chromosomes 10, 11, and 12. In root-tip meristematic interphase cells, the site on chromosome 12 remains condensed and inactive, while the sites on chromosomes 10 and 11 show activity at the proximal end of the locus only. Nicotiana tomentosiformis has one major locus on chromosome 3 showing activity and a minor, inactive locus on chromosome 11. In N. tabacum cv. 095-55, there are four rDNA loci on T3, S10, S11/t and S12 (S11/t carries a small T-genome translocation). The locus on S12 remains condensed and inactive in root-tip meristematic cells while the others show activity, including decondensation at interphase and secondary constrictions at metaphase. Nicotiana tabacum DNA digested with methylcytosine-sensitive enzymes revealed a hybridisation pattern for rDNA that resembled that of N. tomentosiformis and not N. sylvestris. The data indicate that active, undermethylated genes are of the N. tomentosiformis type. Since S-genome chromosomes of N. tabacum show rDNA expression, the result indicates rDNA gene conversion of the active rDNA units on these chromosomes. Gene conversion in N. tabacum is consistent with the results of previous work. However, using primers specific for the S-genome rDNA intergenic sequences (IGS) in the polymerase chain reaction (PCR) show that rDNA gene conversion has not gone to completion in N. tabacum. Furthermore, using methylation-insensitive restriction enzymes we demonstrate that about 8% of the rDNA units remain of the N

  13. Rearrangement of Rag-1 recombinase gene in DNA-repair deficient/immunodeficient ``wasted`` mice

    Energy Technology Data Exchange (ETDEWEB)

    Woloschak, G.E.; Weaver, P.; Churchill, M.; Chang-Liu, C-M. [Argonne National Lab., IL (United States); Libertin, C.R. [Loyola Univ., Maywood, IL (United States)

    1992-11-01

    Mice recessive for the autosomal gene ``wasted`` (wst) display a disease pattern which includes increased sensitivity to the killing effects of ionizing radiation, immunodeficiency, and neurologic dysfunction. The recent cloning and characterization of recombinase genes (Rag-l/Rag-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice. Our results revealed that in thymus tissue, a small Rag-I transcript (1.0 kb) was detected in wst/wst mice that was not evident in thymus from control mice. In wst/{sm_bullet} mice, a two-fold increase in Rag-1 mRNA was evident in thymus tissue. Rag-2 mRNA could only be detected in thymus tissue from wst/{sm_bullet} and not from wst/wst or parental control BCF, mice. Southern blots revealed a rearrangement or deletion within the Rag-1 gene of affected wasted mice that was not evident in known strain-specific parental or littermate controls. These results support the idea that the Rag-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage.

  14. Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.

    Science.gov (United States)

    Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Rivera, Henry; Hernández-Laín, Aurelio; Coca-Robinot, David; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco

    2017-01-01

    Whole-exome sequencing was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase, deficiency of mitochondrial complex III and depletion of mtDNA. With whole-exome sequencing data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in thymidine kinase 2 gene ( TK2; NM_004614.4:c.323 C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes. This patient presents an atypical TK2-related myopathic form of mtDNA depletion syndromes, because despite having a very low content of mtDNA (TK2 gene in mtDNA depletion syndromes and expanded the phenotypic spectrum.

  15. SigG Does Not Control Gene Expression in Response to DNA Damage in Mycobacterium tuberculosis H37Rv ▿ §

    OpenAIRE

    Smollett, Katherine L.; Dawson, Lisa F.; Davis, Elaine O.

    2010-01-01

    Expression of the Mycobacterium tuberculosis sigG sigma factor was induced by a variety of DNA-damaging agents, but inactivation of sigG did not affect induction of gene expression or bacterial survival under these conditions. Therefore, SigG does not control the DNA repair response of M. tuberculosis H37Rv.

  16. Sleep loss reduces the DNA-binding of BMAL1, CLOCK, and NPAS2 to specific clock genes in the mouse cerebral cortex.

    Directory of Open Access Journals (Sweden)

    Valérie Mongrain

    Full Text Available We have previously demonstrated that clock genes contribute to the homeostatic aspect of sleep regulation. Indeed, mutations in some clock genes modify the markers of sleep homeostasis and an increase in homeostatic sleep drive alters clock gene expression in the forebrain. Here, we investigate a possible mechanism by which sleep deprivation (SD could alter clock gene expression by quantifying DNA-binding of the core-clock transcription factors CLOCK, NPAS2, and BMAL1 to the cis-regulatory sequences of target clock genes in mice. Using chromatin immunoprecipitation (ChIP, we first showed that, as reported for the liver, DNA-binding of CLOCK and BMAL1 to target clock genes changes in function of time-of-day in the cerebral cortex. Tissue extracts were collected at ZT0 (light onset, -6, -12, and -18, and DNA enrichment of E-box or E'-box containing sequences was measured by qPCR. CLOCK and BMAL1 binding to Cry1, Dbp, Per1, and Per2 depended on time-of-day, with maximum values reached at around ZT6. We then observed that SD, performed between ZT0 and -6, significantly decreased DNA-binding of CLOCK and BMAL1 to Dbp, consistent with the observed decrease in Dbp mRNA levels after SD. The DNA-binding of NPAS2 and BMAL1 to Per2 was also decreased by SD, although SD is known to increase Per2 expression in the cortex. DNA-binding to Per1 and Cry1 was not affected by SD. Our results show that the sleep-wake history can affect the clock molecular machinery directly at the level of chromatin binding thereby altering the cortical expression of Dbp and Per2 and likely other targets. Although the precise dynamics of the relationship between DNA-binding and mRNA expression, especially for Per2, remains elusive, the results also suggest that part of the reported circadian changes in DNA-binding of core clock components in tissues peripheral to the suprachiasmatic nuclei could, in fact, be sleep-wake driven.

  17. Sleep loss reduces the DNA-binding of BMAL1, CLOCK, and NPAS2 to specific clock genes in the mouse cerebral cortex.

    Science.gov (United States)

    Mongrain, Valérie; La Spada, Francesco; Curie, Thomas; Franken, Paul

    2011-01-01

    We have previously demonstrated that clock genes contribute to the homeostatic aspect of sleep regulation. Indeed, mutations in some clock genes modify the markers of sleep homeostasis and an increase in homeostatic sleep drive alters clock gene expression in the forebrain. Here, we investigate a possible mechanism by which sleep deprivation (SD) could alter clock gene expression by quantifying DNA-binding of the core-clock transcription factors CLOCK, NPAS2, and BMAL1 to the cis-regulatory sequences of target clock genes in mice. Using chromatin immunoprecipitation (ChIP), we first showed that, as reported for the liver, DNA-binding of CLOCK and BMAL1 to target clock genes changes in function of time-of-day in the cerebral cortex. Tissue extracts were collected at ZT0 (light onset), -6, -12, and -18, and DNA enrichment of E-box or E'-box containing sequences was measured by qPCR. CLOCK and BMAL1 binding to Cry1, Dbp, Per1, and Per2 depended on time-of-day, with maximum values reached at around ZT6. We then observed that SD, performed between ZT0 and -6, significantly decreased DNA-binding of CLOCK and BMAL1 to Dbp, consistent with the observed decrease in Dbp mRNA levels after SD. The DNA-binding of NPAS2 and BMAL1 to Per2 was also decreased by SD, although SD is known to increase Per2 expression in the cortex. DNA-binding to Per1 and Cry1 was not affected by SD. Our results show that the sleep-wake history can affect the clock molecular machinery directly at the level of chromatin binding thereby altering the cortical expression of Dbp and Per2 and likely other targets. Although the precise dynamics of the relationship between DNA-binding and mRNA expression, especially for Per2, remains elusive, the results also suggest that part of the reported circadian changes in DNA-binding of core clock components in tissues peripheral to the suprachiasmatic nuclei could, in fact, be sleep-wake driven.

  18. Vitrification affects nuclear maturation and gene expression of immature human oocytes

    Directory of Open Access Journals (Sweden)

    Abbas Shahedi

    2017-02-01

    Full Text Available Background: Vitrification of oocytes is a fast-freezing technique, which may affect the quality of the human oocyte, and consequently affects the embryo development, pregnancy and birth. The aim of the current study was to investigate the consequence of in-vitro vitrification on maturation status of immature human oocytes, additionally, expression levels of stress, and apoptosis related genes. Materials and Methods: The total of 213 human immature oocytes which routinely discarded from assisted reproduction clinics were collected and divided into two groups including: (I fresh germinal vesicle (GV oocytes (n=106 (matured in-vitro  (fIVM , and  (II GV oocytes (n=107 that initially vitrified, then matured in  in-vitro (vIVM. After 36 hours of incubation, the oocytes were evaluated for nuclear maturation and expression level of DNA methyltransferase (DNMT1, stress related genes (Sod1 and Hsp70, and apoptotic related genes (Bax and Bcl-2 by quantitative Real-Time PCR. Results: Oocyte maturation rates were reduced in vIVM compared to fIVM oocytes (P=0.001. The expression of stress (Sod1 and Hsp70, and apoptotic-related genes (Bax and Bcl-2 in vIVM were significantly higher compared to the fIVM group. Additionally, pro-apoptotic gene up-regulated 4.3 times more than anti-apoptotic gene in vIVM oocyte. However, DNMT1 gene expression was reduced in vIVM oocyte (P = 0.047. Conclusions: The low survival rate of vitrified In-vitro matured GV oocytes could definitely be explained by the alterations of their gene expression profile. 

  19. PAH-DNA adducts in environmentally exposed population in relation to metabolic and DNA repair gene polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Binkova, Blanka [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Chvatalova, Irena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Lnenickova, Zdena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Milcova, Alena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Tulupova, Elena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Cancer Biomarkers and Prevention Group, Biocentre, University of Leicester (United Kingdom); Farmer, Peter B. [Cancer Biomarkers and Prevention Group, Biocentre, University of Leicester (United Kingdom); Sram, Radim J. [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic)]. E-mail: sram@biomed.cas.cz

    2007-07-01

    Epidemiologic studies indicate that prolonged exposure to particulate air pollution may be associated with increased risk of cardiovascular diseases and cancer in general population. These effects may be attributable to polycyclic aromatic hydrocarbons (PAHs) adsorbed to respirable air particles. It is expected that metabolic and DNA repair gene polymorphisms may modulate individual susceptibility to PAH exposure. This study investigates relationships between exposure to PAHs, polymorphisms of these genes and DNA adducts in group of occupationally exposed policemen (EXP, N = 53, males, aged 22-50 years) working outdoors in the downtown area of Prague and in matched 'unexposed' controls (CON, N = 52). Personal exposure to eight carcinogenic PAHs (c-PAHs) was evaluated by personal samplers during working shift prior to collection of biological samples. Bulky-aromatic DNA adducts were analyzed in lymphocytes by {sup 32}P-postlabeling assay. Polymorphisms of metabolizing (GSTM1, GSTP1, GSTT1, EPHX1, CYP1A1-MspI) and DNA repair (XRCC1, XPD) genes were determined by PCR-based RFLP assays. As potential modifiers and/or cofounders, urinary cotinine levels were analyzed by radioimmunoassay, plasma levels of vitamins A, C, E and folates by HPLC, cholesterol and triglycerides using commercial kits. During the sampling period ambient particulate air pollution was as follows: PM10 32-55 {mu}g/m{sup 3}, PM2.5 27-38 {mu}g/m{sup 3}, c-PAHs 18-22 ng/m{sup 3}; personal exposure to c-PAHs: 9.7 ng/m{sup 3} versus 5.8 ng/m{sup 3} (P < 0.01) for EXP and CON groups, respectively. The total DNA adduct levels did not significantly differ between EXP and CON groups (0.92 {+-} 0.28 adducts/10{sup 8} nucleotides versus 0.82 {+-} 0.23 adducts/10{sup 8} nucleotides, P = 0.065), whereas the level of the B[a]P-'like' adduct was significantly higher in exposed group (0.122 {+-} 0.036 adducts/10{sup 8} nucleotides versus 0.099 {+-} 0.035 adducts/10{sup 8} nucleotides, P = 0

  20. Sequence and transcription analysis of the human cytomegalovirus DNA polymerase gene

    International Nuclear Information System (INIS)

    Kouzarides, T.; Bankier, A.T.; Satchwell, S.C.; Weston, K.; Tomlinson, P.; Barrell, B.G.

    1987-01-01

    DNA sequence analysis has revealed that the gene coding for the human cytomegalovirus (HCMV) DNA polymerase is present within the long unique region of the virus genome. Identification is based on extensive amino acid homology between the predicted HCMV open reading frame HFLF2 and the DNA polymerase of herpes simplex virus type 1. The authors present here a 5280 base-pair DNA sequence containing the HCMV pol gene, along with the analysis of transcripts encoded within this region. Since HCMV pol also shows homology to the predicted Epstein-Barr virus pol, they were able to analyze the extent of homology between the DNA polymerases of three distantly related herpes viruses, HCMV, Epstein-Barr virus, and herpes simplex virus. The comparison shows that these DNA polymerases exhibit considerable amino acid homology and highlights a number of highly conserved regions; two such regions show homology to sequences within the adenovirus type 2 DNA polymerase. The HCMV pol gene is flanked by open reading frames with homology to those of other herpes viruses; upstream, there is a reading frame homologous to the glycoprotein B gene of herpes simplex virus type I and Epstein-Barr virus, and downstream there is a reading frame homologous to BFLF2 of Epstein-Barr virus

  1. Chromosomal location of the human gene for DNA polymerase β

    International Nuclear Information System (INIS)

    McBride, O.W.; Zmudzka, B.Z.; Wilson, S.H.

    1987-01-01

    Inhibition studies indicate that DNA polymerase β has a synthetic role in DNA repair after exposure of mammalian cells to some types of DNA-damaging agents. The primary structure of the enzyme is highly conserved in vertebrates, and nearly full-length cDNAs for the enzyme were recently cloned from mammalian cDNA libraries. Southern blot analysis of DNA from a panel of human-rodent somatic cell hybrids, using portions of the cDNA as probe, indicates that the gene for human DNA polymerase β is single copy and located on the short arm or proximal long arm of chromosome 8 (8pter-8q22). A restriction fragment length polymorphism (RFLP) was detected in normal individuals by using a probe from the 5' end of the cDNA, and this RFLP probably is due to an insertion or duplication of DNA in 20-25% of the population. This restriction site can be used as one marker for chromosome 8 genetic linkage studies and for family studies of traits potentially involving this DNA repair gene

  2. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Science.gov (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  3. DNMT1-interacting RNAs block gene specific DNA methylation

    Science.gov (United States)

    Di Ruscio, Annalisa; Ebralidze, Alexander K.; Benoukraf, Touati; Amabile, Giovanni; Goff, Loyal A.; Terragni, Joylon; Figueroa, Maria Eugenia; De Figureido Pontes, Lorena Lobo; Alberich-Jorda, Meritxell; Zhang, Pu; Wu, Mengchu; D’Alò, Francesco; Melnick, Ari; Leone, Giuseppe; Ebralidze, Konstantin K.; Pradhan, Sriharsa; Rinn, John L.; Tenen, Daniel G.

    2013-01-01

    Summary DNA methylation was described almost a century ago. However, the rules governing its establishment and maintenance remain elusive. Here, we present data demonstrating that active transcription regulates levels of genomic methylation. We identified a novel RNA arising from the CEBPA gene locus critical in regulating the local DNA methylation profile. This RNA binds to DNMT1 and prevents CEBPA gene locus methylation. Deep sequencing of transcripts associated with DNMT1 combined with genome-scale methylation and expression profiling extended the generality of this finding to numerous gene loci. Collectively, these results delineate the nature of DNMT1-RNA interactions and suggest strategies for gene selective demethylation of therapeutic targets in disease. PMID:24107992

  4. DNA repair synthesis dependent on the uvrA,B gene products

    International Nuclear Information System (INIS)

    Moses, R.E.; Moody, E.E.M.

    1975-01-01

    Ultraviolet irradiation of toluene-treated Escherichia coli causes an inhibition of replicative DNA synthesis. This is followed by the appearance of nonconservative DNA repair synthesis which does not require either the polymerase or 5' → 3' exonucleolytic activities of DNA polymerase I. The repair synthesis may be catalyzed by DNA polymerase III activity but does not require a functional DNA polymerase II. The ultraviolet-induced synthesis requires ATP and is dependent on a functional uvrA and uvrB gene product. However, other uvr gene products are not required for the synthesis. The recB function is also not required

  5. To What Extent Does DNA Methylation Affect Phenotypic Variation in Cattle?

    Directory of Open Access Journals (Sweden)

    Stephanie McKAY

    2015-07-01

    Full Text Available DNA methylation is an environmentally influenced epigenetic modification that regulates gene transcription and has the potential to influence variation in economically important phenotypes in agricultural species. We have utilized a novel approach to evaluate the relationship between genetic and epigenetic variation and downstream phenotypes. To begin with, we have integrated RNA-Seq and methyl binding domain sequencing (MBD-Seq data in order to determine the extent to which DNA methylation affects phenotypic variation in economically important traits of cattle. MBD-Seq is a technique that involves the sample enrichment of methylated genomic regions followed by their next-generation sequencing. This study utilized Illumina next generation sequencing technology to perform both RNA-Seq and MBD-Seq. NextGENe software (SoftGenetics, State College, PA was employed for quality trimming and aligning the sequence reads to the UMD3.1 bovine reference genome, generating counts of matched reads and methylated peak identification. Subsequently, we identified and quantified genome-wide methylated regions and characterized the extent of differential methylation and differential expression between two groups of animals with extreme phenotypes. The program edgeR from the R software package (version 3.0.1 was employed for identifying differentially methylated regions and regions of differential expression. Finally, Partial Correlation with Information Theory (PCIT was performed to identify transcripts and methylation events that exhibit differential hubbing. A differential hub is defined as a gene network hub that is more highly connected in one treatment group than the other. This analysis produced every possible pair-wise interaction that subsequently enabled us to look at network interactions of how methylation affects expression. (co-expression, co-methylation, methylation x expression. Genomic regions of interest derived from this analysis were then aligned

  6. Variation in the DNA methylation pattern of expressed and nonexpressed genes in chicken.

    Science.gov (United States)

    Cooper, D N; Errington, L H; Clayton, R M

    1983-01-01

    Using methyl-sensitive and -insensitive restriction enzymes, Hpa II and Msp I, the methylation status of various chicken genes was examined in different tissues and developmental stages. Tissue-specific differences in methylation were found for the delta-crystallin, beta-tubulin, G3PDH, rDNA, and actin genes but not for the histone genes. Developmental decreases in methylation were noted for the delta-crystallin and actin genes in chicken kidney between embryo and adult. Since most of the sequences examined were housekeeping genes, transcriptional differences are apparently not a necessary accompaniment to changes in DNA methylation at the CpG sites examined. The only exception is sperm DNA where the delta-crystallin, beta-tubulin, and actin genes are highly methylated and almost certainly not transcribed. However the G3PDH genes are no more highly methylated in sperm than in other somatic tissues. Many sequences homologous to the rDNA and histone probes used are unmethylated in all tissues examined including sperm, but a methylated rDNA subfraction is more heavily methylated in sperm than in other tissues. We speculate as to the significance of these differences in sperm DNA methylation in the light of possible requirements for early gene activation and the probable deleterious mutagenic effects of heavy methylation within coding sequences.

  7. Evolutionary Transition of Promoter and Gene Body DNA Methylation across Invertebrate-Vertebrate Boundary.

    Science.gov (United States)

    Keller, Thomas E; Han, Priscilla; Yi, Soojin V

    2016-04-01

    Genomes of invertebrates and vertebrates exhibit highly divergent patterns of DNA methylation. Invertebrate genomes tend to be sparsely methylated, and DNA methylation is mostly targeted to a subset of transcription units (gene bodies). In a drastic contrast, vertebrate genomes are generally globally and heavily methylated, punctuated by the limited local hypo-methylation of putative regulatory regions such as promoters. These genomic differences also translate into functional differences in DNA methylation and gene regulation. Although promoter DNA methylation is an important regulatory component of vertebrate gene expression, its role in invertebrate gene regulation has been little explored. Instead, gene body DNA methylation is associated with expression of invertebrate genes. However, the evolutionary steps leading to the differentiation of invertebrate and vertebrate genomic DNA methylation remain unresolved. Here we analyzed experimentally determined DNA methylation maps of several species across the invertebrate-vertebrate boundary, to elucidate how vertebrate gene methylation has evolved. We show that, in contrast to the prevailing idea, a substantial number of promoters in an invertebrate basal chordate Ciona intestinalis are methylated. Moreover, gene expression data indicate significant, epigenomic context-dependent associations between promoter methylation and expression in C. intestinalis. However, there is no evidence that promoter methylation in invertebrate chordate has been evolutionarily maintained across the invertebrate-vertebrate boundary. Rather, body-methylated invertebrate genes preferentially obtain hypo-methylated promoters among vertebrates. Conversely, promoter methylation is preferentially found in lineage- and tissue-specific vertebrate genes. These results provide important insights into the evolutionary origin of epigenetic regulation of vertebrate gene expression. © The Author(s) 2015. Published by Oxford University Press on behalf

  8. Repair of DNA damage in the human metallothionein gene family

    International Nuclear Information System (INIS)

    Leadon, S.A.; Snowden, M.M.

    1987-01-01

    In order to distinguish enhanced repair of a sequence due to its transcriptional activity from enhanced repair due to chromatin alterations brought about by integration of a sequence into the genome, we have investigated the repair of damage both in endogenous genes and in cell lines that contain an integrated gene with an inducible promoter. The endogenous genes we are studying are the metallothioneins (MTs), a multigene family in man consisting of about 10-12 members. Cultured cells were exposed to 10-J/m 2 uv light and allowed to repair in the presence of bromodeoxyuridine. The DNA was then isolated, digested with Eco RI, and fully hybrid density DNA made by semiconservative synthesis was separated from unreplicated DNA by centrifugation in CsCl density gradients. Unreplicated, parental-density DNA was then reacted with a monoclonal antibody against bromouracil. 1 ref., 1 fig., 1 tab

  9. Rearrangement of RAG-1 recombinase gene in DNA-repair deficient ``wasted`` mice

    Energy Technology Data Exchange (ETDEWEB)

    Woloschak, G.E.; Libertin, C.R.; Weaver, P. [Loyola Univ., Chicago, IL (United States); Churchill, M.; Chang-Liu, C.M. [Argonne National Lab., IL (United States)

    1993-11-01

    Mice recessive for the autosomal gene ``wasted`` wst display a disease pattern which includes increased sensitivity to the killing effects of ionizing radiation, immunodeficiency, and neurologic dysfunction. The recent cloning and characterization of recombinase genes (RAG-l/RAG-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice. Our results revealed expression of RAG-1 mRNA in spinal cord (but not brain) of control mice; no expression of RAG-1 mRNA was detected in spinal cord or brain from wst/wst mice or their normal littermates (wst/{center_dot}mice). In thymus tissue, a small RAG-1 transcript (1.0 kb) was detected in wst/wst mice that was not evident in thymus from control mice. In wst/{center_dot}mice, a two-fold increase in RAG-1 mRNA was evident in thymus tissue. RAG-2 mRNA could only be detected in thymus tissue from wst/{center_dot} and not from wst/wst or parental control BCF{sub 1} mice. Southern blots revealed a rearrangement/deletion within the RAG-1 gene of affected wasted mice, not evident in known strain-specific parental or littermate controls. These results support the idea that the RAG-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage.

  10. MethylMix 2.0: an R package for identifying DNA methylation genes.

    Science.gov (United States)

    Cedoz, Pierre-Louis; Prunello, Marcos; Brennan, Kevin; Gevaert, Olivier

    2018-04-14

    DNA methylation is an important mechanism regulating gene transcription, and its role in carcinogenesis has been extensively studied. Hyper and hypomethylation of genes is a major mechanism of gene expression deregulation in a wide range of diseases. At the same time, high-throughput DNA methylation assays have been developed generating vast amounts of genome wide DNA methylation measurements. We developed MethylMix, an algorithm implemented in R to identify disease specific hyper and hypomethylated genes. Here we present a new version of MethylMix that automates the construction of DNA-methylation and gene expression datasets from The Cancer Genome Atlas (TCGA). More precisely, MethylMix 2.0 incorporates two major updates: the automated downloading of DNA methylation and gene expression datasets from TCGA and the automated preprocessing of such datasets: value imputation, batch correction and CpG sites clustering within each gene. The resulting datasets can subsequently be analyzed with MethylMix to identify transcriptionally predictive methylation states. We show that the Differential Methylation Values created by MethylMix can be used for cancer subtyping. olivier.gevaert@stanford.edu. https://bioconductor.org/packages/release/bioc/manuals/MethylMix/man/MethylMix.pdf. MethylMix 2.0 was implemented as an R package and is available in bioconductor.

  11. Differences in the ovine HSP90AA1 gene expression rates caused by two linked polymorphisms at its promoter affect rams sperm DNA fragmentation under environmental heat stress conditions.

    Science.gov (United States)

    Salces-Ortiz, Judit; Ramón, Manuel; González, Carmen; Pérez-Guzmán, M Dolores; Garde, J Julián; García-Álvarez, Olga; Maroto-Morales, Alejandro; Calvo, Jorge H; Serrano, M Magdalena

    2015-01-01

    Heat shock (HS) is one of the best-studied exogenous cellular stresses. Almost all tissues, cell types, metabolic pathways and biochemical reactions are affected in greater or lesser extent by HS. However, there are some especially thermo sensible cellular types such as the mammalian male germ cells. The present study examined the role of three INDELs in conjunction with the -660G/C polymorphism located at the HSP90AA1 promoter region over the gene expression rate under HS. Specially, the -668insC INDEL, which is very close to the -660G/C transversion, is a good candidate to be implied in the transcriptional regulation of the gene by itself or in a cooperative way with this SNP. Animals carrying the genotype II-668 showed higher transcription rates than those with ID-668 (FC = 3.07) and DD-668 (FC = 3.40) genotypes for samples collected under HS. A linkage between gene expression and sperm DNA fragmentation was also found. When HS conditions were present along or in some stages of the spermatogenesis, alternative genotypes of the -668insC and -660G/C mutations are involved in the effect of HS over sperm DNA fragmentation. Thus, unfavorable genotypes in terms of gene expression induction (ID-668GC-660 and DD-668GG-660) do not produce enough mRNA (stored as messenger ribonucleoprotein particles) and Hsp90α protein to cope with future thermal stress which might occur in posterior stages when transcriptional activity is reduced and cell types and molecular processes are more sensible to heat (spermatocytes in pachytene and spermatids protamination). This would result in the impairment of DNA packaging and the consequent commitment of the events occurring shortly after fertilization and during embryonic development. In the short-term, the assessment of the relationship between sperm DNA fragmentation sensitivity and ram's fertility will be of interest to a better understanding of the mechanisms of response to HS and its consequences on animal production and

  12. Application of DNA Machineries for the Barcode Patterned Detection of Genes or Proteins.

    Science.gov (United States)

    Zhou, Zhixin; Luo, Guofeng; Wulf, Verena; Willner, Itamar

    2018-06-05

    The study introduces an analytical platform for the detection of genes or aptamer-ligand complexes by nucleic acid barcode patterns generated by DNA machineries. The DNA machineries consist of nucleic acid scaffolds that include specific recognition sites for the different genes or aptamer-ligand analytes. The binding of the analytes to the scaffolds initiate, in the presence of the nucleotide mixture, a cyclic polymerization/nicking machinery that yields displaced strands of variable lengths. The electrophoretic separation of the resulting strands provides barcode patterns for the specific detection of the different analytes. Mixtures of DNA machineries that yield, upon sensing of different genes (or aptamer ligands), one-, two-, or three-band barcode patterns are described. The combination of nucleic acid scaffolds acting, in the presence of polymerase/nicking enzyme and nucleotide mixture, as DNA machineries, that generate multiband barcode patterns provide an analytical platform for the detection of an individual gene out of many possible genes. The diversity of genes (or other analytes) that can be analyzed by the DNA machineries and the barcode patterned imaging is given by the Pascal's triangle. As a proof-of-concept, the detection of one of six genes, that is, TP53, Werner syndrome, Tay-Sachs normal gene, BRCA1, Tay-Sachs mutant gene, and cystic fibrosis disorder gene by six two-band barcode patterns is demonstrated. The advantages and limitations of the detection of analytes by polymerase/nicking DNA machineries that yield barcode patterns as imaging readout signals are discussed.

  13. Germline stem cell gene PIWIL2 mediates DNA repair through relaxation of chromatin.

    Directory of Open Access Journals (Sweden)

    De-Tao Yin

    Full Text Available DNA damage response (DDR is an intrinsic barrier of cell to tumorigenesis initiated by genotoxic agents. However, the mechanisms underlying the DDR are not completely understood despite of extensive investigation. Recently, we have reported that ectopic expression of germline stem cell gene PIWIL2 is associated with tumor stem cell development, although the underlying mechanisms are largely unknown. Here we show that PIWIL2 is required for the repair of DNA-damage induced by various types of genotoxic agents. Upon ultraviolet (UV irradiation, silenced PIWIL2 gene in normal human fibroblasts was transiently activated after treatment with UV light. This activation was associated with DNA repair, because Piwil2-deficienct mouse embryonic fibroblasts (mili(-/- MEFs were defective in cyclobutane pyrimidine dimers (CPD repair after UV treatment. As a result, the UV-treated mili(-/- MEFs were more susceptible to apoptosis, as characterized by increased levels of DNA damage-associated apoptotic proteins, such as active caspase-3, cleaved Poly (ADP-ribose polymerase (PARP and Bik. The impaired DNA repair in the mili(-/- MEFs was associated with the reductions of histone H3 acetylation and chromatin relaxation, although the DDR pathway downstream chromatin relaxation appeared not to be directly affected by Piwil2. Moreover, guanine-guanine (Pt-[GG] and double strand break (DSB repair were also defective in the mili(-/- MEFs treated by genotoxic chemicals Cisplatin and ionizing radiation (IR, respectively. The results indicate that Piwil2 can mediate DNA repair through an axis of Piwil2 → histone acetylation → chromatin relaxation upstream DDR pathways. The findings reveal a new role for Piwil2 in DNA repair and suggest that Piwil2 may act as a gatekeeper against DNA damage-mediated tumorigenesis.

  14. GeneBreak: detection of recurrent DNA copy number aberration-associated chromosomal breakpoints within genes [version 2; referees: 2 approved

    Directory of Open Access Journals (Sweden)

    Evert van den Broek

    2017-07-01

    Full Text Available Development of cancer is driven by somatic alterations, including numerical and structural chromosomal aberrations. Currently, several computational methods are available and are widely applied to detect numerical copy number aberrations (CNAs of chromosomal segments in tumor genomes. However, there is lack of computational methods that systematically detect structural chromosomal aberrations by virtue of the genomic location of CNA-associated chromosomal breaks and identify genes that appear non-randomly affected by chromosomal breakpoints across (large series of tumor samples. ‘GeneBreak’ is developed to systematically identify genes recurrently affected by the genomic location of chromosomal CNA-associated breaks by a genome-wide approach, which can be applied to DNA copy number data obtained by array-Comparative Genomic Hybridization (CGH or by (low-pass whole genome sequencing (WGS. First, ‘GeneBreak’ collects the genomic locations of chromosomal CNA-associated breaks that were previously pinpointed by the segmentation algorithm that was applied to obtain CNA profiles. Next, a tailored annotation approach for breakpoint-to-gene mapping is implemented. Finally, dedicated cohort-based statistics is incorporated with correction for covariates that influence the probability to be a breakpoint gene. In addition, multiple testing correction is integrated to reveal recurrent breakpoint events. This easy-to-use algorithm, ‘GeneBreak’, is implemented in R (www.cran.r-project.org and is available from Bioconductor (www.bioconductor.org/packages/release/bioc/html/GeneBreak.html.

  15. Uropathogenic Escherichia coli virulence genes: invaluable approaches for designing DNA microarray probes.

    Science.gov (United States)

    Jahandeh, Nadia; Ranjbar, Reza; Behzadi, Payam; Behzadi, Elham

    2015-01-01

    The pathotypes of uropathogenic Escherichia coli (UPEC) cause different types of urinary tract infections (UTIs). The presence of a wide range of virulence genes in UPEC enables us to design appropriate DNA microarray probes. These probes, which are used in DNA microarray technology, provide us with an accurate and rapid diagnosis and definitive treatment in association with UTIs caused by UPEC pathotypes. The main goal of this article is to introduce the UPEC virulence genes as invaluable approaches for designing DNA microarray probes. Main search engines such as Google Scholar and databases like NCBI were searched to find and study several original pieces of literature, review articles, and DNA gene sequences. In parallel with in silico studies, the experiences of the authors were helpful for selecting appropriate sources and writing this review article. There is a significant variety of virulence genes among UPEC strains. The DNA sequences of virulence genes are fabulous patterns for designing microarray probes. The location of virulence genes and their sequence lengths influence the quality of probes. The use of selected virulence genes for designing microarray probes gives us a wide range of choices from which the best probe candidates can be chosen. DNA microarray technology provides us with an accurate, rapid, cost-effective, sensitive, and specific molecular diagnostic method which is facilitated by designing microarray probes. Via these tools, we are able to have an accurate diagnosis and a definitive treatment regarding UTIs caused by UPEC pathotypes.

  16. The gene expressions of DNA methylation/demethylation enzymes ...

    African Journals Online (AJOL)

    A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases (Dnmts), DNA ...

  17. Maternal high-fat diet associated with altered gene expression, DNA methylation, and obesity risk in mouse offspring

    Science.gov (United States)

    Zaidi, Rabab; Shah, Shyam; Oakley, M. Elsa; Pavlatos, Cassondra; El Idrissi, Samir; Xing, Xiaoyun; Li, Daofeng; Wang, Ting; Cheverud, James M.

    2018-01-01

    We investigated maternal obesity in inbred SM/J mice by assigning females to a high-fat diet or a low-fat diet at weaning, mating them to low-fat-fed males, cross-fostering the offspring to low-fat-fed SM/J nurses at birth, and weaning the offspring onto a high-fat or low-fat diet. A maternal high-fat diet exacerbated obesity in the high-fat-fed daughters, causing them to weigh more, have more fat, and have higher serum levels of leptin as adults, accompanied by dozens of gene expression changes and thousands of DNA methylation changes in their livers and hearts. Maternal diet particularly affected genes involved in RNA processing, immune response, and mitochondria. Between one-quarter and one-third of differentially expressed genes contained a differentially methylated region associated with maternal diet. An offspring high-fat diet reduced overall variation in DNA methylation, increased body weight and organ weights, increased long bone lengths and weights, decreased insulin sensitivity, and changed the expression of 3,908 genes in the liver. Although the offspring were more affected by their own diet, their maternal diet had epigenetic effects lasting through adulthood, and in the daughters these effects were accompanied by phenotypic changes relevant to obesity and diabetes. PMID:29447215

  18. Maternal high-fat diet associated with altered gene expression, DNA methylation, and obesity risk in mouse offspring.

    Science.gov (United States)

    Keleher, Madeline Rose; Zaidi, Rabab; Shah, Shyam; Oakley, M Elsa; Pavlatos, Cassondra; El Idrissi, Samir; Xing, Xiaoyun; Li, Daofeng; Wang, Ting; Cheverud, James M

    2018-01-01

    We investigated maternal obesity in inbred SM/J mice by assigning females to a high-fat diet or a low-fat diet at weaning, mating them to low-fat-fed males, cross-fostering the offspring to low-fat-fed SM/J nurses at birth, and weaning the offspring onto a high-fat or low-fat diet. A maternal high-fat diet exacerbated obesity in the high-fat-fed daughters, causing them to weigh more, have more fat, and have higher serum levels of leptin as adults, accompanied by dozens of gene expression changes and thousands of DNA methylation changes in their livers and hearts. Maternal diet particularly affected genes involved in RNA processing, immune response, and mitochondria. Between one-quarter and one-third of differentially expressed genes contained a differentially methylated region associated with maternal diet. An offspring high-fat diet reduced overall variation in DNA methylation, increased body weight and organ weights, increased long bone lengths and weights, decreased insulin sensitivity, and changed the expression of 3,908 genes in the liver. Although the offspring were more affected by their own diet, their maternal diet had epigenetic effects lasting through adulthood, and in the daughters these effects were accompanied by phenotypic changes relevant to obesity and diabetes.

  19. The gene expressions of DNA methylation/demethylation enzymes ...

    African Journals Online (AJOL)

    user

    2011-01-31

    Jan 31, 2011 ... A decrease in mRNA levels for cytochrome c oxidase (COX) subunits was observed in skeletal muscle of hypothyroid rats. However, the precise expression mechanisms of the related genes in hypothyroid state still remain unclear. This study investigated gene expressions of DNA methyltransferases.

  20. GenePublisher: automated analysis of DNA microarray data

    DEFF Research Database (Denmark)

    Knudsen, Steen; Workman, Christopher; Sicheritz-Ponten, T.

    2003-01-01

    GenePublisher, a system for automatic analysis of data from DNA microarray experiments, has been implemented with a web interface at http://www.cbs.dtu.dk/services/GenePublisher. Raw data are uploaded to the server together with aspecification of the data. The server performs normalization...

  1. Complete gene expression profiling of Saccharopolyspora erythraea using GeneChip DNA microarrays

    Directory of Open Access Journals (Sweden)

    Bordoni Roberta

    2007-11-01

    Full Text Available Abstract Background The Saccharopolyspora erythraea genome sequence, recently published, presents considerable divergence from those of streptomycetes in gene organization and function, confirming the remarkable potential of S. erythraea for producing many other secondary metabolites in addition to erythromycin. In order to investigate, at whole transcriptome level, how S. erythraea genes are modulated, a DNA microarray was specifically designed and constructed on the S. erythraea strain NRRL 2338 genome sequence, and the expression profiles of 6494 ORFs were monitored during growth in complex liquid medium. Results The transcriptional analysis identified a set of 404 genes, whose transcriptional signals vary during growth and characterize three distinct phases: a rapid growth until 32 h (Phase A; a growth slowdown until 52 h (Phase B; and another rapid growth phase from 56 h to 72 h (Phase C before the cells enter the stationary phase. A non-parametric statistical method, that identifies chromosomal regions with transcriptional imbalances, determined regional organization of transcription along the chromosome, highlighting differences between core and non-core regions, and strand specific patterns of expression. Microarray data were used to characterize the temporal behaviour of major functional classes and of all the gene clusters for secondary metabolism. The results confirmed that the ery cluster is up-regulated during Phase A and identified six additional clusters (for terpenes and non-ribosomal peptides that are clearly regulated in later phases. Conclusion The use of a S. erythraea DNA microarray improved specificity and sensitivity of gene expression analysis, allowing a global and at the same time detailed picture of how S. erythraea genes are modulated. This work underlines the importance of using DNA microarrays, coupled with an exhaustive statistical and bioinformatic analysis of the results, to understand the transcriptional

  2. DNA repair and cancer

    International Nuclear Information System (INIS)

    Rathore, Shakuntla; Joshi, Pankaj Kumar; Gaur, Sudha

    2012-01-01

    DNA repair refers to a collection of processes by which a cell identifies and corrects damage to the DNA molecule that encode it's genome. In human cells, both normal metabolic activities and environmental factors such as UV light and radiation can cause DNA damage, resulting in as many one million individual molecular lesions per day. Many of these lesions cause structural damage to the DNA molecule and can alter or eliminate the cell's ability to transcribe the gene that the affected DNA encodes. Other lesions include potentially harmful mutation in cell's genome which affect the survival of it's daughter cells after it undergoes mitosis. As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. Inherited mutation that affect DNA repair genes are strongly associated with high cancer risks in humans. Hereditary non polyposis colorectal cancer (HNPCC) is strongly associated with specific mutation in the DNA mismatch repair pathway. BRCA1, BRCA2 two famous mutation conferring a hugely increased risk of breast cancer on carrier, are both associated with a large number of DNA repair pathway, especially NHEJ and homologous recombination. Cancer therapy procedures such as chemotherapy and radiotherapy work by overwhelming the capacity of the cell to repair DNA damage, resulting in cell death. Cells that are most rapidly dividing most typically cancer cells are preferentially affected. The side effect is that other non-cancerous but rapidly dividing cells such as stem cells in the bone marrow are also affected. Modern cancer treatment attempt to localize the DNA damage to cells and tissue only associated with cancer, either by physical means (concentrating the therapeutic agent in the region of the tumor) or by biochemical means (exploiting a feature unique to cancer cells in the body). (author)

  3. DNA demethylases target promoter transposable elements to positively regulate stress responsive genes in Arabidopsis.

    Science.gov (United States)

    Le, Tuan-Ngoc; Schumann, Ulrike; Smith, Neil A; Tiwari, Sameer; Au, Phil Chi Khang; Zhu, Qian-Hao; Taylor, Jennifer M; Kazan, Kemal; Llewellyn, Danny J; Zhang, Ren; Dennis, Elizabeth S; Wang, Ming-Bo

    2014-09-17

    DNA demethylases regulate DNA methylation levels in eukaryotes. Arabidopsis encodes four DNA demethylases, DEMETER (DME), REPRESSOR OF SILENCING 1 (ROS1), DEMETER-LIKE 2 (DML2), and DML3. While DME is involved in maternal specific gene expression during seed development, the biological function of the remaining DNA demethylases remains unclear. We show that ROS1, DML2, and DML3 play a role in fungal disease resistance in Arabidopsis. A triple DNA demethylase mutant, rdd (ros1 dml2 dml3), shows increased susceptibility to the fungal pathogen Fusarium oxysporum. We identify 348 genes differentially expressed in rdd relative to wild type, and a significant proportion of these genes are downregulated in rdd and have functions in stress response, suggesting that DNA demethylases maintain or positively regulate the expression of stress response genes required for F. oxysporum resistance. The rdd-downregulated stress response genes are enriched for short transposable element sequences in their promoters. Many of these transposable elements and their surrounding sequences show localized DNA methylation changes in rdd, and a general reduction in CHH methylation, suggesting that RNA-directed DNA methylation (RdDM), responsible for CHH methylation, may participate in DNA demethylase-mediated regulation of stress response genes. Many of the rdd-downregulated stress response genes are downregulated in the RdDM mutants nrpd1 and nrpe1, and the RdDM mutants nrpe1 and ago4 show enhanced susceptibility to F. oxysporum infection. Our results suggest that a primary function of DNA demethylases in plants is to regulate the expression of stress response genes by targeting promoter transposable element sequences.

  4. A Genome-Wide mQTL Analysis in Human Adipose Tissue Identifies Genetic Variants Associated with DNA Methylation, Gene Expression and Metabolic Traits

    DEFF Research Database (Denmark)

    Volkov, Petr; Olsson, Anders H; Gillberg, Linn

    2016-01-01

    Little is known about the extent to which interactions between genetics and epigenetics may affect the risk of complex metabolic diseases and/or their intermediary phenotypes. We performed a genome-wide DNA methylation quantitative trait locus (mQTL) analysis in human adipose tissue of 119 men, w...... and epigenetic variation in both cis and trans positions influencing gene expression in adipose tissue and in vivo (dys)metabolic traits associated with the development of obesity and diabetes.......Little is known about the extent to which interactions between genetics and epigenetics may affect the risk of complex metabolic diseases and/or their intermediary phenotypes. We performed a genome-wide DNA methylation quantitative trait locus (mQTL) analysis in human adipose tissue of 119 men......, where 592,794 single nucleotide polymorphisms (SNPs) were related to DNA methylation of 477,891 CpG sites, covering 99% of RefSeq genes. SNPs in significant mQTLs were further related to gene expression in adipose tissue and obesity related traits. We found 101,911 SNP-CpG pairs (mQTLs) in cis and 5...

  5. Decreased expression level of BER genes in Alzheimer's disease patients is not derivative of their DNA methylation status.

    Science.gov (United States)

    Sliwinska, Agnieszka; Sitarek, Przemysław; Toma, Monika; Czarny, Piotr; Synowiec, Ewelina; Krupa, Renata; Wigner, Paulina; Bialek, Katarzyna; Kwiatkowski, Dominik; Korycinska, Anna; Majsterek, Ireneusz; Szemraj, Janusz; Galecki, Piotr; Sliwinski, Tomasz

    2017-10-03

    Neurodegeneration in Alzheimer's disease can be caused by accumulation of oxidative DNA damage resulting from altered expression of genes involved in the base excision repair system (BER). Promoter methylation can affect the profile of BER genes expression. Decreased expression of BER genes was observed in the brains of AD patients. The aim of our study was to compare the expression and methylation profiles of six genes coding for proteins involved in BER, namely: hOGG1, APE1, MUTYH, NEIL1, PARP1 and XRCC1, in the peripheral blood cells of AD patients and healthy volunteers. The study consisted of 100 persons diagnosed with Alzheimer's disease according to DSM-IV criteria, and 110 healthy volunteers. DNA and total RNA were isolated from venous blood cells. Promoter methylation profiles were obtained by High Resolution Melting (HRM) analysis of bisulfide converted DNA samples. Real-time PCR with TaqMan probes was employed for gene expression analysis. APE1, hOGG1, MUTYH, PARP1 and NEIL1 were significantly (pgenes. The methylation status of promoters is not associated with downregulation of BER genes. Our results show that downregulation of BER genes detected in peripheral blood samples could reflect the changes occurring in the brain of patients with AD, and may be a useful biomarker of this disease. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  7. Hepatitis B virus DNA integration and transactivation of cellular genes

    Directory of Open Access Journals (Sweden)

    Vijay Kumar

    2007-02-01

    Full Text Available

    Chronic hepatitis B virus (HBV infection is etiologically related to human hepatocellular carcinoma (HCC. Most HCCs contain integrated HBV DNA in hepatocyte, suggesting that the integration may be involved in carcinogenesis. Available data on the integrants from human hepatocellular carcinomas seem to represent primary integrants as well as the products of secondary rearrangements. By means of structural analyses of the possible primary integrants, it has been observed that the replication intermediates of the viral genome are the preferred substrates for integration. The integrated HBV DNA and the target cellular DNA are invariably associated with deletions, possibly reflecting the substrate for, and the mechanism of, the integration reaction. The host DNA sequences as well as the target site of integration in chromosomes are selected randomly suggesting that HBV DNA integration should bring about random mutagenic effects. Analysis of the samples recovered from hepatocellular carcinomas show that the integrated HBV DNA can mediate secondary rearrangements of chromosomes, such as translocations, inversions, deletions and (possibly amplifications. The integration of HBV DNA into the host genome occurs at early steps of clonal tumor expansion. The integration has been shown in a number of cases to affect a variety of cancer-related genes and to exert insertional mutagenesis. However, in contrast to the woodchuck model, in which specific HBV-DNA integration is detectable in most cases, insertional activation or inactivation of cellular genes appears to be a rare event in man. The discovery of transactivating functions exerted by HBx and truncated HBs(urface proteins supports the notion that these could be relevant to hepatocarcinogenesis as these transactivator sequences have been found in a large number of HCC tumors or hepatoma-derived cell lines. The HBx

  8. Conidiogenesis-related DNA photolyase gene in Beauveria bassiana.

    Science.gov (United States)

    Lee, Se Jin; Lee, Mi Rong; Kim, Sihyeon; Kim, Jong Cheol; Park, So Eun; Shin, Tae Young; Kim, Jae Su

    2018-03-01

    Beauveria bassiana is an entomopathogenic fungi used in environmentally mindful pest management. Its main active ingredient, conidia, is commercially available as a fungal biopesticide. Many studies of conidia production have focused on how to optimize culture conditions for maximum productivity and stability against unfavorable abiotic factors. However, understanding of how conidiogenesis-related genes provide improved conidial production remains unclear. In this study, we focus on identifying conidiogenesis-related genes in B. bassiana ERL1170 using a random mutagenesis technique. Transformation of ERL1170 using restriction enzyme-mediated integration generated one morphologically different transformant, ERL1170-pABeG #163. The transformant was confirmed to represent B. bassiana, and the binary vector was successfully integrated into the genome of ERL1170. Compared to the wild type, transformant #163 showed very slow hyphal growth and within 6 days only produced bassiana exhibits thread-like hyphae and conidiophore structures and circular conidia. To determine the location of the randomly inserted DNA, we conducted thermal asymmetric interlaced (TAIL) PCR and Escherichia coli cloning to clearly sequence the disrupted region. We identified one colony (colony No. 7) with an insertion site identified as DNA photolyase. This was confirmed through a gene knock-out study. It is possible the gene that encodes for DNA photolyase was disrupted during the insertion process and might be involved in fungal conidiogenesis. This work serves as a platform for exploring the function of a variety of B. bassiana genes involved in pest management and their downstream processing. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. The application of DNA microarrays in gene expression analysis

    NARCIS (Netherlands)

    Hal, van N.L.W.; Vorst, O.; Houwelingen, van A.M.M.L.; Kok, E.J.; Peijnenburg, A.A.C.M.; Aharoni, A.; Tunen, van A.J.; Keijer, J.

    2000-01-01

    DNA microarray technology is a new and powerful technology that will substantially increase the speed of molecular biological research. This paper gives a survey of DNA microarray technology and its use in gene expression studies. The technical aspects and their potential improvements are discussed.

  10. DNA-transporting nanoparticles : design and in vitro evaluation of DNA and formulation for non-viral gene delivery

    NARCIS (Netherlands)

    van Gaal, E.V.B.

    2010-01-01

    The aim of gene therapy is to treat, cure or prevent a disease by replacing defective genes, introducing new genes or changing the expression of a person’s genes. Success of gene therapy is dependent on successful delivery of DNA from the site of administration into cell nuclei. Naturally occurring

  11. Optimizing hyaluronidase dose and plasmid DNA delivery greatly improves gene electrotransfer efficiency in rat skeletal muscle

    DEFF Research Database (Denmark)

    Åkerström, Thorbjörn; Vedel, Kenneth; Needham Andersen, Josefine

    2015-01-01

    Transfection of rat skeletal muscle in vivo is a widely used research model. However, gene electrotransfer protocols have been developed for mice and yield variable results in rats. We investigated whether changes in hyaluronidase pre-treatment and plasmid DNA delivery can improve transfection...... with a homogenous distribution. We also show that transfection was stable over five weeks of regular exercise or inactivity. Our findings show that species-specific plasmid DNA delivery and hyaluronidase pre-treatment greatly improves transfection efficiency in rat skeletal muscle....... efficiency in rat skeletal muscle. We found that pre-treating the muscle with a hyaluronidase dose suitable for rats (0.56. U/g b.w.) prior to plasmid DNA injection increased transfection efficiency by >200% whereas timing of the pre-treatment did not affect efficiency. Uniformly distributing plasmid DNA...

  12. Chitosan-Graft-Polyethylenimine/DNA Nanoparticles as Novel Non-Viral Gene Delivery Vectors Targeting Osteoarthritis

    Science.gov (United States)

    Lv, Lulu; Zhao, Huiqing

    2014-01-01

    The development of safe and efficient gene carriers is the key to the clinical success of gene therapy. The present study was designed to develop and evaluate the chitosan-graft-polyethylenimine (CP)/DNA nanoparticles as novel non-viral gene vectors for gene therapy of osteoarthritis. The CP/DNA nanoparticles were produced through a complex coacervation of the cationic polymers with pEGFP after grafting chitosan (CS) with a low molecular weight (Mw) PEI (Mw = 1.8 kDa). Particle size and zeta potential were related to the weight ratio of CP:DNA, where decreases in nanoparticle size and increases in surface charge were observed as CP content increased. The buffering capacity of CP was significantly greater than that of CS. The transfection efficiency of CP/DNA nanoparticles was similar with that of the Lipofectamine™ 2000, and significantly higher than that of CS/DNA and PEI (25 kDa)/DNA nanoparticles. The transfection efficiency of the CP/DNA nanoparticles was dependent on the weight ratio of CP:DNA (w/w). The average cell viability after the treatment with CP/DNA nanoparticles was over 90% in both chondrocytes and synoviocytes, which was much higher than that of PEI (25 kDa)/DNA nanoparticles. The CP copolymers efficiently carried the pDNA inside chondrocytes and synoviocytes, and the pDNA was detected entering into nucleus. These results suggest that CP/DNA nanoparticles with improved transfection efficiency and low cytotoxicity might be a safe and efficient non-viral vector for gene delivery to both chondrocytes and synoviocytes. PMID:24392152

  13. Tagging of blast resistance gene(s) to DNA markers and marker-assisted selection (MAS) in rice improvement

    International Nuclear Information System (INIS)

    Zhuang, J.Y.; Lu, J.; Qian, H.R.; Lin, H.X.; Zheng, K.L.

    1998-01-01

    This paper reports progress made on the tagging of blast resistance gene(s) to DNA markers and on the initiation of marker-assisted selection (MAS) for blast resistance in rice improvement. A pair of near isogenic lines, K8OR and K79S, were developed using a Chinese landrace Hong-jiao-zhan as the resistance donor. Ten putatively positive markers were identified by screening 177 mapped DNA markers. Using the F 2 population of 143 plants and the derived F 3 lines, three Restriction Fragment Length Polymorphism (RFLP) markers (RG81, RG869 and RZ397) on chromosome 12 of rice were identified to be closely linked to the blast resistance gene Pi-12(t). The genetic distance between Pi-12(t) and the closest marker RG869 was 5.1 cM. By employing the bulk segregant analysis (BSA) procedure, six of 199 arbitrary primers were found to produce positive Randomly Amplified Polymorphic DNA (RAPD) bands. Tight linkage between Pi-12(t) and three RAPD bands, each from a different primer, was confirmed after amplification of DNA of all F 2 individuals. Two fragments were cloned and sequenced, and two sequence characterised amplified re-ion (SCAR) markers were established. In two other F 3 populations, Xian-feng I/Tetep and Xian-feng, 1/Hong-jiao-zhan, the blast resistance was found to be controlled by interactions of two or more genes. One resistance gene was located in the vicinity of RG81 in both populations. Work to identify other gene(s) is currently under way. Marker assisted selection for blast resistance was initiated. Crosses were made between elite varieties and blast resistance donors to develop populations for DNA marker-assisted selection of blast resistance. In addition, 48 varieties widely used in current rice breeding programs were provided by rice breeders. DNA marker-based polymorphism among, these varieties and resistance donors were analysed to produce a database for future MAS program. (author)

  14. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    Science.gov (United States)

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  15. Non-electrostatic complexes with DNA: towards novel synthetic gene delivery systems.

    Science.gov (United States)

    Soto, J; Bessodes, M; Pitard, B; Mailhe, P; Scherman, D; Byk, G

    2000-05-01

    We have developed new DNA complexing amphiphile based on Hoechst 33258 interaction with DNA grooves. The synthesis and physicochemical characterisation of lipid/DNA complexes, as compared to that of classical lipopolyamine for gene delivery, are described and discussed.

  16. Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast

    International Nuclear Information System (INIS)

    Lin, Y.H.; Keil, R.L.

    1991-01-01

    HOT1 is a cis-acting recombination-stimulatory sequence isolated from the rDNA repeat unit of yeast. The ability of HOT1 to stimulate mitotic exchange appears to depend on its ability to promote high levels of RNA polymerase I transcription. A qualitative colony color sectoring assay was developed to screen for trans-acting mutations that alter the activity of HOT1. Both hypo-recombination and hyper-recombination mutants were isolated. Genetic analysis of seven HOT1 recombination mutants (hrm) that decrease HOT1 activity shows that they behave as recessive nuclear mutations and belong to five linkage groups. Three of these mutations, hrm1, hrm2, and hrm3, also decrease rDNA exchange but do not alter recombination in the absence of HOT1. Another mutation, hrm4, decreases HOT1-stimulated recombination but does not affect rDNA recombination or exchange in the absence of HOT1. Two new alleles of RAD52 were also isolated using this screen. With regard to HOT1 activity, rad52 is epistatic to all four hrm mutations indicating that the products of the HRM genes and of RAD52 mediate steps in the same recombination pathway. Finding mutations that decrease both the activity of HOT1 and exchange in the rDNA supports the hypothesis that HOT1 plays a role in rDNA recombination

  17. The Human Tyrosyl-DNA Phosphodiesterase 1 (hTdp1) Inhibitor NSC120686 as an Exploratory Tool to Investigate Plant Tdp1 Genes.

    Science.gov (United States)

    Macovei, Anca; Pagano, Andrea; Sabatini, Maria Elisa; Grandi, Sofia; Balestrazzi, Alma

    2018-03-28

    The hTdp1 (human tyrosyl-DNA phosphodiesterase 1) inhibitor NSC120686 has been used, along with topoisomerase inhibitors, as a pharmacophoric model to restrain the Tdp1 activity as part of a synergistic treatment for cancer. While this compound has an end-point application in medical research, in plants, its application has not been considered so far. The originality of our study consists in the use of hTdp1 inhibitor in Medicago truncatula cells, which, unlike human cells, contain two Tdp1 genes. Hence, the purpose of this study was to test the hTdp1 inhibitor NSC120686 as an exploratory tool to investigate the plant Tdp1 genes, since their characterization is still in incipient phases. To do so, M. truncatula calli were exposed to increasing (75, 150, 300 μM) concentrations of NSC120686. The levels of cell mortality and DNA damage, measured via diffusion assay and comet assay, respectively, were significantly increased when the highest doses were used, indicative of a cytotoxic and genotoxic threshold. In addition, the NSC120686-treated calli and untreated MtTdp1α -depleted calli shared a similar response in terms of programmed cell death (PCD)/necrosis and DNA damage. Interestingly, the expression profiles of MtTdp1α and MtTdp1β genes were differently affected by the NSC120686 treatment, as MtTdp1α was upregulated while MtTdp1β was downregulated. The NSC120686 treatment affected not only the MtTdp1 genes but also other genes with roles in alternative DNA repair pathways. Since the expression patterns of these genes were different than what was observed in the MtTdp1α -depleted plants, it could be hypothesized that the NSC120686 treatment exerts a different influence compared to that resulting from the lack of the MtTdp1α gene function.

  18. Rearrangement of Rag-1 recombinase gene in DNA-repair deficient/immunodeficient wasted'' mice

    Energy Technology Data Exchange (ETDEWEB)

    Woloschak, G.E.; Weaver, P.; Churchill, M.; Chang-Liu, C-M. (Argonne National Lab., IL (United States)); Libertin, C.R. (Loyola Univ., Maywood, IL (United States))

    1992-01-01

    Mice recessive for the autosomal gene wasted'' (wst) display a disease pattern which includes increased sensitivity to the killing effects of ionizing radiation, immunodeficiency, and neurologic dysfunction. The recent cloning and characterization of recombinase genes (Rag-l/Rag-2) expressed in lymphoid and possibly central nervous system tissues prompted us to examine expression of these genes in DNA repair-deficient/immunodeficient wasted mice. Our results revealed that in thymus tissue, a small Rag-I transcript (1.0 kb) was detected in wst/wst mice that was not evident in thymus from control mice. In wst/[sm bullet] mice, a two-fold increase in Rag-1 mRNA was evident in thymus tissue. Rag-2 mRNA could only be detected in thymus tissue from wst/[sm bullet] and not from wst/wst or parental control BCF, mice. Southern blots revealed a rearrangement or deletion within the Rag-1 gene of affected wasted mice that was not evident in known strain-specific parental or littermate controls. These results support the idea that the Rag-1 gene may map at or near the locus for the wasted mutation. In addition, they suggest the importance of recombinase function in normal immune and central nervous system development as well as the potential contribution of this gene family to the normal repair of radiation-induced DNA damage.

  19. Selective Gene Delivery for Integrating Exogenous DNA into Plastid and Mitochondrial Genomes Using Peptide-DNA Complexes.

    Science.gov (United States)

    Yoshizumi, Takeshi; Oikawa, Kazusato; Chuah, Jo-Ann; Kodama, Yutaka; Numata, Keiji

    2018-05-14

    Selective gene delivery into organellar genomes (mitochondrial and plastid genomes) has been limited because of a lack of appropriate platform technology, even though these organelles are essential for metabolite and energy production. Techniques for selective organellar modification are needed to functionally improve organelles and produce transplastomic/transmitochondrial plants. However, no method for mitochondrial genome modification has yet been established for multicellular organisms including plants. Likewise, modification of plastid genomes has been limited to a few plant species and algae. In the present study, we developed ionic complexes of fusion peptides containing organellar targeting signal and plasmid DNA for selective delivery of exogenous DNA into the plastid and mitochondrial genomes of intact plants. This is the first report of exogenous DNA being integrated into the mitochondrial genomes of not only plants, but also multicellular organisms in general. This fusion peptide-mediated gene delivery system is a breakthrough platform for both plant organellar biotechnology and gene therapy for mitochondrial diseases in animals.

  20. DNA repair-related genes in sugarcane expressed sequence tags (ESTs

    Directory of Open Access Journals (Sweden)

    R.M.A. Costa

    2001-12-01

    Full Text Available There is much interest in the identification and characterization of genes involved in DNA repair because of their importance in the maintenance of the genome integrity. The high level of conservation of DNA repair genes means that these genetic elements may be used in phylogenetic studies as a source of information on the genetic origin and evolution of species. The mechanisms by which damaged DNA is repaired are well understood in bacteria, yeast and mammals, but much remains to be learned as regards plants. We identified genes involved in DNA repair mechanisms in sugarcane using a similarity search of the Brazilian Sugarcane Expressed Sequence Tag (SUCEST database against known sequences deposited in other public databases (National Center of Biotechnology Information (NCBI database and the Munich Information Center for Protein Sequences (MIPS Arabidopsis thaliana database. This search revealed that most of the various proteins involved in DNA repair in sugarcane are similar to those found in other eukaryotes. However, we also identified certain intriguing features found only in plants, probably due to the independent evolution of this kingdom. The DNA repair mechanisms investigated include photoreactivation, base excision repair, nucleotide excision repair, mismatch repair, non-homologous end joining, homologous recombination repair and DNA lesion tolerance. We report the main differences found in the DNA repair machinery in plant cells as compared to other organisms. These differences point to potentially different strategies plants employ to deal with DNA damage, that deserve further investigation.A identificação e caracterização de genes envolvidos com reparo de DNA são de grande interesse, dada a sua importância na manutenção da integridade genômica. Além disso, a alta conservação dos genes de reparo de DNA faz com que possam ser utilizados como fonte de informação no que diz respeito à origem e evolução das esp

  1. Ionizing and ultraviolet radiation enhances the efficiency of DNA mediated gene transfer in vitro

    International Nuclear Information System (INIS)

    Perez, C.F.

    1984-08-01

    The enhancement effects of ionizing and non-ionizing radiation on the efficiency of DNA mediated gene transfer were studied. Confluent Rat-2 cells were transfected with purified SV40 viral DNA, irradiated with either X-rays or ultraviolet, trypsinized, plated, and assayed for the formation of foci on Rat-2 monolayers. Both ionizing and ultraviolet radiation enhanced the frequency of A-gene transformants/survivor compared to unirradiated transfected cells. These enhancements were non-linear and dose dependent. A recombinant plasmid, pOT-TK5, was constructed that contained the SV40 virus A-gene and the Herpes Simplex virus (HSV) thymidine kinase (TK) gene. Confluent Rat-2 cells transfected with pOT-TK5 DNA and then immediately irradiated with either X-rays or 330 MeV/amu argon particles at the Berkeley Bevalac showed a higher frequency of HAT + colonies/survivor than unirradiated transfected cells. Rat-2 cells transfected with the plasmid, pTK2, containing only the HSV TK-gene were enhanced for TK-transformation by both X-rays and ultraviolet radiation. The results demonstrate that radiation enhancement of the efficiency of DNA mediated gene transfer is not explained by increased nuclear uptake of the transfected DNA. Radiation increases the competence of the transfected cell population for genetic transformation. Three models for this increased competence are presented. The targeted integration model, the inducible recombination model, the partition model, and the utilization of DNA mediated gene transfer for DNA repair studies are discussed. 465 references

  2. Ionizing and ultraviolet radiation enhances the efficiency of DNA mediated gene transfer in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Perez, C.F.

    1984-08-01

    The enhancement effects of ionizing and non-ionizing radiation on the efficiency of DNA mediated gene transfer were studied. Confluent Rat-2 cells were transfected with purified SV40 viral DNA, irradiated with either X-rays or ultraviolet, trypsinized, plated, and assayed for the formation of foci on Rat-2 monolayers. Both ionizing and ultraviolet radiation enhanced the frequency of A-gene transformants/survivor compared to unirradiated transfected cells. These enhancements were non-linear and dose dependent. A recombinant plasmid, pOT-TK5, was constructed that contained the SV40 virus A-gene and the Herpes Simplex virus (HSV) thymidine kinase (TK) gene. Confluent Rat-2 cells transfected with pOT-TK5 DNA and then immediately irradiated with either X-rays or 330 MeV/amu argon particles at the Berkeley Bevalac showed a higher frequency of HAT/sup +/ colonies/survivor than unirradiated transfected cells. Rat-2 cells transfected with the plasmid, pTK2, containing only the HSV TK-gene were enhanced for TK-transformation by both X-rays and ultraviolet radiation. The results demonstrate that radiation enhancement of the efficiency of DNA mediated gene transfer is not explained by increased nuclear uptake of the transfected DNA. Radiation increases the competence of the transfected cell population for genetic transformation. Three models for this increased competence are presented. The targeted integration model, the inducible recombination model, the partition model, and the utilization of DNA mediated gene transfer for DNA repair studies are discussed. 465 references.

  3. DR-Integrator: a new analytic tool for integrating DNA copy number and gene expression data.

    Science.gov (United States)

    Salari, Keyan; Tibshirani, Robert; Pollack, Jonathan R

    2010-02-01

    DNA copy number alterations (CNA) frequently underlie gene expression changes by increasing or decreasing gene dosage. However, only a subset of genes with altered dosage exhibit concordant changes in gene expression. This subset is likely to be enriched for oncogenes and tumor suppressor genes, and can be identified by integrating these two layers of genome-scale data. We introduce DNA/RNA-Integrator (DR-Integrator), a statistical software tool to perform integrative analyses on paired DNA copy number and gene expression data. DR-Integrator identifies genes with significant correlations between DNA copy number and gene expression, and implements a supervised analysis that captures genes with significant alterations in both DNA copy number and gene expression between two sample classes. DR-Integrator is freely available for non-commercial use from the Pollack Lab at http://pollacklab.stanford.edu/ and can be downloaded as a plug-in application to Microsoft Excel and as a package for the R statistical computing environment. The R package is available under the name 'DRI' at http://cran.r-project.org/. An example analysis using DR-Integrator is included as supplemental material. Supplementary data are available at Bioinformatics online.

  4. The evolution of CHROMOMETHYLASES and gene body DNA methylation in plants.

    Science.gov (United States)

    Bewick, Adam J; Niederhuth, Chad E; Ji, Lexiang; Rohr, Nicholas A; Griffin, Patrick T; Leebens-Mack, Jim; Schmitz, Robert J

    2017-05-01

    The evolution of gene body methylation (gbM), its origins, and its functional consequences are poorly understood. By pairing the largest collection of transcriptomes (>1000) and methylomes (77) across Viridiplantae, we provide novel insights into the evolution of gbM and its relationship to CHROMOMETHYLASE (CMT) proteins. CMTs are evolutionary conserved DNA methyltransferases in Viridiplantae. Duplication events gave rise to what are now referred to as CMT1, 2 and 3. Independent losses of CMT1, 2, and 3 in eudicots, CMT2 and ZMET in monocots and monocots/commelinids, variation in copy number, and non-neutral evolution suggests overlapping or fluid functional evolution of this gene family. DNA methylation within genes is widespread and is found in all major taxonomic groups of Viridiplantae investigated. Genes enriched with methylated CGs (mCG) were also identified in species sister to angiosperms. The proportion of genes and DNA methylation patterns associated with gbM are restricted to angiosperms with a functional CMT3 or ortholog. However, mCG-enriched genes in the gymnosperm Pinus taeda shared some similarities with gbM genes in Amborella trichopoda. Additionally, gymnosperms and ferns share a CMT homolog closely related to CMT2 and 3. Hence, the dependency of gbM on a CMT most likely extends to all angiosperms and possibly gymnosperms and ferns. The resulting gene family phylogeny of CMT transcripts from the most diverse sampling of plants to date redefines our understanding of CMT evolution and its evolutionary consequences on DNA methylation. Future, functional tests of homologous and paralogous CMTs will uncover novel roles and consequences to the epigenome.

  5. DNA methyltransferase 1 mutations and mitochondrial pathology: is mtDNA methylated?

    Directory of Open Access Journals (Sweden)

    Alessandra eMaresca

    2015-03-01

    Full Text Available Autosomal dominant cerebellar ataxia, deafness and narcolepsy (ADCA-DN and Hereditary sensory neuropathy with dementia and hearing loss (HSN1E are two rare, overlapping neurodegenerative syndromes that have been recently linked to allelic dominant pathogenic mutations in the DNMT1 gene, coding for DNA (cytosine-5-methyltransferase 1. DNMT1 is the enzyme responsible for maintaining the nuclear genome methylation patterns during the DNA replication and repair, thus regulating gene expression. The mutations responsible for ADCA-DN and HSN1E affect the replication foci targeting sequence domain, which regulates DNMT1 binding to chromatin. DNMT1 dysfunction is anticipated to lead to a global alteration of the DNA methylation pattern with predictable downstream consequences on gene expression. Interestingly, ADCA-DN and HSN1E phenotypes share some clinical features typical of mitochondrial diseases, such as optic atrophy, peripheral neuropathy and deafness, and some biochemical evidence of mitochondrial dysfunction. The recent discovery of a mitochondrial isoform of DNMT1 and its proposed role in methylating mitochondrial DNA (mtDNA suggests that DNMT1 mutations may directly affect mtDNA and mitochondrial physiology. On the basis of this latter finding the link between DNMT1 abnormal activity and mitochondrial dysfunction in ADCA-DN and HSN1E appears intuitive, however mtDNA methylation remains highly debated. In the last years several groups demonstrated the presence of 5-methylcytosine in mtDNA by different approaches, but, on the other end, the opposite evidence that mtDNA is not methylated has also been published. Since over 1500 mitochondrial proteins are encoded by the nuclear genome, the altered methylation of these genes may well have a critical role in leading to the mitochondrial impairment observed in ADCA-DN and HSN1E. Thus, many open questions still remain unanswered, such as why mtDNA should be methylated, and how this process is

  6. Cumulative Impact of Polychlorinated Biphenyl and Large Chromosomal Duplications on DNA Methylation, Chromatin, and Expression of Autism Candidate Genes.

    Science.gov (United States)

    Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M

    2016-12-13

    Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. Genomic survey and expression analysis of DNA repair genes in the genus Leptospira.

    Science.gov (United States)

    Martins-Pinheiro, Marinalva; Schons-Fonseca, Luciane; da Silva, Josefa B; Domingos, Renan H; Momo, Leonardo Hiroyuki Santos; Simões, Ana Carolina Quirino; Ho, Paulo Lee; da Costa, Renata M A

    2016-04-01

    Leptospirosis is an emerging zoonosis with important economic and public health consequences and is caused by pathogenic leptospires. The genus Leptospira belongs to the order Spirochaetales and comprises saprophytic (L. biflexa), pathogenic (L. interrogans) and host-dependent (L. borgpetersenii) members. Here, we present an in silico search for DNA repair pathways in Leptospira spp. The relevance of such DNA repair pathways was assessed through the identification of mRNA levels of some genes during infection in animal model and after exposition to spleen cells. The search was performed by comparison of available Leptospira spp. genomes in public databases with known DNA repair-related genes. Leptospires exhibit some distinct and unexpected characteristics, for instance the existence of a redundant mechanism for repairing a chemically diverse spectrum of alkylated nucleobases, a new mutS-like gene and a new shorter version of uvrD. Leptospira spp. shares some characteristics from Gram-positive, as the presence of PcrA, two RecQ paralogs and two SSB proteins; the latter is considered a feature shared by naturally competent bacteria. We did not find a significant reduction in the number of DNA repair-related genes in both pathogenic and host-dependent species. Pathogenic leptospires were enriched for genes dedicated to base excision repair and non-homologous end joining. Their evolutionary history reveals a remarkable importance of lateral gene transfer events for the evolution of the genus. Up-regulation of specific DNA repair genes, including components of SOS regulon, during infection in animal model validates the critical role of DNA repair mechanisms for the complex interplay between host/pathogen.

  8. Caffeine inhibits gene conversion by displacing Rad51 from ssDNA

    Science.gov (United States)

    Tsabar, Michael; Mason, Jennifer M.; Chan, Yuen-Ling; Bishop, Douglas K.; Haber, James E.

    2015-01-01

    Efficient repair of chromosomal double-strand breaks (DSBs) by homologous recombination relies on the formation of a Rad51 recombinase filament that forms on single-stranded DNA (ssDNA) created at DSB ends. This filament facilitates the search for a homologous donor sequence and promotes strand invasion. Recently caffeine treatment has been shown to prevent gene targeting in mammalian cells by increasing non-productive Rad51 interactions between the DSB and random regions of the genome. Here we show that caffeine treatment prevents gene conversion in yeast, independently of its inhibition of the Mec1ATR/Tel1ATM-dependent DNA damage response or caffeine's inhibition of 5′ to 3′ resection of DSB ends. Caffeine treatment results in a dosage-dependent eviction of Rad51 from ssDNA. Gene conversion is impaired even at low concentrations of caffeine, where there is no discernible dismantling of the Rad51 filament. Loss of the Rad51 filament integrity is independent of Srs2's Rad51 filament dismantling activity or Rad51's ATPase activity and does not depend on non-specific Rad51 binding to undamaged double-stranded DNA. Caffeine treatment had similar effects on irradiated HeLa cells, promoting loss of previously assembled Rad51 foci. We conclude that caffeine treatment can disrupt gene conversion by disrupting Rad51 filaments. PMID:26019181

  9. Asynchronous DNA replication within the human β-globin gene locus

    International Nuclear Information System (INIS)

    Epner, E.; Forrester, W.C.; Groudine, M.

    1988-01-01

    The timing of DNA replication of the human β-globin gene locus has been studied by blot hybridization of newly synthesized BrdUrd-substituted DNA from cells in different stages of the S phase. Using probes that span >120 kilobases across the human β-globin gene locus, the authors show that the majority of this domain replicates in early S phase in the human erythroleukemia cell line K562 and in middle-to-late S phase in the lymphoid cell line Manca. However, in K562 cells three small regions display a strikingly different replication pattern than adjacent sequences. These islands, located in the inter-γ-globin gene region and approximately 20 kilobases 5' to the ε-globin gene and 20 kilobases 3' to the β-globin gene, replicate later and throughout S phase. A similar area is also present in the α-globin gene region in K562 cells. They suggest that these regions may represent sites of termination of replication forks

  10. Observation of intermittency in gene expression on cDNA microarrays

    CERN Document Server

    Peterson, L E

    2002-01-01

    We used scaled factorial moments to search for intermittency in the log expression ratios (LERs) for thousands of genes spotted on cDNA microarrays (gene chips). Results indicate varying levels of intermittency in gene expression. The observation of intermittency in the data analyzed provides a complimentary handle on moderately expressed genes, generally not tackled by conventional techniques.

  11. A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs

    Directory of Open Access Journals (Sweden)

    Gong Shiaochin

    2009-03-01

    Full Text Available Abstract Background Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. Results We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1 subclone genes of interest into BAC linking vectors, (2 insert desired reporter genes into respective genes and (3 link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. Conclusion The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

  12. A BAC-bacterial recombination method to generate physically linked multiple gene reporter DNA constructs.

    Science.gov (United States)

    Maye, Peter; Stover, Mary Louise; Liu, Yaling; Rowe, David W; Gong, Shiaochin; Lichtler, Alexander C

    2009-03-13

    Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP) reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1) subclone genes of interest into BAC linking vectors, (2) insert desired reporter genes into respective genes and (3) link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.

  13. An SGS3-like protein functions in RNA-directed DNA methylation and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Zheng, Zhimin

    2010-01-06

    RNA-directed DNA methylation (RdDM) is an important epigenetic mechanism for silencing transgenes and endogenous repetitive sequences such as transposons. The RD29A promoter-driven LUCIFERASE transgene and its corresponding endogenous RD29A gene are hypermethylated and silenced in the Arabidopsis DNA demethylase mutant ros1. By screening for second-site suppressors of ros1, we identified the RDM12 locus. The rdm12 mutation releases the silencing of the RD29A-LUC transgene and the endogenous RD29A gene by reducing the promoter DNA methylation. The rdm12 mutation also reduces DNA methylation at endogenous RdDM target loci, including transposons and other repetitive sequences. In addition, the rdm12 mutation affects the levels of small interfering RNAs (siRNAs) from some of the RdDM target loci. RDM12 encodes a protein with XS and coiled-coil domains, and is similar to SGS3, which is a partner protein of RDR6 and can bind to double-stranded RNAs with a 5′ overhang, and is required for several post-transcriptional gene silencing pathways. Our results show that RDM12 is a component of the RdDM pathway, and suggest that RdDM may involve double-stranded RNAs with a 5′ overhang and the partnering between RDM12 and RDR2. © 2010 Blackwell Publishing Ltd.

  14. Intrinsically bent DNA in replication origins and gene promoters.

    Science.gov (United States)

    Gimenes, F; Takeda, K I; Fiorini, A; Gouveia, F S; Fernandez, M A

    2008-06-24

    Intrinsically bent DNA is an alternative conformation of the DNA molecule caused by the presence of dA/dT tracts, 2 to 6 bp long, in a helical turn phase DNA or with multiple intervals of 10 to 11 bp. Other than flexibility, intrinsic bending sites induce DNA curvature in particular chromosome regions such as replication origins and promoters. Intrinsically bent DNA sites are important in initiating DNA replication, and are sometimes found near to regions associated with the nuclear matrix. Many methods have been developed to localize bent sites, for example, circular permutation, computational analysis, and atomic force microscopy. This review discusses intrinsically bent DNA sites associated with replication origins and gene promoter regions in prokaryote and eukaryote cells. We also describe methods for identifying bent DNA sites for circular permutation and computational analysis.

  15. Cloning, DNA sequence, and expression of the Rhodobacter sphaeroides cytochrome c/sub 2/ gene

    Energy Technology Data Exchange (ETDEWEB)

    Donohue, T.J.; McEwan, A.G.; Kaplan, S.

    1986-11-01

    The Rhodobacter sphaeroides cytochrome c/sub 2/ functions as a mobile electron carrier in both aerobic and photosynthetic electron transport chains. Synthetic deoxyoligonucleotide probes, based on the known amino acid sequence of this protein (M/sub r/ 14,000), were used to identify and clone the cytochrome c/sub 2/ structural gene (cycA). DNA sequence analysis of the cycA gene indicated the presence of a typical procaryotic 21-residue signal sequence, suggesting that this periplasmic protein is synthesized in vivo as a precursor. Synthesis of an immunoreactive cytochrome c/sub 2/ precursor protein (M/sub r/ 15,500) was observed in vitro when plasmids containing the cycA gene were used as templates in an R. sphaeroides coupled transcription-translation system. Approximately 500 base pairs of DNA upstream of the cycA gene was sufficient to allow expression of this gene product in vitro. Northern blot analysis with an internal cycA-specific probe identified at least two possibly monocistronic transcripts present in both different cellular levels and relative stoichiometries in steady-state cells grown under different physiological conditions. The ratio of the small (740-mucleotide) and large (920-nucleotide) cycA-specific mRNA species was dependent on cultural conditions but was not affected by light intensity under photosynthetic conditions. These results suggest that the increase in the cellular level of the cytochrome c/sub 2/ protein found in photosynthetic cells was due, in part, to increased transcription of the single-copy cyc operon.

  16. Use of electroporation for high-molecular-weight DNA-mediated gene transfer.

    Science.gov (United States)

    Jastreboff, M M; Ito, E; Bertino, J R; Narayanan, R

    1987-08-01

    Electroporation was used to introduce high-molecular-weight DNA into murine hematopoietic cells and NIH3T3 cells. CCRF-CEM cells were stably transfected with SV2NEO plasmid and the genomic DNA from G-418-resistant clones (greater than 65 kb) was introduced into mouse bone marrow and NIH3T3 cells by electroporation. NEO sequences and expression were detected in the hematopoietic tissues of lethally irradiated mice, with 24% of individual spleen colonies expressing NEO. The frequency of genomic DNA transfer into NIH3T3 cells was 0.25 X 10(-3). Electroporation thus offers a powerful mode of gene transfer not only of cloned genes but also of high-molecular-weight DNA into cells.

  17. DNA Methylation of Regulatory Regions of Imprinted Genes at Birth and Its Relation to Infant Temperament

    Directory of Open Access Journals (Sweden)

    Bernard F. Fuemmeler

    2016-01-01

    Full Text Available BACKGROUND DNA methylation of the differentially methylated regions (DMRs of imprinted genes is relevant to neurodevelopment. METHODS DNA methylation status of the DMRs of nine imprinted genes in umbilical cord blood leukocytes was analyzed in relation to infant behaviors and temperament (n = 158. RESULTS MEG3 DMR levels were positively associated with internalizing ( β = 0.15, P = 0.044 and surgency ( β = 0.19, P = 0.018 behaviors, after adjusting for birth weight, gender, gestational age at birth, maternal age at delivery, race/ethnicity, education level, smoking status, parity, and a history of anxiety or depression. Higher methylation levels at the intergenic MEG3-IG methylation regions were associated with surgency ( β = 0.28, P = 0.0003 and PEG3 was positively related to externalizing ( β = 0.20, P = 0.01 and negative affectivity ( β = 0.18, P = 0.02. CONCLUSION While the small sample size limits inference, these pilot data support gene-specific associations between epigenetic differences in regulatory regions of imprinted domains at birth and later infant temperament.

  18. Essential and non-essential DNA replication genes in the model halophilic Archaeon, Halobacterium sp. NRC-1

    Directory of Open Access Journals (Sweden)

    DasSarma Shiladitya

    2007-06-01

    Full Text Available Abstract Background Information transfer systems in Archaea, including many components of the DNA replication machinery, are similar to those found in eukaryotes. Functional assignments of archaeal DNA replication genes have been primarily based upon sequence homology and biochemical studies of replisome components, but few genetic studies have been conducted thus far. We have developed a tractable genetic system for knockout analysis of genes in the model halophilic archaeon, Halobacterium sp. NRC-1, and used it to determine which DNA replication genes are essential. Results Using a directed in-frame gene knockout method in Halobacterium sp. NRC-1, we examined nineteen genes predicted to be involved in DNA replication. Preliminary bioinformatic analysis of the large haloarchaeal Orc/Cdc6 family, related to eukaryotic Orc1 and Cdc6, showed five distinct clades of Orc/Cdc6 proteins conserved in all sequenced haloarchaea. Of ten orc/cdc6 genes in Halobacterium sp. NRC-1, only two were found to be essential, orc10, on the large chromosome, and orc2, on the minichromosome, pNRC200. Of the three replicative-type DNA polymerase genes, two were essential: the chromosomally encoded B family, polB1, and the chromosomally encoded euryarchaeal-specific D family, polD1/D2 (formerly called polA1/polA2 in the Halobacterium sp. NRC-1 genome sequence. The pNRC200-encoded B family polymerase, polB2, was non-essential. Accessory genes for DNA replication initiation and elongation factors, including the putative replicative helicase, mcm, the eukaryotic-type DNA primase, pri1/pri2, the DNA polymerase sliding clamp, pcn, and the flap endonuclease, rad2, were all essential. Targeted genes were classified as non-essential if knockouts were obtained and essential based on statistical analysis and/or by demonstrating the inability to isolate chromosomal knockouts except in the presence of a complementing plasmid copy of the gene. Conclusion The results showed that ten

  19. Histone H3.3 promotes IgV gene diversification by enhancing formation of AID-accessible single-stranded DNA.

    Science.gov (United States)

    Romanello, Marina; Schiavone, Davide; Frey, Alexander; Sale, Julian E

    2016-07-01

    Immunoglobulin diversification is driven by activation-induced deaminase (AID), which converts cytidine to uracil within the Ig variable (IgV) regions. Central to the recruitment of AID to the IgV genes are factors that regulate the generation of single-stranded DNA (ssDNA), the enzymatic substrate of AID Here, we report that chicken DT40 cells lacking variant histone H3.3 exhibit reduced IgV sequence diversification. We show that this results from impairment of the ability of AID to access the IgV genes due to reduced formation of ssDNA during IgV transcription. Loss of H3.3 also diminishes IgV R-loop formation. However, reducing IgV R-loops by RNase HI overexpression in wild-type cells does not affect IgV diversification, showing that these structures are not necessary intermediates for AID access. Importantly, the reduction in the formation of AID-accessible ssDNA in cells lacking H3.3 is independent of any effect on the level of transcription or the kinetics of RNAPII elongation, suggesting the presence of H3.3 in the nucleosomes of the IgV genes increases the chances of the IgV DNA becoming single-stranded, thereby creating an effective AID substrate. © 2016 MRC Laboratory of Molecular Biology. Published under the terms of the CC BY 4.0 license.

  20. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  1. Hepatitis B virus DNA polymerase gene polymorphism based ...

    African Journals Online (AJOL)

    Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

  2. Satellite DNA-based artificial chromosomes for use in gene therapy.

    Science.gov (United States)

    Hadlaczky, G

    2001-04-01

    Satellite DNA-based artificial chromosomes (SATACs) can be made by induced de novo chromosome formation in cells of different mammalian species. These artificially generated accessory chromosomes are composed of predictable DNA sequences and they contain defined genetic information. Prototype human SATACs have been successfully constructed in different cell types from 'neutral' endogenous DNA sequences from the short arm of the human chromosome 15. SATACs have already passed a number of hurdles crucial to their further development as gene therapy vectors, including: large-scale purification; transfer of purified artificial chromosomes into different cells and embryos; generation of transgenic animals and germline transmission with purified SATACs; and the tissue-specific expression of a therapeutic gene from an artificial chromosome in the milk of transgenic animals.

  3. Differentially expressed genes in Populus simonii x P. nigra in respnse to NaCl stress using cDNA-AFLP

    Science.gov (United States)

    Salinity is an important environmental factor limiting growth and productivity of plants, and affects almost every aspect of the plant physiology and biochemistry. The objective of this study was to apply cDNA-AFLP and to identify differentially expressed genes in response to NaCl stress vs. no-stre...

  4. A subset of herpes simplex virus replication genes induces DNA amplification within the host cell genome

    Energy Technology Data Exchange (ETDEWEB)

    Heilbronn, R.; zur Hausen, H. (Deutsches Krebsforschungszentrum, Heidelberg (West Germany))

    1989-09-01

    Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of sic HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensable for SV40 DNA amplification. The results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo.

  5. Horizontal gene transfer and nucleotide compositional anomaly in large DNA viruses

    Directory of Open Access Journals (Sweden)

    Ogata Hiroyuki

    2007-12-01

    Full Text Available Abstract Background DNA viruses have a wide range of genome sizes (5 kb up to 1.2 Mb, compared to 0.16 Mb to 1.5 Mb for obligate parasitic bacteria that do not correlate with their virulence or the taxonomic distribution of their hosts. The reasons for such large variation are unclear. According to the traditional view of viruses as gifted "gene pickpockets", large viral genome sizes could originate from numerous gene acquisitions from their hosts. We investigated this hypothesis by studying 67 large DNA viruses with genome sizes larger than 150 kb, including the recently characterized giant mimivirus. Given that horizontally transferred DNA often have anomalous nucleotide compositions differing from the rest of the genome, we conducted a detailed analysis of the inter- and intra-genome compositional properties of these viruses. We then interpreted their compositional heterogeneity in terms of possible causes, including strand asymmetry, gene function/expression, and horizontal transfer. Results We first show that the global nucleotide composition and nucleotide word usage of viral genomes are species-specific and distinct from those of their hosts. Next, we identified compositionally anomalous (cA genes in viral genomes, using a method based on Bayesian inference. The proportion of cA genes is highly variable across viruses and does not exhibit a significant correlation with genome size. The vast majority of the cA genes were of unknown function, lacking homologs in the databases. For genes with known homologs, we found a substantial enrichment of cA genes in specific functional classes for some of the viruses. No significant association was found between cA genes and compositional strand asymmetry. A possible exogenous origin for a small fraction of the cA genes could be confirmed by phylogenetic reconstruction. Conclusion At odds with the traditional dogma, our results argue against frequent genetic transfers to large DNA viruses from their

  6. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Yeast DNA-repair gene RAD14 encodes a zinc metalloprotein with affinity for ultraviolet-damaged DNA

    International Nuclear Information System (INIS)

    Guzder, S.N.; Sung, P.; Prakash, S.; Prakash, L.

    1993-01-01

    Xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers due to a defect in excision repair of UV light-damaged DNA. Of the seven XP complementation groups, A--G, group A represents a severe and frequent form of the disease. The Saccharomyces cerevisiae RAD14 gene is a homolog of the XP-A correcting (XPAC) gene. Like XP-A cells, rad14-null mutants are defective in the incision step of excision repair of UV-damaged DNA. The authors have purified RAD14 protein to homogeneity from extract of a yeast strain genetically tailored to overexpress RAD14. As determined by atomic emission spectroscopy, RAD14 contains one zinc atom. They also show in vitro that RAD14 binds zinc but does not bind other divalent metal ions. In DNA mobility-shift assays, RAD14 binds specifically to UV-damaged DNA. Removal of cyclobutane pyrimidine dimers from damaged DNA by enzymatic photoreactivation has no effect on binding, strongly suggesting that RAD14 recognizes pyrimidine(6-4)pyrimidone photoproduct sites. These findings indicate that RAD14 functions in damage recognition during excision repair. 37 refs., 4 figs

  8. Modeling Hybridization Kinetics of Gene Probes in a DNA Biochip Using FEMLAB

    Science.gov (United States)

    Munir, Ahsan; Waseem, Hassan; Williams, Maggie R.; Stedtfeld, Robert D.; Gulari, Erdogan; Tiedje, James M.; Hashsham, Syed A.

    2017-01-01

    Microfluidic DNA biochips capable of detecting specific DNA sequences are useful in medical diagnostics, drug discovery, food safety monitoring and agriculture. They are used as miniaturized platforms for analysis of nucleic acids-based biomarkers. Binding kinetics between immobilized single stranded DNA on the surface and its complementary strand present in the sample are of interest. To achieve optimal sensitivity with minimum sample size and rapid hybridization, ability to predict the kinetics of hybridization based on the thermodynamic characteristics of the probe is crucial. In this study, a computer aided numerical model for the design and optimization of a flow-through biochip was developed using a finite element technique packaged software tool (FEMLAB; package included in COMSOL Multiphysics) to simulate the transport of DNA through a microfluidic chamber to the reaction surface. The model accounts for fluid flow, convection and diffusion in the channel and on the reaction surface. Concentration, association rate constant, dissociation rate constant, recirculation flow rate, and temperature were key parameters affecting the rate of hybridization. The model predicted the kinetic profile and signal intensities of eighteen 20-mer probes targeting vancomycin resistance genes (VRGs). Predicted signal intensities and hybridization kinetics strongly correlated with experimental data in the biochip (R2 = 0.8131). PMID:28555058

  9. Modeling Hybridization Kinetics of Gene Probes in a DNA Biochip Using FEMLAB

    Directory of Open Access Journals (Sweden)

    Ahsan Munir

    2017-05-01

    Full Text Available Microfluidic DNA biochips capable of detecting specific DNA sequences are useful in medical diagnostics, drug discovery, food safety monitoring and agriculture. They are used as miniaturized platforms for analysis of nucleic acids-based biomarkers. Binding kinetics between immobilized single stranded DNA on the surface and its complementary strand present in the sample are of interest. To achieve optimal sensitivity with minimum sample size and rapid hybridization, ability to predict the kinetics of hybridization based on the thermodynamic characteristics of the probe is crucial. In this study, a computer aided numerical model for the design and optimization of a flow-through biochip was developed using a finite element technique packaged software tool (FEMLAB; package included in COMSOL Multiphysics to simulate the transport of DNA through a microfluidic chamber to the reaction surface. The model accounts for fluid flow, convection and diffusion in the channel and on the reaction surface. Concentration, association rate constant, dissociation rate constant, recirculation flow rate, and temperature were key parameters affecting the rate of hybridization. The model predicted the kinetic profile and signal intensities of eighteen 20-mer probes targeting vancomycin resistance genes (VRGs. Predicted signal intensities and hybridization kinetics strongly correlated with experimental data in the biochip (R2 = 0.8131.

  10. Periodic expression of nuclear and mitochondrial DNA replication genes during the trypanosomatid cell cycle.

    Science.gov (United States)

    Pasion, S G; Brown, G W; Brown, L M; Ray, D S

    1994-12-01

    In trypanosomatids, DNA replication in the nucleus and in the single mitochondrion (or kinetoplast) initiates nearly simultaneously, suggesting that the DNA synthesis (S) phases of the nucleus and the mitochondrion are coordinately regulated. To investigate the basis for the temporal link between nuclear and mitochondrial DNA synthesis phases the expression of the genes encoding DNA ligase I, the 51 and 28 kDa subunits of replication protein A, dihydrofolate reductase and the mitochondrial type II topoisomerase were analyzed during the cell cycle progression of synchronous cultures of Crithidia fasciculata. These DNA replication genes were all expressed periodically, with peak mRNA levels occurring just prior to or at the peak of DNA synthesis in the synchronized cultures. A plasmid clone (pdN-1) in which TOP2, the gene encoding the mitochondrial topoisomerase, was disrupted by the insertion of a NEO drug-resistance cassette was found to express both a truncated TOP2 mRNA and a truncated topoisomerase polypeptide. The truncated mRNA was also expressed periodically coordinate with the expression of the endogenous TOP2 mRNA indicating that cis elements necessary for periodic expression are contained within cloned sequences. The expression of both TOP2 and nuclear DNA replication genes at the G1/S boundary suggests that regulated expression of these genes may play a role in coordinating nuclear and mitochondrial S phases in trypanosomatids.

  11. Molecular genetic and biochemical analyses of a DNA repair gene from Serratia marcescens

    International Nuclear Information System (INIS)

    Murphy, K.E.

    1989-01-01

    In Escherichia coli, the SOS response and two 3-methyladenine DNA glycosylases (TagI and TagII) are required for repair of DNA damaged by alkylating agents such as methyl methanesulfonate (MMS). Mutations of the recA gene eliminate the SOS response. TagI and TagII are encoded by the tag and alkA genes, respectively. A gene (rpr) encoding 3-methyladenine DNA glycosylase activity was isolated from the Gram-negative bacterium Serratia marcescens. The gene, localized to a 1.5-kilobase pair SmaI-HindIII restriction fragment, was cloned into plasmid pUC18. The clone complemented E. coli tag alkA and recA mutations for MMS resistance. The rpr gene did not, however, complement recA mutations for resistance to ultraviolet light or the ability to perform homologous recombination reactions, nor did it complement E. coli ada or alkB mutations. Two proteins of molecular weights 42,000 and 16,000 were produced from the rpr locus. Analysis of deletion and insertion mutants of rpr suggested that the 42kD molecule is the active protein. The 16kD protein may either be a breakdown product of the 42kD species or may be encoded by another gene overlapping the reading frame of the rpr gene. Biochemical assays showed that the rpr gene product (Rpr) possesses 3-methyladenine DNA glycosylase activity

  12. Apparent polyploidization after gamma irradiation: pitfalls in the use of quantitative polymerase chain reaction (qPCR) for the estimation of mitochondrial and nuclear DNA gene copy numbers.

    Science.gov (United States)

    Kam, Winnie W Y; Lake, Vanessa; Banos, Connie; Davies, Justin; Banati, Richard

    2013-05-30

    Quantitative polymerase chain reaction (qPCR) has been widely used to quantify changes in gene copy numbers after radiation exposure. Here, we show that gamma irradiation ranging from 10 to 100 Gy of cells and cell-free DNA samples significantly affects the measured qPCR yield, due to radiation-induced fragmentation of the DNA template and, therefore, introduces errors into the estimation of gene copy numbers. The radiation-induced DNA fragmentation and, thus, measured qPCR yield varies with temperature not only in living cells, but also in isolated DNA irradiated under cell-free conditions. In summary, the variability in measured qPCR yield from irradiated samples introduces a significant error into the estimation of both mitochondrial and nuclear gene copy numbers and may give spurious evidence for polyploidization.

  13. Modulation of DNA binding by gene-specific transcription factors.

    Science.gov (United States)

    Schleif, Robert F

    2013-10-01

    The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.

  14. Expression of DNA repair genes in ovarian cancer samples: biological and clinical considerations.

    Science.gov (United States)

    Ganzinelli, M; Mariani, P; Cattaneo, D; Fossati, R; Fruscio, R; Corso, S; Ricci, F; Broggini, M; Damia, G

    2011-05-01

    The purpose of this study was to investigate retrospectively the mRNA expression of genes involved in different DNA repair pathways implicated in processing platinum-induced damage in 171 chemotherapy-naïve ovarian tumours and correlate the expression of the different genes with clinical parameters. The expression of genes involved in DNA repair pathways (PARP1, ERCC1, XPA, XPF, XPG, BRCA1, FANCA, FANCC, FANCD2, FANCF and PolEta), and in DNA damage transduction (Chk1 and Claspin) was measured by RT-PCR in 13 stage I borderline and 77 stage I and 88 III ovarian carcinomas. ERCC1, XPA, XPF and XPG genes were significantly less expressed in stage III than in stage I carcinoma; BRCA1, FANCA, FANCC, FANCD2 gene expressions were low in borderline tumours, higher in stage I carcinomas and lower in stage III samples. High levels of ERCC1, XPA, FANCC, XPG and PolEta correlated with an increase in Overall Survival (OS) and Progression Free Survival (PFS), whilst high BRCA1 levels were associated with PFS on univariate analysis. With multivariate analyses no genes retained an association when adjusted by stage, grade and residual tumour. A tendency towards a better PFS was observed in patients with the highest level of ERCC1 and BRCA1 after platinum-based therapy than those given both platinum and taxol. The expression of DNA repair genes differed in borderline stage I, stage I and stage III ovarian carcinomas. The role of DNA repair genes in predicting the response in ovarian cancer patients seems far from being established. Copyright © 2010 Elsevier Ltd. All rights reserved.

  15. A functional polymorphism in the reduced folate carrier gene and DNA hypomethylation in mothers of children with autism.

    Science.gov (United States)

    James, S Jill; Melnyk, Stepan; Jernigan, Stefanie; Pavliv, Oleksandra; Trusty, Timothy; Lehman, Sara; Seidel, Lisa; Gaylor, David W; Cleves, Mario A

    2010-09-01

    The biologic basis of autism is complex and is thought to involve multiple and variable gene-environment interactions. While the logical focus has been on the affected child, the impact of maternal genetics on intrauterine microenvironment during pivotal developmental windows could be substantial. Folate-dependent one carbon metabolism is a highly polymorphic pathway that regulates the distribution of one-carbon derivatives between DNA synthesis (proliferation) and DNA methylation (cell-specific gene expression and differentiation). These pathways are essential to support the programmed shifts between proliferation and differentiation during embryogenesis and organogenesis. Maternal genetic variants that compromise intrauterine availability of folate derivatives could alter fetal cell trajectories and disrupt normal neurodevelopment. In this investigation, the frequency of common functional polymorphisms in the folate pathway was investigated in a large population-based sample of autism case-parent triads. In case-control analysis, a significant increase in the reduced folate carrier (RFC1) G allele frequency was found among case mothers, but not among fathers or affected children. Subsequent log linear analysis of the RFC1 A80G genotype within family trios revealed that the maternal G allele was associated with a significant increase in risk of autism whereas the inherited genotype of the child was not. Further, maternal DNA from the autism mothers was found to be significantly hypomethylated relative to reference control DNA. Metabolic profiling indicated that plasma homocysteine, adenosine, and S-adenosylhomocyteine were significantly elevated among autism mothers consistent with reduced methylation capacity and DNA hypomethylation. Together, these results suggest that the maternal genetics/epigenetics may influence fetal predisposition to autism. (c) 2010 Wiley-Liss, Inc.

  16. DNA repair genes RAD52 and SRS2, a cell wall synthesis regulator gene SMI1, and the membrane sterol synthesis scaffold gene ERG28 are important in efficient Agrobacterium-mediated yeast transformation with chromosomal T-DNA.

    Science.gov (United States)

    Ohmine, Yuta; Satoh, Yukari; Kiyokawa, Kazuya; Yamamoto, Shinji; Moriguchi, Kazuki; Suzuki, Katsunori

    2016-04-02

    Plant pathogenic Agrobacterium strains can transfer T-DNA regions of their Ti plasmids to a broad range of eukaryotic hosts, including fungi, in vitro. In the recent decade, the yeast Saccharomyces cerevisiae is used as a model host to reveal important host proteins for the Agrobacterium-mediated transformation (AMT). Further investigation is required to understand the fundamental mechanism of AMT, including interaction at the cell surface, to expand the host range, and to develop new tools. In this study, we screened a yeast mutant library for low AMT mutant strains by advantage of a chromosome type T-DNA, which transfer is efficient and independent on integration into host chromosome. By the mutant screening, we identified four mutant strains (srs2Δ, rad52Δ, smi1Δ and erg28Δ), which showed considerably low AMT efficiency. Structural analysis of T-DNA product replicons in AMT colonies of mutants lacking each of the two DNA repair genes, SRS2 and RAD52, suggested that the genes act soon after T-DNA entry for modification of the chromosomal T-DNA to stably maintain them as linear replicons and to circularize certain T-DNA simultaneously. The cell wall synthesis regulator SMI1 might have a role in the cell surface interaction between the donor and recipient cells, but the smi1Δ mutant exhibited pleiotropic effect, i.e. low effector protein transport as well as low AMT for the chromosomal T-DNA, but relatively high AMT for integrative T-DNAs. The ergosterol synthesis regulator/enzyme-scaffold gene ERG28 probably contributes by sensing a congested environment, because growth of erg28Δ strain was unaffected by the presence of donor bacterial cells, while the growth of the wild-type and other mutant yeast strains was suppressed by their presence. RAD52 and the DNA helicase/anti-recombinase gene SRS2 are necessary to form and maintain artificial chromosomes through the AMT of chromosomal T-DNA. A sterol synthesis scaffold gene ERG28 is important in the high

  17. Distinct co-evolution patterns of genes associated to DNA polymerase III DnaE and PolC

    Directory of Open Access Journals (Sweden)

    Engelen Stefan

    2012-02-01

    Full Text Available Abstract Background Bacterial genomes displaying a strong bias between the leading and the lagging strand of DNA replication encode two DNA polymerases III, DnaE and PolC, rather than a single one. Replication is a highly unsymmetrical process, and the presence of two polymerases is therefore not unexpected. Using comparative genomics, we explored whether other processes have evolved in parallel with each polymerase. Results Extending previous in silico heuristics for the analysis of gene co-evolution, we analyzed the function of genes clustering with dnaE and polC. Clusters were highly informative. DnaE co-evolves with the ribosome, the transcription machinery, the core of intermediary metabolism enzymes. It is also connected to the energy-saving enzyme necessary for RNA degradation, polynucleotide phosphorylase. Most of the proteins of this co-evolving set belong to the persistent set in bacterial proteomes, that is fairly ubiquitously distributed. In contrast, PolC co-evolves with RNA degradation enzymes that are present only in the A+T-rich Firmicutes clade, suggesting at least two origins for the degradosome. Conclusion DNA replication involves two machineries, DnaE and PolC. DnaE co-evolves with the core functions of bacterial life. In contrast PolC co-evolves with a set of RNA degradation enzymes that does not derive from the degradosome identified in gamma-Proteobacteria. This suggests that at least two independent RNA degradation pathways existed in the progenote community at the end of the RNA genome world.

  18. pH-Dependent DNA Distortion and Repression of Gene Expression by Pectobacterium atrosepticum PecS.

    Science.gov (United States)

    Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne

    2016-07-15

    Transcriptional activity is exquisitely sensitive to changes in promoter DNA topology. Transcription factors may therefore control gene activity by modulating the relative positioning of -10 and -35 promoter elements. The plant pathogen Pectobacterium atrosepticum, which causes soft rot in potatoes, must alter gene expression patterns to ensure growth in planta. In the related soft-rot enterobacterium Dickeya dadantii, PecS functions as a master regulator of virulence gene expression. Here, we report that P. atrosepticum PecS controls gene activity by altering promoter DNA topology in response to pH. While PecS binds the pecS promoter with high affinity regardless of pH, it induces significant DNA distortion only at neutral pH, the pH at which the pecS promoter is repressed in vivo. At pH ∼8, DNA distortions are attenuated, and PecS no longer represses the pecS promoter. A specific histidine (H142) located in a crevice between the dimerization- and DNA-binding regions is required for pH-dependent changes in DNA distortion and repression of gene activity, and mutation of this histidine renders the mutant protein incapable of repressing the pecS promoter. We propose that protonated PecS induces a DNA conformation at neutral pH in which -10 and -35 promoter elements are suboptimally positioned for RNA polymerase binding; on deprotonation of PecS, binding is no longer associated with significant changes in DNA conformation, allowing gene expression. We suggest that this mode of gene regulation leads to differential expression of the PecS regulon in response to alkalinization of the plant apoplast.

  19. Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion

    Directory of Open Access Journals (Sweden)

    Jeffrey A. Fawcett

    2011-02-01

    Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.

  20. Radioactive cDNA microarrys for gene expression profiles in antidepressant therapy

    International Nuclear Information System (INIS)

    Lee, M. S.; Han, B. J.; Cha, J. H.; Ryu, Y. M.; Shin, E. K.; Park, J. H.; Park, Y. H.; Kim, M. K.

    2002-01-01

    Using radioactive cDNA microarray, we investigated a pattern of gene regulation under treatment of antidepressant on patients of depressive disoder. Basic microarray technology was performed as previously described in our research. The bioinformatic selection of human cDNAs, which is specifically designed for psychiatry, neurology, and signal transduction, were arrayed on nylon membranes. Using with 33P-labeled probes, this method provided highly sensitive gene expression profiles of our interest including brain receptors, drug metabolism, and cellular signalings. Gene expression profiles were also classified into several categories in accordance with the gene-regulation of antidepressant. The gene profiles of our interest were significantly up- (16 genes, >2.0 of Z-ratio) or down- (24 genes, <-2.0 of Z ratio) regulated when compared the good responsed group with the bad-responsed one. Consequently, we demonstrated that radioactive human cDNA microarray is highly likely to be an efficient technology for evaluating the gene regulation of antidepressants, such as selective serotonin-reuptake inhibitors (SSRIs), by using high-throughput biotechnology

  1. Exercise-associated DNA methylation change in skeletal muscle and the importance of imprinted genes: a bioinformatics meta-analysis.

    Science.gov (United States)

    Brown, William M

    2015-12-01

    Epigenetics is the study of processes--beyond DNA sequence alteration--producing heritable characteristics. For example, DNA methylation modifies gene expression without altering the nucleotide sequence. A well-studied DNA methylation-based phenomenon is genomic imprinting (ie, genotype-independent parent-of-origin effects). We aimed to elucidate: (1) the effect of exercise on DNA methylation and (2) the role of imprinted genes in skeletal muscle gene networks (ie, gene group functional profiling analyses). Gene ontology (ie, gene product elucidation)/meta-analysis. 26 skeletal muscle and 86 imprinted genes were subjected to g:Profiler ontology analysis. Meta-analysis assessed exercise-associated DNA methylation change. g:Profiler found four muscle gene networks with imprinted loci. Meta-analysis identified 16 articles (387 genes/1580 individuals) associated with exercise. Age, method, sample size, sex and tissue variation could elevate effect size bias. Only skeletal muscle gene networks including imprinted genes were reported. Exercise-associated effect sizes were calculated by gene. Age, method, sample size, sex and tissue variation were moderators. Six imprinted loci (RB1, MEG3, UBE3A, PLAGL1, SGCE, INS) were important for muscle gene networks, while meta-analysis uncovered five exercise-associated imprinted loci (KCNQ1, MEG3, GRB10, L3MBTL1, PLAGL1). DNA methylation decreased with exercise (60% of loci). Exercise-associated DNA methylation change was stronger among older people (ie, age accounted for 30% of the variation). Among older people, genes exhibiting DNA methylation decreases were part of a microRNA-regulated gene network functioning to suppress cancer. Imprinted genes were identified in skeletal muscle gene networks and exercise-associated DNA methylation change. Exercise-associated DNA methylation modification could rewind the 'epigenetic clock' as we age. CRD42014009800. Published by the BMJ Publishing Group Limited. For permission to use (where

  2. Genome-Wide DNA Methylation Indicates Silencing of Tumor Suppressor Genes in Uterine Leiomyoma

    Science.gov (United States)

    Navarro, Antonia; Yin, Ping; Monsivais, Diana; Lin, Simon M.; Du, Pan; Wei, Jian-Jun; Bulun, Serdar E.

    2012-01-01

    Background Uterine leiomyomas, or fibroids, represent the most common benign tumor of the female reproductive tract. Fibroids become symptomatic in 30% of all women and up to 70% of African American women of reproductive age. Epigenetic dysregulation of individual genes has been demonstrated in leiomyoma cells; however, the in vivo genome-wide distribution of such epigenetic abnormalities remains unknown. Principal Findings We characterized and compared genome-wide DNA methylation and mRNA expression profiles in uterine leiomyoma and matched adjacent normal myometrial tissues from 18 African American women. We found 55 genes with differential promoter methylation and concominant differences in mRNA expression in uterine leiomyoma versus normal myometrium. Eighty percent of the identified genes showed an inverse relationship between DNA methylation status and mRNA expression in uterine leiomyoma tissues, and the majority of genes (62%) displayed hypermethylation associated with gene silencing. We selected three genes, the known tumor suppressors KLF11, DLEC1, and KRT19 and verified promoter hypermethylation, mRNA repression and protein expression using bisulfite sequencing, real-time PCR and western blot. Incubation of primary leiomyoma smooth muscle cells with a DNA methyltransferase inhibitor restored KLF11, DLEC1 and KRT19 mRNA levels. Conclusions These results suggest a possible functional role of promoter DNA methylation-mediated gene silencing in the pathogenesis of uterine leiomyoma in African American women. PMID:22428009

  3. Neuronal DNA Methyltransferases: Epigenetic Mediators between Synaptic Activity and Gene Expression?

    Science.gov (United States)

    Bayraktar, Gonca; Kreutz, Michael R

    2018-04-01

    DNMT3A and 3B are the main de novo DNA methyltransferases (DNMTs) in the brain that introduce new methylation marks to non-methylated DNA in postmitotic neurons. DNA methylation is a key epigenetic mark that is known to regulate important cellular processes in neuronal development and brain plasticity. Accumulating evidence disclosed rapid and dynamic changes in DNA methylation of plasticity-relevant genes that are important for learning and memory formation. To understand how DNMTs contribute to brain function and how they are regulated by neuronal activity is a prerequisite for a deeper appreciation of activity-dependent gene expression in health and disease. This review discusses the functional role of de novo methyltransferases and in particular DNMT3A1 in the adult brain with special emphasis on synaptic plasticity, memory formation, and brain disorders.

  4. Diversification of DnaA dependency for DNA replication in cyanobacterial evolution.

    Science.gov (United States)

    Ohbayashi, Ryudo; Watanabe, Satoru; Ehira, Shigeki; Kanesaki, Yu; Chibazakura, Taku; Yoshikawa, Hirofumi

    2016-05-01

    Regulating DNA replication is essential for all living cells. The DNA replication initiation factor DnaA is highly conserved in prokaryotes and is required for accurate initiation of chromosomal replication at oriC. DnaA-independent free-living bacteria have not been identified. The dnaA gene is absent in plastids and some symbiotic bacteria, although it is not known when or how DnaA-independent mechanisms were acquired. Here, we show that the degree of dependency of DNA replication on DnaA varies among cyanobacterial species. Deletion of the dnaA gene in Synechococcus elongatus PCC 7942 shifted DNA replication from oriC to a different site as a result of the integration of an episomal plasmid. Moreover, viability during the stationary phase was higher in dnaA disruptants than in wild-type cells. Deletion of dnaA did not affect DNA replication or cell growth in Synechocystis sp. PCC 6803 or Anabaena sp. PCC 7120, indicating that functional dependency on DnaA was already lost in some nonsymbiotic cyanobacterial lineages during diversification. Therefore, we proposed that cyanobacteria acquired DnaA-independent replication mechanisms before symbiosis and such an ancestral cyanobacterium was the sole primary endosymbiont to form a plastid precursor.

  5. Polymorphisms of Selected DNA Repair Genes and Lung Cancer in Chromium Exposure.

    Science.gov (United States)

    Halasova, E; Matakova, T; Skerenova, M; Krutakova, M; Slovakova, P; Dzian, A; Javorkova, S; Pec, M; Kypusova, K; Hamzik, J

    2016-01-01

    Chromium is a well-known mutagen and carcinogen involved in lung cancer development. DNA repair genes play an important role in the elimination of genetic changes caused by chromium exposure. In the present study, we investigated the polymorphisms of the following DNA repair genes: XRCC3, participating in the homologous recombination repair, and hMLH1 and hMSH2, functioning in the mismatch repair. We focused on the risk the polymorphisms present in the development of lung cancer regarding the exposure to chromium. We analyzed 106 individuals; 45 patients exposed to chromium with diagnosed lung cancer and 61 healthy controls. Genotypes were determined by a PCR-RFLP method. We unravelled a potential for increased risk of lung cancer development in the hMLH1 (rs1800734) AA genotype in the recessive model. In conclusion, gene polymorphisms in the DNA repair genes underscores the risk of lung cancer development in chromium exposed individuals.

  6. DNA tagging of blast resistant gene(s in three Brazilian rice cultivars

    Directory of Open Access Journals (Sweden)

    S.S. Sandhu

    2003-12-01

    Full Text Available Rice blast is the most important fungal disease of rice and is caused by Pyricularia oryzae Sacc. (Telomorph Magnoporthe grisea Barr.. Seven randomly amplified polymorphic DNA (RAPD markers OPA5, OPG17, OPG18, OPG19, OPF9, OPF17 and OPF19 showed very clear polymorphism in resistant cultivar lines which differed from susceptible lines. By comparing different susceptible lines, nine DNA amplifications of seven primers (OPA5(1000, OPA5(1200, OPG17(700, OPG18(850, OPG19(500, OPG19(600, OPF9(600, OPF17(1200 and OPF19(600 were identified as dominant markers for the blast resistant gene in resistant cultivar lines. These loci facilitate the indirect scoring of blast resistant and blast susceptible genotypes. The codomine RAPDs markers will facilitate marker-assisted selection of the blast resistant gene in two blast resistant genotypes of rice (Labelle and Line 11 and will be useful in rice breeding programs.

  7. A DNA methylation microarray-based study identifies ERG as a gene commonly methylated in prostate cancer.

    Science.gov (United States)

    Schwartzman, Jacob; Mongoue-Tchokote, Solange; Gibbs, Angela; Gao, Lina; Corless, Christopher L; Jin, Jennifer; Zarour, Luai; Higano, Celestia; True, Lawrence D; Vessella, Robert L; Wilmot, Beth; Bottomly, Daniel; McWeeney, Shannon K; Bova, G Steven; Partin, Alan W; Mori, Motomi; Alumkal, Joshi

    2011-10-01

    DNA methylation of promoter regions is a common event in prostate cancer, one of the most common cancers in men worldwide. Because prior reports demonstrating that DNA methylation is important in prostate cancer studied a limited number of genes, we systematically quantified the DNA methylation status of 1505 CpG dinucleotides for 807 genes in 78 paraffin-embedded prostate cancer samples and three normal prostate samples. The ERG gene, commonly repressed in prostate cells in the absence of an oncogenic fusion to the TMPRSS2 gene, was one of the most commonly methylated genes, occurring in 74% of prostate cancer specimens. In an independent group of patient samples, we confirmed that ERG DNA methylation was common, occurring in 57% of specimens, and cancer-specific. The ERG promoter is marked by repressive chromatin marks mediated by polycomb proteins in both normal prostate cells and prostate cancer cells, which may explain ERG's predisposition to DNA methylation and the fact that tumors with ERG DNA methylation were more methylated, in general. These results demonstrate that bead arrays offer a high-throughput method to discover novel genes with promoter DNA methylation such as ERG, whose measurement may improve our ability to more accurately detect prostate cancer.

  8. Sperm DNA fragmentation affects epigenetic feature in human male pronucleus.

    Science.gov (United States)

    Rajabi, H; Mohseni-Kouchesfehani, H; Eslami-Arshaghi, T; Salehi, M

    2018-02-01

    To evaluate whether the sperm DNA fragmentation affects male pronucleus epigenetic factors, semen analysis was performed and DNA fragmentation was assessed by the method of sperm chromatin structure assay (SCSA). Human-mouse interspecies fertilisation was used to create human male pronucleus. Male pronucleus DNA methylation and H4K12 acetylation were evaluated by immunostaining. Results showed a significant positive correlation between the level of sperm DNA fragmentation and DNA methylation in male pronuclei. In other words, an increase in DNA damage caused an upsurge in DNA methylation. In the case of H4K12 acetylation, no correlation was detected between DNA damage and the level of histone acetylation in the normal group, but results for the group in which male pronuclei were derived from sperm cells with DNA fragmentation, increased DNA damage led to a decreased acetylation level. Sperm DNA fragmentation interferes with the active demethylation process and disrupts the insertion of histones into the male chromatin in the male pronucleus, following fertilisation. © 2017 Blackwell Verlag GmbH.

  9. DNA demethylation activates genes in seed maternal integument development in rice (Oryza sativa L.).

    Science.gov (United States)

    Wang, Yifeng; Lin, Haiyan; Tong, Xiaohong; Hou, Yuxuan; Chang, Yuxiao; Zhang, Jian

    2017-11-01

    DNA methylation is an important epigenetic modification that regulates various plant developmental processes. Rice seed integument determines the seed size. However, the role of DNA methylation in its development remains largely unknown. Here, we report the first dynamic DNA methylomic profiling of rice maternal integument before and after pollination by using a whole-genome bisulfite deep sequencing approach. Analysis of DNA methylation patterns identified 4238 differentially methylated regions underpin 4112 differentially methylated genes, including GW2, DEP1, RGB1 and numerous other regulators participated in maternal integument development. Bisulfite sanger sequencing and qRT-PCR of six differentially methylated genes revealed extensive occurrence of DNA hypomethylation triggered by double fertilization at IAP compared with IBP, suggesting that DNA demethylation might be a key mechanism to activate numerous maternal controlling genes. These results presented here not only greatly expanded the rice methylome dataset, but also shed novel insight into the regulatory roles of DNA methylation in rice seed maternal integument development. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  10. DNA-mediated gene transfer into human diploid fibroblasts derived from normal and ataxia-telangiectasia donors: parameters for DNA transfer and properties of DNA transformants

    International Nuclear Information System (INIS)

    Debenham, P.G.; Webb, M.B.T.; Masson, W.K.; Cox, R.

    1984-01-01

    An investigation was made of the feasibility of DNA-mediated gene transfer into human diploid fibroblasts derived from patients with the radiation sensitive syndrome ataxia-telangiectasia (A-T) and from a normal donor. Although they are markedly different in their growth characteristics, both normal and A-T strains give similar frequencies for DNA transfer in a model system using the recombinant plasmid pSV2-gpt. pSV2-gpt DNA transformants arise with a frequency between 10 -5 and 10 -4 per viable cell. Analysis of such transformants, although possible, is severely handicapped by the limited clonal life span of diploid human cells. Despite these problems it may be concluded that diploid human fibroblasts are competent recipients for DNA-mediated gene transfer and the putative repair deficiency of A-T does not markedly effect the efficiency of this process. (author)

  11. A data mining approach for classifying DNA repair genes into ageing-related or non-ageing-related

    Directory of Open Access Journals (Sweden)

    Vasieva Olga

    2011-01-01

    Full Text Available Abstract Background The ageing of the worldwide population means there is a growing need for research on the biology of ageing. DNA damage is likely a key contributor to the ageing process and elucidating the role of different DNA repair systems in ageing is of great interest. In this paper we propose a data mining approach, based on classification methods (decision trees and Naive Bayes, for analysing data about human DNA repair genes. The goal is to build classification models that allow us to discriminate between ageing-related and non-ageing-related DNA repair genes, in order to better understand their different properties. Results The main patterns discovered by the classification methods are as follows: (a the number of protein-protein interactions was a predictor of DNA repair proteins being ageing-related; (b the use of predictor attributes based on protein-protein interactions considerably increased predictive accuracy of attributes based on Gene Ontology (GO annotations; (c GO terms related to "response to stimulus" seem reasonably good predictors of ageing-relatedness for DNA repair genes; (d interaction with the XRCC5 (Ku80 protein is a strong predictor of ageing-relatedness for DNA repair genes; and (e DNA repair genes with a high expression in T lymphocytes are more likely to be ageing-related. Conclusions The above patterns are broadly integrated in an analysis discussing relations between Ku, the non-homologous end joining DNA repair pathway, ageing and lymphocyte development. These patterns and their analysis support non-homologous end joining double strand break repair as central to the ageing-relatedness of DNA repair genes. Our work also showcases the use of protein interaction partners to improve accuracy in data mining methods and our approach could be applied to other ageing-related pathways.

  12. Alteration of gene expression and DNA methylation in drug-resistant gastric cancer.

    Science.gov (United States)

    Maeda, Osamu; Ando, Takafumi; Ohmiya, Naoki; Ishiguro, Kazuhiro; Watanabe, Osamu; Miyahara, Ryoji; Hibi, Yoko; Nagai, Taku; Yamada, Kiyofumi; Goto, Hidemi

    2014-04-01

    The mechanisms of drug resistance in cancer are not fully elucidated. To study the drug resistance of gastric cancer, we analyzed gene expression and DNA methylation profiles of 5-fluorouracil (5-FU)- and cisplatin (CDDP)-resistant gastric cancer cells and biopsy specimens. Drug-resistant gastric cancer cells were established with culture for >10 months in a medium containing 5-FU or CDDP. Endoscopic biopsy specimens were obtained from gastric cancer patients who underwent chemotherapy with oral fluoropyrimidine S-1 and CDDP. Gene expression and DNA methylation analyses were performed using microarray, and validated using real-time PCR and pyrosequencing, respectively. Out of 17,933 genes, 541 genes commonly increased and 569 genes decreased in both 5-FU- and CDDP-resistant AGS cells. Genes with expression changed by drugs were related to GO term 'extracellular region' and 'p53 signaling pathway' in both 5-FU- and CDDP-treated cells. Expression of 15 genes including KLK13 increased and 12 genes including ETV7 decreased, in both drug-resistant cells and biopsy specimens of two patients after chemotherapy. Out of 10,365 genes evaluated with both expression microarray and methylation microarray, 74 genes were hypermethylated and downregulated, or hypomethylated and upregulated in either 5-FU-resistant or CDDP-resistant cells. Of these genes, expression of 21 genes including FSCN1, CPT1C and NOTCH3, increased from treatment with a demethylating agent. There are alterations of gene expression and DNA methylation in drug-resistant gastric cancer; they may be related to mechanisms of drug resistance and may be useful as biomarkers of gastric cancer drug sensitivity.

  13. Sequence homology and expression profile of genes associated with DNA repair pathways in Mycobacterium leprae.

    Science.gov (United States)

    Sharma, Mukul; Vedithi, Sundeep Chaitanya; Das, Madhusmita; Roy, Anindya; Ebenezer, Mannam

    2017-01-01

    Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%), 11 hypothetical proteins (18%), and 14 pseudogenes (23%). All these genes have homologs in M. tuberculosis and 49 (80.32%) in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA). The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes) were analyzed using quantitative Polymerase Chain Reaction (qPCR) assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the direct repair pathway. This study provided

  14. DNA methylation and gene expression of TXNIP in adult offspring of women with diabetes in pregnancy.

    Directory of Open Access Journals (Sweden)

    Azadeh Houshmand-Oeregaard

    Full Text Available Fetal exposure to maternal diabetes increases the risk of type 2 diabetes (T2DM, possibly mediated by epigenetic mechanisms. Low blood TXNIP DNA methylation has been associated with elevated glucose levels and risk of T2DM, and increased skeletal muscle TXNIP gene expression was reported in subjects with impaired glucose metabolism or T2DM. Subcutaneous adipose tissue (SAT and skeletal muscle play a key role in the control of whole body glucose metabolism and insulin action. The extent to which TXNIP DNA methylation levels are decreased and/or gene expression levels increased in SAT or skeletal muscle of a developmentally programmed at-risk population is unknown.The objective of this study was to investigate TXNIP DNA methylation and gene expression in SAT and skeletal muscle, and DNA methylation in blood, from adult offspring of women with gestational diabetes (O-GDM, n = 82 or type 1 diabetes (O-T1DM, n = 67 in pregnancy compared with offspring of women from the background population (O-BP, n = 57.SAT TXNIP DNA methylation was increased (p = 0.032 and gene expression decreased (p = 0.001 in O-GDM, but these differences were attenuated after adjustment for confounders. Neither blood/muscle TXNIP DNA methylation nor muscle gene expression differed between groups.We found no evidence of decreased TXNIP DNA methylation or increased gene expression in metabolic target tissues of offspring exposed to maternal diabetes. Further studies are needed to confirm and understand the paradoxical SAT TXNIP DNA methylation and gene expression changes in O-GDM subjects.

  15. Junk DNA enhances pEI-based non-viral gene delivery

    NARCIS (Netherlands)

    Gaal, E.V.B. van; Oosting, R.S.; Hennink, W.E.; Crommelin, D.J.A.; Mastrobattista, E.

    Gene therapy aims at delivering exogenous DNA into the nuclei of target cells to establish expression of a therapeutic protein. Non-viral gene delivery is examined as a safer alternative to viral approaches, but is presently characterized by a low efficiency. In the past years several non-viral

  16. Amphibian antimicrobial peptide fallaxin analogue FL9 affects virulence gene expression and DNA replication in Staphylococcus aureus.

    Science.gov (United States)

    Gottschalk, Sanne; Gottlieb, Caroline T; Vestergaard, Martin; Hansen, Paul R; Gram, Lone; Ingmer, Hanne; Thomsen, Line E

    2015-12-01

    The rapid rise in antibiotic-resistant pathogens is causing increased health concerns, and consequently there is an urgent need for novel antimicrobial agents. Antimicrobial peptides (AMPs), which have been isolated from a wide range of organisms, represent a very promising class of novel antimicrobials. In the present study, the analogue FL9, based on the amphibian AMP fallaxin, was studied to elucidate its mode of action and antibacterial activity against the human pathogen Staphylococcus aureus. Our data showed that FL9 may have a dual mode of action against S. aureus. At concentrations around the MIC, FL9 bound DNA, inhibited DNA synthesis and induced the SOS DNA damage response, whereas at concentrations above the MIC the interaction between S. aureus and FL9 led to membrane disruption. The antibacterial activity of the peptide was maintained over a wide range of NaCl and MgCl(2) concentrations and at alkaline pH, while it was compromised by acidic pH and exposure to serum. Furthermore, at subinhibitory concentrations of FL9, S. aureus responded by increasing the expression of two major virulence factor genes, namely the regulatory rnaIII and hla, encoding α-haemolysin. In addition, the S. aureus-encoded natural tolerance mechanisms included peptide cleavage and the addition of positive charge to the cell surface, both of which minimized the antimicrobial activity of FL9. Our results add new information about FL9 and its effect on S. aureus, which may aid in the future development of analogues with improved therapeutic potential.

  17. Identification and localization of a gene that specifies production of Escherichia coli DNA topoisomerase I

    International Nuclear Information System (INIS)

    Trucksis, M.; Depew, R.E.

    1981-01-01

    A gene that specifies production of Escherichia coli DNA topoisomerase I (ω protein) was identified with the aid of a radioimmunoassay for this protein. E. coli DNA topoisomerase I was produced by Salmonella typhimurium merodiploids that harbored E. coli plasmid F' 123, but not by strains that lost this plasmid. Analysis of strains with spontaneous deletions of F' 123 showed that the gene, topA, required for production of the E. coli ω protein was between the trp operon and the cysB gene. Deletions that eliminated topA also eliminated the supX gene. We suggest that topA is the structural gene of E. coli DNA topoisomerase I and that topA is identical to supX

  18. DNA microarrays of baculovirus genomes: differential expression of viral genes in two susceptible insect cell lines.

    Science.gov (United States)

    Yamagishi, J; Isobe, R; Takebuchi, T; Bando, H

    2003-03-01

    We describe, for the first time, the generation of a viral DNA chip for simultaneous expression measurements of nearly all known open reading frames (ORFs) in the best-studied members of the family Baculoviridae, Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Bombyx mori nucleopolyhedrovirus (BmNPV). In this study, a viral DNA chip (Ac-BmNPV chip) was fabricated and used to characterize the viral gene expression profile for AcMNPV in different cell types. The viral chip is composed of microarrays of viral DNA prepared by robotic deposition of PCR-amplified viral DNA fragments on glass for ORFs in the NPV genome. Viral gene expression was monitored by hybridization to the DNA fragment microarrays with fluorescently labeled cDNAs prepared from infected Spodoptera frugiperda, Sf9 cells and Trichoplusia ni, TnHigh-Five cells, the latter a major producer of baculovirus and recombinant proteins. A comparison of expression profiles of known ORFs in AcMNPV elucidated six genes (ORF150, p10, pk2, and three late gene expression factor genes lef-3, p35 and lef- 6) the expression of each of which was regulated differently in the two cell lines. Most of these genes are known to be closely involved in the viral life cycle such as in DNA replication, late gene expression and the release of polyhedra from infected cells. These results imply that the differential expression of these viral genes accounts for the differences in viral replication between these two cell lines. Thus, these fabricated microarrays of NPV DNA which allow a rapid analysis of gene expression at the viral genome level should greatly speed the functional analysis of large genomes of NPV.

  19. Transgelin gene is frequently downregulated by promoter DNA hypermethylation in breast cancer.

    Science.gov (United States)

    Sayar, Nilufer; Karahan, Gurbet; Konu, Ozlen; Bozkurt, Betul; Bozdogan, Onder; Yulug, Isik G

    2015-01-01

    CpG hypermethylation in gene promoters is a frequent mechanism of tumor suppressor gene silencing in various types of cancers. It usually occurs at early steps of cancer progression and can be detected easily, giving rise to development of promising biomarkers for both detection and progression of cancer, including breast cancer. 5-aza-2'-deoxycytidine (AZA) is a DNA demethylating and anti-cancer agent resulting in induction of genes suppressed via DNA hypermethylation. Using microarray expression profiling of AZA- or DMSO-treated breast cancer and non-tumorigenic breast (NTB) cells, we identified for the first time TAGLN gene as a target of DNA hypermethylation in breast cancer. TAGLN expression was significantly and frequently downregulated via promoter DNA hypermethylation in breast cancer cells compared to NTB cells, and also in 13/21 (61.9 %) of breast tumors compared to matched normal tissues. Analyses of public microarray methylation data showed that TAGLN was also hypermethylated in 63.02 % of tumors compared to normal tissues; relapse-free survival of patients was worse with higher TAGLN methylation; and methylation levels could discriminate between tumors and healthy tissues with 83.14 % sensitivity and 100 % specificity. Additionally, qRT-PCR and immunohistochemistry experiments showed that TAGLN expression was significantly downregulated in two more independent sets of breast tumors compared to normal tissues and was lower in tumors with poor prognosis. Colony formation was increased in TAGLN silenced NTB cells, while decreased in overexpressing BC cells. TAGLN gene is frequently downregulated by DNA hypermethylation, and TAGLN promoter methylation profiles could serve as a future diagnostic biomarker, with possible clinical impact regarding the prognosis in breast cancer.

  20. Varicella-zoster virus (VZV) origin of DNA replication oriS influences origin-dependent DNA replication and flanking gene transcription.

    Science.gov (United States)

    Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M

    2015-07-01

    The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Stress-induced gene expression and behavior are controlled by DNA methylation and methyl donor availability in the dentate gyrus

    Science.gov (United States)

    Saunderson, Emily A.; Spiers, Helen; Gutierrez-Mecinas, Maria; Trollope, Alexandra F.; Shaikh, Abeera; Mill, Jonathan; Reul, Johannes M. H. M.

    2016-01-01

    Stressful events evoke long-term changes in behavioral responses; however, the underlying mechanisms in the brain are not well understood. Previous work has shown that epigenetic changes and immediate-early gene (IEG) induction in stress-activated dentate gyrus (DG) granule neurons play a crucial role in these behavioral responses. Here, we show that an acute stressful challenge [i.e., forced swimming (FS)] results in DNA demethylation at specific CpG (5′-cytosine–phosphate–guanine-3′) sites close to the c-Fos (FBJ murine osteosarcoma viral oncogene homolog) transcriptional start site and within the gene promoter region of Egr-1 (early growth response protein 1) specifically in the DG. Administration of the (endogenous) methyl donor S-adenosyl methionine (SAM) did not affect CpG methylation and IEG gene expression at baseline. However, administration of SAM before the FS challenge resulted in an enhanced CpG methylation at the IEG loci and suppression of IEG induction specifically in the DG and an impaired behavioral immobility response 24 h later. The stressor also specifically increased the expression of the de novo DNA methyltransferase Dnmt3a [DNA (cytosine-5-)-methyltransferase 3 alpha] in this hippocampus region. Moreover, stress resulted in an increased association of Dnmt3a enzyme with the affected CpG loci within the IEG genes. No effects of SAM were observed on stress-evoked histone modifications, including H3S10p-K14ac (histone H3, phosphorylated serine 10 and acetylated lysine-14), H3K4me3 (histone H3, trimethylated lysine-4), H3K9me3 (histone H3, trimethylated lysine-9), and H3K27me3 (histone H3, trimethylated lysine-27). We conclude that the DNA methylation status of IEGs plays a crucial role in FS-induced IEG induction in DG granule neurons and associated behavioral responses. In addition, the concentration of available methyl donor, possibly in conjunction with Dnmt3a, is critical for the responsiveness of dentate neurons to environmental

  2. Quantification of differential gene expression by multiplexed targeted resequencing of cDNA

    Science.gov (United States)

    Arts, Peer; van der Raadt, Jori; van Gestel, Sebastianus H.C.; Steehouwer, Marloes; Shendure, Jay; Hoischen, Alexander; Albers, Cornelis A.

    2017-01-01

    Whole-transcriptome or RNA sequencing (RNA-Seq) is a powerful and versatile tool for functional analysis of different types of RNA molecules, but sample reagent and sequencing cost can be prohibitive for hypothesis-driven studies where the aim is to quantify differential expression of a limited number of genes. Here we present an approach for quantification of differential mRNA expression by targeted resequencing of complementary DNA using single-molecule molecular inversion probes (cDNA-smMIPs) that enable highly multiplexed resequencing of cDNA target regions of ∼100 nucleotides and counting of individual molecules. We show that accurate estimates of differential expression can be obtained from molecule counts for hundreds of smMIPs per reaction and that smMIPs are also suitable for quantification of relative gene expression and allele-specific expression. Compared with low-coverage RNA-Seq and a hybridization-based targeted RNA-Seq method, cDNA-smMIPs are a cost-effective high-throughput tool for hypothesis-driven expression analysis in large numbers of genes (10 to 500) and samples (hundreds to thousands). PMID:28474677

  3. Radioactive cDNA microarray (II): Gene expression profiling of antidepressant treatment by human cDNA microarray

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji Hye; Kang, Rhee Hun; Ham, Byung Joo; Lee, Min Su; Shin, Kyung Ho; Choe, Jae Gol; Kim, Meyoung Kon [College of Medicine, Univ. of Korea, Seoul (Korea, Republic of)

    2003-07-01

    Major depressive disorder is a prevalent psychiatric disorder in primary care, associated with impaired patient functioning and well-being. Fluoxetine is a selective serotonin-reuptake inhibitors (SSRIs) and is a commonly prescribed antidepressant compound. Its action is primarily attributed to selective inhibition of the reuptake of serotonin (5-hydroxytryptamine) in the central nervous system. Objectives ; the aims of this study were two-fold: (1) to determine the usefulness for investigation of the transcription profiles in depression patients, and (2) to assess the differences in gene expression profiles between positive response group and negative response groups by fluoxetine treatment. This study included 53 patients with major depression (26 in positive response group with antidepressant treatment, 27 in negative response group with antidepressant treatment), and 53 healthy controls. To examine the difference of gene expression profile in depression patients, radioactive complementary DNA microarrays were used to evaluate changes in the expression of 1,152 genes in total. Using 33p-labeled probes, this method provided highly sensitive gene expression profiles including brain receptors, drug metabolism, and cellular signaling. Gene transcription profiles were classified into several categories in accordance with the antidepressant gene-regulation. The gene profiles were significantly up-(22 genes) and down-(16 genes) regulated in the positive response group when compared to the control group. Also, in the negative response group, 35 genes were up-regulated and 8 genes were down-regulated when compared to the control group. Consequently, we demonstrated that radioactive human cDNA microarray is highly likely to be an efficient technology for evaluating the gene regulation of antidepressants, such as selective serotonin-reuptake inhibitors (SSRIs), by using high-throughput biotechnology.

  4. Radioactive cDNA microarray (II): Gene expression profiling of antidepressant treatment by human cDNA microarray

    International Nuclear Information System (INIS)

    Lee, Ji Hye; Kang, Rhee Hun; Ham, Byung Joo; Lee, Min Su; Shin, Kyung Ho; Choe, Jae Gol; Kim, Meyoung Kon

    2003-01-01

    Major depressive disorder is a prevalent psychiatric disorder in primary care, associated with impaired patient functioning and well-being. Fluoxetine is a selective serotonin-reuptake inhibitors (SSRIs) and is a commonly prescribed antidepressant compound. Its action is primarily attributed to selective inhibition of the reuptake of serotonin (5-hydroxytryptamine) in the central nervous system. Objectives ; the aims of this study were two-fold: (1) to determine the usefulness for investigation of the transcription profiles in depression patients, and (2) to assess the differences in gene expression profiles between positive response group and negative response groups by fluoxetine treatment. This study included 53 patients with major depression (26 in positive response group with antidepressant treatment, 27 in negative response group with antidepressant treatment), and 53 healthy controls. To examine the difference of gene expression profile in depression patients, radioactive complementary DNA microarrays were used to evaluate changes in the expression of 1,152 genes in total. Using 33p-labeled probes, this method provided highly sensitive gene expression profiles including brain receptors, drug metabolism, and cellular signaling. Gene transcription profiles were classified into several categories in accordance with the antidepressant gene-regulation. The gene profiles were significantly up-(22 genes) and down-(16 genes) regulated in the positive response group when compared to the control group. Also, in the negative response group, 35 genes were up-regulated and 8 genes were down-regulated when compared to the control group. Consequently, we demonstrated that radioactive human cDNA microarray is highly likely to be an efficient technology for evaluating the gene regulation of antidepressants, such as selective serotonin-reuptake inhibitors (SSRIs), by using high-throughput biotechnology

  5. cDNA fingerprinting of osteoprogenitor cells to isolate differentiation stage-specific genes.

    OpenAIRE

    Candeliere, G A; Rao, Y; Floh, A; Sandler, S D; Aubin, J E

    1999-01-01

    A cDNA fingerprinting strategy was developed to identify genes based on their differential expression pattern during osteoblast development. Preliminary biological and molecular staging of cDNA pools prepared by global amplification PCR allowed discrim-inating choices to be made in selection of expressed sequence tags (ESTs) to be isolated. Sequencing of selected ESTs confirmed that both known and novel genes can be isolated from any developmental stage of interest, e.g. from primitive progen...

  6. Species-level para- and polyphyly in DNA barcode gene trees

    DEFF Research Database (Denmark)

    Mutanen, Marko; Kivelä, Sami M.; Vos, Rutger A.

    2016-01-01

    was paid to accurate species identification to ensure data integrity. We investigated the effects of tree-building method, sampling effort, and other methodological issues, all of which can influence estimates of non-monophyly. We found a 12% incidence of non-monophyly, a value significantly lower than...... between species and gene genealogies, as indicated by situations where conspecific individuals do not form a monophyletic cluster in a gene tree. In two previous reviews, non-monophyly has been reported as being common in mitochondrial DNA gene trees. We developed a novel web service "Monophylizer......" to detect non-monophyly in phylogenetic trees and used it to ascertain the incidence of species non-monophyly in COI (a.k.a. cox1) barcode sequence data from 4977 species and 41,583 specimens of European Lepidoptera, the largest data set of DNA barcodes analyzed from this regard. Particular attention...

  7. Gene-gun DNA vaccination aggravates respiratory syncytial virus-induced pneumonitis

    DEFF Research Database (Denmark)

    Bartholdy, Christina; Olszewska, Wieslawa; Stryhn, Anette

    2004-01-01

    elicited with recombinant vaccinia virus expressing the complete RSV M2 protein, but stronger than those induced by a similar DNA construct without the beta2m gene. DNA vaccination led to enhanced pulmonary disease after RSV challenge, with increased weight loss and cell recruitment to the lung. Depletion......A CD8+ T-cell memory response to respiratory syncytial virus (RSV) was generated by using a DNA vaccine construct encoding the dominant Kd-restricted epitope from the viral transcription anti-terminator protein M2 (M2(82-90)), linked covalently to human beta2-microglobulin (beta2m). Cutaneous gene...... of CD8+ T cells reduced, but did not abolish, enhancement of disease. Mice vaccinated with a construct encoding a class I-restricted lymphocytic choriomeningitis virus epitope and beta2m suffered more severe weight loss after RSV infection than unvaccinated RSV-infected mice, although RSV-specific CD8...

  8. Unwinding after high salinity stress: Pea DNA helicase 45 over- expression in tobacco confers high salinity tolerance without affecting yield (abstract)

    International Nuclear Information System (INIS)

    Tuteja, N.

    2005-01-01

    Soil salinity is an increasing threat for agriculture and is a major factor in reducing plant productivity; therefore, it is necessary to obtain salinity-tolerant varieties. A typical characteristic of soil salinity is the induction of multiple stress- inducible genes. Some of the genes encoding osmolytes, ion channels or enzymes are able to confer salinity-tolerant phenotypes when transferred to sensitive plants. As salinity stress affects the cellular gene-expression machinery, it is evident that molecules involved in nucleic acid processing including helicases, are likely to be affected as well. DNA helicases unwind duplex DNA and are involved in replication, repair, recombination and transcription while RNA helicases unfold the secondary structures in RNA and are involved in transcription, ribosome biogenesis and translation initiation. We have earlier reported the isolation of a pea DNA helicase 45 (PDH45) that exhibits striking homology with eIF-4A (Plant J. 24:219-230,2000). Here we report that PDH45 mRNA is induced in pea seedlings in response to high salt and its over- expression driven by a constitutive CAMV-355-promoter in tobacco plants confers salinity tolerance, thus suggesting a new pathway for manipulating stress tolerance in crop plants. The T0 transgenic plants showed high-levels of PDH45 protein in normal and stress conditions, as compared to wild type (WT) plants. The T0 transgenics also showed tolerance to high salinity as tested by a leaf disc senescence assay. The T1 transgenics were able to grow to maturity and set normal viable seeds under continuous salinity stress, without any reduction in plant yield, in terms of seed weight. Measurement of Na/sup +/ ions in different parts of the plant showed higher accumulation in the old leaves and negligible in seeds of T1 transgenic lines as compared with the WT plants. The possible mechanism of salinity tolerance will be discussed. Over-expression of PDH45 provides a possible example of the

  9. Molecular and clinical characterization of the myopathic form of mitochondrial DNA depletion syndrome caused by mutations in the thymidine kinase (TK2) gene.

    Science.gov (United States)

    Chanprasert, Sirisak; Wang, Jing; Weng, Shao-Wen; Enns, Gregory M; Boué, Daniel R; Wong, Brenda L; Mendell, Jerry R; Perry, Deborah A; Sahenk, Zarife; Craigen, William J; Alcala, Francisco J Climent; Pascual, Juan M; Melancon, Serge; Zhang, Victor Wei; Scaglia, Fernando; Wong, Lee-Jun C

    2013-01-01

    Mitochondrial DNA (mtDNA) depletion syndromes (MDSs) are a clinically and molecularly heterogeneous group of mitochondrial cytopathies characterized by severe mtDNA copy number reduction in affected tissues. Clinically, MDSs are mainly categorized as myopathic, encephalomyopathic, hepatocerebral, or multi-systemic forms. To date, the myopathic form of MDS is mainly caused by mutations in the TK2 gene, which encodes thymidine kinase 2, the first and rate limiting step enzyme in the phosphorylation of pyrimidine nucleosides. We analyzed 9 unrelated families with 11 affected subjects exhibiting the myopathic form of MDS, by sequencing the TK2 gene. Twelve mutations including 4 novel mutations were detected in 9 families. Skeletal muscle specimens were available from 7 out of 11 subjects. Respiratory chain enzymatic activities in skeletal muscle were measured in 6 subjects, and enzymatic activities were reduced in 3 subjects. Quantitative analysis of mtDNA content in skeletal muscle was performed in 5 subjects, and marked mtDNA content reduction was observed in each. In addition, we outline the molecular and clinical characteristics of this syndrome in a total of 52 patients including those previously reported, and a total of 36 TK2 mutations are summarized. Clinically, hypotonia and proximal muscle weakness are the major phenotypes present in all subjects. In summary, our study expands the molecular and clinical spectrum associated with TK2 deficiency. © 2013.

  10. AKT phosphorylates H3-threonine 45 to facilitate termination of gene transcription in response to DNA damage.

    Science.gov (United States)

    Lee, Jong-Hyuk; Kang, Byung-Hee; Jang, Hyonchol; Kim, Tae Wan; Choi, Jinmi; Kwak, Sojung; Han, Jungwon; Cho, Eun-Jung; Youn, Hong-Duk

    2015-05-19

    Post-translational modifications of core histones affect various cellular processes, primarily through transcription. However, their relationship with the termination of transcription has remained largely unknown. In this study, we show that DNA damage-activated AKT phosphorylates threonine 45 of core histone H3 (H3-T45). By genome-wide chromatin immunoprecipitation sequencing (ChIP-seq) analysis, H3-T45 phosphorylation was distributed throughout DNA damage-responsive gene loci, particularly immediately after the transcription termination site. H3-T45 phosphorylation pattern showed close-resemblance to that of RNA polymerase II C-terminal domain (CTD) serine 2 phosphorylation, which establishes the transcription termination signal. AKT1 was more effective than AKT2 in phosphorylating H3-T45. Blocking H3-T45 phosphorylation by inhibiting AKT or through amino acid substitution limited RNA decay downstream of mRNA cleavage sites and decreased RNA polymerase II release from chromatin. Our findings suggest that AKT-mediated phosphorylation of H3-T45 regulates the processing of the 3' end of DNA damage-activated genes to facilitate transcriptional termination. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Genetic manipulation in Sulfolobus islandicus and functional analysis of DNA repair genes

    DEFF Research Database (Denmark)

    Zhang, Changyi; Tian, Bin; Li, Suming

    2013-01-01

    Recently, a novel gene-deletion method was developed for the crenarchaeal model Sulfolobus islandicus, which is a suitable tool for addressing gene essentiality in depth. Using this technique, we have investigated functions of putative DNA repair genes by constructing deletion mutants and studying...

  12. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

    Energy Technology Data Exchange (ETDEWEB)

    Prior, Sara; Miousse, Isabelle R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nzabarushimana, Etienne [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Department of Bioinformatics, School of Informatics and Computing, Indiana University, Bloomington, IN 47405 (United States); Pathak, Rupak [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Skinner, Charles; Kutanzi, Kristy R. [Department of Environmental and Occupational Health, Fay W. Boozman College of Public Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Allen, Antiño R. [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Raber, Jacob [Departments of Behavioral Neuroscience, Neurology, and Radiation Medicine, Division of Neuroscience, ONPRC, Oregon Health & Science University, Portland, OR 97239 (United States); Tackett, Alan J. [Department of Biochemistry, College of Medicine, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Hauer-Jensen, Martin [Division of Radiation Health, Department of Pharmaceutical Sciences, College of Pharmacy, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nelson, Gregory A. [Department of Basic Sciences, Division of Radiation Research, Loma Linda University, Loma Linda, CA 92350 (United States); and others

    2016-10-15

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.

  13. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

    International Nuclear Information System (INIS)

    Prior, Sara; Miousse, Isabelle R.; Nzabarushimana, Etienne; Pathak, Rupak; Skinner, Charles; Kutanzi, Kristy R.; Allen, Antiño R.; Raber, Jacob; Tackett, Alan J.; Hauer-Jensen, Martin; Nelson, Gregory A.

    2016-01-01

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promoter type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.

  14. Hda-mediated inactivation of the DnaA protein and dnaA gene autoregulation act in concert to ensure homeostatic maintenance of the Escherichia coli chromosome.

    Science.gov (United States)

    Riber, Leise; Olsson, Jan A; Jensen, Rasmus B; Skovgaard, Ole; Dasgupta, Santanu; Marinus, Martin G; Løbner-Olesen, Anders

    2006-08-01

    Initiation of DNA replication in Eschericia coli requires the ATP-bound form of the DnaA protein. The conversion of DnaA-ATP to DnaA-ADP is facilitated by a complex of DnaA, Hda (homologous to DnaA), and DNA-loaded beta-clamp proteins in a process termed RIDA (regulatory inactivation of DnaA). Hda-deficient cells initiate replication at each origin mainly once per cell cycle, and the rare reinitiation events never coincide with the end of the origin sequestration period. Therefore, RIDA is not the predominant mechanism to prevent immediate reinitiation from oriC. The cellular level of Hda correlated directly with dnaA gene expression such that Hda deficiency led to reduced dnaA gene expression, and overproduction of Hda led to DnaA overproduction. Hda-deficient cells were very sensitive to variations in the cellular level of DnaA, and DnaA overproduction led to uncontrolled initiation of replication from oriC, causing severe growth retardation or cell death. Based on these observations, we propose that both RIDA and dnaA gene autoregulation are required as homeostatic mechanisms to ensure that initiation of replication occurs at the same time relative to cell mass in each cell cycle.

  15. Effect of ionizing radiation on DNA-mediated gene transfer efficiency

    International Nuclear Information System (INIS)

    Rubin, J.S.; Hall, E.J.; Hei, T.K.

    1986-01-01

    Ionizing radiation causes a number of molecular changes in cells including DNA damage and gene amplification. In this study the authors examined whether radiation can effect the efficiency of integration and expression of exogenous DNA sequences. They examined both 137 Cs γ rays and various monoenergetic neutron beams. This enabled them to test whether the LET or RBE of the radiation had any effect. Rat2 cells were transfected with various amounts of the bacterial plasmid pSV2-GPT along with carrier DNA for 24 hours

  16. The FRIABLE1 gene product affects cell adhesion in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lutz Neumetzler

    Full Text Available Cell adhesion in plants is mediated predominantly by pectins, a group of complex cell wall associated polysaccharides. An Arabidopsis mutant, friable1 (frb1, was identified through a screen of T-DNA insertion lines that exhibited defective cell adhesion. Interestingly, the frb1 plants displayed both cell and organ dissociations and also ectopic defects in organ separation. The FRB1 gene encodes a Golgi-localized, plant specific protein with only weak sequence similarities to known proteins (DUF246. Unlike other cell adhesion deficient mutants, frb1 mutants do not have reduced levels of adhesion related cell wall polymers, such as pectins. Instead, FRB1 affects the abundance of galactose- and arabinose-containing oligosaccharides in the Golgi. Furthermore, frb1 mutants displayed alteration in pectin methylesterification, cell wall associated extensins and xyloglucan microstructure. We propose that abnormal FRB1 action has pleiotropic consequences on wall architecture, affecting both the extensin and pectin matrices, with consequent changes to the biomechanical properties of the wall and middle lamella, thereby influencing cell-cell adhesion.

  17. A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1

    International Nuclear Information System (INIS)

    Sebastian, J.; Sancar, G.B.

    1991-01-01

    The PHR1 gene of Saccharomyces cerevisiae encodes the DNA repair enzyme photolyase. Transcription of PHR1 increases in response to treatment of cells with 254-nm radiation and chemical agents that damage DNA. The authors here the identification of a damage-responsive DNA binding protein, termed photolyase regulatory protein (PRP), and its cognate binding site, termed the PHR1 transcription after DNA damage. PRP activity, monitored by electrophoretic-mobility-shift assay, was detected in cells during normal growth but disappeared within 30 min after irradiation. Copper-phenanthroline footprinting of PRP-DNA complexes revealed that PRP protects a 39-base-pair region of PHR1 5' flanking sequence beginning 40 base pairs upstream from the coding sequence. Thus these observations establish that PRP is a damage-responsive repressor of PHR1 transcription

  18. Glycoprotein is enough for sindbis virus-derived DNA vector to express heterogenous genes

    Directory of Open Access Journals (Sweden)

    Fu Juanjuan

    2011-07-01

    Full Text Available Abstract To investigate the necessity and potential application of structural genes for expressing heterogenous genes from Sindbis virus-derived vector, the DNA-based expression vector pVaXJ was constructed by placing the recombinant genome of sindbis-like virus XJ-160 under the control of the human cytomegalovirus (CMV promoter of the plasmid pVAX1, in which viral structural genes were replaced by a polylinker cassette to allow for insertion of heterologous genes. The defect helper plasmids pVaE or pVaC were developed by cloning the gene of glycoprotein E3E26KE1 or capsid protein of XJ-160 virus into pVAX1, respectively. The report gene cassette pVaXJ-EGFP or pV-Gluc expressing enhanced green fluorescence protein (EGFP or Gaussia luciferase (G.luc were constructed by cloning EGFP or G.luc gene into pVaXJ. EGFP or G.luc was expressed in the BHK-21 cells co-transfected with report gene cassettes and pVaE at levels that were comparable to those produced by report gene cassettes, pVaC and pVaE and were much higher than the levels produced by report gene cassette and pVaC, suggesting that glycoprotein is enough for Sindbis virus-derived DNA vector to express heterogenous genes in host cells. The method of gene expression from Sindbis virus-based DNA vector only co-transfected with envelop E gene increase the conveniency and the utility of alphavirus-based vector systems in general.

  19. Horizontal gene transfer from macrophages to ischemic muscles upon delivery of naked DNA with Pluronic block copolymers.

    Science.gov (United States)

    Mahajan, Vivek; Gaymalov, Zagit; Alakhova, Daria; Gupta, Richa; Zucker, Irving H; Kabanov, Alexander V

    2016-01-01

    Intramuscular administration of plasmid DNA (pDNA) with non-ionic Pluronic block copolymers increases gene expression in injected muscles and lymphoid organs. We studied the role of immune cells in muscle transfection upon inflammation. Local inflammation in murine hind limb ischemia model (MHLIM) drastically increased DNA, RNA and expressed protein levels in ischemic muscles injected with pDNA/Pluronic. The systemic inflammation (MHLIM or peritonitis) also increased expression of pDNA/Pluronic in the muscles. When pDNA/Pluronic was injected in ischemic muscles the reporter gene, Green Fluorescent Protein (GFP) co-localized with desmin(+) muscle fibers and CD11b(+) macrophages (MØs), suggesting transfection of MØs along with the muscle cells. P85 enhanced (∼ 4 orders) transfection of MØs with pDNA in vitro. Moreover, adoptively transferred MØs were shown to pass the transgene to inflamed muscle cells in MHLIM. Using a co-culture of myotubes (MTs) and transfected MØs expressing a reporter gene under constitutive (cmv-luciferase) or muscle specific (desmin-luciferase) promoter we demonstrated that P85 enhances horizontal gene transfer from MØ to MTs. Therefore, MØs can play an important role in muscle transfection with pDNA/Pluronic during inflammation, with both inflammation and Pluronic contributing to the increased gene expression. pDNA/Pluronic has potential for therapeutic gene delivery in muscle pathologies that involve inflammation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Cloning and characterization of human DNA repair genes

    International Nuclear Information System (INIS)

    Thompson, L.H.; Brookman, K.W.; Weber, C.A.; Salazar, E.P.; Stewart, S.A.; Carrano, A.V.

    1987-01-01

    The isolation of two addition human genes that give efficient restoration of the repair defects in other CHO mutant lines is reported. The gene designated ERCC2 (Excision Repair Complementing Chinese hamster) corrects mutant UV5 from complementation group 1. They recently cloned this gene by first constructing a secondary transformant in which the human gene was shown to have become physically linked to the bacterial gpt dominant-marker gene by cotransfer in calcium phosphate precipitates in the primary transfection. Transformants expressing both genes were recovered by selecting for resistance to both UV radiation and mycophenolic acid. Using similar methods, the human gene that corrects CHO mutant EM9 was isolated in cosmids and named XRCC1 (X-ray Repair Complementing Chinese hamster). In this case, transformants were recovered by selecting for resistance to CldUrd, which kills EM9 very efficiently. In both genomic and cosmid transformants, the XRCC1 gene restored resistance to the normal range. DNA repair was studied using the kinetics of strand-break rejoining, which was measured after exposure to 137 Cs γ-rays

  1. Suppression of DNA-dependent protein kinase sensitize cells to radiation without affecting DSB repair

    International Nuclear Information System (INIS)

    Gustafsson, Ann-Sofie; Abramenkovs, Andris; Stenerlöw, Bo

    2014-01-01

    Highlights: • We reduced the level of DNA-PKcs with siRNA and examined cells after γ-irradiation. • Low DNA-PKcs levels lead to radiosensitivity but did not affect repair of DSB. • Low DNA-PKcs levels may block progression of mitosis. • DNA-PKcs role in mitotic progression is independent of its role in DSB repair. • We suggest different mechanisms by which loss of DNA-PKcs function sensitize cells. - Abstract: Efficient and correct repair of DNA double-strand break (DSB) is critical for cell survival. Defects in the DNA repair may lead to cell death, genomic instability and development of cancer. The catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is an essential component of the non-homologous end joining (NHEJ) which is the major DSB repair pathway in mammalian cells. In the present study, by using siRNA against DNA-PKcs in four human cell lines, we examined how low levels of DNA-PKcs affected cellular response to ionizing radiation. Decrease of DNA-PKcs levels by 80–95%, induced by siRNA treatment, lead to extreme radiosensitivity, similar to that seen in cells completely lacking DNA-PKcs and low levels of DNA-PKcs promoted cell accumulation in G2/M phase after irradiation and blocked progression of mitosis. Surprisingly, low levels of DNA-PKcs did not affect the repair capacity and the removal of 53BP1 or γ-H2AX foci and rejoining of DSB appeared normal. This was in strong contrast to cells completely lacking DNA-PKcs and cells treated with the DNA-PKcs inhibitor NU7441, in which DSB repair were severely compromised. This suggests that there are different mechanisms by which loss of DNA-PKcs functions can sensitize cells to ionizing radiation. Further, foci of phosphorylated DNA-PKcs (T2609 and S2056) co-localized with DSB and this was independent of the amount of DNA-PKcs but foci of DNA-PKcs was only seen in siRNA-treated cells. Our study emphasizes on the critical role of DNA-PKcs for maintaining survival after radiation exposure

  2. Suppression of DNA-dependent protein kinase sensitize cells to radiation without affecting DSB repair

    Energy Technology Data Exchange (ETDEWEB)

    Gustafsson, Ann-Sofie, E-mail: ann-sofie.gustafsson@bms.uu.se; Abramenkovs, Andris; Stenerlöw, Bo

    2014-11-15

    Highlights: • We reduced the level of DNA-PKcs with siRNA and examined cells after γ-irradiation. • Low DNA-PKcs levels lead to radiosensitivity but did not affect repair of DSB. • Low DNA-PKcs levels may block progression of mitosis. • DNA-PKcs role in mitotic progression is independent of its role in DSB repair. • We suggest different mechanisms by which loss of DNA-PKcs function sensitize cells. - Abstract: Efficient and correct repair of DNA double-strand break (DSB) is critical for cell survival. Defects in the DNA repair may lead to cell death, genomic instability and development of cancer. The catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is an essential component of the non-homologous end joining (NHEJ) which is the major DSB repair pathway in mammalian cells. In the present study, by using siRNA against DNA-PKcs in four human cell lines, we examined how low levels of DNA-PKcs affected cellular response to ionizing radiation. Decrease of DNA-PKcs levels by 80–95%, induced by siRNA treatment, lead to extreme radiosensitivity, similar to that seen in cells completely lacking DNA-PKcs and low levels of DNA-PKcs promoted cell accumulation in G2/M phase after irradiation and blocked progression of mitosis. Surprisingly, low levels of DNA-PKcs did not affect the repair capacity and the removal of 53BP1 or γ-H2AX foci and rejoining of DSB appeared normal. This was in strong contrast to cells completely lacking DNA-PKcs and cells treated with the DNA-PKcs inhibitor NU7441, in which DSB repair were severely compromised. This suggests that there are different mechanisms by which loss of DNA-PKcs functions can sensitize cells to ionizing radiation. Further, foci of phosphorylated DNA-PKcs (T2609 and S2056) co-localized with DSB and this was independent of the amount of DNA-PKcs but foci of DNA-PKcs was only seen in siRNA-treated cells. Our study emphasizes on the critical role of DNA-PKcs for maintaining survival after radiation exposure

  3. Sequence homology and expression profile of genes associated with dna repair pathways in Mycobacterium leprae

    Directory of Open Access Journals (Sweden)

    Mukul Sharma

    2017-01-01

    Full Text Available Background: Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. Methods: T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%, 11 hypothetical proteins (18%, and 14 pseudogenes (23%. All these genes have homologs in M. tuberculosis and 49 (80.32% in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. Results: It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA. The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes were analyzed using quantitative Polymerase Chain Reaction (qPCR assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the

  4. Homology of genes for exopolysaccharide synthesis in Rhizobium leguminosarum and effect of cloned exo genes on nodule formation

    International Nuclear Information System (INIS)

    Skorupska, A.; Derylo, M.

    1993-01-01

    A 5.4 kb BamHI fragment of Rhizobium leguminosarum (R.l.) bv. trifolii TA1 was found to carry genes involved in exopolysaccharide synthesis (exo genes). This fragment was strongly hybridized to the total DNA from DNA from R.l. bv. viciae and bv. phaseoli digested with EcoRI. No homology was found with total DNA of R. melilotic and Rhizobium sp. NGR 234. The exo genes R.l. bv. trifolii TA1 conjugally introduced into R.l. bv. viciae 1302 considerably affected the symbiosis: the nodules induced on vetch were abortive and did not fix nitrogen. On the other hand, Phaseolus beans infected with R.l. bv. trifolii exo genes formed the nitrogen-fixing nodules. It can be conduced that additional copies of exo genes introduced into wild type R.l. strains can disturb the synthesis of acidic exopolysaccharides and affect symbiosis of the plants forming indeterminate nodules, but do not affect symbiosis of the plants forming the determinate nodules. (author). 29 refs, 2 figs, 2 tabs

  5. Silencing of PINK1 expression affects mitochondrial DNA and oxidative phosphorylation in dopaminergic cells.

    Directory of Open Access Journals (Sweden)

    Matthew E Gegg

    Full Text Available Mitochondrial dysfunction has been implicated in the pathogenesis of Parkinson's disease (PD. Impairment of the mitochondrial electron transport chain (ETC and an increased frequency in deletions of mitochondrial DNA (mtDNA, which encodes some of the subunits of the ETC, have been reported in the substantia nigra of PD brains. The identification of mutations in the PINK1 gene, which cause an autosomal recessive form of PD, has supported mitochondrial involvement in PD. The PINK1 protein is a serine/threonine kinase localized in mitochondria and the cytosol. Its precise function is unknown, but it is involved in neuroprotection against a variety of stress signalling pathways.In this report we have investigated the effect of silencing PINK1 expression in human dopaminergic SH-SY5Y cells by siRNA on mtDNA synthesis and ETC function. Loss of PINK1 expression resulted in a decrease in mtDNA levels and mtDNA synthesis. We also report a concomitant loss of mitochondrial membrane potential and decreased mitochondrial ATP synthesis, with the activity of complex IV of the ETC most affected. This mitochondrial dysfunction resulted in increased markers of oxidative stress under basal conditions and increased cell death following treatment with the free radical generator paraquat.This report highlights a novel function of PINK1 in mitochondrial biogenesis and a role in maintaining mitochondrial ETC activity. Dysfunction of both has been implicated in sporadic forms of PD suggesting that these may be key pathways in the development of the disease.

  6. MOLECULAR CLONING OF OVINE cDNA LEPTIN GENE

    Directory of Open Access Journals (Sweden)

    CLAUDIA TEREZIA SOCOL

    2008-05-01

    Full Text Available An efficient bacterial transformation system suitable for cloning the coding sequence of the ovine leptin gene in E. coli DH5α host cells using the pGEMT easy vector it is described in this paper. The necessity of producing leptin is based on the fact that the role of this molecule in the animal and human organism is still unknown, leptin not existing as commercial product on the Romanian market. The results obtained in the bacterial transformation, cloning, recombinant clones selection, control of the insertion experiments and DNA computational analysis represent the first steps in further genetic engineering experiments such as production of DNA libraries, DNA sequencing, protein expression, etc., for a further contribution in elucidating the role of leptin in the animal and human organism.

  7. Optimal control of gene mutation in DNA replication.

    Science.gov (United States)

    Yu, Juanyi; Li, Jr-Shin; Tarn, Tzyh-Jong

    2012-01-01

    We propose a molecular-level control system view of the gene mutations in DNA replication from the finite field concept. By treating DNA sequences as state variables, chemical mutagens and radiation as control inputs, one cell cycle as a step increment, and the measurements of the resulting DNA sequence as outputs, we derive system equations for both deterministic and stochastic discrete-time, finite-state systems of different scales. Defining the cost function as a summation of the costs of applying mutagens and the off-trajectory penalty, we solve the deterministic and stochastic optimal control problems by dynamic programming algorithm. In addition, given that the system is completely controllable, we find that the global optimum of both base-to-base and codon-to-codon deterministic mutations can always be achieved within a finite number of steps.

  8. The majority of inducible DNA repair genes in Mycobacterium tuberculosis are induced independently of RecA.

    Science.gov (United States)

    Rand, Lucinda; Hinds, Jason; Springer, Burkhard; Sander, Peter; Buxton, Roger S; Davis, Elaine O

    2003-11-01

    In many species of bacteria most inducible DNA repair genes are regulated by LexA homologues and are dependent on RecA for induction. We have shown previously by analysing the induction of recA that two mechanisms for the induction of gene expression following DNA damage exist in Mycobacterium tuberculosis. Whereas one of these depends on RecA and LexA in the classical way, the other mechanism is independent of both of these proteins and induction occurs in the absence of RecA. Here we investigate the generality of each of these mechanisms by analysing the global response to DNA damage in both wild-type M. tuberculosis and a recA deletion strain of M. tuberculosis using microarrays. This revealed that the majority of the genes that were induced remained inducible in the recA mutant stain. Of particular note most of the inducible genes with known or predicted functions in DNA repair did not depend on recA for induction. Amongst these are genes involved in nucleotide excision repair, base excision repair, damage reversal and recombination. Thus, it appears that this novel mechanism of gene regulation is important for DNA repair in M. tuberculosis.

  9. Genome-wide DNA methylation profiles reveal novel candidate genes associated with meat quality at different age stages in hens.

    Science.gov (United States)

    Zhang, Meng; Yan, Feng-Bin; Li, Fang; Jiang, Ke-Ren; Li, Dong-Hua; Han, Rui-Li; Li, Zhuan-Jan; Jiang, Rui-Rui; Liu, Xiao-Jun; Kang, Xiang-Tao; Sun, Gui-Rong

    2017-04-05

    Poultry meat quality is associated with breed, age, tissue and other factors. Many previous studies have focused on distinct breeds; however, little is known regarding the epigenetic regulatory mechanisms in different age stages, such as DNA methylation. Here, we compared the global DNA methylation profiles between juvenile (20 weeks old) and later laying-period (55 weeks old) hens and identified candidate genes related to the development and meat quality of breast muscle using whole-genome bisulfite sequencing. The results showed that the later laying-period hens, which had a higher intramuscular fat (IMF) deposition capacity and water holding capacity (WHC) and less tenderness, exhibited higher global DNA methylation levels than the juvenile hens. A total of 2,714 differentially methylated regions were identified in the present study, which corresponded to 378 differentially methylated genes, mainly affecting muscle development, lipid metabolism, and the ageing process. Hypermethylation of the promoters of the genes ABCA1, COL6A1 and GSTT1L and the resulting transcriptional down-regulation in the later laying-period hens may be the reason for the significant difference in the meat quality between the juvenile and later laying-period hens. These findings contribute to a better understanding of epigenetic regulation in the skeletal muscle development and meat quality of chicken.

  10. DNA polymorphism of HLA class II genes in primary biliary cirrhosis

    DEFF Research Database (Denmark)

    Morling, Niels; Dalhoff, K; Fugger, L

    1992-01-01

    We investigated the DNA restriction fragment length polymorphism of the major histocompatibility complex class II genes: HLA-DRB, -DQA, -DQB, DPA, -DPB, the serologically defined HLA-A, B, C, DR antigens, and the primed lymphocyte typing defined HLA-DP antigens in 23 Danish patients with primary...... than 0.05, 'corrected' P greater than 0.05). No DNA fragments specific for DRB1*0301 (DR3) could be identified. The frequencies in PBC of other genetic markers including DRw8, DRB1*08, HLA-DP antigens, DPA, and DPB genes did not differ significantly from those in controls. The associations between PBC...

  11. Multiple and variable NHEJ-like genes are involved in resistance to DNA damage in Streptomyces ambofaciens

    Directory of Open Access Journals (Sweden)

    Grégory Hoff

    2016-11-01

    Full Text Available Non homologous end-joining (NHEJ is a double strand break (DSB repair pathway which does not require any homologous template and can ligate two DNA ends together. The basic bacterial NHEJ machinery involves two partners: the Ku protein, a DNA end binding protein for DSB recognition and the multifunctional LigD protein composed a ligase, a nuclease and a polymerase domain, for end processing and ligation of the broken ends. In silico analyses performed in the 38 sequenced genomes of Streptomyces species revealed the existence of a large panel of NHEJ-like genes. Indeed, ku genes or ligD domain homologues are scattered throughout the genome in multiple copies and can be distinguished in two categories: the core NHEJ gene set constituted of conserved loci and the variable NHEJ gene set constituted of NHEJ-like genes present in only a part of the species. In Streptomyces ambofaciens ATCC 23877, not only the deletion of core genes but also that of variable genes led to an increased sensitivity to DNA damage induced by electron beam irradiation. Multiple mutants of ku, ligase or polymerase encoding genes showed an aggravated phenotype compared to single mutants. Biochemical assays revealed the ability of Ku-like proteins to protect and to stimulate ligation of DNA ends. RT-qPCR and GFP fusion experiments suggested that ku-like genes show a growth phase dependent expression profile consistent with their involvement in DNA repair during spores formation and/or germination.

  12. Role of gene 59 of bacteriophage T4 in repair of uv-irradiated and alkylated DNA in vivo

    International Nuclear Information System (INIS)

    Wu, R.; Wu, J.L.; Yeh, Y.C.

    1975-01-01

    Nonsense mutants in gene 59 (amC5, am HL628) were used to study the role of this gene in the repair of uv-damaged and alkylated DNA of bacteriophage T4 in vivo. The higher sensitivity to uv irradiation and alkylation of gene 59 mutants after exposure to these agents was established by a comparison of the survival fractions with wild type. Zonal centrifugal analysis of both parental and nascent mutant intracellular DNA molecules after uv irradiation showed that immediately after exposure the size of single-stranded DNA fragments was the same as the wild-type intracellular DNA. However, the capability of rejoining fragmented intracellular DNA was greatly reduced in the mutant. In contrast, the wild-type-infected cells under the same condition resumed DNA replication and repaired its DNA to normal size. Methyl methanesulfonate induced more randomly fragmented intracellular DNA, when compared to uv irradiation. The rate of rejoining under these conditions as judged from their sedimentation profiles was also greatly reduced in mutant-infected cells. Further evidence is presented that uv repair is not a simple consequence of arrested DNA replication, which is a phenotype of the mutant when infected in a nonpermissive host, Escherichia coli B(su - ), but rather that the DNA repair function of gene 59 is independent of the replication function. These and other data presented indicate that a product(s) of gene 59 is essential for both repair of uv lesions and repair of alkylation damage of DNA in vivo. It is suggested that gene 59 may have two functions during viral development: DNA replication and replication repair of DNA molecules

  13. Roles of genes and Alu repeats in nonlinear correlations of HUMHBB DNA sequence

    International Nuclear Information System (INIS)

    Xiao Yi; Huang Yanzhao

    2004-01-01

    DNA sequences of different species and different portion of the DNA of the same species may have completely different correlation properties, but the origin of these correlations is still not very clear and is currently being investigated, especially in different particular cases. We report here a study of the DNA sequence of human beta globin region (HUMHBB) which has strong linear and nonlinear correlations. We studied the roles of two of the typical elements of DNA sequence, genes and Alu repeats, in the nonlinear correlations of HUMHBB. We find that there exist strong nonlinear correlations between the exons or introns in different genes and between the Alu repeats. They may be one of the major sources of the nonlinear correlations in HUMBHB

  14. Novel PVA-DNA nanoparticles prepared by ultra high pressure technology for gene delivery

    International Nuclear Information System (INIS)

    Kimura, Tsuyoshi; Okuno, Akira; Miyazaki, Kozo; Furuzono, Tsutomu; Ohya, Yuichi; Ouchi, Tatsuro; Mutsuo, Shingo; Yoshizawa, Hidekazu; Kitamura, Yoshiro; Fujisato, Toshiyta; Kishida, Akio

    2004-01-01

    Polyvinyl alcohol (PVA)-DNA nanoparticles have been developed by ultra high pressure (UHP) technology. Mixture solutions of DNA and PVA having various molecular weights (Mw) and degree of saponifications (DS) were treated under 10,000 atmospheres (981 MPa) condition at 40 deg. C for 10 min. Agarose gel electrophoresis and scanning electron microscope observation revealed that the PVA-DNA nanoparticles with average diameter of about 200 nm were formed. Using PVA of higher Mw and degree of saponifications, the amount of nanoparticles formed increased. The driving force of nanoparticle formation was the hydrogen bonding between DNA and PVA. In order to apply the PVA-DNA nanoparticles for gene delivery, the cytotoxicity and the cellular uptake of them were investigated using Raw264 cell lines. The cell viability was not influenced whether the presence of the PVA-DNA nanoparticles. Further, the nanoparticles internalized into cells were observed by fluorescent microscope. These results indicates that the PVA-DNA nanoparticles prepared by UHP technology showed be useful as drug carrier, especially for gene delivery

  15. Triple negative breast cancers have a reduced expression of DNA repair genes.

    Directory of Open Access Journals (Sweden)

    Enilze Ribeiro

    Full Text Available DNA repair is a key determinant in the cellular response to therapy and tumor repair status could play an important role in tailoring patient therapy. Our goal was to evaluate the mRNA of 13 genes involved in different DNA repair pathways (base excision, nucleotide excision, homologous recombination, and Fanconi anemia in paraffin embedded samples of triple negative breast cancer (TNBC compared to luminal A breast cancer (LABC. Most of the genes involved in nucleotide excision repair and Fanconi Anemia pathways, and CHK1 gene were significantly less expressed in TNBC than in LABC. PARP1 levels were higher in TNBC than in LABC. In univariate analysis high level of FANCA correlated with an increased overall survival and event free survival in TNBC; however multivariate analyses using Cox regression did not confirm FANCA as independent prognostic factor. These data support the evidence that TNBCs compared to LABCs harbour DNA repair defects.

  16. DNA entropy reveals a significant difference in complexity between housekeeping and tissue specific gene promoters.

    Science.gov (United States)

    Thomas, David; Finan, Chris; Newport, Melanie J; Jones, Susan

    2015-10-01

    The complexity of DNA can be quantified using estimates of entropy. Variation in DNA complexity is expected between the promoters of genes with different transcriptional mechanisms; namely housekeeping (HK) and tissue specific (TS). The former are transcribed constitutively to maintain general cellular functions, and the latter are transcribed in restricted tissue and cells types for specific molecular events. It is known that promoter features in the human genome are related to tissue specificity, but this has been difficult to quantify on a genomic scale. If entropy effectively quantifies DNA complexity, calculating the entropies of HK and TS gene promoters as profiles may reveal significant differences. Entropy profiles were calculated for a total dataset of 12,003 human gene promoters and for 501 housekeeping (HK) and 587 tissue specific (TS) human gene promoters. The mean profiles show the TS promoters have a significantly lower entropy (pentropy distributions for the 3 datasets show that promoter entropies could be used to identify novel HK genes. Functional features comprise DNA sequence patterns that are non-random and hence they have lower entropies. The lower entropy of TS gene promoters can be explained by a higher density of positive and negative regulatory elements, required for genes with complex spatial and temporary expression. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Regulation of UGT1A1 and HNF1 transcription factor gene expression by DNA methylation in colon cancer cells

    Directory of Open Access Journals (Sweden)

    Harvey Mario

    2010-01-01

    Full Text Available Abstract Background UDP-glucuronosyltransferase 1A1 (UGT1A1 is a pivotal enzyme involved in metabolism of SN-38, the active metabolite of irinotecan commonly used to treat metastatic colorectal cancer. We previously demonstrated aberrant methylation of specific CpG dinucleotides in UGT1A1-negative cells, and revealed that methylation state of the UGT1A1 5'-flanking sequence is negatively correlated with gene transcription. Interestingly, one of these CpG dinucleotides (CpG -4 is found close to a HNF1 response element (HRE, known to be involved in activation of UGT1A1 gene expression, and within an upstream stimulating factor (USF binding site. Results Gel retardation assays revealed that methylation of CpG-4 directly affect the interaction of USF1/2 with its cognate sequence without altering the binding for HNF1-alpha. Luciferase assays sustained a role for USF1/2 and HNF1-alpha in UGT1A1 regulation in colon cancer cells. Based on the differential expression profiles of HNF1A gene in colon cell lines, we also assessed whether methylation affects its expression. In agreement with the presence of CpG islands in the HNF1A promoter, treatments of UGT1A1-negative HCT116 colon cancer cells with a DNA methyltransferase inhibitor restore HNF1A gene expression, as observed for UGT1A1. Conclusions This study reveals that basal UGT1A1 expression in colon cells is positively regulated by HNF1-alpha and USF, and negatively regulated by DNA methylation. Besides, DNA methylation of HNF1A could also play an important role in regulating additional cellular drug metabolism and transporter pathways. This process may contribute to determine local inactivation of drugs such as the anticancer agent SN-38 by glucuronidation and define tumoral response.

  18. Comparative analysis of DNA nanoparticles and AAVs for ocular gene delivery.

    Directory of Open Access Journals (Sweden)

    Zongchao Han

    Full Text Available Gene therapy is a critical tool for the treatment of monogenic retinal diseases. However, the limited vector capacity of the current benchmark delivery strategy, adeno-associated virus (AAV, makes development of larger capacity alternatives, such as compacted DNA nanoparticles (NPs, critical. Here we conduct a side-by-side comparison of self-complementary AAV and CK30PEG NPs using matched ITR plasmids. We report that although AAVs are more efficient per vector genome (vg than NPs, NPs can drive gene expression on a comparable scale and longevity to AAV. We show that subretinally injected NPs do not leave the eye while some of the AAV-injected animals exhibited vector DNA and GFP expression in the visual pathways of the brain from PI-60 onward. As a result, these NPs have the potential to become a successful alternative for ocular gene therapy, especially for the multitude of genes too large for AAV vectors.

  19. Functional role of DNA mismatch repair gene PMS2 in prostate cancer cells.

    Science.gov (United States)

    Fukuhara, Shinichiro; Chang, Inik; Mitsui, Yozo; Chiyomaru, Takeshi; Yamamura, Soichiro; Majid, Shahana; Saini, Sharanjot; Deng, Guoren; Gill, Ankurpreet; Wong, Darryn K; Shiina, Hiroaki; Nonomura, Norio; Lau, Yun-Fai C; Dahiya, Rajvir; Tanaka, Yuichiro

    2015-06-30

    DNA mismatch repair (MMR) enzymes act as proofreading complexes that maintains genomic integrity and MMR-deficient cells show an increased mutation rate. MMR has also been shown to influence cell signaling and the regulation of tumor development. MMR consists of various genes and includes post-meiotic segregation (PMS) 2 which is a vital component of mutL-alpha. In prostate, the functional role of this gene has never been reported and in this study, our aim was to investigate the effect of PMS2 on growth properties of prostate cancer (PCa) cells. Previous studies have shown PMS2 to be deficient in DU145 cells and this lack of expression was confirmed by Western blotting whereas normal prostatic PWR-1E and RWPE-1 cells expressed this gene. PMS2 effects on various growth properties of DU145 were then determined by creating stable gene transfectants. Interestingly, PMS2 caused decreased cell proliferation, migration, invasion, and in vivo growth; and increased apoptosis as compared to vector control. We further analyzed genes affected by PMS2 expression and observe the apoptosis-related TMS1 gene to be significantly upregulated whereas anti-apoptotic BCL2A1 was downregulated. These results demonstrate a functional role for PMS2 to protect against PCa progression by enhancing apoptosis of PCa cells.

  20. Correlation of SHOX2 Gene Amplification and DNA Methylation in Lung Cancer Tumors

    International Nuclear Information System (INIS)

    Schneider, Katja U; Liebenberg, Volker; Kneip, Christoph; Seegebarth, Anke; Erdogan, Fikret; Rappold, Gudrun; Schmidt, Bernd; Dietrich, Dimo; Fleischhacker, Michael; Leschber, Gunda; Merk, Johannes; Schäper, Frank; Stapert, Henk R; Vossenaar, Erik R; Weickmann, Sabine

    2011-01-01

    DNA methylation in the SHOX2 locus was previously used to reliably detect lung cancer in a group of critical controls, including 'cytologically negative' samples with no visible tumor cell content, at a high specificity based on the analysis of bronchial lavage samples. This study aimed to investigate, if the methylation correlates with SHOX2 gene expression and/or copy number alterations. An amplification of the SHOX2 gene locus together with the observed tumor-specific hypermethylation might explain the good performance of this marker in bronchial lavage samples. SHOX2 expression, gene copy number and DNA methylation were determined in lung tumor tissues and matched morphologically normal adjacent tissues (NAT) from 55 lung cancer patients. Quantitative HeavyMethyl (HM) real-time PCR was used to detect SHOX2 DNA methylation levels. SHOX2 expression was assayed with quantitative real-time PCR, and copy numbers alterations were measured with conventional real-time PCR and array CGH. A hypermethylation of the SHOX2 locus in tumor tissue as compared to the matched NAT from the same patient was detected in 96% of tumors from a group of 55 lung cancer patients. This correlated highly significantly with the frequent occurrence of copy number amplification (p < 0.0001), while the expression of the SHOX2 gene showed no difference. Frequent gene amplification correlated with hypermethylation of the SHOX2 gene locus. This concerted effect qualifies SHOX2 DNA methylation as a biomarker for lung cancer diagnosis, especially when sensitive detection is needed, i.e. in bronchial lavage or blood samples

  1. Mitochondrial DNA depletion syndrome due to mutations in the RRM2B gene.

    Science.gov (United States)

    Bornstein, Belén; Area, Estela; Flanigan, Kevin M; Ganesh, Jaya; Jayakar, Parul; Swoboda, Kathryn J; Coku, Jorida; Naini, Ali; Shanske, Sara; Tanji, Kurenai; Hirano, Michio; DiMauro, Salvatore

    2008-06-01

    Mitochondrial DNA depletion syndrome (MDS) is characterized by a reduction in mtDNA copy number and has been associated with mutations in eight nuclear genes, including enzymes involved in mitochondrial nucleotide metabolism (POLG, TK2, DGUOK, SUCLA2, SUCLG1, PEO1) and MPV17. Recently, mutations in the RRM2B gene, encoding the p53-controlled ribonucleotide reductase subunit, have been described in seven infants from four families, who presented with various combinations of hypotonia, tubulopathy, seizures, respiratory distress, diarrhea, and lactic acidosis. All children died before 4 months of age. We sequenced the RRM2B gene in three unrelated cases with unexplained severe mtDNA depletion. The first patient developed intractable diarrhea, profound weakness, respiratory distress, and died at 3 months. The other two unrelated patients had a much milder phenotype and are still alive at ages 27 and 36 months. All three patients had lactic acidosis and severe depletion of mtDNA in muscle. Muscle histochemistry showed RRF and COX deficiency. Sequencing the RRM2B gene revealed three missense mutations and two single nucleotide deletions in exons 6, 8, and 9, confirming that RRM2B mutations are important causes of MDS and that the clinical phenotype is heterogeneous and not invariably fatal in infancy.

  2. Patterns of prokaryotic lateral gene transfers affecting parasitic microbial eukaryotes

    DEFF Research Database (Denmark)

    Alsmark, Cecilia; Foster, Peter G; Sicheritz-Pontén, Thomas

    2013-01-01

    BACKGROUND: The influence of lateral gene transfer on gene origins and biology in eukaryotes is poorly understood compared with those of prokaryotes. A number of independent investigations focusing on specific genes, individual genomes, or specific functional categories from various eukaryotes have...... approach to systematically investigate lateral gene transfer affecting the proteomes of thirteen, mainly parasitic, microbial eukaryotes, representing four of the six eukaryotic super-groups. All of the genomes investigated have been significantly affected by prokaryote-to-eukaryote lateral gene transfers...... indicated that lateral gene transfer does indeed affect eukaryotic genomes. However, the lack of common methodology and criteria in these studies makes it difficult to assess the general importance and influence of lateral gene transfer on eukaryotic genome evolution. RESULTS: We used a phylogenomic...

  3. Comprehensive Pathway-Based Association Study of DNA Repair Gene Variants and the Risk of Nasopharyngeal Carcinoma

    Science.gov (United States)

    Qin, Hai-De; Shugart, Yin Yao; Bei, Jin-Xin; Pan, Qing-Hua; Chen, Lina; Feng, Qi-Sheng; Chen, Li-Zhen; Huang, Wei; Liu, Jian Jun; Jorgensen, Timothy J.; Zeng, Yi-Xin; Jia, Wei-Hua

    2011-01-01

    DNA repair plays a central role in protecting against environmental carcinogenesis, and genetic variants of DNA repair genes have been reported to be associated with several human malignancies. To assess whether DNA gene variants were associated with nasopharyngeal carcinoma (NPC) risk, a candidate gene association study was conducted among the Cantonese population within the Guangdong Province, China --the ethnic group with the highest risk for NPC. A two-stage study design was utilized. In the discovery stage, 676 tagging SNPs covering 88 DNA repair genes were genotyped in a matched case-control study (cases/controls = 755/755). Eleven SNPs with Ptrend Cantonese population (cases/controls = 1,568/1,297). Two of the SNPs (rs927220 and rs11158728) – both in RAD51L1 – remained strongly associated with NPC. The SNP rs927220 had a significant Pcombined of 5.55 × 10−5, with OR = 1.20 (95%CI = 1.10 to 1.30), Bonferroni corrected P = 0.0381. The other SNP (rs11158728), which is in strong LD with rs927220 (r2 = 0.7), had a significant Pcombined of 2.0 × 10−4, Bonferroni corrected P = 0.1372. Gene-environment interaction analysis suggested that the exposures of salted-fish consumption and cigarette smoking had potential interactions with DNA repair gene variations, but need to be further investigated. Our findings support the notion that DNA repair genes, in particular RAD51L1, play a role in NPC etiology and development. PMID:21368091

  4. Potential efficacy of mitochondrial genes for animal DNA barcoding: a case study using eutherian mammals.

    Science.gov (United States)

    Luo, Arong; Zhang, Aibing; Ho, Simon Yw; Xu, Weijun; Zhang, Yanzhou; Shi, Weifeng; Cameron, Stephen L; Zhu, Chaodong

    2011-01-28

    A well-informed choice of genetic locus is central to the efficacy of DNA barcoding. Current DNA barcoding in animals involves the use of the 5' half of the mitochondrial cytochrome oxidase 1 gene (CO1) to diagnose and delimit species. However, there is no compelling a priori reason for the exclusive focus on this region, and it has been shown that it performs poorly for certain animal groups. To explore alternative mitochondrial barcoding regions, we compared the efficacy of the universal CO1 barcoding region with the other mitochondrial protein-coding genes in eutherian mammals. Four criteria were used for this comparison: the number of recovered species, sequence variability within and between species, resolution to taxonomic levels above that of species, and the degree of mutational saturation. Based on 1,179 mitochondrial genomes of eutherians, we found that the universal CO1 barcoding region is a good representative of mitochondrial genes as a whole because the high species-recovery rate (> 90%) was similar to that of other mitochondrial genes, and there were no significant differences in intra- or interspecific variability among genes. However, an overlap between intra- and interspecific variability was still problematic for all mitochondrial genes. Our results also demonstrated that any choice of mitochondrial gene for DNA barcoding failed to offer significant resolution at higher taxonomic levels. We suggest that the CO1 barcoding region, the universal DNA barcode, is preferred among the mitochondrial protein-coding genes as a molecular diagnostic at least for eutherian species identification. Nevertheless, DNA barcoding with this marker may still be problematic for certain eutherian taxa and our approach can be used to test potential barcoding loci for such groups.

  5. DNA polymorphism of HLA class II genes in pauciarticular juvenile rheumatoid arthritis

    DEFF Research Database (Denmark)

    Morling, N; Friis, J; Fugger, L

    1991-01-01

    We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) class II genes: HLA-DRB, -DQA, -DQB, DPA, and -DPB in 54 patients with pauciarticular juvenile rheumatoid arthritis (PJRA) and in healthy Danes. The frequencies of DNA fragments a...

  6. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  7. In vitro analysis of integrated global high-resolution DNA methylation profiling with genomic imbalance and gene expression in osteosarcoma.

    Directory of Open Access Journals (Sweden)

    Bekim Sadikovic

    Full Text Available Genetic and epigenetic changes contribute to deregulation of gene expression and development of human cancer. Changes in DNA methylation are key epigenetic factors regulating gene expression and genomic stability. Recent progress in microarray technologies resulted in developments of high resolution platforms for profiling of genetic, epigenetic and gene expression changes. OS is a pediatric bone tumor with characteristically high level of numerical and structural chromosomal changes. Furthermore, little is known about DNA methylation changes in OS. Our objective was to develop an integrative approach for analysis of high-resolution epigenomic, genomic, and gene expression profiles in order to identify functional epi/genomic differences between OS cell lines and normal human osteoblasts. A combination of Affymetrix Promoter Tilling Arrays for DNA methylation, Agilent array-CGH platform for genomic imbalance and Affymetrix Gene 1.0 platform for gene expression analysis was used. As a result, an integrative high-resolution approach for interrogation of genome-wide tumour-specific changes in DNA methylation was developed. This approach was used to provide the first genomic DNA methylation maps, and to identify and validate genes with aberrant DNA methylation in OS cell lines. This first integrative analysis of global cancer-related changes in DNA methylation, genomic imbalance, and gene expression has provided comprehensive evidence of the cumulative roles of epigenetic and genetic mechanisms in deregulation of gene expression networks.

  8. TLR9 agonists oppositely modulate DNA repair genes in tumor versus immune cells and enhance chemotherapy effects.

    Science.gov (United States)

    Sommariva, Michele; De Cecco, Loris; De Cesare, Michelandrea; Sfondrini, Lucia; Ménard, Sylvie; Melani, Cecilia; Delia, Domenico; Zaffaroni, Nadia; Pratesi, Graziella; Uva, Valentina; Tagliabue, Elda; Balsari, Andrea

    2011-10-15

    Synthetic oligodeoxynucleotides expressing CpG motifs (CpG-ODN) are a Toll-like receptor 9 (TLR9) agonist that can enhance the antitumor activity of DNA-damaging chemotherapy and radiation therapy in preclinical mouse models. We hypothesized that the success of these combinations is related to the ability of CpG-ODN to modulate genes involved in DNA repair. We conducted an in silico analysis of genes implicated in DNA repair in data sets obtained from murine colon carcinoma cells in mice injected intratumorally with CpG-ODN and from splenocytes in mice treated intraperitoneally with CpG-ODN. CpG-ODN treatment caused downregulation of DNA repair genes in tumors. Microarray analyses of human IGROV-1 ovarian carcinoma xenografts in mice treated intraperitoneally with CpG-ODN confirmed in silico findings. When combined with the DNA-damaging drug cisplatin, CpG-ODN significantly increased the life span of mice compared with individual treatments. In contrast, CpG-ODN led to an upregulation of genes involved in DNA repair in immune cells. Cisplatin-treated patients with ovarian carcinoma as well as anthracycline-treated patients with breast cancer who are classified as "CpG-like" for the level of expression of CpG-ODN modulated DNA repair genes have a better outcome than patients classified as "CpG-untreated-like," indicating the relevance of these genes in the tumor cell response to DNA-damaging drugs. Taken together, the findings provide evidence that the tumor microenvironment can sensitize cancer cells to DNA-damaging chemotherapy, thereby expanding the benefits of CpG-ODN therapy beyond induction of a strong immune response.

  9. Candidate luminal B breast cancer genes identified by genome, gene expression and DNA methylation profiling.

    Directory of Open Access Journals (Sweden)

    Stéphanie Cornen

    Full Text Available Breast cancers (BCs of the luminal B subtype are estrogen receptor-positive (ER+, highly proliferative, resistant to standard therapies and have a poor prognosis. To better understand this subtype we compared DNA copy number aberrations (CNAs, DNA promoter methylation, gene expression profiles, and somatic mutations in nine selected genes, in 32 luminal B tumors with those observed in 156 BCs of the other molecular subtypes. Frequent CNAs included 8p11-p12 and 11q13.1-q13.2 amplifications, 7q11.22-q34, 8q21.12-q24.23, 12p12.3-p13.1, 12q13.11-q24.11, 14q21.1-q23.1, 17q11.1-q25.1, 20q11.23-q13.33 gains and 6q14.1-q24.2, 9p21.3-p24,3, 9q21.2, 18p11.31-p11.32 losses. A total of 237 and 101 luminal B-specific candidate oncogenes and tumor suppressor genes (TSGs presented a deregulated expression in relation with their CNAs, including 11 genes previously reported associated with endocrine resistance. Interestingly, 88% of the potential TSGs are located within chromosome arm 6q, and seven candidate oncogenes are potential therapeutic targets. A total of 100 candidate oncogenes were validated in a public series of 5,765 BCs and the overexpression of 67 of these was associated with poor survival in luminal tumors. Twenty-four genes presented a deregulated expression in relation with a high DNA methylation level. FOXO3, PIK3CA and TP53 were the most frequent mutated genes among the nine tested. In a meta-analysis of next-generation sequencing data in 875 BCs, KCNB2 mutations were associated with luminal B cases while candidate TSGs MDN1 (6q15 and UTRN (6q24, were mutated in this subtype. In conclusion, we have reported luminal B candidate genes that may play a role in the development and/or hormone resistance of this aggressive subtype.

  10. Fructose-Rich Diet Affects Mitochondrial DNA Damage and Repair in Rats.

    Science.gov (United States)

    Cioffi, Federica; Senese, Rosalba; Lasala, Pasquale; Ziello, Angela; Mazzoli, Arianna; Crescenzo, Raffaella; Liverini, Giovanna; Lanni, Antonia; Goglia, Fernando; Iossa, Susanna

    2017-03-24

    Evidence indicates that many forms of fructose-induced metabolic disturbance are associated with oxidative stress and mitochondrial dysfunction. Mitochondria are prominent targets of oxidative damage; however, it is not clear whether mitochondrial DNA (mtDNA) damage and/or its lack of repair are events involved in metabolic disease resulting from a fructose-rich diet. In the present study, we evaluated the degree of oxidative damage to liver mtDNA and its repair, in addition to the state of oxidative stress and antioxidant defense in the liver of rats fed a high-fructose diet. We used male rats feeding on a high-fructose or control diet for eight weeks. Our results showed an increase in mtDNA damage in the liver of rats fed a high-fructose diet and this damage, as evaluated by the expression of DNA polymerase γ, was not repaired; in addition, the mtDNA copy number was found to be significantly reduced. A reduction in the mtDNA copy number is indicative of impaired mitochondrial biogenesis, as is the finding of a reduction in the expression of genes involved in mitochondrial biogenesis. In conclusion, a fructose-rich diet leads to mitochondrial and mtDNA damage, which consequently may have a role in liver dysfunction and metabolic diseases.

  11. Folate deficiency facilitates recruitment of upstream binding factor to hot spots of DNA double-strand breaks of rRNA genes and promotes its transcription.

    Science.gov (United States)

    Xie, Qiu; Li, Caihua; Song, Xiaozhen; Wu, Lihua; Jiang, Qian; Qiu, Zhiyong; Cao, Haiyan; Yu, Kaihui; Wan, Chunlei; Li, Jianting; Yang, Feng; Huang, Zebing; Niu, Bo; Jiang, Zhengwen; Zhang, Ting

    2017-03-17

    The biogenesis of ribosomes in vivo is an essential process for cellular functions. Transcription of ribosomal RNA (rRNA) genes is the rate-limiting step in ribosome biogenesis controlled by environmental conditions. Here, we investigated the role of folate antagonist on changes of DNA double-strand breaks (DSBs) landscape in mouse embryonic stem cells. A significant DSB enhancement was detected in the genome of these cells and a large majority of these DSBs were found in rRNA genes. Furthermore, spontaneous DSBs in cells under folate deficiency conditions were located exclusively within the rRNA gene units, representing a H3K4me1 hallmark. Enrichment H3K4me1 at the hot spots of DSB regions enhanced the recruitment of upstream binding factor (UBF) to rRNA genes, resulting in the increment of rRNA genes transcription. Supplement of folate resulted in a restored UBF binding across DNA breakage sites of rRNA genes, and normal rRNA gene transcription. In samples from neural tube defects (NTDs) with low folate level, up-regulation of rRNA gene transcription was observed, along with aberrant UBF level. Our results present a new view by which alterations in folate levels affects DNA breakage through epigenetic control leading to the regulation of rRNA gene transcription during the early stage of development. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    Science.gov (United States)

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  13. The co-repressor SMRT delays DNA damage-induced caspase activation by repressing pro-apoptotic genes and modulating the dynamics of checkpoint kinase 2 activation.

    Directory of Open Access Journals (Sweden)

    Claudio Scafoglio

    Full Text Available Checkpoint kinase 2 (Chk2 is a major regulator of DNA damage response and can induce alternative cellular responses: cell cycle arrest and DNA repair or programmed cell death. Here, we report the identification of a new role of Chk2 in transcriptional regulation that also contributes to modulating the balance between survival and apoptosis following DNA damage. We found that Chk2 interacts with members of the NCoR/SMRT transcriptional co-regulator complexes and serves as a functional component of the repressor complex, being required for recruitment of SMRT on the promoter of pro-apoptotic genes upon DNA damage. Thus, the co-repressor SMRT exerts a critical protective action against genotoxic stress-induced caspase activation, repressing a functionally important cohort of pro-apoptotic genes. Amongst them, SMRT is responsible for basal repression of Wip1, a phosphatase that de-phosphorylates and inactivates Chk2, thus affecting a feedback loop responsible for licensing the correct timing of Chk2 activation and the proper execution of the DNA repair process.

  14. Examination of gene expression in mice exposed to low dose radiation using affymetrix cDNA microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Morris, D.; Knox, D.; Lavoie, J.; Lemon, J.; Boreham, D. [McMaster Univ., Hamilton, Ontario (Canada)

    2005-07-01

    'Full text:' Gamma radiation acts via the indirect effect to damage cells by producing reactive oxygen species (ROS). These ROS are capable damaging macromolecules and, altering signal pathways and gene transcription. Cells have evolved enzymes and mechanisms to scavenge ROS and repair oxidative damage. Microarrays allow the survey of the gene transcription activity of thousands of genes simultaneously. Messenger RNA is extracted from cells, hybridized with the complementary DNA (cDNA) of a microarray chip, and examined with a chip reader. Affymetrix microarray chips have been produced by the CSCHAH in Winnipeg containing 26000 murine genes. Groups of female mice have been exposed to low dose whole body chronic gamma radiation exposures of 0,50,100, and 120 mGy, corresponding to 15,30,60, and 75 weeks, respectively. MRNA from mice brain tissue has been extracted, isolated, converted to cDNA and labeled. Gene expression in each irradiated mouse was compared to the pooled expression of the control mice. Analysis of gene expression levels are performed with microarray analytical software, Array Pro by Media Cybernetics, and powerful statistical software, BRB microarray tools. Differences in gene expressions, focusing on genes for cytokines, DNA repair mechanisms, immuno-modulators, apoptosis pathways, and enzymatic anti-oxidant systems, are being examined and will be reported. (author)

  15. Nonparametric testing for DNA copy number induced differential mRNA gene expression

    NARCIS (Netherlands)

    van Wieringen, W.N.; van de Wiel, M.A.

    2009-01-01

    The central dogma of molecular biology relates DNA with mRNA. Array CGH measures DNA copy number and gene expression microarrays measure the amount of mRNA. Methods that integrate data from these two platforms may uncover meaningful biological relationships that further our understanding of cancer.

  16. Rapid assessment of repair of ultraviolet DNA damage with a modified host-cell reactivation assay using a luciferase reporter gene and correlation with polymorphisms of DNA repair genes in normal human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Qiao Yawei; Spitz, Margaret R.; Guo Zhaozheng; Hadeyati, Mohammad; Grossman, Lawrence; Kraemer, Kenneth H.; Wei Qingyi

    2002-11-30

    As DNA repair plays an important role in genetic susceptibility to cancer, assessment of the DNA repair phenotype is critical for molecular epidemiological studies of cancer. In this report, we compared use of the luciferase (luc) reporter gene in a host-cell reactivation (HCR) (LUC) assay of repair of ultraviolet (UV) damage to DNA to use of the chloramphenicol (cat) gene-based HCR (CAT) assay we used previously for case-control studies. We performed both the assays on cryopreserved lymphocytes from 102 healthy non-Hispanic white subjects. There was a close correlation between DNA repair capacity (DRC) as measured by the LUC and CAT assays. Although these two assays had similar variation, the LUC assay was faster and more sensitive. We also analyzed the relationship between DRC and the subjects' previously determined genotypes for four polymorphisms of two nucleotide-excision repair (NER) genes (in intron 9 of xeroderma pigmentosum (XP) C and exons 6, 10 and 23 of XPD) and one polymorphism of a base-excision repair gene in exon 10 of X-ray complementing group 1 (XRCC1). The DRC was significantly lower in subjects homozygous for one or more polymorphisms of the two NER genes than in subjects with other genotypes (P=0.010). In contrast, the polymorphic XRCC1 allele had no significant effect on DRC. These results suggest that the post-UV LUC assay measures NER phenotype and that polymorphisms of XPC and XPD genes modulate DRC. For population studies of the DNA repair phenotype, many samples need to be evaluated, and so the LUC assay has several advantages over the CAT assay: the LUC assay was more sensitive, had less variation, was not radioactive, was easier to perform, and required fewer cryopreserved cells. These features make the LUC-based HCR assay suitable for molecular epidemiological studies.

  17. Twin target self-amplification-based DNA machine for highly sensitive detection of cancer-related gene.

    Science.gov (United States)

    Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng

    2018-06-29

    The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. DNA-damaging agents stimulate gene expression at specific loci in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Kenyon, C.J.; Walker, G.C.

    1988-05-01

    Operon fusions in Escherichia coli were obtained that showed increased beta-galactosidase expression in response to treatment with the DNA-damaging agent mitomycin C. These fusions were generated by using the Mud(ApR, lac) vector to insert the lactose structural genes randomly into the bacterial chromosome. Induction of beta-galactosidase in these strains, which carried fusions of lac to these din (damage-inducible) loci, was (i) triggered by UV light as well as by mitomycin C and (ii) abolished by either a recA- or a lexA- mutation. Similar characteristics of induction were observed when the lactose genes were fused to a prophage lambda promoter by using Mud(ApR, lac). These results indicate that E. coli contains a set of genes that, like prophage lambda genes, are expressed in response to DNA-damaging agents and regulated by the recA and lexA gene products. These din genes map at five bacterial loci. One din::Mud(ApR, lac) insertion results in a UV-sensitive phenotype and may be within the uvrA transcriptional unit.

  19. The DNA damage response of C. elegans affected by gravity sensing and radiosensitivity during the Shenzhou-8 spaceflight

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Ying [Center of Medical Physics and Technology, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Shushanhu Road 350, Hefei 230031 (China); Cancer Hospital, Hefei Institutes of Physical Science, Chinese Academy of Sciences, Shushanhu Road 350, Hefei 230031 (China); Xu, Dan; Zhao, Lei [Institute of Environmental Systems Biology, College of Environmental Science and Engineering, Dalian Maritime University, Linghai Road 1, Dalian 116026 (China); Sun, Yeqing, E-mail: yqsun@dlmu.edu.cn [Institute of Environmental Systems Biology, College of Environmental Science and Engineering, Dalian Maritime University, Linghai Road 1, Dalian 116026 (China)

    2017-01-15

    Highlights: • Extrinsic condition and intrinsic sensitivity both affect responses to spaceflight. • Protein phosphorylation/dephosphorylation is sensitive to μg and space radiation. • Microgravity affects transcription depending on dystrophin gene dys-1 in C.elegans. • Loss-function of apoptotic gene ced-1 leads protective responses to space radiation. - Abstract: Space radiation and microgravity are recognized as primary and inevitable risk factors for humans traveling in space, but the reports regarding their synergistic effects remain inconclusive and vary across studies due to differences in the environmental conditions and intrinsic biological sensitivity. Thus, we studied the synergistic effects on transcriptional changes in the global genome and DNA damage response (DDR) by using dys-1 mutant and ced-1 mutant of C. elegans, which respectively presented microgravity-insensitivity and radiosensitivity when exposure to spaceflight condition (SF) and space radiation (SR). The dys-1 mutation induced similar transcriptional changes under both conditions, including the transcriptional distribution and function of altered genes. The majority of alterations were related to metabolic shift under both conditions, including transmembrane transport, lipid metabolic processes and proteolysis. Under SF and SR conditions, 12/14 and 10/13 altered pathways, respectively, were both grouped in the metabolism category. Out of the 778 genes involved in DDR, except eya-1 and ceh-34, 28 altered genes in dys-1 mutant showed no predicted protein interactions, or anti-correlated miRNAs during spaceflight. The ced-1 mutation induced similar changes under SF and SR; however, these effects were stronger than those of the dys-1 mutant. The additional genes identified were related to phosphorous/phosphate metabolic processes and growth rather than, metabolism, especially for environmental information processing under SR. Although the DDR profiles were significantly changed under

  20. The DNA damage response of C. elegans affected by gravity sensing and radiosensitivity during the Shenzhou-8 spaceflight

    International Nuclear Information System (INIS)

    Gao, Ying; Xu, Dan; Zhao, Lei; Sun, Yeqing

    2017-01-01

    Highlights: • Extrinsic condition and intrinsic sensitivity both affect responses to spaceflight. • Protein phosphorylation/dephosphorylation is sensitive to μg and space radiation. • Microgravity affects transcription depending on dystrophin gene dys-1 in C.elegans. • Loss-function of apoptotic gene ced-1 leads protective responses to space radiation. - Abstract: Space radiation and microgravity are recognized as primary and inevitable risk factors for humans traveling in space, but the reports regarding their synergistic effects remain inconclusive and vary across studies due to differences in the environmental conditions and intrinsic biological sensitivity. Thus, we studied the synergistic effects on transcriptional changes in the global genome and DNA damage response (DDR) by using dys-1 mutant and ced-1 mutant of C. elegans, which respectively presented microgravity-insensitivity and radiosensitivity when exposure to spaceflight condition (SF) and space radiation (SR). The dys-1 mutation induced similar transcriptional changes under both conditions, including the transcriptional distribution and function of altered genes. The majority of alterations were related to metabolic shift under both conditions, including transmembrane transport, lipid metabolic processes and proteolysis. Under SF and SR conditions, 12/14 and 10/13 altered pathways, respectively, were both grouped in the metabolism category. Out of the 778 genes involved in DDR, except eya-1 and ceh-34, 28 altered genes in dys-1 mutant showed no predicted protein interactions, or anti-correlated miRNAs during spaceflight. The ced-1 mutation induced similar changes under SF and SR; however, these effects were stronger than those of the dys-1 mutant. The additional genes identified were related to phosphorous/phosphate metabolic processes and growth rather than, metabolism, especially for environmental information processing under SR. Although the DDR profiles were significantly changed under

  1. Deoxynucleoside salvage enzymes and tissue specific mitochondrial DNA depletion.

    Science.gov (United States)

    Wang, L

    2010-06-01

    Adequate mitochondrial DNA (mtDNA) copies are required for normal mitochondria function and reductions in mtDNA copy number due to genetic alterations cause tissue-specific mtDNA depletion syndrome (MDS). There are eight nuclear genes, directly or indirectly involved in mtDNA replication and mtDNA precursor synthesis, which have been identified as the cause of MDS. However, the tissue specific pathology of these nuclear gene mutations is not well understood. Here, mtDNA synthesis, mtDNA copy number control, and mtDNA turnover, as well as the synthesis of mtDNA precursors in relation to the levels of salvage enzymes are discussed. The question why MDS caused by TK2 and p53R2 mutations are predominantly muscle specific while dGK deficiency affected mainly liver will be addressed.

  2. DNA methylation patterns of candidate genes regulated by thymine DNA glycosylase in patients with TP53 germline mutations

    Energy Technology Data Exchange (ETDEWEB)

    Fortes, F.P. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Kuasne, H. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Marchi, F.A. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Programa Inter-Institucional em Bioinformtica, Instituto de Matemtica e Estatstica, Universidade So Paulo, So Paulo, SP (Brazil); Miranda, P.M. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Rogatto, S.R. [CIPE, Laboratrio NeoGene, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Urologia, Faculdade de Medicina, Universidade Estadual Paulista, Botucatu, SP (Brazil); Achatz, M.I. [CIPE, Laboratrio de Oncogentica Molecular, A.C. Camargo Cancer Center, São Paulo, SP (Brazil); Departamento de Oncogentica, A.C. Camargo Cancer Center, So Paulo, SP (Brazil)

    2015-04-28

    Li-Fraumeni syndrome (LFS) is a rare, autosomal dominant, hereditary cancer predisposition disorder. In Brazil, the p.R337H TP53 founder mutation causes the variant form of LFS, Li-Fraumeni-like syndrome. The occurrence of cancer and age of disease onset are known to vary, even in patients carrying the same mutation, and several mechanisms such as genetic and epigenetic alterations may be involved in this variability. However, the extent of involvement of such events has not been clarified. It is well established that p53 regulates several pathways, including the thymine DNA glycosylase (TDG) pathway, which regulates the DNA methylation of several genes. This study aimed to identify the DNA methylation pattern of genes potentially related to the TDG pathway (CDKN2A, FOXA1, HOXD8, OCT4, SOX2, and SOX17) in 30 patients with germline TP53mutations, 10 patients with wild-type TP53, and 10 healthy individuals. We also evaluated TDG expression in patients with adrenocortical tumors (ADR) with and without the p.R337H TP53 mutation. Gene methylation patterns of peripheral blood DNA samples assessed by pyrosequencing revealed no significant differences between the three groups. However, increased TDG expression was observed by quantitative reverse transcription PCR in p.R337H carriers with ADR. Considering the rarity of this phenotype and the relevance of these findings, further studies using a larger sample set are necessary to confirm our results.

  3. A mutation in the aroE gene affects pigment production, virulence, and chemotaxis in Xanthomonas oryzae pv. oryzae.

    Science.gov (United States)

    Kim, Hong-Il; Noh, Tae-Hwan; Lee, Chang-Soo; Park, Young-Jin

    2015-01-01

    Xanthomonas oryzae pv. oryzae (Xoo) causes bacterial blight (BB) in rice. To study its function, a random insertion mutation library of Xoo was constructed using the Tn5 transposon. A mutant strain with decreased virulence against the susceptible rice cultivar IR24 was isolated from the library (aroE mutant), which also had extremely low pigment production. Thermal asymmetric interlaced-polymerase chain reaction (TAIL-PCR) and sequence analysis of the mutant revealed that the transposon was inserted into the aroE gene (encoding shikimate dehydrogenase). To investigate gene expression changes in the pigment- and virulence-deficient mutant, DNA microarray analysis was performed, which showed downregulation of 20 genes involved in the chemotaxis of Xoo. Our findings reveal that mutation of the aroE gene affects virulence and pigment production, as well as expression of genes involved in Xoo chemotaxis. Copyright © 2014 Elsevier GmbH. All rights reserved.

  4. Exposure to 3,3',5-triiodothyronine affects histone and RNA polymerase II modifications, but not DNA methylation status, in the regulatory region of the Xenopus laevis thyroid hormone receptor βΑ gene.

    Science.gov (United States)

    Kasai, Kentaro; Nishiyama, Norihito; Izumi, Yushi; Otsuka, Shunsuke; Ishihara, Akinori; Yamauchi, Kiyoshi

    2015-11-06

    Thyroid hormones (THs) play a critical role in amphibian metamorphosis, during which the TH receptor (TR) gene, thrb, is upregulated in a tissue-specific manner. The Xenopus laevis thrb gene has 3 TH response elements (TREs) in the 5' flanking regulatory region and 1 TRE in the exon b region, around which CpG sites are highly distributed. To clarify whether exposure to 3,3',5-triiodothyronine (T3) affects histone and RNA polymerase II (RNAPII) modifications and the level of DNA methylation in the 5' regulatory region, we conducted reverse transcription-quantitative polymerase chain reaction, bisulfite sequencing and chromatin immunoprecipitation assay using X. laevis cultured cells and premetamorphic tadpoles treated with or without 2 nM T3. Exposure to T3 increased the amount of the thrb transcript, in parallel with enhanced histone H4 acetylation and RNAPII recruitment, and probably phosphorylation of RNAPII at serine 5, in the 5' regulatory and exon b regions. However, the 5' regulatory region remained hypermethylated even with exposure to T3, and there was no significant difference in the methylation status between DNAs from T3-untreated and -treated cultured cells or tadpole tissues. Our results demonstrate that exposure to T3 induced euchromatin-associated epigenetic marks by enhancing histone acetylation and RNAPII recruitment, but not by decreasing the level of DNA methylation, in the 5' regulatory region of the X. laevis thrb gene. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Epigenetic Alteration by DNA Promoter Hypermethylation of Genes Related to Transforming Growth Factor-β (TGF-β) Signaling in Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Khin, Sann Sanda [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Pathology Research Unit, Department of Medical Research (Central Myanmar), Naypyitaw, Union of (Myanmar); Kitazawa, Riko [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan); Kondo, Takeshi; Idei, Yuka; Fujimoto, Masayo [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Haraguchi, Ryuma [Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan); Mori, Kiyoshi [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Kitazawa, Sohei, E-mail: kitazawa@m.ehime-u.ac.jp [Kobe University Graduate School of Medicine, Division of Diagnostic Molecular Pathology, Kobe 650-0017 (Japan); Ehime University Graduate School of Medicine, Toon 791-0295, Ehime (Japan)

    2011-03-03

    Epigenetic alterations in cancer, especially DNA methylation and histone modification, exert a significant effect on the deregulated expression of cancer-related genes and lay an epigenetic pathway to carcinogenesis and tumor progression. Global hypomethylation and local hypermethylation of CpG islands in the promoter region, which result in silencing tumor suppressor genes, constitute general and major epigenetic modification, the hallmark of the neoplastic epigenome. Additionally, methylation-induced gene silencing commonly affects a number of genes and increases with cancer progression. Indeed, cancers with a high degree of methylation (CpG island methylator phenotype/CIMP) do exist and represent a distinct subset of certain cancers including colorectal, bladder and kidney. On the other hand, signals from the microenvironment, especially those from transforming growth factor-β (TGF-β), induce targeted de novo epigenetic alterations of cancer-related genes. While TGF-β signaling has been implicated in two opposite roles in cancer, namely tumor suppression and tumor promotion, its deregulation is also partly induced by epigenetic alteration itself. Although the epigenetic pathway to carcinogenesis and cancer progression has such reciprocal complexity, the important issue is to identify genes or signaling pathways that are commonly silenced in various cancers in order to find early diagnostic and therapeutic targets. In this review, we focus on the epigenetic alteration by DNA methylation and its role in molecular modulations of the TGF-β signaling pathway that cause or underlie altered cancer-related gene expression in both phases of early carcinogenesis and late cancer progression.

  6. Epigenetic Alteration by DNA Promoter Hypermethylation of Genes Related to Transforming Growth Factor-β (TGF-β) Signaling in Cancer

    International Nuclear Information System (INIS)

    Khin, Sann Sanda; Kitazawa, Riko; Kondo, Takeshi; Idei, Yuka; Fujimoto, Masayo; Haraguchi, Ryuma; Mori, Kiyoshi; Kitazawa, Sohei

    2011-01-01

    Epigenetic alterations in cancer, especially DNA methylation and histone modification, exert a significant effect on the deregulated expression of cancer-related genes and lay an epigenetic pathway to carcinogenesis and tumor progression. Global hypomethylation and local hypermethylation of CpG islands in the promoter region, which result in silencing tumor suppressor genes, constitute general and major epigenetic modification, the hallmark of the neoplastic epigenome. Additionally, methylation-induced gene silencing commonly affects a number of genes and increases with cancer progression. Indeed, cancers with a high degree of methylation (CpG island methylator phenotype/CIMP) do exist and represent a distinct subset of certain cancers including colorectal, bladder and kidney. On the other hand, signals from the microenvironment, especially those from transforming growth factor-β (TGF-β), induce targeted de novo epigenetic alterations of cancer-related genes. While TGF-β signaling has been implicated in two opposite roles in cancer, namely tumor suppression and tumor promotion, its deregulation is also partly induced by epigenetic alteration itself. Although the epigenetic pathway to carcinogenesis and cancer progression has such reciprocal complexity, the important issue is to identify genes or signaling pathways that are commonly silenced in various cancers in order to find early diagnostic and therapeutic targets. In this review, we focus on the epigenetic alteration by DNA methylation and its role in molecular modulations of the TGF-β signaling pathway that cause or underlie altered cancer-related gene expression in both phases of early carcinogenesis and late cancer progression

  7. Virus-specific DNA sequences present in cells which carry the herpes simplex virus thymidine kinase gene.

    Science.gov (United States)

    Minson, A C; Darby, G K; Wildy, P

    1979-11-01

    Two independently derived cell lines which carry the herpes simplex type 2 thymidine kinase gene have been examined for the presence of HSV-2-specific DNA sequences. Both cell lines contained 1 to 3 copies per cell of a sequence lying within map co-ordinates 0.2 to 0.4 of the HSV-2 genome. Revertant cells, which contained no detectable thymidine kinase, did not contain this DNA sequence. The failure of EcoR1-restricted HSV-2 DNA to act as a donor of the thymidine kinase gene in transformation experiments suggests that the gene lies close to the EcoR1 restriction site within this sequence at a map position of approx. 0.3. The HSV-2 kinase gene is therefore approximately co-linear with the HSV-1 gene.

  8. Laboratory of Mutagenesis and DNA Repair

    International Nuclear Information System (INIS)

    2000-01-01

    Full text: Two main lines of research were continued: the first one concerned the mechanisms controlling the fidelity of DNA replication in Escherichia coli; the second concerned cellular responses of Saccharomyces cerevisiae to DNA damaging agents. We have been investigating the question whether during chromosomal DNA replication in Escherichia coli the two DNA strands may be replicated with differential accuracy. To address this question we set up a new system that allows the examination of mutagenesis either of the leading strand or the lagging strand. Our results suggest that the lagging strand replication of the E. coli chromosome may be more accurate than leading strand replication. More recently, we studied mutagenesis of the two strands in recA730 strains which exhibit constitutive expression of the SOS system. Our results clearly indicate that in recA730 strains there is a significant difference in the fidelity of replication between the two replicating strands. Based on our data we propose a model describing a possible mechanism of SOS mutagenesis. To get more insight into cellular responses to DNA damage we have isolated several novel genes of S. cerevisiae, the transcription of which is induced by DNA lesions. Main effort was concentrated on the characterization of the DIN7 gene. We found that Din7p specifically affects the metabolism of mitochondrial DNA (mtDNA). The elevated level of Din7p results in an increased frequency of mitochondrial petite mutants, as well as in a higher frequency of mitochondrial point mutations. Din7p affects also the stability of microsatellite sequences present in the mitochondrial genome. As expected, Din7p was found to be located in mitochondria. In another project, we found that the DIN8 gene isolated in our laboratory is identical with the UMP1 gene encoding a chaperone-like protein involved in 20S proteasome maturation. Interestingly, induction of UMP1 expression in response to DNA damage is subject to regulation

  9. Land use type significantly affects microbial gene transcription in soil.

    Science.gov (United States)

    Nacke, Heiko; Fischer, Christiane; Thürmer, Andrea; Meinicke, Peter; Daniel, Rolf

    2014-05-01

    Soil microorganisms play an essential role in sustaining biogeochemical processes and cycling of nutrients across different land use types. To gain insights into microbial gene transcription in forest and grassland soil, we isolated mRNA from 32 sampling sites. After sequencing of generated complementary DNA (cDNA), a total of 5,824,229 sequences could be further analyzed. We were able to assign nonribosomal cDNA sequences to all three domains of life. A dominance of bacterial sequences, which were affiliated to 25 different phyla, was found. Bacterial groups capable of aromatic compound degradation such as Phenylobacterium and Burkholderia were detected in significantly higher relative abundance in forest soil than in grassland soil. Accordingly, KEGG pathway categories related to degradation of aromatic ring-containing molecules (e.g., benzoate degradation) were identified in high abundance within forest soil-derived metatranscriptomic datasets. The impact of land use type forest on community composition and activity is evidently to a high degree caused by the presence of wood breakdown products. Correspondingly, bacterial groups known to be involved in lignin degradation and containing ligninolytic genes such as Burkholderia, Bradyrhizobium, and Azospirillum exhibited increased transcriptional activity in forest soil. Higher solar radiation in grassland presumably induced increased transcription of photosynthesis-related genes within this land use type. This is in accordance with high abundance of photosynthetic organisms and plant-infecting viruses in grassland.

  10. DNA methylation and gene expression changes derived from assisted reproductive technologies can be decreased by reproductive fluids

    Science.gov (United States)

    Canovas, Sebastian; Ivanova, Elena; Romar, Raquel; García-Martínez, Soledad; Soriano-Úbeda, Cristina; García-Vázquez, Francisco A; Saadeh, Heba; Andrews, Simon; Kelsey, Gavin; Coy, Pilar

    2017-01-01

    The number of children born since the origin of Assisted Reproductive Technologies (ART) exceeds 5 million. The majority seem healthy, but a higher frequency of defects has been reported among ART-conceived infants, suggesting an epigenetic cost. We report the first whole-genome DNA methylation datasets from single pig blastocysts showing differences between in vivo and in vitro produced embryos. Blastocysts were produced in vitro either without (C-IVF) or in the presence of natural reproductive fluids (Natur-IVF). Natur-IVF embryos were of higher quality than C-IVF in terms of cell number and hatching ability. RNA-Seq and DNA methylation analyses showed that Natur-IVF embryos have expression and methylation patterns closer to in vivo blastocysts. Genes involved in reprogramming, imprinting and development were affected by culture, with fewer aberrations in Natur-IVF embryos. Methylation analysis detected methylated changes in C-IVF, but not in Natur-IVF, at genes whose methylation could be critical, such as IGF2R and NNAT. DOI: http://dx.doi.org/10.7554/eLife.23670.001 PMID:28134613

  11. Actin and myosin contribute to mammalian mitochondrial DNA maintenance

    Science.gov (United States)

    Reyes, A.; He, J.; Mao, C. C.; Bailey, L. J.; Di Re, M.; Sembongi, H.; Kazak, L.; Dzionek, K.; Holmes, J. B.; Cluett, T. J.; Harbour, M. E.; Fearnley, I. M.; Crouch, R. J.; Conti, M. A.; Adelstein, R. S.; Walker, J. E.; Holt, I. J.

    2011-01-01

    Mitochondrial DNA maintenance and segregation are dependent on the actin cytoskeleton in budding yeast. We found two cytoskeletal proteins among six proteins tightly associated with rat liver mitochondrial DNA: non-muscle myosin heavy chain IIA and β-actin. In human cells, transient gene silencing of MYH9 (encoding non-muscle myosin heavy chain IIA), or the closely related MYH10 gene (encoding non-muscle myosin heavy chain IIB), altered the topology and increased the copy number of mitochondrial DNA; and the latter effect was enhanced when both genes were targeted simultaneously. In contrast, genetic ablation of non-muscle myosin IIB was associated with a 60% decrease in mitochondrial DNA copy number in mouse embryonic fibroblasts, compared to control cells. Gene silencing of β-actin also affected mitochondrial DNA copy number and organization. Protease-protection experiments and iodixanol gradient analysis suggest some β-actin and non-muscle myosin heavy chain IIA reside within human mitochondria and confirm that they are associated with mitochondrial DNA. Collectively, these results strongly implicate the actomyosin cytoskeleton in mammalian mitochondrial DNA maintenance. PMID:21398640

  12. Gene activation by induced DNA rearrangements

    International Nuclear Information System (INIS)

    Schnipper, L.E.; Chan, V.; Sedivy, J.; Jat, P.; Sharp, P.A.

    1989-01-01

    A murine cell line (EN/NIH) containing the retroviral vector ZIPNeoSV(x)1 that was modified by deletion of the enhancer elements in the viral long terminal repeats has been used as an assay system to detect induced DNA rearrangements that result in activation of a transcriptionally silent reporter gene encoded by the viral genome. The spontaneous frequency of G418 resistance is less than 10(-7), whereas exposure to the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) or the combination of UV irradiation plus TPA resulted in the emergence of drug resistant cell lines at a frequency of 5 per 10(6) and 67 per 10(6) cells, respectively. In several of the cell lines that were analyzed a low level of amplification of one of the two parental retroviral integrants was observed, whereas in others no alteration in the region of the viral genome was detected. To determine the effect of the SV40 large T antigen on induced DNA rearrangements, EN/NIH cells were transfected with a temperature sensitive (ts) mutant of SV40 T. Transfectants were maintained at the permissive temperature (33 degrees C) for varying periods of time (1-5 days) in order to vary SV40 T antigen exposure, after which they were shifted to 39.5 degrees C for selection in G418. The frequency of emergence of drug resistant cell clones increased with duration of exposure to large T antigen (9-52 per 10(6) cells over 1-5 days, respectively), and all cell lines analyzed demonstrated DNA rearrangements in the region of the neo gene. A novel 18-kilobase pair XbaI fragment was cloned from one cell line which revealed the presence of a 2.0-kilobase pair EcoRI segment containing an inverted duplication which hybridized to neo sequences. It is likely that the observed rearrangement was initiated by the specific binding of large T antigen to the SV40 origin of replication encoded within the viral genome

  13. The (PrS/HGF-pDNA) multilayer films for gene-eluting stent coating: Gene-protecting, anticoagulation, antibacterial properties, and in vivo antirestenosis evaluation.

    Science.gov (United States)

    Chang, Hao; Ren, Ke-feng; Zhang, He; Wang, Jin-lei; Wang, Bai-liang; Ji, Jian

    2015-02-01

    Vascular gene-eluting stents (GES) is a promising strategy for treatment of cardiovascular disease. Very recently, we have proved that the (protamine sulfate/plasmid DNA encoding hepatocyte growth factor) (PrS/HGF-pDNA) multilayer can serve as a powerful tool for enhancing competitiveness of endothelial cell over smooth muscle cell, which opens perspectives for the regulation of intercellular competitiveness in the field of interventional therapy. However, before the gene multilayer films could be used in vascular stents for real clinical application, the preservation of gene bioactivity during the industrial sterilization and the hemocompatibility of film should be taken into account. Actually, both are long been ignored issues in the field of gene coating for GES. In this study, we demonstrate that the (PrS/HGF-pDNA) multilayer film exhibits the good gene-protecting abilities, which is confirmed by using the industrial sterilizations (gamma irradiation and ethylene oxide) and a routine storage condition (dry state at 4°C for 30 days). Furthermore, hemocompatible measurements (such as platelet adhesion and whole blood coagulation) and antibacterial assays (bacteria adhesion and growth inhibition) indicate the good anticoagulation and antibacterial properties of the (PrS/HGF-pDNA) multilayer film. The in vivo preliminary data of angiography and histological analysis suggest that the (PrS/HGF-pDNA) multilayer coated stent can reduce the in-stent restenosis. This work reveals that the (PrS/HGF-pDNA) multilayer film could be a promising candidate as coating for GES, which is of great potential in future clinic application. © 2014 Wiley Periodicals, Inc.

  14. Size effect on transfection and cytotoxicity of nanoscale plasmid DNA/polyethyleneimine complexes for aerosol gene delivery

    Energy Technology Data Exchange (ETDEWEB)

    Hoon Byeon, Jeong, E-mail: jbyeon@purdue.edu [Department of Chemistry, Purdue University, West Lafayette, Indiana 47907 (United States); Kim, Jang-Woo, E-mail: jwkim@hoseo.edu [Department of Digital Display Engineering, Hoseo University, Asan 336-795 (Korea, Republic of)

    2014-02-03

    Nanoscale plasmid DNA (pDNA)/polyethyleneimine (PEI) complexes were fabricated in the aerosol state using a nebulization system consisting of a collison atomizer and a cool-walled diffusion dryer. The aerosol fabricated nanoscale complexes were collected and employed to determine fundamental properties of the complexes, such as size, structure, surface charge, and in vitro gene transfection efficiency and cytotoxicity. The results showed that mass ratio between pDNA and PEI should be optimized to enhance gene transfection efficiency without a significant loss of cell viability. These findings may support practical advancements in the field of nonviral gene delivery.

  15. LNA effects on DNA binding and conformation

    DEFF Research Database (Denmark)

    Pabon-Martinez, Y Vladimir; Xu, You; Villa, Alessandra

    2017-01-01

    -substitution in the duplex pyrimidine strand alters the double helix structure, affecting x-displacement, slide and twist favoring triplex formation through enhanced TFO major groove accommodation. Collectively, these findings should facilitate the design of potent anti-gene ONs.......The anti-gene strategy is based on sequence-specific recognition of double-strand DNA by triplex forming (TFOs) or DNA strand invading oligonucleotides to modulate gene expression. To be efficient, the oligonucleotides (ONs) should target DNA selectively, with high affinity. Here we combined...... hybridization analysis and electrophoretic mobility shift assay with molecular dynamics (MD) simulations to better understand the underlying structural features of modified ONs in stabilizing duplex- and triplex structures. Particularly, we investigated the role played by the position and number of locked...

  16. Common variants in mismatch repair genes associated with increased risk of sperm DNA damage and male infertility

    Directory of Open Access Journals (Sweden)

    Ji Guixiang

    2012-05-01

    Full Text Available Abstract Background The mismatch repair (MMR pathway plays an important role in the maintenance of the genome integrity, meiotic recombination and gametogenesis. This study investigated whether genetic variations in MMR genes are associated with an increased risk of sperm DNA damage and male infertility. Methods We selected and genotyped 21 tagging single nucleotide polymorphisms (SNPs in five MMR genes (MLH1, MLH3, PMS2, MSH4 and MSH5 using the SNPstream 12-plex platform in a case-control study of 1,292 idiopathic infertility patients and 480 fertile controls in a Chinese population. Sperm DNA damage levels were detected with the Tdt-mediated dUTP nick end labelling (TUNEL assay in 450 cases. Fluorescence resonance energy transfer (FRET and co-immunoprecipitation techniques were employed to determine the effects of functional variants. Results One intronic SNP in MLH1 (rs4647269 and two non-synonymous SNPs in PMS2 (rs1059060, Ser775Asn and MSH5 (rs2075789, Pro29Ser seem to be risk factors for the development of azoospermia or oligozoospermia. Meanwhile, we also identified a possible contribution of PMS2 rs1059060 to the risk of male infertility with normal sperm count. Among patients with normal sperm count, MLH1 rs4647269 and PMS2 rs1059060 were associated with increased sperm DNA damage. Functional analysis revealed that the PMS2 rs1059060 can affect the interactions between MLH1 and PMS2. Conclusions Our results provide evidence supporting the involvement of genetic polymorphisms in MMR genes in the aetiology of male infertility.

  17. Methamphetamine and HIV-Tat alter murine cardiac DNA methylation and gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Koczor, Christopher A., E-mail: ckoczor@emory.edu; Fields, Earl; Jedrzejczak, Mark J.; Jiao, Zhe; Ludaway, Tomika; Russ, Rodney; Shang, Joan; Torres, Rebecca A.; Lewis, William

    2015-11-01

    This study addresses the individual and combined effects of HIV-1 and methamphetamine (N-methyl-1-phenylpropan-2-amine, METH) on cardiac dysfunction in a transgenic mouse model of HIV/AIDS. METH is abused epidemically and is frequently associated with acquisition of HIV-1 infection or AIDS. We employed microarrays to identify mRNA differences in cardiac left ventricle (LV) gene expression following METH administration (10 d, 3 mg/kg/d, subcutaneously) in C57Bl/6 wild-type littermates (WT) and Tat-expressing transgenic (TG) mice. Arrays identified 880 differentially expressed genes (expression fold change > 1.5, p < 0.05) following METH exposure, Tat expression, or both. Using pathway enrichment analysis, mRNAs encoding polypeptides for calcium signaling and contractility were altered in the LV samples. Correlative DNA methylation analysis revealed significant LV DNA methylation changes following METH exposure and Tat expression. By combining these data sets, 38 gene promoters (27 related to METH, 11 related to Tat) exhibited differences by both methods of analysis. Among those, only the promoter for CACNA1C that encodes L-type calcium channel Cav1.2 displayed DNA methylation changes concordant with its gene expression change. Quantitative PCR verified that Cav1.2 LV mRNA abundance doubled following METH. Correlative immunoblots specific for Cav1.2 revealed a 3.5-fold increase in protein abundance in METH LVs. Data implicate Cav1.2 in calcium dysregulation and hypercontractility in the murine LV exposed to METH. They suggest a pathogenetic role for METH exposure to promote LV dysfunction that outweighs Tat-induced effects. - Highlights: • HIV-1 Tat and methamphetamine (METH) alter cardiac gene expression and epigenetics. • METH impacts gene expression or epigenetics more significantly than Tat expression. • METH alters cardiac mitochondrial function and calcium signaling independent of Tat. • METH alters DNA methylation, expression, and protein abundance of

  18. Methamphetamine and HIV-Tat alter murine cardiac DNA methylation and gene expression

    International Nuclear Information System (INIS)

    Koczor, Christopher A.; Fields, Earl; Jedrzejczak, Mark J.; Jiao, Zhe; Ludaway, Tomika; Russ, Rodney; Shang, Joan; Torres, Rebecca A.; Lewis, William

    2015-01-01

    This study addresses the individual and combined effects of HIV-1 and methamphetamine (N-methyl-1-phenylpropan-2-amine, METH) on cardiac dysfunction in a transgenic mouse model of HIV/AIDS. METH is abused epidemically and is frequently associated with acquisition of HIV-1 infection or AIDS. We employed microarrays to identify mRNA differences in cardiac left ventricle (LV) gene expression following METH administration (10 d, 3 mg/kg/d, subcutaneously) in C57Bl/6 wild-type littermates (WT) and Tat-expressing transgenic (TG) mice. Arrays identified 880 differentially expressed genes (expression fold change > 1.5, p < 0.05) following METH exposure, Tat expression, or both. Using pathway enrichment analysis, mRNAs encoding polypeptides for calcium signaling and contractility were altered in the LV samples. Correlative DNA methylation analysis revealed significant LV DNA methylation changes following METH exposure and Tat expression. By combining these data sets, 38 gene promoters (27 related to METH, 11 related to Tat) exhibited differences by both methods of analysis. Among those, only the promoter for CACNA1C that encodes L-type calcium channel Cav1.2 displayed DNA methylation changes concordant with its gene expression change. Quantitative PCR verified that Cav1.2 LV mRNA abundance doubled following METH. Correlative immunoblots specific for Cav1.2 revealed a 3.5-fold increase in protein abundance in METH LVs. Data implicate Cav1.2 in calcium dysregulation and hypercontractility in the murine LV exposed to METH. They suggest a pathogenetic role for METH exposure to promote LV dysfunction that outweighs Tat-induced effects. - Highlights: • HIV-1 Tat and methamphetamine (METH) alter cardiac gene expression and epigenetics. • METH impacts gene expression or epigenetics more significantly than Tat expression. • METH alters cardiac mitochondrial function and calcium signaling independent of Tat. • METH alters DNA methylation, expression, and protein abundance of

  19. Mapping of gene transcripts by nuclease protection assays and cDNA primer extension

    International Nuclear Information System (INIS)

    Calzone, F.J.; Britten, R.J.; Davidson, E.J.

    1987-01-01

    An important problem often faced in the molecular characterization of genes is the precise mapping of those genomic sequences transcribed into RNA. This requires identification of the genomic site initiating gene transcription, the location of genomic sequences removed from the primary gene transcript during RNA processing, and knowledge of sequences terminating the processed gene transcript. The objective of the protocols described here is the generation of transcription maps utilizing relatively uncharacterized gene fragments. The basic approach is hybridization of a single-stranded DNA probe with cellular RNA, followed by treatment with a single-strand-specific nuclease that does not attack DNA-RNA hybrids, in order to destroy any unreacted probe sequences. Thus the probe sequences included in the hybrid duplexes are protected from nuclease digestion. The sizes of the protected probe fragments determined by gel electrophoresis correspond to the lengths of the hybridized sequence elements

  20. DNA demethylation by 5-aza-2-deoxycytidine treatment abrogates 17 beta-estradiol-induced cell growth and restores expression of DNA repair genes in human breast cancer cells.

    Science.gov (United States)

    Singh, Kamaleshwar P; Treas, Justin; Tyagi, Tulika; Gao, Weimin

    2012-03-01

    Prolonged exposure to elevated levels of estrogen is a risk factor for breast cancer. Though increased cell growth and loss of DNA repair capacity is one of the proposed mechanisms for estrogen-induced cancers, the mechanism through which estrogen induces cell growth and decreases DNA repair capacity is not clear. DNA hypermethylation is known to inactivate DNA repair genes and apoptotic response in cancer cells. Therefore, the objective of this study was to determine the role of DNA hypermethylation in estrogen-induced cell growth and regulation of DNA repair genes expression in breast cancer cells. To achieve this objective, the estrogen-responsive MCF-7 cells either pretreated with 5-aza-2-deoxycytidine (5-aza-dC) or untreated (as control) were exposed to 17 beta-estradiol (E2), and its effect on cell growth and expression of DNA repair genes were measured. The result revealed that 5-aza-dC abrogates the E2-induced growth in MCF-7 cells. An increased expression of OGG1, MSH4, and MLH1 by 5-aza-dC treatment alone, suggest the DNA hypermethylation as a potential cause for decreased expression of these genes in MCF-7 cells. The decreased expression of ERCC1, XPC, OGG1, and MLH1 by E2 alone and its restoration by co-treatment with 5-aza-dC further suggest that E2 reduces the expression of these DNA repair genes potentially through promoter hypermethylation. Reactivation of mismatch repair (MMR) gene MLH1 and abrogation of E2-induced cell growth by 5-aza-dC treatment suggest that estrogen causes increased growth in breast cancer cells potentially through the inhibition of MMR-mediated apoptotic response. In summary, this study suggests that estrogen increases cell growth and decreases the DNA repair capacity in breast cancer cells, at least in part, through epigenetic mechanism. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  1. Assembly of a biocompatible triazole-linked gene by one-pot click-DNA ligation

    Science.gov (United States)

    Kukwikila, Mikiembo; Gale, Nittaya; El-Sagheer, Afaf H.; Brown, Tom; Tavassoli, Ali

    2017-11-01

    The chemical synthesis of oligonucleotides and their enzyme-mediated assembly into genes and genomes has significantly advanced multiple scientific disciplines. However, these approaches are not without their shortcomings; enzymatic amplification and ligation of oligonucleotides into genes and genomes makes automation challenging, and site-specific incorporation of epigenetic information and/or modified bases into large constructs is not feasible. Here we present a fully chemical one-pot method for the assembly of oligonucleotides into a gene by click-DNA ligation. We synthesize the 335 base-pair gene that encodes the green fluorescent protein iLOV from ten functionalized oligonucleotides that contain 5ʹ-azide and 3ʹ-alkyne units. The resulting click-linked iLOV gene contains eight triazoles at the sites of chemical ligation, and yet is fully biocompatible; it is replicated by DNA polymerases in vitro and encodes a functional iLOV protein in Escherichia coli. We demonstrate the power and potential of our one-pot gene-assembly method by preparing an epigenetically modified variant of the iLOV gene.

  2. Transcription profiles of mitochondrial genes correlate with mitochondrial DNA haplotypes in a natural population of Silene vulgaris

    Directory of Open Access Journals (Sweden)

    Olson Matthew S

    2010-01-01

    Full Text Available Abstract Background Although rapid changes in copy number and gene order are common within plant mitochondrial genomes, associated patterns of gene transcription are underinvestigated. Previous studies have shown that the gynodioecious plant species Silene vulgaris exhibits high mitochondrial diversity and occasional paternal inheritance of mitochondrial markers. Here we address whether variation in DNA molecular markers is correlated with variation in transcription of mitochondrial genes in S. vulgaris collected from natural populations. Results We analyzed RFLP variation in two mitochondrial genes, cox1 and atp1, in offspring of ten plants from a natural population of S. vulgaris in Central Europe. We also investigated transcription profiles of the atp1 and cox1 genes. Most DNA haplotypes and transcription profiles were maternally inherited; for these, transcription profiles were associated with specific mitochondrial DNA haplotypes. One individual exhibited a pattern consistent with paternal inheritance of mitochondrial DNA; this individual exhibited a transcription profile suggestive of paternal but inconsistent with maternal inheritance. We found no associations between gender and transcript profiles. Conclusions Specific transcription profiles of mitochondrial genes were associated with specific mitochondrial DNA haplotypes in a natural population of a gynodioecious species S. vulgaris. Our findings suggest the potential for a causal association between rearrangements in the plant mt genome and transcription product variation.

  3. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong

    2010-01-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  4. DNA replication factor C1 mediates genomic stability and transcriptional gene silencing in Arabidopsis

    KAUST Repository

    Liu, Qian

    2010-07-01

    Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.

  5. Characterization of three Agrobacterium tumefaciens avirulent mutants with chromosomal mutations that affect induction of vir genes.

    Science.gov (United States)

    Metts, J; West, J; Doares, S H; Matthysse, A G

    1991-02-01

    Three Agrobacterium tumefaciens mutants with chromosomal mutations that affect bacterial virulence were isolated by transposon mutagenesis. Two of the mutants were avirulent on all hosts tested. The third mutant, Ivr-211, was a host range mutant which was avirulent on Bryophyllum diagremontiana, Nicotiana tabacum, N. debneyi, N. glauca, and Daucus carota but was virulent on Zinnia elegans and Lycopersicon esculentum (tomato). That the mutant phenotype was due to the transposon insertion was determined by cloning the DNA containing the transposon insertion and using the cloned DNA to replace the wild-type DNA in the parent bacterial strain by marker exchange. The transposon insertions in the three mutants mapped at three widely separated locations on the bacterial chromosome. The effects of the mutations on various steps in tumor formation were examined. All three mutants showed no alteration in binding to carrot cells. However, none of the mutants showed any induction of vir genes by acetosyringone under conditions in which the parent strain showed vir gene induction. When the mutant bacteria were examined for changes in surface components, it was found that all three of the mutants showed a similar alteration in lipopolysaccharide (LPS). LPS from the mutants was larger in size and more heavily saccharide substituted than LPS from the parent strain. Two of the mutants showed no detectable alteration in outer membrane and periplasmic space proteins. The third mutant, Ivr-225, was missing a 79-kDa surface peptide. The reason(s) for the failure of vir gene induction in these mutants and its relationship, if any, to the observed alteration in LPS are unknown.

  6. DNA mutation motifs in the genes associated with inherited diseases.

    Directory of Open Access Journals (Sweden)

    Michal Růžička

    Full Text Available Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs rarely associated with mutations (coldspots and frequently associated with mutations (hotspots exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

  7. Non-equilibrium repressor binding kinetics link DNA damage dose to transcriptional timing within the SOS gene network.

    Science.gov (United States)

    Culyba, Matthew J; Kubiak, Jeffrey M; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

    2018-06-01

    Biochemical pathways are often genetically encoded as simple transcription regulation networks, where one transcription factor regulates the expression of multiple genes in a pathway. The relative timing of each promoter's activation and shut-off within the network can impact physiology. In the DNA damage repair pathway (known as the SOS response) of Escherichia coli, approximately 40 genes are regulated by the LexA repressor. After a DNA damaging event, LexA degradation triggers SOS gene transcription, which is temporally separated into subsets of 'early', 'middle', and 'late' genes. Although this feature plays an important role in regulating the SOS response, both the range of this separation and its underlying mechanism are not experimentally defined. Here we show that, at low doses of DNA damage, the timing of promoter activities is not separated. Instead, timing differences only emerge at higher levels of DNA damage and increase as a function of DNA damage dose. To understand mechanism, we derived a series of synthetic SOS gene promoters which vary in LexA-operator binding kinetics, but are otherwise identical, and then studied their activity over a large dose-range of DNA damage. In distinction to established models based on rapid equilibrium assumptions, the data best fit a kinetic model of repressor occupancy at promoters, where the drop in cellular LexA levels associated with higher doses of DNA damage leads to non-equilibrium binding kinetics of LexA at operators. Operators with slow LexA binding kinetics achieve their minimal occupancy state at later times than operators with fast binding kinetics, resulting in a time separation of peak promoter activity between genes. These data provide insight into this remarkable feature of the SOS pathway by demonstrating how a single transcription factor can be employed to control the relative timing of each gene's transcription as a function of stimulus dose.

  8. A parasitic selfish gene that affects host promiscuity.

    Science.gov (United States)

    Giraldo-Perez, Paulina; Goddard, Matthew R

    2013-11-07

    Selfish genes demonstrate transmission bias and invade sexual populations despite conferring no benefit to their hosts. While the molecular genetics and evolutionary dynamics of selfish genes are reasonably well characterized, their effects on hosts are not. Homing endonuclease genes (HEGs) are one well-studied family of selfish genes that are assumed to be benign. However, we show that carrying HEGs is costly for Saccharomyces cerevisiae, demonstrating that these genetic elements are not necessarily benign but maybe parasitic. We estimate a selective load of approximately 1-2% in 'natural' niches. The second aspect we examine is the ability of HEGs to affect hosts' sexual behaviour. As all selfish genes critically rely on sex for spread, then any selfish gene correlated with increased host sexuality will enjoy a transmission advantage. While classic parasites are known to manipulate host behaviour, we are not aware of any evidence showing a selfish gene is capable of affecting host promiscuity. The data presented here show a selfish element may increase the propensity of its eukaryote host to undergo sex and along with increased rates of non-Mendelian inheritance, this may counterbalance mitotic selective load and promote spread. Demonstration that selfish genes are correlated with increased promiscuity in eukaryotes connects with ideas suggesting that selfish genes promoted the evolution of sex initially.

  9. Obesity is associated with depot-specific alterations in adipocyte DNA methylation and gene expression

    DEFF Research Database (Denmark)

    Sonne, Si Brask; Yadav, Rachita; Yin, Guangliang

    2017-01-01

    The present study aimed to identify genes exhibiting concomitant obesity-dependent changes in DNA methylation and gene expression in adipose tissues in the mouse using diet-induced obese (DIO) C57BL/6J and genetically obese ob/ob mice as models. Mature adipocytes were isolated from epididymal...... and inguinal adipose tissues of ob/ob and DIO C57BL/6J mice. DNA methylation was analyzed by MeDIP-sequencing and gene expression by microarray analysis. The majority of differentially methylated regions (DMRs) were hypomethylated in obese mice. Global methylation of long interspersed elements indicated......57BL/6J mice occurred primarily in exons, whereas inguinal adipocytes of ob/ob mice exhibited a higher enrichment of DMRs in promoter regions than in other regions of the genome, suggesting an influence of leptin on DNA methylation in inguinal adipocytes. We observed altered methylation...

  10. Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter

    International Nuclear Information System (INIS)

    Dávalos-Salas, Mercedes; Furlan-Magaril, Mayra; González-Buendía, Edgar; Valdes-Quezada, Christian; Ayala-Ortega, Erandi; Recillas-Targa, Félix

    2011-01-01

    Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb) gene promoter in different tumoral cell lines. To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing

  11. Production of DNA microarray and expression analysis of genes from Xylella fastidiosa in different culture media

    Directory of Open Access Journals (Sweden)

    Regiane de Fátima Travensolo

    2009-06-01

    Full Text Available DNA Microarray was developed to monitor the expression of many genes from Xylella fastidiosa, allowing the side by-side comparison of two situations in a single experiment. The experiments were performed using X. fastidiosa cells grown in two culture media: BCYE and XDM2. The primers were synthesized, spotted onto glass slides and the array was hybridized against fluorescently labeled cDNAs. The emitted signals were quantified, normalized and the data were statistically analyzed to verify the differentially expressed genes. According to the data, 104 genes were differentially expressed in XDM2 and 30 genes in BCYE media. The present study showed that DNA microarray technique efficiently differentiate the expressed genes under different conditions.DNA Microarray foi desenvolvida para monitorar a expressão de muitos genes de Xylella fastidiosa, permitindo a comparação de duas situações distintas em um único experimento. Os experimentos foram feitos utilizando células de X. fastidiosa cultivada em dois meios de cultura: BCYE e XDM2. Pares de oligonucleotídeos iniciadores foram sintetizados, depositados em lâminas de vidro e o arranjo foi hibridizado contra cDNAs marcados fluorescentemente. Os sinais emitidos foram quantificados, normalizados e os dados foram estatisticamente analisados para verificar os genes diferencialmente expressos. De acordo com nossos dados, 104 genes foram diferencialmente expressos para o meio de cultura XDM2 e 30 genes para o BCYE. No presente estudo, nós demonstramos que a técnica de DNA microarrays eficientemente diferencia genes expressos sob diferentes condições de cultivo.

  12. Development of library preparation method able to correct gene expression levels in rice anther and isolate a trace expression gene mediated in cold-resistance

    Energy Technology Data Exchange (ETDEWEB)

    Yamaguchi, Tomoya; Koike, Setsuo [Tohoku National Agricultural Experiment Station, Morioka (Japan)

    2000-02-01

    When cDNA library is prepared by a previously developed method, genes of which expression level is high are apt to be cloned at a high frequency, whereas genes of which expression level are low, are difficult to be cloned. A low-expression gene has been cloned at very low frequency. Therefore, the gene encoding the key enzyme that is involved in growth disturbance of rice pollen has not been identified. In this study, development of a library preparing method able to correct the expression level was attempted using highly sensitive detection method with radioisotope and some genes related to cold-resistance of rice were isolated. Double strand DNAs were synthesized using mRNA extract from rice anthers and annealed following heat-denaturation. It has been known that single strand DNA molecules abundantly existing in DNA solution can easily aggregate to form double strand DNA, but single stranded DNA molecules poor in the solution are apt to still remain as single strand after annealing. Thus, the amount of single strand DNA would be balanced in the solution between abundant DNA and poor DNA species. The authors succeeded to prepare a gene library including low and high expression genes at similar proportions. Moreover, spin trap method that allows RI labeling of DNA bound to latex particle, was developed to detect with high sensitivity, especially for genes that are expressed at low level. The present method could be used for recovery, detection and quantitative analysis of radiolabeled single strand DNA. Thus, it was demonstrated that the stage from tetrad sperm to small sperm might be easily affected by cold stress. The present results suggest that the expressions of {beta}-1 and {beta}-3 glucanase, which are involved in the release of small sperms following meiosis in the pollen formation, might be easily affected by cold stress. (M.N.)

  13. Development of library preparation method able to correct gene expression levels in rice anther and isolate a trace expression gene mediated in cold-resistance

    International Nuclear Information System (INIS)

    Yamaguchi, Tomoya; Koike, Setsuo

    2000-01-01

    When cDNA library is prepared by a previously developed method, genes of which expression level is high are apt to be cloned at a high frequency, whereas genes of which expression level are low, are difficult to be cloned. A low-expression gene has been cloned at very low frequency. Therefore, the gene encoding the key enzyme that is involved in growth disturbance of rice pollen has not been identified. In this study, development of a library preparing method able to correct the expression level was attempted using highly sensitive detection method with radioisotope and some genes related to cold-resistance of rice were isolated. Double strand DNAs were synthesized using mRNA extract from rice anthers and annealed following heat-denaturation. It has been known that single strand DNA molecules abundantly existing in DNA solution can easily aggregate to form double strand DNA, but single stranded DNA molecules poor in the solution are apt to still remain as single strand after annealing. Thus, the amount of single strand DNA would be balanced in the solution between abundant DNA and poor DNA species. The authors succeeded to prepare a gene library including low and high expression genes at similar proportions. Moreover, spin trap method that allows RI labeling of DNA bound to latex particle, was developed to detect with high sensitivity, especially for genes that are expressed at low level. The present method could be used for recovery, detection and quantitative analysis of radiolabeled single strand DNA. Thus, it was demonstrated that the stage from tetrad sperm to small sperm might be easily affected by cold stress. The present results suggest that the expressions of β-1 and β-3 glucanase, which are involved in the release of small sperms following meiosis in the pollen formation, might be easily affected by cold stress. (M.N.)

  14. A defect in the thymidine kinase 2 gene causing isolated mitochondrial myopathy without mtDNA depletion.

    Science.gov (United States)

    Leshinsky-Silver, E; Michelson, M; Cohen, S; Ginsberg, M; Sadeh, M; Barash, V; Lerman-Sagie, T; Lev, D

    2008-07-01

    Isolated mitochondrial myopathies (IMM) are either due to primary defects in mtDNA, in nuclear genes that control mtDNA abundance and structure such as thymidine kinase 2 (TK2), or due to CoQ deficiency. Defects in the TK2 gene have been found to be associated with mtDNA depletion attributed to a depleted mitochondrial dNTP pool in non-dividing cells. We report an unusual case of IMM, homozygous for the H90N mutation in the TK2 gene but unlike other cases with the same mutation, does not demonstrate mtDNA depletion. The patient's clinical course is relatively mild and a muscle biopsy showed ragged red muscle fibers with a mild decrease in complexes I and an increase in complexes IV and II activities. This report extends the phenotypic expression of TK2 defects and suggests that all patients who present with an IMM even with normal quantities of mtDNA should be screened for TK2 mutations.

  15. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells.

    Science.gov (United States)

    Kostyuk, Svetlana; Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia

    2015-01-01

    Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose-derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis.

  16. DNA repair gene polymorphisms in relation to chromosome aberration frequencies in retired radiation workers

    International Nuclear Information System (INIS)

    Wilding, Craig S.; Relton, Caroline L.; Rees, Gwen S.; Tarone, Robert E.; Whitehouse, Caroline A.; Tawn, E. Janet

    2005-01-01

    Polymorphic variation in DNA repair genes was examined in a group of retired workers from the British Nuclear Fuels plc facility at Sellafield in relation to previously determined translocation frequencies in peripheral blood lymphocytes. Variation at seven polymorphisms in four genes involved in the base excision repair (XRCC1 R194W, R399Q and a [AC] n microsatellite in the 3' UTR) and double strand break repair (XRCC3 T241M and a [AC] n microsatellite in intron 3 of XRCC3, XRCC4 I134T, and a GACTAn microsatellite located 120kb 5' of XRCC5) pathways was determined for 291 retired radiation workers who had received cumulative occupational external radiation doses of between 0 and 1873mSv. When the interaction between radiation dose and each DNA repair gene polymorphism was examined in relation to translocation frequency there was no evidence for any of the polymorphisms studied influencing the response to occupational exposure. A positive interaction observed between genotype (individuals with at least one allele >=20 repeat units) at a microsatellite locus in the XRCC3 gene and smoking status should be interpreted cautiously because interactions were investigated for seven polymorphisms and two exposures. Nonetheless, further research is warranted to examine whether this DNA repair gene variant might be associated with a sub-optimal repair response to smoking-induced DNA damage and hence an increased frequency of translocations

  17. Corruption of the intra-gene DNA methylation architecture is a hallmark of cancer.

    Science.gov (United States)

    Bartlett, Thomas E; Zaikin, Alexey; Olhede, Sofia C; West, James; Teschendorff, Andrew E; Widschwendter, Martin

    2013-01-01

    Epigenetic processes--including DNA methylation--are increasingly seen as having a fundamental role in chronic diseases like cancer. It is well known that methylation levels at particular genes or loci differ between normal and diseased tissue. Here we investigate whether the intra-gene methylation architecture is corrupted in cancer and whether the variability of levels of methylation of individual CpGs within a defined gene is able to discriminate cancerous from normal tissue, and is associated with heterogeneous tumour phenotype, as defined by gene expression. We analysed 270985 CpGs annotated to 18272 genes, in 3284 cancerous and 681 normal samples, corresponding to 14 different cancer types. In doing so, we found novel differences in intra-gene methylation pattern across phenotypes, particularly in those genes which are crucial for stem cell biology; our measures of intra-gene methylation architecture are a better determinant of phenotype than measures based on mean methylation level alone (K-S test [Formula: see text] in all 14 diseases tested). These per-gene methylation measures also represent a considerable reduction in complexity, compared to conventional per-CpG beta-values. Our findings strongly support the view that intra-gene methylation architecture has great clinical potential for the development of DNA-based cancer biomarkers.

  18. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    Science.gov (United States)

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Differential structural status of the RNA counterpart of an undecamer quasi-palindromic DNA sequence present in LCR of human β-globin gene cluster.

    Science.gov (United States)

    Kaushik, Mahima; Kukreti, Shrikant

    2015-01-01

    Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.

  20. Coordinate regulation of stromelysin and collagenase genes determined with cDNA probes

    International Nuclear Information System (INIS)

    Frisch, S.M.; Clark, E.J.; Werb, Z.

    1987-01-01

    Secreted proteinases are required for tumor metastasis, angiogenesis, and tissue remodeling during wound healing and embryonic growth. Thus, the regulation of the genes of secreted proteinases may serve as an interesting model for growth-controlled genes in general. The authors studied the genes of the secreted proteinases stromelysin and collagenase by using molecularly cloned cDNAs from each proteinase. Stromelysin cDNA was cloned by differential screening of a total cDNA library from rabbit synovial cells treated with phorbol 12-myristate 13-acetate, which yielded a clone of 1.2 kilobase pairs; collagenase cDNA was obtained by cloning reverse transcripts of anti-collagenase-immunoadsorbed polysomal mRNA, which yielded a clone of 0.8 kilobase pairs. Stromelysin and collagenase mRNA species of 2.2 and 2.4 kilobases, respectively, were detected on hybridization blots of RNA from phorbol 12-myristate 13-acetate-treated but not untreated rabbit synovial cells. Expression of stromelysin mRNA was also induced in rabbit alveolar macrophages and rabbit brain capillary endothelial cells treated with phorbol 12-myristate 13-acetate. Stromelysin and collagenase mRNA were both induced by phorbol 12-myristate 13-acetate and cytochalasin B at a constant ratio of the two gene products; this suggest coordinate regulation. The fact that induction was blocked after inhibition of protein synthesis by cycloheximide implicates an indirect signal transduction pathway that requires new protein synthesis

  1. A novel Listeria monocytogenes-based DNA delivery system for cancer gene therapy.

    LENUS (Irish Health Repository)

    van Pijkeren, Jan Peter

    2012-01-31

    Bacteria-mediated transfer of plasmid DNA to mammalian cells (bactofection) has been shown to have significant potential as an approach to express heterologous proteins in various cell types. This is achieved through entry of the entire bacterium into cells, followed by release of plasmid DNA. In a murine model, we show that Listeria monocytogenes can invade and spread in tumors, and establish the use of Listeria to deliver genes to tumors in vivo. A novel approach to vector lysis and release of plasmid DNA through antibiotic administration was developed. Ampicillin administration facilitated both plasmid transfer and safety control of vector. To further improve on the gene delivery system, we selected a Listeria monocytogenes derivative that is more sensitive to ampicillin, and less pathogenic than the wild-type strain. Incorporation of a eukaryotic-transcribed lysin cassette in the plasmid further increased bacterial lysis. Successful gene delivery of firefly luciferase to growing tumors in murine models and to patient breast tumor samples ex vivo was achieved. The model described encompasses a three-phase treatment regimen, involving (1) intratumoral administration of vector followed by a period of vector spread, (2) systemic ampicillin administration to induce vector lysis and plasmid transfer, and (3) systemic administration of combined moxifloxacin and ampicillin to eliminate systemic vector. For the first time, our results reveal the potential of Listeria monocytogenes for in vivo gene delivery.

  2. Digital quantification of gene methylation in stool DNA by emulsion-PCR coupled with hydrogel immobilized bead-array.

    Science.gov (United States)

    Liu, Yunlong; Wu, Haiping; Zhou, Qiang; Song, Qinxin; Rui, Jianzhong; Zou, Bingjie; Zhou, Guohua

    2017-06-15

    Aberrations of gene methylation in stool DNA (sDNA) is an effective biomarker for non-invasive colorectal cancer diagnosis. However, it is challenging to accurately quantitate the gene methylation levels in sDNA due to the low abundance and degradation of sDNA. In this study, a digital quantification strategy was proposed by combining emulsion PCR (emPCR) with hydrogel immobilized bead-array. The assay includes following steps: bisulfite conversion of sDNA, pre-amplification by PCR with specific primers containing 5' universal sequences, emPCR of pre-amplicons with beaded primers to achieve single-molecular amplification and identification of hydrogel embedding beads coated with amplicons. The sensitivity and the specificity of the method are high enough to pick up 0.05% methylated targets from unmethylated DNA background. The successful detection of hypermethylated vimentin gene in clinical stool samples suggests that the proposed method should be a potential tool for non-invasive colorectal cancer screening. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. A Small-Molecule Inducible Synthetic Circuit for Control of the SOS Gene Network without DNA Damage.

    Science.gov (United States)

    Kubiak, Jeffrey M; Culyba, Matthew J; Liu, Monica Yun; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

    2017-11-17

    The bacterial SOS stress-response pathway is a pro-mutagenic DNA repair system that mediates bacterial survival and adaptation to genotoxic stressors, including antibiotics and UV light. The SOS pathway is composed of a network of genes under the control of the transcriptional repressor, LexA. Activation of the pathway involves linked but distinct events: an initial DNA damage event leads to activation of RecA, which promotes autoproteolysis of LexA, abrogating its repressor function and leading to induction of the SOS gene network. These linked events can each independently contribute to DNA repair and mutagenesis, making it difficult to separate the contributions of the different events to observed phenotypes. We therefore devised a novel synthetic circuit to unlink these events and permit induction of the SOS gene network in the absence of DNA damage or RecA activation via orthogonal cleavage of LexA. Strains engineered with the synthetic SOS circuit demonstrate small-molecule inducible expression of SOS genes as well as the associated resistance to UV light. Exploiting our ability to activate SOS genes independently of upstream events, we further demonstrate that the majority of SOS-mediated mutagenesis on the chromosome does not readily occur with orthogonal pathway induction alone, but instead requires DNA damage. More generally, our approach provides an exemplar for using synthetic circuit design to separate an environmental stressor from its associated stress-response pathway.

  4. DNA probe labeling with digoxigenin-dUTP and its application in gene diagnosis

    International Nuclear Information System (INIS)

    Liu Guoyang

    1992-01-01

    DNA probe labeling by the randomly primed incorporation of digoxigenin-dUTP is reported. The sensitivity of color reaction and hybridization were 32 fg and 200 fg, respectively, and both were specific for the target. Single-copy and multi-copy gene fragments among 2 μg human genomic DNA were detected by β IVS II, Fr 3-42 and 3'HVR labeled with digoxigenin-dUTP. The results were consistent with a radioactive control assay. This method has been successfully used in the gene diagnosis of adult polycystic kidney disease

  5. CDKL5 is a brain MeCP2 target gene regulated by DNA methylation.

    Science.gov (United States)

    Carouge, Delphine; Host, Lionel; Aunis, Dominique; Zwiller, Jean; Anglard, Patrick

    2010-06-01

    Rett syndrome and its "early-onset seizure" variant are severe neurodevelopmental disorders associated with mutations within the MECP2 and the CDKL5 genes. Antidepressants and drugs of abuse induce the expression of the epigenetic factor MeCP2, thereby influencing chromatin remodeling. We show that increased MeCP2 levels resulted in the repression of Cdkl5 in rat brain structures in response to cocaine, as well as in cells exposed to serotonin, or overexpressing MeCP2. In contrast, Cdkl5 was induced by siRNA-mediated knockdown of Mecp2 and by DNA-methyltransferase inhibitors, demonstrating its regulation by MeCP2 and by DNA methylation. Cdkl5 gene methylation and its methylation-dependent binding to MeCP2 were increased in the striatum of cocaine-treated rats. Our data demonstrate that Cdkl5 is a MeCP2-repressed target gene providing a link between genes the mutation of which generates overlapping symptoms. They highlight DNA methylation changes as a potential mechanism participating in the long-term plasticity triggered by pharmacological agents.

  6. Epigenetic Alteration by DNA Promoter Hypermethylation of Genes Related to Transforming Growth Factor-β (TGF-β Signaling in Cancer

    Directory of Open Access Journals (Sweden)

    Kiyoshi Mori

    2011-03-01

    Full Text Available Epigenetic alterations in cancer, especially DNA methylation and histone modification, exert a significant effect on the deregulated expression of cancer-related genes and lay an epigenetic pathway to carcinogenesis and tumor progression. Global hypomethylation and local hypermethylation of CpG islands in the promoter region, which result in silencing tumor suppressor genes, constitute general and major epigenetic modification, the hallmark of the neoplastic epigenome. Additionally, methylation-induced gene silencing commonly affects a number of genes and increases with cancer progression. Indeed, cancers with a high degree of methylation (CpG island methylator phenotype/CIMP do exist and represent a distinct subset of certain cancers including colorectal, bladder and kidney. On the other hand, signals from the microenvironment, especially those from transforming growth factor-β (TGF-β, induce targeted de novo epigenetic alterations of cancer-related genes. While TGF-β signaling has been implicated in two opposite roles in cancer, namely tumor suppression and tumor promotion, its deregulation is also partly induced by epigenetic alteration itself. Although the epigenetic pathway to carcinogenesis and cancer progression has such reciprocal complexity, the important issue is to identify genes or signaling pathways that are commonly silenced in various cancers in order to find early diagnostic and therapeutic targets. In this review, we focus on the epigenetic alteration by DNA methylation and its role in molecular modulations of the TGF-β signaling pathway that cause or underlie altered cancer-related gene expression in both phases of early carcinogenesis and late cancer progression.

  7. Cloning of the PYR3 gene of Ustilago maydis and its use in DNA transformation

    Energy Technology Data Exchange (ETDEWEB)

    Banks, G.R.; Taylor, S.Y. (National Institute for Medical Research, London (England))

    1988-12-01

    The Ustilago maydis PYR3 gene encoding dihydroorotase activity was cloned by direct complementation of Escherichia coli pyrC mutations. PYR3 transformants of E. coli pyrC mutants expressed homologous transcripts of a variety of sizes and regained dihydroorotase activity. PYR3 also complemented Saccharomyces cerevisiae ura4 mutations, and again multiple transcripts were expressed in transformants, and enzyme activity was regained. A 1.25-kilobase poly(rA)+ PYR3 transcript was detected in U. maydis itself. Linear DNA carrying the PYR3 gene transformed a U. maydis pyr3-1 pyrimidine auxotroph to prototrophy. Hybridization analysis revealed that three different types of transformants could be generated, depending on the structure of the transforming DNA used. The first type involved exchange of chromosomal mutant gene sequences with the cloned wild-type plasmid sequences. A second type had integrated linear transforming DNA at the chromosomal PYR3 locus, probably via a single crossover event. The third type had integrated transforming DNA sequences at multiple sites in the U. maydis genome. In the last two types, tandemly reiterated copies of the transforming DNA were found to have been integrated. All three types had lost the sensitivity of the parental pyr3-1 mutant to UV irradiation. They had also regained dihydroorotase activity, although its level did not correlate with the PYR3 gene copy number.

  8. Development and validation of an integrated DNA walking strategy to detect GMO expressing cry genes.

    Science.gov (United States)

    Fraiture, Marie-Alice; Vandamme, Julie; Herman, Philippe; Roosens, Nancy H C

    2018-06-27

    Recently, an integrated DNA walking strategy has been proposed to prove the presence of GMO via the characterisation of sequences of interest, including their transgene flanking regions and the unnatural associations of elements in their transgenic cassettes. To this end, the p35S, tNOS and t35S pCAMBIA elements have been selected as key targets, allowing the coverage of most of GMO, EU authorized or not. In the present study, a bidirectional DNA walking method anchored on the CryAb/c genes is proposed with the aim to cover additional GMO and additional sequences of interest. The performance of the proposed bidirectional DNA walking method anchored on the CryAb/c genes has been evaluated in a first time for its feasibility using several GM events possessing these CryAb/c genes. Afterwards, its sensitivity has been investigated through low concentrations of targets (as low as 20 HGE). In addition, to illustrate its applicability, the entire workflow has been tested on a sample mimicking food/feed matrices analysed in GMO routine analysis. Given the successful assessment of its performance, the present bidirectional DNA walking method anchored on the CryAb/c genes can easily be implemented in GMO routine analysis by the enforcement laboratories and allows completing the entire DNA walking strategy in targeting an additional transgenic element frequently found in GMO.

  9. Extraction of Total DNA and RNA from Marine Filter Samples and Generation of a cDNA as Universal Template for Marker Gene Studies.

    Science.gov (United States)

    Schneider, Dominik; Wemheuer, Franziska; Pfeiffer, Birgit; Wemheuer, Bernd

    2017-01-01

    Microbial communities play an important role in marine ecosystem processes. Although the number of studies targeting marker genes such as the 16S rRNA gene has been increased in the last few years, the vast majority of marine diversity is rather unexplored. Moreover, most studies focused on the entire bacterial community and thus disregarded active microbial community players. Here, we describe a detailed protocol for the simultaneous extraction of DNA and RNA from marine water samples and for the generation of cDNA from the isolated RNA which can be used as a universal template in various marker gene studies.

  10. Alterations in radioresistance of eucaryotic cells after the transfer of genomic wildtype DNA and metallothionein genes

    International Nuclear Information System (INIS)

    Lohrer, H.

    1987-01-01

    The presented paper describes experiments concerning the alteration of radiosensitivity of eucaryotic cells after gene transfer. Ionizing radiation (γ- or X-ray) induces DNA single- or double strand breaks, which are religated by an unknown repair system. Repair deficient cells are highly sensitive to ionizing radiation. In the experiments described, cells from a patient with the heritable disease Ataxia telangiectasia were used as well as two X-ray sensitive CHO mutant cell lines. After gene transfer of an intact human DNA repair gene or a metallothionein gene the cells should regain radioresistance. (orig.) [de

  11. Anchoring of self-assembled plasmid DNA/ anti-DNA antibody/cationic lipid micelles on bisphosphonate-modified stent for cardiovascular gene delivery

    Directory of Open Access Journals (Sweden)

    Ma G

    2013-03-01

    Full Text Available Guilei Ma,1,# Yong Wang,1,# Ilia Fishbein,2 Mei Yu,1 Linhua Zhang,1 Ivan S Alferiev,2 Jing Yang,1 Cunxian Song,1 Robert J Levy2 1Institute of Biomedical Engineering, Chinese Academy of Medical Sciences and Peking Union Medical College, Tianjin, People's Republic of China; 2Children's Hospital of Philadelphia, Abramson Research Building, Philadelphia, PA, USA #These authors contributed equally to this work Purpose: To investigate the anchoring of plasmid DNA/anti-DNA antibody/cationic lipid tri-complex (DAC micelles onto bisphosphonate-modified 316 L coronary stents for cardiovascular site-specific gene delivery. Methods: Stents were first modified with polyallylamine bisphosphonate (PAA-BP, thereby enabling the retention of a PAA-BP molecular monolayer that permits the anchoring (via vector-binding molecules of DAC micelles. DAC micelles were then chemically linked onto the PAA-BP-modified stents by using N-succinimidyl-3-(2-pyridyldithiol-propionate (SPDP as a crosslinker. Rhodamine-labeled DNA was used to assess the anchoring of DAC micelles, and radioactive-labeled antibody was used to evaluate binding capacity and stability. DAC micelles (encoding green fluorescent protein were tethered onto the PAA-BP-modified stents, which were assessed in cell culture. The presence of a PAA-BP molecular monolayer on the steel surface was confirmed by X-ray photoelectron spectroscopy and atomic force microscope analysis. Results: The anchoring of DAC micelles was generally uniform and devoid of large-scale patches of defects. Isotopic quantification confirmed that the amount of antibody chemically linked on the stents was 17-fold higher than that of the physical adsorbed control stents and its retention time was also significantly longer. In cell culture, numerous green fluorescent protein-positive cells were found on the PAA-BP modified stents, which demonstrated high localization and efficiency of gene delivery. Conclusion: The DAC micelle

  12. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Science.gov (United States)

    Birla, Bhagyashree S; Chou, Hui-Hsien

    2015-01-01

    Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  13. Rational Design of High-Number dsDNA Fragments Based on Thermodynamics for the Construction of Full-Length Genes in a Single Reaction.

    Directory of Open Access Journals (Sweden)

    Bhagyashree S Birla

    Full Text Available Gene synthesis is frequently used in modern molecular biology research either to create novel genes or to obtain natural genes when the synthesis approach is more flexible and reliable than cloning. DNA chemical synthesis has limits on both its length and yield, thus full-length genes have to be hierarchically constructed from synthesized DNA fragments. Gibson Assembly and its derivatives are the simplest methods to assemble multiple double-stranded DNA fragments. Currently, up to 12 dsDNA fragments can be assembled at once with Gibson Assembly according to its vendor. In practice, the number of dsDNA fragments that can be assembled in a single reaction are much lower. We have developed a rational design method for gene construction that allows high-number dsDNA fragments to be assembled into full-length genes in a single reaction. Using this new design method and a modified version of the Gibson Assembly protocol, we have assembled 3 different genes from up to 45 dsDNA fragments at once. Our design method uses the thermodynamic analysis software Picky that identifies all unique junctions in a gene where consecutive DNA fragments are specifically made to connect to each other. Our novel method is generally applicable to most gene sequences, and can improve both the efficiency and cost of gene assembly.

  14. Dietary Berries and Ellagic Acid Prevent Oxidative DNA Damage and Modulate Expression of DNA Repair Genes

    Directory of Open Access Journals (Sweden)

    Ramesh C. Gupta

    2008-03-01

    Full Text Available DNA damage is a pre-requisite for the initiation of cancer and agents that reduce this damage are useful in cancer prevention. In this study, we evaluated the ability of whole berries and berry phytochemical, ellagic acid to reduce endogenous oxidative DNA damage. Ellagic acid was selected based on > 95% inhibition of 8-oxodeoxyguosine (8-oxodG and other unidentified oxidative DNA adducts induced by 4-hydroxy-17B;-estradiol and CuCl2 in vitro. Inhibition of the latter occurred at lower concentrations (10 u(microM than that for 8-oxodG (100 u(microM. In the in vivo study, female CD-1 mice (n=6 were fed either a control diet or diet supplemented with ellagic acid (400 ppm and dehydrated berries (5% w/w with varying ellagic acid contents -- blueberry (low, strawberry (medium and red raspberry (high, for 3 weeks. Blueberry and strawberry diets showed moderate reductions in endogenous DNA adducts (25%. However, both red raspberry and ellagic acid diets showed a significant reduction of 59% (p < 0.001 and 48% (p < 0.01, respectively. Both diets also resulted in a 3-8 fold over-expression of genes involved in DNA repair such as xeroderma pigmentosum group A complementing protein (XPA, DNA excision repair protein (ERCC5 and DNA ligase III (DNL3. These results suggest that red raspberry and ellagic acid reduce endogenous oxidative DNA damage by mechanisms which may involve increase in DNA repair.

  15. Genomics and radical mediated DNA damage: major differences between ionizing radiation and DNA-cleaving enediynes

    International Nuclear Information System (INIS)

    Cosgrove, J.P.; Begley, T.J.; Samson, L.D.; Dedon, P.C.

    2003-01-01

    While the evidence is strong for radical-mediated oxidative processes in the pathophysiology of cancer and aging, the mechanisms by which cells respond to oxidative stress have eluded definition. To this end, we have undertaken genomic studies comparing the response of S. cerevisiae to DNA-specific oxidizing agents, the enediynes calicheamicin (CAL), esperamicin (ESP), and neocarzinostatin (NCS), and the non-specific gamma-radiation (RAD). While RAD results in relatively indiscriminate oxidation of cellular molecules, the enediynes are highly specific to DNA and produce damage by a common mechanism involving radical-mediated oxidation of deoxyribose. Transcriptional profiling in response to these agents (80% survival; 15 min exposure; Affymetrix) revealed unexpected differences between RAD and the enediynes and among the three enediynes. Only 2 genes responded in common to all agents, while 9 genes were regulated in common for the 3 enediynes (no DNA repair genes altered in common). The limited common gene expression changes for the 3 enediynes may result from differences in deoxyribose oxidation chemistry, DNA and chromatin targets or the proportions of single- and double-strand DNA lesions. RAD produced a more robust response than the enediynes, altering expression of 195 and 52 genes by more than 2- and 5-fold, respectively, compared to 16-44 and *2 genes, respectively, for the enediynes. This suggests that the transcriptional response varies in intensity according to the number of cellular features affected by the toxin. Genes showing the strongest up-regulation with RAD: ribonucleotide reductase, multidrug resistance, DS break repair/RAD51, GSH transferase; strongly reduced gene expression: TEL1 (damage signaling), NAT2 (acetyltransferase). Genomic phenotyping studies, using a subset of the Research Genetics deletion library, revealed that loss of apn1, the major AP endonuclease, caused resistance to NCS, possibly due to reduced formation of protein-DNA cross

  16. Application of DNA chips in the analysis of gene mutation in HBV

    International Nuclear Information System (INIS)

    Wang Yongzhong; Ruan Lihua; Zhou Guoping; Wu Guoxiang; Chen Min

    2005-01-01

    Objective: To investigate the clinical applicability of DNA chips for analysis of gene mutation in HBV. Methods: Serum HBV DNA from 47 patients with viral hepatitis type B was amplified with PCR. Possible gene mutations were searched for in site 1896 of pre-C section, sites 1762,1764 of BCP section and sites 528, 552 of P section with DNA chip method based upon membrane coloration. Results: In the 32 patients without lamivudine treatment, the results were as follows: (1) 6 specimens with HBsAg + , HBeAg + , HBeAb - , no mutations observed. (2) 13 specimens with HBsAg + , HBeAg - , HBeAb + , mutations at site 1896, pre- C 4 cases, mutations at sites 1762,1764, BCP 11 cases. (3) 13 specimens with HBsAg + , HBeAg + , HBeAb + , mutations at site 1896 pre -C 4 cases, mutations at sites 1762,1764 BCP 13 cases. In the 15 patients after 48 weeks treatment with lamivudine but remained HBV DNA positive, mutations were observed at: site 1896 pre-C, 5 cases, sites 1762,1764 BCP, 6 cases, site 528 P section, 2 cases, site 552 P section, YVDD 4 cases, YIDD 7 cases. Conclusion: Mutations at sites 1896, 1762,1764 were more frequent in patients with HBeAb + and were related to the negative expression of HBeAg, Mutations at 1762,1764 BCP were closely related to the changes of HBeAg/HBeAb. P section mutations were only observed after lamivadine treatment and were related to resistance against the drug. DNA chip method based upon membrane coloration for detection of gene mutation was expedient and specific and worth popularization. (authors)

  17. Dynamic DNA cytosine methylation in the Populus trichocarpa genome: tissue-level variation and relationship to gene expression

    Directory of Open Access Journals (Sweden)

    Vining Kelly J

    2012-01-01

    Full Text Available Abstract Background DNA cytosine methylation is an epigenetic modification that has been implicated in many biological processes. However, large-scale epigenomic studies have been applied to very few plant species, and variability in methylation among specialized tissues and its relationship to gene expression is poorly understood. Results We surveyed DNA methylation from seven distinct tissue types (vegetative bud, male inflorescence [catkin], female catkin, leaf, root, xylem, phloem in the reference tree species black cottonwood (Populus trichocarpa. Using 5-methyl-cytosine DNA immunoprecipitation followed by Illumina sequencing (MeDIP-seq, we mapped a total of 129,360,151 36- or 32-mer reads to the P. trichocarpa reference genome. We validated MeDIP-seq results by bisulfite sequencing, and compared methylation and gene expression using published microarray data. Qualitative DNA methylation differences among tissues were obvious on a chromosome scale. Methylated genes had lower expression than unmethylated genes, but genes with methylation in transcribed regions ("gene body methylation" had even lower expression than genes with promoter methylation. Promoter methylation was more frequent than gene body methylation in all tissues except male catkins. Male catkins differed in demethylation of particular transposable element categories, in level of gene body methylation, and in expression range of genes with methylated transcribed regions. Tissue-specific gene expression patterns were correlated with both gene body and promoter methylation. Conclusions We found striking differences among tissues in methylation, which were apparent at the chromosomal scale and when genes and transposable elements were examined. In contrast to other studies in plants, gene body methylation had a more repressive effect on transcription than promoter methylation.

  18. The Tyrosyl-DNA Phosphodiesterase 1β (Tdp1β Gene Discloses an Early Response to Abiotic Stresses

    Directory of Open Access Journals (Sweden)

    Maria Elisa Sabatini

    2017-11-01

    Full Text Available Tyrosyl-DNA phosphodiesterase 1 (Tdp1 is involved in DNA repair pathways as it mends the topoisomerase I—DNA covalent complexes. In plants, a small Tdp1 gene family, composed by Tdp1α and Tdp1β genes, was identified, but the roles of these genes in abiotic stress responses are not fully understood. To investigate their specific stress response patterns, the present study made use of bioinformatic and molecular tools to look into the Tdp1β gene function, so far described only in the plant kingdom, and compare it with Tdp1α gene coding for the canonical, highly conserved α isoform. The expression profiles of Tdp1α and Tdp1β genes were examined under abiotic stress conditions (cold, heat, high osmolarity, salt, and UV-B in two model species, Arabidopsis thaliana and Medicago truncatula. The two isoforms of topoisomerase I (TOP1α and TOP1β were also taken into consideration in view of their known roles in DNA metabolism and cell proliferation. Data relative to gene expression in Arabidopsis were retrieved from the AtGenExpress microarray dataset, while quantitative Real-Time PCR was carried out to evaluate the stress response in M. truncatula cell cultures. These analyses revealed that Tdp1β gene expression was enhanced during the first hour of treatment, whereas Tdp1α enhanced expression succeeded at subsequent timepoints. In agreement with the gene-specific responses to abiotic stress conditions, the promoter regions of Tdp1α and Tdp1β genes are well equipped with stress-related cis-elements. An in-depth bioinformatic characterization of the HIRAN motif, a distinctive feature of the Tdp1β protein, showed its wide distribution in chromatin remodeling and DNA repair proteins. The reported data suggests that Tdp1β functions in the early response to abiotic stresses.

  19. Immunohistochemical loss of 5-hydroxymethylcytosine expression in acute myeloid leukaemia: relationship to somatic gene mutations affecting epigenetic pathways.

    Science.gov (United States)

    Magotra, Minoti; Sakhdari, Ali; Lee, Paul J; Tomaszewicz, Keith; Dresser, Karen; Hutchinson, Lloyd M; Woda, Bruce A; Chen, Benjamin J

    2016-12-01

    Genes affecting epigenetic pathways are frequently mutated in myeloid malignancies, including acute myeloid leukaemia (AML). The genes encoding TET2, IDH1 and IDH2 are among the most commonly mutated genes, and cause defective conversion of 5-methylcytosine into 5-hydroxymethylcytosine (5hmC), impairing demethylation of DNA, and presumably serving as driver mutations in leukaemogenesis. The aim of this study was to correlate 5hmC immunohistochemical loss with the mutation status of genes involved in epigenetic pathways in AML. Immunohistochemical staining with an anti-5hmC antibody was performed on 41 decalcified, formalin-fixed paraffin-embedded (FFPE) bone marrow biopsies from patients with AML. Archived DNA was subjected to next-generation sequencing for analysis of a panel of genes, including TET2, IDH1, IDH2, WT1 and DNMT3A. TET2, IDH1, IDH2, WT1 and DNMT3A mutations were found in 46% (19/41) of the cases. Ten of 15 cases (67%) with TET2, IDH1, IDH2 or WT1 mutations showed deficient 5hmC staining, whereas nine of 26 cases (35%) without a mutation in these genes showed loss of 5hmC. It is of note that all four cases with TET2 mutations showed deficient 5hmC staining. Overall, somatic mutations in TET2, IDH1, IDH2, WT1 and DNMT3A were common in our cohort of AML cases. Immunohistochemical staining for 5hmC was lost in the majority of cases harbouring mutations in these genes, reflecting the proposed relationship between dysfunctional epigenetic pathways and leukaemogenesis. © 2016 John Wiley & Sons Ltd.

  20. DNA Methylation and Gene Expression Profiling of Ewing Sarcoma Primary Tumors Reveal Genes That Are Potential Targets of Epigenetic Inactivation

    Directory of Open Access Journals (Sweden)

    Nikul Patel

    2012-01-01

    Full Text Available The role of aberrant DNA methylation in Ewing sarcoma is not completely understood. The methylation status of 503 genes in 52 formalin-fixed paraffin-embedded EWS tumors and 3 EWS cell lines was compared to human mesenchymal stem cell primary cultures (hMSCs using bead chip methylation analysis. Relative expression of methylated genes was assessed in 5-Aza-2-deoxycytidine-(5-AZA-treated EWS cell lines and in a cohort of primary EWS samples and hMSCs by gene expression and quantitative RT-PCR. 129 genes demonstrated statistically significant hypermethylation in EWS tumors compared to hMSCs. Thirty-six genes were profoundly methylated in EWS and unmethylated in hMSCs. 5-AZA treatment of EWS cell lines resulted in upregulation of expression of hundreds of genes including 162 that were increased by at least 2-fold. The expression of 19 of 36 candidate hypermethylated genes was increased following 5-AZA. Analysis of gene expression from an independent cohort of tumors confirmed decreased expression of six of nineteen hypermethylated genes (AXL, COL1A1, CYP1B1, LYN, SERPINE1, and VCAN. Comparing gene expression and DNA methylation analyses proved to be an effective way to identify genes epigenetically regulated in EWS. Further investigation is ongoing to elucidate the role of these epigenetic alterations in EWS pathogenesis.

  1. A comparison of digital gene expression profiling and methyl DNA immunoprecipitation as methods for gene discovery in honeybee (Apis mellifera behavioural genomic analyses.

    Directory of Open Access Journals (Sweden)

    Cui Guan

    Full Text Available The honey bee has a well-organized system of division of labour among workers. Workers typically progress through a series of discrete behavioural castes as they age, and this has become an important case study for exploring how dynamic changes in gene expression can influence behaviour. Here we applied both digital gene expression analysis and methyl DNA immunoprecipitation analysis to nurse, forager and reverted nurse bees (nurses that have returned to the nursing state after a period spent foraging from the same colony in order to compare the outcomes of these different forms of genomic analysis. A total of 874 and 710 significantly differentially expressed genes were identified in forager/nurse and reverted nurse/forager comparisons respectively. Of these, 229 genes exhibited reversed directions of gene expression differences between the forager/nurse and reverted nurse/forager comparisons. Using methyl-DNA immunoprecipitation combined with high-throughput sequencing (MeDIP-seq we identified 366 and 442 significantly differentially methylated genes in forager/nurse and reverted nurse/forager comparisons respectively. Of these, 165 genes were identified as differentially methylated in both comparisons. However, very few genes were identified as both differentially expressed and differentially methylated in our comparisons of nurses and foragers. These findings confirm that changes in both gene expression and DNA methylation are involved in the nurse and forager behavioural castes, but the different analytical methods reveal quite distinct sets of candidate genes.

  2. Functional analyses of PtRDM1 gene overexpression in poplars and evaluation of its effect on DNA methylation and response to salt stress.

    Science.gov (United States)

    Movahedi, Ali; Zhang, Jiaxin; Sun, Weibo; Mohammadi, Kourosh; Almasi Zadeh Yaghuti, Amir; Wei, Hui; Wu, Xiaolong; Yin, Tongming; Zhuge, Qiang

    2018-06-01

    Epigenetic modification by DNA methylation is necessary for all cellular processes, including genetic expression events, DNA repair, genomic imprinting and regulation of tissue development. It occurs almost exclusively at the C5 position of symmetric CpG and asymmetric CpHpG and CpHpH sites in genomic DNA. The RNA-directed DNA methylation (RDM1) gene is crucial for heterochromatin and DNA methylation. We overexpressed PtRDM1 gene from Populus trichocarpa to amplify transcripts of orthologous RDM1 in 'Nanlin895' (P. deltoides × P. euramericana 'Nanlin895'). This overexpression resulted in increasing RDM1 transcript levels: by ∼150% at 0 mM NaCl treatment and by ∼300% at 60 mM NaCl treatment compared to WT (control) poplars. Genomic cytosine methylation was monitored within 5.8S rDNA and histone H3 loci by bisulfite sequencing. In total, transgenic poplars revealed more DNA methylation than WT plants. In our results, roots revealed more methylated CG contexts than stems and leaves whereas, histone H3 presented more DNA methylation than 5.8S rDNA in both WT and transgenic poplars. The NaCl stresses enhanced more DNA methylation in transgenic poplars than WT plants through histone H3 and 5.8 rDNA loci. Also, the overexpression of PtRDM1 resulted in hyper-methylation, which affected plant phenotype. Transgenic poplars revealed significantly more regeneration of roots than WT poplars via NaCl treatments. Our results proved that RDM1 protein enhanced the DNA methylation by chromatin remodeling (e.g. histone H3) more than repetitive DNA sequences (e.g. 5.8S rDNA). Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  3. Development of Gene Expression Fingerprints for Identification of Environmental Contaminants Using cDNA Arrays

    National Research Council Canada - National Science Library

    Inouye, L

    2004-01-01

    ...) to develop cDNA array-based assays that map gene expression from contaminant exposures. Results substantiate that distinct gene expression profiles exist for major contaminant classes such as PARs, PCBs, and PCDD/Fs...

  4. Ternary polyplex micelles with PEG shells and intermediate barrier to complexed DNA cores for efficient systemic gene delivery.

    Science.gov (United States)

    Li, Junjie; Chen, Qixian; Zha, Zengshi; Li, Hui; Toh, Kazuko; Dirisala, Anjaneyulu; Matsumoto, Yu; Osada, Kensuke; Kataoka, Kazunori; Ge, Zhishen

    2015-07-10

    Simultaneous achievement of prolonged retention in blood circulation and efficient gene transfection activity in target tissues has always been a major challenge hindering in vivo applications of nonviral gene vectors via systemic administration. Herein, we constructed novel rod-shaped ternary polyplex micelles (TPMs) via complexation between the mixed block copolymers of poly(ethylene glycol)-b-poly{N'-[N-(2-aminoethyl)-2-aminoethyl]aspartamide} (PEG-b-PAsp(DET)) and poly(N-isopropylacrylamide)-b-PAsp(DET) (PNIPAM-b-PAsp(DET)) and plasmid DNA (pDNA) at room temperature, exhibiting distinct temperature-responsive formation of a hydrophobic intermediate layer between PEG shells and pDNA cores through facile temperature increase from room temperature to body temperature (~37 °C). As compared with binary polyplex micelles of PEG-b-PAsp(DET) (BPMs), TPMs were confirmed to condense pDNA into a more compact structure, which achieved enhanced tolerability to nuclease digestion and strong counter polyanion exchange. In vitro gene transfection results demonstrated TPMs exhibiting enhanced gene transfection efficiency due to efficient cellular uptake and endosomal escape. Moreover, in vivo performance evaluation after intravenous injection confirmed that TPMs achieved significantly prolonged blood circulation, high tumor accumulation, and promoted gene expression in tumor tissue. Moreover, TPMs loading therapeutic pDNA encoding an anti-angiogenic protein remarkably suppressed tumor growth following intravenous injection into H22 tumor-bearing mice. These results suggest TPMs with PEG shells and facilely engineered intermediate barrier to inner complexed pDNA have great potentials as systemic nonviral gene vectors for cancer gene therapy. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Study of design parameters affecting the motion of DNA for nanoinjection

    International Nuclear Information System (INIS)

    David, Regis A; Jensen, Brian D; Howell, Larry L; Black, Justin L; Burnett, Sandra H

    2012-01-01

    This paper reports the effects of various parameters on the attraction and repulsion of DNA to and from a silicon lance. An understanding of DNA motion is crucial for a new approach to insert DNA, or other foreign microscopic matter, into a living cell. The approach, called nanoinjection, uses electrical forces to attract and repel the desired substance to a micromachined lance designed to pierce the cell membranes. We have developed mathematical models to predict the trajectory of DNA. The mathematical model allows investigation of the attraction/repulsion process by varying specific parameters. We find that the ground electrode placement, lance orientation and lance penetration significantly affect attraction or repulsion efficiency, while the gap, lance direction, lance tip width, lance tip half-angle and lance tip height do not. (paper)

  6. StpA and Hha stimulate pausing by RNA polymerase by promoting DNA-DNA bridging of H-NS filaments.

    Science.gov (United States)

    Boudreau, Beth A; Hron, Daniel R; Qin, Liang; van der Valk, Ramon A; Kotlajich, Matthew V; Dame, Remus T; Landick, Robert

    2018-06-20

    In enterobacteria, AT-rich horizontally acquired genes, including virulence genes, are silenced through the actions of at least three nucleoid-associated proteins (NAPs): H-NS, StpA and Hha. These proteins form gene-silencing nucleoprotein filaments through direct DNA binding by H-NS and StpA homodimers or heterodimers. Both linear and bridged filaments, in which NAPs bind one or two DNA segments, respectively, have been observed. Hha can interact with H-NS or StpA filaments, but itself lacks a DNA-binding domain. Filaments composed of H-NS alone can inhibit transcription initiation and, in the bridged conformation, slow elongating RNA polymerase (RNAP) by promoting backtracking at pause sites. How the other NAPs modulate these effects of H-NS is unknown, despite evidence that they help regulate subsets of silenced genes in vivo (e.g. in pathogenicity islands). Here we report that Hha and StpA greatly enhance H-NS-stimulated pausing by RNAP at 20°C. StpA:H-NS or StpA-only filaments also stimulate pausing at 37°C, a temperature at which Hha:H-NS or H-NS-only filaments have much less effect. In addition, we report that both Hha and StpA greatly stimulate DNA-DNA bridging by H-NS filaments. Together, these observations indicate that Hha and StpA can affect H-NS-mediated gene regulation by stimulating bridging of H-NS/DNA filaments.

  7. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia

    Directory of Open Access Journals (Sweden)

    C.B. Sacramento

    2010-08-01

    Full Text Available The main objective of the present study was to find suitable DNA-targeting sequences (DTS for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS and hypoxia-responsive element (HRE sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF. The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2 and hypoxia (less than 5% O2 were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  8. The DnaJ Gene Family in Pepper (Capsicum annuum L.: Comprehensive Identification, Characterization and Expression Profiles

    Directory of Open Access Journals (Sweden)

    Yunyan Kang

    2017-05-01

    Full Text Available The DnaJ proteins which function as molecular chaperone played critical roles in plant growth and development and response to heat stress (HS and also called heat shock protein 40 based on molecular weight. However, little was reported on this gene family in pepper. Recently, the release of the whole pepper genome provided an opportunity for identifying putative DnaJ homologous. In this study, a total of 76 putative pepper DnaJ genes (CaDnaJ01 to CaDnaJ76 were identified using bioinformatics methods and classified into five groups by the presence of the complete three domains (J-domain, zinc finger domain, and C-terminal domain. Chromosome mapping suggested that segmental duplication and tandem duplication were occurred in evolution. The multiple stress-related cis-elements were found in the promoter region of these CaDnaJ genes, which indicated that the CaDnaJs might be involved in the process of responding to complex stress conditions. In addition, expression profiles based on RNA-seq showed that the 47 CaDnaJs were expressed in at least one tissue tested. The result implied that they could be involved in the process of pepper growth and development. qRT-PCR analysis found that 80.60% (54/67 CaDnaJs were induced by HS, indicated that they could participated in pepper response to high temperature treatments. In conclusion, all these results would provide a comprehensive basis for further analyzing the function of CaDnaJ members and be also significant for elucidating the evolutionary relationship in pepper.

  9. The effect of co-administration of DNA carrying chicken interferon-gamma gene on protection of chickens against infectious bursal disease by DNA-mediated vaccination.

    Science.gov (United States)

    Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long

    2006-11-17

    The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (Pprotection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (Pprotected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.

  10. Analysis of variants in DNA damage signalling genes in bladder cancer

    Directory of Open Access Journals (Sweden)

    Bishop D Timothy

    2008-07-01

    Full Text Available Abstract Background Chemicals from occupational exposure and components of cigarette smoke can cause DNA damage in bladder urothelium. Failure to repair DNA damage by DNA repair proteins may result in mutations leading to genetic instability and the development of bladder cancer. Immunohistochemistry studies have shown DNA damage signal activation in precancerous bladder lesions which is lost on progression, suggesting that the damage signalling mechanism acts as a brake to further tumorigenesis. Single nucleotide polymorphisms (SNPs in DSB signalling genes may alter protein function. We hypothesized that SNPs in DSB signalling genes may modulate predisposition to bladder cancer and influence the effects of environmental exposures. Methods We recruited 771 cases and 800 controls (573 hospital-based and 227 population-based from a previous case-control study and interviewed them regarding their smoking habits and occupational history. DNA was extracted from a peripheral blood sample and genotyping of 24 SNPs in MRE11, NBS1, RAD50, H2AX and ATM was undertaken using an allelic discrimination method (Taqman. Results Smoking and occupational dye exposure were strongly associated with bladder cancer risk. Using logistic regression adjusting for age, sex, smoking and occupational dye exposure, there was a marginal increase in risk of bladder cancer for an MRE11 3'UTR SNP (rs2155209, adjusted odds ratio 1.54 95% CI (1.13–2.08, p = 0.01 for individuals homozygous for the rare allele compared to those carrying the common homozygous or heterozygous genotype. However, in the hospital-based controls, the genotype distribution for this SNP deviated from Hardy-Weinberg equilibrium. None of the other SNPs showed an association with bladder cancer and we did not find any significant interaction between any of these polymorphisms and exposure to smoking or dye exposure. Conclusion Apart from a possible effect for one MRE11 3'UTR SNP, our study does not support

  11. Fiscal 2000 pioneering research report on the basic technology for novel DNA drug creation using anti-gene engineering; 2000 nendo anti gene kogaku ni yoru shinki DNA drug soshutsu kiban gijutsu chosa kenkyu hokokusho

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2001-03-01

    Research is conducted concerning the possibility of anti-gene engineering basic to the application of DNA (deoxyribonucleic acid) drugs capable of serving as functional DNAs to the control of the expression of industrially useful substance producing genes or of anomalous genes and concerning the possibility of novel industry creation on the strength of the said engineering. The specific research items are described below. Technical seeds are investigated relating to the tissue- and cell-specific drug delivery system for the expression of the molecular device function of the DNA drug. Concerning molecular target technologies such as the anti-sense method, possibilities are studied of utilizing the currently available technical seeds for the eventual creation of novel industries. Concerning novel designing methods utilizing genome information such as SNPs (single nucleotide polymorphisms), investigations are conducted to determine if they would help novel technology development and novel material development. The domestic state is surveyed in relation to DNA drugs, and possibilities are investigated of novel substance production and novel medicine creation with the aid of anti-gene engineering. (NEDO)

  12. Gene-specific DNA methylation association with serum levels of C-reactive protein in African Americans.

    Directory of Open Access Journals (Sweden)

    Yan V Sun

    Full Text Available A more thorough understanding of the differences in DNA methylation (DNAm profiles in populations may hold promise for identifying molecular mechanisms through which genetic and environmental factors jointly contribute to human diseases. Inflammation is a key molecular mechanism underlying several chronic diseases including cardiovascular disease, and it affects DNAm profile on both global and locus-specific levels. To understand the impact of inflammation on the DNAm of the human genome, we investigated DNAm profiles of peripheral blood leukocytes from 966 African American participants in the Genetic Epidemiology Network of Arteriopathy (GENOA study. By testing the association of DNAm sites on CpG islands of over 14,000 genes with C-reactive protein (CRP, an inflammatory biomarker of cardiovascular disease, we identified 257 DNAm sites in 240 genes significantly associated with serum levels of CRP adjusted for age, sex, body mass index and smoking status, and corrected for multiple testing. Of the significantly associated DNAm sites, 80.5% were hypomethylated with higher CRP levels. The most significant Gene Ontology terms enriched in the genes associated with the CRP levels were immune system process, immune response, defense response, response to stimulus, and response to stress, which are all linked to the functions of leukocytes. While the CRP-associated DNAm may be cell-type specific, understanding the DNAm association with CRP in peripheral blood leukocytes of multi-ethnic populations can assist in unveiling the molecular mechanism of how the process of inflammation affects the risks of developing common disease through epigenetic modifications.

  13. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Svetlana Kostyuk

    2015-01-01

    Full Text Available Background. Cell free DNA (cfDNA circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Principal Findings. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci. As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR, PCNA (FACS and antiapoptotic genes (BCL2 (RT-PCR and FACS, BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR. Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs. Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR, in the level of fatty acid binding protein FABP4 (FACS analysis and in the level of fat (Oil Red O. Conclusions. GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose—derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis.

  14. DNA methylation in obesity

    Directory of Open Access Journals (Sweden)

    Małgorzata Pokrywka

    2014-11-01

    Full Text Available The number of overweight and obese people is increasing at an alarming rate, especially in the developed and developing countries. Obesity is a major risk factor for diabetes, cardiovascular disease, and cancer, and in consequence for premature death. The development of obesity results from the interplay of both genetic and environmental factors, which include sedentary life style and abnormal eating habits. In the past few years a number of events accompanying obesity, affecting expression of genes which are not directly connected with the DNA base sequence (e.g. epigenetic changes, have been described. Epigenetic processes include DNA methylation, histone modifications such as acetylation, methylation, phosphorylation, ubiquitination, and sumoylation, as well as non-coding micro-RNA (miRNA synthesis. In this review, the known changes in the profile of DNA methylation as a factor affecting obesity and its complications are described.

  15. An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

    Science.gov (United States)

    Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

    2017-07-01

    We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

  16. Radiosensitivity and genes

    Energy Technology Data Exchange (ETDEWEB)

    Qiyue, Hu; Mingyue, Lun [Suzhou Medical Coll., JS (China)

    1995-07-01

    Reported effects of some oncogenes, tumour suppressor genes and DNA repair genes on sensitivity of cells to ionizing radiation are reviewed. The role of oncogenes in cellular response to irradiation is discussed, especially the extensively studied oncogenes such as the ras gene family. For tumour suppressor genes, mainly the p53, which is increasingly implicated as a gene affecting radiosensitivity, is reviewed. It is considered that there is a cell cycle checkpoint determinant which is postulated to be able to arrest the irradiated cells in G{sub 1} phase to allow them to repair damage before they undergo DNA synthesis. So far there are six DNA repair genes which have been cloned in mammalian cells, but only one, XRCC1, appears to be involved in repair of human X-ray damage. XRCC1 can correct high sisterchromatid exchange levels when transferred into EM{sub 9} cells, but its expression seems to have no correlation with radiosensitivity of human neck and head tumour cells. Radiosensitivity is an intricate issue which may involve many factors. A scheme of cellular reactions after exposure to irradiation is proposed to indicate a possible sequence of events initiated by ionizing radiation.

  17. Radiosensitivity and genes

    International Nuclear Information System (INIS)

    Hu Qiyue; Lun Mingyue

    1995-07-01

    Reported effects of some oncogenes, tumour suppressor genes and DNA repair genes on sensitivity of cells to ionizing radiation are reviewed. The role of oncogenes in cellular response to irradiation is discussed, especially the extensively studied oncogenes such as the ras gene family. For tumour suppressor genes, mainly the p53, which is increasingly implicated as a gene affecting radiosensitivity, is reviewed. It is considered that there is a cell cycle checkpoint determinant which is postulated to be able to arrest the irradiated cells in G 1 phase to allow them to repair damage before they undergo DNA synthesis. So far there are six DNA repair genes which have been cloned in mammalian cells, but only one, XRCC1, appears to be involved in repair of human X-ray damage. XRCC1 can correct high sisterchromatid exchange levels when transferred into EM 9 cells, but its expression seems to have no correlation with radiosensitivity of human neck and head tumour cells. Radiosensitivity is an intricate issue which may involve many factors. A scheme of cellular reactions after exposure to irradiation is proposed to indicate a possible sequence of events initiated by ionizing radiation

  18. Review: Clinical aspects of hereditary DNA Mismatch repair gene mutations

    NARCIS (Netherlands)

    Sijmons, Rolf H.; Hofstra, Robert M. W.

    Inherited mutations of the DNA Mismatch repair genes MLH1, MSH2, MSH6 and PMS2 can result in two hereditary tumor syndromes: the adult-onset autosomal dominant Lynch syndrome, previously referred to as Hereditary Non-Polyposis Colorectal Cancer (HNPCC) and the childhood-onset autosomal recessive

  19. Polymorphisms in human DNA repair genes and head and neck ...

    Indian Academy of Sciences (India)

    Abstract. Genetic polymorphisms in some DNA repair proteins are associated with a number of malignant transformations like head and ... Such studies may benefit from analysis of multiple genes or polymorphisms and from the ... low survival and high morbidity when diagnosed in advanced ...... racial and/or ethnic cohort.

  20. Immunohistochemical and DNA sequencing analysis on human mismatch repair gene MLH1 in cervical squamous cell carcinoma with LOH of this gene

    NARCIS (Netherlands)

    Hu, X.; Guo, Z.; Pang, T.; Li, Q.; Afink, G.; Pontén, J.

    2000-01-01

    BACKGROUND: The human MLH1 gene (hMLH1) is one of the DNA mismatch repair genes. Defects in these genes are believed to be the underlying cause of microsatellite instability (MSI). MSI has been demonstrated in many human cancers such as colon cancer and some female-specific tumors. The hMLH1 gene

  1. p53 downregulates the Fanconi anaemia DNA repair pathway.

    Science.gov (United States)

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-04-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

  2. A deletion affecting an LRR-RLK gene co-segregates with the fruit flat shape trait in peach.

    Science.gov (United States)

    López-Girona, Elena; Zhang, Yu; Eduardo, Iban; Mora, José Ramón Hernández; Alexiou, Konstantinos G; Arús, Pere; Aranzana, María José

    2017-07-27

    In peach, the flat phenotype is caused by a partially dominant allele in heterozygosis (Ss), fruits from homozygous trees (SS) abort a few weeks after fruit setting. Previous research has identified a SSR marker (UDP98-412) highly associated with the trait, found suitable for marker assisted selection (MAS). Here we report a ∼10 Kb deletion affecting the gene PRUPE.6G281100, 400 Kb upstream of UDP98-412, co-segregating with the trait. This gene is a leucine-rich repeat receptor-like kinase (LRR-RLK) orthologous to the Brassinosteroid insensitive 1-associated receptor kinase 1 (BAK1) group. PCR markers suitable for MAS confirmed its strong association with the trait in a collection of 246 cultivars. They were used to evaluate the DNA from a round fruit derived from a somatic mutation of the flat variety 'UFO-4', revealing that the mutation affected the flat associated allele (S). Protein BLAST alignment identified significant hits with genes involved in different biological processes. Best protein hit occurred with AtRLP12, which may functionally complement CLAVATA2, a key regulator that controls the stem cell population size. RT-PCR analysis revealed the absence of transcription of the partially deleted allele. The data support PRUPE.6G281100 as a candidate gene for flat shape in peach.

  3. Oral Gene Application Using Chitosan-DNA Nanoparticles Induces Transferable Tolerance

    Science.gov (United States)

    Ensminger, Stephan M.; Spriewald, Bernd M.

    2012-01-01

    Oral tolerance is a promising approach to induce unresponsiveness to various antigens. The development of tolerogenic vaccines could be exploited in modulating the immune response in autoimmune disease and allograft rejection. In this study, we investigated a nonviral gene transfer strategy for inducing oral tolerance via antigen-encoding chitosan-DNA nanoparticles (NP). Oral application of ovalbumin (OVA)-encoding chitosan-DNA NP (OVA-NP) suppressed the OVA-specific delayed-type hypersensitivity (DTH) response and anti-OVA antibody formation, as well as spleen cell proliferation following OVA stimulation. Cytokine expression patterns following OVA stimulation in vitro showed a shift from a Th1 toward a Th2/Th3 response. The OVA-NP-induced tolerance was transferable from donor to naïve recipient mice via adoptive spleen cell transfer and was mediated by CD4+CD25+ T cells. These findings indicate that nonviral oral gene transfer can induce regulatory T cells for antigen-specific immune modulation. PMID:22933401

  4. TDP2 suppresses chromosomal translocations induced by DNA topoisomerase II during gene transcription.

    Science.gov (United States)

    Gómez-Herreros, Fernando; Zagnoli-Vieira, Guido; Ntai, Ioanna; Martínez-Macías, María Isabel; Anderson, Rhona M; Herrero-Ruíz, Andrés; Caldecott, Keith W

    2017-08-10

    DNA double-strand breaks (DSBs) induced by abortive topoisomerase II (TOP2) activity are a potential source of genome instability and chromosome translocation. TOP2-induced DNA double-strand breaks are rejoined in part by tyrosyl-DNA phosphodiesterase 2 (TDP2)-dependent non-homologous end-joining (NHEJ), but whether this process suppresses or promotes TOP2-induced translocations is unclear. Here, we show that TDP2 rejoins DSBs induced during transcription-dependent TOP2 activity in breast cancer cells and at the translocation 'hotspot', MLL. Moreover, we find that TDP2 suppresses chromosome rearrangements induced by TOP2 and reduces TOP2-induced chromosome translocations that arise during gene transcription. Interestingly, however, we implicate TDP2-dependent NHEJ in the formation of a rare subclass of translocations associated previously with therapy-related leukemia and characterized by junction sequences with 4-bp of perfect homology. Collectively, these data highlight the threat posed by TOP2-induced DSBs during transcription and demonstrate the importance of TDP2-dependent non-homologous end-joining in protecting both gene transcription and genome stability.DNA double-strand breaks (DSBs) induced by topoisomerase II (TOP2) are rejoined by TDP2-dependent non-homologous end-joining (NHEJ) but whether this promotes or suppresses translocations is not clear. Here the authors show that TDP2 suppresses chromosome translocations from DSBs introduced during gene transcription.

  5. Efficacy of DNA double-strand breaks repair in breast cancer is decreased in carriers of the variant allele of the UBC9 gene c.73G>A polymorphism

    International Nuclear Information System (INIS)

    Synowiec, Ewelina; Krupa, Renata; Morawiec, Zbigniew; Wasylecka, Maja; Dziki, Lukasz; Morawiec, Jan; Blasiak, Janusz; Wozniak, Katarzyna

    2010-01-01

    UBC9 (E2) SUMO conjugating enzyme plays an important role in the maintenance of genome stability and integrity. In the present work we examined the association between the c.73G>A (Val25Met) polymorphism of the UBC9 gene (rs11553473) and efficacy of DNA double-strand breaks (DSBs) repair (DRE) in breast cancer patients. We determined the level of endogenous (basal) and exogenous (induced by γ-irradiation) DSBs and efficacy of their repair in peripheral blood lymphocytes of 57 breast cancer patients and 70 healthy individuals. DNA damage and repair were studied by neutral comet assay. Genotypes were determined in DNA from peripheral blood lymphocytes by allele-specific PCR (ASO-PCR). We also correlated genotypes with the clinical characteristics of breast cancer patients. We observed a strong association between breast cancer occurrence and the variant allele carried genotypes in patients with elevated level of basal as well as induced DNA damage (OR 6.74, 95% CI 2.27-20.0 and OR 5.33, 95% CI 1.81-15.7, respectively). We also found statistically significant (p A polymorphism of the UBC9 gene in breast cancer patients. Carriers of variant allele have decreased DNA DRE as compared to wild type genotype carriers. We did not find any association with the UBC9 gene polymorphism and estrogen and progesterone receptor status. The variant allele of the UBC9 gene polymorphism was strongly inversely related to HER negative breast cancer patients (OR 0.03, 95% CI 0.00-0.23). Our results suggest that the c.73G>A polymorphism of the UBC9 gene may affect DNA DSBs repair efficacy in breast cancer patients.

  6. Amyloid protein-mediated differential DNA methylation status regulates gene expression in Alzheimer’s disease model cell line

    International Nuclear Information System (INIS)

    Sung, Hye Youn; Choi, Eun Nam; Ahn Jo, Sangmee; Oh, Seikwan; Ahn, Jung-Hyuck

    2011-01-01

    Highlights: ► Genome-wide DNA methylation pattern in Alzheimer’s disease model cell line. ► Integrated analysis of CpG methylation and mRNA expression profiles. ► Identify three Swedish mutant target genes; CTIF, NXT2 and DDR2 gene. ► The effect of Swedish mutation on alteration of DNA methylation and gene expression. -- Abstract: The Swedish mutation of amyloid precursor protein (APP-sw) has been reported to dramatically increase beta amyloid production through aberrant cleavage at the beta secretase site, causing early-onset Alzheimer’s disease (AD). DNA methylation has been reported to be associated with AD pathogenesis, but the underlying molecular mechanism of APP-sw-mediated epigenetic alterations in AD pathogenesis remains largely unknown. We analyzed genome-wide interplay between promoter CpG DNA methylation and gene expression in an APP-sw-expressing AD model cell line. To identify genes whose expression was regulated by DNA methylation status, we performed integrated analysis of CpG methylation and mRNA expression profiles, and identified three target genes of the APP-sw mutant; hypomethylated CTIF (CBP80/CBP20-dependent translation initiation factor) and NXT2 (nuclear exporting factor 2), and hypermethylated DDR2 (discoidin domain receptor 2). Treatment with the demethylating agent 5-aza-2′-deoxycytidine restored mRNA expression of these three genes, implying methylation-dependent transcriptional regulation. The profound alteration in the methylation status was detected at the −435, −295, and −271 CpG sites of CTIF, and at the −505 to −341 region in the promoter of DDR2. In the promoter region of NXT2, only one CpG site located at −432 was differentially unmethylated in APP-sw cells. Thus, we demonstrated the effect of the APP-sw mutation on alteration of DNA methylation and subsequent gene expression. This epigenetic regulatory mechanism may contribute to the pathogenesis of AD.

  7. Effect of transfection and co-incubation of bovine sperm with exogenous DNA on sperm quality and functional parameters for its use in sperm-mediated gene transfer.

    Science.gov (United States)

    Arias, María Elena; Sánchez-Villalba, Esther; Delgado, Andrea; Felmer, Ricardo

    2017-02-01

    Sperm-mediated gene transfer (SMGT) is based on the capacity of sperm to bind exogenous DNA and transfer it into the oocyte during fertilization. In bovines, the progress of this technology has been slow due to the poor reproducibility and efficiency of the production of transgenic embryos. The aim of the present study was to evaluate the effects of different sperm transfection systems on the quality and functional parameters of sperm. Additionally, the ability of sperm to bind and incorporate exogenous DNA was assessed. These analyses were carried out by flow cytometry and confocal fluorescence microscopy, and motility parameters were also evaluated by computer-assisted sperm analysis (CASA). Transfection was carried out using complexes of plasmid DNA with Lipofectamine, SuperFect and TurboFect for 0.5, 1, 2 or 4 h. The results showed that all of the transfection treatments promoted sperm binding and incorporation of exogenous DNA, similar to sperm incorporation of DNA alone, without affecting the viability. Nevertheless, the treatments and incubation times significantly affected the motility parameters, although no effect on the integrity of DNA or the levels of reactive oxygen species (ROS) was observed. Additionally, we observed that transfection using SuperFect and TurboFect negatively affected the acrosome integrity, and TurboFect affected the mitochondrial membrane potential of sperm. In conclusion, we demonstrated binding and incorporation of exogenous DNA by sperm after transfection and confirmed the capacity of sperm to spontaneously incorporate exogenous DNA. These findings will allow the establishment of the most appropriate method [intracytoplasmic sperm injection (ICSI) or in vitro fertilization (IVF)] of generating transgenic embryos via SMGT based on the fertilization capacity of transfected sperm.

  8. Control of DEMETER DNA demethylase gene transcription in male and female gamete companion cells in Arabidopsis thaliana.

    Science.gov (United States)

    Park, Jin-Sup; Frost, Jennifer M; Park, Kyunghyuk; Ohr, Hyonhwa; Park, Guen Tae; Kim, Seohyun; Eom, Hyunjoo; Lee, Ilha; Brooks, Janie S; Fischer, Robert L; Choi, Yeonhee

    2017-02-21

    The DEMETER (DME) DNA glycosylase initiates active DNA demethylation via the base-excision repair pathway and is vital for reproduction in Arabidopsis thaliana DME-mediated DNA demethylation is preferentially targeted to small, AT-rich, and nucleosome-depleted euchromatic transposable elements, influencing expression of adjacent genes and leading to imprinting in the endosperm. In the female gametophyte, DME expression and subsequent genome-wide DNA demethylation are confined to the companion cell of the egg, the central cell. Here, we show that, in the male gametophyte, DME expression is limited to the companion cell of sperm, the vegetative cell, and to a narrow window of time: immediately after separation of the companion cell lineage from the germline. We define transcriptional regulatory elements of DME using reporter genes, showing that a small region, which surprisingly lies within the DME gene, controls its expression in male and female companion cells. DME expression from this minimal promoter is sufficient to rescue seed abortion and the aberrant DNA methylome associated with the null dme-2 mutation. Within this minimal promoter, we found short, conserved enhancer sequences necessary for the transcriptional activities of DME and combined predicted binding motifs with published transcription factor binding coordinates to produce a list of candidate upstream pathway members in the genetic circuitry controlling DNA demethylation in gamete companion cells. These data show how DNA demethylation is regulated to facilitate endosperm gene imprinting and potential transgenerational epigenetic regulation, without subjecting the germline to potentially deleterious transposable element demethylation.

  9. Ecstasy (MDMA) Alters Cardiac Gene Expression and DNA Methylation: Implications for Circadian Rhythm Dysfunction in the Heart.

    Science.gov (United States)

    Koczor, Christopher A; Ludlow, Ivan; Hight, Robert S; Jiao, Zhe; Fields, Earl; Ludaway, Tomika; Russ, Rodney; Torres, Rebecca A; Lewis, William

    2015-11-01

    MDMA (ecstasy) is an illicit drug that stimulates monoamine neurotransmitter release and inhibits reuptake. MDMA's acute cardiotoxicity includes tachycardia and arrhythmia which are associated with cardiomyopathy. MDMA acute cardiotoxicity has been explored, but neither long-term MDMA cardiac pathological changes nor epigenetic changes have been evaluated. Microarray analyses were employed to identify cardiac gene expression changes and epigenetic DNA methylation changes. To identify permanent MDMA-induced pathogenetic changes, mice received daily 10- or 35-day MDMA, or daily 10-day MDMA followed by 25-day saline washout (10 + 25 days). MDMA treatment caused differential gene expression (p 1.5) in 752 genes following 10 days, 558 genes following 35 days, and 113 genes following 10-day MDMA + 25-day saline washout. Changes in MAPK and circadian rhythm gene expression were identified as early as 10 days. After 35 days, circadian rhythm genes (Per3, CLOCK, ARNTL, and NPAS2) persisted to be differentially expressed. MDMA caused DNA hypermethylation and hypomethylation that was independent of gene expression; hypermethylation of genes was found to be 71% at 10 days, 68% at 35 days, and 91% at 10 + 25 days washout. Differential gene expression paralleled DNA methylation in 22% of genes at 10-day treatment, 17% at 35 days, and 48% at 10 + 25 days washout. We show here that MDMA induced cardiac epigenetic changes in DNA methylation where hypermethylation predominated. Moreover, MDMA induced gene expression of key elements of circadian rhythm regulatory genes. This suggests a fundamental organism-level event to explain some of the etiologies of MDMA dysfunction in the heart. © The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  10. The genome-wide landscape of DNA methylation and hydroxymethylation in response to sleep deprivation impacts on synaptic plasticity genes.

    Science.gov (United States)

    Massart, R; Freyburger, M; Suderman, M; Paquet, J; El Helou, J; Belanger-Nelson, E; Rachalski, A; Koumar, O C; Carrier, J; Szyf, M; Mongrain, V

    2014-01-21

    Sleep is critical for normal brain function and mental health. However, the molecular mechanisms mediating the impact of sleep loss on both cognition and the sleep electroencephalogram remain mostly unknown. Acute sleep loss impacts brain gene expression broadly. These data contributed to current hypotheses regarding the role for sleep in metabolism, synaptic plasticity and neuroprotection. These changes in gene expression likely underlie increased sleep intensity following sleep deprivation (SD). Here we tested the hypothesis that epigenetic mechanisms coordinate the gene expression response driven by SD. We found that SD altered the cortical genome-wide distribution of two major epigenetic marks: DNA methylation and hydroxymethylation. DNA methylation differences were enriched in gene pathways involved in neuritogenesis and synaptic plasticity, whereas large changes (>4000 sites) in hydroxymethylation where observed in genes linked to cytoskeleton, signaling and neurotransmission, which closely matches SD-dependent changes in the transcriptome. Moreover, this epigenetic remodeling applied to elements previously linked to sleep need (for example, Arc and Egr1) and synaptic partners of Neuroligin-1 (Nlgn1; for example, Dlg4, Nrxn1 and Nlgn3), which we recently identified as a regulator of sleep intensity following SD. We show here that Nlgn1 mutant mice display an enhanced slow-wave slope during non-rapid eye movement sleep following SD but this mutation does not affect SD-dependent changes in gene expression, suggesting that the Nlgn pathway acts downstream to mechanisms triggering gene expression changes in SD. These data reveal that acute SD reprograms the epigenetic landscape, providing a unique molecular route by which sleep can impact brain function and health.

  11. Chitinase genes revealed and compared in bacterial isolates, DNA extracts and a metagenomic library from a phytopathogen suppressive soil

    Energy Technology Data Exchange (ETDEWEB)

    Hjort, K.; Bergstrom, M.; Adesina, M.F.; Jansson, J.K.; Smalla, K.; Sjoling, S.

    2009-09-01

    Soil that is suppressive to disease caused by fungal pathogens is an interesting source to target for novel chitinases that might be contributing towards disease suppression. In this study we screened for chitinase genes, in a phytopathogen-suppressive soil in three ways: (1) from a metagenomic library constructed from microbial cells extracted from soil, (2) from directly extracted DNA and (3) from bacterial isolates with antifungal and chitinase activities. Terminal-restriction fragment length polymorphism (T-RFLP) of chitinase genes revealed differences in amplified chitinase genes from the metagenomic library and the directly extracted DNA, but approximately 40% of the identified chitinase terminal-restriction fragments (TRFs) were found in both sources. All of the chitinase TRFs from the isolates were matched to TRFs in the directly extracted DNA and the metagenomic library. The most abundant chitinase TRF in the soil DNA and the metagenomic library corresponded to the TRF{sup 103} of the isolate, Streptomyces mutomycini and/or Streptomyces clavifer. There were good matches between T-RFLP profiles of chitinase gene fragments obtained from different sources of DNA. However, there were also differences in both the chitinase and the 16S rRNA gene T-RFLP patterns depending on the source of DNA, emphasizing the lack of complete coverage of the gene diversity by any of the approaches used.

  12. ESTs, cDNA microarrays, and gene expression profiling: tools for dissecting plant physiology and development.

    Science.gov (United States)

    Alba, Rob; Fei, Zhangjun; Payton, Paxton; Liu, Yang; Moore, Shanna L; Debbie, Paul; Cohn, Jonathan; D'Ascenzo, Mark; Gordon, Jeffrey S; Rose, Jocelyn K C; Martin, Gregory; Tanksley, Steven D; Bouzayen, Mondher; Jahn, Molly M; Giovannoni, Jim

    2004-09-01

    Gene expression profiling holds tremendous promise for dissecting the regulatory mechanisms and transcriptional networks that underlie biological processes. Here we provide details of approaches used by others and ourselves for gene expression profiling in plants with emphasis on cDNA microarrays and discussion of both experimental design and downstream analysis. We focus on methods and techniques emphasizing fabrication of cDNA microarrays, fluorescent labeling, cDNA hybridization, experimental design, and data processing. We include specific examples that demonstrate how this technology can be used to further our understanding of plant physiology and development (specifically fruit development and ripening) and for comparative genomics by comparing transcriptome activity in tomato and pepper fruit.

  13. A High Phosphorus Diet Affects Lipid Metabolism in Rat Liver: A DNA Microarray Analysis

    Science.gov (United States)

    Chun, Sunwoo; Bamba, Takeshi; Suyama, Tatsuya; Ishijima, Tomoko; Fukusaki, Eiichiro; Abe, Keiko; Nakai, Yuji

    2016-01-01

    A high phosphorus (HP) diet causes disorders of renal function, bone metabolism, and vascular function. We previously demonstrated that DNA microarray analysis is an appropriate method to comprehensively evaluate the effects of a HP diet on kidney dysfunction such as calcification, fibrillization, and inflammation. We reported that type IIb sodium-dependent phosphate transporter is significantly up-regulated in this context. In the present study, we performed DNA microarray analysis to investigate the effects of a HP diet on the liver, which plays a pivotal role in energy metabolism. DNA microarray analysis was performed with total RNA isolated from the livers of rats fed a control diet (containing 0.3% phosphorus) or a HP diet (containing 1.2% phosphorus). Gene Ontology analysis of differentially expressed genes (DEGs) revealed that the HP diet induced down-regulation of genes involved in hepatic amino acid catabolism and lipogenesis, while genes related to fatty acid β-oxidation process were up-regulated. Although genes related to fatty acid biosynthesis were down-regulated in HP diet-fed rats, genes important for the elongation and desaturation reactions of omega-3 and -6 fatty acids were up-regulated. Concentrations of hepatic arachidonic acid and eicosapentaenoic acid were increased in HP diet-fed rats. These essential fatty acids activate peroxisome proliferator-activated receptor alpha (PPARα), a transcription factor for fatty acid β-oxidation. Evaluation of the upstream regulators of DEGs using Ingenuity Pathway Analysis indicated that PPARα was activated in the livers of HP diet-fed rats. Furthermore, the serum concentration of fibroblast growth factor 21, a hormone secreted from the liver that promotes fatty acid utilization in adipose tissue as a PPARα target gene, was higher (p = 0.054) in HP diet-fed rats than in control diet-fed rats. These data suggest that a HP diet enhances energy expenditure through the utilization of free fatty acids

  14. A High Phosphorus Diet Affects Lipid Metabolism in Rat Liver: A DNA Microarray Analysis.

    Directory of Open Access Journals (Sweden)

    Sunwoo Chun

    Full Text Available A high phosphorus (HP diet causes disorders of renal function, bone metabolism, and vascular function. We previously demonstrated that DNA microarray analysis is an appropriate method to comprehensively evaluate the effects of a HP diet on kidney dysfunction such as calcification, fibrillization, and inflammation. We reported that type IIb sodium-dependent phosphate transporter is significantly up-regulated in this context. In the present study, we performed DNA microarray analysis to investigate the effects of a HP diet on the liver, which plays a pivotal role in energy metabolism. DNA microarray analysis was performed with total RNA isolated from the livers of rats fed a control diet (containing 0.3% phosphorus or a HP diet (containing 1.2% phosphorus. Gene Ontology analysis of differentially expressed genes (DEGs revealed that the HP diet induced down-regulation of genes involved in hepatic amino acid catabolism and lipogenesis, while genes related to fatty acid β-oxidation process were up-regulated. Although genes related to fatty acid biosynthesis were down-regulated in HP diet-fed rats, genes important for the elongation and desaturation reactions of omega-3 and -6 fatty acids were up-regulated. Concentrations of hepatic arachidonic acid and eicosapentaenoic acid were increased in HP diet-fed rats. These essential fatty acids activate peroxisome proliferator-activated receptor alpha (PPARα, a transcription factor for fatty acid β-oxidation. Evaluation of the upstream regulators of DEGs using Ingenuity Pathway Analysis indicated that PPARα was activated in the livers of HP diet-fed rats. Furthermore, the serum concentration of fibroblast growth factor 21, a hormone secreted from the liver that promotes fatty acid utilization in adipose tissue as a PPARα target gene, was higher (p = 0.054 in HP diet-fed rats than in control diet-fed rats. These data suggest that a HP diet enhances energy expenditure through the utilization of free fatty

  15. Association of season of birth with DNA methylation and allergic disease

    NARCIS (Netherlands)

    Lockett, G. A.; Soto-Ramirez, N.; Ray, M. A.; Everson, T. M.; Xu, C-J.; Patil, V. K.; Terry, W.; Kaushal, A.; Rezwan, F. I.; Ewart, S. L.; Gehring, U.; Postma, D. S.; Koppelman, G. H.; Arshad, S. H.; Zhang, H.; Karmaus, W.; Holloway, J. W.

    Background Season of birth influences allergy risk; however, the biological mechanisms underlying this observation are unclear. The environment affects DNA methylation, with potentially long-lasting effects on gene expression and disease. This study examined whether DNA methylation could underlie

  16. Multiplex preamplification of specific cDNA targets prior to gene expression analysis by TaqMan Arrays

    Directory of Open Access Journals (Sweden)

    Ribal María

    2008-06-01

    Full Text Available Abstract Background An accurate gene expression quantification using TaqMan Arrays (TA could be limited by the low RNA quantity obtained from some clinical samples. The novel cDNA preamplification system, the TaqMan PreAmp Master Mix kit (TPAMMK, enables a multiplex preamplification of cDNA targets and therefore, could provide a sufficient amount of specific amplicons for their posterior analysis on TA. Findings A multiplex preamplification of 47 genes was performed in 22 samples prior to their analysis by TA, and relative gene expression levels of non-preamplified (NPA and preamplified (PA samples were compared. Overall, the mean cycle threshold (CT decrement in the PA genes was 3.85 (ranging from 2.07 to 5.01. A high correlation (r between the gene expression measurements of NPA and PA samples was found (mean r = 0.970, ranging from 0.937 to 0.994; p Conclusion We demonstrate that cDNA preamplification using the TPAMMK before TA analysis is a reliable approach to simultaneously measure gene expression of multiple targets in a single sample. Moreover, this procedure was validated in genes from degraded RNA samples and low abundance expressed genes. This combined methodology could have wide applications in clinical research, where scarce amounts of degraded RNA are usually obtained and several genes need to be quantified in each sample.

  17. New polymorphisms of Xeroderma Pigmentosum DNA repair genes in myelodysplastic syndrome.

    Science.gov (United States)

    Santiago, Sabrina Pinheiro; Junior, Howard Lopes Ribeiro; de Sousa, Juliana Cordeiro; de Paula Borges, Daniela; de Oliveira, Roberta Taiane Germano; Farias, Izabelle Rocha; Costa, Marília Braga; Maia, Allan Rodrigo Soares; da Nóbrega Ito, Mayumi; Magalhães, Silvia Maria Meira; Pinheiro, Ronald Feitosa

    2017-07-01

    The association between Xeroderma Pigmentosum DNA repair genes (XPA rs1800975, XPC rs2228000, XPD rs1799793 and XPF rs1800067) polymorphisms and myelodysplastic syndrome (MDS) have not been reported. To assess the functional role between these polymorphisms and MDS, we evaluated 189 samples stratified in two groups: 95 bone marrow samples from MDS patients and 94 from healthy elderly volunteers used as controls. Genotypes for all polymorphisms were identified in DNA samples in an allelic discrimination experiment by real-time polymerase chain reaction (qPCR). We also studied the mRNA expression of XPA and XPC genes to evaluate if its polymorphisms were functional in 53 RNAm MDS patients by qPCR methodologies. To the rs2228000 polymorphism, the CT and TT polymorphic genotype were associated with increased odds ratio (OR) of more profound cytopenia (hemoglobin and neutrophils count). To the rs1799793 polymorphism, we found that the GG homozygous wild-type genotype was associated with a decreased chance of developing MDS. We observed low expression of XPA in younger patients, in hypoplastic MDS and patients with abnormal karyotype when presented AG or AA polymorphic genotypes. We also found that there was a statistically significant interaction between the presence of micromegakaryocyte on down regulation of XPC regarding the CT heterozygous genotype of the rs1800975 polymorphism. Our results suggest that new functional polymorphisms of Xeroderma Pigmentosum DNA repair genes in MDS are related to its pathogenesis and prognosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Nucleolin is required for DNA methylation state and the expression of rRNA gene variants in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Frédéric Pontvianne

    2010-11-01

    Full Text Available In eukaryotes, 45S rRNA genes are arranged in tandem arrays in copy numbers ranging from several hundred to several thousand in plants. Although it is clear that not all copies are transcribed under normal growth conditions, the molecular basis controlling the expression of specific sets of rRNA genes remains unclear. Here, we report four major rRNA gene variants in Arabidopsis thaliana. Interestingly, while transcription of one of these rRNA variants is induced, the others are either repressed or remain unaltered in A. thaliana plants with a disrupted nucleolin-like protein gene (Atnuc-L1. Remarkably, the most highly represented rRNA gene variant, which is inactive in WT plants, is reactivated in Atnuc-L1 mutants. We show that accumulated pre-rRNAs originate from RNA Pol I transcription and are processed accurately. Moreover, we show that disruption of the AtNUC-L1 gene induces loss of symmetrical DNA methylation without affecting histone epigenetic marks at rRNA genes. Collectively, these data reveal a novel mechanism for rRNA gene transcriptional regulation in which the nucleolin protein plays a major role in controlling active and repressed rRNA gene variants in Arabidopsis.

  19. Dynamic regulation of cerebral DNA repair genes by psychological stress

    DEFF Research Database (Denmark)

    Forsberg, Kristin; Aalling, Nadia; Wörtwein, Gitta

    2015-01-01

    Neuronal genotoxic insults from oxidative stress constitute a putative molecular link between stress and depression on the one hand, and cognitive dysfunction and dementia risk on the other. Oxidative modifications to DNA are repaired by specific enzymes; a process that plays a critical role...... restraint stress (6h/day) or daily handling (controls), and sacrificed after 1, 7 or 21 stress sessions. The mRNA expression of seven genes (Ogg1, Ape1, Ung1, Neil1, Xrcc1, Ercc1, Nudt1) involved in the repair of oxidatively damaged DNA was determined by quantitative real time polymerase chain reaction...

  20. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  1. Horizontal gene transfer of an entire metabolic pathway between a eukaryotic alga and its DNA virus

    Science.gov (United States)

    Monier, Adam; Pagarete, António; de Vargas, Colomban; Allen, Michael J.; Read, Betsy; Claverie, Jean-Michel; Ogata, Hiroyuki

    2009-01-01

    Interactions between viruses and phytoplankton, the main primary producers in the oceans, affect global biogeochemical cycles and climate. Recent studies are increasingly revealing possible cases of gene transfers between cyanobacteria and phages, which might have played significant roles in the evolution of cyanobacteria/phage systems. However, little has been documented about the occurrence of horizontal gene transfer in eukaryotic phytoplankton/virus systems. Here we report phylogenetic evidence for the transfer of seven genes involved in the sphingolipid biosynthesis pathway between the cosmopolitan eukaryotic microalga Emiliania huxleyi and its large DNA virus EhV. PCR assays indicate that these genes are prevalent in E. huxleyi and EhV strains isolated from different geographic locations. Patterns of protein and gene sequence conservation support that these genes are functional in both E. huxleyi and EhV. This is the first clear case of horizontal gene transfer of multiple functionally linked enzymes in a eukaryotic phytoplankton–virus system. We examine arguments for the possible direction of the gene transfer. The virus-to-host direction suggests the existence of ancient viruses that controlled the complex metabolic pathway in order to infect primitive eukaryotic cells. In contrast, the host-to-virus direction suggests that the serial acquisition of genes involved in the same metabolic pathway might have been a strategy for the ancestor of EhVs to stay ahead of their closest relatives in the great evolutionary race for survival. PMID:19451591

  2. Association of season of birth with DNA methylation and allergic disease

    NARCIS (Netherlands)

    Lockett, G. A.; Soto-Ramirez, N.; Ray, M. A.; Everson, T. M.; Xu, C-J.; Patil, V. K.; Terry, W.; Kaushal, A.; Rezwan, F. I.; Ewart, S. L.; Gehring, U.; Postma, D. S.; Koppelman, G. H.; Arshad, S. H.; Zhang, H.; Karmaus, W.; Holloway, J. W.

    BackgroundSeason of birth influences allergy risk; however, the biological mechanisms underlying this observation are unclear. The environment affects DNA methylation, with potentially long-lasting effects on gene expression and disease. This study examined whether DNA methylation could underlie the

  3. Microsatellites in the Eukaryotic DNA Mismatch Repair Genes as Modulators of Evolutionary Mutation Rate

    Science.gov (United States)

    Chang, Dong Kyung; Metzgar, David; Wills, Christopher; Boland, C. Richard

    2003-01-01

    All "minor" components of the human DNA mismatch repair (MMR) system-MSH3, MSH6, PMS2, and the recently discovered MLH3-contain mononucleotide microsatellites in their coding sequences. This intriguing finding contrasts with the situation found in the major components of the DNA MMR system-MSH2 and MLH1-and, in fact, most human genes. Although eukaryotic genomes are rich in microsatellites, non-triplet microsatellites are rare in coding regions. The recurring presence of exonal mononucleotide repeat sequences within a single family of human genes would therefore be considered exceptional.

  4. Control of radiation sensitivity of mammalian cells. Regulation of expression of DNA repair genes

    International Nuclear Information System (INIS)

    Yoshida, Kayo; Morita, Takashi

    2003-01-01

    This review describes authors' investigations concerning regulation of expression of DNA repair genes for the purpose of control of radiosensitivity of mammalian cells for cancer radiotherapy. One of their experiments concerns the enhancement of sensitivity to radiation and anti-tumor agents by suppressing the expression of mammalian Rad51 gene which playing a central role in recombination repair against DNA double-strand break, by RNA interference (RNAi). Described are the mode of action of RNAi, mechanism of suppression of Rad51 gene expression by it, enhancing effect in radiosensitivity, stable suppression and enhancement by hairpin RNA and its possible usefulness in cancer therapy. The other concerns the histone H2AX gene, which delivering the repair signal post phosphorylation in chromatin against the double-strand break. Experimental results of suppression of the histone H2AX gene by tet-off system, enhancement of radiosensitivity by the suppression and functional recovery by the gene transfer are described, and the radiosensitivity can be thus artificially controlled by tetracycline in authors' F9 2AX (tet/tet) cells. (N.I.)

  5. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.

    Science.gov (United States)

    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-11-01

    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1. © 2014 Wiley Periodicals, Inc.

  6. Transient p53 suppression increases reprogramming of human fibroblasts without affecting apoptosis and DNA damage

    DEFF Research Database (Denmark)

    Rasmussen, Mikkel Aabech; Holst, Bjørn; Tümer, Zeynep

    2014-01-01

    The discovery of human-induced pluripotent stem cells (iPSCs) has sparked great interest in the potential treatment of patients with their own in vitro differentiated cells. Recently, knockout of the Tumor Protein 53 (p53) gene was reported to facilitate reprogramming but unfortunately also led...... to genomic instability. Here, we report that transient suppression of p53 during nonintegrative reprogramming of human fibroblasts leads to a significant increase in expression of pluripotency markers and overall number of iPSC colonies, due to downstream suppression of p21, without affecting apoptosis...... and DNA damage. Stable iPSC lines generated with or without p53 suppression showed comparable expression of pluripotency markers and methylation patterns, displayed normal karyotypes, contained between 0 and 5 genomic copy number variations and produced functional neurons in vitro. In conclusion...

  7. DNA methylation changes in genes frequently mutated in sporadic colorectal cancer and in the DNA repair and Wnt/β-catenin signaling pathway genes

    Czech Academy of Sciences Publication Activity Database

    Farkas, S. A.; Vymetálková, Veronika; Vodičková, Ludmila; Vodička, Pavel; Torbjörn, K. N.

    2014-01-01

    Roč. 6, č. 2 (2014), s. 179-191 ISSN 1750-1911 R&D Projects: GA ČR GPP304/11/P715; GA ČR(CZ) GAP304/12/1585; GA MZd NT14329 Institutional support: RVO:68378041 Keywords : CpG * DNA repair genes * sporadic colorectal cancer Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.649, year: 2014

  8. DNA methylation mediated control of gene expression is critical for development of crown gall tumors.

    Directory of Open Access Journals (Sweden)

    Jochen Gohlke

    Full Text Available Crown gall tumors develop after integration of the T-DNA of virulent Agrobacterium tumefaciens strains into the plant genome. Expression of the T-DNA-encoded oncogenes triggers proliferation and differentiation of transformed plant cells. Crown gall development is known to be accompanied by global changes in transcription, metabolite levels, and physiological processes. High levels of abscisic acid (ABA in crown galls regulate expression of drought stress responsive genes and mediate drought stress acclimation, which is essential for wild-type-like tumor growth. An impact of epigenetic processes such as DNA methylation on crown gall development has been suggested; however, it has not yet been investigated comprehensively. In this study, the methylation pattern of Arabidopsis thaliana crown galls was analyzed on a genome-wide scale as well as at the single gene level. Bisulfite sequencing analysis revealed that the oncogenes Ipt, IaaH, and IaaM were unmethylated in crown galls. Nevertheless, the oncogenes were susceptible to siRNA-mediated methylation, which inhibited their expression and subsequently crown gall growth. Genome arrays, hybridized with methylated DNA obtained by immunoprecipitation, revealed a globally hypermethylated crown gall genome, while promoters were rather hypomethylated. Mutants with reduced non-CG methylation developed larger tumors than the wild-type controls, indicating that hypermethylation inhibits plant tumor growth. The differential methylation pattern of crown galls and the stem tissue from which they originate correlated with transcriptional changes. Genes known to be transcriptionally inhibited by ABA and methylated in crown galls became promoter methylated upon treatment of A. thaliana with ABA. This suggests that the high ABA levels in crown galls may mediate DNA methylation and regulate expression of genes involved in drought stress protection. In summary, our studies provide evidence that epigenetic processes

  9. Cell-cycle-specific interaction of nuclear DNA-binding proteins with a CCAAT sequence from the human thymidine kinase gene

    International Nuclear Information System (INIS)

    Knight, G.B.; Gudas, J.M.; Pardee, A.B.

    1987-01-01

    Induction of thymidine kinase parallels the onset of DNA synthesis. To investigate the transcriptional regulation of the thymidine kinase gene, the authors have examined whether specific nuclear factors interact in a cell-cycle-dependent manner with sequences upstream of this gene. Two inverted CCAAT boxes near the transcriptional initiation sites were observed to form complexes with nuclear DNA-binding proteins. The nature of the complexes changes dramatically as the cells approach DNA synthesis and correlates well with the previously reported transcriptional increase of the thymidine kinase gene

  10. Zebrafish: swimming towards a role for fanconi genes in DNA repair.

    Science.gov (United States)

    Scata, Kimberly A; El-Deiry, Wafik S

    2004-06-01

    The zebrafish, Danio rerio, has become a favorite model organism for geneticists and developmental biologists. Recently cancer biologists have turned to this tiny fish to help them unravel the mysteries of conserved pathways such as the Fanconi Anemia (FA) pathway. Although a relatively rare disease, the genes involved in FA are part of a large network of DNA damage response/repair genes. Liu and colleagues have recapitulated some of the clinical manifestations of human FA by knocking down the zebrafish FANC-D2 gene thereby providing a new model for probing the underlying causes of these phenotypes.

  11. Role of aldo-keto reductases and other doxorubicin pharmacokinetic genes in doxorubicin resistance, DNA binding, and subcellular localization

    International Nuclear Information System (INIS)

    Heibein, Allan D; Guo, Baoqing; Sprowl, Jason A; MacLean, David A; Parissenti, Amadeo M

    2012-01-01

    Since proteins involved in chemotherapy drug pharmacokinetics and pharmacodynamics have a strong impact on the uptake, metabolism, and efflux of such drugs, they likely play critical roles in resistance to chemotherapy drugs in cancer patients. To investigate this hypothesis, we conducted a whole genome microarray study to identify difference in the expression of genes between isogenic doxorubicin-sensitive and doxorubicin-resistant MCF-7 breast tumour cells. We then assessed the degree of over-representation of doxorubicin pharmacokinetic and pharmacodynamic genes in the dataset of doxorubicin resistance genes. Of 27,958 Entrez genes on the array, 7.4 per cent or 2,063 genes were differentially expressed by ≥ 2-fold between wildtype and doxorubicin-resistant cells. The false discovery rate was set at 0.01 and the minimum p value for significance for any gene within the “hit list” was 0.01. Seventeen and 43 per cent of doxorubicin pharmacokinetic genes were over-represented in the hit list, depending upon whether the gene name was identical or within the same gene family, respectively. The most over-represented genes were within the 1C and 1B families of aldo-keto reductases (AKRs), which convert doxorubicin to doxorubicinol. Other genes convert doxorubicin to other metabolites or affect the influx, efflux, or cytotoxicity of the drug. In further support of the role of AKRs in doxorubicin resistance, we observed that, in comparison to doxorubicin, doxorubincol exhibited dramatically reduced cytotoxicity, reduced DNA-binding activity, and strong localization to extra nuclear lysosomes. Pharmacologic inhibition of the above AKRs in doxorubicin-resistant cells increased cellular doxorubicin levels, restored doxorubicin cytotoxicity and re-established doxorubicin localization to the nucleus. The properties of doxorubicinol were unaffected. These findings demonstrate the utility of using curated pharmacokinetic and pharmacodynamic knowledge bases to identify

  12. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  13. Identification of pork contamination in meatball using genetic marker mitochondrial DNA cytochrome b gene by duplex-PCR

    Science.gov (United States)

    Novianty, E.; Kartikasari, L. R.; Lee, J. H.; Cahyadi, M.

    2017-04-01

    Meat based food products have a big opportunity to mix and adulterated with other meats. Muslim communities are prohibited to consume pork-containing product or other pig derivatives in food. Therefore, the high sensitivity, fast, cheap and accurate approach is needed to detect pig contamination in raw meat and meat-processed product such as meatball. The aim of this study was to identify pork contamination in meatball using genetic marker of mitochondrial DNA cytochrome b gene by duplex-PCR. Samples were prepared and designed by following the proportions 0, 1, 5, 10, 25% of pork in meatballs, respectively. The DNA genome was extracted from meatballs and polymerase chain reaction (PCR) was performed using species specific primer to isolate mt-DNA cytochrome b gene. The results showed that the DNA genome was successfully isolated from pork, beef, and contaminated meatballs. Furthermore, 2% agarose gels was able to visualize of duplex-PCR to identify pork contamination in meatballs up to very small proportion (1%). It can be concluded that duplex-PCR of mt-DNA cytochrome b gene was very sensitive to identify pork contamination in meatball with the presence of specific 398 bp DNA band.

  14. DnaC inactivation in Escherichia coli K-12 induces the SOS response and expression of nucleotide biosynthesis genes

    DEFF Research Database (Denmark)

    Løbner-Olesen, Anders; Slominska-Wojewodzka, Monika; Hansen, Flemming G.

    2008-01-01

    Background: Initiation of chromosome replication in E. coli requires the DnaA and DnaC proteins and conditionally-lethal dnaA and dnaC mutants are often used to synchronize cell populations. Methodology/Principal Findings: DNA microarrays were used to measure mRNA steady-state levels in initiatio......C genes was increased at the non-permissive temperature in the respective mutant strains indicating auto-regulation of both genes. Induction of the SOS regulon was observed in dnaC2 cells at 38 degrees C and 42 degrees C. Flow cytometric analysis revealed that dnaC2 mutant cells at non......-permissive temperature had completed the early stages of chromosome replication initiation. Conclusion/Significance: We suggest that in dnaC2 cells the SOS response is triggered by persistent open-complex formation at oriC and/or by arrested forks that require DnaC for replication restart....

  15. Arsenic exposure from drinking water is associated with decreased gene expression and increased DNA methylation in peripheral blood

    Energy Technology Data Exchange (ETDEWEB)

    Ameer, Syeda Shegufta [Department of Laboratory Medicine, Division of Occupational and Environmental Medicine, Lund University, Lund (Sweden); Engström, Karin [Department of Laboratory Medicine, Division of Occupational and Environmental Medicine, Lund University, Lund (Sweden); Institute of Environmental Medicine, Unit of Metals & Health, Karolinska Institutet, Stockholm (Sweden); Hossain, Mohammad Bakhtiar [Department of Laboratory Medicine, Division of Occupational and Environmental Medicine, Lund University, Lund (Sweden); Concha, Gabriela [Science Department, Risk Benefit Assessment Unit, National Food Agency, Uppsala (Sweden); Vahter, Marie [Institute of Environmental Medicine, Unit of Metals & Health, Karolinska Institutet, Stockholm (Sweden); Broberg, Karin, E-mail: Karin.broberg@ki.se [Institute of Environmental Medicine, Unit of Metals & Health, Karolinska Institutet, Stockholm (Sweden)

    2017-04-15

    Background: Exposure to inorganic arsenic increases the risk of cancer and non-malignant diseases. Inefficient arsenic metabolism is a marker for susceptibility to arsenic toxicity. Arsenic may alter gene expression, possibly by altering DNA methylation. Objectives: To elucidate the associations between arsenic exposure, gene expression, and DNA methylation in peripheral blood, and the modifying effects of arsenic metabolism. Methods: The study participants, women from the Andes, Argentina, were exposed to arsenic via drinking water. Arsenic exposure was assessed as the sum of arsenic metabolites in urine (U-As), using high performance liquid-chromatography hydride-generation inductively-coupled-plasma-mass-spectrometry, and arsenic metabolism efficiency was assessed by the urinary fractions (%) of the individual metabolites. Genome-wide gene expression (N = 80 women) and DNA methylation (N = 93; 80 overlapping with gene expression) in peripheral blood were measured using Illumina DirectHyb HumanHT-12 v4.0 and Infinium Human-Methylation 450K BeadChip, respectively. Results: U-As concentrations, ranging 10–1251 μg/L, was associated with decreased gene expression: 64% of the top 1000 differentially expressed genes were down-regulated with increasing U-As. U-As was also associated with hypermethylation: 87% of the top 1000 CpGs were hypermethylated with increasing U-As. The expression of six genes and six individual CpG sites were significantly associated with increased U-As concentration. Pathway analyses revealed enrichment of genes related to cell death and cancer. The pathways differed somewhat depending on arsenic metabolism efficiency. We found no overlap between arsenic-related gene expression and DNA methylation for individual genes. Conclusions: Increased arsenic exposure was associated with lower gene expression and hypermethylation in peripheral blood, but with no evident overlap. - Highlights: • Women exposed to inorganic arsenic were studied for

  16. Toward metrological traceability for DNA fragment ratios in GM quantification. 1. Effect of DNA extraction methods on the quantitative determination of Bt176 corn by real-time PCR.

    Science.gov (United States)

    Corbisier, Philippe; Broothaerts, Wim; Gioria, Sabrina; Schimmel, Heinz; Burns, Malcolm; Baoutina, Anna; Emslie, Kerry R; Furui, Satoshi; Kurosawa, Yasunori; Holden, Marcia J; Kim, Hyong-Ha; Lee, Yun-Mi; Kawaharasaki, Mamoru; Sin, Della; Wang, Jing

    2007-05-02

    An international CCQM-P60 pilot study involving eight national metrological institutes was organized to investigate if the quantification of genetically modified (GM) corn powder by real-time PCR was affected by the DNA extraction method applied. Four commonly used extraction methods were compared for the extraction of DNA from a GM Bt176 corn powder. The CTAB-based method yielded the highest DNA template quantity and quality. A difference in the 260 nm/230 nm absorbance ratio was observed among the different extraction methods. Real-time amplification of sequences specific for endogenous genes zein and hmg as well as transgenic sequences within the cryIA(b) gene and a fragment covering the junction between the transformed DNA and the plant genome were used to determine the GM percentage. The detection of the transgenic gene was affected by the quantity and quality of template used for the PCR reaction. The Bt176 percentages measured on diluted or purified templates were statistically different depending on the extraction method applied.

  17. Rapid, highly sensitive and highly specific gene detection by combining enzymatic amplification and DNA chip detection simultaneously

    Directory of Open Access Journals (Sweden)

    Koji Hashimoto

    2016-05-01

    Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond

  18. Mutant DNA quantification by digital PCR can be confounded by heating during DNA fragmentation.

    Science.gov (United States)

    Kang, Qing; Parkin, Brian; Giraldez, Maria D; Tewari, Muneesh

    2016-04-01

    Digital PCR (dPCR) is gaining popularity as a DNA mutation quantification method for clinical specimens. Fragmentation prior to dPCR is required for non-fragmented genomic DNA samples; however, the effect of fragmentation on DNA analysis has not been well-studied. Here we evaluated three fragmentation methods for their effects on dPCR point mutation assay performance. Wild-type (WT) human genomic DNA was fragmented by heating, restriction digestion, or acoustic shearing using a Covaris focused-ultrasonicator. dPCR was then used to determine the limit of blank (LoB) by quantifying observed WT and mutant allele counts of the proto-oncogenes KRAS and BRAF in the WT DNA sample. DNA fragmentation by heating to 95°C, while the simplest and least expensive method, produced a high background mutation frequency for certain KRAS mutations relative to the other methods. This was due to heat-induced mutations, specifically affecting dPCR assays designed to interrogate guanine to adenine (G>A) mutations. Moreover, heat-induced fragmentation overestimated gene copy number, potentially due to denaturation and partition of single-stranded DNA into different droplets. Covaris acoustic shearing and restriction enzyme digestion showed similar LoBs and gene copy number estimates to one another. It should be noted that moderate heating, commonly used in genomic DNA extraction protocols, did not significantly increase observed KRAS mutation counts.

  19. The dynamic changes of DNA methylation and histone modifications of salt responsive transcription factor genes in soybean.

    Directory of Open Access Journals (Sweden)

    Yuguang Song

    Full Text Available Epigenetic modification contributes to the regulation of gene expression and plant development under salinity stress. Here we describe the identification of 49 soybean transcription factors by microarray analysis as being inducible by salinity stress. A semi-quantitative RT-PCR-based expression assay confirmed the salinity stress inducibility of 45 of these 49 transcription factors, and showed that ten of them were up-regulated when seedlings were exposed to the demethylation agent 5-aza-2-deoxycytidine. Salinity stress was shown to affect the methylation status of four of these ten transcription factors (one MYB, one b-ZIP and two AP2/DREB family members using a combination of bisulfite sequencing and DNA methylation-sensitive DNA gel blot analysis. ChIP analysis indicated that the activation of three of the four DNA methylated transcription factors was correlated with an increased level of histone H3K4 trimethylation and H3K9 acetylation, and/or a reduced level of H3K9 demethylation in various parts of the promoter or coding regions. Our results suggest a critical role for some transcription factors' activation/repression by DNA methylation and/or histone modifications in soybean tolerance to salinity stress.

  20. Combined analysis of DNA methylome and transcriptome reveal novel candidate genes with susceptibility to bovine Staphylococcus aureus subclinical mastitis.

    Science.gov (United States)

    Song, Minyan; He, Yanghua; Zhou, Huangkai; Zhang, Yi; Li, Xizhi; Yu, Ying

    2016-07-14

    Subclinical mastitis is a widely spread disease of lactating cows. Its major pathogen is Staphylococcus aureus (S. aureus). In this study, we performed genome-wide integrative analysis of DNA methylation and transcriptional expression to identify candidate genes and pathways relevant to bovine S. aureus subclinical mastitis. The genome-scale DNA methylation profiles of peripheral blood lymphocytes in cows with S. aureus subclinical mastitis (SA group) and healthy controls (CK) were generated by methylated DNA immunoprecipitation combined with microarrays. We identified 1078 differentially methylated genes in SA cows compared with the controls. By integrating DNA methylation and transcriptome data, 58 differentially methylated genes were shared with differently expressed genes, in which 20.7% distinctly hypermethylated genes showed down-regulated expression in SA versus CK, whereas 14.3% dramatically hypomethylated genes showed up-regulated expression. Integrated pathway analysis suggested that these genes were related to inflammation, ErbB signalling pathway and mismatch repair. Further functional analysis revealed that three genes, NRG1, MST1 and NAT9, were strongly correlated with the progression of S. aureus subclinical mastitis and could be used as powerful biomarkers for the improvement of bovine mastitis resistance. Our studies lay the groundwork for epigenetic modification and mechanistic studies on susceptibility of bovine mastitis.

  1. Allele-specific DNA methylation of disease susceptibility genes in Japanese patients with inflammatory bowel disease.

    Science.gov (United States)

    Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru

    2018-01-01

    Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score ([Formula: see text]) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing [Formula: see text] >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of [Formula: see text] (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 ([Formula: see text] = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). We confirmed the existence of cis-regulated ASM around

  2. Allele-specific DNA methylation of disease susceptibility genes in Japanese patients with inflammatory bowel disease

    Science.gov (United States)

    Chiba, Hirofumi; Kakuta, Yoichi; Kinouchi, Yoshitaka; Kawai, Yosuke; Watanabe, Kazuhiro; Nagao, Munenori; Naito, Takeo; Onodera, Motoyuki; Moroi, Rintaro; Kuroha, Masatake; Kanazawa, Yoshitake; Kimura, Tomoya; Shiga, Hisashi; Endo, Katsuya; Negoro, Kenichi; Nagasaki, Masao; Unno, Michiaki; Shimosegawa, Tooru

    2018-01-01

    Background Inflammatory bowel disease (IBD) has an unknown etiology; however, accumulating evidence suggests that IBD is a multifactorial disease influenced by a combination of genetic and environmental factors. The influence of genetic variants on DNA methylation in cis and cis effects on expression have been demonstrated. We hypothesized that IBD susceptibility single-nucleotide polymorphisms (SNPs) regulate susceptibility gene expressions in cis by regulating DNA methylation around SNPs. For this, we determined cis-regulated allele-specific DNA methylation (ASM) around IBD susceptibility genes in CD4+ effector/memory T cells (Tem) in lamina propria mononuclear cells (LPMCs) in patients with IBD and examined the association between the ASM SNP genotype and neighboring susceptibility gene expressions. Methods CD4+ effector/memory T cells (Tem) were isolated from LPMCs in 15 Japanese IBD patients (ten Crohn's disease [CD] and five ulcerative colitis [UC] patients). ASM analysis was performed by methylation-sensitive SNP array analysis. We defined ASM as a changing average relative allele score (ΔRAS¯) >0.1 after digestion by methylation-sensitive restriction enzymes. Among SNPs showing ΔRAS¯ >0.1, we extracted the probes located on tag-SNPs of 200 IBD susceptibility loci and around IBD susceptibility genes as candidate ASM SNPs. To validate ASM, bisulfite-pyrosequencing was performed. Transcriptome analysis was examined in 11 IBD patients (seven CD and four UC patients). The relation between rs36221701 genotype and neighboring gene expressions were analyzed. Results We extracted six candidate ASM SNPs around IBD susceptibility genes. The top of ΔRAS¯ (0.23) was rs1130368 located on HLA-DQB1. ASM around rs36221701 (ΔRAS¯ = 0.14) located near SMAD3 was validated using bisulfite pyrosequencing. The SMAD3 expression was significantly associated with the rs36221701 genotype (p = 0.016). Conclusions We confirmed the existence of cis-regulated ASM around IBD

  3. cDNA-SRAP and Its Application in Differential Gene Expression Analysis: A Case Study in Erianthus arundinaceum

    Directory of Open Access Journals (Sweden)

    Youxiong Que

    2012-01-01

    Full Text Available Erianthus arundinaceum is a wild relative species of sugarcane. The aim of this research was to demonstrate the feasibility of cDNA-SRAP for differential gene expression and to explore the molecular mechanism of drought resistance in E. arundinaceum. cDNA-SRAP technique, for the first time, was applied in the analysis of differential gene expression in E. arundinaceum under drought stress. In total, eight differentially expressed genes with length of 185–427 bp were successfully isolated (GenBank Accession numbers: EU071770, EU071772, EU071774, EU071776, EU071777, EU071779, EU071780, and EU071781. Based on their homologies with genes in GenBank, these genes were assumed to encode ribonuclease III, vacuolar protein, ethylene insensitive protein, aerobactin biosynthesis protein, photosystem II protein, glucose transporter, leucine-rich repeat protein, and ammonia monooxygenase. Real-time PCR analysis on the expression profiling of gene (EU071774 encoding ethylene-insensitive protein and gene (EU071781 encoding ammonia monooxygenase revealed that the expression of these two genes was upregulated both by PEG and ABA treatments, suggesting that they may involve in the drought resistance of E. arundinaceum. This study constitutes the first report of genes activated in E. arundinaceum by drought stress and opens up the application of cDNA-SRAP in differential gene expression analysis in E. arundinaceum under certain stress conditions.

  4. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    NARCIS (Netherlands)

    Nalcacioglu, R.; Marks, H.; Vlak, J.M.; Demirbag, Z.; Oers, van M.M.

    2003-01-01

    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an

  5. Efficacy of DNA double-strand breaks repair in breast cancer is decreased in carriers of the variant allele of the UBC9 gene c.73G>A polymorphism

    Energy Technology Data Exchange (ETDEWEB)

    Synowiec, Ewelina [Department of Molecular Genetics, University of Lodz, Lodz (Poland); Krupa, Renata [Laboratory of DNA Repair, Department of Molecular Genetics, University of Lodz, Banacha 12/16, Lodz (Poland); Morawiec, Zbigniew; Wasylecka, Maja [Department of Surgical Oncology, N. Copernicus Hospital, Lodz (Poland); Dziki, Lukasz; Morawiec, Jan [Department of General and Colorectal Surgery, Medical University of Lodz, Lodz (Poland); Blasiak, Janusz [Department of Molecular Genetics, University of Lodz, Lodz (Poland); Wozniak, Katarzyna, E-mail: wozniak@biol.uni.lodz.pl [Laboratory of DNA Repair, Department of Molecular Genetics, University of Lodz, Banacha 12/16, Lodz (Poland)

    2010-12-10

    UBC9 (E2) SUMO conjugating enzyme plays an important role in the maintenance of genome stability and integrity. In the present work we examined the association between the c.73G>A (Val25Met) polymorphism of the UBC9 gene (rs11553473) and efficacy of DNA double-strand breaks (DSBs) repair (DRE) in breast cancer patients. We determined the level of endogenous (basal) and exogenous (induced by {gamma}-irradiation) DSBs and efficacy of their repair in peripheral blood lymphocytes of 57 breast cancer patients and 70 healthy individuals. DNA damage and repair were studied by neutral comet assay. Genotypes were determined in DNA from peripheral blood lymphocytes by allele-specific PCR (ASO-PCR). We also correlated genotypes with the clinical characteristics of breast cancer patients. We observed a strong association between breast cancer occurrence and the variant allele carried genotypes in patients with elevated level of basal as well as induced DNA damage (OR 6.74, 95% CI 2.27-20.0 and OR 5.33, 95% CI 1.81-15.7, respectively). We also found statistically significant (p < 0.05) difference in DRE related to the c.73G>A polymorphism of the UBC9 gene in breast cancer patients. Carriers of variant allele have decreased DNA DRE as compared to wild type genotype carriers. We did not find any association with the UBC9 gene polymorphism and estrogen and progesterone receptor status. The variant allele of the UBC9 gene polymorphism was strongly inversely related to HER negative breast cancer patients (OR 0.03, 95% CI 0.00-0.23). Our results suggest that the c.73G>A polymorphism of the UBC9 gene may affect DNA DSBs repair efficacy in breast cancer patients.

  6. The complete chloroplast genome sequence of the chlorophycean green alga Scenedesmus obliquus reveals a compact gene organization and a biased distribution of genes on the two DNA strands

    Science.gov (United States)

    de Cambiaire, Jean-Charles; Otis, Christian; Lemieux, Claude; Turmel, Monique

    2006-01-01

    Background The phylum Chlorophyta contains the majority of the green algae and is divided into four classes. While the basal position of the Prasinophyceae is well established, the divergence order of the Ulvophyceae, Trebouxiophyceae and Chlorophyceae (UTC) remains uncertain. The five complete chloroplast DNA (cpDNA) sequences currently available for representatives of these classes display considerable variability in overall structure, gene content, gene density, intron content and gene order. Among these genomes, that of the chlorophycean green alga Chlamydomonas reinhardtii has retained the least ancestral features. The two single-copy regions, which are separated from one another by the large inverted repeat (IR), have similar sizes, rather than unequal sizes, and differ radically in both gene contents and gene organizations relative to the single-copy regions of prasinophyte and ulvophyte cpDNAs. To gain insights into the various changes that underwent the chloroplast genome during the evolution of chlorophycean green algae, we have sequenced the cpDNA of Scenedesmus obliquus, a member of a distinct chlorophycean lineage. Results The 161,452 bp IR-containing genome of Scenedesmus features single-copy regions of similar sizes, encodes 96 genes, i.e. only two additional genes (infA and rpl12) relative to its Chlamydomonas homologue and contains seven group I and two group II introns. It is clearly more compact than the four UTC algal cpDNAs that have been examined so far, displays the lowest proportion of short repeats among these algae and shows a stronger bias in clustering of genes on the same DNA strand compared to Chlamydomonas cpDNA. Like the latter genome, Scenedesmus cpDNA displays only a few ancestral gene clusters. The two chlorophycean genomes share 11 gene clusters that are not found in previously sequenced trebouxiophyte and ulvophyte cpDNAs as well as a few genes that have an unusual structure; however, their single-copy regions differ

  7. Single-base resolution maps of cultivated and wild rice methylomes and regulatory roles of DNA methylation in plant gene expression

    Directory of Open Access Journals (Sweden)

    Li Xin

    2012-07-01

    Full Text Available Abstract Background DNA methylation plays important biological roles in plants and animals. To examine the rice genomic methylation landscape and assess its functional significance, we generated single-base resolution DNA methylome maps for Asian cultivated rice Oryza sativa ssp. japonica, indica and their wild relatives, Oryza rufipogon and Oryza nivara. Results The overall methylation level of rice genomes is four times higher than that of Arabidopsis. Consistent with the results reported for Arabidopsis, methylation in promoters represses gene expression while gene-body methylation generally appears to be positively associated with gene expression. Interestingly, we discovered that methylation in gene transcriptional termination regions (TTRs can significantly repress gene expression, and the effect is even stronger than that of promoter methylation. Through integrated analysis of genomic, DNA methylomic and transcriptomic differences between cultivated and wild rice, we found that primary DNA sequence divergence is the major determinant of methylational differences at the whole genome level, but DNA methylational difference alone can only account for limited gene expression variation between the cultivated and wild rice. Furthermore, we identified a number of genes with significant difference in methylation level between the wild and cultivated rice. Conclusions The single-base resolution methylomes of rice obtained in this study have not only broadened our understanding of the mechanism and function of DNA methylation in plant genomes, but also provided valuable data for future studies of rice epigenetics and the epigenetic differentiation between wild and cultivated rice.

  8. Plasmid DNA transfection using magnetite cationic liposomes for construction of multilayered gene-engineered cell sheet.

    Science.gov (United States)

    Ino, Kosuke; Kawasumi, Tamayo; Ito, Akira; Honda, Hiroyuki

    2008-05-01

    Modification of cellular functions by overexpression of genes is being increasingly practiced for tissue engineering. In the present study, we investigated whether transfection efficiency could be enhanced by magnetofection that involves the use of plasmid DNA (pDNA)/magnetite cationic liposomes (MCLs) complexes (pDNA/MCL) and magnetic force. The transfection efficiencies of the magnetofection technique by pDNA/MCL in fibroblasts and keratinocytes using reporter genes were 36- and 10-fold higher, respectively, than those of a lipofection technique by cationic liposomes. Moreover, in vitro construction of three-dimensional (3D) tissues is an important challenge. We recently proposed a novel technique termed "magnetic force-based tissue engineering" (Mag-TE) to produce 3D tissues. Since the fibroblasts after magnetofection incorporated both magnetite nanoparticles and pDNA, we investigated whether multilayered heterotypic cell sheets expressing transgene could be fabricated by Mag-TE. First, the fibroblasts were seeded onto an ultra-low attachment culture plate. When a magnet was placed under the plate, the cells accumulated at the bottom of the culture plate. After 24 h of culture, the transgene-expressing cells formed a multilayered cell sheet-like structure. These results indicated that MCLs are a potent biomanipulation tool for both gene transfer and 3D tissue construction, suggesting that these techniques are useful for tissue engineering. Copyright 2007 Wiley Periodicals, Inc.

  9. Mouse RAD54 affects DNA double-strand break repair and sister chromatid exchange

    NARCIS (Netherlands)

    H.B. Beverloo (Berna); R.D. Johnson (Roger); M. Jasin (Maria); R. Kanaar (Roland); J.H.J. Hoeijmakers (Jan); M.L.G. Dronkert (Mies)

    2000-01-01

    textabstractCells can achieve error-free repair of DNA double-strand breaks (DSBs) by homologous recombination through gene conversion with or without crossover. In contrast, an alternative homology-dependent DSB repair pathway, single-strand annealing (SSA), results in deletions. In this study, we

  10. Cloning of low dose radiation induced gene RIG1 by RACE based on non-cloned cDNA library

    International Nuclear Information System (INIS)

    Luo Ying; Sui Jianli; Tie Yi; Zhang Yuanping; Zhou Pingkun; Sun Zhixian

    2001-01-01

    Objective: To obtain full-length cDNA of radiation induced new gene RIG1 based on its EST fragment. Methods: Based on non-cloned cDNA library, enhanced nested RACE PCR and biotin-avidin labelled probe for magnetic bead purification was used to obtain full-length cDNA of RIG1. Results: About 1 kb of 3' end of RIG1 gene was successfully cloned by this set of methods and cloning of RIG1 5' end is proceeding well. Conclusion: The result is consistent with the design of experiment. This set of protocol is useful for cloning of full-length gene based on EST fragment

  11. First description of a novel mitochondrial mutation in the MT-TI gene associated with multiple mitochondrial DNA deletion and depletion in family with severe dilated mitochondrial cardiomyopathy.

    Science.gov (United States)

    Alila-Fersi, Olfa; Tabebi, Mouna; Maalej, Marwa; Belguith, Neila; Keskes, Leila; Mkaouar-Rebai, Emna; Fakhfakh, Faiza

    2018-03-18

    Mitochondria are essential for early cardiac development and impaired mitochondrial function was described associated with heart diseases such as hypertrophic or dilated mitochondrial cardiomyopathy. In this study, we report a family including two individuals with severe dilated mitochondrial cardiomyopathy. The whole mitochondrial genome screening showed the presence of several variations and a novel homoplasmic mutation m.4318-4322delC in the MT-TI gene shared by the two patients and their mother and leading to a disruption of the tRNA Ile secondary structure. In addition, a mitochondrial depletion was present in blood leucocyte of the two affected brother whereas a de novo heteroplasmic multiple deletion in the major arc of mtDNA was present in blood leucocyte and mucosa of only one of them. These deletions in the major arc of the mtDNA resulted to the loss of several protein-encoding genes and also some tRNA genes. The mtDNA deletion and depletion could result to an impairment of the oxidative phosphorylation and energy metabolism in the respiratory chain in the studied patients. Our report is the first description of a family with severe lethal dilated mitochondrial cardiomyopathy and presenting several mtDNA abnormalities including punctual mutation, deletion and depletion. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Cellular responses of Saccharomyces cerevisiae to DNA damage

    International Nuclear Information System (INIS)

    Ciesla, Z.; Sledziewska-Gojska, E.; Nowicka, A.; Mieczkowski, P.; Fikus, M.U.; Koprowski, P.

    1998-01-01

    Full text. Several experimental strategies have been used to study responses of S. cerevisiae cells to DNA damage. One approach was based on the isolation of novel genes, the expression of which is induced by lesions in DNA. One of these genes, DIN7, was cloned and partially characterized previously. The product of DIN7 belongs to a large family of proteins involved in DNA repair and mutagenesis. This family includes Rad2, Rad27 and ExoI proteins of S. cerevisiae and their respective human homologues, all of which are endowed with DNA nuclease activity. To study cellular function of Din7 we constructed the pPK3 plasmid carrying DIN7 fused to the GAL1 promoter. Effects of DIN7 overproduction on the phenotypes of wild-type cells and of rad27 and exoI mutants were examined. Overproduction of Din7 does not seem to affect the proficiency of wild-type S. cerevisiae cells in recombination and mutagenesis. Also, overexpression of DIN7 does not suppress the deficiency of the EXOI gene product, the closest homologue of Din7, both in recombination and in controlling the fidelity of DNA replication. Unexpectedly, we found that elevated levels of Din7 result in a very high frequency of mitochondrial rho - mutants. A high frequency of production of rho - mutants wa s also observed in strains defective in the functioning of the Dun1 protein kinase involved in signal transmission in cells exposed to DNA damaging agents. Interestingly, deficiency of Dun1 results also in a significant derepression of the DIN7 gene. Experiments are under way to distinguish whether a high cellular level of Din7 specifically decreases stability of mitochondrial DNA or affects stability of chromosomal DNA as well. Analysis of previously constructed S. cerevisiae strains carrying random geno mic fusions with reporter lacZ gene, allowed us to identify the reading frame YBR173c, on chromosome II as a novel damage inducible gene - DIN8. We have shown that DIN8-lacZ fusion is induced in yeast cells treated

  13. Trichloroethylene-induced gene expression and DNA methylation changes in B6C3F1 mouse liver.

    Directory of Open Access Journals (Sweden)

    Yan Jiang

    Full Text Available Trichloroethylene (TCE, widely used as an organic solvent in the industry, is a common contaminant in air, soil, and water. Chronic TCE exposure induced hepatocellular carcinoma in mice, and occupational exposure in humans was suggested to be associated with liver cancer. To understand the role of non-genotoxic mechanism(s for TCE action, we examined the gene expression and DNA methylation changes in the liver of B6C3F1 mice orally administered with TCE (0, 100, 500 and 1000 mg/kg b.w. per day for 5 days. After 5 days TCE treatment at a dose level of 1000 mg/kg b.w., a total of 431 differentially expressed genes were identified in mouse liver by microarray, of which 291 were up-regulated and 140 down-regulated. The expression changed genes were involved in key signal pathways including PPAR, proliferation, apoptosis and homologous recombination. Notably, the expression level of a number of vital genes involved in the regulation of DNA methylation, such as Utrf1, Tet2, DNMT1, DNMT3a and DNMT3b, were dysregulated. Although global DNA methylation change was not detected in the liver of mice exposed to TCE, the promoter regions of Cdkn1a and Ihh were found to be hypo- and hypermethylated respectively, which correlated negatively with their mRNA expression changes. Furthermore, the gene expression and DNA methylation changes induced by TCE were dose dependent. The overall data indicate that TCE exposure leads to aberrant DNA methylation changes, which might alter the expression of genes involved in the TCE-induced liver tumorgenesis.

  14. DNA sequence of 15 base pairs is sufficient to mediate both glucocorticoid and progesterone induction of gene expression

    International Nuclear Information System (INIS)

    Straehle, U.; Klock, G.; Schuetz, G.

    1987-01-01

    To define the recognition sequence of the glucocorticoid receptor and its relationship with that of the progesterone receptor, oligonucleotides derived from the glucocorticoid response element of the tyrosine aminotransferase gene were tested upstream of a heterologous promoter for their capacity to mediate effects of these two steroids. The authors show that a 15-base-pair sequence with partial symmetry is sufficient to confer glucocorticoid inducibility on the promoter of the herpes simplex virus thymidine kinase gene. The same 15-base-pair sequence mediates induction by progesterone. Point mutations in the recognition sequence affect inducibility by glucocorticoids and progesterone similarly. Together with the strong conservation of the sequence of the DNA-binding domain of the two receptors, these data suggest that both proteins recognize a sequence that is similar, if not the same

  15. DNA methylation polymorphism in a set of elite rice cultivars and its possible contribution to inter-cultivar differential gene expression.

    Science.gov (United States)

    Wang, Yongming; Lin, Xiuyun; Dong, Bo; Wang, Yingdian; Liu, Bao

    2004-01-01

    RAPD (randomly amplified polymorphic DNA) and ISSR (inter-simple sequence repeat) fingerprinting on HpaII/MspI-digested genomic DNA of nine elite japonica rice cultivars implies inter-cultivar DNA methylation polymorphism. Using both DNA fragments isolated from RAPD or ISSR gels and selected low-copy sequences as probes, methylation-sensitive Southern blot analysis confirms the existence of extensive DNA methylation polymorphism in both genes and DNA repeats among the rice cultivars. The cultivar-specific methylation patterns are stably maintained, and can be used as reliable molecular markers. Transcriptional analysis of four selected sequences (RdRP, AC9, HSP90 and MMR) on leaves and roots from normal and 5-azacytidine-treated seedlings of three representative cultivars shows an association between the transcriptional activity of one of the genes, the mismatch repair (MMR) gene, and its CG methylation patterns.

  16. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes

    Science.gov (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.

    2011-01-01

    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  17. Inherited Variation in Cytokine, Acute Phase Response, and Calcium Metabolism Genes Affects Susceptibility to Infective Endocarditis

    Directory of Open Access Journals (Sweden)

    Anastasia V. Ponasenko

    2017-01-01

    Full Text Available Infective endocarditis (IE is a septic inflammation of the endocardium. Recognition of microbial patterns, cytokine and acute phase responses, hemostasis features, and alterations in plasma lipid and calcium profile all have been reported to affect pathogenesis and clinical course of IE. Having recruited 123 patients with IE and 300 age-, sex-, and ethnicity-matched healthy blood donors, we profiled their genomic DNA for 35 functionally significant polymorphisms within the 22 selected genes involved in the abovementioned pathways, with the further genetic association analysis. We found that the G/A genotype of the rs1143634 polymorphism within the IL1B gene, the G/T genotype of the rs3212227 polymorphism within the IL12B gene, the A/G genotype of the rs1130864 polymorphism within the CRP gene, and the G allele of the rs1801197 polymorphism within the CALCR gene were associated with a decreased risk of IE whereas the T/T genotype of the rs1205 polymorphism within the CRP gene was associated with a higher risk of IE. Furthermore, heterozygous genotypes of the rs1143634 and rs3212227 polymorphisms were associated with the higher plasma levels of IL-1β and IL-12, respectively. Our results indicate that inherited variation in the cytokine, acute phase response, and calcium metabolism pathways may be linked to IE.

  18. Inherited Variation in Cytokine, Acute Phase Response, and Calcium Metabolism Genes Affects Susceptibility to Infective Endocarditis

    Science.gov (United States)

    Rutkovskaya, Natalia V.; Kondyukova, Natalia V.; Odarenko, Yuri N.; Kazachek, Yana V.; Tsepokina, Anna V.; Barbarash, Leonid S.

    2017-01-01

    Infective endocarditis (IE) is a septic inflammation of the endocardium. Recognition of microbial patterns, cytokine and acute phase responses, hemostasis features, and alterations in plasma lipid and calcium profile all have been reported to affect pathogenesis and clinical course of IE. Having recruited 123 patients with IE and 300 age-, sex-, and ethnicity-matched healthy blood donors, we profiled their genomic DNA for 35 functionally significant polymorphisms within the 22 selected genes involved in the abovementioned pathways, with the further genetic association analysis. We found that the G/A genotype of the rs1143634 polymorphism within the IL1B gene, the G/T genotype of the rs3212227 polymorphism within the IL12B gene, the A/G genotype of the rs1130864 polymorphism within the CRP gene, and the G allele of the rs1801197 polymorphism within the CALCR gene were associated with a decreased risk of IE whereas the T/T genotype of the rs1205 polymorphism within the CRP gene was associated with a higher risk of IE. Furthermore, heterozygous genotypes of the rs1143634 and rs3212227 polymorphisms were associated with the higher plasma levels of IL-1β and IL-12, respectively. Our results indicate that inherited variation in the cytokine, acute phase response, and calcium metabolism pathways may be linked to IE. PMID:28659664

  19. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    Science.gov (United States)

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  20. Biochemical studies of DNA strand break repair and molecular characterization of mei-41, a gene involved in DNA break repair

    International Nuclear Information System (INIS)

    Oliveri, D.R.

    1989-01-01

    The ability to repair X-irradiation induced single-strand DNA breaks was examined in mutagen-sensitive mutants of Drosophila melanogaster. This analysis demonstrated that examined stocks possess a normal capacity to repair X-ray induced single-strand breaks. One of the mutants in this study, mei-41, has been shown to be involved in a number of DNA metabolizing functions. A molecular characterization of this mutant is presented. A cDNA hybridizing to genomic DNA both proximal and distal to a P element inducing a mei-41 mutation was isolated from both embryonic and adult female recombinant lambda phage libraries. A 2.2 kilobase embryonic cDNA clone was sequenced; the sequence of an open reading frame was identified which would predict a protein of 384 amino acids with a molecular weight of 43,132 daltons. An examination of homologies to sequences in protein and nucleic acid data bases revealed no sequences with significant homology to mei-41, however, two potential Zinc-finger domains were identified. Analysis of RNA hybridizing to the embryonic cDNA demonstrated the existence of a major 2.2 kilobase transcript expressed primarily in embryos and adult flies. An examination of the transcription of this gene in mei-41 mutants revealed significant variation from wild-type, an indication that the embryonic cDNA does represent a mei-41 transcript. Expression in tissues from adult animals demonstrated that the 2.2 kilobase RNA is expressed primarily in reproductive tissues. A 3.8kb transcript is the major species of RNA in the adult head and thorax. Evidence is presented which implies that expression of the mei-41 gene is strongly induced by exposure of certain cells to mutagens

  1. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  2. Development of gene diagnosis for diabetes and cholecystitis based on gene analysis of CCK-A receptor

    International Nuclear Information System (INIS)

    Kono, Akira

    1999-01-01

    Base sequence analysis of CCKAR gene (a gene of A-type receptor for cholecystokinin) from OLETF rat, a model rat for insulin-independent diabetes was made based on the base sequence of wild CCKAR gene, which had been clarified in the previous year. From the pancreas of OLETF rat, DNA was extracted and transduced into λphage after fragmentation to construct the gene library of OLETF. Then, λphage DNA clone bound with labelled cDNA of CCKAR gene was analyzed and the gene structure was compared with that of the wild gene. It was demonstrated that CCKAR gene of OLETF had a deletion (6800 b.p.) ranging from the promoter region to the Exon 2, suggesting that CCKAR gene is not functional in OLETF rat. The whole sequence of this mutant gene was registered into Japan DNA Bank (D 50610). Then, F 2 offspring rats were obtained through crossing OLETF (female) and F344 (male) and the time course-changes in the blood glucose level after glucose loading were compared among them. The blood glucose level after glucose loading was significantly higher in the homo-mutant F 2 (CCKAR,-/-) as well as the parent OLETF rat than hetero-mutant F 2 (CCKARm-/+) or the wild rat (CCKAR,+/+). This suggests that CCKAR gene might be involved in the control of blood glucose level and an alteration of the expression level or the functions of CCKAR gene might affect the blood glucose level. (M.N.)

  3. cDNA sequence of human transforming gene hst and identification of the coding sequence required for transforming activity

    International Nuclear Information System (INIS)

    Taira, M.; Yoshida, T.; Miyagawa, K.; Sakamoto, H.; Terada, M.; Sugimura, T.

    1987-01-01

    The hst gene was originally identified as a transforming gene in DNAs from human stomach cancers and from a noncancerous portion of stomach mucosa by DNA-mediated transfection assay using NIH3T3 cells. cDNA clones of hst were isolated from the cDNA library constructed from poly(A) + RNA of a secondary transformant induced by the DNA from a stomach cancer. The sequence analysis of the hst cDNA revealed the presence of two open reading frames. When this cDNA was inserted into an expression vector containing the simian virus 40 promoter, it efficiently induced the transformation of NIH3T3 cells upon transfection. It was found that one of the reading frames, which coded for 206 amino acids, was responsible for the transforming activity

  4. DNA damage-responsive Drosophila melanogaster gene is also induced by heat shock

    International Nuclear Information System (INIS)

    Vivino, A.A.; Smith, M.D.; Minton, K.W.

    1986-01-01

    A gene isolated by screening Drosophila melanogaster tissue culture cells for DNA damage regulation was also found to be regulated by heat shock. After UV irradiation or heat shock, induction is at the transcriptional level and results in the accumulation of a 1.0-kilobase polyadenylated transcript. The restriction map of the clone bears no resemblance to the known heat shock genes, which are shown to be uninduced by UV irradiation

  5. Senataxin plays an essential role with DNA damage response proteins in meiotic recombination and gene silencing.

    Directory of Open Access Journals (Sweden)

    Olivier J Becherel

    2013-04-01

    Full Text Available Senataxin, mutated in the human genetic disorder ataxia with oculomotor apraxia type 2 (AOA2, plays an important role in maintaining genome integrity by coordination of transcription, DNA replication, and the DNA damage response. We demonstrate that senataxin is essential for spermatogenesis and that it functions at two stages in meiosis during crossing-over in homologous recombination and in meiotic sex chromosome inactivation (MSCI. Disruption of the Setx gene caused persistence of DNA double-strand breaks, a defect in disassembly of Rad51 filaments, accumulation of DNA:RNA hybrids (R-loops, and ultimately a failure of crossing-over. Senataxin localised to the XY body in a Brca1-dependent manner, and in its absence there was incomplete localisation of DNA damage response proteins to the XY chromosomes and ATR was retained on the axial elements of these chromosomes, failing to diffuse out into chromatin. Furthermore persistence of RNA polymerase II activity, altered ubH2A distribution, and abnormal XY-linked gene expression in Setx⁻/⁻ revealed an essential role for senataxin in MSCI. These data support key roles for senataxin in coordinating meiotic crossing-over with transcription and in gene silencing to protect the integrity of the genome.

  6. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jason A Hilton

    Full Text Available Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision, up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption

  7. Surveying DNA Elements within Functional Genes of Heterocyst-Forming Cyanobacteria.

    Science.gov (United States)

    Hilton, Jason A; Meeks, John C; Zehr, Jonathan P

    2016-01-01

    Some cyanobacteria are capable of differentiating a variety of cell types in response to environmental factors. For instance, in low nitrogen conditions, some cyanobacteria form heterocysts, which are specialized for N2 fixation. Many heterocyst-forming cyanobacteria have DNA elements interrupting key N2 fixation genes, elements that are excised during heterocyst differentiation. While the mechanism for the excision of the element has been well-studied, many questions remain regarding the introduction of the elements into the cyanobacterial lineage and whether they have been retained ever since or have been lost and reintroduced. To examine the evolutionary relationships and possible function of DNA sequences that interrupt genes of heterocyst-forming cyanobacteria, we identified and compared 101 interruption element sequences within genes from 38 heterocyst-forming cyanobacterial genomes. The interruption element lengths ranged from about 1 kb (the minimum able to encode the recombinase responsible for element excision), up to nearly 1 Mb. The recombinase gene sequences served as genetic markers that were common across the interruption elements and were used to track element evolution. Elements were found that interrupted 22 different orthologs, only five of which had been previously observed to be interrupted by an element. Most of the newly identified interrupted orthologs encode proteins that have been shown to have heterocyst-specific activity. However, the presence of interruption elements within genes with no known role in N2 fixation, as well as in three non-heterocyst-forming cyanobacteria, indicates that the processes that trigger the excision of elements may not be limited to heterocyst development or that the elements move randomly within genomes. This comprehensive analysis provides the framework to study the history and behavior of these unique sequences, and offers new insight regarding the frequency and persistence of interruption elements in

  8. Transferrin-polycation-mediated introduction of DNA into human leukemic cells: Stimulation by agents that affect the survival of transfected DNA or modulate transferrin receptor levels

    International Nuclear Information System (INIS)

    Cotten, M.; Laengle-Rouault, F.; Kirlappos, H.; Wagner, E.; Mechtler, K.; Zenke, M.; Beug, H.; Birnstiel, M.L.

    1990-01-01

    The authors have subverted a receptor-mediated endocytosis event to transport genes into human leukemic cells. By coupling the natural iron-delivery protein transferrin to the DNA-binding polycations polylysine or protamine, they have created protein conjugates that bind nucleic acids and carry them into the cell during the normal transferrin cycle. They demonstrate here that this procedure is useful for a human leukemic cell line. They enhanced the rate of gene delivery by (i) increasing the transferrin receptor density through treatment of the cells with the cell permeable iron chelator desferrioxamine, (ii) interfering with the synthesis of heme with succinyl acetone treatment, or (iii) stimulating the degradation of heme with cobalt chloride treatment. Consistent with gene delivery as an endocytosis event, they show that the subsequent expression in K-562 cells of a gene included in the transported DNA depends upon the cellular presence of the lysosomotropic agent chloroquine. By contrast, monensin blocks transferrinfection, as does incubation of the cells at 18 degree C

  9. Promoter analysis of the Chilo iridescent virus DNA polymerase and major capsid protein genes

    International Nuclear Information System (INIS)

    Nalcacioglu, Remziye; Marks, Hendrik; Vlak, Just M.; Demirbag, Zihni; Oers, Monique M. van

    2003-01-01

    The DNA polymerase (DNApol) and major capsid protein (MCP) genes were used as models to study promoter activity in Chilo iridescent virus (CIV). Infection of Bombyx mori SPC-BM-36 cells in the presence of inhibitors of DNA or protein synthesis showed that DNApol, as well as helicase, is an immediate-early gene and confirmed that the major capsid protein (MCP) is a late gene. Transcription of DNApol initiated 35 nt upstream and that of MCP 14 nt upstream of the translational start site. In a luciferase reporter gene assay both promoters were active only when cells were infected with CIV. For DNApol sequences between position -27 and -6, relative to the transcriptional start site, were essential for promoter activity. Furthermore, mutation of a G within the sequence TTGTTTT located just upstream of the DNApol transcription initiation site reduced the promoter activity by 25%. Sequences crucial for MCP promoter activity are located between positions -53 and -29

  10. Human native lipoprotein-induced de novo DNA methylation is associated with repression of inflammatory genes in THP-1 macrophages.

    Science.gov (United States)

    Rangel-Salazar, Rubén; Wickström-Lindholm, Marie; Aguilar-Salinas, Carlos A; Alvarado-Caudillo, Yolanda; Døssing, Kristina B V; Esteller, Manel; Labourier, Emmanuel; Lund, Gertrud; Nielsen, Finn C; Rodríguez-Ríos, Dalia; Solís-Martínez, Martha O; Wrobel, Katarzyna; Wrobel, Kazimierz; Zaina, Silvio

    2011-11-25

    We previously showed that a VLDL- and LDL-rich mix of human native lipoproteins induces a set of repressive epigenetic marks, i.e. de novo DNA methylation, histone 4 hypoacetylation and histone 4 lysine 20 (H4K20) hypermethylation in THP-1 macrophages. Here, we: 1) ask what gene expression changes accompany these epigenetic responses; 2) test the involvement of candidate factors mediating the latter. We exploited genome expression arrays to identify target genes for lipoprotein-induced silencing, in addition to RNAi and expression studies to test the involvement of candidate mediating factors. The study was conducted in human THP-1 macrophages. Native lipoprotein-induced de novo DNA methylation was associated with a general repression of various critical genes for macrophage function, including pro-inflammatory genes. Lipoproteins showed differential effects on epigenetic marks, as de novo DNA methylation was induced by VLDL and to a lesser extent by LDL, but not by HDL, and VLDL induced H4K20 hypermethylation, while HDL caused H4 deacetylation. The analysis of candidate factors mediating VLDL-induced DNA hypermethylation revealed that this response was: 1) surprisingly, mediated exclusively by the canonical maintenance DNA methyltransferase DNMT1, and 2) independent of the Dicer/micro-RNA pathway. Our work provides novel insights into epigenetic gene regulation by native lipoproteins. Furthermore, we provide an example of DNMT1 acting as a de novo DNA methyltransferase independently of canonical de novo enzymes, and show proof of principle that de novo DNA methylation can occur independently of a functional Dicer/micro-RNA pathway in mammals.

  11. Lead induces DNA damage and alteration of ALAD and antioxidant genes mRNA expression in construction site workers.

    Science.gov (United States)

    Akram, Zertashia; Riaz, Sadaf; Kayani, Mahmood Akhtar; Jahan, Sarwat; Ahmad, Malik Waqar; Ullah, Muhammad Abaid; Wazir, Hizbullah; Mahjabeen, Ishrat

    2018-01-16

    Oxidative stress and DNA damage are considered as possible mechanisms involved in lead toxicity. To test this hypothesis, DNA damage and expression variations of aminolevulinic acid dehydratase (ALAD), superoxide dismutase 2 (SOD2), and 8-oxoguanine DNA glycosylase 2a (OGG1-2a) genes was studied in a cohort of 100 exposed workers and 100 controls with comet assay and real-time polymerse chain reaction (PCR). Results indicated that increased number of comets was observed in exposed workers versus controls (p gene.

  12. DNA polymorphism of HLA class II genes in systemic lupus erythematosus

    DEFF Research Database (Denmark)

    Cowland, J B; Andersen, V; Halberg, P

    1994-01-01

    We investigated the DNA restriction fragment length polymorphism (RFLP) of the major histocompatibility complex (MHC) genes: HLA-DRB, -DQA, -DQB, -DPB in 24 Danish patients with systemic lupus erythematosus (SLE) and in 102 healthy Danes. A highly significant increase of the frequency of the DR3...

  13. MIWI2 as an Effector of DNA Methylation and Gene Silencing in Embryonic Male Germ Cells

    Directory of Open Access Journals (Sweden)

    Kanako Kojima-Kita

    2016-09-01

    Full Text Available During the development of mammalian embryonic germ cells, global demethylation and de novo DNA methylation take place. In mouse embryonic germ cells, two PIWI family proteins, MILI and MIWI2, are essential for the de novo DNA methylation of retrotransposons, presumably through PIWI-interacting RNAs (piRNAs. Although piRNA-associated MIWI2 has been reported to play critical roles in the process, its molecular mechanisms have remained unclear. To identify the mechanism, transgenic mice were produced; they contained a fusion protein of MIWI2 and a zinc finger (ZF that recognized the promoter region of a type A LINE-1 gene. The ZF-MIWI2 fusion protein brought about DNA methylation, suppression of the type A LINE-1 gene, and a partial rescue of the impaired spermatogenesis of MILI-null mice. In addition, ZF-MIWI2 was associated with the proteins involved in DNA methylation. These data indicate that MIWI2 functions as an effector of de novo DNA methylation of the retrotransposon.

  14. Histone gene expression remains coupled to DNA synthesis during in vitro cellular senescence

    International Nuclear Information System (INIS)

    Zambetti, G.; Stein, G.; Stein, J.; Dell'Orco, R.

    1987-01-01

    Despite a decrease in the extent to which confluent monolayers of late compared to early passage CF3 human diploid fibroblasts can be stimulated to proliferate, the time course of DNA synthesis onset is similar regardless of the in vitro age of the cells. A parallel and stoichiometric relationship is maintained between the rate of DNA synthesis and the cellular levels of histone mRNA independent of the age of the cell cultures. Furthermore, DNA synthesis and cellular histone mRNA levels decline in a coordinate manner after inhibition of DNA replication by hydroxyurea treatment. These results indicate that while the proliferative activity of human diploid fibroblasts decreases with passage in culture, those cells that retain the ability to proliferate continue to exhibit a tight coupling of DNA replication and histone gene expression

  15. cDNA cloning and transcriptional controlling of a novel low dose radiation-induced gene and its function analysis

    International Nuclear Information System (INIS)

    Zhou Pingkun; Sui Jianli

    2002-01-01

    Objective: To clone a novel low dose radiation-induced gene (LRIGx) and study its function as well as its transcriptional changes after irradiation. Methods: Its cDNA was obtained by DDRT-PCR and RACE techniques. Northern blot hybridization was used to investigate the gene transcription. Bioinformatics was employed to analysis structure and function of this gene. Results: LRIGx cDNA was cloned. The sequence of LRIGx was identical to a DNA clone located in human chromosome 20 q 11.2-12 Bioinformatics analysis predicted an encoded protein with a conserved helicase domain. Northern analysis revealed a ∼8.5 kb transcript which was induced after 0.2 Gy as well as 0.02 Gy irradiation, and the transcript level was increased 5 times at 4 h after 0.2 Gy irradiation. The induced level of LRIGx transcript by 2.0 Gy high dose was lower than by 0.2 Gy. Conclusion: A novel low dose radiation-induced gene has been cloned. It encodes a protein with a conserved helicase domain that could involve in DNA metabolism in the cellular process of radiation response

  16. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  17. Gene structure, expression, and DNA methylation characteristics of sea cucumber cyclin B gene during aestivation.

    Science.gov (United States)

    Zhu, Aijun; Chen, Muyan; Zhang, Xiumei; Storey, Kenneth B

    2016-12-05

    The sea cucumber, Apostichopus japonicus, is a good model for studying environmentally-induced aestivation by a marine invertebrate. One of the central requirements of aestivation is the repression of energy-expensive cellular processes such as cell cycle progression. The present study identified the gene structure of the cell cycle regulator, cyclin B, and detected the expression levels of this gene over three stages of the annual aestivation-arousal cycle. Furthermore, the DNA methylation characteristics of cyclin B were analyzed in non-aestivation and deep-aestivation stages of sea cucumbers. We found that the cyclin B promoter contains a CpG island, three CCAAT-boxes and three cell cycle gene homology regions (CHRs). Application of qRT-PCR analysis showed significant downregulation of cyclin B transcript levels during deep-aestivation in comparison with non-aestivation in both intestine and longitudinal muscle, and these returned to basal levels after arousal from aestivation. Methylation analysis of the cyclin B core promoter revealed that its methylation level showed significant differences between non-aestivation and deep-aestivation stages (p<0.05) and interestingly, a positive correlation between Cyclin B transcripts expression and methylation levels of the core promoter was also observed. Our findings suggest that cell cycle progression may be reversibly arrested during aestivation as indicated by the changes in cyclin B expression levels and we propose that DNA methylation is one of the regulatory mechanisms involved in cyclin B transcriptional variation. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Modulation of Colorectal Cancer Risk by Polymorphisms in 51Gln/His, 64Ile/Val, and 148Asp/Glu of APEX Gene; 23Gly/Ala of XPA Gene; and 689Ser/Arg of ERCC4 Gene

    Directory of Open Access Journals (Sweden)

    L. Dziki

    2017-01-01

    Full Text Available Polymorphisms in DNA repair genes may affect the activity of the BER (base excision repair and NER (nucleotide excision repair systems. Using DNA isolated from blood taken from patients (n=312 and a control group (n=320 with CRC, we have analyzed the polymorphisms of selected DNA repair genes and we have demonstrated that genotypes 51Gln/His and 148Asp/Glu of APEX gene and 23Gly/Ala of XPA gene may increase the risk of colorectal cancer. At the same time analyzing the gene-gene interactions, we suggest the thesis that the main factor to be considered when analyzing the impact of polymorphisms on the risk of malignant transformation should be intergenic interactions. Moreover, we are suggesting that some polymorphisms may have impact not only on the malignant transformation but also on the stage of the tumor.

  19. Altered DNA Methylation and Differential Expression of Genes Influencing Metabolism and Inflammation in Adipose Tissue From Subjects With Type 2 Diabetes

    DEFF Research Database (Denmark)

    Nilsson, Emma; Jansson, Per Anders; Perfilyev, Alexander

    2014-01-01

    Genetics, epigenetics, and environment may together affect the susceptibility for type 2 diabetes (T2D). Our aim was to dissect molecular mechanisms underlying T2D using genome-wide expression and DNA methylation data in adipose tissue from monozygotic twin pairs discordant for T2D and independent...... case-control cohorts. In adipose tissue from diabetic twins, we found decreased expression of genes involved in oxidative phosphorylation; carbohydrate, amino acid, and lipid metabolism; and increased expression of genes involved in inflammation and glycan degradation. The most differentially expressed...... genes included ELOVL6, GYS2, FADS1, SPP1 (OPN), CCL18, and IL1RN. We replicated these results in adipose tissue from an independent case-control cohort. Several candidate genes for obesity and T2D (e.g., IRS1 and VEGFA) were differentially expressed in discordant twins. We found a heritable contribution...

  20. Development of a DNA-liposome complex for gene delivery applications

    Energy Technology Data Exchange (ETDEWEB)

    Rasoulianboroujeni, M. [Marquette University School of Dentistry, Milwaukee, WI 53233 (United States); Kupgan, G. [Department of Chemical Engineering, Oklahoma State University, 423 Engineering North, Stillwater, OK 74078 (United States); Moghadam, F. [School of Biological and Health Systems Engineering, Arizona State University, Tempe, AZ (United States); Tahriri, M. [Marquette University School of Dentistry, Milwaukee, WI 53233 (United States); Boughdachi, A. [Polymer Engineering Department, Amirkabir University of Technology, Tehran (Iran, Islamic Republic of); Khoshkenar, P. [Program in Molecular Medicine, University of Massachusetts Medical School, Worcester, MA 01605 (United States); Ambrose, J.J. [Biomedical Engineering Department, Louisiana Tech University, Ruston, LA 71272 (United States); Kiaie, N. [Tissue Engineering Department, Faculty of Biomedical Engineering, Amirkabir University of Technology, Tehran (Iran, Islamic Republic of); Vashaee, D. [Electrical and Computer Engineering Department, North Carolina State University, Raleigh, NC 27606 (United States); Ramsey, J.D. [Department of Chemical Engineering, Oklahoma State University, 423 Engineering North, Stillwater, OK 74078 (United States); Tayebi, L., E-mail: lobat.tayebi@marquette.edu [Marquette University School of Dentistry, Milwaukee, WI 53233 (United States)

    2017-06-01

    The association structures formed by cationic liposomes and DNA (Deoxyribonucleic acid)-liposome have been effectively utilized as gene carriers in transfection assays. In this research study, cationic liposomes were prepared using a modified lipid film hydration method consisting of a lyophilization step for gene delivery applications. The obtained results demonstrated that the mean particle size had no significant change while the polydispersity (PDI) increased after lyophilization. The mean particle size slightly reduced after lyophilization (520 ± 12 nm to 464 ± 25 nm) while the PDI increased after lyophilization (0.094 ± 0.017 to 0.220 ± 0.004). In addition. The mean particle size of vesicles increases when DNA is incorporated to the liposomes (673 ± 27 nm). According to the Scanning Electron Microscopy (SEM) and transmission electron microscopy (TEM) images, the spherical shape of liposomes confirmed their successful preservation and reconstitution from the powder. It was found that liposomal formulation has enhanced transfection considerably compared to the naked DNA as negative control. Finally, liposomal formulation in this research had a better function than Lipofectamine® 2000 as a commercialized product because the cellular activity (cellular protein) was higher in the prepared lipoplex than Lipofectamine® 2000. - Highlights: • Liposomal formulation in this research had a better function than Lipofectamine® 2000. • The average particle size had no significant change while the PDI increased after lyophilization. • LacZ expression of the developed cationic liposomes is approximately equal to the Lipofectamine® 2000.

  1. Nonviral Gene Targeting at rDNA Locus of Human Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Youjin Hu

    2013-01-01

    Full Text Available Background. Genetic modification, such as the addition of exogenous genes to the MSC genome, is crucial to their use as cellular vehicles. Due to the risks associated with viral vectors such as insertional mutagenesis, the safer nonviral vectors have drawn a great deal of attention. Methods. VEGF, bFGF, vitamin C, and insulin-transferrin-selenium-X were supplemented in the MSC culture medium. The cells’ proliferation and survival capacity was measured by MTT, determination of the cumulative number of cells, and a colony-forming efficiency assay. The plasmid pHr2-NL was constructed and nucleofected into MSCs. The recombinants were selected using G418 and characterized using PCR and Southern blotting. Results. BFGF is critical to MSC growth and it acted synergistically with vitamin C, VEGF, and ITS-X, causing the cells to expand significantly. The neomycin gene was targeted to the rDNA locus of human MSCs using a nonviral human ribosomal targeting vector. The recombinant MSCs retained multipotential differentiation capacity, typical levels of hMSC surface marker expression, and a normal karyotype, and none were tumorigenic in nude mice. Conclusions. Exogenous genes can be targeted to the rDNA locus of human MSCs while maintaining the characteristics of MSCs. This is the first nonviral gene targeting of hMSCs.

  2. Early Developmental and Evolutionary Origins of Gene Body DNA Methylation Patterns in Mammalian Placentas.

    Directory of Open Access Journals (Sweden)

    Diane I Schroeder

    2015-08-01

    Full Text Available Over the last 20-80 million years the mammalian placenta has taken on a variety of morphologies through both divergent and convergent evolution. Recently we have shown that the human placenta genome has a unique epigenetic pattern of large partially methylated domains (PMDs and highly methylated domains (HMDs with gene body DNA methylation positively correlating with level of gene expression. In order to determine the evolutionary conservation of DNA methylation patterns and transcriptional regulatory programs in the placenta, we performed a genome-wide methylome (MethylC-seq analysis of human, rhesus macaque, squirrel monkey, mouse, dog, horse, and cow placentas as well as opossum extraembryonic membrane. We found that, similar to human placenta, mammalian placentas and opossum extraembryonic membrane have globally lower levels of methylation compared to somatic tissues. Higher relative gene body methylation was the conserved feature across all mammalian placentas, despite differences in PMD/HMDs and absolute methylation levels. Specifically, higher methylation over the bodies of genes involved in mitosis, vesicle-mediated transport, protein phosphorylation, and chromatin modification was observed compared with the rest of the genome. As in human placenta, higher methylation is associated with higher gene expression and is predictive of genic location across species. Analysis of DNA methylation in oocytes and preimplantation embryos shows a conserved pattern of gene body methylation similar to the placenta. Intriguingly, mouse and cow oocytes and mouse early embryos have PMD/HMDs but their placentas do not, suggesting that PMD/HMDs are a feature of early preimplantation methylation patterns that become lost during placental development in some species and following implantation of the embryo.

  3. Integrative analysis of gene expression and DNA methylation using unsupervised feature extraction for detecting candidate cancer biomarkers.

    Science.gov (United States)

    Moon, Myungjin; Nakai, Kenta

    2018-04-01

    Currently, cancer biomarker discovery is one of the important research topics worldwide. In particular, detecting significant genes related to cancer is an important task for early diagnosis and treatment of cancer. Conventional studies mostly focus on genes that are differentially expressed in different states of cancer; however, noise in gene expression datasets and insufficient information in limited datasets impede precise analysis of novel candidate biomarkers. In this study, we propose an integrative analysis of gene expression and DNA methylation using normalization and unsupervised feature extractions to identify candidate biomarkers of cancer using renal cell carcinoma RNA-seq datasets. Gene expression and DNA methylation datasets are normalized by Box-Cox transformation and integrated into a one-dimensional dataset that retains the major characteristics of the original datasets by unsupervised feature extraction methods, and differentially expressed genes are selected from the integrated dataset. Use of the integrated dataset demonstrated improved performance as compared with conventional approaches that utilize gene expression or DNA methylation datasets alone. Validation based on the literature showed that a considerable number of top-ranked genes from the integrated dataset have known relationships with cancer, implying that novel candidate biomarkers can also be acquired from the proposed analysis method. Furthermore, we expect that the proposed method can be expanded for applications involving various types of multi-omics datasets.

  4. Cloning of the DNA repair gene, uvsF, by transformation of Aspergillus nidulans.

    Science.gov (United States)

    Oza, K; Käfer, E

    1990-06-01

    As a first step in the cloning of the DNA repair gene uvsF of Aspergillus nidulans, uvsF pyrG double mutant strains were transformed with a genomic library which carried the complementing Neurospora pyr-4 gene in the vector. Rare pyr+ uvs+ cotransformants were obtained on media lacking pyrimidines, overlayed with MMS (methyl-methane sulfonate) to which uvsF is hypersensitive. Among MMS-resistant transformants, Southerns revealed two types which showed single bands of different sizes when BglII-digested genomic DNA was probed with the vector. Both types produced uvsF- recombinants without vector sequences in homozygous crosses, but only those with the larger band also produced haploid uvs+ progeny. Using BglII-digested genomic DNA to transform Escherichia coli, plasmids of the corresponding two sizes could be rescued. Their inserts had a short internal region in common, giving evidence of rearrangement(s). In secondary transformation of uvsF mutants, only the plasmids with the larger insert showed complementation and these were used to screen Aspergillus libraries. Three types of genomic and two overlapping cDNA clones were identified. The cDNAs hybridized not only to each other, but also to the common region of the rescued plasmids. Therefore, cDNA subclones were used to map the putative uvsF sequences to a short segment in one genomic clone. In Northerns, the complementing large plasmid hybridized to three mRNAs, while the cDNA subclone identified one of these as the probable uvsF message.

  5. Protective effects of the exopolysaccharide Lasiodiplodan against DNA damage and inflammation induced by doxorubicin in rats: Cytogenetic and gene expression assays

    International Nuclear Information System (INIS)

    Mello, M.B.; Machado, C.S.; Ribeiro, D.L.; Aissa, A.F.; Burim, R.V.; Alves da Cunha, M.A.; Barcelos, G.R.M.

    2017-01-01

    The lasiodiplodan (LS) is a β-(1 → 6)-D-glucan produced by the fungus Lasiodiplodia theobromae and some of the biological activities of LS were reported as hypoglycemic, anticoagulant, anti-proliferative and anticancer action; however, its effects on DNA instability and modulation of gene expression are still unclear. Aims of study were investigate the genotoxic effects of lasiodiplodan, and its protective activity against DNA damage induced by doxorubicin (DXR) and its impact on the expression of genes associated with DNA damage and inflammatory response pathways. Therefore, Wistar rats were treated (15 days) orally with LS (5.0; 10 and 20 mg/kg bw) alone and in combination with DXR (15 mg/kg bw; administrated intraperitoneally on 14th day) as well as their respective controls: distilled water and DXR. Monitoring of DNA damage was assessed by comet and micronucleus (MN) assays and gene expression was evaluated by PCR-Arrays. Treatments with LS alone did not induce disturbances on DNA; when LS was given in combination with DXR, comet and MN formations were reduced to those found in the respective controls. Moreover, LS was able to reduce the disturbances on gene expressions induced by DXR treatment, since the animals that receive LS associated with DXR showed no alteration in the expression of genes related to DNA damage response. Also, DXR induced several up- and down-regulation of several genes associated to inflammatory process, while the animals that received LS + DXR had their gene expression patterns similar to those found in the control group. In conclusion, our results showed that LS did not induce disturbances on DNA stability and significantly reduce the DNA damage and inflammation caused by DXR exposure. In addition, we give further information concerning the molecular mechanisms associated to LS protective effects which seems to be a promising nutraceutical with chemopreventive potential.

  6. Regulation of gene expression in mammalian cells following ionizing radiation

    International Nuclear Information System (INIS)

    Boothman, D.A.; Lee, S.W

    1991-01-01

    Mammalian cells use a variety of mechanisms to control the expression of new gene transcrips elicited in response to ionizing radiation. Damage-induced proteins have been found which contain DNA binding sites located within the promoter regions of SV40 and human thymidine kinase genes. DNA binding proteins as well as proteins which bind to specific DNA lesions (e.g., XIP bp 175 binds specifically to X-ray-damaged DNA) may play a role in the initial recognition of DNA damage and may initiate DNA repair processes, along with new transcription. Mammalian gene expression after DNA damage is also regulated via the stabilization of preexisting mRNA transcripts. Stabilized mRNA transcripts are translated into protein products not previously present in the cell due to undefined posttranscriptional modifications. Thus far, the only example of mRNA stabilization following X-irradiation is the immediate induction of tissue-type plasminogen activator. Mammalian cells synthesize new mRNA transcripts indirect response to DNA damage. Using cDNA cloning, Northern RNA blotting and nuclear run-on techniques, the levels of a variety of known and previously unknown genes dramatically increase following X-irradiation. These genes/proteins now include; a) DNA binding transcripts factors, such as the UV-responsive element binding factors, ionizing radiation-induced DNA-binding proteins, and XIP bP 175; b) proto-oncogenes, such as c-fos, c-jun, and c-myc; c) several growth-related genes, (e.g., the gadd genes, protein kinase C, IL-1, and thymidine kinase); and d) a variety of other genes, including proteases, tumor necrosis factor-alpha, and DT diaphorase. Mammalian cells respond to X-irradiation by eliciting a very complex series of events resulting in the appearance of new genes and proteins. These gene products may affect DNA repair, adaptive responses, apoptosis, SOS-type mutagenic response, and/or carcinogenesis. (J.P.N.)

  7. Relationship between radiation induced activation of DNA repair genes and radiation induced apoptosis in human cell line A431

    International Nuclear Information System (INIS)

    Bom, Hee Seung; Min, Jung Jun; Kim, Kyung Keun; Choi, Keun Hee

    2000-01-01

    The purpose of this study was to evaluate the relationship between radiation-induced acivation of DNA repair genes and radiation induced apoptosis in A431 cell line. Five and 25 Gys of gamma radiation were given to A431 cells by a Cs-137 cell irradiator. Apoptosis was evaluated by flow cytometry using annexin V-fluorescein isothiocyanate and propidium iodide staining. The expression of DNA repair genes was evaluated by both Northern and Western blot analyses. The number of apoptotic cells increased with the increased radiation dose. It increased most significantly at 12 hours after irradiation. Expression of p53, p21, and ℎRAD50 reached the highest level at 12 hours after 5 Gy irradiation. In response to 25 Gy irradiation, ℎRAD50 and p21 were expressed maximally at 12 hours, but p53 and GADD45 genes showed the highest expression level after 12 hours. Induction of apoptosis and DNA repair by ionizing radiation were closely correlated. The peak time of inducing apoptosis and DNA repair was 12 hours in this study model. ℎRAD50, a recently discovered DNA repair gene, was also associated with radiation-induced apoptosis.=20

  8. Phylogenetic relationships and timing of diversification in gonorynchiform fishes inferred using nuclear gene DNA sequences (Teleostei: Ostariophysi).

    Science.gov (United States)

    Near, Thomas J; Dornburg, Alex; Friedman, Matt

    2014-11-01

    The Gonorynchiformes are the sister lineage of the species-rich Otophysi and provide important insights into the diversification of ostariophysan fishes. Phylogenies of gonorynchiforms inferred using morphological characters and mtDNA gene sequences provide differing resolutions with regard to the sister lineage of all other gonorynchiforms (Chanos vs. Gonorynchus) and support for monophyly of the two miniaturized lineages Cromeria and Grasseichthys. In this study the phylogeny and divergence times of gonorynchiforms are investigated with DNA sequences sampled from nine nuclear genes and a published morphological character matrix. Bayesian phylogenetic analyses reveal substantial congruence among individual gene trees with inferences from eight genes placing Gonorynchus as the sister lineage to all other gonorynchiforms. Seven gene trees resolve Cromeria and Grasseichthys as a clade, supporting previous inferences using morphological characters. Phylogenies resulting from either concatenating the nuclear genes, performing a multispecies coalescent species tree analysis, or combining the morphological and nuclear gene DNA sequences resolve Gonorynchus as the living sister lineage of all other gonorynchiforms, strongly support the monophyly of Cromeria and Grasseichthys, and resolve a clade containing Parakneria, Cromeria, and Grasseichthys. The morphological dataset, which includes 13 gonorynchiform fossil taxa that range in age from Early Cretaceous to Eocene, was analyzed in combination with DNA sequences from the nine nuclear genes and a relaxed molecular clock to estimate times of evolutionary divergence. This "tip dating" strategy accommodates uncertainty in the phylogenetic resolution of fossil taxa that provide calibration information in the relaxed molecular clock analysis. The estimated age of the most recent common ancestor (MRCA) of living gonorynchiforms is slightly older than estimates from previous node dating efforts, but the molecular tip dating

  9. Human native lipoprotein-induced de novo DNA methylation is associated with repression of inflammatory genes in THP-1 macrophages

    Directory of Open Access Journals (Sweden)

    Rangel-Salazar Rubén

    2011-11-01

    Full Text Available Abstract Background We previously showed that a VLDL- and LDL-rich mix of human native lipoproteins induces a set of repressive epigenetic marks, i.e. de novo DNA methylation, histone 4 hypoacetylation and histone 4 lysine 20 (H4K20 hypermethylation in THP-1 macrophages. Here, we: 1 ask what gene expression changes accompany these epigenetic responses; 2 test the involvement of candidate factors mediating the latter. We exploited genome expression arrays to identify target genes for lipoprotein-induced silencing, in addition to RNAi and expression studies to test the involvement of candidate mediating factors. The study was conducted in human THP-1 macrophages. Results Native lipoprotein-induced de novo DNA methylation was associated with a general repression of various critical genes for macrophage function, including pro-inflammatory genes. Lipoproteins showed differential effects on epigenetic marks, as de novo DNA methylation was induced by VLDL and to a lesser extent by LDL, but not by HDL, and VLDL induced H4K20 hypermethylation, while HDL caused H4 deacetylation. The analysis of candidate factors mediating VLDL-induced DNA hypermethylation revealed that this response was: 1 surprisingly, mediated exclusively by the canonical maintenance DNA methyltransferase DNMT1, and 2 independent of the Dicer/micro-RNA pathway. Conclusions Our work provides novel insights into epigenetic gene regulation by native lipoproteins. Furthermore, we provide an example of DNMT1 acting as a de novo DNA methyltransferase independently of canonical de novo enzymes, and show proof of principle that de novo DNA methylation can occur independently of a functional Dicer/micro-RNA pathway in mammals.

  10. Genome-scale study of the importance of binding site context for transcription factor binding and gene regulation

    Directory of Open Access Journals (Sweden)

    Ronne Hans

    2008-11-01

    Full Text Available Abstract Background The rate of mRNA transcription is controlled by transcription factors that bind to specific DNA motifs in promoter regions upstream of protein coding genes. Recent results indicate that not only the presence of a motif but also motif context (for example the orientation of a motif or its location relative to the coding sequence is important for gene regulation. Results In this study we present ContextFinder, a tool that is specifically aimed at identifying cases where motif context is likely to affect gene regulation. We used ContextFinder to examine the role of motif context in S. cerevisiae both for DNA binding by transcription factors and for effects on gene expression. For DNA binding we found significant patterns of motif location bias, whereas motif orientations did not seem to matter. Motif context appears to affect gene expression even more than it affects DNA binding, as biases in both motif location and orientation were more frequent in promoters of co-expressed genes. We validated our results against data on nucleosome positioning, and found a negative correlation between preferred motif locations and nucleosome occupancy. Conclusion We conclude that the requirement for stable binding of transcription factors to DNA and their subsequent function in gene regulation can impose constraints on motif context.

  11. The Toll-like receptor gene family is integrated into human DNA damage and p53 networks.

    Directory of Open Access Journals (Sweden)

    Daniel Menendez

    2011-03-01

    Full Text Available In recent years the functions that the p53 tumor suppressor plays in human biology have been greatly extended beyond "guardian of the genome." Our studies of promoter response element sequences targeted by the p53 master regulatory transcription factor suggest a general role for this DNA damage and stress-responsive regulator in the control of human Toll-like receptor (TLR gene expression. The TLR gene family mediates innate immunity to a wide variety of pathogenic threats through recognition of conserved pathogen-associated molecular motifs. Using primary human immune cells, we have examined expression of the entire TLR gene family following exposure to anti-cancer agents that induce the p53 network. Expression of all TLR genes, TLR1 to TLR10, in blood lymphocytes and alveolar macrophages from healthy volunteers can be induced by DNA metabolic stressors. However, there is considerable inter-individual variability. Most of the TLR genes respond to p53 via canonical as well as noncanonical promoter binding sites. Importantly, the integration of the TLR gene family into the p53 network is unique to primates, a recurrent theme raised for other gene families in our previous studies. Furthermore, a polymorphism in a TLR8 response element provides the first human example of a p53 target sequence specifically responsible for endogenous gene induction. These findings-demonstrating that the human innate immune system, including downstream induction of cytokines, can be modulated by DNA metabolic stress-have many implications for health and disease, as well as for understanding the evolution of damage and p53 responsive networks.

  12. DNA methylation and gene expression of HIF3A

    DEFF Research Database (Denmark)

    Main, Ailsa Maria; Gillberg, Linn; Jacobsen, Anna Louisa

    2016-01-01

    from 48 families, from whom we had SAT and muscle biopsies. DNA methylation of four CpG sites in the HIF3A promoter was analyzed in the blood and SAT by pyrosequencing, and HIF3A gene expression was analyzed in SAT and muscle by qPCR. An index of whole-body insulin sensitivity was estimated from oral...... individuals, and whether HIF3A gene expression in SAT and skeletal muscle biopsies showed associations with BMI and insulin resistance. Furthermore, we aimed to investigate gender specificity and heritability of these traits. METHODS: We studied 137 first-degree relatives of type 2 diabetes (T2D) patients...... glucose tolerance tests. RESULTS: BMI was associated with HIF3A methylation at one CpG site in the blood, and there was a positive association between the blood and SAT methylation levels at a different CpG site within the individuals. The SAT methylation level did not correlate with HIF3A gene expression...

  13. Tagging genes for drought resistance by DNA markers in wheat (abstract)

    International Nuclear Information System (INIS)

    Malik, T.A.; Rahman, S.; Zafar, Y.

    2005-01-01

    Wheat families (F/sub 3) raised from the seed of drought resistant and susceptible F/sub 2/ plants developed from the cross of drought resistant and susceptible parents were grown under greenhouse conditions in polyethylene tubes filled with soil and sand mixture. Drought stress was imposed and monitored at the seedling stage. The relative water content and net photosynthesis was recorded with increasing drought stress until a significant part of the seedling population had zero or negative net photosynthesis. The seedling with zero or negative net photosynthesis were named as drought susceptible and the seedlings at the same drought stress showing net photosynthesis were named as drought resistance. Twenty each of the most susceptible and resistant seedlings were selected for DNA extraction. Random Amplified Polymorphic DNA (RAPD) technique using bulked segregant analysis was used to identify DNA markers linked to drought resistance. The primers OPJ-05, OPJ-14, OPI-20 and OPA-19 produced polymorphic DNA fragments between the contrasting bulks. The polymorphic DNA fragment of 1.55kb produced by the primer OPA-19 was found linked to drought resistance. This DNA marker can be used in markers-assisted selection for drought resistance or to clone drought resistance gene. (author)

  14. RecET driven chromosomal gene targeting to generate a RecA deficient Escherichia coli strain for Cre mediated production of minicircle DNA

    Directory of Open Access Journals (Sweden)

    Coutelle Charles

    2006-03-01

    Full Text Available Abstract Background Minicircle DNA is the non-replicating product of intramolecular site-specific recombination within a bacterial minicircle producer plasmid. Minicircle DNA can be engineered to contain predominantly human sequences which have a low content of CpG dinucleotides and thus reduced immunotoxicity for humans, whilst the immunogenic bacterial origin and antibiotic resistance marker gene sequences are entirely removed by site-specific recombination. This property makes minicircle DNA an excellent vector for non-viral gene therapy. Large-scale production of minicircle DNA requires a bacterial strain expressing tightly controlled site-specific recombinase, such as Cre recombinase. As recombinant plasmids tend to be more stable in RecA-deficient strains, we aimed to construct a recA- bacterial strain for generation of minicircle vector DNA with less chance of unwanted deletions. Results We describe here the construction of the RecA-deficient minicircle DNA producer Escherichia coli HB101Cre with a chromosomally located Cre recombinase gene under the tight control of the araC regulon. The Cre gene expression cassette was inserted into the chromosomal lacZ gene by creating transient homologous recombination proficiency in the recA- strain HB101 using plasmid-born recET genes and homology-mediated chromosomal "pop-in, pop-out" of the plasmid pBAD75Cre containing the Cre gene and a temperature sensitive replication origin. Favourably for the Cre gene placement, at the "pop-out" step, the observed frequency of RecET-led recombination between the proximal regions of homology was 10 times higher than between the distal regions. Using the minicircle producing plasmid pFIXluc containing mutant loxP66 and loxP71 sites, we isolated pure minicircle DNA from the obtained recA- producer strain HB101Cre. The minicircle DNA preparation consisted of monomeric and, unexpectedly, also multimeric minicircle DNA forms, all containing the hybrid loxP66

  15. A Histone-Like Protein Induces Plasmid DNA to Form Liquid Crystals in Vitro and Gene Compaction in Vivo

    Directory of Open Access Journals (Sweden)

    Shiyong Sun

    2013-12-01

    Full Text Available The liquid crystalline state is a universal phenomenon involving the formation of an ordered structure via a self-assembly process that has attracted attention from numerous scientists. In this study, the dinoflagellate histone-like protein HCcp3 is shown to induce super-coiled pUC18 plasmid DNA to enter a liquid crystalline state in vitro, and the role of HCcp3 in gene condensation in vivo is also presented. The plasmid DNA (pDNA-HCcp3 complex formed birefringent spherical particles with a semi-crystalline selected area electronic diffraction (SAED pattern. Circular dichroism (CD titrations of pDNA and HCcp3 were performed. Without HCcp3, pUC18 showed the characteristic B conformation. As the HCcp3 concentration increased, the 273 nm band sharply shifted to 282 nm. When the HCcp3 concentration became high, the base pair (bp/dimer ratio fell below 42/1, and the CD spectra of the pDNA-HCcp3 complexes became similar to that of dehydrated A-form DNA. Microscopy results showed that HCcp3 compacted the super-coiled gene into a condensed state and that inclusion bodies were formed. Our results indicated that HCcp3 has significant roles in gene condensation both in vitro and in histone-less eukaryotes in vivo. The present study indicates that HCcp3 has great potential for applications in non-viral gene delivery systems, where HCcp3 may compact genetic material to form liquid crystals.

  16. Prostate Cancer Epigenetics: A Review on Gene Regulation

    OpenAIRE

    Diaw, Lena; Woodson, Karen; Gillespie, John W.

    2007-01-01

    Prostate cancer is the most common cancer in men in western countries, and its incidence is increasing steadily worldwide. Molecular changes including both genetic and epigenetic events underlying the development and progression of this disease are still not well understood. Epigenetic events are involved in gene regulation and occur through different mechanisms such as DNA methylation and histone modifi cations. Both DNA methylation and histone modifi cations affect gene regulation and play ...

  17. Molecular insight into mitochondrial DNA depletion syndrome in two patients with novel mutations in the deoxyguanosine kinase and thymidine kinase 2 genes.

    Science.gov (United States)

    Wang, Liya; Limongelli, Anna; Vila, Maya R; Carrara, Franco; Zeviani, Massimo; Eriksson, Staffan

    2005-01-01

    Thymidine kinase 2 (TK2) and deoxyguanosine kinase (dGK) are the two key enzymes in mitochondrial DNA (mtDNA) precursor synthesis. Deficiencies in TK2 or dGK activity, due to genetic alteration, have been shown to cause tissue-specific depletion of mtDNA. In the case of TK2 deficiency, affected individuals suffer severe myopathy and, in the case of dGK deficiency, devastating liver or multi-systemic disease. Here, we report clinical and biochemical findings from two patients with mtDNA depletion syndrome. Patient A was a compound heterozygote carrying the previously reported T77M mutation and a novel mutation (R161K) in the TK2 gene. Patient B carried a novel mutation (L250S) in the dGK gene. The clinical symptoms of patient A included muscular weakness and exercise intolerance due to a severe mitochondrial myopathy associated with a 92% reduction in mtDNA. There was minimal involvement of other organs. Patient B suffered from rapidly progressive, early onset fatal liver failure associated with profoundly decreased mtDNA levels in liver and, to a lesser extent, in skeletal muscle. Site-directed mutagenesis was used to introduce the mutations detected in patients A and B into the TK2 and dGK cDNAs, respectively. We then characterized each of these recombinant enzymes. Catalytic activities of the three mutant enzymes were reduced to about 2-4% for TK2 and 0.5% for dGK as compared to the wild-type enzymes. Altered competition between dCyd and dThd was observed for the T77M mutant. The residual activities of the two mitochondrial enzymes correlated directly with disease development.

  18. Transcriptome sequencing in pediatric acute lymphoblastic leukemia identifies fusion genes associated with distinct DNA methylation profiles

    Directory of Open Access Journals (Sweden)

    Yanara Marincevic-Zuniga

    2017-08-01

    Full Text Available Abstract Background Structural chromosomal rearrangements that lead to expressed fusion genes are a hallmark of acute lymphoblastic leukemia (ALL. In this study, we performed transcriptome sequencing of 134 primary ALL patient samples to comprehensively detect fusion transcripts. Methods We combined fusion gene detection with genome-wide DNA methylation analysis, gene expression profiling, and targeted sequencing to determine molecular signatures of emerging ALL subtypes. Results We identified 64 unique fusion events distributed among 80 individual patients, of which over 50% have not previously been reported in ALL. Although the majority of the fusion genes were found only in a single patient, we identified several recurrent fusion gene families defined by promiscuous fusion gene partners, such as ETV6, RUNX1, PAX5, and ZNF384, or recurrent fusion genes, such as DUX4-IGH. Our data show that patients harboring these fusion genes displayed characteristic genome-wide DNA methylation and gene expression signatures in addition to distinct patterns in single nucleotide variants and recurrent copy number alterations. Conclusion Our study delineates the fusion gene landscape in pediatric ALL, including both known and novel fusion genes, and highlights fusion gene families with shared molecular etiologies, which may provide additional information for prognosis and therapeutic options in the future.

  19. Expression of DNA repair genes in burned skin exposed to low-level red laser.

    Science.gov (United States)

    Trajano, Eduardo Tavares Lima; Mencalha, Andre Luiz; Monte-Alto-Costa, Andréa; Pôrto, Luís Cristóvão; de Souza da Fonseca, Adenilson

    2014-11-01

    Although red laser lights lie in the region of non-ionizing radiations in the electromagnetic spectrum, there are doubts whether absorption of these radiations causes lesions in the DNA molecule. Our aim was to investigate the expression of the genes involved with base excision and nucleotide excision repair pathways in skin tissue submitted to burn injury and exposed to low-level red laser. Wistar rats were divided as follows: control group-rats burned and not irradiated, laser group-rats burned and irradiated 1 day after injury for five consecutive days, and later laser group-rats injured and treated 4 days after injury for five consecutive days. Irradiation was performed according to a clinical protocol (20 J/cm(2), 100 mW, continuous wave emission mode). The animals were sacrificed on day 10, and scarred tissue samples were withdrawn for total RNA extraction, complementary DNA (cDNA) synthesis, and evaluation of gene expression by quantitative polymerase chain reaction. Low-level red laser exposure (1) reduces the expression of APE1 messenger (mRNA), (2) increases the expression of OGG1 mRNA, (3) reduces the expression of XPC mRNA, and (4) increases the expression of XPA mRNA both in laser and later laser groups. Red laser exposure at therapeutic fluences alters the expression of genes related to base excision and nucleotide excision pathways of DNA repair during wound healing of burned skin.

  20. Gene promoter methylation and DNA repair capacity in monozygotic twins with discordant smoking habits.

    Science.gov (United States)

    Ottini, Laura; Rizzolo, Piera; Siniscalchi, Ester; Zijno, Andrea; Silvestri, Valentina; Crebelli, Riccardo; Marcon, Francesca

    2015-02-01

    The influence of DNA repair capacity, plasma nutrients and tobacco smoke exposure on DNA methylation was investigated in blood cells of twenty-one couples of monozygotic twins with discordant smoking habits. All study subjects had previously been characterized for mutagen sensitivity with challenge assays with ionizing radiation in peripheral blood lymphocytes. Plasma levels of folic acid, vitamin B12 and homocysteine were also available from a previous investigation. In this work DNA methylation in the promoter region of a panel of ten genes involved in cell cycle control, differentiation, apoptosis and DNA repair (p16, FHIT, RAR, CDH1, DAPK1, hTERT, RASSF1A, MGMT, BRCA1 and PALB2) was assessed in the same batches of cells isolated for previous studies, using the methylation-sensitive high-resolution melting technique. Fairly similar profiles of gene promoter methylation were observed within co-twins compared to unrelated subjects (p= 1.23 × 10(-7)), with no significant difference related to smoking habits (p = 0.23). In a regression analysis the methylation index of study subjects, used as synthetic descriptor of overall promoter methylation, displayed a significant inverse correlation with radiation-induced micronuclei (p = 0.021) and plasma folic acid level (p = 0.007) both in smokers and in non-smokers. The observed association between repair of radiation-induced DNA damage and promoter methylation suggests the involvement of the DNA repair machinery in DNA modification. Data also highlight the possible modulating effect of folate deficiency on DNA methylation and the strong influence of familiarity on the individual epigenetic profile. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Gene conversion and DNA sequence polymorphism in the sex-determination gene fog-2 and its paralog ftr-1 in Caenorhabditis elegans.

    Science.gov (United States)

    Rane, Hallie S; Smith, Jessica M; Bergthorsson, Ulfar; Katju, Vaishali

    2010-07-01

    Gene conversion, a form of concerted evolution, bears enormous potential to shape the trajectory of sequence and functional divergence of gene paralogs subsequent to duplication events. fog-2, a sex-determination gene unique to Caenorhabditis elegans and implicated in the origin of hermaphroditism in this species, resulted from the duplication of ftr-1, an upstream gene of unknown function. Synonymous sequence divergence in regions of fog-2 and ftr-1 (excluding recent gene conversion tracts) suggests that the duplication occurred 46 million generations ago. Gene conversion between fog-2 and ftr-1 was previously discovered in experimental fog-2 knockout lines of C. elegans, whereby hermaphroditism was restored in mutant obligately outcrossing male-female populations. We analyzed DNA-sequence variation in fog-2 and ftr-1 within 40 isolates of C. elegans from diverse geographic locations in order to evaluate the contribution of gene conversion to genetic variation in the two gene paralogs. The analysis shows that gene conversion contributes significantly to DNA-sequence diversity in fog-2 and ftr-1 (22% and 34%, respectively) and may have the potential to alter sexual phenotypes in natural populations. A radical amino acid change in a conserved region of the F-box domain of fog-2 was found in natural isolates of C. elegans with significantly lower fecundity. We hypothesize that the lowered fecundity is due to reduced masculinization and less sperm production and that amino acid replacement substitutions and gene conversion in fog-2 may contribute significantly to variation in the degree of inbreeding and outcrossing in natural populations.

  2. Prediction of disease-related genes based on weighted tissue-specific networks by using DNA methylation.

    Science.gov (United States)

    Li, Min; Zhang, Jiayi; Liu, Qing; Wang, Jianxin; Wu, Fang-Xiang

    2014-01-01

    Predicting disease-related genes is one of the most important tasks in bioinformatics and systems biology. With the advances in high-throughput techniques, a large number of protein-protein interactions are available, which make it possible to identify disease-related genes at the network level. However, network-based identification of disease-related genes is still a challenge as the considerable false-positives are still existed in the current available protein interaction networks (PIN). Considering the fact that the majority of genetic disorders tend to manifest only in a single or a few tissues, we constructed tissue-specific networks (TSN) by integrating PIN and tissue-specific data. We further weighed the constructed tissue-specific network (WTSN) by using DNA methylation as it plays an irreplaceable role in the development of complex diseases. A PageRank-based method was developed to identify disease-related genes from the constructed networks. To validate the effectiveness of the proposed method, we constructed PIN, weighted PIN (WPIN), TSN, WTSN for colon cancer and leukemia, respectively. The experimental results on colon cancer and leukemia show that the combination of tissue-specific data and DNA methylation can help to identify disease-related genes more accurately. Moreover, the PageRank-based method was effective to predict disease-related genes on the case studies of colon cancer and leukemia. Tissue-specific data and DNA methylation are two important factors to the study of human diseases. The same method implemented on the WTSN can achieve better results compared to those being implemented on original PIN, WPIN, or TSN. The PageRank-based method outperforms degree centrality-based method for identifying disease-related genes from WTSN.

  3. DNA damage, homology-directed repair, and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Concetta Cuozzo

    2007-07-01

    Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

  4. Sampling the genomic pool of protein tyrosine kinase genes using the polymerase chain reaction with genomic DNA.

    Science.gov (United States)

    Oates, A C; Wollberg, P; Achen, M G; Wilks, A F

    1998-08-28

    The polymerase chain reaction (PCR), with cDNA as template, has been widely used to identify members of protein families from many species. A major limitation of using cDNA in PCR is that detection of a family member is dependent on temporal and spatial patterns of gene expression. To circumvent this restriction, and in order to develop a technique that is broadly applicable we have tested the use of genomic DNA as PCR template to identify members of protein families in an expression-independent manner. This test involved amplification of DNA encoding protein tyrosine kinase (PTK) genes from the genomes of three animal species that are well known development models; namely, the mouse Mus musculus, the fruit fly Drosophila melanogaster, and the nematode worm Caenorhabditis elegans. Ten PTK genes were identified from the mouse, 13 from the fruit fly, and 13 from the nematode worm. Among these kinases were 13 members of the PTK family that had not been reported previously. Selected PTKs from this screen were shown to be expressed during development, demonstrating that the amplified fragments did not arise from pseudogenes. This approach will be useful for the identification of many novel members of gene families in organisms of agricultural, medical, developmental and evolutionary significance and for analysis of gene families from any species, or biological sample whose habitat precludes the isolation of mRNA. Furthermore, as a tool to hasten the discovery of members of gene families that are of particular interest, this method offers an opportunity to sample the genome for new members irrespective of their expression pattern.

  5. DNA fusion gene vaccines

    DEFF Research Database (Denmark)

    Holst, Peter Johannes; Bassi, Maria Rosaria; Thomsen, Allan Randrup

    2010-01-01

    DNA vaccines are versatile and safe, but limited immunogenicity has prevented their use in the clinical setting. Experimentally, immunogenicity may be enhanced by the use of new delivery technologies, by coadministration of cytokines and pathogen-associated molecular patterns, or by fusion...... of antigens into molecular domains that enhance antigen presentation. More specifically, the immunogenicity of DNA vaccines may benefit from increased protein synthesis, increased T-cell help and MHC class I presentation, and the addition of a range of specific cytokines and pathogen-associated molecular...... with viral-vectored vaccines, various synergistic components may need to be incorporated into DNA vaccines. From the perspective of the future clinical use of DNA vaccines, it has been suggested that antigen presentation should be improved and cytokine coadministration attempted. However, even...

  6. Molecular cloning of a mouse DNA repair gene that complements the defect of group-A xeroderma pigmentosum

    International Nuclear Information System (INIS)

    Tanaka, K.; Satokata, I.; Ogita, Z.; Uchida, T.; Okada, Y.

    1989-01-01

    For isolation of the gene responsible for xeroderma pigmentosum (XP) complementation group A, plasmid pSV2gpt and genomic DNA from a mouse embryo were cotransfected into XP2OSSV cells, a group-A XP cell line. Two primary UV-resistant XP transfectants were isolated from about 1.6 X 10(5) pSV2gpt-transformed XP colonies. pSV2gpt and genomic DNA from the primary transfectants were again cotransfected into XP2OSSV cells and a secondary UV-resistant XP transfectant was obtained by screening about 4.8 X 10(5) pSV2gpt-transformed XP colonies. The secondary transfectant retained fewer mouse repetitive sequences. A mouse gene that complements the defect of XP2OSSV cells was cloned into an EMBL3 vector from the genome of a secondary transfectant. Transfections of the cloned DNA also conferred UV resistance on another group-A XP cell line but not on XP cell lines of group C, D, F, or G. Northern blot analysis of poly(A)+ RNA with a subfragment of cloned mouse DNA repair gene as the probe revealed that an approximately 1.0 kilobase mRNA was transcribed in the donor mouse embryo and secondary transfectant, and approximately 1.0- and approximately 1.3-kilobase mRNAs were transcribed in normal human cells, but none of these mRNAs was detected in three strains of group-A XP cells. These results suggest that the cloned DNA repair gene is specific for group-A XP and may be the mouse homologue of the group-A XP human gene

  7. Enhancement of ultraviolet-DNA repair in denV gene transfectants and T4 endonuclease V-liposome recipients

    International Nuclear Information System (INIS)

    Kibitel, J.T.; Yee, V.; Yarosh, D.B.

    1991-01-01

    The phage T4 denV gene, coding for the pyrimidine-dimer specific T4 endonuclease V, was transfected into human repair-proficient fibroblasts, repair-deficient xeroderma pigmentosum fibroblasts, and wild type CHO hamster cells. Transfectants maintained denV DNA and expressed denV mRNA. Purified T4 endonuclease V encapsulated in liposomes was also used to treat repair-proficient and -deficient human cells. The denV transfected clones and liposome-treated cells showed increased unscheduled DNA synthesis and enhanced removal of pyrimidine dimers compared to controls. Both denV gene transfection and endonuclease V liposome treatment enhanced post-UV survival in xeroderma pigmentosum cells but had no effect on survival in repair-proficient human or hamster cells. The results demonstrate that an exogenous DNA repair enzyme can correct the DNA repair defect in xeroderma pigmentosum cells and enhance DNA repair in normal cells. (author)

  8. Increased yield of PCR products by addition of T4 gene 32 protein to the SMART PCR cDNA synthesis system.

    Science.gov (United States)

    Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P

    2001-07-01

    Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.

  9. Establishing the validity of domestication genes using DNA from ancient chickens

    Science.gov (United States)

    Girdland Flink, Linus; Allen, Richard; Barnett, Ross; Malmström, Helena; Peters, Joris; Eriksson, Jonas; Andersson, Leif; Dobney, Keith

    2014-01-01

    Modern domestic plants and animals are subject to human-driven selection for desired phenotypic traits and behavior. Large-scale genetic studies of modern domestic populations and their wild relatives have revealed not only the genetic mechanisms underlying specific phenotypic traits, but also allowed for the identification of candidate domestication genes. Our understanding of the importance of these genes during the initial stages of the domestication process traditionally rests on the assumption that robust inferences about the past can be made on the basis of modern genetic datasets. A growing body of evidence from ancient DNA studies, however, has revealed that ancient and even historic populations often bear little resemblance to their modern counterparts. Here, we test the temporal context of selection on specific genetic loci known to differentiate modern domestic chickens from their extant wild ancestors. We extracted DNA from 80 ancient chickens excavated from 12 European archaeological sites, dated from ∼280 B.C. to the 18th century A.D. We targeted three unlinked genetic loci: the mitochondrial control region, a gene associated with yellow skin color (β-carotene dioxygenase 2), and a putative domestication gene thought to be linked to photoperiod and reproduction (thyroid-stimulating hormone receptor, TSHR). Our results reveal significant variability in both nuclear genes, suggesting that the commonality of yellow skin in Western breeds and the near fixation of TSHR in all modern chickens took place only in the past 500 y. In addition, mitochondrial variation has increased as a result of recent admixture with exotic breeds. We conclude by emphasizing the perils of inferring the past from modern genetic data alone. PMID:24753608

  10. Establishing the validity of domestication genes using DNA from ancient chickens.

    Science.gov (United States)

    Girdland Flink, Linus; Allen, Richard; Barnett, Ross; Malmström, Helena; Peters, Joris; Eriksson, Jonas; Andersson, Leif; Dobney, Keith; Larson, Greger

    2014-04-29

    Modern domestic plants and animals are subject to human-driven selection for desired phenotypic traits and behavior. Large-scale genetic studies of modern domestic populations and their wild relatives have revealed not only the genetic mechanisms underlying specific phenotypic traits, but also allowed for the identification of candidate domestication genes. Our understanding of the importance of these genes during the initial stages of the domestication process traditionally rests on the assumption that robust inferences about the past can be made on the basis of modern genetic datasets. A growing body of evidence from ancient DNA studies, however, has revealed that ancient and even historic populations often bear little resemblance to their modern counterparts. Here, we test the temporal context of selection on specific genetic loci known to differentiate modern domestic chickens from their extant wild ancestors. We extracted DNA from 80 ancient chickens excavated from 12 European archaeological sites, dated from ∼ 280 B.C. to the 18th century A.D. We targeted three unlinked genetic loci: the mitochondrial control region, a gene associated with yellow skin color (β-carotene dioxygenase 2), and a putative domestication gene thought to be linked to photoperiod and reproduction (thyroid-stimulating hormone receptor, TSHR). Our results reveal significant variability in both nuclear genes, suggesting that the commonality of yellow skin in Western breeds and the near fixation of TSHR in all modern chickens took place only in the past 500 y. In addition, mitochondrial variation has increased as a result of recent admixture with exotic breeds. We conclude by emphasizing the perils of inferring the past from modern genetic data alone.

  11. Interaction of DNA/nuclear protein/polycation and the terplexes for gene delivery

    Energy Technology Data Exchange (ETDEWEB)

    Shen Yuan; Pan Shirong; Feng Min; Wen Yuting; Deng Jingjing; Luo Xin; Wu Chuanbin [School of Pharmaceutical Sciences, Sun Yat-sen University, Zhongshan II Road 74, Guangzhou 510080 (China); Peng Hui, E-mail: fengmin@mail.sysu.edu.cn [School of Zhongshan Medicine, Sun Yat-sen University, 74 Zhongshan Road II, Guangzhou 510080 (China)

    2010-01-29

    Nuclear transport of exogenous DNA is a major barrier to nonviral gene delivery that needs to be addressed in the design of new vectors. In this study, we prepared pDNA/HMGB1/PEG-PEI terplexes to promote nuclear import. HMGB1 in the terplexes was used to assist the transportation of pDNA into the nucleus of cells, since it contained nuclear localization signal (NLS); PEG chains were introduced to stabilize pDNA/vector terplexes and reduce the cytotoxicity. HMGB1/PEG-PEI combined vectors have been investigated specifically for their structure interaction by atomic force microscopy and circular dichroic spectroscopy. The results demonstrated that the HMGB1 molecule could bind with the pDNA chains, but not condense pDNA well. The PEG-PEI further compacted pDNA/HMGB1 complexes into nanosized spherical terplexes. The pDNA delivered by HMGB1/PEG-PEI combined vectors was significantly accumulated in the nucleus of cells, as observed by confocal laser scanning microscopy. The percentage of GFP-transfected cells and VEGF protein expression level induced by HMGB1/PEG-PEI were 2.6-4.9-fold and 1.4-2.8-fold higher, respectively, than that of a common cationic polymer PEI 25 kDa. Therefore, the HMGB1/PEG-PEI combined vector could be used as a versatile vector for promoting exogenous DNA nuclear localization, thereby enhancing its expression.

  12. Agrobacterium rhizogenes rolB gene affects photosynthesis and chlorophyll content in transgenic tomato (Solanum lycopersicum L.) plants.

    Science.gov (United States)

    Bettini, Priscilla P; Marvasi, Massimiliano; Fani, Fabiola; Lazzara, Luigi; Cosi, Elena; Melani, Lorenzo; Mauro, Maria Luisa

    2016-10-01

    Insertion of Agrobacterium rhizogenes rolB gene into plant genome affects plant development, hormone balance and defence. However, beside the current research, the overall transcriptional response and gene expression of rolB as a modulator in plant is unknown. Transformed rolB tomato plant (Solanum lycopersicum L.) cultivar Tondino has been used to investigate the differential expression profile. Tomato is a well-known model organism both at the genetic and molecular level, and one of the most important commercial food crops in the world. Through the construction and characterization of a cDNA subtracted library, we have investigated the differential gene expression between transgenic clones of rolB and control tomato and have evaluated genes specifically transcribed in transgenic rolB plants. Among the selected genes, five genes encoding for chlorophyll a/b binding protein, carbonic anhydrase, cytochrome b 6 /f complex Fe-S subunit, potassium efflux antiporter 3, and chloroplast small heat-shock protein, all involved in chloroplast function, were identified. Measurement of photosynthesis efficiency by the level of three different photosynthetic parameters (F v /F m , rETR, NPQ) showed rolB significant increase in non-photochemical quenching and a, b chlorophyll content. Our results point to highlight the role of rolB on plant fitness by improving photosynthesis. Copyright © 2016 Elsevier GmbH. All rights reserved.

  13. Cloning of the DNA Repair Gene, Uvsf, by Transformation of Aspergillus Nidulans

    OpenAIRE

    Oza, K.; Kafer, E.

    1990-01-01

    As a first step in the cloning of the DNA repair gene uvsF of Aspergillus nidulans, uvsF pyrG double mutant strains were transformed with a genomic library which carried the complementing Neurospora pyr-4 gene in the vector. Rare pyr(+) uvs(+) cotransformants were obtained on media lacking pyrimidines, overlayed with MMS (methyl-methane sulfonate) to which uvsF is hypersensitive. Among MMS-resistant transformants, Southerns revealed two types which showed single bands of different sizes when ...

  14. Genetic polymorphisms of DNA double-strand break repair pathway genes and glioma susceptibility

    International Nuclear Information System (INIS)

    Zhao, Peng; Zou, Peng; Zhao, Lin; Yan, Wei; Kang, Chunsheng; Jiang, Tao; You, Yongping

    2013-01-01

    Genetic variations in DNA double-strand break repair genes can influence the ability of a cell to repair damaged DNA and alter an individual’s susceptibility to cancer. We studied whether polymorphisms in DNA double-strand break repair genes are associated with an increased risk of glioma development. We genotyped 10 potentially functional single nucleotide polymorphisms (SNPs) in 7 DNA double-strand break repair pathway genes (XRCC3, BRCA2, RAG1, XRCC5, LIG4, XRCC4 and ATM) in a case–control study including 384 glioma patients and 384 cancer-free controls in a Chinese Han population. Genotypes were determined using the OpenArray platform. In the single-locus analysis there was a significant association between gliomas and the LIG4 rs1805388 (Ex2 +54C>T, Thr9Ile) TT genotype (adjusted OR, 3.27; 95% CI, 1.87-5.71), as well as the TC genotype (adjusted OR, 1.62; 95% CI, 1.20-2.18). We also found that the homozygous variant genotype (GG) of XRCC4 rs1805377 (IVS7-1A>G, splice-site) was associated with a significantly increased risk of gliomas (OR, 1.77; 95% CI, 1.12-2.80). Interestingly, we detected a significant additive and multiplicative interaction effect between the LIG4 rs1805388 and XRCC4 rs1805377 polymorphisms with an increasing risk of gliomas. When we stratified our analysis by smoking status, LIG4 rs1805388 was associated with an increased glioma risk among smokers. These results indicate for the first time that LIG4 rs1805388 and XRCC4 rs1805377, alone or in combination, are associated with a risk of gliomas

  15. Identifying pathways affected by cancer mutations.

    Science.gov (United States)

    Iengar, Prathima

    2017-12-16

    Mutations in 15 cancers, sourced from the COSMIC Whole Genomes database, and 297 human pathways, arranged into pathway groups based on the processes they orchestrate, and sourced from the KEGG pathway database, have together been used to identify pathways affected by cancer mutations. Genes studied in ≥15, and mutated in ≥10 samples of a cancer have been considered recurrently mutated, and pathways with recurrently mutated genes have been considered affected in the cancer. Novel doughnut plots have been presented which enable visualization of the extent to which pathways and genes, in each pathway group, are targeted, in each cancer. The 'organismal systems' pathway group (including organism-level pathways; e.g., nervous system) is the most targeted, more than even the well-recognized signal transduction, cell-cycle and apoptosis, and DNA repair pathway groups. The important, yet poorly-recognized, role played by the group merits attention. Pathways affected in ≥7 cancers yielded insights into processes affected. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Oxidative Stress and DNA Methylation in Prostate Cancer

    Directory of Open Access Journals (Sweden)

    Krishna Vanaja Donkena

    2010-01-01

    Full Text Available The protective effects of fruits, vegetables, and other foods on prostate cancer may be due to their antioxidant properties. An imbalance in the oxidative stress/antioxidant status is observed in prostate cancer patients. Genome oxidative damage in prostate cancer patients is associated with higher lipid peroxidation and lower antioxidant levels. Oxygen radicals are associated with different steps of carcinogenesis, including structural DNA damage, epigenetic changes, and protein and lipid alterations. Epigenetics affects genetic regulation, cellular differentiation, embryology, aging, cancer, and other diseases. DNA methylation is perhaps the most extensively studied epigenetic modification, which plays an important role in the regulation of gene expression and chromatin architecture, in association with histone modification and other chromatin-associated proteins. This review will provide a broad overview of the interplay of oxidative stress and DNA methylation, DNA methylation changes in regulation of gene expression, lifestyle changes for prostate cancer prevention, DNA methylation as biomarkers for prostate cancer, methods for detection of methylation, and clinical application of DNA methylation inhibitors for epigenetic therapy.

  17. DENV gene of bacteriophage T4 codes for both pyrimidine dimer-DNA glycosylase and apyrimidinic endonuclease activities

    International Nuclear Information System (INIS)

    McMillan, S.; Edenberg, H.J.; Radany, E.H.; Friedberg, R.C.; Friedberg, E.C.

    1981-01-01

    Recent studies have shown that purified preparations of phage T4 UV DNA-incising activity (T4 UV endonuclease or endonuclease V of phase T4) contain a pyrimidine dimer-DNA glycosylase activity that catalyzes hydrolysis of the 5' glycosyl bond of dimerized pyrimidines in UV-irradiated DNA. Such enzyme preparations have also been shown to catalyze the hydrolysis of phosphodiester bonds in UV-irradiated DNA at a neutral pH, presumably reflecting the action of an apurinic/apyrimidinic endonuclease at the apyrimidinic sites created by the pyrimidine dimer-DNA glycosylase. In this study we found that preparations of T4 UV DNA-incising activity contained apurinic/apyrimidinic endonuclease activity that nicked depurinated form I simian virus 40 DNA. Apurinic/apyrimidinic endonuclease activity was also found in extracts of Escherichia coli infected with T4 denV + phage. Extracts of cells infected with T4 denV mutants contained significantly lower levels of apurinic/apyrimidinic endonuclease activity; these levels were no greater than the levels present in extracts of uninfected cells. Furthermore, the addition of DNA containing UV-irradiated DNA and T4 enzyme resulted in competition for pyrimidine dimer-DNA glycosylase activity against the UV-irradiated DNA. On the basis of these results, we concluded that apurinic/apyrimidinic endonuclease activity is encoded by the denV gene of phage T4, the same gene that codes for pyrimidine dimer-DNA glycosylase activity

  18. Molecular cloning of the human gene SUVCC3 associated with the formation of DNA-protein crosslinks following exposure to solar UV radiation

    International Nuclear Information System (INIS)

    Rosenstein, B.S.; Vaslet, C.A.

    1995-01-01

    DRP 153 cells, which are hypersensitive to solar UV and deficient in the formation of DNA-protein crosslinks (DPC) following irradiation, were transfected with human DNA and a secondary transformant obtained in which a normal DPC response and solar UV sensitivity reestablished. DNA from this secondary transformant was used to construct a genomic DNA library from which a recombinant phage was isolated containing the human gene capable of restoring a normal DPC response and solar UV sensitivity to DRP 153. This gene has been designated SUVCC3 to denote solar UV cross-complementing gene number 3. 27 refs., 5 figs., 2 tabs

  19. Spectrophotometric, colorimetric and visually detection of Pseudomonas aeruginosa ETA gene based gold nanoparticles DNA probe and endonuclease enzyme

    Science.gov (United States)

    Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh

    2018-06-01

    Colorimetric DNA detection is preferred over other methods for clinical molecular diagnosis because it does not require expensive equipment. In the present study, the colorimetric method based on gold nanoparticles (GNPs) and endonuclease enzyme was used for the detection of P. aeruginosa ETA gene. Firstly, the primers and probe for P. aeruginosa exotoxin A (ETA) gene were designed and checked for specificity by the PCR method. Then, GNPs were synthesized using the citrate reduction method and conjugated with the prepared probe to develop the new nano-biosensor. Next, the extracted target DNA of the bacteria was added to GNP-probe complex to check its efficacy for P. aeruginosa ETA gene diagnosis. A decrease in absorbance was seen when GNP-probe-target DNA cleaved into the small fragments of BamHI endonuclease due to the weakened electrostatic interaction between GNPs and the shortened DNA. The right shift of the absorbance peak from 530 to 562 nm occurred after adding the endonuclease. It was measured using a UV-VIS absorption spectroscopy that indicates the existence of the P. aeruginosa ETA gene. Sensitivity was determined in the presence of different concentrations of target DNA of P. aeruginosa. The results obtained from the optimized conditions showed that the absorbance value has linear correlation with concentration of target DNA (R: 0.9850) in the range of 10-50 ng mL-1 with the limit detection of 9.899 ng mL-1. Thus, the specificity of the new method for detection of P. aeruginosa was established in comparison with other bacteria. Additionally, the designed assay was quantitatively applied to detect the P. aeruginosa ETA gene from 103 to 108 CFU mL-1 in real samples with a detection limit of 320 CFU mL-1.

  20. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  1. Conservation of the rad21 Schizosaccharomyces pombe DNA double-strand break repair gene in mammals

    International Nuclear Information System (INIS)

    McKay, Michael J.; Spek, Peter van der; Kanaar, Roland; Smit, Bep; Bootsma, Dirk; Hoeijmakers, Jan H. J.

    1996-01-01

    Purpose/Objective: Genetic factors are likely to be major determinants of human cellular ionizing radiation sensitivity. DNA double strand breaks (dsbs) are significant ionizing radiation-induced lesions; cellular DNA dsb processing is also important in a number of other contexts. To further the understanding of DNA dsb processing in mammalian cells, we cloned and sequenced mammalian homologs of the rad21 Schizosaccharomyces pombe DNA dsb repair gene. Materials and Methods: The genes were cloned by evolutionary walking, exploiting sequence homology between the yeast and mammalian genes. Results: No major motifs indicative of a particular function were present in the predicted amino acid sequences of the mammalian genes. Alignment of the Rad21 amino acid sequence with its putative homologs showed that similarity was distributed across the length of the proteins, with more highly conserved regions at both termini. The mHR21 sp (mouse homolog ofR ad21, S. pombe) and hHR21 sp (humanh omolog of Rad21, S. pombe) predicted proteins were 96% identical, whereas the human and S. pombe proteins were 25% identical and 47% similar. RNA blot analysis showed that mHR21 sp mRNA was abundant in all adult mouse tissues examined, with highest expression in testis and thymus. In addition to a 3.1kb mRNA transcript in all tissues, an additional 2.2kb transcript was present at a high level in post-meiotic spermatids, white expression of the 3.1kb mRNA in testis was confined to the meiotic compartment. hHR21 sp mRNA was cell cycle regulated in human cells, increasing in late S phase to a peak in G2 phase. The level of hHR21 sp transcripts was not altered by exposure of normal diploid fibroblasts to 10 Gy ionizing radiation. In situ hybridization showed mHR21 sp resided on chromosome 15D3, whereashHR21 sp localized to the syntenic 8q24 region. Conclusion: Cloning these novel mammalian genes and characterization of their protein products should contribute to the understanding of cellular

  2. Toxicity of the bacteriophage λ cII gene product to Escherichia coli arises from inhibition of host cell DNA replication

    International Nuclear Information System (INIS)

    Kedzierska, Barbara; Glinkowska, Monika; Iwanicki, Adam; Obuchowski, Michal; Sojka, Piotr; Thomas, Mark S.; Wegrzyn, Grzegorz

    2003-01-01

    The bacteriophage λ cII gene codes for a transcriptional activator protein which is a crucial regulator at the stage of the 'lysis-versus-lysogeny' decision during phage development. The CII protein is highly toxic to the host, Escherichia coli, when overproduced. However, the molecular mechanism of this toxicity is not known. Here we demonstrate that DNA synthesis, but not total RNA synthesis, is strongly inhibited in cII-overexpressing E. coli cells. The toxicity was also observed when the transcriptional stimulator activity of CII was abolished either by a point mutation in the cII gene or by a point mutation, rpoA341, in the gene coding for the RNA polymerase α subunit. Moreover, inhibition of cell growth, caused by both wild-type and mutant CII proteins in either rpoA + or rpoA341 hosts, could be relieved by overexpression of the E. coli dnaB and dnaC genes. In vitro replication of an oriC-based plasmid DNA was somewhat impaired by the presence of the CII, and several CII-resistant E. coli strains contain mutations near dnaC. We conclude that the DNA replication machinery may be a target for the toxic activity of CII

  3. Bidirectional gene sequences with similar homology to functional proteins of alkane degrading bacterium pseudomonas fredriksbergensis DNA

    International Nuclear Information System (INIS)

    Megeed, A.A.

    2011-01-01

    The potential for two overlapping fragments of DNA from a clone of newly isolated alkanes degrading bacterium Pseudomonas frederiksbergensis encoding sequences with similar homology to two parts of functional proteins is described. One strand contains a sequence with high homology to alkanes monooxygenase (alkB), a member of the alkanes hydroxylase family, and the other strand contains a sequence with some homology to alcohol dehydrogenase gene (alkJ). Overlapping of the genes on opposite strands has been reported in eukaryotic species, and is now reported in a bacterial species. The sequence comparisons and ORFS results revealed that the regulation and the genes organization involved in alkane oxidation represented in Pseudomonas frederiksberghensis varies among the different known alkane degrading bacteria. The alk gene cluster containing homologues to the known alkane monooxygenase (alkB), and rubredoxin (alkG) are oriented in the same direction, whereas alcohol dehydrogenase (alkJ) is oriented in the opposite direction. Such genomes encode messages on both strands of the DNA, or in an overlapping but different reading frames, of the same strand of DNA. The possibility of creating novel genes from pre-existing sequences, known as overprinting, which is a widespread phenomenon in small viruses. Here, the origin and evolution of the gene overlap to bacteriophages belonging to the family Microviridae have been investigated. Such a phenomenon is most widely described in extremely small genomes such as those of viruses or small plasmids, yet here is a unique phenomenon. (author)

  4. DNA methylation changes at infertility genes in newborn twins conceived by in vitro fertilisation.

    Science.gov (United States)

    Castillo-Fernandez, Juan E; Loke, Yuk Jing; Bass-Stringer, Sebastian; Gao, Fei; Xia, Yudong; Wu, Honglong; Lu, Hanlin; Liu, Yuan; Wang, Jun; Spector, Tim D; Saffery, Richard; Craig, Jeffrey M; Bell, Jordana T

    2017-03-24

    The association of in vitro fertilisation (IVF) and DNA methylation has been studied predominantly at regulatory regions of imprinted genes and at just thousands of the ~28 million CpG sites in the human genome. We investigated the links between IVF and DNA methylation patterns in whole cord blood cells (n = 98) and cord blood mononuclear cells (n = 82) from newborn twins using genome-wide methylated DNA immunoprecipitation coupled with deep sequencing. At a false discovery rate (FDR) of 5%, we identified one significant whole blood DNA methylation change linked to conception via IVF, which was located ~3 kb upstream of TNP1, a gene previously linked to male infertility. The 46 most strongly associated signals (FDR of 25%) included a second region in a gene also previously linked to infertility, C9orf3, suggesting that our findings may in part capture the effect of parental subfertility. Using twin modelling, we observed that individual-specific environmental factors appear to be the main overall contributors of methylation variability at the FDR 25% IVF-associated differentially methylated regions, although evidence for methylation heritability was also obtained at several of these regions. We replicated previous findings of differential methylation associated with IVF at the H19/IGF2 region in cord blood mononuclear cells, and we validated the signal at C9orf3 in monozygotic twins. We also explored the impact of intracytoplasmic sperm injection on the FDR 25% signals for potential effects specific to male or female infertility factors. To our knowledge, this is the most comprehensive study of DNA methylation profiles at birth and IVF conception to date, and our results show evidence for epigenetic modifications that may in part reflect parental subfertility.

  5. Dnmts and Tet target memory-associated genes after appetitive olfactory training in honey bees.

    Science.gov (United States)

    Biergans, Stephanie D; Giovanni Galizia, C; Reinhard, Judith; Claudianos, Charles

    2015-11-04

    DNA methylation and demethylation are epigenetic mechanisms involved in memory formation. In honey bees DNA methyltransferase (Dnmt) function is necessary for long-term memory to be stimulus specific (i.e. to reduce generalization). So far, however, it remains elusive which genes are targeted and what the time-course of DNA methylation is during memory formation. Here, we analyse how DNA methylation affects memory retention, gene expression, and differential methylation in stimulus-specific olfactory long-term memory formation. Out of 30 memory-associated genes investigated here, 9 were upregulated following Dnmt inhibition in trained bees. These included Dnmt3 suggesting a negative feedback loop for DNA methylation. Within these genes also the DNA methylation pattern changed during the first 24 hours after training. Interestingly, this was accompanied by sequential activation of the DNA methylation machinery (i.e. Dnmts and Tet). In sum, memory formation involves a temporally complex epigenetic regulation of memory-associated genes that facilitates stimulus specific long-term memory in the honey bee.

  6. In vivo protein-DNA interactions at the β-globin gene locus

    International Nuclear Information System (INIS)

    Tohru Ikuta; Yuet Wai Kan

    1991-01-01

    The authors have investigated in vivo protein-DNA interactions in the β-globin gene locus by dimethyl sulfate (DMS) footprinting in K562 cells, which express var-epsilon- and γ-globin but not β-globin. In the locus control region, hypersensitive site 2 (HS-2) exhibited footprints in several putative protein binding motifs. HS-3 was not footprinted. The β promoter was also not footprinted, while extensive footprints were observed in the promoter of the active γ-globin gene. No footprints were seen in the A γ and β3' enhancers. With several motifs, additional protein interactions and alterations in binding patterns occurred with hemin induction. In HeLa cells, some footprints were observed in some of the motifs in HS-2, compatible with the finding that HS-2 has some enhancer function in HeLa cells, albeit much weaker than its activity in K562 cells. No footprint was seen in B lymphocytes. In vivo footprinting is a useful method for studying relevant protein-DNA interactions in erythroid cells

  7. Characterization of a bacteriophage T4 mutant lacking DNA-dependent ATPase

    International Nuclear Information System (INIS)

    Behme, M.T.; Ebisuzaki, K.

    1975-01-01

    A DNA-dependent ATPase has previously been purified from bacteriophage T4-infected Escherichia coli. A mutant phage strain lacking this enzyme has been isolated and characterized. Although the mutant strain produced no detectable DNA-dependent ATPase, growth properties were not affected. Burst sizes were similar for the mutant phage and T4D in polAl, recB, recC, uvrA, uvrB, uvrC, and various DNA-negative E. coli. UV sensitivity and genetic recombination were normal in a variety of E. coli hosts. Mapping data indicate that the genetic locus controlling the mutant occurs near gene 56. The nonessential nature of this gene is discussed

  8. Spaceflight induces both transient and heritable alterations in DNA methylation and gene expression in rice (Oryza sativa L.)

    Energy Technology Data Exchange (ETDEWEB)

    Ou Xiufang [Key Laboratory of Molecular Epigenetic of MOE and Institute of Genetics and Cytology, Northeast Normal University, Changchun 130024 (China); Long Likun [Inspection and Quarantine Technology Centre of Zhongshan Entry-Exit Inspection and Quarantine Bureau, Zhongshan 528400, Guangdong Province (China); Zhang Yunhong; Xue Yiqun; Liu Jingchun; Lin Xiuyun [Key Laboratory of Molecular Epigenetic of MOE and Institute of Genetics and Cytology, Northeast Normal University, Changchun 130024 (China); Liu Bao [Key Laboratory of Molecular Epigenetic of MOE and Institute of Genetics and Cytology, Northeast Normal University, Changchun 130024 (China)], E-mail: baoliu6677@yahoo.com.cn

    2009-03-09

    Spaceflight represents a complex environmental condition in which several interacting factors such as cosmic radiation, microgravity and space magnetic fields are involved, which may provoke stress responses and jeopardize genome integrity. Given the inherent property of epigenetic modifications to respond to intrinsic as well as external perturbations, it is conceivable that epigenetic markers like DNA methylation may undergo alterations in response to spaceflight. We report here that extensive alteration in both DNA methylation and gene expression occurred in rice plants subjected to a spaceflight, as revealed by a set of characterized sequences including 6 transposable elements (TEs) and 11 cellular genes. We found that several features characterize the alterations: (1) All detected alterations are hypermethylation events; (2) whereas alteration in both CG and CNG methylation occurred in the TEs, only alteration in CNG methylation occurred in the cellular genes; (3) alteration in expression includes both up- and down-regulations, which did not show a general correlation with alteration in methylation; (4) altered methylation patterns in both TEs and cellular genes are heritable to progenies at variable frequencies; however, stochastic reversion to wild-type patterns and further de novo changes in progenies are also apparent; and (5) the altered expression states in both TEs and cellular genes are also heritable to selfed progenies but with markedly lower transmission frequencies than altered DNA methylation states. Furthermore, we found that a set of genes encoding for the various putative DNA methyltransferases, 5-methylcytosine DNA glycosylases, the SWI/SNF chromatin remodeller (DDM1) and siRNA-related proteins are extremely sensitive to perturbation by spaceflight, which might be an underlying cause for the altered methylation patterns in the space-flown plants. We discuss implications of spaceflight-induced epigenetic variations with regard to health safety

  9. Spaceflight induces both transient and heritable alterations in DNA methylation and gene expression in rice (Oryza sativa L.)

    International Nuclear Information System (INIS)

    Ou Xiufang; Long Likun; Zhang Yunhong; Xue Yiqun; Liu Jingchun; Lin Xiuyun; Liu Bao

    2009-01-01

    Spaceflight represents a complex environmental condition in which several interacting factors such as cosmic radiation, microgravity and space magnetic fields are involved, which may provoke stress responses and jeopardize genome integrity. Given the inherent property of epigenetic modifications to respond to intrinsic as well as external perturbations, it is conceivable that epigenetic markers like DNA methylation may undergo alterations in response to spaceflight. We report here that extensive alteration in both DNA methylation and gene expression occurred in rice plants subjected to a spaceflight, as revealed by a set of characterized sequences including 6 transposable elements (TEs) and 11 cellular genes. We found that several features characterize the alterations: (1) All detected alterations are hypermethylation events; (2) whereas alteration in both CG and CNG methylation occurred in the TEs, only alteration in CNG methylation occurred in the cellular genes; (3) alteration in expression includes both up- and down-regulations, which did not show a general correlation with alteration in methylation; (4) altered methylation patterns in both TEs and cellular genes are heritable to progenies at variable frequencies; however, stochastic reversion to wild-type patterns and further de novo changes in progenies are also apparent; and (5) the altered expression states in both TEs and cellular genes are also heritable to selfed progenies but with markedly lower transmission frequencies than altered DNA methylation states. Furthermore, we found that a set of genes encoding for the various putative DNA methyltransferases, 5-methylcytosine DNA glycosylases, the SWI/SNF chromatin remodeller (DDM1) and siRNA-related proteins are extremely sensitive to perturbation by spaceflight, which might be an underlying cause for the altered methylation patterns in the space-flown plants. We discuss implications of spaceflight-induced epigenetic variations with regard to health safety

  10. Investigation of the Mitochondrial ATPase 6/8 and tRNA(Lys) Genes Mutations in Autism.

    Science.gov (United States)

    Piryaei, Fahimeh; Houshmand, Massoud; Aryani, Omid; Dadgar, Sepideh; Soheili, Zahra-Soheila

    2012-01-01

    Autism results from developmental factors that affect many or all functional brain systems. Brain is one of tissues which are crucially in need of adenosine triphosphate (ATP). Autism is noticeably affected by mitochondrial dysfunction which impairs energy metabolism. Considering mutations within ATPase 6, ATPase 8 and tRNA(Lys) genes, associated with different neural diseases, and the main role of ATPase 6/8 in energy generation, we decided to investigate mutations on these mtDNA-encoded genes to reveal their roles in autism pathogenesis. In this experimental study, mutation analysis for the mentioned genes were performed in a cohort of 24 unrelated patients with idiopathic autism by employing amplicon sequencing of mtDNA fragments. In this study, 12 patients (50%) showed point mutations that represent a significant correlation between autism and mtDNA variations. Most of the identified substitutions (55.55%) were observed on MT-ATP6, altering some conserved amino acids to other ones which could potentially affect ATPase 6 function. Mutations causing amino acid replacement denote involvement of mtDNA genes, especially ATPase 6 in autism pathogenesis. MtDNA mutations in relation with autism could be remarkable to realize an understandable mechanism of pathogenesis in order to achieve therapeutic solutions.

  11. A Genome-Wide mQTL Analysis in Human Adipose Tissue Identifies Genetic Variants Associated with DNA Methylation, Gene Expression and Metabolic Traits.

    Directory of Open Access Journals (Sweden)

    Petr Volkov

    Full Text Available Little is known about the extent to which interactions between genetics and epigenetics may affect the risk of complex metabolic diseases and/or their intermediary phenotypes. We performed a genome-wide DNA methylation quantitative trait locus (mQTL analysis in human adipose tissue of 119 men, where 592,794 single nucleotide polymorphisms (SNPs were related to DNA methylation of 477,891 CpG sites, covering 99% of RefSeq genes. SNPs in significant mQTLs were further related to gene expression in adipose tissue and obesity related traits. We found 101,911 SNP-CpG pairs (mQTLs in cis and 5,342 SNP-CpG pairs in trans showing significant associations between genotype and DNA methylation in adipose tissue after correction for multiple testing, where cis is defined as distance less than 500 kb between a SNP and CpG site. These mQTLs include reported obesity, lipid and type 2 diabetes loci, e.g. ADCY3/POMC, APOA5, CETP, FADS2, GCKR, SORT1 and LEPR. Significant mQTLs were overrepresented in intergenic regions meanwhile underrepresented in promoter regions and CpG islands. We further identified 635 SNPs in significant cis-mQTLs associated with expression of 86 genes in adipose tissue including CHRNA5, G6PC2, GPX7, RPL27A, THNSL2 and ZFP57. SNPs in significant mQTLs were also associated with body mass index (BMI, lipid traits and glucose and insulin levels in our study cohort and public available consortia data. Importantly, the Causal Inference Test (CIT demonstrates how genetic variants mediate their effects on metabolic traits (e.g. BMI, cholesterol, high-density lipoprotein (HDL, hemoglobin A1c (HbA1c and homeostatic model assessment of insulin resistance (HOMA-IR via altered DNA methylation in human adipose tissue. This study identifies genome-wide interactions between genetic and epigenetic variation in both cis and trans positions influencing gene expression in adipose tissue and in vivo (dysmetabolic traits associated with the development of

  12. Identification of pathogenic genes related to rheumatoid arthritis through integrated analysis of DNA methylation and gene expression profiling.

    Science.gov (United States)

    Zhang, Lei; Ma, Shiyun; Wang, Huailiang; Su, Hang; Su, Ke; Li, Longjie

    2017-11-15

    The purpose of our study was to identify new pathogenic genes used for exploring the pathogenesis of rheumatoid arthritis (RA). To screen pathogenic genes of RA, an integrated analysis was performed by using the microarray datasets in RA derived from the Gene Expression Omnibus (GEO) database. The functional annotation and potential pathways of differentially expressed genes (DEGs) were further discovered by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. Afterwards, the integrated analysis of DNA methylation and gene expression profiling was used to screen crucial genes. In addition, we used RT-PCR and MSP to verify the expression levels and methylation status of these crucial genes in 20 synovial biopsy samples obtained from 10 RA model mice and 10 normal mice. BCL11B, CCDC88C, FCRLA and APOL6 were both up-regulated and hypomethylated in RA according to integrated analysis, RT-PCR and MSP verification. Four crucial genes (BCL11B, CCDC88C, FCRLA and APOL6) identified and analyzed in this study might be closely connected with the pathogenesis of RA. Copyright © 2017. Published by Elsevier B.V.

  13. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  14. Identification of candidate new cancer susceptibility genes using yeast genomics

    International Nuclear Information System (INIS)

    Brown, M.; Brown, J.A.; Game, J.C.

    2003-01-01

    A large proportion of cancer susceptibility syndromes are the result of mutations in genes in DNA repair or in cell-cycle checkpoints in response to DNA damage, such as ataxia telangiectasia (AT), Fanconi's anemia (FA), Bloom's syndrome (BS), Nijmegen breakage syndrome (NBS), and xeroderma pigmentosum (XP). Mutations in these genes often cause gross chromosomal instability leading to an increased mutation rate of all genes including those directly responsible for cancer. We have proposed that because the orthologs of these genes in budding yeast, S. cerevisiae, confer protection against killing by DNA damaging agents it should be possible to identify new cancer susceptibility genes by identifying yeast genes whose deletion causes sensitivity to DNA damage. We therefore screened the recently completed collection of individual gene deletion mutants to identify genes that affect sensitivity to DNA-damaging agents. Screening for sensitivity in this obtained up to now with the F98 glioma model othe fact that each deleted gene is replaced by a cassette containing two molecular 'barcodes', or 20-mers, that uniquely identify the strain when DNA from a pool of strains is hybridized to an oligonucleotide array containing the complementary sequences of the barcodes. We performed the screen with UV, IR, H 2 0 2 and other DNA damaging agents. In addition to identifying genes already known to confer resistance to DNA damaging agents we have identified, and individually confirmed, several genes not previously associated with resistance. Several of these are of unknown function. We have also examined the chromosomal stability of selected strains and found that IR sensitive strains often but not always exhibit genomic instability. We are presently constructing a yeast artificial chromosome to globally interrogate all the genes in the deletion pool for their involvement in genomic stability. This work shows that budding yeast is a valuable eukaryotic model organism to identify

  15. Selfish DNA in protein-coding genes of Rickettsia.

    Science.gov (United States)

    Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M

    2000-10-13

    Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.

  16. Charged residues in the H-NS linker drive DNA binding and gene silencing in single cells.

    Science.gov (United States)

    Gao, Yunfeng; Foo, Yong Hwee; Winardhi, Ricksen S; Tang, Qingnan; Yan, Jie; Kenney, Linda J

    2017-11-21

    Nucleoid-associated proteins (NAPs) facilitate chromosome organization in bacteria, but the precise mechanism remains elusive. H-NS is a NAP that also plays a major role in silencing pathogen genes. We used genetics, single-particle tracking in live cells, superresolution microscopy, atomic force microscopy, and molecular dynamics simulations to examine H-NS/DNA interactions in single cells. We discovered a role for the unstructured linker region connecting the N-terminal oligomerization and C-terminal DNA binding domains. In the present work we demonstrate that linker amino acids promote engagement with DNA. In the absence of linker contacts, H-NS binding is significantly reduced, although no change in chromosome compaction is observed. H-NS is not localized to two distinct foci; rather, it is scattered all around the nucleoid. The linker makes DNA contacts that are required for gene silencing, while chromosome compaction does not appear to be an important H-NS function.

  17. Stripped-down DNA repair in a highly reduced parasite

    Directory of Open Access Journals (Sweden)

    Fast Naomi M

    2007-03-01

    Full Text Available Abstract Background Encephalitozoon cuniculi is a member of a distinctive group of single-celled parasitic eukaryotes called microsporidia, which are closely related to fungi. Some of these organisms, including E. cuniculi, also have uniquely small genomes that are within the prokaryotic range. Thus, E. cuniculi has undergone a massive genome reduction which has resulted in a loss of genes from diverse biological pathways, including those that act in DNA repair. DNA repair is essential to any living cell. A loss of these mechanisms invariably results in accumulation of mutations and/or cell death. Six major pathways of DNA repair in eukaryotes include: non-homologous end joining (NHEJ, homologous recombination repair (HRR, mismatch repair (MMR, nucleotide excision repair (NER, base excision repair (BER and methyltransferase repair. DNA polymerases are also critical players in DNA repair processes. Given the close relationship between microsporidia and fungi, the repair mechanisms present in E. cuniculi were compared to those of the yeast Saccharomyces cerevisiae to ascertain how the process of genome reduction has affected the DNA repair pathways. Results E. cuniculi lacks 16 (plus another 6 potential absences of the 56 DNA repair genes sought via BLASTP and PSI-BLAST searches. Six of 14 DNA polymerases or polymerase subunits are also absent in E. cuniculi. All of these genes are relatively well conserved within eukaryotes. The absence of genes is not distributed equally among the different repair pathways; some pathways lack only one protein, while there is a striking absence of many proteins that are components of both double strand break repair pathways. All specialized repair polymerases are also absent. Conclusion Given the large number of DNA repair genes that are absent from the double strand break repair pathways, E. cuniculi is a prime candidate for the study of double strand break repair with minimal machinery. Strikingly, all of the

  18. Inter-genomic DNA Exchanges and Homeologous Gene Silencing Shaped the Nascent Allopolyploid Coffee Genome (Coffea arabica L.

    Directory of Open Access Journals (Sweden)

    Philippe Lashermes

    2016-09-01

    Full Text Available Allopolyploidization is a biological process that has played a major role in plant speciation and evolution. Genomic changes are common consequences of polyploidization, but their dynamics over time are still poorly understood. Coffea arabica, a recently formed allotetraploid, was chosen to study genetic changes that accompany allopolyploid formation. Both RNA-seq and DNA-seq data were generated from two genetically distant C. arabica accessions. Genomic structural variation was investigated using C. canephora, one of its diploid progenitors, as reference genome. The fate of 9047 duplicate homeologous genes was inferred and compared between the accessions. The pattern of SNP density along the reference genome was consistent with the allopolyploid structure. Large genomic duplications or deletions were not detected. Two homeologous copies were retained and expressed in 96% of the genes analyzed. Nevertheless, duplicated genes were found to be affected by various genomic changes leading to homeolog loss or silencing. Genetic and epigenetic changes were evidenced that could have played a major role in the stabilization of the unique ancestral allotetraploid and its subsequent diversification. While the early evolution of C. arabica mainly involved homeologous crossover exchanges, the later stage appears to have relied on more gradual evolution involving gene conversion and homeolog silencing.

  19. DNA replication machinery is required for development in Drosophila.

    Science.gov (United States)

    Kohzaki, Hidetsugu; Asano, Maki; Murakami, Yota

    2018-01-01

     In Drosophila , some factors involved in chromosome replication seem to be involved in gene amplification and endoreplication, which are actively utilized in particular tissue development, but direct evidence has not been shown. Therefore, we examined the effect of depletion of replication factors on these processes. First, we confirmed RNAi knockdown can be used for the depletion of replication factors by comparing the phenotypes of RNAi knockdown and deletion or point mutants of the components of DNA licensing factor, MCM2, MCM4 and Cdt1. Next, we found that tissue-specific RNAi knockdown of replication factors caused tissue-specific defects, probably due to defects in DNA replication. In particular, we found that depletion inhibited gene amplification of the chorion gene in follicle cells and endoreplication in salivary glands, showing that chromosomal DNA replication factors are required for these processes. Finally, using RNAi, we screened the genes for chromosomal DNA replication that affected tissue development. Interestingly, wing specific knockdown of Mcm10 induced wing formation defects. These results suggest that some components of chromosomal replication machinery are directly involved in tissue development.

  20. PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.

    Science.gov (United States)

    Wimmer, Katharina; Wernstedt, Annekatrin

    2014-01-01

    The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.

  1. DNA damage and gene therapy of xeroderma pigmentosum, a human DNA repair-deficient disease

    Energy Technology Data Exchange (ETDEWEB)

    Dupuy, Aurélie [Laboratory of Genetic Instability and Oncogenesis UMR8200CNRS, Institut Gustave Roussy and University Paris-Sud, Villejuif (France); Sarasin, Alain, E-mail: alain.sarasin@gustaveroussy.fr [Laboratory of Genetic Instability and Oncogenesis UMR8200CNRS, Institut Gustave Roussy and University Paris-Sud, Villejuif (France); Service de Génétique, Institut Gustave Roussy (France)

    2015-06-15

    Graphical abstract: - Highlights: • Full correction of mutation in the XPC gene by engineered nucleases. • Meganucleases and TALENs are inhibited by 5-MeC for inducing double strand breaks. • Gene therapy of XP cells is possible using homologous recombination for DSB repair. - Abstract: Xeroderma pigmentosum (XP) is a genetic disease characterized by hypersensitivity to ultra-violet and a very high risk of skin cancer induction on exposed body sites. This syndrome is caused by germinal mutations on nucleotide excision repair genes. No cure is available for these patients except a complete protection from all types of UV radiations. We reviewed the various techniques to complement or to correct the genetic defect in XP cells. We, particularly, developed the correction of XP-C skin cells using the fidelity of the homologous recombination pathway during repair of double-strand break (DSB) in the presence of XPC wild type sequences. We used engineered nucleases (meganuclease or TALE nuclease) to induce a DSB located at 90 bp of the mutation to be corrected. Expression of specific TALE nuclease in the presence of a repair matrix containing a long stretch of homologous wild type XPC sequences allowed us a successful gene correction of the original TG deletion found in numerous North African XP patients. Some engineered nucleases are sensitive to epigenetic modifications, such as cytosine methylation. In case of methylated sequences to be corrected, modified nucleases or demethylation of the whole genome should be envisaged. Overall, we showed that specifically-designed TALE-nuclease allowed us to correct a 2 bp deletion in the XPC gene leading to patient's cells proficient for DNA repair and showing normal UV-sensitivity. The corrected gene is still in the same position in the human genome and under the regulation of its physiological promoter. This result is a first step toward gene therapy in XP patients.

  2. DNA damage and gene therapy of xeroderma pigmentosum, a human DNA repair-deficient disease

    International Nuclear Information System (INIS)

    Dupuy, Aurélie; Sarasin, Alain

    2015-01-01

    Graphical abstract: - Highlights: • Full correction of mutation in the XPC gene by engineered nucleases. • Meganucleases and TALENs are inhibited by 5-MeC for inducing double strand breaks. • Gene therapy of XP cells is possible using homologous recombination for DSB repair. - Abstract: Xeroderma pigmentosum (XP) is a genetic disease characterized by hypersensitivity to ultra-violet and a very high risk of skin cancer induction on exposed body sites. This syndrome is caused by germinal mutations on nucleotide excision repair genes. No cure is available for these patients except a complete protection from all types of UV radiations. We reviewed the various techniques to complement or to correct the genetic defect in XP cells. We, particularly, developed the correction of XP-C skin cells using the fidelity of the homologous recombination pathway during repair of double-strand break (DSB) in the presence of XPC wild type sequences. We used engineered nucleases (meganuclease or TALE nuclease) to induce a DSB located at 90 bp of the mutation to be corrected. Expression of specific TALE nuclease in the presence of a repair matrix containing a long stretch of homologous wild type XPC sequences allowed us a successful gene correction of the original TG deletion found in numerous North African XP patients. Some engineered nucleases are sensitive to epigenetic modifications, such as cytosine methylation. In case of methylated sequences to be corrected, modified nucleases or demethylation of the whole genome should be envisaged. Overall, we showed that specifically-designed TALE-nuclease allowed us to correct a 2 bp deletion in the XPC gene leading to patient's cells proficient for DNA repair and showing normal UV-sensitivity. The corrected gene is still in the same position in the human genome and under the regulation of its physiological promoter. This result is a first step toward gene therapy in XP patients

  3. DNA breaks and chromatin structural changes enhance the transcription of autoimmune regulator target genes.

    Science.gov (United States)

    Guha, Mithu; Saare, Mario; Maslovskaja, Julia; Kisand, Kai; Liiv, Ingrid; Haljasorg, Uku; Tasa, Tõnis; Metspalu, Andres; Milani, Lili; Peterson, Pärt

    2017-04-21

    The autoimmune regulator (AIRE) protein is the key factor in thymic negative selection of autoreactive T cells by promoting the ectopic expression of tissue-specific genes in the thymic medullary epithelium. Mutations in AIRE cause a monogenic autoimmune disease called autoimmune polyendocrinopathy-candidiasis-ectodermal dystrophy. AIRE has been shown to promote DNA breaks via its interaction with topoisomerase 2 (TOP2). In this study, we investigated topoisomerase-induced DNA breaks and chromatin structural alterations in conjunction with AIRE-dependent gene expression. Using RNA sequencing, we found that inhibition of TOP2 religation activity by etoposide in AIRE-expressing cells had a synergistic effect on genes with low expression levels. AIRE-mediated transcription was not only enhanced by TOP2 inhibition but also by the TOP1 inhibitor camptothecin. The transcriptional activation was associated with structural rearrangements in chromatin, notably the accumulation of γH2AX and the exchange of histone H1 with HMGB1 at AIRE target gene promoters. In addition, we found the transcriptional up-regulation to co-occur with the chromatin structural changes within the genomic cluster of carcinoembryonic antigen-like cellular adhesion molecule genes. Overall, our results suggest that the presence of AIRE can trigger molecular events leading to an altered chromatin landscape and the enhanced transcription of low-expressed genes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. The entire β-globin gene cluster is deleted in a form of τδβ-thalassemia.

    NARCIS (Netherlands)

    E.R. Fearon; H.H.Jr. Kazazian; P.G. Waber (Pamela); J.I. Lee (Joseph); S.E. Antonarakis; S.H. Orkin (Stuart); E.F. Vanin; P.S. Henthorn; F.G. Grosveld (Frank); A.F. Scott; G.R. Buchanan

    1983-01-01

    textabstractWe have used restriction endonuclease mapping to study a deletion involving the beta-globin gene cluster in a Mexican-American family with gamma delta beta-thalassemia. Analysis of DNA polymorphisms demonstrated deletion of the beta-globin gene from the affected chromosome. Using a DNA

  5. Do recent US Supreme Court rulings on patenting of genes and genetic diagnostics affect the practice of genetic screening and diagnosis in prenatal and reproductive care?

    Science.gov (United States)

    Chandrasekharan, Subhashini; McGuire, Amy L.; Van den Veyver, Ignatia B.

    2015-01-01

    Thousands of patents have been awarded that claim human gene sequences and their uses, and some have been challenged in court. In a recent high-profile case, Association for Molecular Pathology, et al. vs. Myriad Genetics, Inc., et al., the United States Supreme Court ruled that genes are natural occurring substances and therefore not patentable through “composition of matter” claims. The consequences of this ruling will extend well beyond ending Myriad's monopoly over BRCA testing, and may affect similar monopolies of other commercial laboratories for tests involving other genes. It could also simplify intellectual property issues surrounding genome-wide clinical sequencing, which can generate results for genes covered by intellectual property. Non-invasive prenatal testing (NIPT) for common aneuploidies using cell-free fetal (cff) DNA in maternal blood is currently offered through commercial laboratories and is also the subject of ongoing patent litigation. The recent Supreme Court decision in the Myriad case has already been invoked by a lower district court in NIPT litigation and resulted in invalidation of primary claims in a patent on currently marketed cffDNA-based testing for chromosomal aneuploidies. PMID:24989832

  6. Do recent US Supreme Court rulings on patenting of genes and genetic diagnostics affect the practice of genetic screening and diagnosis in prenatal and reproductive care?

    Science.gov (United States)

    Chandrasekharan, Subhashini; McGuire, Amy L; Van den Veyver, Ignatia B

    2014-10-01

    Thousands of patents have been awarded that claim human gene sequences and their uses, and some have been challenged in court. In a recent high-profile case, Association for Molecular Pathology, et al. v. Myriad Genetics, Inc., et al., the US Supreme Court ruled that genes are natural occurring substances and therefore not patentable through 'composition of matter' claims. The consequences of this ruling will extend well beyond ending Myriad's monopoly over BRCA testing and may affect similar monopolies of other commercial laboratories for tests involving other genes. It could also simplify intellectual property issues surrounding genome-wide clinical sequencing, which can generate results for genes covered by intellectual property. Non-invasive prenatal testing (NIPT) for common aneuploidies using cell-free fetal (cff) DNA in maternal blood is currently offered through commercial laboratories and is also the subject of ongoing patent litigation. The recent Supreme Court decision in the Myriad case has already been invoked by a lower district court in NIPT litigation and resulted in invalidation of primary claims in a patent on currently marketed cffDNA-based testing for chromosomal aneuploidies. © 2014 John Wiley & Sons, Ltd.

  7. SNP genotyping by DNA photoligation: application to SNP detection of genes from food crops

    Energy Technology Data Exchange (ETDEWEB)

    Yoshimura, Yoshinaga; Ohtake, Tomoko; Okada, Hajime; Fujimoto, Kenzo [School of Materials Science, Japan Advanced Institute of Science and Technology, 1-1 Asahidai, Nomi, Ishikawa 923-1292 (Japan); Ami, Takehiro [Innovation Plaza Ishikawa, Japan Science and Technology Agency, 2-13 Asahidai, Nomi, Ishikawa 923-1211 (Japan); Tsukaguchi, Tadashi, E-mail: kenzo@jaist.ac.j [Faculty of Bioresources and Environmental Sciences, Ishikawa Prefectural University, 1-308 Suematsu, Nonoichi, Ishikawa 921-8836 (Japan)

    2009-06-15

    We describe a simple and inexpensive single-nucleotide polymorphism (SNP) typing method, using DNA photoligation with 5-carboxyvinyl-2'-deoxyuridine and two fluorophores. This SNP-typing method facilitates qualitative determination of genes from indica and japonica rice, and showed a high degree of single nucleotide specificity up to 10 000. This method can be used in the SNP typing of actual genomic DNA samples from food crops.

  8. SNP genotyping by DNA photoligation: application to SNP detection of genes from food crops

    Directory of Open Access Journals (Sweden)

    Yoshinaga Yoshimura, Tomoko Ohtake, Hajime Okada, Takehiro Ami, Tadashi Tsukaguchi and Kenzo Fujimoto

    2009-01-01

    Full Text Available We describe a simple and inexpensive single-nucleotide polymorphism (SNP typing method, using DNA photoligation with 5-carboxyvinyl-2'-deoxyuridine and two fluorophores. This SNP-typing method facilitates qualitative determination of genes from indica and japonica rice, and showed a high degree of single nucleotide specificity up to 10 000. This method can be used in the SNP typing of actual genomic DNA samples from food crops.

  9. Investigation of the effect of ionizing radiation on gene expression variation by the 'DNA chips': feasibility of a biological dosimeter

    International Nuclear Information System (INIS)

    Gruel, G.

    2005-01-01

    After having described the different biological effects of ionizing radiation and the different approaches to biological dosimetry, and introduced 'DNA chips' or DNA micro-arrays, the author reports the characterization of gene expression variations in the response of cells to a gamma irradiation. Both main aspects of the use DNA chips are investigated: fundamental research and diagnosis. This research thesis thus proposes an analysis of the effect of ionizing radiation using DNA chips, notably by comparing gene expression modifications measured in mouse irradiated lung, heart and kidney. It reports a feasibility study of bio-dosimeter based on expression profiles

  10. Novel mechanism of gene regulation: the protein Rv1222 of Mycobacterium tuberculosis inhibits transcription by anchoring the RNA polymerase onto DNA.

    Science.gov (United States)

    Rudra, Paulami; Prajapati, Ranjit Kumar; Banerjee, Rajdeep; Sengupta, Shreya; Mukhopadhyay, Jayanta

    2015-07-13

    We propose a novel mechanism of gene regulation in Mycobacterium tuberculosis where the protein Rv1222 inhibits transcription by anchoring RNA polymerase (RNAP) onto DNA. In contrast to our existing knowledge that transcriptional repressors function either by binding to DNA at specific sequences or by binding to RNAP, we show that Rv1222-mediated transcription inhibition requires simultaneous binding of the protein to both RNAP and DNA. We demonstrate that the positively charged C-terminus tail of Rv1222 is responsible for anchoring RNAP on DNA, hence the protein slows down the movement of RNAP along the DNA during transcription elongation. The interaction between Rv1222 and DNA is electrostatic, thus the protein could inhibit transcription from any gene. As Rv1222 slows down the RNA synthesis, upon expression of the protein in Mycobacterium smegmatis or Escherichia coli, the growth rate of the bacteria is severely impaired. The protein does not possess any significant affinity for DNA polymerase, thus, is unable to inhibit DNA synthesis. The proposed mechanism by which Rv1222 inhibits transcription reveals a new repertoire of prokaryotic gene regulation. © Crown copyright 2015.

  11. Genomic DNA-based absolute quantification of gene expression in Vitis.

    Science.gov (United States)

    Gambetta, Gregory A; McElrone, Andrew J; Matthews, Mark A

    2013-07-01

    Many studies in which gene expression is quantified by polymerase chain reaction represent the expression of a gene of interest (GOI) relative to that of a reference gene (RG). Relative expression is founded on the assumptions that RG expression is stable across samples, treatments, organs, etc., and that reaction efficiencies of the GOI and RG are equal; assumptions which are often faulty. The true variability in RG expression and actual reaction efficiencies are seldom determined experimentally. Here we present a rapid and robust method for absolute quantification of expression in Vitis where varying concentrations of genomic DNA were used to construct GOI standard curves. This methodology was utilized to absolutely quantify and determine the variability of the previously validated RG ubiquitin (VvUbi) across three test studies in three different tissues (roots, leaves and berries). In addition, in each study a GOI was absolutely quantified. Data sets resulting from relative and absolute methods of quantification were compared and the differences were striking. VvUbi expression was significantly different in magnitude between test studies and variable among individual samples. Absolute quantification consistently reduced the coefficients of variation of the GOIs by more than half, often resulting in differences in statistical significance and in some cases even changing the fundamental nature of the result. Utilizing genomic DNA-based absolute quantification is fast and efficient. Through eliminating error introduced by assuming RG stability and equal reaction efficiencies between the RG and GOI this methodology produces less variation, increased accuracy and greater statistical power. © 2012 Scandinavian Plant Physiology Society.

  12. Uniparental mitochondrial DNA inheritance is not affected in Ustilago maydis Δatg11 mutants blocked in mitophagy.

    Science.gov (United States)

    Wagner-Vogel, Gaby; Lämmer, Frauke; Kämper, Jörg; Basse, Christoph W

    2015-02-06

    Maternal or uniparental inheritance (UPI) of mitochondria is generally observed in sexual eukaryotes, however, the underlying mechanisms are diverse and largely unknown. Recently, based on the use of mutants blocked in autophagy, it has been demonstrated that autophagy is required for strict maternal inheritance in the nematode Caenorhabditis elegans. Uniparental mitochondrial DNA (mtDNA) inheritance has been well documented for numerous fungal species, and in particular, has been shown to be genetically governed by the mating-type loci in the isogamous species Cryptococcus neoformans, Phycomyces blakesleeanus and Ustilago maydis. Previously, we have shown that the a2 mating-type locus gene lga2 is decisive for UPI during sexual development of U. maydis. In axenic culture, conditional overexpression of lga2 triggers efficient loss of mtDNA as well as mitophagy. To assess a functional relationship, we have investigated UPI in U. maydis Δatg11 mutants, which are blocked in mitophagy. This study has revealed that Δatg11 mutants are not affected in pathogenic development and this has allowed us to analyse UPI under comparable developmental conditions between mating-compatible wild-type and mutant strain combinations. Explicitly, we have examined two independent strain combinations that gave rise to different efficiencies of UPI. We demonstrate that in both cases UPI is atg11-independent, providing evidence that mitophagy is not critical for UPI in U. maydis, even under conditions of strict UPI. Until now, analysis of a role of mitophagy in UPI has not been reported for microbial species. Our study suggests that selective autophagy does not contribute to UPI in U. maydis, but is rather a consequence of selective mtDNA elimination in response to mitochondrial damage.

  13. The detection of HBV DNA with gold-coated iron oxide nanoparticle gene probes

    International Nuclear Information System (INIS)

    Xi Dong; Luo Xiaoping; Lu Qianghua; Yao Kailun; Liu Zuli; Ning Qin

    2008-01-01

    Gold-coated iron oxide nanoparticle Hepatitis B virus (HBV) DNA probes were prepared, and their application for HBV DNA measurement was studied. Gold-coated iron oxide nanoparticles were prepared by the citrate reduction of tetra-chloroauric acid in the presence of iron oxide nanoparticles which were added as seeds. With a fluorescence-based method, the maximal surface coverage of hexaethiol 30-mer oligonucleotides and the maximal percentage of hybridization strands on gold-coated iron oxide nanoparticles were (120 ± 8) oligonucleotides per nanoparticle, and (14 ± 2%), respectively, which were comparable with those of (132 ± 10) and (22 ± 3%) in Au nanoparticle groups. Large network aggregates were formed when gold-coated iron oxide nanoparticle HBV DNA gene probe was applied to detect HBV DNA molecules as evidenced by transmission electron microscopy and the high specificity was verified by blot hybridization. Our results further suggested that detecting DNA with iron oxide nanoparticles and magnetic separator was feasible and might be an alternative effective method

  14. Dendritic silica nanomaterials (KCC-1) with fibrous pore structure possess high DNA adsorption capacity and effectively deliver genes in vitro.

    Science.gov (United States)

    Huang, Xiaoxi; Tao, Zhimin; Praskavich, John C; Goswami, Anandarup; Al-Sharab, Jafar F; Minko, Tamara; Polshettiwar, Vivek; Asefa, Tewodros

    2014-09-16

    The pore size and pore structure of nanoporous materials can affect the materials' physical properties, as well as potential applications in different areas, including catalysis, drug delivery, and biomolecular therapeutics. KCC-1, one of the newest members of silica nanomaterials, possesses fibrous, large pore, dendritic pore networks with wide pore entrances, large pore size distribution, spacious pore volume and large surface area--structural features that are conducive for adsorption and release of large guest molecules and biomacromolecules (e.g., proteins and DNAs). Here, we report the results of our comparative studies of adsorption of salmon DNA in a series of KCC-1-based nanomaterials that are functionalized with different organoamine groups on different parts of their surfaces (channel walls, external surfaces or both). For comparison the results of our studies of adsorption of salmon DNA in similarly functionalized, MCM-41 mesoporous silica nanomaterials with cylindrical pores, some of the most studied silica nanomaterials for drug/gene delivery, are also included. Our results indicate that, despite their relatively lower specific surface area, the KCC-1-based nanomaterials show high adsorption capacity for DNA than the corresponding MCM-41-based nanomaterials, most likely because of KCC-1's large pores, wide pore mouths, fibrous pore network, and thereby more accessible and amenable structure for DNA molecules to diffuse through. Conversely, the MCM-41-based nanomaterials adsorb much less DNA, presumably because their outer surfaces/cylindrical channel pore entrances can get blocked by the DNA molecules, making the inner parts of the materials inaccessible. Moreover, experiments involving fluorescent dye-tagged DNAs suggest that the amine-grafted KCC-1 materials are better suited for delivering the DNAs adsorbed on their surfaces into cellular environments than their MCM-41 counterparts. Finally, cellular toxicity tests show that the KCC-1-based

  15. Identification of immune protective genes of Eimeria maxima through cDNA expression library screening.

    Science.gov (United States)

    Yang, XinChao; Li, MengHui; Liu, JianHua; Ji, YiHong; Li, XiangRui; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai

    2017-02-16

    Eimeria maxima is one of the most prevalent Eimeria species causing avian coccidiosis, and results in huge economic loss to the global poultry industry. Current control strategies, such as anti-coccidial medication and live vaccines have been limited because of their drawbacks. The third generation anticoccidial vaccines including the recombinant vaccines as well as DNA vaccines have been suggested as a promising alternative strategy. To date, only a few protective antigens of E. maxima have been reported. Hence, there is an urgent need to identify novel protective antigens of E. maxima for the development of neotype anticoccidial vaccines. With the aim of identifying novel protective genes of E. maxima, a cDNA expression library of E. maxima sporozoites was constructed using Gateway technology. Subsequently, the cDNA expression library was divided into 15 sub-libraries for cDNA expression library immunization (cDELI) using parasite challenged model in chickens. Protective sub-libraries were selected for the next round of screening until individual protective clones were obtained, which were further sequenced and analyzed. Adopting the Gateway technology, a high-quality entry library was constructed, containing 9.2 × 10 6 clones with an average inserted fragments length of 1.63 kb. The expression library capacity was 2.32 × 10 7 colony-forming units (cfu) with an average inserted fragments length of 1.64 Kb. The expression library was screened using parasite challenged model in chickens. The screening yielded 6 immune protective genes including four novel protective genes of EmJS-1, EmRP, EmHP-1 and EmHP-2, and two known protective genes of EmSAG and EmCKRS. EmJS-1 is the selR domain-containing protein of E. maxima whose function is unknown. EmHP-1 and EmHP-2 are the hypothetical proteins of E. maxima. EmRP and EmSAG are rhomboid-like protein and surface antigen glycoproteins of E. maxima respectively, and involved in invasion of the parasite. Our

  16. DNA array analysis of gene expression changes by Choto-san in the ischemic rat brain

    OpenAIRE

    Tohda, Michihisa; Matsumoto, Kinzo; Hayashi, Hisae; Murakami, Yukihisa; Watanabe, Hiroshi

    2004-01-01

    The effects of Choto-san on gene expression in the dementia model rat brain were studied using a DNA microarray system. Choto-san inhibited the expression of 181 genes that has been enhanced by permanent occlusion of the bilateral common carotid arteries (2VO). Choto-san also reversed the expression inhibition of 32 genes induced by 2VO. These results may suggest that Choto-san, which has been therapeutically used as an antidementive drug, shows therapeutic effects through gene expression cha...

  17. Cloning of the cDNA and gene for a human D2 dopamine receptor

    International Nuclear Information System (INIS)

    Grady, D.K.; Makam, H.; Stofko, R.E.; Bunzow, J.R.; Civelli, O.; Marchionni, M.A.; Alfano, M.; Frothingham, L.; Fischer, J.B.; Burke-Howie, K.J.; Server, A.C.

    1989-01-01

    A clone encoding a human D 2 dopamine receptor was isolated from a pituitary cDNA library and sequenced. The deduced protein sequence is 96% identical with that of the cloned rat receptor with one major difference: the human receptor contains an additional 29 amino acids in its putative third cytoplasmic loop. Southern blotting demonstrated the presence of only one human D 2 receptor gene. Two overlapping phage containing the gene were isolated and characterized. DNA sequence analysis of these clones showed that the coding sequence is interrupted by six introns and that the additional amino acids present in the human pituitary receptor are encoded by a single exon of 87 base pairs. The involvement of this sequence in alternative splicing and its biological significance are discussed

  18. Development of DNA-based radiopharmaceuticals carrying Auger-electron emitters for anti-gene radiotherapy

    International Nuclear Information System (INIS)

    Panyutin, I.G.; Winters, T.A.; Feinendegen, L.E.; Neumann, R.D.

    2000-01-01

    Targeting of radiation damage to specific DNA sequences is the essence of antigene radiotherapy. This technique also provides a tool to study molecular mechanisms of DNA repair on a defined, single radio damaged site. It was achieved such sequence-specific radio damage by combining the highly localized DNA damage produced by the decay of Auger-electron-emitters such as 125 I with the sequence-specific action of triplex-forming oligonucleotides (TFO). TFO complementary to polypurine-polypyrimidine regions of human genes were synthesized and labeled with 125 I-dCTP by the primer extension method. 125 I-TFO were delivered into cells with several delivery systems. In addition, human enzymes capable of supporting DNA single-strand-break repair were isolated and assessed for their role in the repair of this lesion. Also, the mutagenicity and repairability of 125 I-TFO-induced double strand breaks (DSB) were assessed by repair of plasmid possessing a site-specific DSB lesion. Using plasmids containing target polypurine-polypyrimidine tracts, it was obtained the fine structure of sequence-specific DNA breaks produced by decay of 125 I with single-nucleotide resolution. It was showed that the designed 125 I-TFO in nanomolar concentrations could bind to and introduce double-strand breaks into the target sequences in situ, i.e., within isolated nuclei and intact digitonin-permeabilized cells. It was also showed 125 I-TFO-induced DSB to be highly mutagenic lesions resulting in a mutation frequency of nearly 80%, with deletions comprising the majority of mutations. The results obtained demonstrate the ability of 125 I-TFO to target specific sequences in their natural environment - within eukaryotic nucleus. Repair of 125 I-TFO-induced DNA damage should typically result in mutagenic gene inactivation

  19. DNA methyltransferases and stress-related genes expression in zebrafish larvae after exposure to heat and copper during reprogramming of DNA methylation.

    Science.gov (United States)

    Dorts, Jennifer; Falisse, Elodie; Schoofs, Emilie; Flamion, Enora; Kestemont, Patrick; Silvestre, Frédéric

    2016-10-12

    DNA methylation, a well-studied epigenetic mark, is important for gene regulation in adulthood and for development. Using genetic and epigenetic approaches, the present study aimed at evaluating the effects of heat stress and copper exposure during zebrafish early embryogenesis when patterns of DNA methylation are being established, a process called reprogramming. Embryos were exposed to 325 μg Cu/L from fertilization (<1 h post fertilization - hpf) to 4 hpf at either 26.5 °C or 34 °C, followed by incubation in clean water at 26.5 °C till 96 hpf. Significant increased mortality rates and delayed hatching were observed following exposure to combined high temperature and Cu. Secondly, both stressors, alone or in combination, significantly upregulated the expression of de novo DNA methyltransferase genes (dnmt3) along with no differences in global cytosine methylation level. Finally, Cu exposure significantly increased the expression of metallothionein (mt2) and heat shock protein (hsp70), the latter being also increased following exposure to high temperature. These results highlighted the sensitivity of early embryogenesis and more precisely of the reprogramming period to environmental challenges, in a realistic situation of combined stressors.

  20. CEBPG transcription factor correlates with antioxidant and DNA repair genes in normal bronchial epithelial cells but not in individuals with bronchogenic carcinoma

    International Nuclear Information System (INIS)

    Mullins, D'Anna N; Crawford, Erin L; Khuder, Sadik A; Hernandez, Dawn-Alita; Yoon, Youngsook; Willey, James C

    2005-01-01

    Cigarette smoking is the primary cause of bronchogenic carcinoma (BC), yet only 10–15% of heavy smokers develop BC and it is likely that this variation in risk is, in part, genetically determined. We previously reported a set of antioxidant genes for which transcript abundance was lower in normal bronchial epithelial cells (NBEC) of BC individuals compared to non-BC individuals. In unpublished studies of the same NBEC samples, transcript abundance values for several DNA repair genes were correlated with these antioxidant genes. From these data, we hypothesized that antioxidant and DNA repair genes are co-regulated by one or more transcription factors and that inter-individual variation in expression and/or function of one or more of these transcription factors is responsible for inter-individual variation in risk for BC. The putative transcription factor recognition sites common to six of the antioxidant genes were identified through in silico DNA sequence analysis. The transcript abundance values of these transcription factors (n = 6) and an expanded group of antioxidant and DNA repair genes (n = 16) were measured simultaneously by quantitative PCR in NBEC of 24 non-BC and 25 BC individuals. CEBPG transcription factor was significantly (p < 0.01) correlated with eight of the antioxidant or DNA repair genes in non-BC individuals but not in BC individuals. In BC individuals the correlation with CEBPG was significantly (p < 0.01) lower than that of non-BC individuals for four of the genes (XRCC1, ERCC5, GSTP1, and SOD1) and the difference was nearly significant for GPX1. The only other transcription factor correlated with any of these five target genes in non-BC individuals was E2F1. E2F1 was correlated with GSTP1 among non-BC individuals, but in contrast to CEBPG, there was no significant difference in this correlation in non-BC individuals compared to BC individuals. We conclude that CEBPG is the transcription factor primarily responsible for regulating