The V domain of dog PVRL4 (nectin-4) mediates canine distemper virus entry and virus cell-to-cell spread

International Nuclear Information System (INIS)

Delpeut, Sebastien; Noyce, Ryan S.; Richardson, Christopher D.

2014-01-01

The entry of canine distemper virus (CDV) is a multistep process that involves the attachment of CDV hemagglutinin (H) to its cellular receptor, followed by fusion between virus and cell membranes. Our laboratory recently identified PVRL4 (nectin-4) to be the epithelial receptor for measles and canine distemper viruses. In this study, we demonstrate that the V domain of PVRL4 is critical for CDV entry and virus cell-to-cell spread. Furthermore, four key amino acid residues within the V domain of dog PVRL4 and two within the CDV hemagglutinin were shown to be essential for receptor-mediated virus entry. - Highlights: • PVRL4 (nectin-4) is the epithelial cell receptor for measles and canine distemper viruses. • V domain of PVRL4 is critical for CDV entry, cell-to-cell spread, and syncytia formation. • Chimeric PVRL1 backbone substituted with the V domain of PVRL4 can function as a receptor. • Amino acids (F132/P133/A134/G135) within the V domain are essential for PVRL4 receptor activity. • Amino acids (P493/Y539) within CDV H protein are essential for PVRL4 receptor interaction

The V domain of dog PVRL4 (nectin-4) mediates canine distemper virus entry and virus cell-to-cell spread

Energy Technology Data Exchange (ETDEWEB)

Delpeut, Sebastien; Noyce, Ryan S. [The Department of Microbiology and Immunology, Dalhousie University, Halifax, Nova Scotia, Canada B3H 1X5 (Canada); IWK Health Centre, Canadian Center for Vaccinology, Goldbloom Pavilion, Halifax, Nova Scotia, Canada B3H 1X5 (Canada); Richardson, Christopher D., E-mail: chris.richardson@dal.ca [The Department of Microbiology and Immunology, Dalhousie University, Halifax, Nova Scotia, Canada B3H 1X5 (Canada); IWK Health Centre, Canadian Center for Vaccinology, Goldbloom Pavilion, Halifax, Nova Scotia, Canada B3H 1X5 (Canada); The Department of Pediatrics, Dalhousie University, Halifax, Nova Scotia (Canada)

2014-04-15

The entry of canine distemper virus (CDV) is a multistep process that involves the attachment of CDV hemagglutinin (H) to its cellular receptor, followed by fusion between virus and cell membranes. Our laboratory recently identified PVRL4 (nectin-4) to be the epithelial receptor for measles and canine distemper viruses. In this study, we demonstrate that the V domain of PVRL4 is critical for CDV entry and virus cell-to-cell spread. Furthermore, four key amino acid residues within the V domain of dog PVRL4 and two within the CDV hemagglutinin were shown to be essential for receptor-mediated virus entry. - Highlights: • PVRL4 (nectin-4) is the epithelial cell receptor for measles and canine distemper viruses. • V domain of PVRL4 is critical for CDV entry, cell-to-cell spread, and syncytia formation. • Chimeric PVRL1 backbone substituted with the V domain of PVRL4 can function as a receptor. • Amino acids (F132/P133/A134/G135) within the V domain are essential for PVRL4 receptor activity. • Amino acids (P493/Y539) within CDV H protein are essential for PVRL4 receptor interaction.

Homologous recombination is a force in the evolution of canine distemper virus.

Science.gov (United States)

Yuan, Chaowen; Liu, Wenxin; Wang, Yingbo; Hou, Jinlong; Zhang, Liguo; Wang, Guoqing

2017-01-01

Canine distemper virus (CDV) is the causative agent of canine distemper (CD) that is a highly contagious, lethal, multisystemic viral disease of receptive carnivores. The prevalence of CDV is a major concern in susceptible animals. Presently, it is unclear whether intragenic recombination can contribute to gene mutations and segment reassortment in the virus. In this study, 25 full-length CDV genome sequences were subjected to phylogenetic and recombinational analyses. The results of phylogenetic analysis, intragenic recombination, and nucleotide selection pressure indicated that mutation and recombination occurred in the six individual genes segment (H, F, P, N, L, M) of the CDV genome. The analysis also revealed pronounced genetic diversity in the CDV genome according to the geographically distinct lineages (genotypes), namely Asia-1, Asia-2, Asia-3, Europe, America-1, and America-2. The six recombination events were detected using SimPlot and RDP programs. The analysis of selection pressure demonstrated that a majority of the nucleotides in the CDV individual gene were under negative selection. Collectively, these data suggested that homologous recombination acts as a key force driving the genetic diversity and evolution of canine distemper virus.

Studies on manifestations of canine distemper virus infection in an urban dog population.

Science.gov (United States)

Blixenkrone-Møller, M; Svansson, V; Have, P; Orvell, C; Appel, M; Pedersen, I R; Dietz, H H; Henriksen, P

1993-10-01

An upsurge of canine distemper was recognized at the beginning of 1991 in the urban dog population of the Copenhagen area. The outbreak had the characteristics of a virulent morbillivirus introduction in a partly immune population, where the disease primarily was manifested in young individuals. Testing of single serum samples for the presence of canine distemper virus (CDV) IgM antibodies using an IgM ELISA confirmed current and recent CDV infections in an urban dog population, where the use of attenuated CDV vaccines was widespread. In 49 out of 66 sera from clinical cases suspected of canine distemper we detected CDV IgM antibodies, as compared to the detection of viral antigen by indirect immunofluorescence in 27 of 65 specimens of conjunctival cells. The antigenic make-up of isolates from acute and subacute clinical cases was investigated with a panel of 51 monoclonal antibodies directed against CDV and the related phocine distemper virus. The isolates exhibited an homogeneous reaction pattern and shared overall antigenic characteristics of the CDV prototype. The majority of cases were diagnosed among unvaccinated dogs and individuals with unknown or obscure vaccination record. However, severe clinical cases were also diagnosed in vaccinated individuals.

Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

Directory of Open Access Journals (Sweden)

Otávio Valério Carvalho

2012-01-01

Full Text Available Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV, which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies.

Immunopathogenic and Neurological Mechanisms of Canine Distemper Virus

Science.gov (United States)

Carvalho, Otávio Valério; Botelho, Clarisse Vieira; Ferreira, Caroline Gracielle Torres; Scherer, Paulo Oldemar; Soares-Martins, Jamária Adriana Pinheiro; Almeida, Márcia Rogéria; Silva Júnior, Abelardo

2012-01-01

Canine distemper is a highly contagious viral disease caused by the canine distemper virus (CDV), which is a member of the Morbillivirus genus, Paramyxoviridae family. Animals that most commonly suffer from this disease belong to the Canidae family; however, the spectrum of natural hosts for CDV also includes several other families of the order Carnivora. The infectious disease presents worldwide distribution and maintains a high incidence and high levels of lethality, despite the availability of effective vaccines, and no specific treatment. CDV infection in dogs is characterized by the presentation of systemic and/or neurological courses, and viral persistence in some organs, including the central nervous system (CNS) and lymphoid tissues. An elucidation of the pathogenic mechanisms involved in canine distemper disease will lead to a better understanding of the injuries and clinical manifestations caused by CDV. Ultimately, further insight about this disease will enable the improvement of diagnostic methods as well as therapeutic studies. PMID:23193403

Inactivated Recombinant Rabies Viruses Displaying Canine Distemper Virus Glycoproteins Induce Protective Immunity against Both Pathogens.

Science.gov (United States)

da Fontoura Budaszewski, Renata; Hudacek, Andrew; Sawatsky, Bevan; Krämer, Beate; Yin, Xiangping; Schnell, Matthias J; von Messling, Veronika

2017-04-15

The development of multivalent vaccines is an attractive methodology for the simultaneous prevention of several infectious diseases in vulnerable populations. Both canine distemper virus (CDV) and rabies virus (RABV) cause lethal disease in wild and domestic carnivores. While RABV vaccines are inactivated, the live-attenuated CDV vaccines retain residual virulence for highly susceptible wildlife species. In this study, we developed recombinant bivalent vaccine candidates based on recombinant vaccine strain rabies virus particles, which concurrently display the protective CDV and RABV glycoprotein antigens. The recombinant viruses replicated to near-wild-type titers, and the heterologous glycoproteins were efficiently expressed and incorporated in the viral particles. Immunization of ferrets with beta-propiolactone-inactivated recombinant virus particles elicited protective RABV antibody titers, and animals immunized with a combination of CDV attachment protein- and fusion protein-expressing recombinant viruses were protected from lethal CDV challenge. However, animals that were immunized with only a RABV expressing the attachment protein of CDV vaccine strain Onderstepoort succumbed to infection with a more recent wild-type strain, indicating that immune responses to the more conserved fusion protein contribute to protection against heterologous CDV strains. IMPORTANCE Rabies virus and canine distemper virus (CDV) cause high mortality rates and death in many carnivores. While rabies vaccines are inactivated and thus have an excellent safety profile and high stability, live-attenuated CDV vaccines can retain residual virulence in highly susceptible species. Here we generated recombinant inactivated rabies viruses that carry one of the CDV glycoproteins on their surface. Ferrets immunized twice with a mix of recombinant rabies viruses carrying the CDV fusion and attachment glycoproteins were protected from lethal CDV challenge, whereas all animals that received

Measles and canine distemper virus antibodies in patients with multiple sclerosis determined by radioimmunoassay

International Nuclear Information System (INIS)

Arnadottir, T.

1980-01-01

Antibodies against measles virus (MV) and canine distemper virus (CDV) were measured by solid-phase radioimmunoassay (RIA) of sera and cerebrospinal fluid (CSF) from 28 patients with multiple sclerosis (MS) and matched neurological controls. When the groups were compared for MV antibody titers and CDV antibody titers of sera and MV/CDV serum antibody titer ratios, no significant difference was found. The CDV antibody titers and the MV antibody titers were in good correlation. CDV antibodies showed RIA titration curves typical of low avidity antibodies. In tests for MV antibodies in CSF, 82% of the MS patients and 19% of the controls were positive, whereas 36% of the MS patients and 4% of the controls were positive in CDV RIA. The correlation between MV and CDV antibody levels, the low avidity of CDV antibodies and the fact that absorption of the specimens with MV antigen abolished all CDV antibody activity suggest that the CDV antibodies are MV antibodies cross-reacting with CDV. It is concluded that canine distemper virus is unlikely to be involved in the etiology of multiple sclerosis. (author)

Recombinant canine distemper virus strain snyder hill expressing green or red fluorescent proteins causes meningoencephalitis in the ferret

NARCIS (Netherlands)

M. Ludlow (Martin); D.T. Nguyen (Tien); D. Silin; O. Lyubomska; R.D. de Vries (Rory); V. von Messling; S. McQuaid (Stephen); R.L. de Swart (Rik); W.P. Duprex (Paul)

2012-01-01

textabstractThe propensity of canine distemper virus (CDV) to spread to the central nervous system is one of the primary features of distemper. Therefore, we developed a reverse genetics system based on the neurovirulent Snyder Hill (SH) strain of CDV (CDVSH) and show that this virus rapidly

Experimental adaptation of wild-type canine distemper virus (CDV to the human entry receptor CD150.

Directory of Open Access Journals (Sweden)

Maria Bieringer

Full Text Available Canine distemper virus (CDV, a close relative of measles virus (MV, is widespread and well known for its broad host range. When the goal of measles eradication may be achieved, and when measles vaccination will be stopped, CDV might eventually cross the species barrier to humans and emerge as a new human pathogen. In order to get an impression how fast such alterations may occur, we characterized required adaptive mutations to the human entry receptors CD150 (SLAM and nectin-4 as first step to infect human target cells. Recombinant wild-type CDV-A75/17(red adapted quickly to growth in human H358 epithelial cells expressing human nectin-4. Sequencing of the viral attachment proteins (hemagglutinin, H, and fusion protein, F genes revealed that no adaptive alteration was required to utilize human nectin-4. In contrast, the virus replicated only to low titres (10(2 pfu/ml in Vero cells expressing human CD150 (Vero-hSLAM. After three passages using these cells virus was adapted to human CD150 and replicated to high titres (10(5 pfu/ml. Sequence analyses revealed that only one amino acid exchange in the H-protein at position 540 Asp→Gly (D540G was required for functional adaptation to human CD150. Structural modelling suggests that the adaptive mutation D540G in H reflects the sequence alteration from canine to human CD150 at position 70 and 71 from Pro to Leu (P70L and Gly to Glu (G71E, and compensates for the gain of a negative charge in the human CD150 molecule. Using this model system our data indicate that only a minimal alteration, in this case one adaptive mutation, is required for adaptation of CDV to the human entry receptors, and help to understand the molecular basis why this adaptive mutation occurs.

Canine distemper virus infection in a lesser grison (Galictis cuja: first report and virus phylogeny

Directory of Open Access Journals (Sweden)

Jane Megid

2013-02-01

Full Text Available Infectious diseases in wild animals have been increasing as a result of their habitat alterations and closer contact with domestic animals. Canine distemper virus (CDV has been reported in several species of wild carnivores, presenting a threat to wildlife conservation. We described the first case of canine distemper virus infection in lesser grison (Galictis cuja. A free-ranging individual, with no visible clinical sigs, presented sudden death after one day in captivity. Molecular diagnosis for CDV infection was performed using whole blood collected by postmortem intracardiac puncture, which resulted positive. The virus phylogeny indicated that domestic dogs were the probable source of infection.

Recombinant rabies virus expressing the H protein of canine distemper virus protects dogs from the lethal distemper challenge.

Science.gov (United States)

Wang, Feng-Xue; Zhang, Shu-Qin; Zhu, Hong-Wei; Yang, Yong; Sun, Na; Tan, Bin; Li, Zhen-Guang; Cheng, Shi-Peng; Fu, Zhen F; Wen, Yong-Jun

2014-12-05

The rabies virus (RV) vector LBNSE expressing foreign antigens have shown considerable promise as vaccines against viral and bacteria diseases, which is effective and safe. We produced a new RV-based vaccine vehicle expressing 1.824 kb hemagglutinin (H) gene of the canine distemper virus (CDV) by reverse genetics technology. The recombinant virus LBNSE-CDV-H retained growth properties similar to those of vector LBNSE both in BSR and mNA cell culture. The H gene of CDV was expressed and detected by immunostaining. To compare the immunogenicity of LBNSE-CDV-H, dogs were immunized with each of these recombinant viruses by intramuscular (i.m.). The dogs were bled at third weeks after the immunization for the measurement of virus neutralizing antibody (VNA) and then challenged with virulent virus (ZJ 7) at fourth weeks. The parent virus (LBNSE) without expression of any foreign molecules was included for comparison. Dogs inoculated with LBNSE-CDV-H showed no any signs of disease and exhibited seroconversion against both RV and CDV H protein. The LBNSE-CDV-H did not cause disease in dogs and conferred protection from challenge with a lethal wild type CDV strain, demonstrating its potential value for wildlife conservation efforts. Together, these studies suggest that recombinant RV expressing H protein from CDV stimulated high levels of adaptive immune responses (VNA), and protected all dogs challenge infection. Copyright © 2014 Elsevier B.V. All rights reserved.

Advances in canine distemper virus pathogenesis research: a wildlife perspective.

Science.gov (United States)

Loots, Angelika K; Mitchell, Emily; Dalton, Desiré L; Kotzé, Antoinette; Venter, Estelle H

2017-03-01

Canine distemper virus (CDV) has emerged as a significant disease of wildlife, which is highly contagious and readily transmitted between susceptible hosts. Initially described as an infectious disease of domestic dogs, it is now recognized as a global multi-host pathogen, infecting and causing mass mortalities in a wide range of carnivore species. The last decade has seen the effect of numerous CDV outbreaks in various wildlife populations. Prevention of CDV requires a clear understanding of the potential hosts in danger of infection as well as the dynamic pathways CDV uses to gain entry to its host cells and its ability to initiate viral shedding and disease transmission. We review recent research conducted on CDV infections in wildlife, including the latest findings on the causes of host specificity and cellular receptors involved in distemper pathogenesis.

Complete Genomic Sequence of Canine Distemper Virus from an Ethiopian Wolf.

Science.gov (United States)

Marston, Denise A; Watson, Jemma; Wise, Emma L; Ellis, Richard J; Bedin, Eric; Ayalew, Girma; Abute, Muktar; de Lamballerie, Xavier; Fooks, Anthony R; Sillero-Zubiri, Claudio; Banyard, Ashley C

2017-07-20

Canine distemper virus (CDV) has been implicated in population declines of wildlife, including many threatened species. Here we present the full genome of CDV from an Ethiopian wolf, Canis simensis , the world's rarest and most endangered canid. © Crown copyright 2017.

Detection of Canine Distemper Virus Nucleoprotein RNA by Reverse Transcription-PCR Using Serum, Whole Blood, and Cerebrospinal Fluid from Dogs with Distemper

Science.gov (United States)

Frisk, A. L.; König, M.; Moritz, A.; Baumgärtner, W.

1999-01-01

Reverse transcription-PCR (RT-PCR) was used to detect canine distemper virus (CDV) nucleoprotein (NP) RNA in serum, whole blood, and cerebrospinal fluid (CSF) samples from 38 dogs with clinically suspected distemper. Results were correlated to clinical findings, anti-CDV neutralizing antibody titers, postmortem findings, and demonstration of CDV NP antigen by immunohistochemistry. The specificity of the RT-PCR was ensured by amplification of RNA from various laboratory CDV strains, restriction enzyme digestion, and Southern blot hybridization. In 29 of 38 dogs, CDV infection was confirmed by postmortem examination and immunohistochemistry. The animals displayed the catarrhal, systemic, and nervous forms of distemper. Seventeen samples (serum, whole blood, or CSF) from dogs with distemper were tested with three sets of primers targeted to different regions of the NP gene of the CDV Onderstepoort strain. Expected amplicons were observed in 82, 53, and 41% of the 17 samples, depending upon the primer pair used. With the most sensitive primer pair (primer pair I), CDV NP RNA was detected in 25 of 29 (86%) serum samples and 14 of 16 (88%) whole blood and CSF samples from dogs with distemper but not in body fluids from immunohistochemically negative dogs. Nucleotide sequence analysis of five RT-PCR amplicons from isolates from the field revealed few silent point mutations. These isolates exhibited greater homology to the Rockborn (97 to 99%) than to the Onderstepoort (95 to 96%) CDV strain. In summary, although the sensitivity of the RT-PCR for detection of CDV is strongly influenced by the location of the selected primers, this nucleic acid detection system represents a highly specific and sensitive method for the antemortem diagnosis of distemper in dogs, regardless of the form of distemper, humoral immune response, and viral antigen distribution. PMID:10523566

Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus

DEFF Research Database (Denmark)

Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter

2009-01-01

The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper...

The V protein of canine distemper virus is required for virus replication in human epithelial cells.

Directory of Open Access Journals (Sweden)

Noriyuki Otsuki

Full Text Available Canine distemper virus (CDV becomes able to use human receptors through a single amino acid substitution in the H protein. In addition, CDV strains possessing an intact C protein replicate well in human epithelial H358 cells. The present study showed that CDV strain 007Lm, which was isolated from lymph node tissue of a dog with distemper, failed to replicate in H358 cells, although it possessed an intact C protein. Sequence analyses suggested that a cysteine-to-tyrosine substitution at position 267 of the V protein caused this growth defect. Analyses using H358 cells constitutively expressing the CDV V protein showed that the V protein with a cysteine, but not that with a tyrosine, at this position effectively blocked the interferon-stimulated signal transduction pathway, and supported virus replication of 007Lm in H358 cells. Thus, the V protein as well as the C protein appears to be functional and essential for CDV replication in human epithelial cells.

Genetic variant of canine distemper virus from clinical cases in ...

African Journals Online (AJOL)

Canine distemper virus (CDV) is a highly contagious viral pathogen of worldwide distribution that can cause lethal disease in domestic dogs and other members of the family Canidae. Genetic diversity is found among reference strains and isolates of CDV, mainly in the haemagglutinin (H) protein, and this may be ...

Recombinant canine distemper virus strain Snyder Hill expressing green or red fluorescent proteins causes meningoencephalitis in the ferret.

Science.gov (United States)

Ludlow, M; Nguyen, D T; Silin, D; Lyubomska, O; de Vries, R D; von Messling, V; McQuaid, S; De Swart, R L; Duprex, W P

2012-07-01

The propensity of canine distemper virus (CDV) to spread to the central nervous system is one of the primary features of distemper. Therefore, we developed a reverse genetics system based on the neurovirulent Snyder Hill (SH) strain of CDV (CDV(SH)) and show that this virus rapidly circumvents the blood-brain and blood-cerebrospinal fluid (CSF) barriers to spread into the subarachnoid space to induce dramatic viral meningoencephalitis. The use of recombinant CDV(SH) (rCDV(SH)) expressing enhanced green fluorescent protein (EGFP) or red fluorescent protein (dTomato) facilitated the sensitive pathological assessment of routes of virus spread in vivo. Infection of ferrets with these viruses led to the full spectrum of clinical signs typically associated with distemper in dogs during a rapid, fatal disease course of approximately 2 weeks. Comparison with the ferret-adapted CDV(5804P) and the prototypic wild-type CDV(R252) showed that hematogenous infection of the choroid plexus is not a significant route of virus spread into the CSF. Instead, viral spread into the subarachnoid space in rCDV(SH)-infected animals was triggered by infection of vascular endothelial cells and the hematogenous spread of virus-infected leukocytes from meningeal blood vessels into the subarachnoid space. This resulted in widespread infection of cells of the pia and arachnoid mater of the leptomeninges over large areas of the cerebral hemispheres. The ability to sensitively assess the in vivo spread of a neurovirulent strain of CDV provides a novel model system to study the mechanisms of virus spread into the CSF and the pathogenesis of acute viral meningitis.

Inactivated Recombinant Rabies Viruses Displaying Canine Distemper Virus Glycoproteins Induce Protective Immunity against Both Pathogens

OpenAIRE

da Fontoura Budaszewski, Renata; Hudacek, Andrew; Sawatsky, Bevan; Krämer, Beate; Yin, Xiangping; Schnell, Matthias J.; von Messling, Veronika

2017-01-01

The development of multivalent vaccines is an attractive methodology for the simultaneous prevention of several infectious diseases in vulnerable populations. Both canine distemper virus (CDV) and rabies virus (RABV) cause lethal disease in wild and domestic carnivores. While RABV vaccines are inactivated, the live-attenuated CDV vaccines retain residual virulence for highly susceptible wildlife species. In this study, we developed recombinant bivalent vaccine candidates based on recombinant ...

Detection of intracellular canine distemper virus antigen in mink inoculated with an attenuated or a virulent strain of canine distemper virus.

Science.gov (United States)

Blixenkrone-Møller, M

1989-09-01

Using an indirect immunofluorescence technique, the distribution of viral antigen in various tissues and blood mononuclear leukocytes was studied in wild mink, either vaccinated with an attenuated vaccine strain of canine distemper virus (CDV) or experimentally inoculated with the virulent Snyder-Hill strain of CDV. Viral antigen was detected in cells of the lymphoid system 6 to 12 days after vaccination. From 2 to 3 days after inoculation with the virulent strain, CDV antigen was demonstrated in cells of the lymphoid system and, during the incubation period, the antigen had spread to the epithelia and brain at days 6 and 12, respectively. In clinical cases of acute fatal canine distemper, the viral antigen was detected in a wide variety of tissues, including the cells of the lymphoid system, epithelial cells of skin, mucous membranes, lung, kidney, and cells of the CNS. The diagnostic importance of CDV antigen detection is discussed on the basis of these findings.

Canine distemper virus induces apoptosis in cervical tumor derived cell lines

Directory of Open Access Journals (Sweden)

Rajão Daniela S

2011-06-01

Full Text Available Abstract Apoptosis can be induced or inhibited by viral proteins, it can form part of the host defense against virus infection, or it can be a mechanism for viral spread to neighboring cells. Canine distemper virus (CDV induces apoptotic cells in lymphoid tissues and in the cerebellum of dogs naturally infected. CDV also produces a cytopathologic effect, leading to apoptosis in Vero cells in tissue culture. We tested canine distemper virus, a member of the Paramyxoviridae family, for the ability to trigger apoptosis in HeLa cells, derived from cervical cancer cells resistant to apoptosis. To study the effect of CDV infection in HeLa cells, we examined apoptotic markers 24 h post infection (pi, by flow cytometry assay for DNA fragmentation, real-time PCR assay for caspase-3 and caspase-8 mRNA expression, and by caspase-3 and -8 immunocytochemistry. Flow cytometry showed that DNA fragmentation was induced in HeLa cells infected by CDV, and immunocytochemistry revealed a significant increase in the levels of the cleaved active form of caspase-3 protein, but did not show any difference in expression of caspase-8, indicating an intrinsic apoptotic pathway. Confirming this observation, expression of caspase-3 mRNA was higher in CDV infected HeLa cells than control cells; however, there was no statistically significant change in caspase-8 mRNA expression profile. Our data suggest that canine distemper virus induced apoptosis in HeLa cells, triggering apoptosis by the intrinsic pathway, with no participation of the initiator caspase -8 from the extrinsic pathway. In conclusion, the cellular stress caused by CDV infection of HeLa cells, leading to apoptosis, can be used as a tool in future research for cervical cancer treatment and control.

Identification of a new genotype of canine distemper virus circulating in America.

Science.gov (United States)

Gámiz, César; Martella, Vito; Ulloa, Raúl; Fajardo, Raúl; Quijano-Hernandéz, Israel; Martínez, Simón

2011-08-01

Canine Distemper is a highly contagious viral systemic disease that affects a wide variety of terrestrial carnivores. Canine Distemper virus (CDV) appears genetically heterogeneous, markedly in the hemagglutinin protein (H), showing geographic patterns of diversification that are useful to monitor CDV molecular epidemiology. In Mexico the activity of canine distemper remains high in dogs, likely because vaccine prophylaxis coverage in canine population is under the levels required to control effectively the disease. By phylogenetic analysis based on the nucleoprotein (N) and on the H genes, Mexican CDV strains collected between 2007 and 2010 were distinguished into several genovariants, all which constituted a unique group, clearly distinct from field and vaccine strains circulating worldwide, but resembling a CDV strain, 19876, identified in Missouri, USA, 2004, that was genetically unrelated to other North-American CDV strains. Gathering information on the genetic heterogeneity of CDV on a global scale appears pivotal in order to investigate the origin and modalities of introduction of unusual/novel CDV strains, as well as to understand if vaccine breakthroughs or disease epidemics may be somewhat related to genetic/antigenic or biological differences between field and vaccine strains.

Characterization of a novel Canine distemper virus causing disease in wildlife.

Science.gov (United States)

Pope, Jenny P; Miller, Debra L; Riley, Matthew C; Anis, Eman; Wilkes, Rebecca P

2016-09-01

Canine distemper virus (CDV) is a common cause of a multisystemic disease in both domestic dogs and wildlife species, including raccoons and foxes. Outbreaks of CDV in domestic dogs in eastern Tennessee have occurred since 2012, and it was determined that these outbreaks resulted from a novel genotype of CDV. We hypothesized that this virus is also infecting area wildlife and may be a source of the virus for these outbreaks in dogs. From 2013 to 2014, autopsies were performed and tissues collected from raccoons (Procyon lotor; n = 50) and gray foxes (Urocyon cinereoargenteus; n = 8) for CDV testing. A real-time reverse transcription PCR was used to document the presence of CDV in tissue samples, and a portion of the virus was subsequently sequenced for phylogenetic analysis. A high percentage of wildlife, both with (86%) and without (55%) clinical signs, tested positive for CDV, with the majority (77%) testing positive for the novel genotype. Microscopic findings, including syncytia in the lungs and viral inclusion bodies in urothelium, astrocytes, neurons, and bronchiolar epithelium, were also consistent with canine distemper. Minimal inflammation in the central nervous system of affected animals was indicative of the acute neurologic form of the disease. Pneumonia and parasitism were also commonly found in CDV-infected animals. Based on these results, CDV appears to be prevalent in eastern Tennessee wildlife. Subclinical or clinically recovered shedders are a potential source of this novel genotype for domestic dogs, and this genotype is genetically distinct from vaccine strains. © 2016 The Author(s).

Early life DNA vaccination with the H gene of Canine distemper virus induces robust protection against distemper

DEFF Research Database (Denmark)

Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent

2009-01-01

Young mink kits (n = 8)were vaccinated withDNA plasmids encoding the viral haemagglutinin protein (H) of a vaccine strain of Canine distemper virus (CDV). Virus neutralising (VN) antibodieswere induced after 2 immunisations and after the third immunisation all kits had high VN antibody titres...

Epizootic canine distemper virus infection among wild mammals.

Science.gov (United States)

Kameo, Yuki; Nagao, Yumiko; Nishio, Yohei; Shimoda, Hiroshi; Nakano, Hitoshi; Suzuki, Kazuo; Une, Yumi; Sato, Hiroshi; Shimojima, Masayuki; Maeda, Ken

2012-01-27

In the spring of 2007, seven raccoon dogs and a weasel were captured near the city of Tanabe in Wakayama prefecture, Japan. The causative agent of the animals' death 1-2 days after capture was identified as canine distemper virus (CDV) by virus isolation, immunostaining with an anti-CDV polyclonal antibody, and a commercially available CDV antigen-detection kit. Sequence analysis of hemagglutinin genes indicated the isolated viruses belong to genotype Asia-1 and possess the substitution from tyrosine (Y) to histidine (H) at position 549 that is associated with the spread of CDV to non-canine hosts. A serosurvey for CDV was then conducted among wild animals in the region. The animals assayed consisted of 104 raccoons, 41 wild boars, 19 raccoon dogs, five Sika deer, two badgers, one weasel, one marten, one Siberian weasel and one fox. Virus-neutralization (VN) tests showed that, except for fox and weasel, all of the species assayed had VN antibodies to CDV. Interestingly, 11 of the 41 wild boars (27%) and two of the five Sika deer assayed possessed VN antibodies to CDV. These findings indicate that CDV infection was widespread among wild mammals during this epizootic. Copyright © 2011 Elsevier B.V. All rights reserved.

Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

Science.gov (United States)

Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

2013-09-27

Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA

Science.gov (United States)

Lednicky, John A; Dubach, Jean; Kinsel, Michael J; Meehan, Thomas P; Bocchetta, Maurizio; Hungerford, Laura L; Sarich, Nicolene A; Witecki, Kelley E; Braid, Michael D; Pedrak, Casandra; Houde, Christiane M

2004-01-01

Background Mortality rates have differed during distemper outbreaks among free-ranging raccoons (Procyon lotor) living around a large Chicago-area zoo, and appeared higher in year 2001 than in 1998 and 2000. We hypothesized that a more lethal variant of the local Canine distemper virus (CDV) lineage had emerged in 2001, and sought the genetic basis that led to increased virulence. However, a more complex model surfaced during preliminary analyses of CDV genomic sequences in infected tissues and of virus isolated in vitro from the raccoons. Results Phylogenetic analyses of subgenomic CDV fusion (F) -, phosphoprotein (P) -, and complete hemagglutinin (H) – gene sequences indicated that distinct American CDV lineages caused the distemper epizootics. The 1998 outbreak was caused by viruses that are likely from an old CDV lineage that includes CDV Snyder Hill and Lederle, which are CDV strains from the early 1950's. The 2000 and 2001 viruses appear to stem from the lineage of CDV A75/17, which was isolated in the mid 1970's. Only the 2001 viruses formed large syncytia in brain and/or lung tissue, and during primary isolation in-vitro in Vero cells, demonstrating at least one phenotypic property by which they differed from the other viruses. Conclusions Two different American CDV lineages caused the raccoon distemper outbreaks. The 1998 viruses are genetically distant to the 2000/2001 viruses. Since CDV does not cause persistent infections, the cycling of different CDV lineages within the same locale suggests multiple reintroductions of the virus to area raccoons. Our findings establish a precedent for determining whether the perceived differences in mortality rates are actual and attributable in part to inherent differences between CDV strains arising from different CDV lineages. PMID:15507154

Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA

Directory of Open Access Journals (Sweden)

Lednicky John A

2004-09-01

Full Text Available Abstract Background Mortality rates have differed during distemper outbreaks among free-ranging raccoons (Procyon lotor living around a large Chicago-area zoo, and appeared higher in year 2001 than in 1998 and 2000. We hypothesized that a more lethal variant of the local Canine distemper virus (CDV lineage had emerged in 2001, and sought the genetic basis that led to increased virulence. However, a more complex model surfaced during preliminary analyses of CDV genomic sequences in infected tissues and of virus isolated in vitro from the raccoons. Results Phylogenetic analyses of subgenomic CDV fusion (F -, phosphoprotein (P -, and complete hemagglutinin (H – gene sequences indicated that distinct American CDV lineages caused the distemper epizootics. The 1998 outbreak was caused by viruses that are likely from an old CDV lineage that includes CDV Snyder Hill and Lederle, which are CDV strains from the early 1950's. The 2000 and 2001 viruses appear to stem from the lineage of CDV A75/17, which was isolated in the mid 1970's. Only the 2001 viruses formed large syncytia in brain and/or lung tissue, and during primary isolation in-vitro in Vero cells, demonstrating at least one phenotypic property by which they differed from the other viruses. Conclusions Two different American CDV lineages caused the raccoon distemper outbreaks. The 1998 viruses are genetically distant to the 2000/2001 viruses. Since CDV does not cause persistent infections, the cycling of different CDV lineages within the same locale suggests multiple reintroductions of the virus to area raccoons. Our findings establish a precedent for determining whether the perceived differences in mortality rates are actual and attributable in part to inherent differences between CDV strains arising from different CDV lineages.

Influence of vaccine strains on the evolution of canine distemper virus.

Science.gov (United States)

da Fontoura Budaszewski, Renata; Streck, André Felipe; Nunes Weber, Matheus; Maboni Siqueira, Franciele; Muniz Guedes, Rafael Lucas; Wageck Canal, Cláudio

2016-07-01

Canine distemper virus (CDV) is a major dog pathogen belonging to the genus Morbillivirus of the family Paramyxoviridae. CDV causes disease and high mortality in dogs and wild carnivores. Although homologous recombination has been demonstrated in many members of Paramyxoviridae, these events have rarely been reported for CDV. To detect potential recombination events, the complete CDV genomes available in GenBank up to June 2015 were screened using distinct algorithms to detect genetic conversions and incongruent phylogenies. Eight putative recombinant viruses derived from different CDV genotypes and different hosts were detected. The breakpoints of the recombinant strains were primarily located on fusion and hemagglutinin glycoproteins. These results suggest that homologous recombination is a frequent phenomenon in morbillivirus populations under natural replication, and CDV vaccine strains might play an important role in shaping the evolution of this virus.

Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction.

Science.gov (United States)

Wilkes, Rebecca P; Tsai, Yun-Long; Lee, Pei-Yu; Lee, Fu-Chun; Chang, Hsiao-Fen Grace; Wang, Hwa-Tang Thomas

2014-09-09

Canine distemper virus (CDV) has been associated with outbreaks of canine infectious respiratory disease in shelters and boarding kennel environments. POCKITTM Nucleic Acid Analyzer is a field-deployable device capable of generating automatically interpreted insulated isothermal polymerase chain reaction (iiPCR) results from extracted nucleic acid within one hour. In this study, reverse transcription iiPCR (RT-iiPCR) was developed to facilitate point-of-need diagnosis of CDV infection. Analytical sensitivity (limit of detection 95%) of the established CDV RT-iiPCR was about 11 copies of in vitro transcribed RNA per reaction. CDV RT-iiPCR generated positive signals from CDV, but not Bordetella bronchiseptica, canine parvovirus, canine herpesvirus, canine adenovirus 2, canine influenza virus (subtype H3N8), canine parainfluenza virus, and canine respiratory coronavirus. To evaluate accuracy of the established reaction in canine distemper clinical diagnosis, 110 specimens from dogs, raccoons, and foxes suspected with CDV infection were tested simultaneously by CDV RT-iiPCR and real-time RT-PCR. CDV RT-iiPCR demonstrated excellent sensitivity (100%) and specificity (100%), compared to real-time RT-PCR. The results indicated an excellent correlation between RT-iiPCR and a reference real time RT-PCR method. Working in a lyophilized format, the established method has great potential to be used for point-of-care diagnosis of canine distemper in animals, especially in resource-limited facilities.

Fatal canine distemper virus infection of giant pandas in China.

Science.gov (United States)

Feng, Na; Yu, Yicong; Wang, Tiecheng; Wilker, Peter; Wang, Jianzhong; Li, Yuanguo; Sun, Zhe; Gao, Yuwei; Xia, Xianzhu

2016-06-16

We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possessed the substitutions V26M, T213A, K281R, S300N, P340Q, and Y549H. The presence of the Y549H substitution is notable as it is found at the signaling lymphocytic activation molecule (SLAM) receptor-binding site and has been implicated in the emergence of highly pathogenic CDV and host switching. These findings demonstrate that giant pandas are susceptible to CDV and suggest that surveillance and vaccination among all captive giant pandas are warranted to support conservation efforts for this endangered species.

Occurrence of different Canine distemper virus lineages in Italian dogs.

Science.gov (United States)

Balboni, Andrea; De Lorenzo Dandola, Giorgia; Scagliarini, Alessandra; Prosperi, Santino; Battilani, Mara

2014-01-01

This study describes the sequence analysis of the H gene of 7 Canine distemper virus (CDV) strains identified in dogs in Italy between years 2002-2012. The phylogenetic analysis showed that the CDV strains belonged to 2 clusters: 6 viruses were identified as Arctic-like lineage and 1 as Europe 1 lineage. These data show a considerable prevalence of Arctic-like-CDVs in the analysed dogs. The dogs and the 3 viruses more recently identified showed 4 distinctive amino acid mutations compared to all other Arctic CDVs.

Morbillivirus Experimental Animal Models: Measles Virus Pathogenesis Insights from Canine Distemper Virus.

Science.gov (United States)

da Fontoura Budaszewski, Renata; von Messling, Veronika

2016-10-11

Morbilliviruses share considerable structural and functional similarities. Even though disease severity varies among the respective host species, the underlying pathogenesis and the clinical signs are comparable. Thus, insights gained with one morbillivirus often apply to the other members of the genus. Since the Canine distemper virus (CDV) causes severe and often lethal disease in dogs and ferrets, it is an attractive model to characterize morbillivirus pathogenesis mechanisms and to evaluate the efficacy of new prophylactic and therapeutic approaches. This review compares the cellular tropism, pathogenesis, mechanisms of persistence and immunosuppression of the Measles virus (MeV) and CDV. It then summarizes the contributions made by studies on the CDV in dogs and ferrets to our understanding of MeV pathogenesis and to vaccine and drugs development.

Humoral and cell-mediated immune responses in DNA immunized mink challenged with wild-type canine distemper virus.

Science.gov (United States)

Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete

2009-07-30

The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.

Epidemiology of canine distemper virus in wild raccoon dogs (Nyctereutes procyonoides) from South Korea.

Science.gov (United States)

Cha, Se-Yeoun; Kim, Eun-Ju; Kang, Min; Jang, Sang-Ho; Lee, Hae-Beom; Jang, Hyung-Kwan

2012-09-01

Raccoon dogs (Nyctereutes procyonoides) are widespread and common in South Korea. In 2011, we obtained serum samples from 102 wild raccoon dogs to survey their exposure to canine distemper virus (CDV). Forty-five of the 102 animals (44.1%) were seropositive. Field cases of canine distemper in wild raccoon dogs from 2010 to 2011 were investigated. Fourteen cases of CDV infection were identified by a commercially available CDV antigen detection kit. These cases were used for virus isolation and molecular analysis. Sequence analysis of hemagglutinin genes indicated that all viruses isolated belonged to the Asia-2 genotype. H protein residues which are related to the receptor and host specificity (residues 530 and 549) were analyzed. A glutamic acid (E) residue is present at 530 in all isolates. At 549, a histidine (H) residue was found in five isolates and tyrosine (Y) residue was found in 6 isolates. Our study demonstrated that CDV infection was widespread in wild raccoon dogs in South Korea. Copyright © 2012 Elsevier Ltd. All rights reserved.

6-methylmercaptopurine riboside, a thiopurine nucleoside with antiviral activity against canine distemper virus in vitro.

Science.gov (United States)

de Carvalho, Otávio Valério; Félix, Daniele Mendes; de Camargo Tozato, Claudia; Fietto, Juliana Lopes Rangel; de Almeida, Márcia Rogéria; Bressan, Gustavo Costa; Pena, Lindomar José; Silva-Júnior, Abelardo

2017-06-26

Canine distemper (CD) is a widespread infectious disease that can severely impact a variety of species in the order Carnivora, as well as non-carnivore species such as non-human primates. Despite large-scale vaccination campaigns, several fatal outbreaks have been reported in wild and domestic carnivore populations. This, in association with expansion of the disease host range and the development of vaccine-escape strains, has contributed to an increased demand for therapeutic strategies synergizing with vaccine programs for effectively controlling canine distemper. 6-methylmercaptopurine riboside (6MMPr) is a modified thiopurine nucleoside with known antiviral properties against certain RNA viruses. We tested the inhibitory effects of 6MMPr against a wild-type CDV strain infection in cell culture. We measured infectious particle production and viral RNA levels in treated and untreated CDV-infected cells. Ribavirin (RIB) was used as a positive control. Here, we report for the first time the antiviral effects of 6MMPr against canine distemper virus (CDV) in vitro. 6MMPr was able to reduce viral RNA levels and to inhibit the production of infectious CDV particles. The therapeutic selectivity of 6MMPr was approximately six times higher than that of ribavirin. Our results indicate that 6MMPr has high anti-CDV potential and warrants further testing against other paramyxoviruses, as well as clinical testing of the compound against CDV.

Isolation and phylogenetic characterization of Canine distemper virus from India.

Science.gov (United States)

Swati; Deka, Dipak; Uppal, Sanjeev Kumar; Verma, Ramneek

2015-09-01

Canine distemper (CD), caused by canine distemper virus (CDV) is a highly contagious disease that infects a variety of carnivores. Sequence analysis of CDVs from different geographical areas has shown a lot of variation in the genome of the virus especially in haemagglutinin gene which might be one of the causes of vaccine failure. In this study, we isolated the virus (place: Ludhiana, Punjab; year: 2014) and further cloned, sequenced and analyzed partial haemagglutinin (H) gene and full length genes for fusion protein (F), phosphoprotein (P) and matrix protein (M) from an Indian wild-type CDV. Higher sequence homology was observed with the strains from Switzerland, Hungary, Germany; and lower with the vaccine strains like Ondersteport, CDV3, Convac for all the genes. The multiple sequence alignment showed more variation in partial H (45 nucleotide and 5 amino acid substitutions) and complete F (79 nucleotide and 30 amino acid substitutions) than in complete P (44 nucleotide and 22 amino acid substitutions) and complete M (22 nucleotide and 4 amino acid substitutions) gene/protein. Predicted potential N-linked glycosylation sites in H, F, M and P proteins were similar to the previously known wild-type CDVs but different from the vaccine strains. The Indian CDV formed a distinct clade in the phylogenetic tree clearly separated from the previously known wild-type and vaccine strains.

Canine distemper virus - a morbillivirus in search of new hosts?

NARCIS (Netherlands)

T.C. Harder (Timm); A.D.M.E. Osterhaus (Albert)

1997-01-01

textabstractCanine distemper morbillivirus (CDV) induces a multisystemic, often fatal disease in a wide and seemingly expanding host range among the Carnivora. Several genotypes of an otherwise monotypic virus species co-circulate in a geographically restricted pattern. Interspecies transmissions

Fatal canine distemper virus infection of giant pandas in China

Science.gov (United States)

Feng, Na; Yu, Yicong; Wang, Tiecheng; Wilker, Peter; Wang, Jianzhong; Li, Yuanguo; Sun, Zhe; Gao, Yuwei; Xia, Xianzhu

2016-01-01

We report an outbreak of canine distemper virus (CDV) infection among endangered giant pandas (Ailuropoda melanoleuca). Five of six CDV infected giant pandas died. The surviving giant panda was previously vaccinated against CDV. Genomic sequencing of CDV isolated from one of the infected pandas (giant panda/SX/2014) suggests it belongs to the Asia-1 cluster. The hemagglutinin protein of the isolated virus and virus sequenced from lung samples originating from deceased giant pandas all possessed the substitutions V26M, T213A, K281R, S300N, P340Q, and Y549H. The presence of the Y549H substitution is notable as it is found at the signaling lymphocytic activation molecule (SLAM) receptor-binding site and has been implicated in the emergence of highly pathogenic CDV and host switching. These findings demonstrate that giant pandas are susceptible to CDV and suggest that surveillance and vaccination among all captive giant pandas are warranted to support conservation efforts for this endangered species. PMID:27310722

Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies.

Science.gov (United States)

Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent; Pertoldi, Cino; Blixenkrone-Møller, Merete

2015-03-10

Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits with CDV DNA vaccines. Virus neutralising (VN) antibody responses were induced in mink kits vaccinated with a plasmid encoding the haemaglutinin protein (H) of CDV (n=5, pCDV-H) or a combination of the H, fusion (F) and nucleoprotein (N) of CDV (n=5, pCDV-HFN). These DNA vaccinated kits were protected against virulent experimental infection with field strains of CDV. The pCDV-H was more efficient in inducing protective immunity in the presence of maternal antibodies compared to the pCDV-HFN. The results show that DNA vaccination with the pCDV-H or pCDV-HFN (n=4) only given once at 5 days of age induces virus specific immune response in neonatal mink and protection against virulent CDV exposure later in life. Copyright © 2015 Elsevier Ltd. All rights reserved.

A canine distemper model of virus-induced anergy.

Science.gov (United States)

Mangi, R J; Munyer, T P; Krakowka, S; Jacoby, R O; Kantor, F S

1976-05-01

For development of an animal model of virus-induced anergy, the effect of canine distemper virus (CDV) upon cell-mediated immunity in dogs was investigated. First, canine cutaneous reactions and in vitro lymphocyte responses to soluble protein antigens were characterized. Dogs immunized with picryl guinea pig albumin and with keyhole limpet hemocyanin (both in complete Freund's adjuvant) responded reproducibly to intracutaneous challenge with these antigens. Reactivity peaked in 20-40 days (maximal induration, 6-50 mm). Lymphocytes from these animals responded in vitro to stimulation with keyhole limpet hemocyanin or purified protein derivative. This stimulation was antigen-specific and was maximal on day 6 of culture. Infection with CDV depressed cutaneous reactivity and lymphocyte response in vitro to antigens and mitogens. This effect was transient in animals previously vaccinated with attenuated CDV; however, gnotobiotic puppies (susceptible to CDV) had prolonged depression of cell-mediated immunity and lymphopenia. Some of these animals developed neurologic symptoms and died. The findings indicate that CDV infection is a potentially useful model for study of virus-induced depression of T (thymus)-cell responses and support the hypothesis that there is more than one mechanism responsible for this phenomenon.

Rapid and sensitive detection of canine distemper virus by real-time reverse transcription recombinase polymerase amplification.

Science.gov (United States)

Wang, Jianchang; Wang, Jinfeng; Li, Ruiwen; Liu, Libing; Yuan, Wanzhe

2017-08-15

Canine distemper, caused by Canine distemper virus (CDV), is a highly contagious and fatal systemic disease in free-living and captive carnivores worldwide. Recombinase polymerase amplification (RPA), as an isothermal gene amplification technique, has been explored for the molecular detection of diverse pathogens. A real-time reverse transcription RPA (RT-RPA) assay for the detection of canine distemper virus (CDV) using primers and exo probe targeting the CDV nucleocapsid protein gene was developed. A series of other viruses were tested by the RT-RPA.Thirty-two field samples were further tested by RT-RPA, and the resuts were compared with those obtained by the real-time RT-PCR. The RT-RPA assay was performed successfully at 40 °C, and the results were obtained within 3 min-12 min. The assay could detect CDV, but did not show cross-detection of canine parvovirus-2 (CPV-2), canine coronavirus (CCoV), canine parainfluenza virus (CPIV), pseudorabies virus (PRV) or Newcastle disease virus (NDV), demonstrating high specificity. The analytical sensitivity of RT-RPA was 31.8 copies in vitro transcribed CDV RNA, which is 10 times lower than the real-time RT-PCR. The assay performance was validated by testing 32 field samples and compared to real-time RT-PCR. The results indicated an excellent correlation between RT-RPA and a reference real-time RT-PCR method. Both assays provided the same results, and R 2 value of the positive results was 0.947. The results demonstrated that the RT-RPA assay offers an alternative tool for simple, rapid, and reliable detection of CDV both in the laboratory and point-of-care facility, especially in the resource-limited settings.

Detection of Arctic and European cluster of canine distemper virus in north and center of Iran.

Science.gov (United States)

Namroodi, Somayeh; Rostami, Amir; Majidzadeh-Ardebili, Keyvan; Ghalyanchi Langroudi, Arash; Morovvati, Abbas

2015-01-01

Canine distemper virus (CDV) creates a very contagious viral multi-systemic canine distemper (CD) disease that affects most species of Carnivora order. The virus is genetically heterogeneous, particularly in section of the hemagglutinin (H) gene. Sequence analysis of the H gene can be useful to investigate distinction of various lineages related to geographical distribution and CDV molecular epidemiology. Since vaccination program is conducted only in large cities of Iran, CD still remains as one of the major causes of death in dogs in this country. In order to monitor H gene, CDV has been detected in 14 out of 19 sampled dogs through the amplification of nucleoprotein (NP) gene in nested-PCR assay. In the next step 665 bp of H gene was amplified in 9 out of 14 NP-gene positive dogs. Phylogenetic analysis distinguished two distinct CDV genotypes in Iran. JN941238 has been embedded in European cluster and JN941239 has been embedded in Arctic cluster. Nucleic analysis has been shown high difference among both Iranian CDV lineages with CDV vaccine strains.

The humoral immune response to recombinant nucleocapsid antigen of canine distemper virus in dogs vaccinated with attenuated distemper virus or DNA encoding the nucleocapsid of wild-type virus.

Science.gov (United States)

Griot-Wenk, M E; Cherpillod, P; Koch, A; Zurbriggen, R; Bruckner, L; Wittek, R; Zurbriggen, A

2001-06-01

This study compared the humoral immune response against the nucleocapsid-(N) protein of canine distemper virus (CDV) of dogs vaccinated with a multivalent vaccine against parvo-, adeno-, and parainfluenza virus and leptospira combined with either the attenuated CDV Onderstepoort strain (n = 15) or an expression plasmid containing the N-gene of CDV (n = 30). The vaccinations were applied intramuscularly three times at 2-week intervals beginning at the age of 6 weeks. None of the pre-immune sera recognized the recombinant N-protein, confirming the lack of maternal antibodies at this age. Immunization with DNA vaccine for CDV resulted in positive serum N-specific IgG response. However, their IgG (and IgA) titres were lower than those of CDV-vaccinated dogs. Likewise, DNA-vaccinated dogs did not show an IgM peak. There was no increase in N-specific serum IgE titres in either group. Serum titres to the other multivalent vaccine components were similar in both groups.

Distemper virus encephalitis exerts detrimental effects on hippocampal neurogenesis.

Science.gov (United States)

von Rüden, E-L; Avemary, J; Zellinger, C; Algermissen, D; Bock, P; Beineke, A; Baumgärtner, W; Stein, V M; Tipold, A; Potschka, H

2012-08-01

Despite knowledge about the impact of brain inflammation on hippocampal neurogenesis, data on the influence of virus encephalitis on dentate granule cell neurogenesis are so far limited. Canine distemper is considered an interesting model of virus encephalitis, which can be associated with a chronic progressing disease course and can cause symptomatic seizures. To determine the impact of canine distemper virus (CDV) infection on hippocampal neurogenesis, we compared post-mortem tissue from dogs with infection with and without seizures, from epileptic dogs with non-viral aetiology and from dogs without central nervous system diseases. The majority of animals with infection and with epilepsy of non-viral aetiology exhibited neuronal progenitor numbers below the age average in controls. Virus infection with and without seizures significantly decreased the mean number of neuronal progenitor cells by 43% and 76% as compared to age-matched controls. Ki-67 labelling demonstrated that hippocampal cell proliferation was neither affected by infection nor by epilepsy of non-viral aetiology. Analysis of CDV infection in cells expressing caspase-3, doublecortin or Ki-67 indicated that infection of neuronal progenitor cells is extremely rare and suggests that infection might damage non-differentiated progenitor cells, hamper neuronal differentiation and promote glial differentiation. A high inter-individual variance in the number of lectin-reactive microglial cells was evident in dogs with distemper infection. Statistical analyses did not reveal a correlation between the number of lectin-reactive microglia cells and neuronal progenitor cells. Our data demonstrate that virus encephalitis with and without seizures can exert detrimental effects on hippocampal neurogenesis, which might contribute to long-term consequences of the disease. The lack of a significant impact of distemper virus on Ki-67-labelled cells indicates that the infection affected neuronal differentiation and

Short communication. Occurrence of different Canine distemper virus lineages in Italian dogs

Directory of Open Access Journals (Sweden)

Andrea Balboni

2014-09-01

Full Text Available This study describes the sequence analysis of the H gene of 7 Canine distemper virus (CDV strains identified in dogs in Italy between years 2002-2012. The phylogenetic analysis showed that the CDV strains belonged to 2 clusters: 6 viruses were identified as Arctic‑like lineage and 1 as Europe 1 lineage. These data show a considerable prevalence of Arctic‑like‑CDVs in the analysed dogs. The dogs and the 3 viruses more recently identified showed 4 distinctive amino acid mutations compared to all other Arctic CDVs.

SEROLOGIC RESPONSE TO CANINE DISTEMPER VACCINATION IN CAPTIVE LINNAEUS'S TWO-TOED SLOTHS ( CHOLOEPUS DIDACTYLUS) AFTER A FATAL CANINE DISTEMPER VIRUS OUTBREAK.

Science.gov (United States)

Sheldon, Julie D; Cushing, Andrew C; Wilkes, Rebecca P; Anis, Eman; Dubovi, Edward J

2017-12-01

Canine distemper virus (CDV) affects many wild and captive, nondomestic species worldwide but has not been previously reported in Xenarthra. Paucity of information on vaccination safety and efficacy presents challenges for disease prevention in captive collections. CDV infections and subsequent mortalities in five captive Linnaeus's two-toed sloths ( Choloepus didactylus) in eastern Tennessee are reported. Clinical signs included oculonasal discharge, oral ulcerations, and diarrhea, and the diagnosis was confirmed by necropsy, histopathology, immunohistochemistry, virus isolation, and polymerase chain reaction. Viral sequencing identified the strain to be consistent with a new CDV lineage currently affecting domestic dogs and wildlife in Tennessee. Seven sloths were examined and vaccinated using a recombinant CDV vaccine on days 0 and 21. Subsequent blood samples showed increased titers in 3/4 sloths. Based on the outbreak and serologic findings postvaccination without adverse effects, the authors recommend recombinant CDV vaccination in sloths exposed to known carriers of CDV.

Prevalence of positive antibody test results for canine parvovirus (CPV) and canine distemper virus (CDV) and response to modified live vaccination against CPV and CDV in dogs entering animal shelters.

Science.gov (United States)

Litster, Annette; Nichols, Jamieson; Volpe, Allison

2012-05-25

Canine parvovirus (CPV) and canine distemper virus (CDV) infections are relatively common in animal shelters and are important population management issues since the immune status of incoming dogs is usually unknown. This study aimed to determine the prevalence of positive antibody test results for CPV and CDV in incoming dogs aged ≥ 4 months and to measure antibody response over 2 weeks following vaccination with a modified live vaccine (MLV). Dogs aged 4-24 months entering an adoption-guarantee shelter (Shelter 1, n=51) and aged ≥ 4 months entering a limited admission shelter (Shelter 2; n=51) were enrolled. Dogs from Shelter 1 had been vaccinated with MLV at a municipal shelter 5 days before enrollment, whereas dogs from Shelter 2 had no known history of vaccination at enrollment. Sera were obtained on day 1, immediately prior to CPV/CDV MLV, and tested using an in-clinic ELISA kit to detect CPV/CDV antibodies. Dogs negative for CPV and/or CDV were retested at day 6-8 and those dogs still negative at day 6-8 were retested at day 13-15. Prior to CPV/CDV MLV on day 1, more dogs tested positive for CPV (Shelter 1 - 68.6%; Shelter 2 - 84.3%) than for CDV (Shelter 1 - 37.3%; Shelter 2 - 41.2%). On day 1, prior to MLV, all spayed/neutered animals tested CPV antibody-positive (n=17/102) and CPV antibody-positive dogs were older than serologically negative dogs (Shelter 1, P=0.0029; Shelter 2, P=0.0042). By day 13-15, almost all dogs were CPV antibody-positive (Shelter 1 - 97.9%; Shelter 2 - 100.0%) and CDV antibody-positive (Shelter 1 - 93.8%; Shelter 2 - 97.8%). MLV induces protective antibody titers against CPV/CDV in almost all dogs after 13-15 days. Copyright © 2011 Elsevier B.V. All rights reserved.

Characterization of a new dog isolate of canine distemper virus from China.

Science.gov (United States)

Qiao, J; Meng, Q; Chen, C; Xia, X; Cai, X; Ren, Y; Zhang, H

2011-01-01

Canine distemper virus (CDV) is a highly contagious pathogen of dogs. Vaccination is an effective way to protect dogs from CDV infection, but occasionally fails. In the present study, a wild type (wt) CDV, named XJ2, was isolated from a dead vaccinated dog. The hemagglutinin (H) gene of the XJ2 was amplified and analyzed for the molecular characteristics including N-glycosylation sites, phylogenesis, hydrophobicity and epitopes. The data indicated that XJ2 was a genetic variant strain of CDV. CDV-sero-negative dogs were inoculated intranasally with XJ2, developed severe clinical symptoms and died, suggesting high virulence.

Lights and shades on an historical vaccine canine distemper virus, the Rockborn strain.

Science.gov (United States)

Martella, V; Blixenkrone-Møller, M; Elia, G; Lucente, M S; Cirone, F; Decaro, N; Nielsen, L; Bányai, K; Carmichael, L E; Buonavoglia, C

2011-02-01

Both egg- and cell-adapted canine distemper virus (CDV) vaccines are suspected to retain residual virulence, especially if administered to immuno-suppressed animals, very young pups or to highly susceptible animal species. In the early 1980s, post-vaccine encephalitis was reported in dogs from various parts of Britain after administration of a particular batch of combined CDV Rockborn strain/canine adenovirus type-1 vaccine, although incrimination of the Rockborn strain was subsequently retracted. Notwithstanding, this, and other reports, led to the view that the Rockborn strain is less attenuated and less safe than other CDV vaccines, and the Rockborn strain was officially withdrawn from the markets in the mid 1990s. By sequencing the H gene of the strain Rockborn from the 46th laboratory passage, and a commercial vaccine (Candur(®) SH+P, Hoechst Rousell Vet GmbH), the virus was found to differ from the commonly used vaccine strain, Onderstepoort (93.0% nt and 91.7% aa), and to resemble more closely (99.6% nt and 99.3% aa) a CDV strain detected in China from a Lesser Panda (Ailurus fulgens). An additional four CDV strains matching (>99% nt identity) the Rockborn virus were identified in the sequence databases. Also, Rockborn-like strains were identified in two vaccines currently in the market. These findings indicate that Rockborn-like viruses may be recovered from dogs or other carnivores with distemper, suggesting cases of residual virulence of vaccines, or circulation of vaccine-derived Rockborn-like viruses in the field. Copyright © 2010 Elsevier Ltd. All rights reserved.

Low Titers of Canine Distemper Virus Antibody in Wild Fishers (Martes pennanti) in the Eastern USA.

Science.gov (United States)

Peper, Steven T; Peper, Randall L; Mitcheltree, Denise H; Kollias, George V; Brooks, Robert P; Stevens, Sadie S; Serfass, Thomas L

2016-01-01

Canine distemper virus (CDV) infects species in the order Carnivora. Members of the family Mustelidae are among the species most susceptible to CDV and have a high mortality rate after infection. Assessing an animal's pathogen or disease load prior to any reintroduction project is important to help protect the animal being reintroduced, as well as the wildlife and livestock in the area of relocation. We screened 58 fishers for CDV antibody prior to their release into Pennsylvania, US, as part of a reintroduction program. Five of the 58 (9%) fishers had a weak-positive reaction for CDV antibody at a dilution of 1:16. None of the fishers exhibited any clinical sign of canine distemper while being held prior to release.

In vitro antiviral efficacy of caffeic acid against canine distemper virus.

Science.gov (United States)

Wu, Zong-Mei; Yu, Zhen-Jiang; Cui, Zhen-Qiang; Peng, Lu-Yuan; Li, Hao-Ran; Zhang, Chun-Lei; Shen, Hai-Qing; Yi, Peng-Fei; Fu, Ben-Dong

2017-09-01

Canine distemper (CD) is a highly contagious disease caused by the canine distemper virus (CDV), and mortality can be as high as 100%. However, there is no specific treatment for CD. In this study, the antiviral activity of the caffeic acid against CDV was evaluated in vitro. The results showed that the IC 50 of the caffeic acid against CDV at 1 and 2 h post infection (PI) is 23.3 and 32.3 μg/mL, respectively. Consistently, at 1 and 2 h PI, the caffeic acid exhibited a reduced (23.3-57.0% and 37.2-38.1%) viral inhibitory effect in vero cells. Furthermore, the caffeic acid plus Ribavirin (RBV) has greater antiviral activity against CDV than the caffeic acid or RBV individually. In addition, the caffeic acid reduced the total viral RNA synthesis by 59-86% at 24-72 h. Therefore, our data provided the experimental evidence that the caffeic acid effectively inhibited CDV infection in vero cells, which may potentially be used to treat clinical disease associated with CDV infection. Copyright © 2017. Published by Elsevier Ltd.

Measles vaccination of nonhuman primates provides partial protection against infection with canine distemper virus.

Science.gov (United States)

de Vries, Rory D; Ludlow, Martin; Verburgh, R Joyce; van Amerongen, Geert; Yüksel, Selma; Nguyen, D Tien; McQuaid, Stephen; Osterhaus, Albert D M E; Duprex, W Paul; de Swart, Rik L

2014-04-01

Measles virus (MV) is being considered for global eradication, which would likely reduce compliance with MV vaccination. As a result, children will grow up without MV-specific immunity, creating a potential niche for closely related animal morbilliviruses such as canine distemper virus (CDV). Natural CDV infection causing clinical signs has never been reported in humans, but recent outbreaks in captive macaques have shown that CDV can cause disease in primates. We studied the virulence and tropism of recombinant CDV expressing enhanced green fluorescent protein in naive and measles-vaccinated cynomolgus macaques. In naive animals CDV caused viremia and fever and predominantly infected CD150(+) lymphocytes and dendritic cells. Virus was reisolated from the upper and lower respiratory tracts, but infection of epithelial or neuronal cells was not detectable at the time points examined, and the infections were self-limiting. This demonstrates that CDV readily infects nonhuman primates but suggests that additional mutations are necessary to achieve full virulence in nonnatural hosts. Partial protection against CDV was observed in measles-vaccinated macaques, as demonstrated by accelerated control of virus replication and limited shedding from the upper respiratory tract. While neither CDV infection nor MV vaccination induced detectable cross-reactive neutralizing antibodies, MV-specific neutralizing antibody levels of MV-vaccinated macaques were boosted by CDV challenge infection, suggesting that cross-reactive VN epitopes exist. Rapid increases in white blood cell counts in MV-vaccinated macaques following CDV challenge suggested that cross-reactive cellular immune responses were also present. This study demonstrates that zoonotic morbillivirus infections can be controlled by measles vaccination. Throughout history viral zoonoses have had a substantial impact on human health. Given the drive toward global eradication of measles, it is essential to understand the

Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from giant panda and raccoon dogs in China

Science.gov (United States)

2013-01-01

Background Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. In this study, we sequenced and phylogenetic analyses of the hemagglutinin (H) genes from eight canine distemper virus (CDV) isolates obtained from seven raccoon dogs (Nyctereutes procyonoides) and a giant panda (Ailuropoda melanoleuca) in China. Results Phylogenetic analysis of the partial hemagglutinin gene sequences showed close clustering for geographic lineages, clearly distinct from vaccine strains and other wild-type foreign CDV strains, all the CDV strains were characterized as Asia-1 genotype and were highly similar to each other (91.5-99.8% nt and 94.4-99.8% aa). The giant panda and raccoon dogs all were 549Y on the HA protein in this study, irrespective of the host species. Conclusions These findings enhance our knowledge of the genetic characteristics of Chinese CDV isolates, and may facilitate the development of effective strategies for monitoring and controlling CDV for wild canids and non-cainds in China. PMID:23566727

DNA vaccines encoding proteins from wild-type and attenuated canine distemper virus protect equally well against wild-type virus challenge.

Science.gov (United States)

Nielsen, Line; Jensen, Trine Hammer; Kristensen, Birte; Jensen, Tove Dannemann; Karlskov-Mortensen, Peter; Lund, Morten; Aasted, Bent; Blixenkrone-Møller, Merete

2012-10-01

Immunity induced by DNA vaccines containing the hemagglutinin (H) and nucleoprotein (N) genes of wild-type and attenuated canine distemper virus (CDV) was investigated in mink (Mustela vison), a highly susceptible natural host of CDV. All DNA-immunized mink seroconverted, and significant levels of virus-neutralizing (VN) antibodies were present on the day of challenge with wild-type CDV. The DNA vaccines also primed the cell-mediated memory responses, as indicated by an early increase in the number of interferon-gamma (IFN-γ)-producing lymphocytes after challenge. Importantly, the wild-type and attenuated CDV DNA vaccines had a long-term protective effect against wild-type CDV challenge. The vaccine-induced immunity induced by the H and N genes from wild-type CDV and those from attenuated CDV was comparable. Because these two DNA vaccines were shown to protect equally well against wild-type virus challenge, it is suggested that the genetic/antigenic heterogeneity between vaccine strains and contemporary wild-type strains are unlikely to cause vaccine failure.

Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

International Nuclear Information System (INIS)

Gebara, C.M.S.; Wosiachi, S.R.; Negrao, F.J.; Oliveira, D.B. de; Beloni, S.N.E.; Alfieri, A.A.; Alfieri, A.F.

2004-01-01

The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV) nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control) included 20 assymptomatic dogs. A c2 was used to test RT-PCR results according to clinical form and hematological characteristics. The RT-PCR was positive for CDV in 47% (41/87) of the urine samples from dogs with clinical signs. All samples from assymptomatic dogs were RT-PCR negatives. Positive samples were found in all groups of dogs with distemper symptoms according to the following propositions: 51.2% (21/41), 29% (11/37) and 100% (9/9) for groups A, B and C, respectively. In all clinical forms (groups A, B and C) leucocytosis was the most frequent observed hematological alteration. No relationship between RT-PCR results and hematological changes was observed. The results showed that independently of the clinical stage of the illness the RT-PCR based on urine sample can be applied for ante mortem diagnosis of CDV

Outbreak and genotyping of canine distemper virus in captive Siberian tigers and red pandas

OpenAIRE

Zhang, He; Shan, Fen; Zhou, Xia; Li, Bing; Zhai, Jun-Qiong; Zou, Shu-Zhan; Wu, Meng-Fan; Chen, Wu; Zhai, Shao-Lun; Luo, Man-Lin

2017-01-01

In this study, four canine distemper virus (CDV) strains were isolated from captive Siberian tigers (Panthera tigris altaica) and red pandas (Ailurus fulgens) during two separate CDV outbreaks in a zoo in Guangdong province, China. Sequence alignment and phylogenetic analyses based on the full-length hemagglutinin (H) and fusion (F) genes showed that they were closely identical to genotype Asia-1. Prior to confirmation of CDV in Siberian tigers, to control spread of the disease, a live attenu...

SLAM- and nectin-4-independent noncytolytic spread of canine distemper virus in astrocytes.

Science.gov (United States)

Alves, Lisa; Khosravi, Mojtaba; Avila, Mislay; Ader-Ebert, Nadine; Bringolf, Fanny; Zurbriggen, Andreas; Vandevelde, Marc; Plattet, Philippe

2015-05-01

Measles and canine distemper viruses (MeV and CDV, respectively) first replicate in lymphatic and epithelial tissues by using SLAM and nectin-4 as entry receptors, respectively. The viruses may also invade the brain to establish persistent infections, triggering fatal complications, such as subacute sclerosis pan-encephalitis (SSPE) in MeV infection or chronic, multiple sclerosis-like, multifocal demyelinating lesions in the case of CDV infection. In both diseases, persistence is mediated by viral nucleocapsids that do not require packaging into particles for infectivity but are directly transmitted from cell to cell (neurons in SSPE or astrocytes in distemper encephalitis), presumably by relying on restricted microfusion events. Indeed, although morphological evidence of fusion remained undetectable, viral fusion machineries and, thus, a putative cellular receptor, were shown to contribute to persistent infections. Here, we first showed that nectin-4-dependent cell-cell fusion in Vero cells, triggered by a demyelinating CDV strain, remained extremely limited, thereby supporting a potential role of nectin-4 in mediating persistent infections in astrocytes. However, nectin-4 could not be detected in either primary cultured astrocytes or the white matter of tissue sections. In addition, a bioengineered "nectin-4-blind" recombinant CDV retained full cell-to-cell transmission efficacy in primary astrocytes. Combined with our previous report demonstrating the absence of SLAM expression in astrocytes, these findings are suggestive for the existence of a hitherto unrecognized third CDV receptor expressed by glial cells that contributes to the induction of noncytolytic cell-to-cell viral transmission in astrocytes. While persistent measles virus (MeV) infection induces SSPE in humans, persistent canine distemper virus (CDV) infection causes chronic progressive or relapsing demyelination in carnivores. Common to both central nervous system (CNS) infections is that

Canine Distemper Virus in Wild Felids of Costa Rica.

Science.gov (United States)

Avendaño, Roberto; Barrueta, Flor; Soto-Fournier, Sofía; Chavarría, Max; Monge, Otto; Gutiérrez-Espeleta, Gustavo A; Chaves, Andrea

2016-04-28

Several highly infectious diseases can be transmitted through feces and cause elevated mortality among carnivore species. One such infectious agent, canine distemper virus (CDV; Paramyxoviridae: Morbillivirus), has been reported to affect wild carnivores, among them several felid species. We screened free-ranging and captive wild carnivores in Costa Rica for CDV. Between 2006 and 2012, we collected 306 fecal samples from 70 jaguars (Panther onca), 71 ocelots ( Leopardus pardalis ), five jaguarundis (Puma yaguaroundi), 105 pumas ( Puma concolor ), five margays ( Leopardus wiedii ), 23 coyotes ( Canis latrans ), and 27 undetermined Leopardus spp. We found CDV in six individuals: one captive jaguarundi (rescued in 2009), three free-ranging ocelots (samples collected in 2012), and two free-ranging pumas (samples collected in 2007). Phylogenetic analyses were performed using sequences of the phosphoprotein (P) gene. We provide evidence of CDV in wild carnivores in Costa Rica and sequence data from a Costa Rican CDV isolate, adding to the very few sequence data available for CDV isolates from wild Central American carnivores.

A negative search of acute canine distemper virus infection in DogSLAM transgenic C57BL/6 mice

Directory of Open Access Journals (Sweden)

Somporn Techangamsuwan

2010-12-01

Full Text Available Canine distemper is a highly contagious and immunosuppressive viral disease caused by canine distemper virus(CDV, an enveloped RNA virus of the family Paramyxoviridae. The susceptible host spectrum of CDV is broad andincludes all families of the order Carnivora. To accomplish the infection, CDV requires an expression of signaling lymphocyteactivation molecule (SLAM functioning as a cellular receptor which generally presents in a variety of different lymphoid cellsubpopulations, including immature thymocytes, primary B cells, activated T cells, memory T cells, macrophages and maturedendritic cells. The distribution of SLAM-presenting cells is in accordance with the lymphotropism and immunosuppressionfollowing morbillivirus infection. In the present study, the C57BL/6 mice engrafted with dog-specific SLAM sequence(DogSLAM were used. The weanling (3-week-old transgenic offspring C57BL/6 mice were infected with CDV Snyder Hill(CDV-SH strain via the intranasal (n=6, intracerebral (n=6 and intraperitoneal (n=5 routes. Clinical signs, hematology,histopathology, immunohistochemistry, virus isolation and RT-PCR were observed for two weeks post infection. Resultsshowed that CDV-SH-inoculated transgenic mice displayed mild-to-moderate congestion of various organs (brain, lung,spleen, kidney, lymph node, and adrenal gland. By means of immunohistochemistry, virus isolation and RT-PCR, CDV couldnot be detected. The evidence of CDV infection in this study could not be demonstrated in acute phase. Even though thetransgenic mouse is not a suitable animal model for CDV, or a longer incubation period is prerequisite, it needs to be clarifiedin a future study.

In-vitro antiviral efficacy of ribavirin and interferon-alpha against canine distemper virus.

Science.gov (United States)

Carvalho, Otávio V; Saraiva, Giuliana L; Ferreira, Caroline G T; Felix, Daniele M; Fietto, Juliana L R; Bressan, Gustavo C; Almeida, Márcia R; Silva Júnior, Abelardo

2014-10-01

Canine distemper is a highly contagious disease with high incidence and lethality in the canine population. The objective of this study was to evaluate the efficacy of antiviral action with ribavirin (RBV), interferon-alpha (IFNα), and combinations of RBV and IFNα against canine distemper virus (CDV). Vero cells inoculated with CDV were treated with RBV, IFNα, and combinations of these drugs. The efficacy to inhibit viral replication was evaluated by adding the compounds at different times to determine which step of the viral replicative process was affected. Both drugs were effective against CDV in vitro. The IFNα was the most active compound, with an average IC50 (50% inhibitory concentration) value lower than the IC50 of the RBV. Ribavirin (RBV) was more selective than IFNα, however, and neither drug showed extracellular antiviral activity. The combination of RBV and IFNα exhibited antiviral activity for the intra- and extracellular stages of the replicative cycle of CDV, although the intracellular viral inhibition was higher. Both RBV and IFNα showed high antiviral efficacy against CDV, and furthermore, RBV + IFNα combinations have shown greater interference range in viral infectivity. These compounds could potentially be used to treat clinical disease associated with CDV infection.

One-step triplex PCR/RT-PCR to detect canine distemper virus, canine parvovirus, and canine kobuvirus.

Science.gov (United States)

Liu, Dafei; Liu, Fei; Guo, Dongchun; Hu, Xiaoliang; Li, Zhijie; Li, Zhigang; Ma, Jianzhang; Liu, Chunguo

2018-01-23

To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.

Monitoring of Antibodies Titre Against Canine Distemper Virus in Ferrets Vaccinated with a Live Modified Vaccine

Directory of Open Access Journals (Sweden)

L. Pavlačík

2007-01-01

Full Text Available A group of five ferrets vaccinated against the canine distemper virus (CDV was evaluated as to the onset of anti-CDV antibody production and the serum levels of the animals were monitored for one year. The ferrets were immunized with a live attenuated vaccine. The vaccination pattern was as follows: primary vaccination at the age of 6 weeks, fi rst revaccination at 30 days after primary vaccination, and second revaccination after another 30 days. Blood samples were taken prior to primary vaccination and then at 30-day intervals (sampling 1 to 12. The whole experimental cycle covered the period of one year from primary vaccination (till the age of 1 year and 6 weeks. Serum samples were analysed for anti-CDV virus-neutralisation antibodies using a virus-neutralisation test using the Onderstepoort CDV strain. All ferrets had zero virus-neutralisation antibody titres before primary vaccination. Two ferrets produced virus-neutralisation antibodies as a response to first revaccination. A stable antibody level (titre 256 was maintained between months 4 and 11 after primary vaccination and a sudden increase in antibody titre (titres 512 and 1024 - 2048 occurred in both animals in months 11 and 12. The reason for the abrupt rise in antibody titres in the two animals remains unclear. No anti-CDV seroconversion was observed in the three remaining animals. Regarding the results obtained in this study we do not consider commonly recommended vaccination with a live attenuated anti-CDV vaccine as an effective method of antibodies induction against distemper in young ferrets.

Coinfection with Hepatozoon sp. and Canine Distemper Virus in a Yellow-throated Marten ( Martes flavigula koreana) in Korea.

Science.gov (United States)

Park, Surim; Choi, Ul Soo; Kim, Eun Ju; Lee, Jong Hyun; Lee, Hae Beom; Cho, Ho Seong; Kim, Wonil; Lim, Chae Woong; Kim, Bumseok

2016-04-28

We describe coinfection with Hepatozoon sp. and canine distemper virus (CDV) in a yellow-throated marten ( Martes flavigula koreana). We found Hepatozoon cysts in muscular tissue and viral inclusion bodies in the brain. Hepatozoon sp., and CDV was confirmed in blood and brain, respectively, by PCR.

Mucosal vaccination with recombinant poxvirus vaccines protects ferrets against symptomatic CDV infection.

Science.gov (United States)

Welter, J; Taylor, J; Tartaglia, J; Paoletti, E; Stephensen, C B

1999-01-28

Canine distemper virus (CDV) infection of ferrets causes a disease characterized by fever, erythema, conjunctivitis and leukocytopenia, similar clinically to measles except for the fatal neurologic sequelae of CDV. We vaccinated juvenile ferrets twice at 4-week intervals by the intranasal or intraduodenal route with attenuated vaccinia (NYVAC) or canarypox virus (ALVAC) constructs containing the CDV hemagglutinin and fusion genes. Controls were vaccinated with the same vectors expressing rabies glycoprotein. Animals were challenged intranasally 4 weeks after the second vaccination with virulent CDV. Body weights, white blood cell (WBC) counts and temperatures were monitored and ferrets were observed daily for clinical signs of infection. WBCs were assayed for the presence of viral RNA by RT-PCR. Intranasally vaccinated animals survived challenge with no virologic or clinical evidence of infection. Vaccination by the intraduodenal route did not provide complete protection. All control animals developed typical distemper. Ferrets can be effectively protected against distemper by mucosal vaccination with poxvirus vaccines.

Molecular characterization of complete genome of a canine distemper virus associated with fatal infection in dogs in Gabon, Central Africa.

Science.gov (United States)

Maganga, Gael D; Labouba, Ingrid; Ngoubangoye, Barthélémy; Nkili-Meyong, Andriniaina A; Obame Ondo, Daniel; Leroy, Eric M; Berthet, Nicolas

2018-03-02

Canine distemper (CD) is the most deadly disease in dogs with mortality rates reaching 50%. The pathological agent, the CD virus (CDV), generally causes a severe systemic disease, although the nervous form can coexist with the acute catarrhal form in the same individual. In this study, we describe an outbreak of 18 cases of CD that occurred in 2015 in a German Shepherd dog population in northwestern Gabon. In addition, we determined the sequence of the CDV genotype associated with this fatal distemper infection in Gabon and compared it with other published CDV sequences. The CDV was detected using RT-PCR on cDNA from RNA of harvested brains and other organs. The identification was confirmed by sequencing amplicons. Moreover, we obtained the whole genome sequence using high-throughput sequencing. Phylogenetic analysis revealed that Gabonese CDV strain clustered with European strains belonging to the Europe genotype. This study provided the first molecular detection of the CDV strain associated with this fatal distemper infection in Central Africa region. Copyright © 2018 Elsevier B.V. All rights reserved.

Canine distemper virus from diseased large felids: Biological properties and phylogenetic relationships.

NARCIS (Netherlands)

T.C. Harder (Timm); M.J.H. Kenter (Marcel); H. Vos; C.H.J. Siebelink (Kees); W. Huisman (Willem); C. Örvell; T. Barrett (Thomas); M.J.G. Appel (Max); A.D.M.E. Osterhaus (Albert); G. van Amerongen (Geert)

1996-01-01

textabstractSpecific pathogen free (SPF) domestic cats were inoculated with tissue homogenate obtained from a Chinese leopard (Panthera pardus japonensis) that had died in a North American zoo from a natural infection with canine distemper virus (CDV). The cats developed a transient cell-associated

Canine distemper spillover in domestic dogs from urban wildlife.

Science.gov (United States)

Kapil, Sanjay; Yeary, Teresa J

2011-11-01

Canine distemper virus (CDV) causes a major disease of domestic dogs that develops as a serious systemic infection in unvaccinated or improperly vaccinated dogs. Domesticated dogs are the main reservoir of CDV, a multihost pathogen. This virus of the genus Morbillivirus in the family Paramyxoviridae occurs in other carnivorous species including all members of the Canidae and Mustelidae families and in some members of the Procyonidae, Hyaenidae, Ursidae, and Viverridae families. Canine distemper also has been reported in the Felidae family and marine mammals. The spread and incidences of CDV epidemics in dogs and wildlife here and worldwide are increasing.

Lights and shades on an historical vaccine canine distemper virus, the Rockborn strain

DEFF Research Database (Denmark)

Martella, V.; Blixenkrone-Møller, Merete; Elia, G.

2011-01-01

Both egg- and cell-adapted canine distemper virus (CDV) vaccines are suspected to retain residual virulence, especially if administered to immuno-suppressed animals, very young pups or to highly susceptible animal species. In the early 1980s, post-vaccine encephalitis was reported in dogs from...... in the sequence databases. Also, Rockborn-like strains were identified in two vaccines currently in the market. These findings indicate that Rockborn-like viruses may be recovered from dogs or other carnivores with distemper, suggesting cases of residual virulence of vaccines, or circulation of vaccine...

Variable transcription of pro- and anti-inflammatory cytokines in phocine lymphocytes following canine distemper virus infection.

Science.gov (United States)

Seibel, H; Siebert, U; Rosenberger, T; Baumgärtner, W

2014-10-15

Canine distemper virus (CDV) is a highly contagious viral pathogen. Domesticated dogs are the main reservoir of CDV. Although phocine distemper virus was responsible for the recent epidemics in seals in the North and Baltic Seas, most devastating epidemics in seals were also caused by CDV. To further study the pathogenesis of CDV infection in seals, it was the aim of the present study to investigate the mechanisms of CDV induced immunosuppression in seals by analyzing the gene transcription of different pro- and anti-inflammatory cytokines in Concanavalin A (Con A) stimulated and non-stimulated phocine lymphocytes in vitro following infection with the CDV Onderstepoort (CDV-OND) strain. Phocine lymphocytes were isolated via density gradient centrifugation. The addition of 1 μg/ml Con A and virus was either performed simultaneously or lymphocytes were stimulated for 48 h with Con A prior to virus infection. Gene transcription of interleukin (IL)-6, IL-12 and tumor necrosis factor alpha (TNFα) as pro-inflammatory cytokines and IL-4, IL-10 and transforming growth factor beta (TGFβ) as anti-inflammatory cytokines were determined by using RT-qPCR. CDV-OND infection caused an initial increase of pro-inflammatory phocine cytokines mRNA 24h after infection, followed by a decrease in gene transcription after 48 h. A strong increase in the transcription of IL-4 and TGFβ was detected after 48 h when virus and mitogen were added simultaneously. An increased IL-10 production occurred only when stimulation and infection were performed simultaneously. Furthermore, an inhibition of IL-12 on IL-4 was noticed in phocine lymphocytes which were stimulated for 48 h prior to infection. In summary, the duration of the stimulation or the lymphocytes seem to have an important influence on the cytokine transcription and indicates that the outcome of CDV infection is dependent on various factors that might sensitize lymphocytes or make them more susceptible or reactive to CDV infection

Cross-species transmission of canine distemper virus—an update

Directory of Open Access Journals (Sweden)

Andreas Beineke

2015-12-01

Full Text Available Canine distemper virus (CDV is a pantropic morbillivirus with a worldwide distribution, which causes fatal disease in dogs. Affected animals develop dyspnea, diarrhea, neurological signs and profound immunosuppression. Systemic CDV infection, resembling distemper in domestic dogs, can be found also in wild canids (e.g. wolves, foxes, procyonids (e.g. raccoons, kinkajous, ailurids (e.g. red pandas, ursids (e.g. black bears, giant pandas, mustelids (e.g. ferrets, minks, viverrids (e.g. civets, genets, hyaenids (e.g. spotted hyenas, and large felids (e.g. lions, tigers. Furthermore, besides infection with the closely related phocine distemper virus, seals can become infected by CDV. In some CDV outbreaks including the mass mortalities among Baikal and Caspian seals and large felids in the Serengeti Park, terrestrial carnivores including dogs and wolves have been suspected as vectors for the infectious agent. In addition, lethal infections have been described in non-carnivore species such as peccaries and non-human primates demonstrating the remarkable ability of the pathogen to cross species barriers. Mutations affecting the CDV H protein required for virus attachment to host-cell receptors are associated with virulence and disease emergence in novel host species. The broad and expanding host range of CDV and its maintenance within wildlife reservoir hosts considerably hampers disease eradication.

Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

International Nuclear Information System (INIS)

Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

1985-01-01

Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

Energy Technology Data Exchange (ETDEWEB)

Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

1985-02-01

Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

Isolation and sequence analysis of a canine distemper virus from a raccoon dog in Jilin Province, China.

Science.gov (United States)

Cheng, Yuening; Wang, Jianke; Zhang, Miao; Zhao, Jianjun; Shao, Xiqun; Ma, Zengjun; Zhao, Hang; Lin, Peng; Wu, Hua

2015-10-01

Canine distemper virus (CDV) is a major pathogen not only in raccoon dogs but also in a variety of carnivorous animals, including domesticated animals, particularly if they have not been vaccinated. In this study, a wild-type strain of CDV was isolated from lung tissue from a raccoon dog kept at a fur farm in Jilin Province, China. Cytopathic effects typical of CDV infection were observed after three blind passages in Vero cells, yielding a virus titer of 10(4.6) TCID50/mL. Virus identification was carried out by RT-PCR, immunofluorescence, electron microscopy, and genome sequencing. The results showed that the isolated virus, termed the SY strain, corresponded to the Asia-1 genotype of CDV and has a genome of 15,690 nucleotides. This represents the first complete nucleotide sequence of a CDV strain circulating in raccoon dogs in China.

Canine distemper virus infection among wildlife before and after the epidemic.

Science.gov (United States)

Suzuki, Junko; Nishio, Yohei; Kameo, Yuki; Terada, Yutaka; Kuwata, Ryusei; Shimoda, Hiroshi; Suzuki, Kazuo; Maeda, Ken

2015-11-01

In 2007-2008, a canine distemper virus (CDV) epidemic occurred among wild animals in Wakayama Prefecture, Japan, and many mammals, including the wild boar and deer, were infected. In this study, CDV prevalence among wild animals was surveyed before and after the epidemic. At first, an enzyme-linked immunosorbent assay (ELISA) with horseradish peroxidase-conjugated protein A/G was established to detect CDV antibodies in many mammalian species. This established ELISA was available for testing dogs, raccoons and raccoon dogs as well as virus-neutralization test. Next, a serological survey of wild mammalians was conducted, and it was indicated that many wild mammalians, particularly raccoons, were infected with CDV during the epidemic, but few were infected before and after the epidemic. On the other hand, many raccoon dogs died during the epidemic, but CDV remained prevalent in the remaining population, and a small epidemic occurred in raccoon dogs in 2012-2013. These results indicated that the epidemic of 2007-2008 may have been intensified by transmission to raccoons.

Development and characterization of neutralizing monoclonal antibodies against canine distemper virus hemagglutinin protein.

Science.gov (United States)

Bi, Zhenwei; Xia, Xingxia; Wang, Yongshan; Mei, Yongjie

2015-04-01

Canine distemper virus (CDV) causes a serious multisystemic disease in dogs and other carnivora. Hemagglutinin (H) protein-specific antibodies are mainly responsible for protective immunity against CDV infection. In the present study, six neutralizing MAbs to the H protein of CDV were newly obtained and characterized by immunizing BALB/c mice with a recent Chinese field isolate. Competitive binding inhibition assay revealed that they recognized four distinct antigenic regions of the H protein. Immunofluorescence assay and western blotting showed that all MAbs recognize the conformational rather than the linear epitopes of the H protein. Furthermore, in immunofluorescence and virus neutralization assays, two of the MAbs were found to react only with the recent Chinese field isolate and not with older CDV strains, including vaccine strain Onderstepoort, indicating there are neutralization-related antigenic variations between the recent Chinese field isolate and the older CDV strains examined in this study. The newly established MAbs are useful for differentiating the expanding CDV strains and could be used in immunotherapy and immunodiagnosis against infection with CDV. © 2015 The Societies and Wiley Publishing Asia Pty Ltd.

Molecular phylogeography of canine distemper virus: Geographic origin and global spreading.

Science.gov (United States)

Panzera, Yanina; Sarute, Nicolás; Iraola, Gregorio; Hernández, Martín; Pérez, Ruben

2015-11-01

Canine distemper virus (CDV) (Paramyxoviridae-Morbillivirus) is a worldwide spread virus causing a fatal systemic disease in a broad range of carnivore hosts. In this study we performed Bayesian inferences using 208 full-length hemagglutinin gene nucleotide sequences isolated in 16 countries during 37 years (1975-2011). The estimated time to the most recent common ancestor suggested that current CDV strains emerged in the United States in the 1880s. This ancestor diversified through time into two ancestral clades, the current America 1 lineage that recently spread to Asia, and other ancestral clade that diversified and spread worldwide to originate the remaining eight lineages characterized to date. The spreading of CDV was characterized by several migratory events with posterior local differentiation, and expansion of the virus host range. A significant genetic flow between domestic and wildlife hosts is displayed; being domestic hosts the main viral reservoirs worldwide. This study is an extensive and integrative description of spatio/temporal population dynamics of CDV lineages that provides a novel evolutionary paradigm about the origin and dissemination of the current strains of the virus. Copyright © 2015 Elsevier Inc. All rights reserved.

Canine distemper antibodies in lions of the Masai Mara.

Science.gov (United States)

Kock, R; Chalmers, W S; Mwanzia, J; Chillingworth, C; Wambua, J; Coleman, P G; Baxendale, W

1998-06-13

Canine distemper virus (CDV) has been implicated in some recent deaths of lions, which showed clinical signs of distemper, in the the Serengeti plain. Similar clinical findings have since been reported in lions of the Masai Mara. Fifty-five per cent of serum samples obtained from wild lions of the Masai Mara have been found to contain neutralising antibody to CDV, indicating that they had been exposed to the virus. Adult orphan lions kept in captivity, were vaccinated with the live attenuated Onderstepoort strain of CDV. The results indicated that the vaccine is both safe and immunogenic, and may be potentially useful for the prophylactic vaccination of lions at high risk.

Recombinant Newcastle disease viral vector expressing hemagglutinin or fusion of canine distemper virus is safe and immunogenic in minks.

Science.gov (United States)

Ge, Jinying; Wang, Xijun; Tian, Meijie; Gao, Yuwei; Wen, Zhiyuan; Yu, Guimei; Zhou, Weiwei; Zu, Shulong; Bu, Zhigao

2015-05-15

Canine Distemper Virus (CDV) infects many carnivores and cause several high-mortality disease outbreaks. The current CDV live vaccine cannot be safely used in some exotic species, such as mink and ferret. Here, we generated recombinant lentogenic Newcastle disease virus (NDV) LaSota expressing either envelope glycoproyein, heamagglutinine (H) or fusion protein (F), named as rLa-CDVH and rLa-CDVF, respectively. The feasibility of these recombinant NDVs to serve as live virus-vectored CD vaccine was evaluated in minks. rLa-CDVH induced significant neutralization antibodies (NA) to CDV and provided solid protection against virulent CDV challenge. On the contrast, rLa-CDVF induced much lower NA to CDV and fail to protected mink from virulent CDV challenge. Results suggest that recombinant NDV expressing CDV H is safe and efficient candidate vaccine against CDV in mink, and maybe other host species. Copyright © 2015 Elsevier Ltd. All rights reserved.

Canine Distemper Virus Infection Leads to an Inhibitory Phenotype of Monocyte-Derived Dendritic Cells In Vitro with Reduced Expression of Co-Stimulatory Molecules and Increased Interleukin-10 Transcription

Science.gov (United States)

Herder, Vanessa; Stein, Veronika M.; Tipold, Andrea; Urhausen, Carola; Günzel-Apel, Anne-Rose; Rohn, Karl; Baumgärtner, Wolfgang; Beineke, Andreas

2014-01-01

Canine distemper virus (CDV) exhibits a profound lymphotropism that causes immunosuppression and increased susceptibility of affected dogs to opportunistic infections. Similar to human measles virus, CDV is supposed to inhibit terminal differentiation of dendritic cells (DCs), responsible for disturbed repopulation of lymphoid tissues and diminished antigen presenting function in dogs. In order to testify the hypothesis that CDV-infection leads to an impairment of professional antigen presenting cells, canine DCs have been generated from peripheral blood monocytes in vitro and infected with CDV. Virus infection was confirmed and quantified by transmission electron microscopy, CDV-specific immunofluorescence, and virus titration. Flow cytometric analyses revealed a significant down-regulation of the major histocompatibility complex class II and co-stimulatory molecules CD80 and CD86 in CDV-infected DCs, indicative of disturbed antigen presenting capacity. Molecular analyses revealed an increased expression of the immune inhibitory cytokine interleukin-10 in DCs following infection. Results of the present study demonstrate that CDV causes phenotypical changes and altered cytokine expression of DCs, which represent potential mechanisms to evade host immune responses and might contribute to immune dysfunction and virus persistence in canine distemper. PMID:24769532

Canine distemper virus infection leads to an inhibitory phenotype of monocyte-derived dendritic cells in vitro with reduced expression of co-stimulatory molecules and increased interleukin-10 transcription.

Directory of Open Access Journals (Sweden)

Visar Qeska

Full Text Available Canine distemper virus (CDV exhibits a profound lymphotropism that causes immunosuppression and increased susceptibility of affected dogs to opportunistic infections. Similar to human measles virus, CDV is supposed to inhibit terminal differentiation of dendritic cells (DCs, responsible for disturbed repopulation of lymphoid tissues and diminished antigen presenting function in dogs. In order to testify the hypothesis that CDV-infection leads to an impairment of professional antigen presenting cells, canine DCs have been generated from peripheral blood monocytes in vitro and infected with CDV. Virus infection was confirmed and quantified by transmission electron microscopy, CDV-specific immunofluorescence, and virus titration. Flow cytometric analyses revealed a significant down-regulation of the major histocompatibility complex class II and co-stimulatory molecules CD80 and CD86 in CDV-infected DCs, indicative of disturbed antigen presenting capacity. Molecular analyses revealed an increased expression of the immune inhibitory cytokine interleukin-10 in DCs following infection. Results of the present study demonstrate that CDV causes phenotypical changes and altered cytokine expression of DCs, which represent potential mechanisms to evade host immune responses and might contribute to immune dysfunction and virus persistence in canine distemper.

Canine distemper virus infection leads to an inhibitory phenotype of monocyte-derived dendritic cells in vitro with reduced expression of co-stimulatory molecules and increased interleukin-10 transcription.

Science.gov (United States)

Qeska, Visar; Barthel, Yvonne; Herder, Vanessa; Stein, Veronika M; Tipold, Andrea; Urhausen, Carola; Günzel-Apel, Anne-Rose; Rohn, Karl; Baumgärtner, Wolfgang; Beineke, Andreas

2014-01-01

Canine distemper virus (CDV) exhibits a profound lymphotropism that causes immunosuppression and increased susceptibility of affected dogs to opportunistic infections. Similar to human measles virus, CDV is supposed to inhibit terminal differentiation of dendritic cells (DCs), responsible for disturbed repopulation of lymphoid tissues and diminished antigen presenting function in dogs. In order to testify the hypothesis that CDV-infection leads to an impairment of professional antigen presenting cells, canine DCs have been generated from peripheral blood monocytes in vitro and infected with CDV. Virus infection was confirmed and quantified by transmission electron microscopy, CDV-specific immunofluorescence, and virus titration. Flow cytometric analyses revealed a significant down-regulation of the major histocompatibility complex class II and co-stimulatory molecules CD80 and CD86 in CDV-infected DCs, indicative of disturbed antigen presenting capacity. Molecular analyses revealed an increased expression of the immune inhibitory cytokine interleukin-10 in DCs following infection. Results of the present study demonstrate that CDV causes phenotypical changes and altered cytokine expression of DCs, which represent potential mechanisms to evade host immune responses and might contribute to immune dysfunction and virus persistence in canine distemper.

Lethal canine distemper virus outbreak in cynomolgus monkeys in Japan in 2008.

Science.gov (United States)

Sakai, Kouji; Nagata, Noriyo; Ami, Yasushi; Seki, Fumio; Suzaki, Yuriko; Iwata-Yoshikawa, Naoko; Suzuki, Tadaki; Fukushi, Shuetsu; Mizutani, Tetsuya; Yoshikawa, Tomoki; Otsuki, Noriyuki; Kurane, Ichiro; Komase, Katsuhiro; Yamaguchi, Ryoji; Hasegawa, Hideki; Saijo, Masayuki; Takeda, Makoto; Morikawa, Shigeru

2013-01-01

Canine distemper virus (CDV) has recently expanded its host range to nonhuman primates. A large CDV outbreak occurred in rhesus monkeys at a breeding farm in Guangxi Province, China, in 2006, followed by another outbreak in rhesus monkeys at an animal center in Beijing in 2008. In 2008 in Japan, a CDV outbreak also occurred in cynomolgus monkeys imported from China. In that outbreak, 46 monkeys died from severe pneumonia during a quarantine period. A CDV strain (CYN07-dV) was isolated in Vero cells expressing dog signaling lymphocyte activation molecule (SLAM). Phylogenic analysis showed that CYN07-dV was closely related to the recent CDV outbreaks in China, suggesting continuing chains of CDV infection in monkeys. In vitro, CYN07-dV uses macaca SLAM and macaca nectin4 as receptors as efficiently as dog SLAM and dog nectin4, respectively. CYN07-dV showed high virulence in experimentally infected cynomolgus monkeys and excreted progeny viruses in oral fluid and feces. These data revealed that some of the CDV strains, like CYN07-dV, have the potential to cause acute systemic infection in monkeys.

CANINE DISTEMPER VIRUS IN A WILD FAR EASTERN LEOPARD ( PANTHERA PARDUS ORIENTALIS).

Science.gov (United States)

Sulikhan, Nadezhda S; Gilbert, Martin; Blidchenko, Ekaterina Yu; Naidenko, Sergei V; Ivanchuk, Galina V; Gorpenchenko, Tatiana Yu; Alshinetskiy, Mikhail V; Shevtsova, Elena I; Goodrich, John M; Lewis, John C M; Goncharuk, Mikhail S; Uphyrkina, Olga V; Rozhnov, Vyatcheslav V; Shedko, Sergey V; McAloose, Denise; Miquelle, Dale G

2018-01-01

The critically endangered population of Far Eastern leopards ( Panthera pardus orientalis) may number as few as 60 individuals and is at risk from stochastic processes such as infectious disease. During May 2015, a case of canine distemper virus (CDV) was diagnosed in a wild leopard exhibiting severe neurologic disease in the Russian territory of Primorskii Krai. Amplified sequences of the CDV hemagglutinin gene and phosphoprotein gene aligned within the Arctic-like clade of CDV, which includes viruses from elsewhere in Russia, China, Europe, and North America. Histologic examination of cerebral tissue revealed perivascular lymphoid cuffing and demyelination of the white matter consistent with CDV infection. Neutralizing antibodies against CDV were detected in archived serum from two wild Far Eastern leopards sampled during 1993-94, confirming previous exposure in the population. This leopard population is likely too small to maintain circulation of CDV, suggesting that infections arise from spillover from more-abundant domestic or wild carnivore reservoirs. Increasing the population size and establishment of additional populations of leopards would be important steps toward securing the future of this subspecies and reducing the risk posed by future outbreaks of CDV or other infectious diseases.

Canine distemper virus utilizes different receptors to infect chicken embryo fibroblasts and vero cells.

Science.gov (United States)

Chen, Jun; Liang, Xiu; Chen, Pei-fu

2011-04-01

Inducing animal viruses to adapt to chicken embryos or chicken embryo fibroblasts (CEF) is a common method to develop attenuated live vaccines with full security. Canine distemper virus (CDV) also does this, but the mechanisms and particular receptors remain unclear. Virus overlay protein blot assays were carried out on CEF membrane proteins, which were extracted respectively with a Mem-PER™ kit, a radioimmunoprecipitation assay buffer or a modified co-immunoprecipitation method, and revealed a common 57 kDa positive band that differed from the 42-kDa positive band in Vero cells and also from those receptors reported in lymphocytes and 293 cells, indicating a receptor diversity of CDV and the possibility of the 57-kDa protein acting as a receptor that is involved in adaptive infection of CDV Kunming strain to CEF.

Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies

DEFF Research Database (Denmark)

Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent

2015-01-01

Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits...

Antagonistic pleiotropy and fitness trade-offs reveal specialist and generalist traits in strains of canine distemper virus.

Directory of Open Access Journals (Sweden)

Veljko M Nikolin

Full Text Available Theoretically, homogeneous environments favor the evolution of specialists whereas heterogeneous environments favor generalists. Canine distemper is a multi-host carnivore disease caused by canine distemper virus (CDV. The described cell receptor of CDV is SLAM (CD150. Attachment of CDV hemagglutinin protein (CDV-H to this receptor facilitates fusion and virus entry in cooperation with the fusion protein (CDV-F. We investigated whether CDV strains co-evolved in the large, homogeneous domestic dog population exhibited specialist traits, and strains adapted to the heterogeneous environment of smaller populations of different carnivores exhibited generalist traits. Comparison of amino acid sequences of the SLAM binding region revealed higher similarity between sequences from Canidae species than to sequences from other carnivore families. Using an in vitro assay, we quantified syncytia formation mediated by CDV-H proteins from dog and non-dog CDV strains in cells expressing dog, lion or cat SLAM. CDV-H proteins from dog strains produced significantly higher values with cells expressing dog SLAM than with cells expressing lion or cat SLAM. CDV-H proteins from strains of non-dog species produced similar values in all three cell types, but lower values in cells expressing dog SLAM than the values obtained for CDV-H proteins from dog strains. By experimentally changing one amino acid (Y549H in the CDV-H protein of one dog strain we decreased expression of specialist traits and increased expression of generalist traits, thereby confirming its functional importance. A virus titer assay demonstrated that dog strains produced higher titers in cells expressing dog SLAM than cells expressing SLAM of non-dog hosts, which suggested possible fitness benefits of specialization post-cell entry. We provide in vitro evidence for the expression of specialist and generalist traits by CDV strains, and fitness trade-offs across carnivore host environments caused by

Antagonistic Pleiotropy and Fitness Trade-Offs Reveal Specialist and Generalist Traits in Strains of Canine Distemper Virus

Science.gov (United States)

Nikolin, Veljko M.; Osterrieder, Klaus; von Messling, Veronika; Hofer, Heribert; Anderson, Danielle; Dubovi, Edward; Brunner, Edgar; East, Marion L.

2012-01-01

Theoretically, homogeneous environments favor the evolution of specialists whereas heterogeneous environments favor generalists. Canine distemper is a multi-host carnivore disease caused by canine distemper virus (CDV). The described cell receptor of CDV is SLAM (CD150). Attachment of CDV hemagglutinin protein (CDV-H) to this receptor facilitates fusion and virus entry in cooperation with the fusion protein (CDV-F). We investigated whether CDV strains co-evolved in the large, homogeneous domestic dog population exhibited specialist traits, and strains adapted to the heterogeneous environment of smaller populations of different carnivores exhibited generalist traits. Comparison of amino acid sequences of the SLAM binding region revealed higher similarity between sequences from Canidae species than to sequences from other carnivore families. Using an in vitro assay, we quantified syncytia formation mediated by CDV-H proteins from dog and non-dog CDV strains in cells expressing dog, lion or cat SLAM. CDV-H proteins from dog strains produced significantly higher values with cells expressing dog SLAM than with cells expressing lion or cat SLAM. CDV-H proteins from strains of non-dog species produced similar values in all three cell types, but lower values in cells expressing dog SLAM than the values obtained for CDV-H proteins from dog strains. By experimentally changing one amino acid (Y549H) in the CDV-H protein of one dog strain we decreased expression of specialist traits and increased expression of generalist traits, thereby confirming its functional importance. A virus titer assay demonstrated that dog strains produced higher titers in cells expressing dog SLAM than cells expressing SLAM of non-dog hosts, which suggested possible fitness benefits of specialization post-cell entry. We provide in vitro evidence for the expression of specialist and generalist traits by CDV strains, and fitness trade-offs across carnivore host environments caused by antagonistic

Utility of two modified-live virus canine distemper vaccines in wild-caught fishers (Martes pennanti).

Science.gov (United States)

Peper, Steven T; Peper, Randall L; Mitcheltree, Denise H; Kollias, George V; Brooks, Robert P; Stevens, Sadie S; Serfass, Thomas L

2016-12-01

Canine distemper virus (CDV) infects families in the order Carnivora. As a preventive measure, vaccinations against CDV are frequently given to mustelids in captive environments. Our objectives were to compare the utility between two modified-live virus canine distemper vaccines (MLV CDV's), Fervac-D® (no longer manufactured) and Galaxy-D® (now manufactured by MSD Animal Health as part of a multivalent vaccine), in developing an immune response in wild-caught fishers. The Pennsylvania Fisher Reintroduction Project (PFRP) used 14 wild-caught fishers during one year of the project to evaluate the utility of vaccinations against CDV as part of any reintroduction project. Fishers were injected subcutaneously in the nape of the neck with their designated vaccine. Fervac-D® did not effectively stimulate development of a serologic antibody response, whereas Galaxy-D® had adequate seroconversion or rise of titer levels to suggest that the general use of MLV CDV may be suitable in fishers pending further studies. We recommend that future studies be conducted, evaluating the use of currently produced vaccines in fishers. Future research should also focus on the length of days required between administration of primary and booster vaccines to achieve sufficient immune response. If only primary doses are required, then hard-release reintroduction projects for fishers could be recommended. If primary and booster vaccines are required then soft-release reintroduction projects should be recommended that include captive management periods, allowing for appropriate vaccination intervals needed to maximize the probability of protection against CDV.

Identification of a novel linear B-cell epitope using a monoclonal antibody against the carboxy terminus of the canine distemper virus nucleoprotein and sequence analysis of the identified epitope in different CDV isolates.

Science.gov (United States)

Yi, Li; Cao, Zhigang; Tong, Mingwei; Cheng, Yuening; Yang, Yong; Li, Shuang; Wang, Jianke; Lin, Peng; Sun, Yaru; Zhang, Miao; Cheng, Shipeng

2017-09-29

The Nucleoprotein (NP) is the most abundant and highly immunogenic protein in canine distemper virus (CDV), playing an important role in CDV viral replication and assembly. In this study, a specific monoclonal antibody, named C8, was produced against the NP protein C terminal (amino acids 401-523). A linear N protein epitope was identified by subjecting a series of partially overlapping synthesized peptides to enzyme-linked immunosorbent assay (ELISA) analysis.The results indicated that 444 GDKYPIHFNDER 455 was the minimal linear epitope that could be recognized by mAb C8. Sequence alignments demonstrated that this linear epitope is less conserved among three CDV genotypes. We next analyzed the level of conservation of the defined epitope in19 Chinese CDV clinical isolates, and it has one site variation in amino acid among these CDV isolations. 2 isolates have the amino acid mutations F451L, while one has P448Ssubstitution.Phylogenetic analysis showed the two isolates with F451Lsubstitution had a closer relationship in a virulent strain ZJ-7, so the epitope may be a significant tag associated with virus virulence. This collection of mAb along with defined linear epitope may provide useful reagents for investigations of NP protein function and the development of CDV specific diagnostics.

The quest for a safe and effective canine distemper virus vaccine for black-footed ferrets

Science.gov (United States)

Wimsatt, Jeffrey; Biggins, Dean E.; Williams, Elizabeth S.; Becerra, Victor M.

2006-01-01

Canine distemper virus (CDV) causes a systemic disease that is highly virulent to mustelids and other carnivore (Order Carnivora) species and is found worldwide. Endemic canine distemper in wild and domestic carnivores in the United States has made reintroduction of endangered black-footed ferrets (Mustela nigripes) difficult in the absence of safe and effective CDV vaccines and vaccination practices. Toward this end, researchers have explored appropriate animal models and vaccine preparations in highly susceptible species. Published studies involving domestic ferrets (M. putorius furo) using Galaxy-D® and evaluating a recombinant canarypox-vectored vaccine for oral administration are reviewed. In addition, we present new findings in domestic and black-footed ferrets and Siberian polecats (M. eversmannii) that have extended our understanding of CDV in the black-footed ferret and other at-risk carnivore species. Original research presented here includes trials that determined an effective challenge dose (by route) of virulent CDV in domestic ferrets and Siberian polecats; the low likelihood of collateral vaccination with Galaxy-D; the adverse effect of modified-live virus boostering in black-footed ferrets receiving killed vaccine previously and the response of Siberian polecats receiving canarypoxvectored recombinant CDV vaccine (reCDV); the absence of an effect of reCDV vaccination on conception, pregnancy, and neonatal growth in Siberian polecats; and the apparent inefficacy of active reCDV vaccination during the period of passive immunity in young Siberian polecats. In the final section, we discuss emerging concerns and avenues for disease intervention that may present new opportunities to solve problems in vaccine safety, vaccine availability, field vaccine delivery, and other therapeutic modalities.

Isolation and phylogenetic analysis of canine distemper virus among domestic dogs in Vietnam.

Science.gov (United States)

Nguyen, Dung Van; Suzuki, Junko; Minami, Shohei; Yonemitsu, Kenzo; Nagata, Nao; Kuwata, Ryusei; Shimoda, Hiroshi; Vu, Chien Kim; Truong, Thuy Quoc; Maeda, Ken

2017-01-20

Canine distemper virus (CDV) is one of the most serious pathogens found in many species of carnivores, including domestic dogs. In this study, hemagglutinin (H) genes were detected in five domestic Vietnamese dogs with diarrhea, and two CDVs were successfully isolated from dogs positive for H genes. The complete genome of one isolate, CDV/dog/HCM/33/140816, was determined. Phylogenetic analysis showed that all Vietnamese CDVs belonged to the Asia-1 genotype. In addition, the H proteins of Vietnamese CDV strains were the most homologous to those of Chinese CDVs (98.4% to 99.3% identity). These results indicated that the Asia-1 genotype of CDV was the predominant genotype circulating among the domestic dog population in Vietnam and that transboundary transmission of CDV has occurred between Vietnam and China.

Canine distemper virus neutralization activity is low in human serum and it is sensitive to an amino acid substitution in the hemagglutinin protein

International Nuclear Information System (INIS)

Zhang, Xinsheng; Wallace, Olivia L.; Domi, Arban; Wright, Kevin J.; Driscoll, Jonathan; Anzala, Omu; Sanders, Eduard J.; Kamali, Anatoli; Karita, Etienne; Allen, Susan; Fast, Pat; Gilmour, Jill; Price, Matt A.; Parks, Christopher L.

2015-01-01

Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. - Highlights: • Screened 146 serum samples for measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb). • MV nAb is prevalent in the sera. • CDV neutralizing activity is generally low or absent and when detected it is present in sera with high MV nAb titers. • A neutralization-resistant CDV mutant was isolated using human serum selection. • A mutation was identified in the receptor-binding region of CDV hemagglutinin protein that confers the neutralization resistance

Canine distemper virus neutralization activity is low in human serum and it is sensitive to an amino acid substitution in the hemagglutinin protein

Energy Technology Data Exchange (ETDEWEB)

Zhang, Xinsheng, E-mail: xzhang@iavi.org [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Molecular and Cellular Biology Program, State University of New York, Brooklyn, NY (United States); Wallace, Olivia L.; Domi, Arban; Wright, Kevin J.; Driscoll, Jonathan [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Anzala, Omu [Kenya AIDS Vaccine Initiative (KAVI)-Institute of Clinical Research, Nairobi (Kenya); Sanders, Eduard J. [Centre for Geographic Medicine Research, Kenya Medical Research Institute (KEMRI), Kilifi, Kenya & Centre for Clinical Vaccinology and Tropical Medicine, University of Oxford, Headington (United Kingdom); Kamali, Anatoli [MRC/UVRI Uganda Virus Research Unit on AIDS, Masaka and Entebbe (Uganda); Karita, Etienne [Projet San Francisco, Kigali (Rwanda); Allen, Susan [Department of Pathology and Laboratory Medicine, Emory University, Atlanta, GA (United States); Fast, Pat [Department of Medical Affairs, International AIDS Vaccine Initiative, NY, NY (United States); Gilmour, Jill [Human Immunology Laboratory, International AIDS Vaccine Initiative, London (United Kingdom); Price, Matt A. [Department of Medical Affairs, International AIDS Vaccine Initiative, NY, NY (United States); Department of Epidemiology and Biostatistics, University of California at San Francisco, San Francisco, CA (United States); Parks, Christopher L. [AIDS Vaccine Design and Development Laboratory, International AIDS Vaccine Initiative (IAVI), Brooklyn, NY (United States); Molecular and Cellular Biology Program, State University of New York, Brooklyn, NY (United States)

2015-08-15

Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. - Highlights: • Screened 146 serum samples for measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb). • MV nAb is prevalent in the sera. • CDV neutralizing activity is generally low or absent and when detected it is present in sera with high MV nAb titers. • A neutralization-resistant CDV mutant was isolated using human serum selection. • A mutation was identified in the receptor-binding region of CDV hemagglutinin protein that confers the neutralization resistance.

Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR.

Science.gov (United States)

Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T

1995-06-01

For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

Detection and differentiation of wild-type and vaccine strains of canine distemper virus by a duplex reverse transcription polymerase chain reaction.

Science.gov (United States)

Dong, X Y; Li, W H; Zhu, J L; Liu, W J; Zhao, M Q; Luo, Y W; Chen, J D

2015-01-01

Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance.

Genotyping of canine distemper virus strains circulating in Brazil from 2008 to 2012.

Science.gov (United States)

Budaszewski, Renata da Fontoura; Pinto, Luciane Dubina; Weber, Matheus Nunes; Caldart, Eloiza Teles; Alves, Christian Diniz Beduschi Travassos; Martella, Vito; Ikuta, Nilo; Lunge, Vagner Ricardo; Canal, Cláudio Wageck

2014-02-13

Canine distemper virus (CDV) is a major pathogen of dogs and represents a serious threat to both unvaccinated and vaccinated animals. This study surveyed dogs with or without clinical signs related to canine distemper from different regions of Brazil from 2008 to 2012. A total of 155 out of 386 animals were found to be CDV positive by RT-PCR; 37 (23.8%) dogs were asymptomatic at the time of sampling, and 90 (58%) displayed clinical signs suggestive of distemper. Nineteen (12.2%) dogs had a record of complete vaccination, 15 (9.6%) had an incomplete vaccination protocol, and 76 (49%) had no vaccination record. Based on the sequence analysis of the complete hemagglutinin gene of 13 samples, 12 of the strains were characterized as Genotype South America-I/Europe. Considering criteria of at least 95% nucleotide identity to define a genotype and 98% to define a subgenotype, South America-I/Europe sequences segregated into eight different phylogenetically well-defined clusters that circulated or co-circulated in distinct geographical areas. Together, these findings highlight the relevance of CDV infection in Brazilian dogs, demonstrate the predominance of one genotype in Brazil and support the need to intensify the current control measures. Copyright © 2014 Elsevier B.V. All rights reserved.

Genetic characterization of an isolate of canine distemper virus from a Tibetan Mastiff in China.

Science.gov (United States)

Li, Weike; Li, Tiansong; Liu, Yuxiu; Gao, Yuwei; Yang, Songtao; Feng, Na; Sun, Heting; Wang, Shengle; Wang, Lei; Bu, Zhigao; Xia, Xianzhu

2014-08-01

Canine distemper (CD) is a highly contagious, often fatal, multisystemic, and incurable disease in dogs and other carnivores, which is caused by canine distemper virus (CDV). Although vaccines have been used as the principal means of controlling the disease, CD has been reported in vaccinated animals. The hemoagglutinin (H) protein is one of the most important antigens for inducing protective immunity against CD, and antigenic variation of recent CDV strains may explain vaccination failure. In this study, a new CDV isolate (TM-CC) was obtained from a Tibetan Mastiff that died of distemper, and its genome was characterized. Phylogenetic analysis of the H gene revealed that the CDV-TM-CC strain is unique among 20 other CDV strains and can be classified into the Asia-1 group with the Chinese strains, Hebei and HLJ1-06, and the Japanese strain, CYN07-hV. The H gene of CDV-TM-CC shows low identity (90.4 % nt and 88.9 % aa) with the H gene of the classical Onderstepoort vaccine strain, which may explain the inability of the Tibetan Mastiff to mount a protective immune response. We also performed a comprehensive phylogenetic analysis of the N, P, and F protein sequences, as well as potential N-glycosylation sites and cysteine residues. This analysis shows that an N-glycosylation site at aa 108-110 within the F protein of CDV-TM-CC is specific for the wild-type strains (5804P, A75/17, and 164071) and the Asia-1 group strains, and may be another important factor for the poor immune response. These results provide important information for the design of CD vaccines in the China region and elsewhere.

Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus

OpenAIRE

Wong Min-Liang; Hsu Tien-Huan; Lin Fong-Yuan; Lin Kuan-Hsun; Chiou Shyan-Song; Wang Chi-Young; Lee Min-Shiuh; Chulakasian Songkhla; Chang Tien-Jye; Hsu Wei-Li

2010-01-01

Abstract Background Canine distemper virus (CDV) is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hen...

Phylogenetic analysis of canine distemper virus in domestic dogs in Nanjing, China.

Science.gov (United States)

Bi, Zhenwei; Wang, Yongshan; Wang, Xiaoli; Xia, Xingxia

2015-02-01

Canine distemper virus (CDV) infects a broad range of carnivores, including wild and domestic Canidae. The hemagglutinin gene, which encodes the attachment protein that determines viral tropism, has been widely used to determine the relationship between CDV strains of different lineages circulating worldwide. We determined the full-length H gene sequences of seven CDV field strains detected in domestic dogs in Nanjing, China. A phylogenetic analysis of the H gene sequences of CDV strains from different geographic regions and vaccine strains was performed. Four of the seven CDV strains were grouped in the same cluster of the Asia-1 lineage to which the vast majority of Chinese CDV strains belong, whereas the other three were clustered within the Asia-4 lineage, which has never been detected in China. This represents the first record of detection of strains of the Asia-4 lineage in China since this lineage was reported in Thailand in 2013.

Serologic responses after vaccination of fennec foxes (Vulpes zerda) and meerkats (Suricata suricatta) with a live, canarypox-vectored canine distemper virus vaccine.

Science.gov (United States)

Coke, Rob L; Backues, Kay A; Hoover, John P; Saliki, Jeremiah T; Ritchey, Jerry W; West, Gary D

2005-06-01

Fennec foxes (Vulpes zerda) and meerkats (Suricata suricatta) are considered to be susceptible to canine distemper virus (CDV) infection. Although no definitive clinical cases of natural CDV infections have been reported, mortalities due to CDV have been suspected and are reported in other closely related species. A commercially available monovalent, live, canarypox-vectored CDV vaccine induced neutralizing antibody titers that were maintained for at least a year in both fennec foxes and meerkats.

Infectious Progression of Canine Distemper Virus from Circulating Cerebrospinal Fluid into the Central Nervous System.

Science.gov (United States)

Takenaka, Akiko; Sato, Hiroki; Ikeda, Fusako; Yoneda, Misako; Kai, Chieko

2016-10-15

In the current study, we generated recombinant chimeric canine distemper viruses (CDVs) by replacing the hemagglutinin (H) and/or phosphoprotein (P) gene in an avirulent strain expressing enhanced green fluorescent protein (EGFP) with those of a mouse-adapted neurovirulent strain. An in vitro experimental infection indicated that the chimeric CDVs possessing the H gene derived from the mouse-adapted CDV acquired infectivity for neural cells. These cells lack the CDV receptors that have been identified to date (SLAM and nectin-4), indicating that the H protein defines infectivity in various cell lines. The recombinant viruses were administered intracerebrally to 1-week-old mice. Fatal neurological signs of disease were observed only with a recombinant CDV that possessed both the H and P genes of the mouse-adapted strain, similar to the parental mouse-adapted strain, suggesting that both genes are important to drive virulence of CDV in mice. Using this recombinant CDV, we traced the intracerebral propagation of CDV by detecting EGFP. Widespread infection was observed in the cerebral hemispheres and brainstems of the infected mice. In addition, EGFP fluorescence in the brain slices demonstrated a sequential infectious progression in the central nervous system: CDV primarily infected the neuroependymal cells lining the ventricular wall and the neurons of the hippocampus and cortex adjacent to the ventricle, and it then progressed to an extensive infection of the brain surface, followed by the parenchyma and cortex. In the hippocampal formation, CDV spread in a unidirectional retrograde pattern along neuronal processes in the hippocampal formation from the CA1 region to the CA3 region and the dentate gyrus. Our mouse model demonstrated that the main target cells of CDV are neurons in the acute phase and that the virus spreads via neuronal transmission pathways in the hippocampal formation. CDV is the etiological agent of distemper in dogs and other carnivores, and in

Wildlife Reservoirs of Canine Distemper Virus Resulted in a Major Outbreak in Danish Farmed Mink (Neovison vison)

DEFF Research Database (Denmark)

Trebbien, Ramona; Chriél, Mariann; Struve, Tina

2014-01-01

A major outbreak of canine distemper virus (CDV) in Danish farmed mink (Neovison vison) started in the late summer period of 2012. At the same time, a high number of diseased and dead wildlife species such as foxes, raccoon dogs, and ferrets were observed. To track the origin of the outbreak virus...

Detection of canine distemper virus serum neutralizing antibodies in captive U.S. phocids.

Science.gov (United States)

Clancy, Meredith M; Gamble, Kathryn C; Travis, Dominic A

2013-03-01

Antibodies to morbilliviruses have been documented in free-ranging pinnipeds throughout populations in the Atlantic and Arctic Oceans, but not from the Pacific Ocean. As a symbolic geographic barrier between the exposed Atlantic and naive Pacific populations, the captive phocid population in North America had undocumented serologic status. In this study, canine distemper virus (CDV) serum neutralization assays were used to assess the prevalence of antibodies in this population with participation of 25 U.S. institutions from grey seals (Halichoerus grypus, n = 6) and harbor seals (Phoca vitulina, n = 108). Historic and environmental risk factors associated with the epidemiology of distemper virus were collected by survey. Based on antibodies to canine distemper virus, the prevalence of exposure in this population was 25.5%, with 28 seals (grey, n = 2; harbor, n = 26) demonstrating antibody titers > or = 1:16, and positive titers ranged from 1:4 to 1:1,536. By survey analysis, strong associations with seropositive status were identified for captive origin (P = 0.013) and movement among institutions (P = 0.024). Size of population has positive correlation with likelihood of seropositive seals at an institution (P = 0.020). However, no major husbandry or enclosure-based risk factors were identified in institutions with seropositive seals, and no interaction between individual or institutional risk factors was identified. Previously undocumented prior to this study, CDV antibodies were measured in harbor seals (n = 2) recently stranded from the Pacific coast.

Evaluation of a Direct Immunofluorescent Assay and/or Conjunctival Cytology for Detection of Canine Distemper Virus Antigen.

Science.gov (United States)

Athanasiou, Labrini V; Kantere, Maria C; Kyriakis, Constantinos S; Pardali, Dimitra; Adamama Moraitou, Katerina; Polizopoulou, Zoe S

2018-04-01

Canine distemper is a common and potentially lethal multisystemic disease caused by the Canine distemper virus (CDV). We evaluated the diagnostic performance of direct immunofluorescent assay (FA) and cytology to detect CDV antigen in conjunctival cells compared with an established polymerase chain reaction (PCR) detection assay used as a gold standard for CDV diagnosis. Samples were collected from 57 young dogs presenting with central nervous system signs compatible with distemper disease. Exfoliative epithelial cells were collected from the right and left conjunctiva of each animal using nylon-bristled cytobrushes for cytology and cotton swabs for FA and PCR. For the direct FA, samples were stained with anti-CDV polyclonal antiserum conjugated to fluorescein isothiocyanate and imaged using a fluorescent microscope. Out of 57 dogs tested, 19 were PCR positive (15 positive in direct FA and 4 positive in cytology, including one that was negative by PCR), whereas 37 dogs were negative in all methods. A good agreement was observed between the FA and PCR, with a κ-value of 0.833 (95% CI: 0.678-0.989). Meanwhile, there was poor agreement between cytology and PCR (κ-value of 0.164; 95% CI: -0.045 to 0.373) and a fair agreement between FA and cytology (κ-value of 0.231; 95% CI: -0.026 to 0.487). Our results indicated a poor performance of cytology for the detection of CDV antigen. In contrast, FA is a 100% specific and an adequately sensitive assay (sensitivity: 78.95%, negative likelihood ratio: 0.21, 95% CI: 0.09-0.50) for antemortem diagnosis of canine distemper.

Establishment of reverse transcription loop-mediated isothermal amplification for rapid detection and differentiation of canine distemper virus infected and vaccinated animals.

Science.gov (United States)

Liu, Da-Fei; Liu, Chun-Guo; Tian, Jin; Jiang, Yi-Tong; Zhang, Xiao-Zhan; Chai, Hong-Liang; Yang, Tian-Kuo; Yin, Xiu-Chen; Zhang, Hong-Ying; Liu, Ming; Hua, Yu-Ping; Qu, Lian-Dong

2015-06-01

Although widespread vaccination against canine distemper virus (CDV) has been conducted for many decades, several canine distemper outbreaks in vaccinated animals have been reported frequently. In order to detect and differentiate the wild-type and vaccine strains of the CDV from the vaccinated animals, a novel reverse transcription loop-mediated isothermal amplification (RT-LAMP) method was developed. A set of four primers-two internal and two external-were designed to target the H gene for the specific detection of wild-type CDV variants. The CDV-H RT-LAMP assay rapidly amplified the target gene, within 60 min, using a water bath held at a constant temperature of 65°C. The assay was 100-fold more sensitive than conventional RT-PCR, with a detection limit of 10(-1)TCID50ml(-1). The system showed a preference for wild-type CDV, and exhibited less sensitivity to canine parvovirus, canine adenovirus type 1 and type 2, canine coronavirus, and canine parainfluenza virus. The assay was validated using 102 clinical samples obtained from vaccinated dog farms, and the results were comparable to a multiplex nested RT-PCR assay. The specific CDV-H RT-LAMP assay provides a simple, rapid, and sensitive tool for the detection of canines infected with wild-type CDV from canines vaccinated with attenuated vaccine. Copyright © 2015 Elsevier B.V. All rights reserved.

Molecular surveillance of canine distemper virus in diarrhoetic puppies in northeast China from May 2014 to April 2015.

Science.gov (United States)

Li, Chunqiu; Guo, Donghua; Wu, Rui; Kong, Fanzhi; Zhai, Junjun; Yuan, Dongwei; Sun, Dongbo

2018-04-24

To trace the prevalence of canine distemper virus (CDV) in diarrhoetic dogs, a total of 201 stool samples were collected in the Heilongjiang province of northeastern China from May 2014 to April 2015. The 201 fecal samples were subjected to the detection of CDV by using RT-PCR targeting the partial N gene, phylogenetic analysis based on the complete H gene, and co-infection analysis. Results indicated that 24.88% (50/201) of the samples were positive for CDV. The fifty CDV samples exhibited an overall co-infection rate of 94% (47/50) with four enteric viruses (82%, 41/50) and five bacteria (72%, 36/50). The positivity rate of CDV exhibited differences among regions, seasons, ages, and immunization status. Phylogenetic analysis of the complete H genes (n=6) revealed that the CDV strains identified in our study belonged to the Asia-1 group, and showed genetic diversities. These data provide evidence that there are a number of genetically diverse CDV Asia-1 strains circulating in diarrhoetic dogs in northeastern China; the CDV-affected animals exhibit the high co-infection with other enteric viruses and bacteria.

The fusion protein of wild-type canine distemper virus is a major determinant of persistent infection

International Nuclear Information System (INIS)

Plattet, Philippe; Rivals, Jean-Paul; Zuber, BenoIt; Brunner, Jean-Marc; Zurbriggen, Andreas; Wittek, Riccardo

2005-01-01

The wild-type A75/17 canine distemper virus (CDV) strain induces a persistent infection in the central nervous system but infects cell lines very inefficiently. In contrast, the genetically more distant Onderstepoort CDV vaccine strain (OP-CDV) induces extensive syncytia formation. Here, we investigated the roles of wild-type fusion (F WT ) and attachment (H WT ) proteins in Vero cells expressing, or not, the canine SLAM receptor by transfection experiments and by studying recombinants viruses expressing different combinations of wild-type and OP-CDV glycoproteins. We show that low fusogenicity is not due to a defect of the envelope proteins to reach the cell surface and that H WT determines persistent infection in a receptor-dependent manner, emphasizing the role of SLAM as a potent enhancer of fusogenicity. However, importantly, F WT reduced cell-to-cell fusion independently of the cell surface receptor, thus demonstrating that the fusion protein of the neurovirulent A75/17-CDV strain plays a key role in determining persistent infection

Ribavirin and boceprevir are able to reduce Canine distemper virus growth in vitro.

Science.gov (United States)

Lanave, Gianvito; Cavalli, Alessandra; Martella, Vito; Fontana, Tommaso; Losappio, Ruggero; Tempesta, Maria; Decaro, Nicola; Buonavoglia, Domenico; Camero, Michele

2017-10-01

Canine distemper virus (CDV) is a major infectious disease of dogs. Although vaccines were successful to control CDV spread in canine population, the disease is still common and may pose a threat to unvaccinated dogs. In the attempt to develop specific anti-viral therapeutic tools, the efficacy of several molecules against CDV has been investigated in vitro. In this study the antiviral efficacy in vitro against CDV of ribavirin and boceprevir alone or in combination was evaluated. CDV growth in VERO cells was inhibited by ribavirin, by boceprevir and by a combination of the two molecules at non-cytotoxic concentrations, as evaluated by end-point viral titration in cell monolayers and by quantification of viral RNA using quantitative RT-PCR. By end-point titration, a statistically significant reduction in CDV replication was observed only using ribavirin and boceprevir in combination. By quantitative RT-PCR, a significant reduction of viral growth was observed either in cells treated with ribavirin or boceprevir or with both the two molecules. The association of ribavirin or boceprevir was able to decrease CDV growth by up to 3.4458 logs with respect to untreated infected cells, chiefly at the highest virus dilutions. The results obtained in this study may constitute an important basis for the development of CDV therapies. Copyright © 2017 Elsevier B.V. All rights reserved.

Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China

Directory of Open Access Journals (Sweden)

Tan Bin

2011-11-01

Full Text Available Abstract A new isolate of canine distemper virus (CDV, named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N, phosphoprotein (P and receptor binding haemagglutinin (H gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.

Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China.

Science.gov (United States)

Tan, Bin; Wen, Yong-Jun; Wang, Feng-Xue; Zhang, Shu-Qin; Wang, Xiu-Dong; Hu, Jia-Xin; Shi, Xin-Chuan; Yang, Bo-Chao; Chen, Li-Zhi; Cheng, Shi-Peng; Wu, Hua

2011-11-16

A new isolate of canine distemper virus (CDV), named ZJ7, was isolated from lung tissues of a dog suspected with CDV infection using MDCK cells. The ZJ7 isolate induced cytopathogenic effects of syncytia in MDCK cell after six passages. In order to evaluate pathogenesis of ZJ7 strain, three CDV sero-negative dogs were intranasally inoculated with its virus suspension. All infected dogs developed clinical signs of severe bloody diarrhea, conjunctivitis, ocular discharge, nasal discharge and coughing, fever and weight loss at 21 dpi, whereas the mock group infected with DMEM were normal. The results demonstrated that CDV-ZJ7 strain isolated by MDCK cell was virulent, and the nucleotide and amino acid sequences of strain ZJ7 had no change after isolation by MDCK cell when compared with the original virus from the fresh tissues. Molecular and phylogenetic analyses for the nucleocapsid (N), phosphoprotein (P) and receptor binding haemagglutinin (H) gene of the ZJ7 isolate clearly showed it is joins to the Asia 1 group cluster of CDV strains, the predominant genotype in China.

Monitoring of Antibodies Titre Against Canine Distemper Virus in Ferrets Vaccinated with a Live Modified Vaccine

OpenAIRE

L. Pavlačík; V. Celer, Jr.; V. Kajerová; V. Jekl; Z. Knotek; I. Literák

2007-01-01

A group of five ferrets vaccinated against the canine distemper virus (CDV) was evaluated as to the onset of anti-CDV antibody production and the serum levels of the animals were monitored for one year. The ferrets were immunized with a live attenuated vaccine. The vaccination pattern was as follows: primary vaccination at the age of 6 weeks, fi rst revaccination at 30 days after primary vaccination, and second revaccination after another 30 days. Blood samples were taken prior to primary vac...

Emergence of canine distemper virus strains with modified molecular signature and enhanced neuronal tropism leading to high mortality in wild carnivores.

Science.gov (United States)

Origgi, F C; Plattet, P; Sattler, U; Robert, N; Casaubon, J; Mavrot, F; Pewsner, M; Wu, N; Giovannini, S; Oevermann, A; Stoffel, M H; Gaschen, V; Segner, H; Ryser-Degiorgis, M-P

2012-11-01

An ongoing canine distemper epidemic was first detected in Switzerland in the spring of 2009. Compared to previous local canine distemper outbreaks, it was characterized by unusually high morbidity and mortality, rapid spread over the country, and susceptibility of several wild carnivore species. Here, the authors describe the associated pathologic changes and phylogenetic and biological features of a multiple highly virulent canine distemper virus (CDV) strain detected in and/or isolated from red foxes (Vulpes vulpes), Eurasian badgers (Meles meles), stone (Martes foina) and pine (Martes martes) martens, from a Eurasian lynx (Lynx lynx), and a domestic dog. The main lesions included interstitial to bronchointerstitial pneumonia and meningopolioencephalitis, whereas demyelination--the classic presentation of CDV infection--was observed in few cases only. In the brain lesions, viral inclusions were mainly in the nuclei of the neurons. Some significant differences in brain and lung lesions were observed between foxes and mustelids. Swiss CDV isolates shared together with a Hungarian CDV strain detected in 2004. In vitro analysis of the hemagglutinin protein from one of the Swiss CDV strains revealed functional and structural differences from that of the reference strain A75/17, with the Swiss strain showing increased surface expression and binding efficiency to the signaling lymphocyte activation molecule (SLAM). These features might be part of a novel molecular signature, which might have contributed to an increase in virus pathogenicity, partially explaining the high morbidity and mortality, the rapid spread, and the large host spectrum observed in this outbreak.

Evidence of Two Cocirculating Canine Distemper Virus Strains in Mesocarnivores from Northern Colorado.

Science.gov (United States)

Wostenberg, Darren J; Walker, Nikki; Fox, Karen A; Spraker, Terry R; Piaggio, Antoinette J; Gilbert, Amy

2018-03-02

Canine distemper virus (CDV) is a highly contagious pathogen that principally infects wildlife and domestic carnivores. Peridomestic species such as raccoons ( Procyon lotor) experience outbreaks with high mortality. Clinical signs of infection include anorexia, fever, respiratory infection, and neurologic complications. Although not zoonotic, CDV poses a high risk to unvaccinated domestic animals and the conservation of endangered species. During 2013-2016, we opportunistically collected wild and domestic carnivore specimens through a rabies surveillance program in northern Colorado. Brainstem and cerebellar tissue samples were independently tested for rabies and CDV by fluorescent antibody test. We tested a total of 478 animals for CDV, comprised of 10 wild and domestic carnivore species. A total of 24% (71/300) raccoons and 4% (1/26) coyotes ( Canis latrans) tested positive for CDV, but coinfection with rabies virus was not observed among CDV-positive animals. We extracted RNA from positive tissues, and a reverse-transcription PCR was used to create complementary DNA. We amplified and sequenced the hemagglutinin gene from 60 CDV-positive tissues, and a median joining network and maximum likelihood phylogenetic tree revealed two major lineages among samples. Phylogenetic analysis indicated that our sequences were most similar to: 1) the America-2 ( n=55) and 2) the America-3 ( n=5) CDV lineages circulating in North America. Our results indicated two distinct and distantly related clades of CDV overlapping geographically and temporally among raccoon populations in northern Colorado.

Virus isolation and molecular characterization of canine distemper virus by RT-PCR from a mature dog with multifocal encephalomyelit Isolamento e caracterização molecular do vírus da cinomose canina por RT-PCR a partir de um cão adulto com encefalomielite multifocal

Directory of Open Access Journals (Sweden)

Alexandre Mendes Amude

2007-06-01

Full Text Available A case of multifocal distemper encephalomyelitis in a mature dog is described. In the presented case the ante mortem clinical diagnosis of canine distemper virus (CDV infection could not be ideally performed due to the absence of typical signs of distemper, such as myoclonus and systemic signs accompanying the nervous signs. The definitive diagnosis of distemper encephalomyelitis was only carried out at post mortem through virus isolation in cell culture from fresh central nervous system (CNS fragments and CDV nucleoprotein gene detection in the CNS by RT-PCR.Descreve-se um caso de encefalomielite multifocal pela cinomose em um cão adulto. No caso apresentado o diagnóstico clínico da infecção pelo vírus da cinomose canina (CDV não pode ser adequadamente realizado devido à ausência de sinais típicos da enfermidade, tais como mioclonia e sinais sistêmicos. O diagnóstico definitivo somente foi possível post mortem pelo isolamento do CDV em cultivo celular a partir dos fragmentos frescos do sistema nervoso central (SNC e pela detecção do gene da nucleoproteína do CDV em fragmentos do SNC por meio da RT-PCR.

Lymphotropism and host responses during acute wild-type canine distemper virus infections in a highly susceptible natural host

DEFF Research Database (Denmark)

Nielsen, Line; Søgaard, Mette; Jensen, Trine Hammer

2009-01-01

The mechanisms behind the in vivo virulence of immunosuppressive wild-type Morbillivirus infections are still not fully understood. To investigate lymphotropism and host responses we have selected the natural host model of canine distemper virus (CDV) infection in mink. This model displays...

Efficacy of Recombinant Canine Distemper Virus Expressing Leishmania Antigen against Leishmania Challenge in Dogs.

Science.gov (United States)

Miura, Ryuichi; Kooriyama, Takanori; Yoneda, Misako; Takenaka, Akiko; Doki, Miho; Goto, Yasuyuki; Sanjoba, Chizu; Endo, Yasuyuki; Fujiyuki, Tomoko; Sugai, Akihiro; Tsukiyama-Kohara, Kyoko; Matsumoto, Yoshitsugu; Sato, Hiroki; Kai, Chieko

2015-01-01

Canine distemper virus (CDV) vaccination confers long-term protection against CDV reinfection. To investigate the utility of CDV as a polyvalent vaccine vector for Leishmania, we generated recombinant CDVs, based on an avirulent Yanaka strain, that expressed Leishmania antigens: LACK, TSA, or LmSTI1 (rCDV-LACK, rCDV-TSA, and rCDV-LmSTI1, respectively). Dogs immunized with rCDV-LACK were protected against challenge with lethal doses of virulent CDV, in the same way as the parental Yanaka strain. To evaluate the protective effects of the recombinant CDVs against cutaneous leishmaniasis in dogs, dogs were immunized with one recombinant CDV or a cocktail of three recombinant CDVs, before intradermal challenge (in the ears) with infective-stage promastigotes of Leishmania major. Unvaccinated dogs showed increased nodules with ulcer formation after 3 weeks, whereas dogs immunized with rCDV-LACK showed markedly smaller nodules without ulceration. Although the rCDV-TSA- and rCDV-LmSTI1-immunized dogs showed little protection against L. major, the cocktail of three recombinant CDVs more effectively suppressed the progression of nodule formation than immunization with rCDV-LACK alone. These results indicate that recombinant CDV is suitable for use as a polyvalent live attenuated vaccine for protection against both CDV and L. major infections in dogs.

Elements in the canine distemper virus M 3' UTR contribute to control of replication efficiency and virulence.

Directory of Open Access Journals (Sweden)

Danielle E Anderson

Full Text Available Canine distemper virus (CDV is a negative-sense, single-stranded RNA virus within the genus Morbillivirus and the family Paramyxoviridae. The Morbillivirus genome is composed of six transcriptional units that are separated by untranslated regions (UTRs, which are relatively uniform in length, with the exception of the UTR between the matrix (M and fusion (F genes. This UTR is at least three times longer and in the case of CDV also highly variable. Exchange of the M-F region between different CDV strains did not affect virulence or disease phenotype, demonstrating that this region is functionally interchangeable. Viruses carrying the deletions in the M 3' UTR replicated more efficiently, which correlated with a reduction of virulence, suggesting that overall length as well as specific sequence motifs distributed throughout the region contribute to virulence.

Wildlife Reservoirs of Canine Distemper Virus Resulted in a Major Outbreak in Danish Farmed Mink (Neovison vison)

Science.gov (United States)

Trebbien, Ramona; Chriel, Mariann; Struve, Tina; Hjulsager, Charlotte Kristiane; Larsen, Gitte; Larsen, Lars Erik

2014-01-01

A major outbreak of canine distemper virus (CDV) in Danish farmed mink (Neovison vison) started in the late summer period of 2012. At the same time, a high number of diseased and dead wildlife species such as foxes, raccoon dogs, and ferrets were observed. To track the origin of the outbreak virus full-length sequencing of the receptor binding surface protein hemagglutinin (H) was performed on 26 CDV's collected from mink and 10 CDV's collected from wildlife species. Subsequent phylogenetic analyses showed that the virus circulating in the mink farms and wildlife were highly identical with an identity at the nucleotide level of 99.45% to 100%. The sequences could be grouped by single nucleotide polymorphisms according to geographical distribution of mink farms and wildlife. The signaling lymphocytic activation molecule (SLAM) receptor binding region in most viruses from both mink and wildlife contained G at position 530 and Y at position 549; however, three mink viruses had an Y549H substitution. The outbreak viruses clustered phylogenetically in the European lineage and were highly identical to wildlife viruses from Germany and Hungary (99.29% – 99.62%). The study furthermore revealed that fleas (Ceratophyllus sciurorum) contained CDV and that vertical transmission of CDV occurred in a wild ferret. The study provides evidence that wildlife species, such as foxes, play an important role in the transmission of CDV to farmed mink and that the virus may be maintained in the wild animal reservoir between outbreaks. PMID:24454897

Wildlife reservoirs of canine distemper virus resulted in a major outbreak in Danish farmed mink (Neovison vison.

Directory of Open Access Journals (Sweden)

Ramona Trebbien

Full Text Available A major outbreak of canine distemper virus (CDV in Danish farmed mink (Neovison vison started in the late summer period of 2012. At the same time, a high number of diseased and dead wildlife species such as foxes, raccoon dogs, and ferrets were observed. To track the origin of the outbreak virus full-length sequencing of the receptor binding surface protein hemagglutinin (H was performed on 26 CDV's collected from mink and 10 CDV's collected from wildlife species. Subsequent phylogenetic analyses showed that the virus circulating in the mink farms and wildlife were highly identical with an identity at the nucleotide level of 99.45% to 100%. The sequences could be grouped by single nucleotide polymorphisms according to geographical distribution of mink farms and wildlife. The signaling lymphocytic activation molecule (SLAM receptor binding region in most viruses from both mink and wildlife contained G at position 530 and Y at position 549; however, three mink viruses had an Y549H substitution. The outbreak viruses clustered phylogenetically in the European lineage and were highly identical to wildlife viruses from Germany and Hungary (99.29% - 99.62%. The study furthermore revealed that fleas (Ceratophyllus sciurorum contained CDV and that vertical transmission of CDV occurred in a wild ferret. The study provides evidence that wildlife species, such as foxes, play an important role in the transmission of CDV to farmed mink and that the virus may be maintained in the wild animal reservoir between outbreaks.

The anti-canine distemper virus activities of ex vivo-expanded canine natural killer cells.

Science.gov (United States)

Park, Ji-Yun; Shin, Dong-Jun; Lee, Soo-Hyeon; Lee, Je-Jung; Suh, Guk-Hyun; Cho, Duck; Kim, Sang-Ki

2015-04-17

Natural killer (NK) cells play critical roles in induction of antiviral effects against various viruses of humans and animals. However, few data on NK cell activities during canine distemper virus (CDV) infections are available. Recently, we established a culture system allowing activation and expansion of canine non-B, non-T, large granular NK lymphocytes from PBMCs of normal dogs. In the present study, we explored the ability of such expanded NK cells to inhibit CDV infection in vitro. Cultured CD3-CD5-CD21- NK cells produced large amounts of IFN-γ, exhibited highly upregulated expression of mRNAs encoding NK-cell-associated receptors, and demonstrated strong natural killing activity against canine tumor cells. Although the expanded NK cells were dose-dependently cytotoxic to both normal and CDV-infected Vero cells, CDV infection rendered Vero cells more susceptible to NK cells. Pretreatment with anti-CDV serum from hyperimmunized dogs enhanced the antibody-dependent cellular cytotoxicity (ADCC) of NK cells against CDV-infected Vero cells. The culture supernatants of NK cells, added before or after infection, dose-dependently inhibited both CDV replication and development of CDV-induced cytopathic effects (CPEs) in Vero cells. Anti-IFN-γ antibody neutralized the inhibitory effects of NK cell culture supernatants on CDV replication and CPE induction in Vero cells. Such results emphasize the potential significance of NK cells in controlling CDV infection, and indicate that NK cells may play roles both during CDV infection and in combating such infections, under certain conditions. Copyright © 2015 Elsevier B.V. All rights reserved.

Enzyme-linked immunosorbent Assay for detecting of antibody to canine distemper virus

Directory of Open Access Journals (Sweden)

Sudarisman

2006-03-01

Full Text Available Serum neutralisation test (SNT has been established for evaluating canine distemper vaccination, but until now SNT was rarely used due to the need for continuous tissue culture facilities and requires 3 days to perform. For detecting antibody to canine distemper virus, an enzyme-linked immunosorbent assay (ELISA is relatively simple and rapid seroassay. ELISA for canine immunoglobulin (Ig G antibodies to canine distemper virus (CDV was developed by using Onderstepoort strain of canine distemper virus as coating antigen. Rabbit anti canine IgG labelled with horse radish peroxidase was used as the conjugate, while phenylenediamine dihydrochloride (OPD was used as the substrate. The ELISA results were then compared with the results of the SNT, using the sera of 312 random-source dogs from West Java. The two test-results had a high degree of correlation. Very few discrepancies occurred and most of these were at the lower limits of each test. When the sera were tested at 1 : 100 dilutions, there was a 95.5% agreement between the ELISA and SNT. Their sensitivity and spesificity were 83.9 and 98.4%. Titrated SNT and ELISA also were performed on sera from 7 dogs whose lifetime medical histories were known. The antibodies were inclining up after two months of post vaccination, where the titre was not in zero/lower position at the day of vaccination. However, antibody zero or low position were found at 28 days post vaccination. All of the results indicated that ELISA can be used for evaluating antibody to canine distemper virus response, replacing the SNT.

Arctic lineage-canine distemper virus as a cause of death in Apennine wolves (Canis lupus in Italy.

Directory of Open Access Journals (Sweden)

Daria Di Sabatino

Full Text Available Canine distemper virus (CDV infection is a primary threat affecting a wide number of carnivore species, including wild animals. In January 2013, two carcasses of Apennine wolves (Canis lupus were collected in Ortona dei Marsi (L'Aquila province, Italy by the local Veterinary Services. CDV was immediately identified either by RT-PCR or immunohistochemistry in lung and central nervous tissue samples. At the same time, severe clinical signs consistent with CDV infection were identified and taped (Videos S1-S3 from three wolves rescued in the areas surrounding the National Parks of the Abruzzi region by the Veterinary Services. The samples collected from these symptomatic animals also turned out CDV positive by RT-PCR. So far, 30 carcasses of wolves were screened and CDV was detected in 20 of them. The sequencing of the haemagglutinin gene and subsequent phylogenetic analysis demonstrated that the identified virus belonged to the CDV Arctic lineage. Strains belonging to this lineage are known to circulate in Italy and in Eastern Europe amongst domestic dogs. To the best of our knowledge this is the first report of CDV Arctic lineage epidemics in the wild population in Europe.

Efficacy of Recombinant Canine Distemper Virus Expressing Leishmania Antigen against Leishmania Challenge in Dogs.

Directory of Open Access Journals (Sweden)

Ryuichi Miura

Full Text Available Canine distemper virus (CDV vaccination confers long-term protection against CDV reinfection. To investigate the utility of CDV as a polyvalent vaccine vector for Leishmania, we generated recombinant CDVs, based on an avirulent Yanaka strain, that expressed Leishmania antigens: LACK, TSA, or LmSTI1 (rCDV-LACK, rCDV-TSA, and rCDV-LmSTI1, respectively. Dogs immunized with rCDV-LACK were protected against challenge with lethal doses of virulent CDV, in the same way as the parental Yanaka strain. To evaluate the protective effects of the recombinant CDVs against cutaneous leishmaniasis in dogs, dogs were immunized with one recombinant CDV or a cocktail of three recombinant CDVs, before intradermal challenge (in the ears with infective-stage promastigotes of Leishmania major. Unvaccinated dogs showed increased nodules with ulcer formation after 3 weeks, whereas dogs immunized with rCDV-LACK showed markedly smaller nodules without ulceration. Although the rCDV-TSA- and rCDV-LmSTI1-immunized dogs showed little protection against L. major, the cocktail of three recombinant CDVs more effectively suppressed the progression of nodule formation than immunization with rCDV-LACK alone. These results indicate that recombinant CDV is suitable for use as a polyvalent live attenuated vaccine for protection against both CDV and L. major infections in dogs.

Antibody titers for canine parvovirus type-2, canine distemper virus, and canine adenovirus type-1 in adult household dogs.

Science.gov (United States)

Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Sahara, Hiroeki

2011-09-01

Serum antibody titers for canine parvovirus type-2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type-1 (CAV-1) were investigated in 1031 healthy adult household dogs (2 to 18 years old) given an annual inoculation in the previous 11 to 13 months. The number of dogs retaining significant titers of antibodies against CPV-2, CDV, and CAV-1 were 888 (86%), 744 (72%), and 732 (71%), respectively. There were no differences between males and females in antibody titers against the 3 viruses. Antibody titer for CPV-2 was significantly higher in younger dogs than in older dogs, CDV antibody was significantly higher in older dogs than in younger dogs, and CAV titer was not associated with age.

Canine distemper virus: an emerging disease in wild endangered Amur tigers (Panthera tigris altaica).

Science.gov (United States)

Seimon, Tracie A; Miquelle, Dale G; Chang, Tylis Y; Newton, Alisa L; Korotkova, Irina; Ivanchuk, Galina; Lyubchenko, Elena; Tupikov, Andre; Slabe, Evgeny; McAloose, Denise

2013-08-13

Fewer than 500 Amur tigers (Panthera tigris altaica) remain in the wild. Due to low numbers and their solitary and reclusive nature, tiger sightings across their range in the Russian Far East and China are rare; sightings of sick tigers are rarer still. Serious neurologic disease observed in several wild tigers since 2001 suggested disease emergence in this endangered species. To investigate this possibility, histology, immunohistochemistry (IHC), in situ hybridization (ISH), and reverse transcription-PCR (RT-PCR) were performed on tissues from 5 affected tigers that died or were destroyed in 2001, 2004, or 2010. Our results reveal canine distemper virus (CDV) infection as the cause of neurologic disease in two tigers and definitively establish infection in a third. Nonsuppurative encephalitis with demyelination, eosinophilic nuclear viral inclusions, and positive immunolabeling for CDV by IHC and ISH were present in the two tigers with available brain tissue. CDV phosphoprotein (P) and hemagglutinin (H) gene products were obtained from brains of these two tigers by RT-PCR, and a short fragment of CDV P gene sequence was detected in lymph node tissue of a third tiger. Phylogenetically, Amur tiger CDV groups with an Arctic-like strain in Baikal seals (Phoca siberica). Our results, which include mapping the location of positive tigers and recognition of a cluster of cases in 2010, coupled with a lack of reported CDV antibodies in Amur tigers prior to 2000 suggest wide geographic distribution of CDV across the tiger range and recent emergence of CDV as a significant infectious disease threat to endangered Amur tigers in the Russian Far East. Recognition of disease emergence in wildlife is a rare occurrence. Here, for the first time, we identify and characterize a canine distemper virus (CDV), the second most common cause of infectious disease death in domestic dogs and a viral disease of global importance in common and endangered carnivores, as the etiology of

Expression of canine distemper virus receptor nectin-4 in the central nervous system of dogs.

Science.gov (United States)

Pratakpiriya, Watanyoo; Ping Teh, Angeline Ping; Radtanakatikanon, Araya; Pirarat, Nopadon; Thi Lan, Nguyen; Takeda, Makoto; Techangamsuwan, Somporn; Yamaguchi, Ryoji

2017-03-23

Canine distemper virus (CDV) exhibits lymphotropic, epitheliotropic, and neurotropic nature, and causes a severe systemic infection in susceptible animals. Initially, signaling lymphocyte activation molecule (SLAM) expressed on immune cells has been identified as a crucial cellular receptor for CDV. Currently, nectin-4 expressed in epithelia has been shown to be another receptor for CDV. Our previous study demonstrated that neurons express nectin-4 and are infected with CDV. In this study, we investigated the distribution pattern of nectin-4 in various cell types in the canine central nervous system and showed its relation to CDV infection to further clarify the pathology of disease. Histopathological, immunohistochemical and immunofluorescent analyses were done using formalin-fixed paraffin-embedded tissues of CDV-infected dogs. Dual staining of nectin-4 and CDV antigen or nectin-4 and brain cell markers was performed. Nectin-4 was detected in ependymal cells, epithelia of choroid plexus, meningeal cells, neurons, granular cells, and Purkinje's cells. CDV antigens were detected in these nectin-4-positive cells, further suggesting contribution of nectin-4 for the CDV neurovirulence. On the other hand, astrocytes did not express nectin-4, although they were frequently infected with CDV. Since astrocytes are negative for SLAM expression, they must express an unidentified CDV receptor, which also contributes to CDV neurovirulence.

Clinical syndromes of nervous distemper in dogs initially presented without conventional evidences of CDV infectionSíndromes clínicas da apresentação neurológica da cinomose em cães admitidos inicialmente sem as evidencias convencionais da infecção pelo CDV

Directory of Open Access Journals (Sweden)

Alexandre Mendes Amude

2012-12-01

Full Text Available Despite large vaccination practice, canine distemper virus (CDV is yet an important infectious agent that leads to nervous disease in canine populations worldwide. Unfortunately, the clinical diagnosis of distemper encephalomyelitis is often difficult in cases presented without conventional evidences of CDV infection such as systemic signs and myoclonus. Therefore, the aim of this study was to evaluate the neurological deficits and the clinical syndromes of nervous distemper in dogs suffering from neurological disease admitted in the absence of the conventional evidences of CDV infection. Dogs presented with central nervous disease in which toxic/traumatic or a CDV-free etiology could be excluded ante mortem were prospectively followed up and which that died (natural death or euthanasia, despite medical treatment and necropsy was carried out were included in this study. Ten out of 35 evaluated dogs were post mortem diagnosed with CDV encephalomyelitis by both CDV RNA detection through RT-PCR assay in nervous tissue and observation of distemper-compatible neuroparenchymal lesions. According to the nervous signs, clinical history, and the age of presentation, the distemper dogs were grouped in three clinical syndromes of CDV encephalomyelitis: i canine distemper encephalitis in immature dogs (CDEID (n=3; ii multifocal distemper encephalomyelitis in mature dogs (MDEMD (n=6; and iii old dog encephalitis (ODE-like syndrome (n=1. The respective nervous deficits expected from each one of the syndromes herein presented were discussed.Apesar da prática de vacinação, o vírus da cinomose canina (CDV ainda é um importante agente infeccioso que leva à doença neurológica na população canina em todo o mundo. Infelizmente, o diagnóstico clínico da encefalomielite pela cinomose é difícil nos casos apresentados sem evidências clínicas convencionais de infecção pelo CDV, tais como sinais sistêmicos e mioclonia. Portanto, o objetivo deste estudo

Detection by hemi-nested reverse transcription polymerase chain reaction and genetic characterization of wild type strains of Canine distemper virus in suspected infected dogs.

Science.gov (United States)

Di Francesco, Cristina E; Di Francesco, Daniela; Di Martino, Barbara; Speranza, Roberto; Santori, Domenico; Boari, Andrea; Marsilio, Fulvio

2012-01-01

A new highly sensitive and specific hemi-nested reverse transcription polymerase chain reaction (RT-PCR) assay was applied to detect nucleoprotein (NP) gene of Canine distemper virus (CDV) in samples collected from dogs showing respiratory, gastrointestinal, and neurological signs. Thirty-eight out of 86 samples were positive suggesting that despite the vaccination, canine distemper may still represent a high risk to the canine population. The 968 base pair (bp) fragments from the hemagglutinin (H) gene of 10 viral strains detected in positive samples were amplified and analyzed by restriction fragment length polymorphism (RFLP) using AluI and PsiI enzymes in order to differentiate among vaccine and wild-type CDV strains and to characterize the field viral strains. The products of the both enzymatic digestions allowed identification all viruses as wild strains of CDV. In addition, the RFLP analysis with AluI provided additional information about the identity level among the strains analyzed on the basis of the positions of the cleavage site in the nucleotide sequences of the H gene. The method could be a more useful and simpler method for molecular studies of CDV strains.

Outbreak and genotyping of canine distemper virus in captive Siberian tigers and red pandas.

Science.gov (United States)

Zhang, He; Shan, Fen; Zhou, Xia; Li, Bing; Zhai, Jun-Qiong; Zou, Shu-Zhan; Wu, Meng-Fan; Chen, Wu; Zhai, Shao-Lun; Luo, Man-Lin

2017-08-15

In this study, four canine distemper virus (CDV) strains were isolated from captive Siberian tigers (Panthera tigris altaica) and red pandas (Ailurus fulgens) during two separate CDV outbreaks in a zoo in Guangdong province, China. Sequence alignment and phylogenetic analyses based on the full-length hemagglutinin (H) and fusion (F) genes showed that they were closely identical to genotype Asia-1. Prior to confirmation of CDV in Siberian tigers, to control spread of the disease, a live attenuated combination CDV vaccine was used among almost all carnivore animals except for red pandas in which another recombinant combination CDV vaccine was used. However, about two months later, CDV re-emerged and caused the death among red pandas. Based on the vaccination records, the live combination vaccine could be considered an ideal weapon against CDV in zoo carnivore animals. Although the recombinant combination CDV vaccine was safe for red pandas, its protection effectiveness remains to be further investigated. Moreover, according to the outbreak interval time and sequence characterization, we suspected that stray cats circulating in the zoo were the intermediate host, which contributed to CDV spread from stray dogs to zoo animals. This study revealed the importance of vaccination and biosecurity for zoo animals.

CANINE DISTEMPER VIRUS ANTIBODY TITERS IN DOMESTIC CATS AFTER DELIVERY OF A LIVE ATTENUATED VIRUS VACCINE.

Science.gov (United States)

Ramsay, Edward; Sadler, Ryan; Rush, Robert; Seimon, Tracie; Tomaszewicz, Ania; Fleetwood, Ellen A; McAloose, Denise; Wilkes, Rebecca P

2016-06-01

Three methods for delivering a live attenuated canine distemper virus (CDV) vaccine to domestic cats ( Felis catus ) were investigated, as models for developing vaccination protocols for tigers (Panthera tigris). Twenty domestic cats were randomly divided into four treatment groups: saline injection (negative controls); and oral, intranasal, and subcutaneous vaccinates. Cats were injected with saline or a CDV vaccine (Nobivac DP, Merck) at wk 0 and 4. Blood and nasal swabs were collected at wk 0 (prior to the initial vaccination) and weekly thereafter for 9 wk. Urine samples were collected on wk 1 to 9 after initial vaccination. Forty-nine weeks following the initial vaccination series, three cats from the subcutaneous group and three cats from the intranasal group were revaccinated. Blood was collected immediately prior, and 7 and 21 days subsequent to revaccination. Nasal swabs and urine samples were collected from each cat prior to wk 49 revaccination and daily for 7 days thereafter. Nasal swabs and urine were analyzed by quantitative PCR for vaccine virus presence. Sera were tested for CDV antibodies by virus neutralization. All cats were sero-negative for CDV antibodies at the beginning of the study, and saline-injected cats remained sero-negative throughout the study. A dramatic anamnestic response was seen following wk 4 subcutaneous vaccinations, with titers peaking at wk 6 (geometric mean = 2,435.5). Following wk 49 revaccination, subcutaneous vaccinates again mounted impressive titers (wk 52 geometric mean = 2,048). Revaccination of the intranasal group cats at wk 49 produced a small increase in titers (wk 52 geometric mean = 203). CDV viral RNA was detected in six nasal swabs but no urine samples, demonstrating low viral shedding postvaccination. The strong antibody response to subcutaneous vaccination and the lack of adverse effects suggest this vaccine is safe and potentially protective against CDV infection in domestic cats.

[Establishment and application of a Vero cell line stably expressing raccoon dog SLAM, the cellular receptor of canine distemper virus].

Science.gov (United States)

Zhao, Jianjun; Yan, Ruxun; Zhang, Hailing; Zhang, Lei; Hu, Bo; Bai, Xue; Shao, Xiqun; Chai, Xiuli; Yan, Xijun; Wu, Wei

2012-12-04

The signaling lymphocyte activation molecule (SLAM, also known as CD150), is used as a cellular receptor by canine distemper virus (CDV). Wild-type strains of CDVs can be isolated and propagated efficiently in non-lymphoid cells expressing this protein. Our aim is to establish a Vero cells expressing raccoon dog SLAM (rSLAM) to efficiently isolate CDV from pathological samples. A eukaryotic expression plasmid, pIRES2-EGFP-rSLAMhis, containing rSLAM gene fused with six histidine-coding sequence, EGFP gene, and neomycin resistance gene was constructed. After transfection with the plasmid, a stable cell line, Vero-rSLAM, was screened from Vero cells with the identification of EGFP reporter and G418 resistance. Three CD positive specimens from infected foxes and raccoon dogs were inoculated to Vero-rSLAM cells for CDV isolation. Foxes and raccoon dogs were inoculated subcutaneously LN (10)fl strain with 4 x 10(2.39)TCID50 dose to evaluate pathogenicity of CDV isolations. The rSLAMh fused gene was shown to transcript and express stably in Vero-rSLAM cells by RT-PCR and Immunohistochemistry assay. Three CDV strains were isolated successfully in Vero-rSLAM cells 36 -48 hours after inoculation with spleen or lung specimens from foxes and raccoon dogs with distemper. By contrast, no CDV was recovered from those CD positive specimens when Vero cells were used for virus isolation. Infected foxes and raccoon dogs with LN(10)f1 strain all showed typical CD symptoms and high mortality (2/3 for foxes and 3/3 for raccoon dogs) in 22 days post challenge. Our results indicate that Vero-rSLAM cells stably expressing raccoon dog SLAM are highly sensitive to CDV in clinical specimens and the CDV isolation can maintain high virulence to its host animals.

Dimerization Efficiency of Canine Distemper Virus Matrix Protein Regulates Membrane-Budding Activity.

Science.gov (United States)

Bringolf, Fanny; Herren, Michael; Wyss, Marianne; Vidondo, Beatriz; Langedijk, Johannes P; Zurbriggen, Andreas; Plattet, Philippe

2017-08-15

Paramyxoviruses rely on the matrix (M) protein to orchestrate viral assembly and budding at the plasma membrane. Although the mechanistic details remain largely unknown, structural data suggested that M dimers and/or higher-order oligomers may facilitate membrane budding. To gain functional insights, we employed a structure-guided mutagenesis approach to investigate the role of canine distemper virus (CDV) M protein self-assembly in membrane-budding activity. Three six-alanine-block (6A-block) mutants with mutations located at strategic oligomeric positions were initially designed. While the first one includes residues potentially residing at the protomer-protomer interface, the other two display amino acids located within two distal surface-exposed α-helices proposed to be involved in dimer-dimer contacts. We further focused on the core of the dimeric interface by mutating asparagine 138 (N138) to several nonconservative amino acids. Cellular localization combined with dimerization and coimmunopurification assays, performed under various denaturing conditions, revealed that all 6A-block mutants were impaired in self-assembly and cell periphery accumulation. These phenotypes correlated with deficiencies in relocating CDV nucleocapsid proteins to the cell periphery and in virus-like particle (VLP) production. Conversely, all M-N138 mutants remained capable of self-assembly, though to various extents, which correlated with proper accumulation and redistribution of nucleocapsid proteins at the plasma membrane. However, membrane deformation and VLP assays indicated that the M-N138 variants exhibiting the most reduced dimerization propensity were also defective in triggering membrane remodeling and budding, despite proper plasma membrane accumulation. Overall, our data provide mechanistic evidence that the efficiency of CDV M dimerization/oligomerization governs both cell periphery localization and membrane-budding activity. IMPORTANCE Despite the availability of

A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

Directory of Open Access Journals (Sweden)

Cui Shang-jin

2010-05-01

Full Text Available Abstract A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV. A pair of primers (P1 and P4 specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV, canine parvovirus (CPV, canine coronavirus (CCV, rabies virus (RV, or canine adenovirus (CAV. The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance.

A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus

Science.gov (United States)

2010-01-01

A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759

Severe canine distemper outbreak in unvaccinated dogs in Mozambique

Directory of Open Access Journals (Sweden)

Julieta Zacarias

2016-07-01

Full Text Available Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended. Keywords: Canine distemper; dogs; outbreak; animal welfare; Mozambique

Caspase-3/-8/-9, Bax and Bcl-2 expression in the cerebellum, lymph nodes and leukocytes of dogs naturally infected with canine distemper virus.

Science.gov (United States)

Del Puerto, H L; Martins, A S; Moro, L; Milsted, A; Alves, F; Braz, G F; Vasconcelos, A C

2010-01-26

Canine distemper is an immunosuppressive disease caused by the canine distemper virus (CDV). Pathogenesis mainly involves the central nervous system and immunosuppression. Dogs naturally infected with CDV develop apoptotic cells in lymphoid tissues and the cerebellum, but this apoptotic mechanism is not well characterized. To better understand this process, we evaluated the expression of Bax, Bcl-2, and caspase-3, -8 and -9, by evaluating mRNA levels in the peripheral blood, lymph nodes and cerebellum of CDV-infected (CDV+) and uninfected (CDV-) dogs by real-time polymerase chain reaction (PCR). Blood samples from 12 CDV+ and 8 CDV- dogs, diagnosed by reverse transcription-PCR, were subjected to hematological analysis and apoptotic gene expression was evaluated using real-time-PCR. Tissues from the cerebellum and lymph nodes of four CDV+ and three CDV-dogs were also subjected to real time-PCR. No significant differences were found between CDV+ and CDV- dogs in the hemotological results or in the expression of caspase-3, -8, -9, Bax, and Bcl-2 in the peripheral blood. However, expression of Bax, caspase-3, -8 and -9 was significantly higher in the cerebellum of CDV+ compared to CDV- dogs. Expression of caspase-3 and -8 was significantly higher in the lymph nodes of CDV+ compared to CDV- dogs. We concluded that infection with CDV induces apoptosis in the cerebellum and lymph nodes in different ways. Lymph node apoptosis apparently occurs via caspase-3 activation, through the caspase-8 pathway, and cerebellum apoptosis apparently occurs via caspase-3 activation, through the caspase-8 and mitochondrial pathways.

Phylogenetic analysis of Austrian canine distemper virus strains from clinical samples from dogs and wild carnivores.

Science.gov (United States)

Benetka, V; Leschnik, M; Affenzeller, N; Möstl, K

2011-04-09

Austrian field cases of canine distemper (14 dogs, one badger [Meles meles] and one stone marten [Martes foina]) from 2002 to 2007 were investigated and the case histories were summarised briefly. Phylogenetic analysis of fusion (F) and haemagglutinin (H) gene sequences revealed different canine distemper virus (CDV) lineages circulating in Austria. The majority of CDV strains detected from 2002 to 2004 were well embedded in the European lineage. One Austrian canine sample detected in 2003, with a high similarity to Hungarian sequences from 2005 to 2006, could be assigned to the Arctic group (phocine distemper virus type 2-like). The two canine sequences from 2007 formed a clearly distinct group flanked by sequences detected previously in China and the USA on an intermediate position between the European wildlife and the Asia-1 cluster. The Austrian wildlife strains (2006 and 2007) could be assigned to the European wildlife group and were most closely related to, yet clearly different from, the 2007 canine samples. To elucidate the epidemiological role of Austrian wildlife in the transmission of the disease to dogs and vice versa, H protein residues related to receptor and host specificity (residues 530 and 549) were analysed. All samples showed the amino acids expected for their host of origin, with the exception of a canine sequence from 2007, which had an intermediate position between wildlife and canine viral strains. In the period investigated, canine strains circulating in Austria could be assigned to four different lineages reflecting both a high diversity and probably different origins of virus introduction to Austria in different years.

Distemper outbreak and its effect on African wild dog conservation.

NARCIS (Netherlands)

M.W.G. van de Bildt (Marco); T. Kuiken (Thijs); A.M. Visee; S. Lema; A.R. Fitzjohn; A.D.M.E. Osterhaus (Albert)

2002-01-01

textabstractIn December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus

Sandwich-dot enzyme-linked immunosorbent assay for the detection of canine distemper virus

Science.gov (United States)

Li, Zhi; Zhang, Yanlong; Wang, Huiguo; Jin, Jinhua; Li, Wenzhe

2013-01-01

A sandwich-dot enzyme-linked immunosorbent assay (dot ELISA) was developed for the detection of canine distemper virus (CDV). In 56 dogs suspected to have CD the rates of detection of CDV antigen in samples of blood lymphocytes and palpebral conjunctiva by dot ELISA and ELISA were, respectively, 91% (49/54) and 81% (44/54) for the lymphocyte samples and 88% (28/32) and 75% (24/32) for the conjunctival samples. The CDV detection limits were 10 ng/50 μL for dot ELISA and 40 ng/50 μL for ELISA. The reliability of dot ELISA relative to electron microscopy was 96% with 22 samples: all 21 samples in which CDV particles were observed by electron microscopy yielded positive results with dot ELISA; the single sample in which particles were not observed yielded false-positive results with dot ELISA. The results indicate that the dot ELISA developed can serve as a reliable rapid diagnostic test in suspected cases of CD and also be useful for epidemiologic surveillance of the disease. PMID:24124274

Membrane-bound SIV envelope trimers are immunogenic in ferrets after intranasal vaccination with a replication-competent canine distemper virus vector.

Science.gov (United States)

Zhang, Xinsheng; Wallace, Olivia; Wright, Kevin J; Backer, Martin; Coleman, John W; Koehnke, Rebecca; Frenk, Esther; Domi, Arban; Chiuchiolo, Maria J; DeStefano, Joanne; Narpala, Sandeep; Powell, Rebecca; Morrow, Gavin; Boggiano, Cesar; Zamb, Timothy J; Richter King, C; Parks, Christopher L

2013-11-01

We are investigating canine distemper virus (CDV) as a vaccine vector for the delivery of HIV envelope (Env) that closely resembles the native trimeric spike. We selected CDV because it will promote vaccine delivery to lymphoid tissues, and because human exposure is infrequent, reducing potential effects of pre-existing immunity. Using SIV Env as a model, we tested a number of vector and gene insert designs. Vectors containing a gene inserted between the CDV H and L genes, which encoded Env lacking most of its cytoplasmic tail, propagated efficiently in Vero cells, expressed the immunogen on the cell surface, and incorporated the SIV glycoprotein into progeny virus particles. When ferrets were vaccinated intranasally, there were no signs of distress, vector replication was observed in the gut-associated lymphoid tissues, and the animals produced anti-SIV Env antibodies. These data show that live CDV-SIV Env vectors can safely induce anti-Env immune responses following intranasal vaccination. © 2013 Elsevier Inc. All rights reserved.

Prevalence of protective antibody titers for canine distemper virus and canine parvovirus in dogs entering a Florida animal shelter.

Science.gov (United States)

Lechner, Elizabeth S; Crawford, P Cynda; Levy, Julie K; Edinboro, Charlotte H; Dubovi, Edward J; Caligiuri, Randy

2010-06-15

To determine the proportion of dogs entering an animal shelter with protective antibody titers (PATs) for canine distemper virus (CDV) and canine parvovirus (CPV) and identify factors associated with having a PAT. Cross-sectional study. 431 dogs admitted to an open-admission municipal animal shelter in north central Florida with a history of infectious disease outbreaks. Blood was collected from dogs on the day of admission to the shelter. Antibody titers for CDV and CPV were measured by virus neutralization and hemagglutination inhibition, respectively. Age, sex, neuter status, address of origin, source (stray or previously owned), health status (healthy or not healthy), and outcome (adoption, euthanasia, or reclaimed by owner) data were also collected. Overall, 64.5% (278/431) of dogs had insufficient titers for antibodies against CDV, CPV, or both. A total of 153 (35.5%) dogs had PATs for both CDV and CPV, 33 (7.7%) had PATs for CDV but not CPV, 136 (31.5%) had PATs for CPV but not CDV, and 109 (25.3%) did not have PATs for either virus. Older dogs were more likely to have PATs for CDV and CPV. Neutered dogs were more likely to have PATs for CDV. Factors not associated with having a PAT included source, health status, and type of community from which the dog originated. Most dogs had insufficient antibody titers for CDV, CPV, or both at the time of admission to the animal shelter. Findings support current guidelines recommending vaccination of all dogs immediately upon admission to shelters, regardless of source or physical condition.

Use of serologic tests to predict resistance to Canine distemper virus-induced disease in vaccinated dogs.

Science.gov (United States)

Jensen, Wayne A; Totten, Janet S; Lappin, Michael R; Schultz, Ronald D

2015-09-01

The objective of the current study was to determine whether detection of Canine distemper virus (CDV)-specific serum antibodies correlates with resistance to challenge with virulent virus. Virus neutralization (VN) assay results were compared with resistance to viral challenge in 2 unvaccinated Beagle puppies, 9 unvaccinated Beagle dogs (4.4-7.2 years of age), and 9 vaccinated Beagle dogs (3.7-4.7 years of age). Eight of 9 (89%) unvaccinated adult dogs exhibited clinical signs after virus challenge, and 1 (13%) dog died. As compared to adult dogs, the 2 unvaccinated puppies developed more severe clinical signs and either died or were euthanized after challenge. In contrast, no clinical signs were detected after challenge of the 9 adult vaccinated dogs with post-vaccination intervals of up to 4.4 years. In vaccinated dogs, the positive and negative predictive values of VN assay results for resistance to challenge were 100% and 0%, respectively. Results indicate that dogs vaccinated with modified live CDV can be protected from challenge for ≤4.4 years postvaccination and that detection of virus-specific antibodies is predictive of whether dogs are resistant to challenge with virulent virus. Results also indicate that CDV infection in unvaccinated dogs results in age-dependent morbidity and mortality. Knowledge of age-dependent morbidity and mortality, duration of vaccine-induced immunity, and the positive and negative predictive values of detection of virus-specific serum antibodies are useful in development of rational booster vaccination intervals for the prevention of CDV-mediated disease in adult dogs. © 2015 The Author(s).

Characteristics of a Canine Distemper Virus Outbreak in Dichato, Chile Following the February 2010 Earthquake.

Science.gov (United States)

Garde, Elena; Pérez, Guillermo; Acosta-Jamett, Gerardo; Bronsvoort, Barend Mark

2013-08-27

Following the earthquake and tsunami disaster in Chile in February 2010, residents of Dichato reported high morbidity and mortality in dogs, descriptions of which resembled canine distemper virus (CDV). To assess the situation, free vaccine clinics were offered in April and May. Owner information, dog history and signalment were gathered; dogs received physical examinations and vaccines protecting against CDV, and other common canine pathogens. Blood was collected to screen for IgM antibodies to CDV. In total, 208 dogs received physical exams and vaccines were given to 177. IgM antibody titres to CDV were obtained for 104 dogs. Fifty-four dogs (51.9%) tested positive for CDV at the cut off titre of >1:50, but a total of 91.4% of dogs had a detectable titre >1:10. Most of the positive test results were in dogs less than 2 years of age; 33.5% had been previously vaccinated against CDV, and owners of 84 dogs (42.2%) reported clinical signs characteristic of CDV in their dogs following the disaster. The presence of endemic diseases in dog populations together with poor pre-disaster free-roaming dog management results in a potential for widespread negative effects following disasters. Creation of preparedness plans that include animal welfare, disease prevention and mitigation should be developed.

Pathogenesis of canine distemper virus in experimentally infected raccoon dogs, foxes, and minks.

Science.gov (United States)

Zhao, Jianjun; Shi, Ning; Sun, Yangang; Martella, Vito; Nikolin, Veljko; Zhu, Chunsheng; Zhang, Hailing; Hu, Bo; Bai, Xue; Yan, Xijun

2015-10-01

Canine distemper virus (CDV) infects a broad range of carnivores and causes a highly contagious disease with severe immunosuppression. The disease severity markedly varies in different species. To investigate the pathogenesis of CDV in raccoon dog (Nyctereutes procyonoides), fox (Vulpes vulpes) and mink (Neovison vison) species, three groups of CDV sero-negative animals were infected with CDV strain LN(10)1. This CDV strain belongs to the Asia-1 genotype, which is epidemiologically predominant in carnivores in China. CDV infection provoked marked differences in virulence in the three species that were studied. Raccoon dogs developed fever, severe conjunctivitis, and pathological lesions, with 100% (5/5) mortality and with high viral RNA loads in organs within 15 days post infection (dpi). In infected foxes, the onset of the disease was delayed, with 40% (2/5) mortality by 21 dpi. Infected minks developed only mild clinical signs and pathological lesions, and mortality was not observed. Raccoon dogs and foxes showed more severe immune suppression (lymphopenia, decreased lymphocyte proliferation, viremia and low-level virus neutralizing antibodies) than minks. We also observed a distinct pattern of cytokine mRNA transcripts at different times after infection. Decreased IFN-γ and IL-4 mRNA responses were evident in the animals with fatal disease, while up-regulation of these cytokines was observed in the animals surviving the infection. Increased TNF-α response was detected in animals with mild or severe clinical signs. Based on the results, we could distinguish three different patterns of disease after experimental CDV infection, e.g. a mild form in minks, a moderate form in foxes and a severe disease in raccoon dogs. The observed differences in susceptibility to CDV could be related to distinct host cytokine profiles. Comparative evaluation of CDV pathogenesis in various animal species is pivotal to generate models suitable for the evaluation of CDV

Protective levels of canine distemper virus antibody in an urban dog population using plaque reduction neutralization test

Directory of Open Access Journals (Sweden)

O.I. Oyedele

2004-11-01

Full Text Available Blood samples from 50 dogs were collected at three veterinary clinics in Ibadan and Abuja, Nigeria and the serum from each sample was evaluated serologically for neutralizing antibodies against canine distemper virus (CDV by the highly sensitive plaque reduction (PRN neutralization assay. Thirteen dogs had plaque reduction neutralization titres of 0-100, seven had titres of 100-1 000 while 30 had titres ranging from 1 000-6 000. The PRN titres of vaccinated dogs were found to be significantly higher than unvaccinated dogs. The widespread use of the highly reproducible PRN test for the evaluation of antibody response to CDV may be very important in the generation of international CDV positive serum standards that should help to improve pre-and post-vaccination testing of dogs worldwide.

Fatal combined infection with canine distemper virus and orthopoxvirus in a group of Asian marmots (Marmota caudata).

Science.gov (United States)

Origgi, F C; Sattler, U; Pilo, P; Waldvogel, A S

2013-09-01

A fatal combined infection with canine distemper virus (CDV) and orthopoxvirus (OPXV) in Asian marmots (Marmota caudata) is reported in this article. A total of 7 Asian marmots from a small zoological garden in Switzerland were found dead in hibernation during a routine check in the winter of 2011. The marmots died in February 2011. No clinical signs of disease were observed at any time. The viruses were detected in all individuals for which the tissues were available (n = 3). Detection of the viruses was performed by reverse transcription polymerase chain reaction. The most consistent gross lesion was a neck and thorax edema. A necrotizing pharyngitis and a multifocal necrotizing pneumonia were observed histologically. Numerous large intracytoplasmic eosinophilic inclusions were seen in the epithelial cells of the pharynx, of the airways, and in the skin keratinocytes. Brain lesions were limited to mild multifocal gliosis. Phylogenetic analysis revealed that the marmot CDV strain was closely related to the clusters of CDVs detected in Switzerland in wild carnivores during a local outbreak in 2002 and the 2009-2010 nationwide epidemic, suggesting a spillover of this virus from wildlife. The OPXV was most closely related to a strain of cowpoxvirus, a poxvirus species considered endemic in Europe. This is the first reported instance of CDV infection in a rodent species and of a combined CDV and OPXV infection.

Broadly reactive pan-paramyxovirus reverse transcription polymerase chain reaction and sequence analysis for the detection of Canine distemper virus in a case of canine meningoencephalitis of unknown etiology

Science.gov (United States)

Schatzberg, Scott J.; Li, Qiang; Porter, Brian F.; Barber, Renee M.; Claiborne, Mary Kate; Levine, Jonathan M.; Levine, Gwendolyn J.; Israel, Sarah K.; Young, Benjamin D.; Kiupel, Matti; Greene, Craig; Ruone, Susan; Anderson, Larry; Tong, Suxiang

2016-01-01

Despite the immunologic protection associated with routine vaccination protocols, Canine distemper virus (CDV) remains an important pathogen of dogs. Antemortem diagnosis of systemic CDV infection may be made by reverse transcription polymerase chain reaction (RT-PCR) and/or immunohistochemical testing for CDV antigen; central nervous system infection often requires postmortem confirmation via histopathology and immunohistochemistry. An 8-month-old intact male French Bulldog previously vaccinated for CDV presented with multifocal neurologic signs. Based on clinical and postmortem findings, the dog’s disease was categorized as a meningoencephalitis of unknown etiology. Broadly reactive, pan-paramyxovirus RT-PCR using consensus-degenerate hybrid oligonucleotide primers, combined with sequence analysis, identified CDV amplicons in the dog’s brain. Immunohistochemistry confirmed the presence of CDV antigens, and a specific CDV RT-PCR based on the phosphoprotein gene identified a wild-type versus vaccinal virus strain. This case illustrates the utility of broadly reactive PCR and sequence analysis for the identification of pathogens in diseases with unknown etiology. PMID:19901287

Immunohistochemical detection of autophagy-related microtubule-associated protein 1 light chain 3 (LC3) in the cerebellums of dogs naturally infected with canine distemper virus.

Science.gov (United States)

Kabak, Y B; Sozmen, M; Yarim, M; Guvenc, T; Karayigit, M O; Gulbahar, M Y

2015-01-01

We investigated the expression of microtubule-associated protein 1 light chain 3 (LC3) protein in the cerebellums of dogs infected with canine distemper virus (CDV) using immunohistochemistry to detect autophagy. The cerebellums of 20 dogs infected with CDV were used. Specimens showing demyelination of white matter were considered to have an acute infection, whereas specimens showing signs of severe perivascular cuffing and demyelination of white matter were classified as having chronic CDV. Cerebellar sections were immunostained with CDV and LC3 antibodies. The cytoplasm of Purkinje cells, granular layer cells, motor neurons in large cerebellar ganglia and some neurons in white matter were positive for the LC3 antibody in both the control and CDV-infected dogs. In the infected cerebellums, however, white matter was immunostained more intensely, particularly the neurons and gemistocytic astrocytes in the demyelinated areas, compared to controls. Autophagy also was demonstrated in CDV-positive cells using double immunofluorescence staining. Our findings indicate that increased autophagy in the cerebellum of dogs naturally infected with CDV may play a role in transferring the virus from cell to cell.

Use of hydrophilic extra-viral domain of canine distemper virus H protein for enzyme-linked immunosorbent assay development.

Science.gov (United States)

Cho, Ki-hyun; Kim, Jeongmi; Yoo, Hyun-ah; Kim, Dae-hee; Park, Seung-yong; Song, Chang-seon; Choi, In-soo; Lee, Joong-bok

2014-12-01

Simple methods for measuring the levels of serum antibody against canine distemper virus (CDV) would assist in the effective vaccination of dogs. To develop an enzyme-linked immunosorbent assay (ELISA) specific for CDV, we expressed hydrophilic extra-viral domain (HEVD) protein of the A75/17-CDV H gene in a pET 28a plasmid-based Escherichia (E.) coli vector system. Expression was confirmed by dot and Western blotting. We proposed that detection of E. coli-expressed H protein might be conformation- dependent because intensities of the reactions observed with these two methods varied. The H gene HEVD protein was further purified and used as an antigen for an ELISA. Samples from dogs with undetectable to high anti-CDV antibody titers were analyzed using this HEVD-specific ELISA and a commercial CDV antibody detection kit (ImmunoComb). Levels of HEVD antigenicity measured with the assays and immunochromatography correlated. These data indicated that the HEDV protein may be used as antigen to develop techniques for detecting antibodies against CDV.

Virological and serological findings in dogs with naturally occurring distemper.

Science.gov (United States)

Elia, Gabriella; Camero, Michele; Losurdo, Michele; Lucente, Maria Stella; Larocca, Vittorio; Martella, Vito; Decaro, Nicola; Buonavoglia, Canio

2015-03-01

Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. The unpredictable and variable course of CDV-related disease may hamper correct diagnosis of infection and makes it crucial the collection of samples suitable for laboratory confirmation. In the present study we were able to follow the disease in two dogs infected naturally, collecting different biological matrices during the entire period of infection. By real time RT-PCR, viral RNA was detected and quantified, suggesting that urine and rectal swabs would be useful for ante-mortem diagnosis of distemper in dogs, regardless of the clinical stage and form of the illness. Copyright © 2015 Elsevier B.V. All rights reserved.

Frequency of exposure of endangered Caspian seals to Canine distemper virus, Leptospira interrogans, and Toxoplasma gondii.

Directory of Open Access Journals (Sweden)

Somayeh Namroodi

Full Text Available Canine distemper virus (CDV, Leptospira interrogans, and Toxoplasma gondii are potentially lethal pathogens associated with decline in marine mammal populations. The Caspian Sea is home for the endangered Caspian seal (Pusa caspica. In the late 1990s and early 2000s, CDV caused a series of mortality events involving at least several thousand Caspian seals. To assess current infection status in Caspian seals, we surveyed for antibodies to three pathogens with potential to cause mortality in marine mammals. During 2015-2017, we tested serum samples from 36, apparently healthy, Caspian seals, accidentally caught in fishing nets in the Caspian Sea off Northern Iran, for antibodies to CDV, L. interrogans, and T. gondii, by virus neutralization, microscopic agglutination, and modified agglutination, respectively. Twelve (33%, 6 (17%, and 30 (83% samples were positive for CDV, L. interrogans and T. gondii antibodies, respectively. The highest titers of CDV, L. interrogans, and T. gondii antibodies were 16, 400, and 50, respectively. Frequencies of antibody to these pathogens were higher in seals >1 year old compared to seals <1 year old. Two serovars of L. interrogans (Pomona and Canicola were detected. Our results suggest a need for additional studies to clarify the impact of these pathogens on Caspian seal population decline and the improvement of management programs, including systematic screening to detect and protect the remaining population from disease outbreaks.

Frequency of exposure of endangered Caspian seals to Canine distemper virus, Leptospira interrogans, and Toxoplasma gondii.

Science.gov (United States)

Namroodi, Somayeh; Shirazi, Amir S; Khaleghi, Seyyed Reza; N Mills, James; Kheirabady, Vahid

2018-01-01

Canine distemper virus (CDV), Leptospira interrogans, and Toxoplasma gondii are potentially lethal pathogens associated with decline in marine mammal populations. The Caspian Sea is home for the endangered Caspian seal (Pusa caspica). In the late 1990s and early 2000s, CDV caused a series of mortality events involving at least several thousand Caspian seals. To assess current infection status in Caspian seals, we surveyed for antibodies to three pathogens with potential to cause mortality in marine mammals. During 2015-2017, we tested serum samples from 36, apparently healthy, Caspian seals, accidentally caught in fishing nets in the Caspian Sea off Northern Iran, for antibodies to CDV, L. interrogans, and T. gondii, by virus neutralization, microscopic agglutination, and modified agglutination, respectively. Twelve (33%), 6 (17%), and 30 (83%) samples were positive for CDV, L. interrogans and T. gondii antibodies, respectively. The highest titers of CDV, L. interrogans, and T. gondii antibodies were 16, 400, and 50, respectively. Frequencies of antibody to these pathogens were higher in seals >1 year old compared to seals <1 year old. Two serovars of L. interrogans (Pomona and Canicola) were detected. Our results suggest a need for additional studies to clarify the impact of these pathogens on Caspian seal population decline and the improvement of management programs, including systematic screening to detect and protect the remaining population from disease outbreaks.

Identification of amino acid substitutions with compensational effects in the attachment protein of canine distemper virus.

Science.gov (United States)

Sattler, Ursula; Khosravi, Mojtaba; Avila, Mislay; Pilo, Paola; Langedijk, Johannes P; Ader-Ebert, Nadine; Alves, Lisa A; Plattet, Philippe; Origgi, Francesco C

2014-07-01

The hemagglutinin (H) gene of canine distemper virus (CDV) encodes the receptor-binding protein. This protein, together with the fusion (F) protein, is pivotal for infectivity since it contributes to the fusion of the viral envelope with the host cell membrane. Of the two receptors currently known for CDV (nectin-4 and the signaling lymphocyte activation molecule [SLAM]), SLAM is considered the most relevant for host susceptibility. To investigate how evolution might have impacted the host-CDV interaction, we examined the functional properties of a series of missense single nucleotide polymorphisms (SNPs) naturally accumulating within the H-gene sequences during the transition between two distinct but related strains. The two strains, a wild-type strain and a consensus strain, were part of a single continental outbreak in European wildlife and occurred in distinct geographical areas 2 years apart. The deduced amino acid sequence of the two H genes differed at 5 residues. A panel of mutants carrying all the combinations of the SNPs was obtained by site-directed mutagenesis. The selected mutant, wild type, and consensus H proteins were functionally evaluated according to their surface expression, SLAM binding, fusion protein interaction, and cell fusion efficiencies. The results highlight that the most detrimental functional effects are associated with specific sets of SNPs. Strikingly, an efficient compensational system driven by additional SNPs appears to come into play, virtually neutralizing the negative functional effects. This system seems to contribute to the maintenance of the tightly regulated function of the H-gene-encoded attachment protein. Importance: To investigate how evolution might have impacted the host-canine distemper virus (CDV) interaction, we examined the functional properties of naturally occurring single nucleotide polymorphisms (SNPs) in the hemagglutinin gene of two related but distinct strains of CDV. The hemagglutinin gene encodes the

Phylogenetic analysis of canine distemper virus in South America clade 1 reveals unique molecular signatures of the local epidemic.

Science.gov (United States)

Fischer, Cristine D B; Gräf, Tiago; Ikuta, Nilo; Lehmann, Fernanda K M; Passos, Daniel T; Makiejczuk, Aline; Silveira, Marcos A T; Fonseca, André S K; Canal, Cláudio W; Lunge, Vagner R

2016-07-01

Canine distemper virus (CDV) is a highly contagious pathogen for domestic dogs and several wild carnivore species. In Brazil, natural infection of CDV in dogs is very high due to the large non-vaccinated dog population, a scenario that calls for new studies on the molecular epidemiology. This study investigates the phylodynamics and amino-acid signatures of CDV epidemic in South America by analyzing a large dataset compiled from publicly available sequences and also by collecting new samples from Brazil. A population of 175 dogs with canine distemper (CD) signs was sampled, from which 89 were positive for CDV, generating 42 new CDV sequences. Phylogenetic analysis of the new and publicly available sequences revealed that Brazilian sequences mainly clustered in South America 1 (SA1) clade, which has its origin estimated to the late 1980's. The reconstruction of the demographic history in SA1 clade showed an epidemic expanding until the recent years, doubling in size every nine years. SA1 clade epidemic distinguished from the world CDV epidemic by the emergence of the R580Q strain, a very rare and potentially detrimental substitution in the viral genome. The R580Q substitution was estimated to have happened in one single evolutionary step in the epidemic history in SA1 clade, emerging shortly after introduction to the continent. Moreover, a high prevalence (11.9%) of the Y549H mutation was observed among the domestic dogs sampled here. This finding was associated (p<0.05) with outcome-death and higher frequency in mixed-breed dogs, the later being an indicator of a continuous exchange of CDV strains circulating among wild carnivores and domestic dogs. The results reported here highlight the diversity of the worldwide CDV epidemic and reveal local features that can be valuable for combating the disease. Copyright © 2016 Elsevier B.V. All rights reserved.

Severe canine distemper outbreak in unvaccinated dogs in Mozambique.

Science.gov (United States)

Zacarias, Julieta; Dimande, Alberto; Achá, Sara; Dias, Paula T; Leonel, Elisa M; Messa, Aurora; Macucule, Baltazar; Júnior, José L; Bila, Custódio G

2016-07-15

Although significant animal suffering caused by preventable diseases is frequently seen in developing countries, reports of this are scarce. This report describes avoidable animal suffering owing to a suspected canine distemper (CD) outbreak in unvaccinated dogs owned by low-income families in Mozambique that killed approximately 200 animals. Affected dogs exhibited clinical signs, and gross and microscopic lesions compatible with CD. Immunohistochemical staining confirmed the presence of canine distemper virus (CDV) in the kidney of one dog from the cohort. This brief communication again illustrates that large outbreaks of CDV in unvaccinated dogs occur and that large-scale avoidable suffering and threats to the health of dogs and wild canines continue. Mass vaccination supported by government and non-government organisations is recommended.

Impacts of canine distemper virus infection on the giant panda population from the perspective of gut microbiota.

Science.gov (United States)

Zhao, Na; Li, Meng; Luo, Jing; Wang, Supen; Liu, Shelan; Wang, Shan; Lyu, Wenting; Chen, Lin; Su, Wen; Ding, Hua; He, Hongxuan

2017-01-04

The recent increase in infectious disease outbreaks has been directly linked to the global loss of biodiversity and the decline of some endangered species populations. Between December 2014 and March 2015, five captive giant pandas died due to canine distemper virus (CDV) infection in China. CDV has taken a heavy toll on tigers and lions in recent years. Here, we describe the first gut microbiome diversity study of CDV-infected pandas. By investigating the influence of CDV infection on gut bacterial communities in infected and uninfected individuals and throughout the course of infection, we found that CDV infection distorted the gut microbiota composition by reducing the prevalence of the dominant genera, Escherichia and Clostridium, and increasing microbial diversity. Our results highlight that increases in intestinal inflammation and changes in the relative abundances of pathogen-containing gut communities occur when individuals become infected with CDV. These results may provide new insights into therapeutics that target the microbiota to attenuate the progression of CDV disease and to reduce the risk of gut-linked disease in individuals with CDV. In addition, our findings underscore the need for better information concerning the dynamics of infection and the damage caused by pathogens in panda populations.

Lethal distemper in badgers (Meles meles) following epidemic in dogs and wolves.

Science.gov (United States)

Di Sabatino, Daria; Di Francesco, Gabriella; Zaccaria, Guendalina; Malatesta, Daniela; Brugnola, Luca; Marcacci, Maurilia; Portanti, Ottavio; De Massis, Fabrizio; Savini, Giovanni; Teodori, Liana; Ruggieri, Enzo; Mangone, Iolanda; Badagliacca, Pietro; Lorusso, Alessio

2016-12-01

Canine distemper virus (CDV) represents an important conservation threat to many wild carnivores. A large distemper epidemic sustained by an Arctic-lineage strain occurred in Italy in 2013, mainly in the Abruzzi region, causing overt disease in domestic and shepherd dogs, Apennine wolves (Canis lupus) and other wild carnivores. Two badgers were collected by the end of September 2015 in a rural area of the Abruzzi region and were demonstrated to be CDV-positive by real time RT-PCR and IHC in several tissues. The genome of CDV isolates from badgers showed Y549H substitution in the mature H protein. By employing all publicly available Arctic-lineage H protein encoding gene sequences, six amino acid changes in recent Italian strains with respect to Italian strains of dogs from 2000 to 2008, were observed. A CDV strain belonging to the European-wildlife lineage was also identified in a fox found dead in the same region in 2016, proving co-circulation of an additional CDV lineage. Copyright © 2016 Elsevier B.V. All rights reserved.

Canine distemper in endangered Ethiopian wolves.

Science.gov (United States)

Gordon, Christopher H; Banyard, Ashley C; Hussein, Alo; Laurenson, M Karen; Malcolm, James R; Marino, Jorgelina; Regassa, Fekede; Stewart, Anne-Marie E; Fooks, Anthony R; Sillero-Zubiri, Claudio

2015-05-01

The Ethiopian wolf (Canis simensis) is the world's rarest canid; ≈500 wolves remain. The largest population is found within the Bale Mountains National Park (BMNP) in southeastern Ethiopia, where conservation efforts have demonstrated the negative effect of rabies virus on wolf populations. We describe previously unreported infections with canine distemper virus (CDV) among these wolves during 2005-2006 and 2010. Death rates ranged from 43% to 68% in affected subpopulations and were higher for subadult than adult wolves (83%-87% vs. 34%-39%). The 2010 CDV outbreak started 20 months after a rabies outbreak, before the population had fully recovered, and led to the eradication of several focal packs in BMNP's Web Valley. The combined effect of rabies and CDV increases the chance of pack extinction, exacerbating the typically slow recovery of wolf populations, and represents a key extinction threat to populations of this highly endangered carnivore.

Identification of a novel canine distemper virus B-cell epitope using a monoclonal antibody against nucleocapsid protein.

Science.gov (United States)

Yi, Li; Cheng, Yuening; Zhang, Miao; Cao, Zhigang; Tong, Mingwei; Wang, Jianke; Zhao, Hang; Lin, Peng; Cheng, Shipeng

2016-02-02

Canine distemper virus (CDV) is a member of the genus Morbillivirus within the family Paramyxoviridae and has caused severe economic losses in China. Nucleocapsid protein (N) is the major structural viral protein and can be used to diagnose CDV and other morbilliviruses. In this study, a specific monoclonal antibody, 1N8, was produced against the CDV N protein (amino acids 277-471). A linear N protein epitope was identified by subjecting a series of partially overlapping synthesized peptides to enzyme-linked immunosorbent assay (ELISA) analysis. The results indicated that (350)LNFGRSYFDPA(360) was the minimal linear epitope that could be recognized by mAb 1N8. ELISA assays revealed that mouse anti-CDV sera could also recognize the minimal linear epitope. Alignment analysis of the amino acid sequences indicated that the epitope was highly conserved among CDV strains. Furthermore, the epitope was conserved among other morbilliviruses, which was confirmed with PRRV using western blotting. Taken together, the results of this study may have potential applications in the development of suitable diagnostic techniques for CDV or other morbilliviruses. Copyright © 2015 Elsevier B.V. All rights reserved.

BLACK-BACKED JACKAL EXPOSURE TO RABIES VIRUS, CANINE DISTEMPER VIRUS, AND BACILLUS ANTHRACIS IN ETOSHA NATIONAL PARK, NAMIBIA

Science.gov (United States)

Bellan, Steve E.; Cizauskas, Carrie A.; Miyen, Jacobeth; Ebersohn, Karen; Küsters, Martina; Prager, Katie; Van Vuuren, Moritz; Sabeta, Claude; Getz, Wayne M.

2017-01-01

Canine distemper virus (CDV) and rabies virus (RABV) occur worldwide in wild carnivore and domestic dog populations and pose threats to wildlife conservation and public health. In Etosha National Park (ENP), Namibia, anthrax is endemic and generates carcasses frequently fed on by an unusually dense population of black-backed jackals (Canis mesomelas). Using serology and phylogenetic analyses (on samples obtained from February, 2009 to July, 2010), and historical mortality records (1975–2011), we assessed jackal exposure to Bacillus anthracis (BA; the causal bacterial agent of anthrax), CDV, and RABV. Seroprevalence to all three pathogens was relatively high with 95% (n = 86), 73% (n = 86), and 9% (n = 81) of jackals exhibiting antibodies to BA, CDV, and RABV, respectively. Exposure to BA, as assessed with an anti-Protective Antigen ELISA test, increased significantly with age and all animals >1 yr old tested positive. Seroprevalence of exposure to CDV also increased significantly with age, with similar age-specific trends during both years of the study. No significant effect of age was found on RABV seroprevalence. Three of the seven animals exhibiting immunity to RABV were monitored for more than one year after sampling and did not succumb to the disease. Mortality records revealed that rabid animals are destroyed nearly every year inside the ENP tourist camps. Phylogenetic analyses demonstrated that jackal RABV in ENP is part of the same transmission cycle as other dog-jackal RABV cycles in Namibia. PMID:22493112

Characteristics of a Canine Distemper Virus Outbreak in Dichato, Chile Following the February 2010 Earthquake

Directory of Open Access Journals (Sweden)

Gerardo Acosta-Jamett

2013-08-01

Full Text Available Following the earthquake and tsunami disaster in Chile in February 2010, residents of Dichato reported high morbidity and mortality in dogs, descriptions of which resembled canine distemper virus (CDV. To assess the situation, free vaccine clinics were offered in April and May. Owner information, dog history and signalment were gathered; dogs received physical examinations and vaccines protecting against CDV, and other common canine pathogens. Blood was collected to screen for IgM antibodies to CDV. In total, 208 dogs received physical exams and vaccines were given to 177. IgM antibody titres to CDV were obtained for 104 dogs. Fifty-four dogs (51.9% tested positive for CDV at the cut off titre of >1:50, but a total of 91.4% of dogs had a detectable titre >1:10. Most of the positive test results were in dogs less than 2 years of age; 33.5% had been previously vaccinated against CDV, and owners of 84 dogs (42.2% reported clinical signs characteristic of CDV in their dogs following the disaster. The presence of endemic diseases in dog populations together with poor pre-disaster free-roaming dog management results in a potential for widespread negative effects following disasters. Creation of preparedness plans that include animal welfare, disease prevention and mitigation should be developed.

Dynamic changes of Foxp3(+) regulatory T cells in spleen and brain of canine distemper virus-infected dogs.

Science.gov (United States)

Qeska, V; Barthel, Y; Iseringhausen, M; Tipold, A; Stein, V M; Khan, M A; Baumgärtner, W; Beineke, A

2013-12-15

Canine distemper virus (CDV) infection causes immunosuppression and demyelinating leukoencephalitis in dogs. In viral diseases, an ambiguous function of regulatory T cells (Treg), with both beneficial effects by reducing immunopathology and detrimental effects by inhibiting antiviral immunity, has been described. However, the role of Treg in the pathogenesis of canine distemper remains unknown. In order to determine the effect of CDV upon immune homeostasis, the amount of Foxp3(+) Treg in spleen and brain of naturally infected dogs has been determined by immunohistochemistry. In addition, splenic cytokine expression has been quantified by reverse transcriptase polymerase chain reaction. Splenic depletion of Foxp3(+) Treg was associated with an increased mRNA-expression of tumor necrosis factor and decreased transcription of interleukin-2 in the acute disease phase, indicative of disturbed immunological counter regulation in peripheral lymphoid organs. In the brain, a lack of Foxp3(+) Treg in predemyelinating and early demyelinating lesions and significantly increased infiltrations of Foxp3(+) Treg in chronic demyelinating lesions were observed. In conclusion, disturbed peripheral and CNS immune regulation associated with a reduction of Treg represents a potential prerequisite for excessive neuroinflammation and early lesion development in canine distemper leukoencephalitis. © 2013 Elsevier B.V. All rights reserved.

Evaluation of synthetic infection-enhancing lipopeptides as adjuvants for a live-attenuated canine distemper virus vaccine administered intra-nasally to ferrets.

Science.gov (United States)

Nguyen, D Tien; Ludlow, Martin; van Amerongen, Geert; de Vries, Rory D; Yüksel, Selma; Verburgh, R Joyce; Osterhaus, Albert D M E; Duprex, W Paul; de Swart, Rik L

2012-07-20

Inactivated paramyxovirus vaccines have been associated with hypersensitivity responses upon challenge infection. For measles and canine distemper virus (CDV) safe and effective live-attenuated virus vaccines are available, but for human respiratory syncytial virus and human metapneumovirus development of such vaccines has proven difficult. We recently identified three synthetic bacterial lipopeptides that enhance paramyxovirus infections in vitro, and hypothesized these could be used as adjuvants to promote immune responses induced by live-attenuated paramyxovirus vaccines. Here, we tested this hypothesis using a CDV vaccination and challenge model in ferrets. Three groups of six animals were intra-nasally vaccinated with recombinant (r) CDV(5804P)L(CCEGFPC) in the presence or absence of the infection-enhancing lipopeptides Pam3CSK4 or PHCSK4. The recombinant CDV vaccine virus had previously been described to be over-attenuated in ferrets. A group of six animals was mock-vaccinated as control. Six weeks after vaccination all animals were challenged with a lethal dose of rCDV strain Snyder-Hill expressing the red fluorescent protein dTomato. Unexpectedly, intra-nasal vaccination of ferrets with rCDV(5804P)L(CCEGFPC) in the absence of lipopeptides resulted in good immune responses and protection against lethal challenge infection. However, in animals vaccinated with lipopeptide-adjuvanted virus significantly higher vaccine virus loads were detected in nasopharyngeal lavages and peripheral blood mononuclear cells. In addition, these animals developed significantly higher CDV neutralizing antibody titers compared to animals vaccinated with non-adjuvanted vaccine. This study demonstrates that the synthetic cationic lipopeptides Pam3CSK4 and PHCSK4 not only enhance paramyxovirus infection in vitro, but also in vivo. Given the observed enhancement of immunogenicity their potential as adjuvants for other live-attenuated paramyxovirus vaccines should be considered

Canine distemper virus neutralization activity is low in human serum and it is sensitive to an amino acid substitution in the hemagglutinin protein.

Science.gov (United States)

Zhang, Xinsheng; Wallace, Olivia L; Domi, Arban; Wright, Kevin J; Driscoll, Jonathan; Anzala, Omu; Sanders, Eduard J; Kamali, Anatoli; Karita, Etienne; Allen, Susan; Fast, Pat; Gilmour, Jill; Price, Matt A; Parks, Christopher L

2015-08-01

Serum was analyzed from 146 healthy adult volunteers in eastern Africa to evaluate measles virus (MV) and canine distemper virus (CDV) neutralizing antibody (nAb) prevalence and potency. MV plaque reduction neutralization test (PRNT) results indicated that all sera were positive for MV nAbs. Furthermore, the 50% neutralizing dose (ND50) for the majority of sera corresponded to antibody titers induced by MV vaccination. CDV nAbs titers were low and generally were detected in sera with high MV nAb titers. A mutant CDV was generated that was less sensitive to neutralization by human serum. The mutant virus genome had 10 nucleotide substitutions, which coded for single amino acid substitutions in the fusion (F) and hemagglutinin (H) glycoproteins and two substitutions in the large polymerase (L) protein. The H substitution occurred in a conserved region involved in receptor interactions among morbilliviruses, implying that this region is a target for cross-reactive neutralizing antibodies. Copyright © 2015 Elsevier Inc. All rights reserved.

Canine distemper outbreak in pet store puppies linked to a high-volume dog breeder.

Science.gov (United States)

Schumaker, Brant A; Miller, Myrna M; Grosdidier, Paul; Cavender, Jacqueline L; Montgomery, Donald L; Cornish, Todd E; Farr, Robert M; Driscoll, Michael; Maness, Lori J; Gray, Tangney; Petersen, Dana; Brown, William L; Logan, Jim; O'Toole, Donal

2012-11-01

Canine distemper is uncommon in the pet trade in the United States, in large part due to effective vaccines against Canine distemper virus (CDV). This is a report of CDV affecting 24 young dogs of multiple breeds shortly after sale by 2 pet stores in Wyoming during August-October 2010. Cases were diagnosed over 37 days. Diagnosis was established by a combination of fluorescent antibody staining, reverse transcription polymerase chain reaction, negative stain electron microscopy, and necropsy with histopathology. Viral hemagglutinin gene sequences were analyzed from 2 affected dogs and were identical (GenBank accession no. JF283477). Sequences were distinct from those in a contemporaneous unrelated case of CDV in a Wyoming dog (JF283476) that had no contact with the pet store dogs. The breeding property from which the puppies originated was quarantined by the Kansas Animal Health Department. Puppies intended for sale were tested for CDV. Canine distemper was diagnosed on site in November 2010. At that point 1,466 dogs were euthanized to eliminate dispersal of the disease through commercial channels. The investigation underscores the risks inherent in large-scale dog breeding when vaccination and biosecurity practices are suboptimal.

In vitro inhibition of canine distemper virus by flavonoids and phenolic acids: implications of structural differences for antiviral design.

Science.gov (United States)

Carvalho, O V; Botelho, C V; Ferreira, C G T; Ferreira, H C C; Santos, M R; Diaz, M A N; Oliveira, T T; Soares-Martins, J A P; Almeida, M R; Silva, A

2013-10-01

Infection caused by canine distemper virus (CDV) is a highly contagious disease with high incidence and lethality in the canine population. Antiviral activity of flavonoids quercetin, morin, rutin and hesperidin, and phenolic cinnamic, trans-cinnamic and ferulic acids were evaluated in vitro against the CDV using the time of addition assay to determine which step of the viral replicative cycle was affected. All flavonoids displayed great viral inhibition when they were added at the times 0 (adsorption) and 1h (penetration) of the viral replicative cycle. Both quercetin and hesperidin presented antiviral activity at the time 2h (intracellular). In the other hand, cinnamic acid showed antiviral activity at the times 0 and 2h while trans-cinnamic acid showed antiviral effect at the times -1h (pre-treatment) and 0 h. Ferulic acid inhibited CDV replicative cycle at the times 0 and 1h. Our study revealed promising candidates to be considered in the treatment of CDV. Structural differences among compounds and correlation to their antiviral activity were also explored. Our analysis suggest that these compounds could be useful in order to design new antiviral drugs against CDV as well as other viruses of great meaning in veterinary medicine. Copyright © 2013 Elsevier Ltd. All rights reserved.

Use of quantitative real-time RT-PCR to investigate the correlation between viremia and viral shedding of canine distemper virus, and infection outcomes in experimentally infected dogs.

Science.gov (United States)

Sehata, Go; Sato, Hiroaki; Ito, Toshihiro; Imaizumi, Yoshitaka; Noro, Taichi; Oishi, Eiji

2015-07-01

We used real-time RT-PCR and virus titration to examine canine distemper virus (CDV) kinetics in peripheral blood and rectal and nasal secretions from 12 experimentally infected dogs. Real-time RT-PCR proved extremely sensitive, and the correlation between the two methods for rectal and nasal (r=0.78, 0.80) samples on the peak day of viral RNA was good. Although the dogs showed diverse symptoms, viral RNA kinetics were similar; the peak of viral RNA in the symptomatic dogs was consistent with the onset of symptoms. These results indicate that real-time RT-PCR is sufficiently sensitive to monitor CDV replication in experimentally infected dogs regardless of the degree of clinical manifestation and suggest that the peak of viral RNA reflects active CDV replication.

Molecular typing of canine distemper virus strains reveals the presence of a new genetic variant in South America.

Science.gov (United States)

Sarute, Nicolás; Pérez, Ruben; Aldaz, Jaime; Alfieri, Amauri A; Alfieri, Alice F; Name, Daniela; Llanes, Jessika; Hernández, Martín; Francia, Lourdes; Panzera, Yanina

2014-06-01

Canine distemper virus (CDV, Paramyxoviridae, Morbillivirus) is the causative agent of a severe infectious disease affecting terrestrial and marine carnivores worldwide. Phylogenetic relationships and the genetic variability of the hemagglutinin (H) protein and the fusion protein signal-peptide (Fsp) allow for the classification of field strains into genetic lineages. Currently, there are nine CDV lineages worldwide, two of them co-circulating in South America. Using the Fsp-coding region, we analyzed the genetic variability of strains from Uruguay, Brazil, and Ecuador, and compared them with those described previously in South America and other geographical areas. The results revealed that the Brazilian and Uruguayan strains belong to the already described South America lineage (EU1/SA1), whereas the Ecuadorian strains cluster in a new clade, here named South America 3, which may represent the third CDV lineage described in South America.

Phylogenetic evidence of a new canine distemper virus lineage among domestic dogs in Colombia, South America.

Science.gov (United States)

Espinal, Maria A; Díaz, Francisco J; Ruiz-Saenz, Julian

2014-08-06

Canine distemper virus (CDV) is a highly contagious viral disease of carnivores affecting both wild and domestic populations. The hemagglutinin gene, encoding for the attachment protein that determines viral tropism, shows high heterogeneity among strains, allowing for the distinction of ten different lineages distributed worldwide according to a geographic pattern. We obtained the sequences of the full-length H gene of 15 wild-type CDV strains circulating in domestic dog populations from the Aburrá Valley, Colombia. A phylogenetic analysis of H gene nucleotide sequences from Colombian CDV viruses along with field isolates from different geographic regions and vaccine strains was performed. Colombian wild-type viruses formed a distinct monophyletic cluster clearly separated from the previously identified wild-type and vaccine lineages, suggesting that a novel genetic variant, quite different from vaccines and other lineages, is circulating among dog populations in the Aburrá Valley. We propose naming this new lineage as "South America 3". This information indicates that there are at least three different CDV lineages circulating in domestic and wild carnivore populations in South America. The first one, renamed Europe/South America 1, circulates in Brazil and Uruguay; the second, South America 2, appears to be restricted to Argentina; and the third, South America 3, which comprises all the strains characterized in this study, may also be circulating in other northern countries of South America. Copyright © 2014 Elsevier B.V. All rights reserved.

Estimating the potential impact of canine distemper virus on the Amur tiger population (Panthera tigris altaica) in Russia.

Science.gov (United States)

Gilbert, Martin; Miquelle, Dale G; Goodrich, John M; Reeve, Richard; Cleaveland, Sarah; Matthews, Louise; Joly, Damien O

2014-01-01

Lethal infections with canine distemper virus (CDV) have recently been diagnosed in Amur tigers (Panthera tigris altaica), but long-term implications for the population are unknown. This study evaluates the potential impact of CDV on a key tiger population in Sikhote-Alin Biosphere Zapovednik (SABZ), and assesses how CDV might influence the extinction potential of other tiger populations of varying sizes. An individual-based stochastic, SIRD (susceptible-infected-recovered/dead) model was used to simulate infection through predation of infected domestic dogs, and/or wild carnivores, and direct tiger-to-tiger transmission. CDV prevalence and effective contact based on published and observed data was used to define plausible low- and high-risk infection scenarios. CDV infection increased the 50-year extinction probability of tigers in SABZ by 6.3% to 55.8% compared to a control population, depending on risk scenario. The most significant factors influencing model outcome were virus prevalence in the reservoir population(s) and its effective contact rate with tigers. Adjustment of the mortality rate had a proportional impact, while inclusion of epizootic infection waves had negligible additional impact. Small populations were found to be disproportionately vulnerable to extinction through CDV infection. The 50-year extinction risk in populations consisting of 25 individuals was 1.65 times greater when CDV was present than that of control populations. The effects of density dependence do not protect an endangered population from the impacts of a multi-host pathogen, such as CDV, where they coexist with an abundant reservoir presenting a persistent threat. Awareness of CDV is a critical component of a successful tiger conservation management policy.

Estimating the potential impact of canine distemper virus on the Amur tiger population (Panthera tigris altaica in Russia.

Directory of Open Access Journals (Sweden)

Martin Gilbert

Full Text Available Lethal infections with canine distemper virus (CDV have recently been diagnosed in Amur tigers (Panthera tigris altaica, but long-term implications for the population are unknown. This study evaluates the potential impact of CDV on a key tiger population in Sikhote-Alin Biosphere Zapovednik (SABZ, and assesses how CDV might influence the extinction potential of other tiger populations of varying sizes. An individual-based stochastic, SIRD (susceptible-infected-recovered/dead model was used to simulate infection through predation of infected domestic dogs, and/or wild carnivores, and direct tiger-to-tiger transmission. CDV prevalence and effective contact based on published and observed data was used to define plausible low- and high-risk infection scenarios. CDV infection increased the 50-year extinction probability of tigers in SABZ by 6.3% to 55.8% compared to a control population, depending on risk scenario. The most significant factors influencing model outcome were virus prevalence in the reservoir population(s and its effective contact rate with tigers. Adjustment of the mortality rate had a proportional impact, while inclusion of epizootic infection waves had negligible additional impact. Small populations were found to be disproportionately vulnerable to extinction through CDV infection. The 50-year extinction risk in populations consisting of 25 individuals was 1.65 times greater when CDV was present than that of control populations. The effects of density dependence do not protect an endangered population from the impacts of a multi-host pathogen, such as CDV, where they coexist with an abundant reservoir presenting a persistent threat. Awareness of CDV is a critical component of a successful tiger conservation management policy.

Estimating the Potential Impact of Canine Distemper Virus on the Amur Tiger Population (Panthera tigris altaica) in Russia

Science.gov (United States)

Gilbert, Martin; Miquelle, Dale G.; Goodrich, John M.; Reeve, Richard; Cleaveland, Sarah; Matthews, Louise; Joly, Damien O.

2014-01-01

Lethal infections with canine distemper virus (CDV) have recently been diagnosed in Amur tigers (Panthera tigris altaica), but long-term implications for the population are unknown. This study evaluates the potential impact of CDV on a key tiger population in Sikhote-Alin Biosphere Zapovednik (SABZ), and assesses how CDV might influence the extinction potential of other tiger populations of varying sizes. An individual-based stochastic, SIRD (susceptible-infected-recovered/dead) model was used to simulate infection through predation of infected domestic dogs, and/or wild carnivores, and direct tiger-to-tiger transmission. CDV prevalence and effective contact based on published and observed data was used to define plausible low- and high-risk infection scenarios. CDV infection increased the 50-year extinction probability of tigers in SABZ by 6.3% to 55.8% compared to a control population, depending on risk scenario. The most significant factors influencing model outcome were virus prevalence in the reservoir population(s) and its effective contact rate with tigers. Adjustment of the mortality rate had a proportional impact, while inclusion of epizootic infection waves had negligible additional impact. Small populations were found to be disproportionately vulnerable to extinction through CDV infection. The 50-year extinction risk in populations consisting of 25 individuals was 1.65 times greater when CDV was present than that of control populations. The effects of density dependence do not protect an endangered population from the impacts of a multi-host pathogen, such as CDV, where they coexist with an abundant reservoir presenting a persistent threat. Awareness of CDV is a critical component of a successful tiger conservation management policy. PMID:25354196

Persistence of canine distemper virus in the Greater Yellowstone Ecosystem's carnivore community

Science.gov (United States)

Almberg, E.S.; Cross, P.C.; Smith, D.W.

2010-01-01

Canine distemper virus (CDV) is an acute, highly immunizing pathogen that should require high densities and large populations of hosts for long-term persistence, yet CDV persists among terrestrial carnivores with small, patchily distributed groups. We used CDV in the Greater Yellowstone ecosystem's (GYE) wolves (Canis lupus) and coyotes (Canis latrans) as a case study for exploring how metapopulation structure, host demographics, and multi-host transmission affect the critical community size and spatial scale required for CDV persistence. We illustrate how host spatial connectivity and demographic turnover interact to affect both local epidemic dynamics, such as the length and variation in inter-epidemic periods, and pathogen persistence using stochastic, spatially explicit susceptible-exposed-infectious-recovered simulation models. Given the apparent absence of other known persistence mechanisms (e.g., a carrier or environmental state, densely populated host, chronic infection, or a vector), we suggest that CDV requires either large spatial scales or multi-host transmission for persistence. Current GYE wolf populations are probably too small to support endemic CDV. Coyotes are a plausible reservoir host, but CDV would still require 50 000-100 000 individuals for moderate persistence (>50% over 10 years), which would equate to an area of 1-3 times the size of the GYE (60000-200000 km2). Coyotes, and carnivores in general, are not uniformly distributed; therefore, this is probably a gross underestimate of the spatial scale of CDV persistence. However, the presence of a second competent host species can greatly increase the probability of long-term CDV persistence at much smaller spatial scales. Although no management of CDV is currently recommended for the GYE, wolf managers in the region should expect periodic but unpredictable CDV-related population declines as often as every 2-5 years. Awareness and monitoring of such outbreaks will allow corresponding

Persistence of canine distemper virus in the Greater Yellowstone ecosystem's carnivore community.

Science.gov (United States)

Almberg, Emily S; Cross, Paul C; Smith, Douglas W

2010-10-01

Canine distemper virus (CDV) is an acute, highly immunizing pathogen that should require high densities and large populations of hosts for long-term persistence, yet CDV persists among terrestrial carnivores with small, patchily distributed groups. We used CDV in the Greater Yellowstone ecosystem's (GYE) wolves (Canis lupus) and coyotes (Canis latrans) as a case study for exploring how metapopulation structure, host demographics, and multi-host transmission affect the critical community size and spatial scale required for CDV persistence. We illustrate how host spatial connectivity and demographic turnover interact to affect both local epidemic dynamics, such as the length and variation in inter-epidemic periods, and pathogen persistence using stochastic, spatially explicit susceptible-exposed-infectious-recovered simulation models. Given the apparent absence of other known persistence mechanisms (e.g., a carrier or environmental state, densely populated host, chronic infection, or a vector), we suggest that CDV requires either large spatial scales or multi-host transmission for persistence. Current GYE wolf populations are probably too small to support endemic CDV. Coyotes are a plausible reservoir host, but CDV would still require 50000-100000 individuals for moderate persistence (> 50% over 10 years), which would equate to an area of 1-3 times the size of the GYE (60000-200000 km2). Coyotes, and carnivores in general, are not uniformly distributed; therefore, this is probably a gross underestimate of the spatial scale of CDV persistence. However, the presence of a second competent host species can greatly increase the probability of long-term CDV persistence at much smaller spatial scales. Although no management of CDV is currently recommended for the GYE, wolf managers in the region should expect periodic but unpredictable CDV-related population declines as often as every 2-5 years. Awareness and monitoring of such outbreaks will allow corresponding adjustments

Detection and differentiation of field and vaccine strains of canine distemper virus using reverse transcription followed by nested real time PCR (RT-nqPCR) and RFLP analysis.

Science.gov (United States)

Fischer, Cristine Dossin Bastos; Ikuta, Nilo; Canal, Cláudio Wageck; Makiejczuk, Aline; Allgayer, Mariangela da Costa; Cardoso, Cristine Hoffmeister; Lehmann, Fernanda Kieling; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo

2013-12-01

Canine distemper virus (CDV) is the cause of a severe and highly contagious disease in dogs. Practical diagnosis of canine distemper based on clinical signs and laboratory tests are required to confirm CDV infection. The present study aimed to develop a molecular assay to detect and differentiate field and vaccine CDV strains. Reverse transcription followed by nested real time polymerase chain reaction (RT-nqPCR) was developed, which exhibited analytical specificity (all the samples from healthy dogs and other canine infectious agents were not incorrectly detected) and sensitivity (all replicates of a vaccine strain were positive up to the 3125-fold dilution - 10(0.7) TCID50). RT-nqPCR was validated for CDV detection on different clinical samples (blood, urine, rectal and conjunctival swabs) of 103 animals suspected to have distemper. A total of 53 animals were found to be positive based on RT-nqPCR in at least one clinical sample. Blood resulted in more positive samples (50 out of 53, 94.3%), followed by urine (44/53, 83.0%), rectal (38/53, 71%) and conjunctival (27/53, 50.9%) swabs. A commercial immunochromatography (IC) assay had detected CDV in only 30 conjunctival samples of these positive dogs. Nucleoprotein (NC) gene sequencing of 25 samples demonstrated that 23 of them were closer to other Brazilian field strains and the remaining two to vaccine strains. A single nucleotide sequences difference, which creates an Msp I restriction enzyme digestion, was used to differentiate between field and vaccine CDV strains by restriction fragment length polymorphism (RFLP) analysis. The complete assay was more sensitive than was IC for the detection of CDV. Blood was the more frequently positive specimen and the addition of a restriction enzyme step allowed the differentiation of vaccine and Brazilian field strains. Copyright © 2013 Elsevier B.V. All rights reserved.

Genotyping canine distemper virus (CDV) by a hemi-nested multiplex PCR provides a rapid approach for investigation of CDV outbreaks

DEFF Research Database (Denmark)

Blixenkrone-Møller, Merete; Martella, Vito

2007-01-01

CDV is a highly contagious viral pathogen causing a lethal systemic disease in dogs and other carnivores. Several lineages or genotypes of CDV exist that are variously distributed throughout several continents. Legal or uncontrolled trading of animals may modify the epidemiology of CDV, introduci...

Emergence of canine distemper virus strains with two amino acid substitutions in the haemagglutinin protein, detected from vaccinated carnivores in North-Eastern China in 2012-2013.

Science.gov (United States)

Zhao, Jianjun; Zhang, Hailing; Bai, Xue; Martella, Vito; Hu, Bo; Sun, Yangang; Zhu, Chunsheng; Zhang, Lei; Liu, Hao; Xu, Shujuan; Shao, Xiqun; Wu, Wei; Yan, Xijun

2014-04-01

A total of 16 strains of canine distemper virus (CDV) were detected from vaccinated minks, foxes, and raccoon dogs in four provinces in North-Eastern China between the end of 2011 and 2013. Upon sequence analysis of the haemagglutinin gene and comparison with wild-type CDV from different species in the same geographical areas, two non-synonymous single nucleotide polymorphisms were identified in 10 CDV strains, which led to amino acid changes at positions 542 (isoleucine to asparagine) and 549 (tyrosine to histidine) of the haemagglutinin protein coding sequence. The change at residue 542 generated a potentially novel N-glycosylation site. Masking of antigenic epitopes by sugar moieties might represent a mechanism for evasion of virus neutralising antibodies and reduced protection by vaccination. Copyright © 2014 Elsevier Ltd. All rights reserved.

Canine distemper virus in the Serengeti ecosystem: molecular adaptation to different carnivore species.

Science.gov (United States)

Nikolin, Veljko M; Olarte-Castillo, Ximena A; Osterrieder, Nikolaus; Hofer, Heribert; Dubovi, Edward; Mazzoni, Camila J; Brunner, Edgar; Goller, Katja V; Fyumagwa, Robert D; Moehlman, Patricia D; Thierer, Dagmar; East, Marion L

2017-04-01

Was the 1993/1994 fatal canine distemper virus (CDV) epidemic in lions and spotted hyaenas in the Serengeti ecosystem caused by the recent spillover of a virulent domestic dog strain or one well adapted to these noncanids? We examine this question using sequence data from 13 'Serengeti' strains including five complete genomes obtained between 1993 and 2011. Phylogenetic and haplotype network analyses reveal that strains from noncanids during the epidemic were more closely related to each other than to those from domestic or wild canids. All noncanid 'Serengeti' strains during the epidemic encoded: (1) one novel substitution G134S in the CDV-V protein; and (2) the rare amino acid combination 519I/549H at two sites under positive selection in the region of the CDV-H protein that binds to SLAM (CD 150) host cell receptors. Worldwide, only a few noncanid strains in the America II lineage encode CDV-H 519I/549H. All canid 'Serengeti' strains during the epidemic coded CDV-V 134G, and CDV-H 519R/549Y, or 519R/549H. A functional assay of cell entry revealed the highest performance by CDV-H proteins encoding 519I/549H in cells expressing lion SLAM receptors, and the highest performance by proteins encoding 519R/549Y, typical of dog strains worldwide, in cells expressing dog SLAM receptors. Our findings are consistent with an epidemic in lions and hyaenas caused by CDV variants better adapted to noncanids than canids, but not with the recent spillover of a dog strain. Our study reveals a greater complexity of CDV molecular epidemiology in multihost environments than previously thought. © 2016 John Wiley & Sons Ltd.

Pneumonia due to Talaromyces marneffei in a Dog from Southern Brazil with Concomitant Canine Distemper Virus Infection.

Science.gov (United States)

Headley, S A; Pretto-Giordano, L G; Lima, S C; Suhett, W G; Pereira, A H T; Freitas, L A; Suphoronski, S A; Oliveira, T E S; Alfieri, A F; Pereira, E C; Vilas-Boas, L A; Alfieri, A A

2017-07-01

The pathological and molecular findings associated with Talaromyces marneffei-induced pneumonia with concomitant infection by canine distemper virus (CDV) are described in a dog. The principal pathological alteration occurred in the lungs. Histopathology confirmed multifocal granulomatous pneumonia associated with numerous intralesional and intracellular septate fission cells consistent with T. marneffei. A molecular assay designed to amplify a partial fragment of the 18S rRNA gene of T. marneffei provided positive results from two fungal cultures derived from the lung. Sequencing and phylogenetic analyses confirmed the results of polymerase chain reaction (PCR). Furthermore, antigens of the CDV N protein were identified within the bronchial epithelium by immunohistochemistry and a PCR assay amplified the CDV N gene from hepatic and pulmonary fragments. Collectively, the pathological and molecular techniques confirmed a diagnosis of T. marneffei-induced pneumonia with concomitant infection by CDV. These findings represent the first description of pulmonary penicilliosis in the dog and extend the geographical niche of this emerging infectious pathogen. In this case, infection by CDV may have induced immunosuppression, which facilitated the development of pulmonary penicilliosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

New aspects of the pathogenesis of canine distemper leukoencephalitis.

Science.gov (United States)

Lempp, Charlotte; Spitzbarth, Ingo; Puff, Christina; Cana, Armend; Kegler, Kristel; Techangamsuwan, Somporn; Baumgärtner, Wolfgang; Seehusen, Frauke

2014-07-02

Canine distemper virus (CDV) is a member of the genus morbillivirus, which is known to cause a variety of disorders in dogs including demyelinating leukoencephalitis (CDV-DL). In recent years, substantial progress in understanding the pathogenetic mechanisms of CDV-DL has been made. In vivo and in vitro investigations provided new insights into its pathogenesis with special emphasis on axon-myelin-glia interaction, potential endogenous mechanisms of regeneration, and astroglial plasticity. CDV-DL is characterized by lesions with a variable degree of demyelination and mononuclear inflammation accompanied by a dysregulated orchestration of cytokines as well as matrix metalloproteinases and their inhibitors. Despite decades of research, several new aspects of the neuropathogenesis of CDV-DL have been described only recently. Early axonal damage seems to represent an initial and progressive lesion in CDV-DL, which interestingly precedes demyelination. Axonopathy may, thus, function as a potential trigger for subsequent disturbed axon-myelin-glia interactions. In particular, the detection of early axonal damage suggests that demyelination is at least in part a secondary event in CDV-DL, thus challenging the dogma of CDV as a purely primary demyelinating disease. Another unexpected finding refers to the appearance of p75 neurotrophin (NTR)-positive bipolar cells during CDV-DL. As p75NTR is a prototype marker for immature Schwann cells, this finding suggests that Schwann cell remyelination might represent a so far underestimated endogenous mechanism of regeneration, though this hypothesis still remains to be proven. Although it is well known that astrocytes represent the major target of CDV infection in CDV-DL, the detection of infected vimentin-positive astrocytes in chronic lesions indicates a crucial role of this cell population in nervous distemper. While glial fibrillary acidic protein represents the characteristic intermediate filament of mature astrocytes

New Aspects of the Pathogenesis of Canine Distemper Leukoencephalitis

Science.gov (United States)

Lempp, Charlotte; Spitzbarth, Ingo; Puff, Christina; Cana, Armend; Kegler, Kristel; Techangamsuwan, Somporn; Baumgärtner, Wolfgang; Seehusen, Frauke

2014-01-01

Canine distemper virus (CDV) is a member of the genus morbillivirus, which is known to cause a variety of disorders in dogs including demyelinating leukoencephalitis (CDV-DL). In recent years, substantial progress in understanding the pathogenetic mechanisms of CDV-DL has been made. In vivo and in vitro investigations provided new insights into its pathogenesis with special emphasis on axon-myelin-glia interaction, potential endogenous mechanisms of regeneration, and astroglial plasticity. CDV-DL is characterized by lesions with a variable degree of demyelination and mononuclear inflammation accompanied by a dysregulated orchestration of cytokines as well as matrix metalloproteinases and their inhibitors. Despite decades of research, several new aspects of the neuropathogenesis of CDV-DL have been described only recently. Early axonal damage seems to represent an initial and progressive lesion in CDV-DL, which interestingly precedes demyelination. Axonopathy may, thus, function as a potential trigger for subsequent disturbed axon-myelin-glia interactions. In particular, the detection of early axonal damage suggests that demyelination is at least in part a secondary event in CDV-DL, thus challenging the dogma of CDV as a purely primary demyelinating disease. Another unexpected finding refers to the appearance of p75 neurotrophin (NTR)-positive bipolar cells during CDV-DL. As p75NTR is a prototype marker for immature Schwann cells, this finding suggests that Schwann cell remyelination might represent a so far underestimated endogenous mechanism of regeneration, though this hypothesis still remains to be proven. Although it is well known that astrocytes represent the major target of CDV infection in CDV-DL, the detection of infected vimentin-positive astrocytes in chronic lesions indicates a crucial role of this cell population in nervous distemper. While glial fibrillary acidic protein represents the characteristic intermediate filament of mature astrocytes

9 CFR 113.201 - Canine Distemper Vaccine, Killed Virus.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine, Killed Virus... REQUIREMENTS Killed Virus Vaccines § 113.201 Canine Distemper Vaccine, Killed Virus. Canine Distemper Vaccine... canine distemper susceptible dogs (20 vaccinates and 5 controls) shall be used as test animals. Blood...

Canine Distemper Virus Antigen Detection in External Epithelia of Recently Vaccinated, Sick Dogs by Fluorescence Microscopy Is a Valuable Prognostic Indicator

Science.gov (United States)

Neel, Tina

2014-01-01

Currently, there are no reliable predictors of the clinical outcomes of domesticated dogs that have been recently vaccinated against canine distemper virus (CDV) and develop respiratory disease. In this study, vaccinated dogs from Oklahoma City that were showing clinical signs of respiratory disease were evaluated for CDV antigen using a direct fluorescent antibody test (FAT). Clinical outcomes after standard symptomatic therapy for respiratory disease were recorded, and a statistical analysis of the results was performed. We present our study showing that CDV FAT results were predictive of clinical recovery (prognostic indicator, prospects of clinical recovery) among vaccinated dogs showing clinical signs of respiratory disease. Negative CDV FAT results equated to 80% chances of recovery after symptomatic therapy, compared to 55% chances of recovery when the CDV FAT results were positive. Based on the results of this study, we show that veterinarians can make better informed decisions about the clinical outcomes of suspected CDV cases, with 2-h turnaround times, by using the CDV FAT. Thus, antemortem examination with the CDV FAT on external epithelia of recently vaccinated, sick dogs is a clinically useful diagnostic test and valuable prognostic indicator for veterinarians. Application of the CDV FAT to these samples avoids unnecessary euthanasia of dogs with suspected CDV. PMID:25428156

Three-year rabies duration of immunity in dogs following vaccination with a core combination vaccine against canine distemper virus, canine adenovirus type-1, canine parvovirus, and rabies virus.

Science.gov (United States)

Lakshmanan, Nallakannu; Gore, Thomas C; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

2006-01-01

Thirty-two seronegative pups were vaccinated at 8 weeks of age with modified-live canine distemper virus (CDV), canine adenovirus type-2 (CAV-2), and canine parvovirus (CPV) vaccine and at 12 weeks with a modified-live CDV, CAV-2, CPV, and killed rabies virus vaccine. An additional 31 seronegative pups served as age-matched, nonvaccinated controls. All test dogs were strictly isolated for 3 years after receiving the second vaccination and then were challenged with virulent rabies virus. Clinical signs of rabies were prevented in 28 (88%) of the 32 vaccinated dogs. In contrast, 97% (30 of 31) of the control dogs died of rabies infection. These study results indicated that no immunogenic interference occurred between the modified-live vaccine components and the killed rabies virus component. Furthermore, these results indicated that the rabies component in the test vaccine provided protection against virulent rabies challenge in dogs 12 weeks of age or older for a minimum of 3 years following vaccination.

Three-year duration of immunity in dogs following vaccination against canine adenovirus type-1, canine parvovirus, and canine distemper virus.

Science.gov (United States)

Gore, Thomas C; Lakshmanan, Nallakannu; Duncan, Karen L; Coyne, Michael J; Lum, Melissa A; Sterner, Frank J

2005-01-01

A challenge-of-immunity study was conducted to demonstrate immunity in dogs 3 years after their second vaccination with a new multivalent, modified-live vaccine containing canine adenovirus type 2 (CAV-2), canine parvovirus (CPV), and canine distemper virus (CDV). Twenty-three seronegative pups were vaccinated at 7 and 11 weeks of age. Eighteen seronegative pups, randomized into groups of six dogs, served as challenge controls. Dogs were kept in strict isolation for 3 years following the vaccination and then challenged sequentially with virulent canine adenovirus type 1 (CAV-1), CPV, and CDV. For each viral challenge, a separate group of six control dogs was also challenged. Clinical signs of CAV-1, CPV, and CDV infections were prevented in 100% of vaccinated dogs, demonstrating that the multivalent, modified-live test vaccine provided protection against virulent CAV-1, CPV, and CDV challenge in dogs 7 weeks of age or older for a minimum of 3 years following second vaccination.

EVALUATION OF TWO CANINE DISTEMPER VIRUS VACCINES IN CAPTIVE TIGERS (PANTHERA TIGRIS).

Science.gov (United States)

Sadler, Ryan A; Ramsay, Edward; McAloose, Denise; Rush, Robert; Wilkes, Rebecca P

2016-06-01

Canine distemper virus (CDV) has caused clinical disease and death in nondomestic felids in both captive settings and in the wild. Outbreaks resulting in high mortality rates in tigers (Panthera tigris) have prompted some zoos to vaccinate tigers for CDV. In this study, six tigers received a recombinant canarypox-vectored CDV vaccine (1 ml s.c.) and were revaccinated with 3 ml s.c. (mean) 39 days later. Blood collection for CDV antibody detection via serum neutralization was performed on (mean) days 0, 26, and 66 post-initial vaccination. No tigers had detectable antibodies at days 0 or 26, and only two tigers had low (16 and 32) antibody titers at day 66. Eight additional tigers received a live, attenuated CDV vaccine (1 ml s.c.) on day 0 and were revaccinated with 1 ml s.c. (mean) 171 days later. Blood collection for CDV antibody detection via serum neutralization was performed on (mean) days 0, 26, 171, and 196. Seven of eight tigers receiving the live, attenuated vaccine had no detectable titers prior to vaccination, but all animals had titers of >128 (range 128-1,024) at day 26. At 171 days, all tigers still had detectable titers (geometric mean 69.8, range 16-256), and at 196 days (2 wk post-revaccination) all but two showed an increase to >128 (range 32-512). To determine safety, an additional 41 tigers were vaccinated with 2 ml of a recombinant vaccine containing only CDV components, and an additional 38 tigers received 1 ml of the live, attenuated vaccine, administered either subcutaneously or intramuscularly; no serious adverse effects were noted. Although both vaccines appear safe, the live, attenuated vaccine produced a stronger and more consistent serologic response in tigers.

Comparison of reverse-transcription real-time PCR and immunohistochemistry for the detection of canine distemper virus infection in raccoons in Ontario, Canada.

Science.gov (United States)

Nemeth, Nicole M; Oesterle, Paul T; Campbell, G Douglas; Ojkic, Davor; Jardine, Claire M

2018-03-01

Canine distemper virus (CDV) is a widespread morbillivirus that causes subclinical to fatal infections in domestic and wild carnivores. Raccoons ( Procyon lotor) are CDV reservoirs and suffer from associated disease. Aspects of pathogenesis may lead to difficulty in the interpretation of commonly used testing modalities, such as reverse-transcription real-time (RT-rt)PCR and immunohistochemistry (IHC). The reliance upon such tests is greater for wildlife, which are often submitted as carcasses with no clinical history. We compared CDV RT-rtPCR results to immunohistochemistry (the gold standard) in tissues from 74 raccoons. These tests had high kappa agreement (lymph node: 0.9335; lung: 0.8671) and a negative correlation between IHC score and threshold cycle (Ct) value for lymph node and lung (Spearman rank correlation coefficient [ r s ] = -0.8555 and -0.8179, respectively; p < 0.00001). An RT-rtPCR Ct value of 30 in lung and lymph node with sensitivity and specificity of 92.3 and 92.6% and 86.8 and 96.4%, respectively, was suitable for determining CDV involvement. Conjunctival swabs provide an alternative for distemper diagnosis, as there was a strong correlation between Ct values of conjunctival swabs and tissues ( r s = -0.8498, p < 0.00001, n = 46). This information will aid in more efficient and accurate diagnoses in individuals, small-scale outbreaks, and epidemiologic investigations in wildlife.

Prevalence of antibodies to canine parvovirus and distemper virus in wolves in the Canadian Rocky Mountains.

Science.gov (United States)

Nelson, Brynn; Hebblewhite, Mark; Ezenwa, Vanessa; Shury, Todd; Merrill, Evelyn H; Paquet, Paul C; Schmiegelow, Fiona; Seip, Dale; Skinner, Geoff; Webb, Nathan

2012-01-01

Wild carnivores are often exposed to diseases via contact with peridomestic host species that travel through the wildland-urban interfaces. To determine the antibody prevalences and relationships to human activity for two common canid pathogens, we sampled 99 wolves (Canis lupus) from 2000 to 2008 for antibodies to canine parvovirus (CPV) and canine distemper virus (CDV) in Banff and Jasper National Parks and surrounding areas of the Canadian Rockies. This population was the source for wolves reintroduced into the Northern Rockies of the US. Of 99 wolves sampled, 94 had detectable antibody to CPV (95%), 24 were antibody-positive for CDV (24%), and 24 had antibodies to both pathogens (24%). We tested whether antibody prevalences for CPV and CDV were higher closer to human activity (roads, town sites, First Nation reserves) and as a function of sex and age class. Wolves ≥2 yr old were more likely to be have antibodies to CPV. For CDV, male wolves, wolves ≥2 yr, and those closer to First Nation reserves were more likely to have antibodies. Overall, however, we found minimal support for human influence on antibody prevalence for CDV and CPV. The similarity between our antibody prevalence results and results from recent studies in Yellowstone National Park suggests that at least in the case of CDV, and perhaps CPV, these could be important pathogens with potential effects on wolf populations.

Comparison of two assays for detection of antibodies against canine parvovirus and canine distemper virus in dogs admitted to a Florida animal shelter.

Science.gov (United States)

Gray, Lauren K; Crawford, P Cynda; Levy, Julie K; Dubovi, Edward J

2012-05-01

To compare 2 assays for use in the identification of dogs with a protective antibody titer (PAT) against canine parvovirus (CPV) and canine distemper virus (CDV). Prospective cross-sectional study. 431 dogs admitted to a municipal animal shelter in north central Florida. Blood samples were collected from dogs on the day of admission to the shelter. Serum was obtained, criterion-referenced assays were used to identify dogs that had PATs against CPV (titers ≥ 80; hemagglutination inhibition assay) and CDV (titers ≥ 32; virus neutralization assay), and results were compared with results of a semiquantitative ELISA and an immunofluorescence assay (IFA). For correct identification of dogs that had PATs against viruses, the ELISA had significantly higher specificity for CPV (98%) and CDV (95%) than did the IFA (82% and 70%, respectively) and had significantly lower sensitivity for CDV (88%) than did the IFA (97%); the sensitivity for CPV was similar (ELISA, 98%; IFA, 97%). Overall diagnostic accuracy was significantly greater with the ELISA than with the IFA. Predictive value of a positive result for PATs was significantly higher with the ELISA for CPV (99%) and CDV (93%) than with the IFA (92% and 71%, respectively). The ELISA had fewer false-positive results than did the IFA and could be performed on-site in shelters in < 1 hour. Accuracy and practicality of the ELISA may be useful for identifying the infection risk of dogs exposed during outbreaks attributable to CPV and CDV infections in shelters.

Diversity of susceptible hosts in canine distemper virus infection: a systematic review and data synthesis.

Science.gov (United States)

Martinez-Gutierrez, Marlen; Ruiz-Saenz, Julian

2016-05-12

Canine distemper virus (CDV) is the etiological agent of one of the most infectious diseases of domestic dogs, also known as a highly prevalent viral infectious disease of carnivores and posing a conservation threat to endangered species around the world. To get a better panorama of CDV infection in different Orders, a retrospective and documental systematic review of the role of CDV in different non-dog hosts was conducted. The bibliographical data were collected from MedLine/PubMed and Scopus databases. Data related to Order, Family, Genus and Species of the infected animals, the presence or absence of clinical signs, mortality, serological, molecular or antigenic confirmation of CDV infection, geographic location, were collected and summarized. Two hundred seventeen scientific articles were considered eligible which includes reports of serological evaluation, and antigenic or genomic confirmation of CDV infection in non-dog hosts. CDV infects naturally and experimentally different members of the Orders Carnivora (in 12 Families), Rodentia (four Families), Primates (two Families), Artiodactyla (three Families) and Proboscidea (one Family). The Order Carnivora (excluding domestic dogs) accounts for the vast majority (87.5%) of the records. Clinical disease associated with CDV infection was reported in 51.8% of the records and serological evidence of CDV infection in apparently healthy animals was found in 49.5% of the records. High mortality rate was showed in some of the recorded infections in Orders different to Carnivora. In non-dog hosts, CDV has been reported all continents with the exception of Australasia and in 43 different countries. The results of this systematic review demonstrate that CDV is able to infect a very wide range of host species from many different Orders and emphasizes the potential threat of infection for endangered wild species as well as raising concerns about potential zoonotic threats following the cessation of large-scale measles

An outbreak of canine distemper virus in tigers (Panthera tigris): possible transmission from wild animals to zoo animals.

Science.gov (United States)

Nagao, Yumiko; Nishio, Yohei; Shiomoda, Hiroshi; Tamaru, Seiji; Shimojima, Masayuki; Goto, Megumi; Une, Yumi; Sato, Azusa; Ikebe, Yusuke; Maeda, Ken

2012-06-01

Canine distemper virus (CDV), a morbillivirus that causes one of the most contagious and lethal viral diseases known in canids, has an expanding host range, including wild animals. Since December 2009, several dead or dying wild raccoon dogs (Nyctereutes procyonoides) were found in and around one safari-style zoo in Japan, and CDV was isolated from four of these animals. In the subsequent months (January to February 2010), 12 tigers (Panthera tigris) in the zoo developed respiratory and gastrointestinal diseases, and CDV RNA was detected in fecal samples of the examined tigers. In March 2010, one of the tigers developed a neurological disorder and died; CDV was isolated from the lung of this animal. Sequence analysis of the complete hemagglutinin (H) gene and the signal peptide region of the fusion (F) gene showed high homology among these isolates (99.8-100%), indicating that CDV might have been transmitted from raccoon dog to tiger. In addition, these isolates belonged to genotype Asia-1 and had lower homology (<90%) to the vaccine strain (Onderstepoort). Seropositivity of lions (Panthera leo) in the zoo and wild bears (Ursus thibetanus) captured around this area supported the theory that a CDV epidemic had occurred in many mammal species in and around the zoo. These results indicate a risk of CDV transmission among many animal species, including large felids and endangered species.

Development and Characterization of Canine Distemper Virus Monoclonal Antibodies.

Science.gov (United States)

Liu, Yuxiu; Hao, Liying; Li, Xiangdong; Wang, Linxiao; Zhang, Jianpo; Deng, Junhua; Tian, Kegong

2017-06-01

Five canine distemper virus monoclonal antibodies were developed by immunizing BALB/c mice with a traditional vaccine strain Snyder Hill. Among these monoclonal antibodies, four antibodies recognized both field and vaccine strains of canine distemper virus without neutralizing ability. One monoclonal antibody, 1A4, against hemagglutinin protein of canine distemper virus was found to react only with vaccine strain virus but not field isolates, and showed neutralizing activity to vaccine strain virus. These monoclonal antibodies could be very useful tools in the study of the pathogenesis of canine distemper virus and the development of diagnostic reagents.

Canine distemper virus antigen detection in external epithelia of recently vaccinated, sick dogs by fluorescence microscopy is a valuable prognostic indicator.

Science.gov (United States)

Kapil, Sanjay; Neel, Tina

2015-02-01

Currently, there are no reliable predictors of the clinical outcomes of domesticated dogs that have been recently vaccinated against canine distemper virus (CDV) and develop respiratory disease. In this study, vaccinated dogs from Oklahoma City that were showing clinical signs of respiratory disease were evaluated for CDV antigen using a direct fluorescent antibody test (FAT). Clinical outcomes after standard symptomatic therapy for respiratory disease were recorded, and a statistical analysis of the results was performed. We present our study showing that CDV FAT results were predictive of clinical recovery (prognostic indicator, prospects of clinical recovery) among vaccinated dogs showing clinical signs of respiratory disease. Negative CDV FAT results equated to 80% chances of recovery after symptomatic therapy, compared to 55% chances of recovery when the CDV FAT results were positive. Based on the results of this study, we show that veterinarians can make better informed decisions about the clinical outcomes of suspected CDV cases, with 2-h turnaround times, by using the CDV FAT. Thus, antemortem examination with the CDV FAT on external epithelia of recently vaccinated, sick dogs is a clinically useful diagnostic test and valuable prognostic indicator for veterinarians. Application of the CDV FAT to these samples avoids unnecessary euthanasia of dogs with suspected CDV. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Phylogenetic features of hemagglutin gene in canine distemper virus strains from different genetic lineages.

Science.gov (United States)

Liao, Peng; Guo, Li; Wen, Yongjun; Yang, Yangling; Cheng, Shipeng

2015-01-01

In the present study, the genotype of two Canine distemper virus (CDV) strains, namely, ZJJ-SD and ZJJ-LN, were investigated, based on the whole hemagglutinin (HA) gene. The CDV strains were obtained from two foxes in Shandong Province and Liaoning Province in 2011. Phylogenetic analyses were carried out for 260 CDV strains worldwide, and a statistical analysis was performed in the amino acid substitutions at positions 530 and 549 of the HA protein. Phylogenetic analyses revealed that the two strains, ZJJ-SD and ZJJ-LN, belonged to the CDV Asia I lineage. Site 530 of HA protein was found to be relatively conserved within CDV lineages in different host species by combining the genetic sequence data with the published data from 260 CDV strains worldwide. The data analysis showed a bias toward the predicted substitution Y549H for the non-dog strains in Asia I and Europe lineages. The ratio of site 549 genetic drift in the HA gene were significantly different between dogs and non-dogs in the two lineages. The strain ZJJ-SD, from wild canid, has an Y549H substitution. It is one of three Y549H substitution for wild canids in Asia I lineages. Site 530 of HA protein was not immediately relative to CDV genetic drift from dogs to non-dogs. Statistical analysis indicated that non-dog strains have a high probability to contain Y549H than dog strains in Asia I and Europe lineages. Thus, site 549 is considered important in genetic drift from dogs to non-dogs, at least in Asia I and Europe lineages.

Characterization of two recent Japanese field isolates of canine distemper virus and examination of the avirulent strain utility as an attenuated vaccine.

Science.gov (United States)

Takenaka, Akiko; Yoneda, Misako; Seki, Takahiro; Uema, Masashi; Kooriyama, Takanori; Nishi, Toshiya; Fujita, Kentaro; Miura, Ryuichi; Tsukiyama-Kohara, Kyoko; Sato, Hiroki; Kai, Chieko

2014-12-05

Recently, several new strains of canine distemper virus (CDV) have been isolated in Japan. To investigate their pathogenesis in dogs, the Yanaka and Bunkyo-K strains were investigated by infecting dogs and determining clinical signs, amount of virus, and antibody responses. The Yanaka strain is avirulent and induced an antibody response. The Bunkyo-K strain induced typical CDV clinical signs in infected dogs and virulence was enhanced by brain passage. Molecular and phylogenetic analyses of H genes demonstrated the Bunkyo-K strains were of a different lineage from Asia-1 group including the Yanaka strain and Asia-2 group that contain recent Japanese isolates, which were recently identified as major prevalent strains worldwide but distinct from old vaccine strains. Based on these data, we tested the ability of the Yanaka strain for vaccination. Inoculation with the Yanaka strain efficiently induced CDV neutralizing antibodies with no clinical signs, and the protection effects against challenge with either old virulent strain or Bunkyo-K strain were equal or greater when compared with vaccination by an original vaccine strain. Thus, the Yanaka strain is a potential vaccine candidate against recent prevalent CDV strains. Copyright © 2014 Elsevier B.V. All rights reserved.

Canine distemper virus as a threat to wild tigers in Russia and across their range.

Science.gov (United States)

Gilbert, Martin; Soutyrina, Svetlana V; Seryodkin, Ivan V; Sulikhan, Nadezhda; Uphyrkina, Olga V; Goncharuk, Mikhail; Matthews, Louise; Cleaveland, Sarah; Miquelle, Dale G

2015-07-01

Canine distemper virus (CDV) has recently been identified in populations of wild tigers in Russia and India. Tiger populations are generally too small to maintain CDV for long periods, but are at risk of infections arising from more abundant susceptible hosts that constitute a reservoir of infection. Because CDV is an additive mortality factor, it could represent a significant threat to small, isolated tiger populations. In Russia, CDV was associated with the deaths of tigers in 2004 and 2010, and was coincident with a localized decline of tigers in Sikhote-Alin Biosphere Zapovednik (from 25 tigers in 2008 to 9 in 2012). Habitat continuity with surrounding areas likely played an important role in promoting an ongoing recovery. We recommend steps be taken to assess the presence and the impact of CDV in all tiger range states, but should not detract focus away from the primary threats to tigers, which include habitat loss and fragmentation, poaching and retaliatory killing. Research priorities include: (i) recognition and diagnosis of clinical cases of CDV in tigers when they occur; and (ii) collection of baseline data on the health of wild tigers. CDV infection of individual tigers need not imply a conservation threat, and modeling should complement disease surveillance and targeted research to assess the potential impact to tiger populations across the range of ecosystems, population densities and climate extremes occupied by tigers. Describing the role of domestic and wild carnivores as contributors to a local CDV reservoir is an important precursor to considering control measures. © 2015 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and Wiley Publishing Asia Pty Ltd.

Tumour necrosis factor-alpha-induced protein 8 (TNFAIP8) expression associated with cell survival and death in cancer cell lines infected with canine distemper virus.

Science.gov (United States)

Garcia, J A; Ferreira, H L; Vieira, F V; Gameiro, R; Andrade, A L; Eugênio, F R; Flores, E F; Cardoso, T C

2017-06-01

Oncolytic virotherapy is a novel strategy for treatment of cancer in humans and companion animals as well. Canine distemper virus (CDV), a paramyxovirus, has proven to be oncolytic through induction of apoptosis in canine-derived tumour cells, yet the mechanism behind this inhibitory action is poorly understood. In this study, three human mammary tumour cell lines and one canine-derived adenofibrosarcoma cell line were tested regarding to their susceptibility to CDV infection, cell proliferation, apoptosis, mitochondrial membrane potential and expression of tumour necrosis factor-alpha-induced protein 8 (TNFAIP8). CDV replication-induced cytopathic effect, decrease of cell proliferation rates, and >45% of infected cells were considered death and/or under late apoptosis/necrosis. TNFAIP8 and CDVM gene expression were positively correlated in all cell lines. In addition, mitochondrial membrane depolarization was associated with increase in virus titres (p < 0.005). Thus, these results strongly suggest that both human and canine mammary tumour cells are potential candidates for studies concerning CDV-induced cancer therapy. © 2015 John Wiley & Sons Ltd.

Canine distemper virus matrix protein influences particle infectivity, particle composition, and envelope distribution in polarized epithelial cells and modulates virulence.

Science.gov (United States)

Dietzel, Erik; Anderson, Danielle E; Castan, Alexandre; von Messling, Veronika; Maisner, Andrea

2011-07-01

In paramyxoviruses, the matrix (M) protein mediates the interaction between the envelope and internal proteins during particle assembly and egress. In measles virus (MeV), M mutations, such as those found in subacute sclerosing panencephalitis (SSPE) strains, and differences in vaccine and wild-type M proteins can affect the strength of interaction with the envelope glycoproteins, assembly efficiency, and spread. However, the contribution of the M protein to the replication and pathogenesis of the closely related canine distemper virus (CDV) has not been characterized. To this end this, we generated a recombinant wild-type CDV carrying a vaccine strain M protein. The recombinant virus retained the parental growth phenotype in VerodogSLAMtag cells, but displayed an increased particle-to-infectivity ratio very similar to that of the vaccine strain, likely due to inefficient H protein incorporation. Even though infectious virus was released only from the apical surface, consistent with the release polarity of the wild-type CDV strain, envelope protein distribution in polarized epithelial cells reproduced the bipolar pattern seen in vaccine strain-infected cells. Most notably, the chimeric virus was completely attenuated in ferrets and caused only a mild and transient leukopenia, indicating that the differences in particle infectivity and envelope protein sorting mediated by the vaccine M protein contribute importantly to vaccine strain attenuation.

Exposure of pampas fox (Pseudalopex gymnocercus and crab-eating fox (Cerdocyon thous from the Southern region of Brazil to Canine distemper virus (CDV, Canine parvovirus (CPV and Canine coronavirus (CCoV

Directory of Open Access Journals (Sweden)

Silvia de Oliveira Hübner

2010-06-01

Full Text Available The exposure of 13 Brazilian free-ranging nondomestic canids (five pampas fox - Pseudalopex gymnocercus and eight crab-eating fox -Cerdocyon thous from Southern region of Brazil, to Canine distemper virus (CDV, canine parvovirus (CPV and Canine coronavirus (CCoV was investigated. Antibodies against CDV were detected in 38.5% (5/13 of the samples. There were anti-CDV antibodies in 60% (3/5 of P. gymnocercus and in 25% (2/8 of C. thous. The frequency was higher among the adults and males. Eleven canids (84.6% presented antibodies against CPV, 80% (4/5 were from P. gymnocercus and 87.5% (7/8 were from C. thous. There was no difference in positivity rate against CPV between gender and age. Antibodies against CCoV were detected in 38.5% (5/13 of the samples, with 60% (3/5 of positivity in P. gymnocercus and 25% (2/8 in C. thous. The frequency of antibodies against CCoV was higher among the adults and males. The study showed that these canids were exposed to CDV, CPV and CCoV.Foi investigada a ocorrência de exposição em 13 canídeos não domésticos de vida livre (cinco graxains-do-campo - Pseudalopex gymnocercus e oito graxains-do-mato - Cerdocyon thous da região sul do Brasil ao vírus da cinomose canina (CDV, parvovírus canino (CPV e coronavírus canino (CCoV. Anticorpos contra o CDV foram detectados em 38,5% (5/13 das amostras. Haviam anticorpos anti-CDV em 60% (3/5 dos P. gymnocercus e em 25% (2/8 dos C. thous. A freqüência foi maior entre machos e adultos. Para CPV, 11 canídeos (84,6% apresentaram anticorpos, 80% (4/5 eram da espécie P. gymnocercus e 87,5% (7/8 eram C. thous. Não houve diferença de positividade para o CPV entre sexos e idades. Anticorpos contra o CCoV foram detectados em 38,5% (5/13 das amostras, sendo 60% (3/5 de positividade entre os P. gymnocercus e 25% (2/8 entre os C. thous. A freqüência de anticorpos para CCoV foi maior entre os machos e adultos. O estudo revelou que estes canídeos foram expostos ao CDV, CPV

Comparative trial of the canine parvovirus, canine distemper virus and canine adenovirus type 2 fractions of two commercially available modified live vaccines.

Science.gov (United States)

Bergman, J G H E; Muniz, M; Sutton, D; Fensome, R; Ling, F; Paul, G

2006-11-25

The results of vaccinating two groups of puppies with commercial vaccines, both of which claimed to provide adequate protection with a final vaccination at 10 weeks of age, were compared. Groups of 19 and 20 puppies with similar titres of maternally derived antibodies against canine parvovirus (cpv), canine distemper virus (cdv) and canine adenovirus type 2 (cav-2) at four weeks of age were vaccinated at six and 10 weeks of age and their responses to each vaccination were measured by comparing the titres against cpv, cdv and cav-2 in the serum samples taken immediately before the vaccination and four weeks later. After the vaccination at six weeks of age, all 19 of the puppies in group 1 had responded to cpv and cdv, and 14 had responded to cav-2; in group 2, 17 of the 20 had responded to cpv, 19 to cdv and 15 to cav-2. In both groups the puppies that did not respond to the first vaccination had responded serologically to cpv, cdv and cav-2 at 10 weeks of age.

Recent host range expansion of canine distemper virus and variation in its receptor, the signaling lymphocyte activation molecule, in carnivores.

Science.gov (United States)

Ohishi, Kazue; Suzuki, Rintaro; Maeda, Taro; Tsuda, Miwako; Abe, Erika; Yoshida, Takao; Endo, Yasuyuki; Okamura, Maki; Nagamine, Takashi; Yamamoto, Hanae; Ueda, Miya; Maruyama, Tadashi

2014-07-01

The signaling lymphocyte activation molecule (SLAM) is a receptor for morbilliviruses. To understand the recent host range expansion of canine distemper virus (CDV) in carnivores, we determined the nucleotide sequences of SLAMs of various carnivores and generated three-dimensional homology SLAM models. Thirty-four amino acid residues were found for the candidates binding to CDV on the interface of the carnivore SLAMs. SLAM of the domestic dog (Canis lupus familiaris) were similar to those of other members of the suborder Caniformia, indicating that the animals in this group have similar sensitivity to dog CDV. However, they were different at nine positions from those of felids. Among the nine residues, four of domestic cat (Felis catus) SLAM (72, 76, 82, and 129) and three of lion (Panthera leo persica) SLAM (72, 82, and 129) were associated with charge alterations, suggesting that the felid interfaces have lower affinities to dog CDV. Only the residue at 76 was different between domestic cat and lion SLAM interfaces. The domestic cat SLAM had threonine at 76, whereas the lion SLAM had arginine, a positively charged residue like that of the dog SLAM. The cat SLAM with threonine is likely to have lower affinity to CDV-H and to confer higher resistance against dog CDV. Thus, the four residues (72, 76, 82, and 129) on carnivore SLAMs are important for the determination of affinity and sensitivity with CDV. Additionally, the CDV-H protein of felid strains had a substitution of histidine for tyrosine at 549 of dog CDV-H and may have higher affinity to lion SLAM. Three-dimensional model construction is a new risk assessment method of morbillivirus infectivity. Because the method is applicable to animals that have no information about virus infection, it is especially useful for morbillivirus risk assessment and wildlife conservation.

CANINE DISTEMPER IN A VACCINATED SNOW LEOPARD ( PANTHERA UNCIA).

Science.gov (United States)

Chinnadurai, Sathya K; Kinsel, Michael J; Adkesson, Michael J; Terio, Karen

2017-12-01

A 6-yr-old male snow leopard ( Panthera uncia) presented with acute seizures, hyperthermia, and tachypnea. Because of a diagnosis of anuric renal failure, the animal was euthanized. On histopathologic examination, numerous intralesional intracytoplasmic and intranuclear inclusions were found in the lungs, lymph nodes, and stomach. Positive immunohistochemical staining for canine distemper virus (CDV) was found in the lungs and, to a lesser extent, in the lymph nodes and brain. Molecular testing yielded a CDV H gene sequence that was closely related to CDV isolates concurrently found in wild raccoons from adjacent forested areas. The leopard had been vaccinated once against CDV with the use of a recombinant canarypox-vectored live vaccine during a routine wellness examination 12 wk prior to death. Serial serum neutralization titers performed on banked serum collected between vaccination and death showed poor serologic response to the vaccine. This case demonstrates a probable failure of protection against naturally occurring CDV.

RT-PCR and sequence analysis of the full-length fusion protein of Canine Distemper Virus from domestic dogs.

Science.gov (United States)

Romanutti, Carina; Gallo Calderón, Marina; Keller, Leticia; Mattion, Nora; La Torre, José

2016-02-01

During 2007-2014, 84 out of 236 (35.6%) samples from domestic dogs submitted to our laboratory for diagnostic purposes were positive for Canine Distemper Virus (CDV), as analyzed by RT-PCR amplification of a fragment of the nucleoprotein gene. Fifty-nine of them (70.2%) were from dogs that had been vaccinated against CDV. The full-length gene encoding the Fusion (F) protein of fifteen isolates was sequenced and compared with that of those of other CDVs, including wild-type and vaccine strains. Phylogenetic analysis using the F gene full-length sequences grouped all the Argentinean CDV strains in the SA2 clade. Sequence identity with the Onderstepoort vaccine strain was 89.0-90.6%, and the highest divergence was found in the 135 amino acids corresponding to the F protein signal-peptide, Fsp (64.4-66.7% identity). In contrast, this region was highly conserved among the local strains (94.1-100% identity). One extra putative N-glycosylation site was identified in the F gene of CDV Argentinean strains with respect to the vaccine strain. The present report is the first to analyze full-length F protein sequences of CDV strains circulating in Argentina, and contributes to the knowledge of molecular epidemiology of CDV, which may help in understanding future disease outbreaks. Copyright © 2015 Elsevier B.V. All rights reserved.

Antibodies to parvovirus, distemper virus and adenovirus conferred to household dogs using commercial combination vaccines containing Leptospira bacterin.

Science.gov (United States)

Taguchi, M; Namikawa, K; Maruo, T; Lynch, J; Sahara, H

2010-12-11

To examine how the inclusion (+) or exclusion (-) of inactivated Leptospira antigens in a vaccine for canine parvovirus type 2 (CPV-2), canine distemper virus (CDV) and canine adenovirus type 2 (CAdV-2) affects antibody titres to CPV-2, CDV and CAdV-1 antigens, household dogs were vaccinated with commercially available vaccines from one of three manufacturers. CPV-2, CDV and CAdV-1 antibody titres were measured 11 to 13 months later and compared within three different age groups and three different bodyweight groups. There were significant differences between CPV-2 antibody titres in dogs vaccinated with (+) vaccine and those vaccinated with (-) vaccine for two products in the two-year-old group and for one product in the greater than seven-year-old group; no significant differences were seen that could be attributed to bodyweight. No differences in CDV antibody titres were observed within age groups, but a significant difference was seen in the 11 to 20 kg weight group for one product. Significant differences in CAdV-1 antibody titres were seen for one product in both the two-year-old group and the ≤10 kg weight group.

Distemper Outbreak and Its Effect on African Wild Dog Conservation

Science.gov (United States)

van de Bildt, Marco W.G.; Kuiken, Thijs; Visee, Aart M.; Lema, Sangito; Fitzjohn, Tony R.

2002-01-01

In December 2000, an infectious disease spread through a captive breeding group of African wild dogs (Lycaon pictus) in Tanzania, killing 49 of 52 animals within 2 months. The causative agent was identified as Canine distemper virus (CDV) by means of histologic examination, virus isolation, reverse transcriptase-polymerase chain reaction analysis, and nucleotide sequencing. This report emphasizes the importance of adequate protection against infectious diseases for the successful outcome of captive breeding programs of endangered species. PMID:11897078

Whole genome sequence analysis of the arctic-lineage strain responsible for distemper in Italian wolves and dogs through a fast and robust next generation sequencing protocol.

Science.gov (United States)

Marcacci, Maurilia; Ancora, Massimo; Mangone, Iolanda; Teodori, Liana; Di Sabatino, Daria; De Massis, Fabrizio; Camma', Cesare; Savini, Giovanni; Lorusso, Alessio

2014-06-01

Dynamic surveillance and characterization of canine distemper virus (CDV) circulating strains are essential against possible vaccine breakthroughs events. This study describes the setup of a fast and robust next-generation sequencing (NGS) Ion PGM™ protocol that was used to obtain the complete genome sequence of a CDV isolate (CDV2784/2013). CDV2784/2013 is the prototype of CDV strains responsible for severe clinical distemper in dogs and wolves in Italy during 2013. CDV2784/2013 was isolated on cell culture and total RNA was used for NGS sample preparation. A total of 112.3 Mb of reads were assembled de novo using MIRA version 4.0rc4, which yielded a total number of 403 contigs with 12.1% coverage. The whole genome (15,690 bp) was recovered successfully and compared to those of existing CDV whole genomes. CDV2784/2013 was shown to have 92% nt identity with the Onderstepoort vaccine strain. This study describes for the first time a fast and robust Ion PGM™ platform-based whole genome amplification protocol for non-segmented negative stranded RNA viruses starting from total cell-purified RNA. Additionally, this is the first study reporting the whole genome analysis of an Arctic lineage strain that is known to circulate widely in Europe, Asia and USA. Copyright © 2014 Elsevier B.V. All rights reserved.

Dynamics of a morbillivirus at the domestic–wildlife interface: Canine distemper virus in domestic dogs and lions

Science.gov (United States)

Viana, Mafalda; Matthiopoulos, Jason; Halliday, Jo; Packer, Craig; Craft, Meggan E.; Hampson, Katie; Czupryna, Anna; Dobson, Andrew P.; Dubovi, Edward J.; Ernest, Eblate; Fyumagwa, Robert; Hoare, Richard; Hopcraft, J. Grant C.; Horton, Daniel L.; Kaare, Magai T.; Kanellos, Theo; Lankester, Felix; Mentzel, Christine; Mlengeya, Titus; Mzimbiri, Imam; Takahashi, Emi; Willett, Brian; Haydon, Daniel T.; Lembo, Tiziana

2015-01-01

Morbilliviruses cause many diseases of medical and veterinary importance, and although some (e.g., measles and rinderpest) have been controlled successfully, others, such as canine distemper virus (CDV), are a growing concern. A propensity for host-switching has resulted in CDV emergence in new species, including endangered wildlife, posing challenges for controlling disease in multispecies communities. CDV is typically associated with domestic dogs, but little is known about its maintenance and transmission in species-rich areas or about the potential role of domestic dog vaccination as a means of reducing disease threats to wildlife. We address these questions by analyzing a long-term serological dataset of CDV in lions and domestic dogs from Tanzania’s Serengeti ecosystem. Using a Bayesian state–space model, we show that dynamics of CDV have changed considerably over the past three decades. Initially, peaks of CDV infection in dogs preceded those in lions, suggesting that spill-over from dogs was the main driver of infection in wildlife. However, despite dog-to-lion transmission dominating cross-species transmission models, infection peaks in lions became more frequent and asynchronous from those in dogs, suggesting that other wildlife species may play a role in a potentially complex maintenance community. Widespread mass vaccination of domestic dogs reduced the probability of infection in dogs and the size of outbreaks but did not prevent transmission to or peaks of infection in lions. This study demonstrates the complexity of CDV dynamics in natural ecosystems and the value of long-term, large-scale datasets for investigating transmission patterns and evaluating disease control strategies. PMID:25605919

Dynamics of a morbillivirus at the domestic-wildlife interface: Canine distemper virus in domestic dogs and lions.

Science.gov (United States)

Viana, Mafalda; Cleaveland, Sarah; Matthiopoulos, Jason; Halliday, Jo; Packer, Craig; Craft, Meggan E; Hampson, Katie; Czupryna, Anna; Dobson, Andrew P; Dubovi, Edward J; Ernest, Eblate; Fyumagwa, Robert; Hoare, Richard; Hopcraft, J Grant C; Horton, Daniel L; Kaare, Magai T; Kanellos, Theo; Lankester, Felix; Mentzel, Christine; Mlengeya, Titus; Mzimbiri, Imam; Takahashi, Emi; Willett, Brian; Haydon, Daniel T; Lembo, Tiziana

2015-02-03

Morbilliviruses cause many diseases of medical and veterinary importance, and although some (e.g., measles and rinderpest) have been controlled successfully, others, such as canine distemper virus (CDV), are a growing concern. A propensity for host-switching has resulted in CDV emergence in new species, including endangered wildlife, posing challenges for controlling disease in multispecies communities. CDV is typically associated with domestic dogs, but little is known about its maintenance and transmission in species-rich areas or about the potential role of domestic dog vaccination as a means of reducing disease threats to wildlife. We address these questions by analyzing a long-term serological dataset of CDV in lions and domestic dogs from Tanzania's Serengeti ecosystem. Using a Bayesian state-space model, we show that dynamics of CDV have changed considerably over the past three decades. Initially, peaks of CDV infection in dogs preceded those in lions, suggesting that spill-over from dogs was the main driver of infection in wildlife. However, despite dog-to-lion transmission dominating cross-species transmission models, infection peaks in lions became more frequent and asynchronous from those in dogs, suggesting that other wildlife species may play a role in a potentially complex maintenance community. Widespread mass vaccination of domestic dogs reduced the probability of infection in dogs and the size of outbreaks but did not prevent transmission to or peaks of infection in lions. This study demonstrates the complexity of CDV dynamics in natural ecosystems and the value of long-term, large-scale datasets for investigating transmission patterns and evaluating disease control strategies.

Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

Science.gov (United States)

Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

2004-09-09

We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

Duration of serological response to canine parvovirus-type 2, canine distemper virus, canine adenovirus type 1 and canine parainfluenza virus in client-owned dogs in Australia.

Science.gov (United States)

Mitchell, S A; Zwijnenberg, R J; Huang, J; Hodge, A; Day, M J

2012-12-01

To determine whether client-owned dogs in Australia, last vaccinated with Canvac(®) vaccines containing canine parvovirus-type 2 (CPV-2), canine distemper virus (CDV), canine adenovirus type 2 (CAV-2) ± canine parainfluenza virus (CPiV) at least 18 months ago, were seropositive or responded serologically to revaccination. A total of 235 dogs were recruited from 23 veterinary clinics, representing a variety of breeds, ages and time since last vaccination (TSLV: range 1.5-9 years, mean 2.8 years). Dogs had a blood sample taken and were revaccinated on day 0. A second blood sample was taken 7-14 days later. Blood samples were assessed for antibody titres to CPV-2 (by haemagglutination inhibition) and CDV, CAV type 1 (CAV-1) and CPiV (by virus neutralisation). Dogs with a day 0 titre >10 or a four-fold increase in titre following revaccination were considered to be serological responders. The overall percentage of dogs classified as serological responders was 98.7% for CPV-2, 96.6% for CDV, 99.6% for CAV-1 and 90.3% for CPiV. These results suggest that the duration of serological response induced by modified-live vaccines against CPV-2, CDV, CAV-1 and CPiV, including Canvac(®) vaccines, is beyond 18 months and may extend up to 9 years. Accordingly, these vaccines may be considered for use in extended revaccination interval protocols as recommended by current canine vaccine guidelines. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.

Structural and Functional Studies on the Fusion and Attachment Envelope Glycoproteins of Nipah Virus and Hendra Virus

Science.gov (United States)

2003-01-01

including measles virus (MeV), mumps virus, Sendai virus (SeV), Newcastle disease virus (NDV), rinderpest virus, canine distemper virus (CDV), human...Institute of Health, Bethesda, MD. Hut 102, MT2, MT4, and CEM human T cell lines were provided by Chou-Zen Giam, USUHS, Bethesda, MD. The human osteosarcoma

Canine Distemper in an isolated population of fishers (Martes pennanti) from California

Science.gov (United States)

Stefan m. Keller; Mourad Gabriel; Karen A. Terio; Edward J. Dubovi; Elizabeth Van Wormer; Rick Sweitzer; Reginald Barret; Craig Thompson; Kathryn Purcell; Linda Munson

2012-01-01

Four fishers (Martes pennanti) from an insular population in the southern Sierra Nevada Mountains, California, USA died as a consequence of an infection with canine distemper virus (CDV) in 2009. Three fishers were found in close temporal and spatial relationship; the fourth fisher died 4 mo later at a 70 km distance from the initial group. Gross...

Canine distemper viral infection threatens the giant panda population in China

Science.gov (United States)

Jin, Yipeng; Zhang, Xinke; Ma, Yisheng; Qiao, Yanchao; Liu, Xiaobin; Zhao, Kaihui; Zhang, Chenglin; Lin, Degui; Fu, Xuelian; Xu, Xinrong; Wang, Yiwei; Wang, Huanan

2017-01-01

We evaluated exposure to canine distemper virus (CDV) in eight wild giant pandas (Ailuropoda melanoleuca) and 125 unvaccinated domestic dogs living in and around Foping National Nature Reserve (FNNR), China. Seventy-two percent of unvaccinated domestic dogs (mixed breed) had neutralizing antibodies for CDV due to exposure to the disease. The eight wild giant pandas were naïve to CDV and carried no positive antibody titer. RT-PCR assays for hemagglutinin (H) gene confirmed the presence of CDV in 31 clinically ill dogs from several areas near FNNR. Genomic sequence analysis showed that the 21 canine CDV were highly homologous to each other and belonged to the Asian-1 genotype. They showed high homology with the GP01 strain sequenced from a fatally infected giant panda, suggesting cross-species infection. Observational and GPS tracking data revealed home range overlap in pandas and dogs around FNNR. This study shows that CDV is endemic in domestic dogs near FNNR and that cross-species CDV infection threatens the wild giant panda population. PMID:29371956

Canine distemper viral infection threatens the giant panda population in China.

Science.gov (United States)

Jin, Yipeng; Zhang, Xinke; Ma, Yisheng; Qiao, Yanchao; Liu, Xiaobin; Zhao, Kaihui; Zhang, Chenglin; Lin, Degui; Fu, Xuelian; Xu, Xinrong; Wang, Yiwei; Wang, Huanan

2017-12-26

We evaluated exposure to canine distemper virus (CDV) in eight wild giant pandas ( Ailuropoda melanoleuca ) and 125 unvaccinated domestic dogs living in and around Foping National Nature Reserve (FNNR), China. Seventy-two percent of unvaccinated domestic dogs (mixed breed) had neutralizing antibodies for CDV due to exposure to the disease. The eight wild giant pandas were naïve to CDV and carried no positive antibody titer. RT-PCR assays for hemagglutinin ( H ) gene confirmed the presence of CDV in 31 clinically ill dogs from several areas near FNNR. Genomic sequence analysis showed that the 21 canine CDV were highly homologous to each other and belonged to the Asian-1 genotype. They showed high homology with the GP01 strain sequenced from a fatally infected giant panda, suggesting cross-species infection. Observational and GPS tracking data revealed home range overlap in pandas and dogs around FNNR. This study shows that CDV is endemic in domestic dogs near FNNR and that cross-species CDV infection threatens the wild giant panda population.

Transcriptional changes in canine distemper virus-induced demyelinating leukoencephalitis favor a biphasic mode of demyelination.

Directory of Open Access Journals (Sweden)

Reiner Ulrich

Full Text Available Canine distemper virus (CDV-induced demyelinating leukoencephalitis in dogs (Canis familiaris is suggested to represent a naturally occurring translational model for subacute sclerosing panencephalitis and multiple sclerosis in humans. The aim of this study was a hypothesis-free microarray analysis of the transcriptional changes within cerebellar specimens of five cases of acute, six cases of subacute demyelinating, and three cases of chronic demyelinating and inflammatory CDV leukoencephalitis as compared to twelve non-infected control dogs. Frozen cerebellar specimens were used for analysis of histopathological changes including demyelination, transcriptional changes employing microarrays, and presence of CDV nucleoprotein RNA and protein using microarrays, RT-qPCR and immunohistochemistry. Microarray analysis revealed 780 differentially expressed probe sets. The dominating change was an up-regulation of genes related to the innate and the humoral immune response, and less distinct the cytotoxic T-cell-mediated immune response in all subtypes of CDV leukoencephalitis as compared to controls. Multiple myelin genes including myelin basic protein and proteolipid protein displayed a selective down-regulation in subacute CDV leukoencephalitis, suggestive of an oligodendrocyte dystrophy. In contrast, a marked up-regulation of multiple immunoglobulin-like expressed sequence tags and the delta polypeptide of the CD3 antigen was observed in chronic CDV leukoencephalitis, in agreement with the hypothesis of an immune-mediated demyelination in the late inflammatory phase of the disease. Analysis of pathways intimately linked to demyelination as determined by morphometry employing correlation-based Gene Set Enrichment Analysis highlighted the pathomechanistic importance of up-regulated genes comprised by the gene ontology terms "viral replication" and "humoral immune response" as well as down-regulated genes functionally related to "metabolite and energy

Transcriptional changes in canine distemper virus-induced demyelinating leukoencephalitis favor a biphasic mode of demyelination.

Science.gov (United States)

Ulrich, Reiner; Puff, Christina; Wewetzer, Konstantin; Kalkuhl, Arno; Deschl, Ulrich; Baumgärtner, Wolfgang

2014-01-01

Canine distemper virus (CDV)-induced demyelinating leukoencephalitis in dogs (Canis familiaris) is suggested to represent a naturally occurring translational model for subacute sclerosing panencephalitis and multiple sclerosis in humans. The aim of this study was a hypothesis-free microarray analysis of the transcriptional changes within cerebellar specimens of five cases of acute, six cases of subacute demyelinating, and three cases of chronic demyelinating and inflammatory CDV leukoencephalitis as compared to twelve non-infected control dogs. Frozen cerebellar specimens were used for analysis of histopathological changes including demyelination, transcriptional changes employing microarrays, and presence of CDV nucleoprotein RNA and protein using microarrays, RT-qPCR and immunohistochemistry. Microarray analysis revealed 780 differentially expressed probe sets. The dominating change was an up-regulation of genes related to the innate and the humoral immune response, and less distinct the cytotoxic T-cell-mediated immune response in all subtypes of CDV leukoencephalitis as compared to controls. Multiple myelin genes including myelin basic protein and proteolipid protein displayed a selective down-regulation in subacute CDV leukoencephalitis, suggestive of an oligodendrocyte dystrophy. In contrast, a marked up-regulation of multiple immunoglobulin-like expressed sequence tags and the delta polypeptide of the CD3 antigen was observed in chronic CDV leukoencephalitis, in agreement with the hypothesis of an immune-mediated demyelination in the late inflammatory phase of the disease. Analysis of pathways intimately linked to demyelination as determined by morphometry employing correlation-based Gene Set Enrichment Analysis highlighted the pathomechanistic importance of up-regulated genes comprised by the gene ontology terms "viral replication" and "humoral immune response" as well as down-regulated genes functionally related to "metabolite and energy generation".

Transcriptional Changes in Canine Distemper Virus-Induced Demyelinating Leukoencephalitis Favor a Biphasic Mode of Demyelination

Science.gov (United States)

Ulrich, Reiner; Puff, Christina; Wewetzer, Konstantin; Kalkuhl, Arno; Deschl, Ulrich; Baumgärtner, Wolfgang

2014-01-01

Canine distemper virus (CDV)-induced demyelinating leukoencephalitis in dogs (Canis familiaris) is suggested to represent a naturally occurring translational model for subacute sclerosing panencephalitis and multiple sclerosis in humans. The aim of this study was a hypothesis-free microarray analysis of the transcriptional changes within cerebellar specimens of five cases of acute, six cases of subacute demyelinating, and three cases of chronic demyelinating and inflammatory CDV leukoencephalitis as compared to twelve non-infected control dogs. Frozen cerebellar specimens were used for analysis of histopathological changes including demyelination, transcriptional changes employing microarrays, and presence of CDV nucleoprotein RNA and protein using microarrays, RT-qPCR and immunohistochemistry. Microarray analysis revealed 780 differentially expressed probe sets. The dominating change was an up-regulation of genes related to the innate and the humoral immune response, and less distinct the cytotoxic T-cell-mediated immune response in all subtypes of CDV leukoencephalitis as compared to controls. Multiple myelin genes including myelin basic protein and proteolipid protein displayed a selective down-regulation in subacute CDV leukoencephalitis, suggestive of an oligodendrocyte dystrophy. In contrast, a marked up-regulation of multiple immunoglobulin-like expressed sequence tags and the delta polypeptide of the CD3 antigen was observed in chronic CDV leukoencephalitis, in agreement with the hypothesis of an immune-mediated demyelination in the late inflammatory phase of the disease. Analysis of pathways intimately linked to demyelination as determined by morphometry employing correlation-based Gene Set Enrichment Analysis highlighted the pathomechanistic importance of up-regulated genes comprised by the gene ontology terms “viral replication” and “humoral immune response” as well as down-regulated genes functionally related to “metabolite and energy

Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe

Directory of Open Access Journals (Sweden)

Anna McRee

2014-09-01

Full Text Available Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV and canine distemper virus (CDV, which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV. These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34% had detectable antibodies to CDV, whilst 191 (84% had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13% dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

Serological detection of infection with canine distemper virus, canine parvovirus and canine adenovirus in communal dogs from Zimbabwe.

Science.gov (United States)

McRee, Anna; Wilkes, Rebecca P; Dawson, Jessica; Parry, Roger; Foggin, Chris; Adams, Hayley; Odoi, Agricola; Kennedy, Melissa A

2014-09-05

Domestic dogs are common amongst communities in sub-Saharan Africa and may serve as important reservoirs for infectious agents that may cause diseases in wildlife. Two agents of concern are canine parvovirus (CPV) and canine distemper virus (CDV), which may infect and cause disease in large carnivore species such as African wild dogs and African lions, respectively. The impact of domestic dogs and their diseases on wildlife conservation is increasing in Zimbabwe, necessitating thorough assessment and implementation of control measures. In this study, domestic dogs in north-western Zimbabwe were evaluated for antibodies to CDV, CPV, and canine adenovirus (CAV). These dogs were communal and had no vaccination history. Two hundred and twenty-five blood samples were collected and tested using a commercial enzyme-linked immunosorbent assay (ELISA) for antibodies to CPV, CDV, and CAV. Of these dogs, 75 (34%) had detectable antibodies to CDV, whilst 191 (84%) had antibodies to CPV. Antibodies to canine adenovirus were present in 28 (13%) dogs. Canine parvovirus had high prevalence in all six geographic areas tested. These results indicate that CPV is circulating widely amongst domestic dogs in the region. In addition, CDV is present at high levels. Both pathogens can infect wildlife species. Efforts for conservation of large carnivores in Zimbabwe must address the role of domestic dogs in disease transmission.

Prevalence of serum antibody titers against canine distemper virus and canine parvovirus in dogs hospitalized in an intensive care unit.

Science.gov (United States)

Mahon, Jennifer L; Rozanski, Elizabeth A; Paul, April L

2017-06-15

OBJECTIVE To determine the prevalence of dogs hospitalized in an intensive care unit (ICU) with serum antibody titers against canine distemper virus (CDV) and canine parvovirus (CPV). DESIGN Prospective observational study. ANIMALS 80 dogs. PROCEDURES Dogs hospitalized in an ICU for > 12 hours between February 1 and June 1, 2015, that had at least 0.25 mL of serum left over from diagnostic testing were eligible for study inclusion. Dogs with serum antibody titers > 1:32 (as determined by serum neutralization) and > 1:80 (as determined by hemagglutination inhibition) were considered seropositive for CDV and CPV, respectively. The date of last vaccination was obtained from the medical record of each dog. RESULTS Of the 80 dogs, 40 (50%) and 65 (81%) dogs were seropositive for CDV and CPV, respectively. Of the 40 dogs that were seronegative for CDV, 27 had been vaccinated against CDV within 3 years prior to testing. Of the 15 dogs that were seronegative for CPV, 3 had been vaccinated against CPV within 3 years prior to testing. Ten dogs were seronegative for both CDV and CPV. CONCLUSIONS AND CLINICAL RELEVANCE Results indicated the prevalence of dogs hospitalized in an ICU that were seropositive for CDV and CPV was lower than expected given the high vaccination rate reported for dogs. Although the antibody titer necessary to prevent disease caused by CDV or CPV in critically ill dogs is unknown, adherence to infectious disease control guidelines is warranted when CDV- or CPV-infected dogs are treated in an ICU.

The fusion protein signal-peptide-coding region of canine distemper virus: a useful tool for phylogenetic reconstruction and lineage identification.

Directory of Open Access Journals (Sweden)

Nicolás Sarute

Full Text Available Canine distemper virus (CDV; Paramyxoviridae, Morbillivirus is the etiologic agent of a multisystemic infectious disease affecting all terrestrial carnivore families with high incidence and mortality in domestic dogs. Sequence analysis of the hemagglutinin (H gene has been widely employed to characterize field strains, permitting the identification of nine CDV lineages worldwide. Recently, it has been established that the sequences of the fusion protein signal-peptide (Fsp coding region are extremely variable, suggesting that analysis of its sequence might be useful for strain characterization studies. However, the divergence of Fsp sequences among worldwide strains and its phylogenetic resolution has not yet been evaluated. We constructed datasets containing the Fsp-coding region and H gene sequences of the same strains belonging to eight CDV lineages. Both datasets were used to evaluate their phylogenetic resolution. The phylogenetic analysis revealed that both datasets clustered the same strains into eight different branches, corresponding to CDV lineages. The inter-lineage amino acid divergence was fourfold greater for the Fsp peptide than for the H protein. The likelihood mapping revealed that both datasets display strong phylogenetic signals in the region of well-resolved topologies. These features indicate that Fsp-coding region sequence analysis is suitable for evolutionary studies as it allows for straightforward identification of CDV lineages.

The fusion protein signal-peptide-coding region of canine distemper virus: a useful tool for phylogenetic reconstruction and lineage identification.

Science.gov (United States)

Sarute, Nicolás; Calderón, Marina Gallo; Pérez, Ruben; La Torre, José; Hernández, Martín; Francia, Lourdes; Panzera, Yanina

2013-01-01

Canine distemper virus (CDV; Paramyxoviridae, Morbillivirus) is the etiologic agent of a multisystemic infectious disease affecting all terrestrial carnivore families with high incidence and mortality in domestic dogs. Sequence analysis of the hemagglutinin (H) gene has been widely employed to characterize field strains, permitting the identification of nine CDV lineages worldwide. Recently, it has been established that the sequences of the fusion protein signal-peptide (Fsp) coding region are extremely variable, suggesting that analysis of its sequence might be useful for strain characterization studies. However, the divergence of Fsp sequences among worldwide strains and its phylogenetic resolution has not yet been evaluated. We constructed datasets containing the Fsp-coding region and H gene sequences of the same strains belonging to eight CDV lineages. Both datasets were used to evaluate their phylogenetic resolution. The phylogenetic analysis revealed that both datasets clustered the same strains into eight different branches, corresponding to CDV lineages. The inter-lineage amino acid divergence was fourfold greater for the Fsp peptide than for the H protein. The likelihood mapping revealed that both datasets display strong phylogenetic signals in the region of well-resolved topologies. These features indicate that Fsp-coding region sequence analysis is suitable for evolutionary studies as it allows for straightforward identification of CDV lineages.

Real-time reverse transcription polymerase chain reaction method for detection of Canine distemper virus modified live vaccine shedding for differentiation from infection with wild-type strains.

Science.gov (United States)

Wilkes, Rebecca P; Sanchez, Elena; Riley, Matthew C; Kennedy, Melissa A

2014-01-01

Canine distemper virus (CDV) remains a common cause of infectious disease in dogs, particularly in high-density housing situations such as shelters. Vaccination of all dogs against CDV is recommended at the time of admission to animal shelters and many use a modified live virus (MLV) vaccine. From a diagnostic standpoint for dogs with suspected CDV infection, this is problematic because highly sensitive diagnostic real-time reverse transcription polymerase chain reaction (RT-PCR) tests are able to detect MLV virus in clinical samples. Real-time PCR can be used to quantitate amount of virus shedding and can differentiate vaccine strains from wild-type strains when shedding is high. However, differentiation by quantitation is not possible in vaccinated animals during acute infection, when shedding is low and could be mistaken for low level vaccine virus shedding. While there are gel-based RT-PCR assays for differentiation of vaccine strains from field strains based on sequence differences, the sensitivity of these assays is unable to match that of the real-time RT-PCR assay currently used in the authors' laboratory. Therefore, a real-time RT-PCR assay was developed that detects CDV MLV vaccine strains and distinguishes them from wild-type strains based on nucleotide sequence differences, rather than the amount of viral RNA in the sample. The test is highly sensitive, with detection of as few as 5 virus genomic copies (corresponding to 10(-1) TCID(50)). Sequencing of the DNA real-time products also allows phylogenetic differentiation of the wild-type strains. This test will aid diagnosis during outbreaks of CDV in recently vaccinated animals.

Pathologic and Molecular Virologic Characterization of a Canine Distemper Outbreak in Farmed Civets.

Science.gov (United States)

Techangamsuwan, S; Banlunara, W; Radtanakatikanon, A; Sommanustweechai, A; Siriaroonrat, B; Lombardini, E D; Rungsipipat, A

2015-07-01

In October 2011, a fatal disease outbreak occurred in 3 civet species farmed for their use in the coffee industry in Thailand. The disease quickly killed 20 animals in a mixed population of Asian palm civets (Paradoxurus hermaphroditus; n = 18), a masked palm civet (Paguma larvata; n = 1), and small Indian civet (Viverricula indica; n = 1). Clinical signs consisted of severe lethargy, weakness, vomiting, and diarrhea with associated dehydration, dyspnea, nasal and footpad hyperkeratosis, and seizures. All civets were positive for canine morbillivirus using the commercial canine distemper virus (CDV) antigen test kit. Consistently observed necropsy findings consisted of severe pneumonia and hemorrhagic enteritis. Microscopic examination revealed severe gastroenteritis, bronchointerstitial pneumonia, lymphadenitis, necrotizing dermatitis, nonsuppurative polioencephalitis, and characteristic intranuclear/intracytoplasmic eosinophilic viral inclusions in multiple tissues. Immunohistochemical analysis revealed immunoreactivity of varying intensity, while virus isolation demonstrated typical cytopathic effects. To confirm CDV infection, reverse transcription-polymerase chain reaction against fusion (F), phosphoprotein (P), and hemagglutinin (H) genes showed bands of expected size using conjunctival swabs (9 civets, 1 dog [Canis lupus familiaris] living on the farm). Phylogenetic analyses and restriction fragment length polymorphism results indicated that the civets were infected by the Asia-1 strain of CDV commonly found in dogs in Thailand. The deduced amino acid sequences of the signaling lymphocyte activation molecule binding region of the CDV-H proteins revealed a Y549H mutation in both CDV-infected Asian palm civets (n = 4) and a co-located dog. We report a canine distemper outbreak in a civet colony with lineage classification and a Y549H mutation in noncanid species in Thailand. © The Author(s) 2014.

Use of SLAM and PVRL4 and identification of pro-HB-EGF as cell entry receptors for wild type phocine distemper virus.

Directory of Open Access Journals (Sweden)

Mary M Melia

Full Text Available Signalling lymphocyte activation molecule (SLAM has been identified as an immune cell receptor for the morbilliviruses, measles (MV, canine distemper (CDV, rinderpest and peste des petits ruminants (PPRV viruses, while CD46 is a receptor for vaccine strains of MV. More recently poliovirus like receptor 4 (PVRL4, also known as nectin 4, has been identified as a receptor for MV, CDV and PPRV on the basolateral surface of polarised epithelial cells. PVRL4 is also up-regulated by MV in human brain endothelial cells. Utilisation of PVRL4 as a receptor by phocine distemper virus (PDV remains to be demonstrated as well as confirmation of use of SLAM. We have observed that unlike wild type (wt MV or wtCDV, wtPDV strains replicate in African green monkey kidney Vero cells without prior adaptation, suggesting the use of a further receptor. We therefore examined candidate molecules, glycosaminoglycans (GAG and the tetraspan proteins, integrin β and the membrane bound form of heparin binding epithelial growth factor (proHB-EGF,for receptor usage by wtPDV in Vero cells. We show that wtPDV replicates in Chinese hamster ovary (CHO cells expressing SLAM and PVRL4. Similar wtPDV titres are produced in Vero and VeroSLAM cells but more limited fusion occurs in the latter. Infection of Vero cells was not inhibited by anti-CD46 antibody. Removal/disruption of GAG decreased fusion but not the titre of virus. Treatment with anti-integrin β antibody increased rather than decreased infection of Vero cells by wtPDV. However, infection was inhibited by antibody to HB-EGF and the virus replicated in CHO-proHB-EGF cells, indicating use of this molecule as a receptor. Common use of SLAM and PVRL4 by morbilliviruses increases the possibility of cross-species infection. Lack of a requirement for wtPDV adaptation to Vero cells raises the possibility of usage of proHB-EGF as a receptor in vivo but requires further investigation.

Canine Distemper Virus Infects Canine Keratinocytes and Immune Cells by Using Overlapping and Distinct Regions Located on One Side of the Attachment Protein▿

Science.gov (United States)

Langedijk, Johannes P. M.; Janda, Jozef; Origgi, Francesco C.; Örvell, Claes; Vandevelde, Marc; Zurbriggen, Andreas; Plattet, Philippe

2011-01-01

The morbilliviruses measles virus (MeV) and canine distemper virus (CDV) both rely on two surface glycoproteins, the attachment (H) and fusion proteins, to promote fusion activity for viral cell entry. Growing evidence suggests that morbilliviruses infect multiple cell types by binding to distinct host cell surface receptors. Currently, the only known in vivo receptor used by morbilliviruses is CD150/SLAM, a molecule expressed in certain immune cells. Here we investigated the usage of multiple receptors by the highly virulent and demyelinating CDV strain A75/17. We based our study on the assumption that CDV-H may interact with receptors similar to those for MeV, and we conducted systematic alanine-scanning mutagenesis on CDV-H throughout one side of the β-propeller documented in MeV-H to contain multiple receptor-binding sites. Functional and biochemical assays performed with SLAM-expressing cells and primary canine epithelial keratinocytes identified 11 residues mutation of which selectively abrogated fusion in keratinocytes. Among these, four were identical to amino acids identified in MeV-H as residues contacting a putative receptor expressed in polarized epithelial cells. Strikingly, when mapped on a CDV-H structural model, all residues clustered in or around a recessed groove located on one side of CDV-H. In contrast, reported CDV-H mutants with SLAM-dependent fusion deficiencies were characterized by additional impairments to the promotion of fusion in keratinocytes. Furthermore, upon transfer of residues that selectively impaired fusion induction in keratinocytes into the CDV-H of the vaccine strain, fusion remained largely unaltered. Taken together, our results suggest that a restricted region on one side of CDV-H contains distinct and overlapping sites that control functional interaction with multiple receptors. PMID:21849439

Adjuvant effects of recombinant giant panda (Ailuropoda melanoleuca) IL-18 on the canine distemper disease vaccine in mice

OpenAIRE

YAN, Yue; NIU, Lili; DENG, Jiabo; WANG, Qiang; YU, Jianqiu; ZHANG, Yizheng; WANG, Jianxi; CHEN, Jiao; WEI, Changhe; TAN, Xuemei

2014-01-01

Canine distemper virus (CDV) is a morbillivirus known to cause morbidity and mortality in a broad range of animals. Giant pandas (Ailuropoda melanoleuca), especially captive ones, are susceptible to natural infection with CDV. Interleukin-18 (IL-18) is a powerful adjuvant molecule that can enhance the development of antigen-specific immunity and vaccine efficacy. In this study, a giant panda IL-18 gene eukaryotic expression plasmid (pcAmIL-18) was constructed. Female BALB/c mice were muscular...

Application of xenogeneic anti-canine distemper virus antibodies in treatment of canine distemper puppies.

Science.gov (United States)

Liu, P C; Chen, C A; Chen, C M; Yen, C H; Lee, M H; Chuang, C K; Tu, C F; Su, B L

2016-11-01

The clinical feasibility of passive immunotherapy has not been demonstrated in dogs naturally infected with canine distemper. In this study, porcine anti-canine distemper virus IgG and F(ab') 2 antibody fragments were used to treat infected puppies. A total of 41 naturally infected puppies (age Äsix months) exhibiting severe respiratory signs, but lacking neurological signs, were enrolled in the study. Twenty-five puppies were treated with a combination of IgG or F(ab') 2 antibody fragments (Group 1) and supportive therapy and 16 puppies received routine supportive care only (Group 2). The survival rate of dogs in Group 1 (19/25; 76%) was significantly higher than that in Group 2 (5/16; 31·3%) (Pdistemper virus antibodies improved survival in puppies affected with canine distemper with minimal adverse effects. Therefore, this therapy could be considered for treatment of endangered animal species infected with canine distemper virus. © 2016 British Small Animal Veterinary Association.

Serological and demographic evidence for domestic dogs as a source of canine distemper virus infection for Serengeti wildlife.

Science.gov (United States)

Cleaveland, S; Appel, M G; Chalmers, W S; Chillingworth, C; Kaare, M; Dye, C

2000-03-15

Following an epidemic of canine distemper virus (CDV) in Serengeti lions in 1994, the role of domestic dogs in the epidemiology of the disease was investigated by serological and demographic analyses. From 1992 to 1994, data were collected from two domestic dog populations bordering the Serengeti National Park. Several lines of evidence indicated that patterns of CDV infection differed significantly between higher-density dog populations of Serengeti District to the west of the park and lower-density populations of Ngorongoro District to the south-east: (a) CDV age-seroprevalence patterns differed significantly between years in Ngorongoro District populations but not in Serengeti District populations; (b) CDV seropositive pups (Ngorongoro District only in 1994, whereas a proportion of pups in Serengeti District were seropositive in each year of the study; (c) in Ngorongoro District, the proportion of deaths attributed to disease was significantly higher in 1994 than in 1993, whereas in Serengeti District, there was no significant difference in disease-related mortality between years; (d) in Ngorongoro District, significantly more CDV seronegative dogs than seropositive dogs died in 1994, whereas there was no difference in survival of CDV seropositives and seronegatives between years in Serengeti District. We concluded that, between 1992 and 1994, CDV persisted in higher-density dog populations of Serengeti District, but occurred only sporadically in lower-density Ngorongoro District populations. Data from Ngorongoro District are consistent with exposure of dogs to CDV in 1991 and 1994, but not in 1992 and 1993. These findings suggest that higher-density domestic dog populations to the west of the Serengeti National Park were a more likely source of CDV infection for wildlife during 1994 than lower-density pastoralist dogs to the south and east of the park.

Avaliação da urina e de leucócitos como amostras biológicas para a detecção ante mortem do vírus da cinomose canina por RT-PCR em cães naturalmente infectados Evaluation of the urine and leucocytes as biological samples for ante mortem detection of canine distemper virus by RT-PCR assay in naturally infected dogs

Directory of Open Access Journals (Sweden)

F.J. Negrão

2007-02-01

Full Text Available Urine and leucocytes were comparatively evaluated as clinical samples for ante mortem detection of the canine distemper virus (CDV by a reverse transcription-polymerase chain reaction (RT-PCR assay. One hundred and eighty eight dogs with clinical symptoms of distemper, were distributed in three groups. The group A was constituted of 93 dogs with systemic signs of distemper; the group B by 11 dogs with neurological signs, and the group C by 84 dogs that presented simultaneously systemic and neurological signs. In 66.5% (125/188 of the dogs was amplified an amplicon with 287 base pair of the CDV nucleoprotein gene. In 60.8% (76/125 of the animals the CDV was detected simultaneously in the urine and leucocytes, and in 39.2% (49/125 of the dogs just a type of clinical sample (urine: n=37; leucocytes: n=12 was positive. These results demonstrate that the different forms of clinical distemper disease can hinder the choice of only one type of clinical sample to carry out the ante mortem etiological diagnosis of CDV infection, and false-negative results can be generated.

Accuracy of a point-of-care ELISA test kit for predicting the presence of protective canine parvovirus and canine distemper virus antibody concentrations in dogs.

Science.gov (United States)

Litster, A L; Pressler, B; Volpe, A; Dubovi, E

2012-08-01

Canine parvovirus (CPV) and canine distemper virus (CDV) are highly infectious and often fatal diseases with worldwide distributions, and are important population management considerations in animal shelters. A point-of-care ELISA test kit is available to detect serum antibodies to CPV and CDV, and presumptively to predict protective status. The aim of this study was to determine the diagnostic accuracy of the test compared to CPV hemagglutination inhibition titers and CDV serum neutralization titers determined by a reference laboratory, using sera collected from dogs housed at animal shelters. The ELISA test was used under both field and laboratory conditions and duplicate specimens were processed using an extra wash step. The test kit yielded accurate results (CPV: sensitivity 92.3%, specificity 93.5%; CDV: sensitivity 75.7%, specificity 91.8%) under field conditions. CDV sensitivity was improved by performing the test under laboratory conditions and using an optical density (OD) meter (laboratory performed 94.0%; OD 88.1%). Point-of-care ELISA testing for serum CPV and CDV antibody titers was demonstrated to be a useful tool for determining antibody status when making decisions regarding the need for CPV and/or CDV vaccination and also in animal shelters for population management. Copyright © 2012 Elsevier Ltd. All rights reserved.

Quantitative Analysis of Cellular Proteome Alterations in CDV-Infected Mink Lung Epithelial Cells

Directory of Open Access Journals (Sweden)

Mingwei Tong

2017-12-01

Full Text Available Canine distemper virus (CDV, a paramyxovirus, causes a severe highly contagious lethal disease in carnivores, such as mink. Mink lung epithelial cells (Mv.1.Lu cells are sensitive to CDV infection and are homologous to the natural host system of mink. The current study analyzed the response of Mv.1.Lu cells to CDV infection by iTRAQ combined with LC–MS/MS. In total, 151 and 369 differentially expressed proteins (DEPs were markedly up-regulated or down-regulated, respectively. Thirteen DEPs were validated via real-time RT-PCR or western blot analysis. Network and KEGG pathway analyses revealed several regulated proteins associated with the NF-κB signaling pathway. Further validation was performed by western blot analysis and immunofluorescence assay, which demonstrated that different CDV strains induced NF-κB P65 phosphorylation and nuclear translocation. Moreover, the results provided interesting information that some identified DEPs possibly associated with the pathogenesis and the immune response upon CDV infection. This study is the first overview of the responses to CDV infection in Mv.1.Lu cells, and the findings will help to analyze further aspects of the molecular mechanisms involved in viral pathogenesis and the immune responses upon CDV infection.

Canine distemper virus isolated from a monkey efficiently replicates on Vero cells expressing non-human primate SLAM receptors but not human SLAM receptor.

Science.gov (United States)

Feng, Na; Liu, Yuxiu; Wang, Jianzhong; Xu, Weiwei; Li, Tiansong; Wang, Tiecheng; Wang, Lei; Yu, Yicong; Wang, Hualei; Zhao, Yongkun; Yang, Songtao; Gao, Yuwei; Hu, Guixue; Xia, Xianzhu

2016-08-02

In 2008, an outbreak of canine distemper virus (CDV) infection in monkeys was reported in China. We isolated CDV strain (subsequently named Monkey-BJ01-DV) from lung tissue obtained from a rhesus monkey that died in this outbreak. We evaluated the ability of this virus on Vero cells expressing SLAM receptors from dog, monkey and human origin, and analyzed the H gene of Monkey-BJ01-DV with other strains. The Monkey-BJ01-DV isolate replicated to the highest titer on Vero cells expressing dog-origin SLAM (10(5.2±0.2) TCID50/ml) and monkey-origin SLAM (10(5.4±0.1) TCID50/ml), but achieved markedly lower titers on human-origin SLAM cells (10(3.3±0.3) TCID50/ml). Phylogenetic analysis of the full-length H gene showed that Monkey-BJ01-DV was highly related to other CDV strains obtained during recent CDV epidemics among species of the Canidae family in China, and these Monkey strains CDV (Monkey-BJ01-DV, CYN07-dV, Monkey-KM-01) possessed a number of amino acid specific substitutions (E276V, Q392R, D435Y and I542F) compared to the H protein of CDV epidemic in other animals at the same period. Our results suggested that the monkey origin-CDV-H protein could possess specific substitutions to adapt to the new host. Monkey-BJ01-DV can efficiently use monkey- and dog-origin SLAM to infect and replicate in host cells, but further adaptation may be required for efficient replication in host cells expressing the human SLAM receptor.

Canine distemper outbreak in raccoons suggests pathogen interspecies transmission amongst alien and native carnivores in urban areas from Germany.

Science.gov (United States)

Rentería-Solís, Zaida; Förster, Christine; Aue, Angelika; Wittstatt, Ulrich; Wibbelt, Gudrun; König, Matthias

2014-11-07

From December 2012 to May 2013, an outbreak occurred among urban wild carnivores from Berlin. We collected 97 free-ranging raccoons from the city area. PCR assays, histopathology and immunohistochemistry confirmed canine distemper virus (CDV) infection in 74 raccoons. Phylogenetic analysis of haemagglutinin gene fragments (1767 nucleotides) of CDV isolated from four raccoons showed close relation to CDV isolates from foxes from Germany and a domestic dog from Hungary; all belonging to the "Europe" lineage of CDV. These study results suggest an inter-species transmission of CDV as the origin for the outbreak among the raccoon population. Implications for domestic pets and suggested interspecies transmission between urban wildlife and raccoons are discussed. This is the first major outbreak of CDV amongst free-ranging raccoons in Europe. Copyright © 2014 Elsevier B.V. All rights reserved.

THE APLICATION OF REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION FOR THE DIAGNOSIS OF CANINE DISTEMPER

Directory of Open Access Journals (Sweden)

I Nyoman Suartha

2008-03-01

Full Text Available A study was conducted to apply reverse transcriptase-polymerase chain reaction (RT-PCR technique for the confirmative diagnosis of canine distemper in dogs. Twenty mongreal dogs with clinical symptoms of canine distemper were used in this study. The viral RNA was isolated from nasal swab using Trizol® and transcribed into cDNA using random primers 5’ACAGGATTGCTGAGGACCTAT 3’. The cDNA was amplified in one step RT-PCR using primers 5’-ACAGGATTGCTGAGGACCTAT-3’ (forward and 5’- CAAGATAACCATGTACGGTGC-3’ (backward. A single band of 300 bp which was specific for canine distemper virus CDV was detected in fifteen out of twenty samples. It is therefore evident that confirmative diagnostics of canine distemper disease can be established with RT-PCR technique.

Canine Distemper Virus Fusion Activation: Critical Role of Residue E123 of CD150/SLAM.

Science.gov (United States)

Khosravi, Mojtaba; Bringolf, Fanny; Röthlisberger, Silvan; Bieringer, Maria; Schneider-Schaulies, Jürgen; Zurbriggen, Andreas; Origgi, Francesco; Plattet, Philippe

2016-02-01

Measles virus (MeV) and canine distemper virus (CDV) possess tetrameric attachment proteins (H) and trimeric fusion proteins, which cooperate with either SLAM or nectin 4 receptors to trigger membrane fusion for cell entry. While the MeV H-SLAM cocrystal structure revealed the binding interface, two distinct oligomeric H assemblies were also determined. In one of the conformations, two SLAM units were sandwiched between two discrete H head domains, thus spotlighting two binding interfaces ("front" and "back"). Here, we investigated the functional relevance of both interfaces in activating the CDV membrane fusion machinery. While alanine-scanning mutagenesis identified five critical regulatory residues in the front H-binding site of SLAM, the replacement of a conserved glutamate residue (E at position 123, replaced with A [E123A]) led to the most pronounced impact on fusion promotion. Intriguingly, while determination of the interaction of H with the receptor using soluble constructs revealed reduced binding for the identified SLAM mutants, no effect was recorded when physical interaction was investigated with the full-length counterparts of both molecules. Conversely, although mutagenesis of three strategically selected residues within the back H-binding site of SLAM did not substantially affect fusion triggering, nevertheless, the mutants weakened the H-SLAM interaction recorded with the membrane-anchored protein constructs. Collectively, our findings support a mode of binding between the attachment protein and the V domain of SLAM that is common to all morbilliviruses and suggest a major role of the SLAM residue E123, located at the front H-binding site, in triggering the fusion machinery. However, our data additionally support the hypothesis that other microdomain(s) of both glycoproteins (including the back H-binding site) might be required to achieve fully productive H-SLAM interactions. A complete understanding of the measles virus and canine distemper virus

Rabies and canine distemper virus epidemics in the red fox population of northern Italy (2006-2010).

Science.gov (United States)

Nouvellet, Pierre; Donnelly, Christl A; De Nardi, Marco; Rhodes, Chris J; De Benedictis, Paola; Citterio, Carlo; Obber, Federica; Lorenzetto, Monica; Pozza, Manuela Dalla; Cauchemez, Simon; Cattoli, Giovanni

2013-01-01

Since 2006 the red fox (Vulpes vulpes) population in north-eastern Italy has experienced an epidemic of canine distemper virus (CDV). Additionally, in 2008, after a thirteen-year absence from Italy, fox rabies was re-introduced in the Udine province at the national border with Slovenia. Disease intervention strategies are being developed and implemented to control rabies in this area and minimise risk to human health. Here we present empirical data and the epidemiological picture relating to these epidemics in the period 2006-2010. Of important significance for epidemiological studies of wild animals, basic mathematical models are developed to exploit information collected from the surveillance program on dead and/or living animals in order to assess the incidence of infection. These models are also used to estimate the rate of transmission of both diseases and the rate of vaccination, while correcting for a bias in early collection of CDV samples. We found that the rate of rabies transmission was roughly twice that of CDV, with an estimated effective contact between infected and susceptible fox leading to a new infection occurring once every 3 days for rabies, and once a week for CDV. We also inferred that during the early stage of the CDV epidemic, a bias in the monitoring protocol resulted in a positive sample being almost 10 times more likely to be collected than a negative sample. We estimated the rate of intake of oral vaccine at 0.006 per day, allowing us to estimate that roughly 68% of the foxes would be immunised. This was confirmed by field observations. Finally we discuss the implications for the eco-epidemiological dynamics of both epidemics in relation to control measures.

Controversial results of therapy with mesenchymal stem cells in the acute phase of canine distemper disease.

Science.gov (United States)

Pinheiro, A O; Cardoso, M T; Vidane, A S; Casals, J B; Passarelli, D; Alencar, A L F; Sousa, R L M; Fantinato-Neto, P; Oliveira, V C; Lara, V M; Ambrósio, C E

2016-05-23

Distemper disease is an infectious disease reported in several species of domestic and wild carnivores. The high mortality rate of animals infected with canine distemper virus (CDV) treated with currently available therapies has driven the study of new efficacious treatments. Mesenchymal stem cell (MSC)-based therapy is a promising therapeutic option for many degenerative, hereditary, and inflammatory diseases. Therefore, the aim of this study was to characterize stem cells derived from the canine fetal olfactory epithelium and to assess the systemic response of animals infected with CDV to symptomatic therapy and treatment with MSCs. Eight domestic mongrel dogs (N = 8) were divided into two groups: support group (SG) (N = 5) and support group + cell therapy (SGCT) (N = 3), which were monitored over 15 days. Blood samples were collected on days 0, 6, 9, 12, and 15 to assess blood count and serum biochemistry (urea, creatinine, alanine transferase, alkaline phosphatase, gamma-glutamyl transferase, total protein, albumin, and globulin), and urine samples were obtained on days 0 and 15 for urinary evaluation (urine I). The results showed a high mortality rate (SG = 4 and SGCT = 2), providing inadequate data on the clinical course of CDV infection. MSC therapy resulted in no significant improvement when administered during the acute phase of canine distemper disease, and a prevalence of animals with high mortality rate was found in both groups due to the severity of symptoms.

A chimeric measles virus with canine distemper envelope protects ferrets from lethal distemper challenge.

Science.gov (United States)

Rouxel, Ronan Nicolas; Svitek, Nicholas; von Messling, Veronika

2009-08-06

CDV infects a broad range of carnivores, and over the past decades it has caused outbreaks in a variety of wild carnivore populations. Since the currently available live-attenuated vaccine is not sufficiently safe in these highly susceptible species, we produced a chimeric virus combining the replication complex of the measles Moraten vaccine strain with the envelope of a recent CDV wild type isolate. The resulting virus did not cause disease or immunosuppression in ferrets and conferred protection from challenge with a lethal wild type strain, demonstrating its potential value for wildlife conservation efforts.

Exposure of Free-Ranging Wild Carnivores and Domestic Dogs to Canine Distemper Virus and Parvovirus in the Cerrado of Central Brazil.

Science.gov (United States)

Furtado, Mariana Malzoni; Hayashi, Erika Midori Kida; Allendorf, Susan Dora; Coelho, Claudio José; de Almeida Jácomo, Anah Tereza; Megid, Jane; Ramos Filho, José Domingues; Silveira, Leandro; Tôrres, Natália Mundim; Ferreira Neto, José Soares

2016-09-01

Human population growth around protected areas increases the contact between wild and domestic animals, promoting disease transmission between them. This study investigates the exposure of free-ranging wild carnivores and domestic dogs to canine distemper virus (CDV) and parvovirus in Emas National Park (ENP) in the Cerrado savanna of central Brazil. Serum samples were collected from 169 wild carnivores, including the maned wolf (Chrysocyon brachyurus), crab-eating fox (Cerdocyon thous), hoary fox (Pseudalopex vetulus), puma (Puma concolor), ocelot (Leopardus pardalis), pampas cat (Leopardus colocolo), jaguarundi (Herpailurus yagouaroundi), striped hog-nosed skunk (Conepatus semistriatus) and coati (Nasua nasua), and from 35 domestic dogs living on rural properties bordering ENP. Serological tests showed that 10.6% of wild carnivores (maned wolves, crab-eating foxes and ocelots) and 71.4% of domestic dogs were exposed to CDV, and 56.8% of wild carnivores, including all species sampled except coatis, and 57.1% of domestic dogs were exposed to parvovirus. This report is the first to indicate that the free-ranging pampas cat, jaguarundi and striped hog-nosed skunk are exposed to parvovirus. CDV and parvovirus deserve attention in ENP, and it is extremely important to monitor the health of carnivore populations and perform molecular diagnosis of the viruses to determine the possible involvement of the domestic dog in their transmission.

Epidemiological features and the neuropathological manifestations of canine distemper virus-induced infections in Brazil: a reviewAspectos epidemiológicos e as manifestações neuropatológicas associadas à infecção pelo vírus da cinomose canina no Brasil: uma revisão

Directory of Open Access Journals (Sweden)

Selwyn Arligton Headley

2012-10-01

Full Text Available This article provides a critical review of current epidemiological trends of canine distemper virus (CDV and syndromes related to canine distemper encephalitis (CDE with specific reference to the situation in Brazil. Epidemiological data relative to susceptible animal populations, prevalence, seasonal occurrence, and age-related patterns associated with CDV are discussed. The participation of mongrel dogs in maintaining CDV within rural and semi-urban canine populations and their importance in the epidemiology of canine distemper is highlighted. The economic impact of treating the clinical manifestations associated with CDV-induced infections in Brazil is estimated. Additionally, neurological and neuropathological manifestations of CDV in Brazil are discussed, and a novel manifestation of CDE is proposed. Esse manuscrito fornece uma revisão crítica das tendências epidemiológicas associadas ao vírus da cinomose canina (CDV e às síndromes relacionadas à encefalite por cinomose com referência específica à situação no Brasil. Os dados epidemiológicos relativos às populações de animais suscetíveis, prevalência, sazonalidade e os padrões relacionados à idade foram discutidos. Também é enfocada nessa revisão a participação de cães de rua na manutenção do CDV nas populações caninas nas áreas rurais e nas regiões semiurbanas e a sua importância na epidemiologia da cinomose. Foi ainda estimado o impacto econômico relacionado ao tratamento das manifestações clínicas associadas à cinomose no Brasil. Adicionalmente, as manifestações neurológicas e neuropatológicas da cinomose no Brasil são discutidas e uma manifestação neuropatológica inédita da infecção é sugerida.

Phocine distemper virus (PDV) seroprevalence as predictor for future outbreaks in harbour seals.

Science.gov (United States)

Ludes-Wehrmeister, Eva; Dupke, Claudia; Harder, Timm C; Baumgärtner, Wolfgang; Haas, Ludwig; Teilmann, Jonas; Dietz, Rune; Jensen, Lasse F; Siebert, Ursula

2016-02-01

Phocine distemper virus (PDV) infections caused the two most pronounced mass mortalities in marine mammals documented in the past century. During the two outbreaks, 23,000 and 30,000 harbour seals (Phoca vitulina), died in 1988/1989 and 2002 across populations in the Wadden Sea and adjacent waters, respectively. To follow the mechanism and development of disease spreading, the dynamics of Morbillivirus-specific antibodies in harbour seal populations in German and Danish waters were examined. 522 serum samples of free-ranging harbour seals of different ages were sampled between 1990 and 2014. By standard neutralisation assays, Morbillivirus-specific antibodies were detected, using either the PDV isolate 2558/Han 88 or the related canine distemper virus (CDV) strain Onderstepoort. A total of 159 (30.5%) of the harbour seals were seropositive. Annual seroprevalence rates showed an undulating course: Peaks were seen in the post-epidemic years 1990/1991 and 2002/2003. Following each PDV outbreak, seroprevalence decreased and six to eight years after the epidemics samples were tested seronegative, indicating that the populations are now again susceptible to new PDV outbreak. After the last outbreak in 2002, the populations grew steadily to an estimated maximum (since 1975) of about 39,100 individuals in the Wadden Sea in 2014 and about 23,540 harbour seals in the Kattegat area in 2013. A re-appearence of PDV would presumably result in another epizootic with high mortality rates as encountered in the previous outbreaks. The current high population density renders harbour seals vulnerable to rapid spread of infectious agents including PDV and the recently detected influenza A virus. Copyright © 2015 Elsevier B.V. All rights reserved.

Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR for diagnosis of natural infection with canine distemper virus

Directory of Open Access Journals (Sweden)

Wong Min-Liang

2010-06-01

Full Text Available Abstract Background Canine distemper virus (CDV is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR of the matrix (M gene to the fusion (F gene (designated M-F UTR in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Results Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. Conclusions The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes.

Multiplex Amplification Refractory Mutation System Polymerase Chain Reaction (ARMS-PCR) for diagnosis of natural infection with canine distemper virus.

Science.gov (United States)

Chulakasian, Songkhla; Lee, Min-Shiuh; Wang, Chi-Young; Chiou, Shyan-Song; Lin, Kuan-Hsun; Lin, Fong-Yuan; Hsu, Tien-Huan; Wong, Min-Liang; Chang, Tien-Jye; Hsu, Wei-Li

2010-06-10

Canine distemper virus (CDV) is present worldwide and produces a lethal systemic infection of wild and domestic Canidae. Pre-existing antibodies acquired from vaccination or previous CDV infection might interfere the interpretation of a serologic diagnosis method. In addition, due to the high similarity of nucleic acid sequences between wild-type CDV and the new vaccine strain, current PCR derived methods cannot be applied for the definite confirmation of CD infection. Hence, it is worthy of developing a simple and rapid nucleotide-based assay for differentiation of wild-type CDV which is a cause of disease from attenuated CDVs after vaccination. High frequency variations have been found in the region spanning from the 3'-untranslated region (UTR) of the matrix (M) gene to the fusion (F) gene (designated M-F UTR) in a few CDV strains. To establish a differential diagnosis assay, an amplification refractory mutation analysis was established based on the highly variable region on M-F UTR and F regions. Sequences of frequent polymorphisms were found scattered throughout the M-F UTR region; the identity of nucleic acid between local strains and vaccine strains ranged from 82.5% to 93.8%. A track of AAA residue located 35 nucleotides downstream from F gene start codon highly conserved in three vaccine strains were replaced with TGC in the local strains; that severed as target sequences for deign of discrimination primers. The method established in the present study successfully differentiated seven Taiwanese CDV field isolates, all belonging to the Asia-1 lineage, from vaccine strains. The method described herein would be useful for several clinical applications, such as confirmation of nature CDV infection, evaluation of vaccination status and verification of the circulating viral genotypes.

Rabies and canine distemper virus epidemics in the red fox population of northern Italy (2006-2010.

Directory of Open Access Journals (Sweden)

Pierre Nouvellet

Full Text Available Since 2006 the red fox (Vulpes vulpes population in north-eastern Italy has experienced an epidemic of canine distemper virus (CDV. Additionally, in 2008, after a thirteen-year absence from Italy, fox rabies was re-introduced in the Udine province at the national border with Slovenia. Disease intervention strategies are being developed and implemented to control rabies in this area and minimise risk to human health. Here we present empirical data and the epidemiological picture relating to these epidemics in the period 2006-2010. Of important significance for epidemiological studies of wild animals, basic mathematical models are developed to exploit information collected from the surveillance program on dead and/or living animals in order to assess the incidence of infection. These models are also used to estimate the rate of transmission of both diseases and the rate of vaccination, while correcting for a bias in early collection of CDV samples. We found that the rate of rabies transmission was roughly twice that of CDV, with an estimated effective contact between infected and susceptible fox leading to a new infection occurring once every 3 days for rabies, and once a week for CDV. We also inferred that during the early stage of the CDV epidemic, a bias in the monitoring protocol resulted in a positive sample being almost 10 times more likely to be collected than a negative sample. We estimated the rate of intake of oral vaccine at 0.006 per day, allowing us to estimate that roughly 68% of the foxes would be immunised. This was confirmed by field observations. Finally we discuss the implications for the eco-epidemiological dynamics of both epidemics in relation to control measures.

Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from breeding foxes, raccoon dogs and minks in China.

Science.gov (United States)

Zhao, Jian-Jun; Yan, Xi-Jun; Chai, Xiu-Li; Martella, Vito; Luo, Guo-Liang; Zhang, Hai-Ling; Gao, Han; Liu, Ying-Xue; Bai, Xue; Zhang, Lei; Chen, Tao; Xu, Lei; Zhao, Chun-Fei; Wang, Feng-Xue; Shao, Xi-Qun; Wu, Wei; Cheng, Shi-Peng

2010-01-06

Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. Genetic/antigenic heterogeneity has been observed among the various CDV strains, notably in the haemagglutinin (H) gene, that appears as a good target to gather epidemiological information. Based on sequence analysis of the H gene, wild-type CDV strains cluster into distinct geographic lineages (genotypes), irrespective of the species of isolation. The sequence of the H gene of 28 CDV strains detected from both vaccinated and non-vaccinated breeding foxes, raccoon dogs and minks from different geographical areas of China during the years 2004-2008 was determined. All the CDV strains but two (strains HL and HLJ2) were characterized as Asia-1 genotype and were highly similar to each other (96.2-99.7% at the amino acid [aa] level) and to other Asia-1 strains (96.1-99.5% aa) previously detected in China. The CDV strains HL and HLJ2 were both collected from foxes in Heilongjiang province in 2005. Strain HL resembled CDVs of the Arctic genotype (GR88-like) and displayed high aa identity (98.0%) to the Chinese canine strain Liu. By converse, strain HLJ2 was barely related to CDVs of the Asia-2 genotype (88.7-90.3% aa identity), and could represent a novel CDV genotype, tentatively proposed as Asia-3. These results suggest that at least three different CDV genotypes, distantly related (81.8-91.6% aa identity) to the vaccine strains, Onderstepoort-like (America-1 genotype), are currently circulating in breeding foxes, raccoon dogs and minks in China, and that the genotype Asia-1 is predominant. Whether the diversity between wild-type CDVs and the vaccine strains may affect, to some extent, the efficacy of the vaccines deserves further investigations.

The Ondersteport Canine distemper virus strain and measles ...

African Journals Online (AJOL)

Three groups of dogs aged three months each were used in an experiment to assess efficacy of imported Canine distemper vaccine (Ondersteport strain) and measles vaccine in protecting Nigerian dogs against local isolates of Canine distemper virus. Each group consisted of four randomly selected puppies. One group ...

Níveis de anticorpos contra o vírus da cinomose canina e o parvovírus canino em cães não vacinados e vacinados Antibodies levels against canine distemper virus and canine parvovirus in vaccinated and unvaccinated dogs

Directory of Open Access Journals (Sweden)

R. Hass

2008-02-01

Full Text Available Antibody titres to canine distemper virus (CDV and canine parvovirus (CPV were measured in 132 dogs: 80 had been vaccinated at least once, 22 had not been vaccinated, and 30 had unknown vaccination history. Serum antibody titers were measured by means of serum neutralization (CDV or hemagglutination inhibition (CPV. Serum CDV titers >20 and serum CPV titers >80 were considered protective. Protective antibodies to CDV were present in 40.1% of the population: 39.8% of the vaccinated dogs, 31.8% unvaccinated, and in 46.6% of the dogs with unknown vaccination history. Protective antibodies to CPV were present in 90.9% of the dogs: 93.7% of the vaccinated dogs, 90.9% of the unvaccinated, and 83.3% of the dogs with unknown vaccination history.

Urban domestic dog populations as a source of canine distemper virus for wild carnivores in the Coquimbo region of Chile.

Science.gov (United States)

Acosta-Jamett, G; Chalmers, W S K; Cunningham, A A; Cleaveland, S; Handel, I G; Bronsvoort, B M deC

2011-09-28

Urban areas can support dog populations dense enough to maintain canine distemper virus (CDV) and can be a source of infection for rural dogs and free-ranging carnivores. The aim of this study was to investigate the relationships between urban and rural domestic dog and wild carnivore populations and their effects on the epidemiology of CDV to explain retrospectively a CD outbreak in wild foxes in 2003. From 2005 to 2007 a cross-sectional household questionnaire survey was conducted in Coquimbo and Ovalle cities, in three towns and in rural sites along two transects from these cities to the Fray Jorge National Park (FJNP) in the Coquimbo region, Chile. Blood samples were collected from unvaccinated dogs at surveyed households and from free-ranging foxes in rural areas along the transects. The seroprevalence of CDV in domestic dogs was higher in urban than in rural areas and in the later was highest in dogs born before 2001-2002. The seroprevalence of CDV in foxes was higher in areas closer to human settlements. A high seroprevalence in dogs born before 2001-2002 further supports a link between CDV patterns in rural dog and fox populations. In our study area, urban dogs are proposed to be the source of CDV infection to wild carnivores. The large dog population size and density detected in Coquimbo and Ovalle provides optimal conditions for maintaining a large and dense susceptible population of dogs, which can act as a reservoir for highly infectious diseases and could have been the source of infection in the CD outbreak in wild foxes. Copyright © 2011 Elsevier B.V. All rights reserved.

The Role of the Hendra Virus and Nipah Virus Attachment Glycoproteins in Receptor Binding and Antibody Neutralization

Science.gov (United States)

2014-01-31

of important human (measles (MeV), mumps, human parainfluenza and respiratory syncytial virus (RSV)) and animal ( canine distemper virus (CDV...occurrence of a natural canine infection (6; 7). Since the emergence of HeV there have been a total of 86 horse fatalities, 2 canine infections and 7...Infectious Diseases 6. Anonymous. 2011. HENDRA VIRUS, EQUINE - AUSTRALIA (21): (QUEENSLAND) CANINE . Pro-Med-mail, Archive No. 20110802.2324

Booster effect of canine distemper, canine parvovirus infection and infectious canine hepatitis combination vaccine in domesticated adult dogs.

Science.gov (United States)

Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Orito, Kensuke; Lynch, Jonathan; Tsuchiya, Ryo; Sahara, Hiroeki

2012-08-01

Domesticated adult dogs with antibody titer classified as below 'high' to one or more of canine distemper virus (CDV), canine parvovirus type-2 (CPV-2) and canine adenovirus type-1 (CAdV-1) were then given an additional inoculation, and the effectiveness of this booster evaluated 2 months later. Consequently, CDV and CAdV-1 antibody titer experienced a significant increase, but the same effect was not observed in the antibody titer of CPV-2. These findings suggest that with additional inoculation, a booster effect may be expected in increasing antibody titers for CDV and CAdV-1, but it is unlikely to give an increase in CPV-2 antibody titer. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

Rabies and Canine Distemper Virus Epidemics in the Red Fox Population of Northern Italy (2006–2010)

Science.gov (United States)

De Benedictis, Paola; Citterio, Carlo; Obber, Federica; Lorenzetto, Monica; Pozza, Manuela Dalla; Cauchemez, Simon; Cattoli, Giovanni

2013-01-01

Since 2006 the red fox (Vulpes vulpes) population in north-eastern Italy has experienced an epidemic of canine distemper virus (CDV). Additionally, in 2008, after a thirteen-year absence from Italy, fox rabies was re-introduced in the Udine province at the national border with Slovenia. Disease intervention strategies are being developed and implemented to control rabies in this area and minimise risk to human health. Here we present empirical data and the epidemiological picture relating to these epidemics in the period 2006–2010. Of important significance for epidemiological studies of wild animals, basic mathematical models are developed to exploit information collected from the surveillance program on dead and/or living animals in order to assess the incidence of infection. These models are also used to estimate the rate of transmission of both diseases and the rate of vaccination, while correcting for a bias in early collection of CDV samples. We found that the rate of rabies transmission was roughly twice that of CDV, with an estimated effective contact between infected and susceptible fox leading to a new infection occurring once every 3 days for rabies, and once a week for CDV. We also inferred that during the early stage of the CDV epidemic, a bias in the monitoring protocol resulted in a positive sample being almost 10 times more likely to be collected than a negative sample. We estimated the rate of intake of oral vaccine at 0.006 per day, allowing us to estimate that roughly 68% of the foxes would be immunised. This was confirmed by field observations. Finally we discuss the implications for the eco-epidemiological dynamics of both epidemics in relation to control measures. PMID:23630599

Design of different strategies of multivalent DNA-based vaccination against rabies and canine distemper in mice and dogs

Directory of Open Access Journals (Sweden)

Touihri Leila

2012-12-01

Full Text Available Abstract Background During the vaccination campaigns, puppies younger than 3 months old are not targeted and remain unvaccinated for at least the first year of their lives. Almost half of the reported rabid dogs are 6 months or younger. Hence, we should recommend the vaccination against rabies of young puppies. Unfortunately, owing to the exposure of puppies to infections with either canine parvovirus (CPV or distemper virus (CDV after the intervention of the vaccinators, owners are reluctant to vaccinate puppies against rabies. Therefore, it is necessary to include the CPV and CDV valences in the vaccine against rabies. Multivalent DNA-based vaccination in dogs, including rabies and distemper valences, could help in raising vaccine coverage. Methods We have designed monovalent and multivalent DNA-based vaccine candidates for in vitro and in vivo assays. These plasmids encode to the rabies virus glycoprotein and/or the canine distemper virus hemagglutinin. The first strategy of multivalent DNA-based vaccination is by mixing plasmids encoding to a single antigen each. The second is by simply fusing the genes of the antigens together. The third is by adding the foot and mouth disease virus (FMDV 2A oligopeptide gene into the antigen genes. The last strategy is by the design and use of a bicistronic plasmid with an “Internal Ribosome Entry Site” (IRES domain. Results The monovalent construct against canine distemper was efficiently validated by inducing higher humoral immune responses compared to cell-culture-derived vaccine both in mice and dogs. All multivalent plasmids efficiently expressed both valences after in vitro transfection of BHK-21 cells. In BALB/c mice, the bicistronic IRES-dependant construct was the most efficient inducer of virus-neutralizing antibodies against both valences. It was able to induce better humoral immune responses compared to the administration of either cell-culture-derived vaccines or monovalent plasmids. The

Design of different strategies of multivalent DNA-based vaccination against rabies and canine distemper in mice and dogs.

Science.gov (United States)

Touihri, Leila; Ahmed, Sami Belhaj; Chtourou, Yacine; Daoud, Rahma; Bahloul, Chokri

2012-12-27

During the vaccination campaigns, puppies younger than 3 months old are not targeted and remain unvaccinated for at least the first year of their lives. Almost half of the reported rabid dogs are 6 months or younger. Hence, we should recommend the vaccination against rabies of young puppies. Unfortunately, owing to the exposure of puppies to infections with either canine parvovirus (CPV) or distemper virus (CDV) after the intervention of the vaccinators, owners are reluctant to vaccinate puppies against rabies. Therefore, it is necessary to include the CPV and CDV valences in the vaccine against rabies. Multivalent DNA-based vaccination in dogs, including rabies and distemper valences, could help in raising vaccine coverage. We have designed monovalent and multivalent DNA-based vaccine candidates for in vitro and in vivo assays. These plasmids encode to the rabies virus glycoprotein and/or the canine distemper virus hemagglutinin. The first strategy of multivalent DNA-based vaccination is by mixing plasmids encoding to a single antigen each. The second is by simply fusing the genes of the antigens together. The third is by adding the foot and mouth disease virus (FMDV) 2A oligopeptide gene into the antigen genes. The last strategy is by the design and use of a bicistronic plasmid with an "Internal Ribosome Entry Site" (IRES) domain. The monovalent construct against canine distemper was efficiently validated by inducing higher humoral immune responses compared to cell-culture-derived vaccine both in mice and dogs. All multivalent plasmids efficiently expressed both valences after in vitro transfection of BHK-21 cells. In BALB/c mice, the bicistronic IRES-dependant construct was the most efficient inducer of virus-neutralizing antibodies against both valences. It was able to induce better humoral immune responses compared to the administration of either cell-culture-derived vaccines or monovalent plasmids. The FMDV 2A was also efficient in the design of multivalent

Canine distemper virus infection in a lesser grison (Galictis cuja: first report and virus phylogeny Infecção pelo vírus da cinomose canina em um furão (Galictis cuja: primeiro relato e filogenia viral

Directory of Open Access Journals (Sweden)

Jane Megid

2013-02-01

Full Text Available Infectious diseases in wild animals have been increasing as a result of their habitat alterations and closer contact with domestic animals. Canine distemper virus (CDV has been reported in several species of wild carnivores, presenting a threat to wildlife conservation. We described the first case of canine distemper virus infection in lesser grison (Galictis cuja. A free-ranging individual, with no visible clinical sigs, presented sudden death after one day in captivity. Molecular diagnosis for CDV infection was performed using whole blood collected by postmortem intracardiac puncture, which resulted positive. The virus phylogeny indicated that domestic dogs were the probable source of infection.Doenças infecciosas em animais selvagens têm aumentado devido às alterações em seu habitat e ao maior contato com animais domésticos. A cinomose já foi descrita em diversas espécies de carnívoros selvagens, representando uma ameaça à conservação da vida selvagem. Nesse estudo é descrito o primeiro caso de infecção pelo vírus da cinomose em um furão (Galictis cuja. Um indivíduo de vida livre, sem sinais clínicos aparentes, apresentou morte súbita após um dia em cativeiro. Foi realizado o diagnóstico molecular para detecção do vírus da cinomose canina, sendo o resultado positivo. A filogenia do vírus indicou que cães domésticos foram a provável fonte de infecção.

Morbillivirus control of the interferon response: relevance of STAT2 and mda5 but not STAT1 for canine distemper virus virulence in ferrets.

Science.gov (United States)

Svitek, Nicholas; Gerhauser, Ingo; Goncalves, Christophe; Grabski, Elena; Döring, Marius; Kalinke, Ulrich; Anderson, Danielle E; Cattaneo, Roberto; von Messling, Veronika

2014-03-01

The V proteins of paramyxoviruses control the innate immune response. In particular, the V protein of the genus Morbillivirus interferes with the signal transducer and activator of transcription 1 (STAT1), STAT2, and melanoma differentiation-associated protein 5 (mda5) signaling pathways. To characterize the contributions of these pathways to canine distemper virus (CDV) pathogenesis, we took advantage of the knowledge about the mechanisms of interaction between the measles virus V protein with these key regulators of innate immunity. We generated recombinant CDVs with V proteins unable to properly interact with STAT1, STAT2, or mda5. A virus with combined STAT2 and mda5 deficiencies was also generated, and available wild-type and V-protein-knockout viruses were used as controls. Ferrets infected with wild-type and STAT1-blind viruses developed severe leukopenia and loss of lymphocyte proliferation activity and succumbed to the disease within 14 days. In contrast, animals infected with viruses with STAT2 or mda5 defect or both STAT2 and mda5 defects developed a mild self-limiting disease similar to that associated with the V-knockout virus. This study demonstrates the importance of interference with STAT2 and mda5 signaling for CDV immune evasion and provides a starting point for the development of morbillivirus vectors with reduced immunosuppressive properties. The V proteins of paramyxoviruses interfere with the recognition of the virus by the immune system of the host. For morbilliviruses, the V protein is known to interact with the signal transducer and activator of transcription 1 (STAT1) and STAT2 and the melanoma differentiation-associated protein 5 (mda5), which are involved in interferon signaling. Here, we examined the contribution of each of these signaling pathways to the pathogenesis of the carnivore morbillivirus canine distemper virus. Using viruses selectively unable to interfere with the respective signaling pathway to infect ferrets, we found that

Occurrence of filaria in domestic dogs of Samburu pastoralists in Northern Kenya and its associations with canine distemper.

Science.gov (United States)

Albrechtová, Kateřina; Sedlák, Kamil; Petrželková, Klára J; Hlaváč, Jan; Mihalca, Andrei D; Lesingirian, Alison; Kanyari, Paul W N; Modrý, David

2011-12-15

Samples of blood (serum, smears and blood preserved with ethanol) were collected from dogs during a vaccination campaign in northern Kenya in the years 2006 and 2007. Blood was screened for filarial parasites using molecular and microscopy methods and sera were tested for antibodies against canine distemper virus (CDV). Parasitological examination revealed the presence of two species of canine filariae: Acanthocheilonema dracunculoides and A. reconditum. The DNA from the former species was detected in 58% dogs sampled in 2006 and 36% dogs sampled in 2007, whereas the latter was found only in 4.2% samples collected in 2007. Microfilariae were found in 33.8% blood smears collected in 2006 and 10.6% blood smears collected in 2007. The seroprevalence of CDV was 33.4% in 2006 and 11.2% in 2007. The effect of sex, age and CDV-seropositivity/seronegativity on the occurrence of A. dracunculoides was evaluated. Infection by A. dracunculoides was more common in males and in dogs with a positive antibody titer for canine distemper, but evenly distributed among different age groups. The difference in the prevalence of A. dracunculoides in two isolated mountain ranges was not statistically significant. Methodologies available for detection and determination of canine filariae are compared, underlining methodical pitfalls arising through the determination of less common filarial species. The role of single epidemiological factors and possible association between canine distemper and filariasis are discussed. Copyright © 2011 Elsevier B.V. All rights reserved.

Duration of Maternal Antibodies against Canine Distemper Virus and Hendra Virus in Pteropid Bats

Science.gov (United States)

Zambrana-Torrelio, Carlos; Middleton, Deborah; Barr, Jennifer A.; DuBovi, Edward; Boyd, Victoria; Pope, Brian; Todd, Shawn; Crameri, Gary; Walsh, Allyson; Pelican, Katey; Fielder, Mark D.; Davies, Angela J.; Wang, Lin-Fa; Daszak, Peter

2013-01-01

Old World frugivorous bats have been identified as natural hosts for emerging zoonotic viruses of significant public health concern, including henipaviruses (Nipah and Hendra virus), Ebola virus, and Marburg virus. Epidemiological studies of these viruses in bats often utilize serology to describe viral dynamics, with particular attention paid to juveniles, whose birth increases the overall susceptibility of the population to a viral outbreak once maternal immunity wanes. However, little is understood about bat immunology, including the duration of maternal antibodies in neonates. Understanding duration of maternally derived immunity is critical for characterizing viral dynamics in bat populations, which may help assess the risk of spillover to humans. We conducted two separate studies of pregnant Pteropus bat species and their offspring to measure the half-life and duration of antibodies to 1) canine distemper virus antigen in vaccinated captive Pteropus hypomelanus; and 2) Hendra virus in wild-caught, naturally infected Pteropus alecto. Both of these pteropid bat species are known reservoirs for henipaviruses. We found that in both species, antibodies were transferred from dam to pup. In P. hypomelanus pups, titers against CDV waned over a mean period of 228.6 days (95% CI: 185.4–271.8) and had a mean terminal phase half-life of 96.0 days (CI 95%: 30.7–299.7). In P. alecto pups, antibodies waned over 255.13 days (95% CI: 221.0–289.3) and had a mean terminal phase half-life of 52.24 days (CI 95%: 33.76–80.83). Each species showed a duration of transferred maternal immunity of between 7.5 and 8.5 months, which was longer than has been previously estimated. These data will allow for more accurate interpretation of age-related Henipavirus serological data collected from wild pteropid bats. PMID:23826322

Deduced sequences of the membrane fusion and attachment proteins of canine distemper viruses isolated from dogs and wild animals in Korea.

Science.gov (United States)

Bae, Chae-Wun; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Lee, Nak-Hyung; Seo, Kun-Ho; Kang, Young-Sun; Park, Choi-Kyu; Choi, In-Soo

2013-08-01

Canine distemper virus (CDV) causes highly contagious respiratory, gastrointestinal, and neurological diseases in wild and domestic animal species. Despite a broad vaccination campaign, the disease is still a serious problem worldwide. In this study, six field CDV strains were isolated from three dogs, two raccoon dogs, and one badger in Korea. The full sequence of the genes encoding fusion (F) and hemagglutinin (H) proteins were compared with those of other CDVs including field and vaccine strains. The phylogenetic analysis for the F and H genes indicated that the two CDV strains isolated from dogs were most closely related to Chinese strains in the Asia-1 genotype. Another four strains were closely related to Japanese strains in the Asia-2 genotype. The six currently isolated strains shared 90.2-92.1% and 88.2-91.8% identities with eight commercial vaccine strains in their nucleotide and amino acid sequences of the F protein, respectively. They also showed 90.1-91.4% and 87.8-90.7% identities with the same vaccine strains in their nucleotide and deduced amino acid sequences of the H protein, respectively. Different N-linked glycosylation sites were identified in the F and H genes of the six isolates from the prototype vaccine strain Onderstepoort. Collectively, these results demonstrate that at least two different CDV genotypes currently exist in Korea. The considerable genetic differences between the vaccine strains and wild-type isolates would be a major factor of the incomplete protection of dogs from CDV infections.

Dog overpopulation and burden of exposure to canine distemper virus and other pathogens on Santa Cruz Island, Galapagos.

Science.gov (United States)

Diaz, Nicole M; Mendez, Gabriella S; Grijalva, C Jaime; Walden, Heather S; Cruz, Marilyn; Aragon, Eduardo; Hernandez, Jorge A

2016-01-01

Dog overpopulation and diseases are hazards to native island species and humans on the Galapagos. Vaccination and importation of dogs are prohibited on the Galapagos. Risk management of these hazards requires the use of science-based risk assessment and risk communication. The objectives of the study reported here were (i) to estimate the human:dog ratio and (ii) the prevalence of and identify exposure factors associated with positive antibody titers to canine distemper virus (CDV) and other pathogens, as well as infection with intestinal parasites in owned dogs on Santa Cruz Island, Galapagos in September 2014. The observed human:dog ratio was 6.148:1 which extrapolates to 2503 dogs (two times more than a recent dog count conducted by Galapagos Biosecurity Agency in March 2014). The proportion of spayed female dogs (50%) was higher, compared to neutered male dogs (30%) (p=0.04). Prevalence of dogs with positive antibody titers to CDV was 36% (95% CI=26, 46%), to canine parvovirus was 89% (95% CI=82, 95%), and to canine adenovirus was 40% (95% CI=30, 51%). The frequency of seropositive dogs to CDV was lower in urban dogs (26%), compared to rural dogs (53%) (pdog population on Santa Cruz is susceptible to an outbreak of CDV (particularly among urban dogs) with potential spill over to marine mammals. Dog's age (1-2 or 3-14 years old, compared to younger dogs), and residence (rural, urban) were associated with positive antibody titers to parvovirus, adenovirus, Ehrlichia spp., or Anaplasma spp., as well as infection with Ancylostoma spp., an intestinal parasite in dogs that can be transmitted to humans, particularly children. These results provide the most comprehensive assessment of dog overpopulation and exposure to CDV and other pathogens on the Galapagos to date. Copyright © 2015 Elsevier B.V. All rights reserved.

Clinical and molecular investigation of a canine distemper outbreak and vector-borne infections in a group of rescue dogs imported from Hungary to Switzerland.

Science.gov (United States)

Willi, Barbara; Spiri, Andrea M; Meli, Marina L; Grimm, Felix; Beatrice, Laura; Riond, Barbara; Bley, Tim; Jordi, Rolf; Dennler, Matthias; Hofmann-Lehmann, Regina

2015-07-16

Canine distemper virus (CDV) is a major pathogen of dogs and wild carnivores worldwide. In Switzerland, distemper in domestic dogs is rarely reported. In recent years, the import of dogs from Eastern Europe to Switzerland has steadily increased. In the present study, we describe a distemper outbreak in 15 rescue dogs that were imported from Hungary to Switzerland by an animal welfare organisation. The data on vaccination and medical history were recorded (14 dogs), and the samples were collected to investigate CDV and vector-borne infections (13 dogs) and canine parvovirus infection (12 dogs). The dogs were monitored for six months. One dog was euthanised directly after import. Thirteen dogs showed clinical signs after arrival, i.e., diarrhoea (57 %), coughing (43 %) and nasal and/or ocular discharge (21 %); radiographic findings that were compatible with bronchopneumonia were present in four dogs. CDV infection was diagnosed in 11 dogs (85 %); 10 dogs (91 %) tested PCR-positive in conjunctival swabs. Vector-borne infections (Babesia spp., Leishmania infantum, Dirofilaria immitis) were found in 4 dogs (31 %). Three dogs were hospitalized, and six dogs received ambulatory therapy for up to two months until recovery. None of the dogs developed neurological disease. CDV shedding was detected for a period of up to four months. Because dogs were put under strict quarantine until CDV shedding ceased, CDV did not spread to any other dogs. The CDV isolates showed 99 % sequence identity in the HA gene among each other and belonged to the Arctic-like lineage of CDV. The present study highlights the imminent risks of spreading contagious viral and vector-borne infections through the non-selective import of sick dogs and dogs with incomplete vaccination from Eastern Europe. CDV shedding was detected for several months after the cessation of clinical signs, which emphasised the roles of asymptomatic carriers in CDV epidemiology. A long-term follow-up using sensitive PCR and

Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

Directory of Open Access Journals (Sweden)

Zhao Jianjun

2011-02-01

Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

Evolutionary characteristics of morbilliviruses during serial passages in vitro: Gradual attenuation of virus virulence.

Science.gov (United States)

Liu, Fuxiao; Wu, Xiaodong; Li, Lin; Zou, Yanli; Liu, Shan; Wang, Zhiliang

2016-08-01

The genus Morbillivirus is classified into the family Paramyxoviridae, and is composed of 6 members, namely measles virus (MV), rinderpest virus (RPV), peste-des-petits-ruminants virus (PPRV), canine distemper virus (CDV), phocine distemper virus (PDV) and cetacean morbillivirus (CeMV). The MV, RPV, PPRV and CDV have been successfully attenuated through their serial passages in vitro for the production of live vaccines. It has been demonstrated that the morbilliviral virulence in animals was progressively attenuated with their consecutive passages in vitro. However, only a few reports were involved in explanation of an attenuation-related mechanism on them until many years after the establishment of a quasispecies theory. RNA virus quasispecies arise from rapid evolution of viruses with high mutation rate during genomic replication, and play an important role in gradual loss of viral virulence by serial passages. Here, we overviewed the development of live-attenuated vaccine strains against morbilliviruses by consecutive passages in vitro, and further discussed a related mechanism concerning the relationship between virulence attenuation and viral evolution. Copyright © 2016 Elsevier Ltd. All rights reserved.

Zymographic patterns of MMP-2 and MMP-9 in the CSF and cerebellum of dogs with subacute distemper leukoencephalitis.

Science.gov (United States)

Machado, Gisele F; Melo, Guilherme D; Souza, Milena S; Machado, Andressa A; Migliolo, Daniela S; Moraes, Olívia C; Nunes, Cáris M; Ribeiro, Erica S

2013-07-15

Distemper leukoencephalitis is a disease caused by the canine distemper virus (CDV) infection. It is a demyelinating disease affecting mainly the white matter of the cerebellum and areas adjacent to the fourth ventricle; the enzymes of the matrix metalloproteinases (MMPs) group, especially MMP-2 and MMP-9 have a key role in the myelin basic protein fragmentation and in demyelination, as well as in leukocyte traffic into the nervous milieu. To evaluate the involvement of MMPs during subacute distemper leukoencephalitis, we measured the levels of MMP-2 and MMP-9 by zymography in the cerebrospinal fluid (CSF) and in the cerebellum of 14 dogs naturally infected with CDV and 10 uninfected dogs. The infected dogs presented high levels of pro-MMP-2 in the CSF and elevated levels of pro-MMP-2 and pro-MMP-9 in the cerebellar tissue. Active MMP-2 was detected in the CSF of some infected dogs. As active MMP-2 and MMP-9 are required for cellular migration across the blood-brain barrier and any interference between MMPs and their inhibitors may result in an amplification of demyelination, this study gives additional support to the involvement of MMPs during subacute distemper leukoencephalitis and suggests that MMP-2 and MMP-9 may take part in the brain inflammatory changes of this disease. Copyright © 2013 Elsevier B.V. All rights reserved.

The role of canine distemper virus and persistent organic pollutants in mortality patterns of Caspian seals (Pusa caspica).

Science.gov (United States)

Wilson, Susan C; Eybatov, Tariel M; Amano, Masao; Jepson, Paul D; Goodman, Simon J

2014-01-01

Persistent organic pollutants are a concern for species occupying high trophic levels since they can cause immunosuppression and impair reproduction. Mass mortalities due to canine distemper virus (CDV) occurred in Caspian seals (Pusa caspica), in spring of 1997, 2000 and 2001, but the potential role of organochlorine exposure in these epizootics remains undetermined. Here we integrate Caspian seal mortality data spanning 1971-2008, with data on age, body condition, pathology and blubber organochlorine concentration for carcases stranded between 1997 and 2002. We test the hypothesis that summed PCB and DDT concentrations contributed to CDV associated mortality during epizootics. We show that age is the primary factor explaining variation in blubber organochlorine concentrations, and that organochlorine burden, age, sex, and body condition do not account for CDV infection status (positive/negative) of animals dying in epizootics. Most animals (57%, n = 67) had PCB concentrations below proposed thresholds for toxic effects in marine mammals (17 µg/g lipid weight), and only 3 of 67 animals had predicted TEQ values exceeding levels seen to be associated with immune suppression in harbour seals (200 pg/g lipid weight). Mean organonchlorine levels were higher in CDV-negative animals indicating that organochlorines did not contribute significantly to CDV mortality in epizootics. Mortality monitoring in Azerbaijan 1971-2008 revealed bi-annual stranding peaks in late spring, following the annual moult and during autumn migrations northwards. Mortality peaks comparable to epizootic years were also recorded in the 1970s-1980s, consistent with previous undocumented CDV outbreaks. Gompertz growth curves show that Caspian seals achieve an asymptotic standard body length of 126-129 cm (n = 111). Males may continue to grow slowly throughout life. Mortality during epizootics may exceed the potential biological removal level (PBR) for the population, but the low frequency of

The role of canine distemper virus and persistent organic pollutants in mortality patterns of Caspian seals (Pusa caspica.

Directory of Open Access Journals (Sweden)

Susan C Wilson

Full Text Available Persistent organic pollutants are a concern for species occupying high trophic levels since they can cause immunosuppression and impair reproduction. Mass mortalities due to canine distemper virus (CDV occurred in Caspian seals (Pusa caspica, in spring of 1997, 2000 and 2001, but the potential role of organochlorine exposure in these epizootics remains undetermined. Here we integrate Caspian seal mortality data spanning 1971-2008, with data on age, body condition, pathology and blubber organochlorine concentration for carcases stranded between 1997 and 2002. We test the hypothesis that summed PCB and DDT concentrations contributed to CDV associated mortality during epizootics. We show that age is the primary factor explaining variation in blubber organochlorine concentrations, and that organochlorine burden, age, sex, and body condition do not account for CDV infection status (positive/negative of animals dying in epizootics. Most animals (57%, n = 67 had PCB concentrations below proposed thresholds for toxic effects in marine mammals (17 µg/g lipid weight, and only 3 of 67 animals had predicted TEQ values exceeding levels seen to be associated with immune suppression in harbour seals (200 pg/g lipid weight. Mean organonchlorine levels were higher in CDV-negative animals indicating that organochlorines did not contribute significantly to CDV mortality in epizootics. Mortality monitoring in Azerbaijan 1971-2008 revealed bi-annual stranding peaks in late spring, following the annual moult and during autumn migrations northwards. Mortality peaks comparable to epizootic years were also recorded in the 1970s-1980s, consistent with previous undocumented CDV outbreaks. Gompertz growth curves show that Caspian seals achieve an asymptotic standard body length of 126-129 cm (n = 111. Males may continue to grow slowly throughout life. Mortality during epizootics may exceed the potential biological removal level (PBR for the population, but the low

Genetic characterization of canine distemper virus involved in outbreaks in farmed mink in Denmark 2012

DEFF Research Database (Denmark)

Trebbien, Ramona; Struve, T.; Hjulsager, Charlotte Kristiane

Danish farmed mink herds experienced a large outbreak of canine distemper virus in 2012. Full-length sequence analysis (1824 nucleotides) of the variable hemagglutinin (H) gene were performed on 27 viruses collected from mink and on 7 viruses collected from wild foxes. Results of the study showed...... with other European canine distemper viruses and showed the highest level of similarity (99.3 - 99.6 %) to viruses isolated from wild foxes in Germany. The fox should therefore be considered as an important wild life reservoir of canine distemper virus and may also contribute to the transmission of the virus...

Development of a combined canine distemper virus specific RT-PCR protocol for the differentiation of infected and vaccinated animals (DIVA) and genetic characterization of the hemagglutinin gene of seven Chinese strains demonstrated in dogs.

Science.gov (United States)

Yi, Li; Cheng, Shipeng; Xu, Hongli; Wang, Jianke; Cheng, Yuening; Yang, Shen; Luo, Bin

2012-01-01

A combined reverse-transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of the canine distemper virus (CDV). A pair of primers (P1/P2) was used to detect both CDV wild-type strains and vaccines. Another pair (P3/P4) was used to detect only CDV wild-type strains. A 335bp fragment was amplified from the genomic RNA of the vaccine and wild-type strains. A 555bp fragment was amplified specifically from the genomic RNA of the wild-type strains. No amplification was achieved for the uninfected cells, cells infected with canine parvovirus, canine coronavirus, or canine adenovirus. The combined RT-PCR method detected effectively and differentiated the CDV wild-type and vaccine strains by two separate RT-PCRs. The method can be used for clinical detection and epidemiological surveillance. The phylogenetic analysis of the hemagglutinin gene of the local wild-type CDV strains revealed that the seven local isolates all belonged to the Asia-1 lineage, and were clustered closely with one another at the same location. These results suggested that the CDV genotype Asia-1 is circulating currently in domestic dogs in China. Copyright © 2011 Elsevier B.V. All rights reserved.

Canine distemper virus in Lake Baikal seals (Phoca sibirica).

NARCIS (Netherlands)

L.V. Mamaev; I.K.G. Visser (Ilona); S.I. Belikov; N.N. Denikina; T.C. Harder (Timm); L. Goatley; B. Rima; B. Edginton; A.D.M.E. Osterhaus (Albert); T. Barrett (Thomas)

1996-01-01

textabstractThe virus epizootic which resulted in significant mortality in Siberian seals (Phoca sibirica) in Lake Baikal during 1987/88 was caused by canine distemper virus. Sequence analysis of the virus glycoprotein genes revealed that it was most closely related to recent European field isolates

Development of a duplex real-time RT-qPCR assay to monitor genome replication, gene expression and gene insert stability during in vivo replication of a prototype live attenuated canine distemper virus vector encoding SIV gag.

Science.gov (United States)

Coleman, John W; Wright, Kevin J; Wallace, Olivia L; Sharma, Palka; Arendt, Heather; Martinez, Jennifer; DeStefano, Joanne; Zamb, Timothy P; Zhang, Xinsheng; Parks, Christopher L

2015-03-01

Advancement of new vaccines based on live viral vectors requires sensitive assays to analyze in vivo replication, gene expression and genetic stability. In this study, attenuated canine distemper virus (CDV) was used as a vaccine delivery vector and duplex 2-step quantitative real-time RT-PCR (RT-qPCR) assays specific for genomic RNA (gRNA) or mRNA have been developed that concurrently quantify coding sequences for the CDV nucleocapsid protein (N) and a foreign vaccine antigen (SIV Gag). These amplicons, which had detection limits of about 10 copies per PCR reaction, were used to show that abdominal cavity lymphoid tissues were a primary site of CDV vector replication in infected ferrets, and importantly, CDV gRNA or mRNA was undetectable in brain tissue. In addition, the gRNA duplex assay was adapted for monitoring foreign gene insert genetic stability during in vivo replication by analyzing the ratio of CDV N and SIV gag genomic RNA copies over the course of vector infection. This measurement was found to be a sensitive probe for assessing the in vivo genetic stability of the foreign gene insert. Copyright © 2014 Elsevier B.V. All rights reserved.

Failure of attenuated canine distemper virus (Rockborn strain) to suppress lymphocyte blastogenesis in dogs.

Science.gov (United States)

Schultz, R D

1976-01-01

The attenuated Rockborn strain of canine distemper virus is commonly used in commercial vaccines. Since immunosuppression is a common feature of virulent (Snyder Hill) distemper virus infection of the dog, an evaluation of the cellular immune functions of dogs given inoculums of the less virulent Rockborn strain was done using lymphocyte blastogenesis responses to various mitogens. Unlike the viruslent Snyder Hill strain, the attenuated distemper virus did not alter lymphocyte blastogenesis responses to phytohemaglutinin (PHA) and pokeweed mitogen (PWM) which are considered in vitro correlates of T and B cell immunity.

Morphometric analysis of the thymus of puppies infected with the Snyder Hill Strain of canine distemper virus Análise morfométrica do timo de cães filhotes infectados com a amostra Snyder Hill do vírus de cinomose canina

Directory of Open Access Journals (Sweden)

C.M. Alves

2006-08-01

Full Text Available The thymic morphometry analysis was used for determining apoptosis and atrophy of the thymus of eight puppies inoculated with canine distemper virus (CDV. Three healthy dogs were used as negative controls. Sections, 5µm thick, were stained by HE and Shorr, and the latter were evaluated by morphometry. CDV nucleoprotein was detected by immunohistochemistry. Morphometric results confirmed lymphoid hypotrophy in CDV inoculated dog thymuses, more stroma, less parenchyma and higher apoptotic index/field than negative control (not inoculated puppies. Apoptosis plays a role in the mechanism of thymus atrophy that develops in canine distemper.Determinaram-se a apoptose e a atrofia no timo de oito cães novos, inoculados experimentalmente com o vírus de cinomose. Três cães saudáveis foram usados como controle negativo. Secções coradas pelo Shorr foram avaliadas por morfometria. A nucleoproteína viral foi detectada por imunoistoquímica. Os resultados morfométricos confirmaram a hipotrofia e mostraram que o timo dos cães inoculados tinha mais estroma, menos parênquima e maior índice apoptótico/campo que o dos animais-controle. Pode-se concluir que a apoptose desempenha importante papel no mecanismo de hipotrofia tímica que se desenvolve na cinomose.

Evaluation of Trapper-Collected Nobuto Filter-Paper Blood Samples for Distemper and Parvovirus Antibody Detection in Coyotes (Canis latrans) and Raccoons (Procyon lotor).

Science.gov (United States)

Kamps, Amanda J; Dubay, Shelli A; Langenberg, Julie; Maes, Roger K

2015-07-01

Blood samples are often collected from free-ranging wildlife for antibody detection. However, filter-paper (FP) strips are more cost efficient and easy to collect and store. We evaluated trapper-collected FP strips and body-cavity blood for canine distemper (CDV) and parvovirus (CPV-2) antibody detection in raccoons (Procyon lotor) and coyotes (Canis latrans). From 2008 to 2010, licensed trappers near Madison and Milwaukee, Wisconsin, US collected paired samples from harvested animals. Canine distemper antibodies were detected using virus neutralization and parvovirus antibodies were detected using hemagglutination inhibition. Titers ≥ 1:32 for CDV and ≥ 1:25 for CPV-2 were considered evidence of exposure. Using Cohen's kappa test of agreement, FP strip titers agreed with sera for CDV in coyotes (n = 28, K = 0.772) and raccoons (n = 29, K = 0.858) and for CPV-2 in coyotes (n = 40, K = 0.775) and raccoons (n = 70, K = 0.646). However, raccoons determined to be exposed to CPV-2 from sera were unexposed by FP strips in 35% of the samples. Titer results may be affected by quality and volume of blood samples, interval between collection and processing, small sample sizes, and diagnostic testing procedures. Filter-paper strips can be useful for detecting CDV and CPV-2 exposure in coyotes and raccoons with correct field sample collection and appropriate diagnostic testing procedures.

Fatal canine distemper infection in a pack of African wild dogs in the Serengeti ecosystem, Tanzania.

Science.gov (United States)

Goller, Katja V; Fyumagwa, Robert D; Nikolin, Veljko; East, Marion L; Kilewo, Morris; Speck, Stephanie; Müller, Thomas; Matzke, Martina; Wibbelt, Gudrun

2010-12-15

In 2007, disease related mortality occurred in one African wild dog (Lycaon pictus) pack close to the north-eastern boundary of the Serengeti National Park, Tanzania. Histopathological examination of tissues from six animals revealed that the main pathologic changes comprised interstitial pneumonia and suppurative to necrotizing bronchopneumonia. Respiratory epithelial cells contained numerous eosinophilic intracytoplasmic inclusion bodies and multiple syncytial cells were found throughout the parenchymal tissue, both reacting clearly positive with antibodies against canine distemper virus (CDV) antigen. Phylogenetic analysis based on a 388 nucleotide (nt) fragment of the CDV phosphoprotein (P) gene revealed that the pack was infected with a CDV variant most closely related to Tanzanian variants, including those obtained in 1994 during a CDV epidemic in the Serengeti National Park and from captive African wild dogs in the Mkomazi Game Reserve in 2000. Phylogenetic analysis of a 335-nt fragment of the fusion (F) gene confirmed that the pack in 2007 was infected with a variant most closely related to one variant from 1994 during the epidemic in the Serengeti National Park from which a comparable fragment is available. Screening of tissue samples for concurrent infections revealed evidence of canine parvovirus, Streptococcus equi subsp. ruminatorum and Hepatozoon sp. No evidence of infection with Babesia sp. or rabies virus was found. Possible implications of concurrent infections are discussed. This is the first molecular characterisation of CDV in free-ranging African wild dogs and only the third confirmed case of fatal CDV infection in a free-ranging pack. Copyright © 2010 Elsevier B.V. All rights reserved.

Viral Oncolysis — Can Insights from Measles Be Transferred to Canine Distemper Virus?

Directory of Open Access Journals (Sweden)

Stefanie Lapp

2014-06-01

Full Text Available Neoplastic diseases represent one of the most common causes of death among humans and animals. Currently available and applied therapeutic options often remain insufficient and unsatisfactory, therefore new and innovative strategies and approaches are highly needed. Periodically, oncolytic viruses have been in the center of interest since the first anecdotal description of their potential usefulness as an anti-tumor treatment concept. Though first reports referred to an incidental measles virus infection causing tumor regression in a patient suffering from lymphoma several decades ago, no final treatment concept has been developed since then. However, numerous viruses, such as herpes-, adeno- and paramyxoviruses, have been investigated, characterized, and modified with the aim to generate a new anti-cancer treatment option. Among the different viruses, measles virus still represents a highly interesting candidate for such an approach. Numerous different tumors of humans including malignant lymphoma, lung and colorectal adenocarcinoma, mesothelioma, and ovarian cancer, have been studied in vitro and in vivo as potential targets. Moreover, several concepts using different virus preparations are now in clinical trials in humans and may proceed to a new treatment option. Surprisingly, only few studies have investigated viral oncolysis in veterinary medicine. The close relationship between measles virus (MV and canine distemper virus (CDV, both are morbilliviruses, and the fact that numerous tumors in dogs exhibit similarities to their human counterpart, indicates that both the virus and species dog represent a highly interesting translational model for future research in viral oncolysis. Several recent studies support such an assumption. It is therefore the aim of the present communication to outline the mechanisms of morbillivirus-mediated oncolysis and to stimulate further research in this potentially expanding field of viral oncolysis in a highly

Viral Oncolysis — Can Insights from Measles Be Transferred to Canine Distemper Virus?

Science.gov (United States)

Lapp, Stefanie; Pfankuche, Vanessa M.; Baumgärtner, Wolfgang; Puff, Christina

2014-01-01

Neoplastic diseases represent one of the most common causes of death among humans and animals. Currently available and applied therapeutic options often remain insufficient and unsatisfactory, therefore new and innovative strategies and approaches are highly needed. Periodically, oncolytic viruses have been in the center of interest since the first anecdotal description of their potential usefulness as an anti-tumor treatment concept. Though first reports referred to an incidental measles virus infection causing tumor regression in a patient suffering from lymphoma several decades ago, no final treatment concept has been developed since then. However, numerous viruses, such as herpes-, adeno- and paramyxoviruses, have been investigated, characterized, and modified with the aim to generate a new anti-cancer treatment option. Among the different viruses, measles virus still represents a highly interesting candidate for such an approach. Numerous different tumors of humans including malignant lymphoma, lung and colorectal adenocarcinoma, mesothelioma, and ovarian cancer, have been studied in vitro and in vivo as potential targets. Moreover, several concepts using different virus preparations are now in clinical trials in humans and may proceed to a new treatment option. Surprisingly, only few studies have investigated viral oncolysis in veterinary medicine. The close relationship between measles virus (MV) and canine distemper virus (CDV), both are morbilliviruses, and the fact that numerous tumors in dogs exhibit similarities to their human counterpart, indicates that both the virus and species dog represent a highly interesting translational model for future research in viral oncolysis. Several recent studies support such an assumption. It is therefore the aim of the present communication to outline the mechanisms of morbillivirus-mediated oncolysis and to stimulate further research in this potentially expanding field of viral oncolysis in a highly suitable

Early DNA vaccination of puppies against canine distemper in the presence of maternally derived immunity.

Science.gov (United States)

Griot, Christian; Moser, Christian; Cherpillod, Pascal; Bruckner, Lukas; Wittek, Riccardo; Zurbriggen, Andreas; Zurbriggen, Rinaldo

2004-01-26

Canine distemper (CD) is a disease in carnivores caused by CD virus (CDV), a member of the morbillivirus genus. It still is a threat to the carnivore and ferret population. The currently used modified attenuated live vaccines have several drawbacks of which lack of appropriate protection from severe infection is the most outstanding one. In addition, puppies up to the age of 6-8 weeks cannot be immunized efficiently due to the presence of maternal antibodies. In this study, a DNA prime modified live vaccine boost strategy was investigated in puppies in order to determine if vaccinated neonatal dogs induce a neutralizing immune response which is supposed to protect animals from a CDV challenge. Furthermore, a single DNA vaccination of puppies, 14 days after birth and in the presence of high titers of CDV neutralizing maternal antibodies, induced a clear and significant priming effect observed as early as 3 days after the subsequent booster with a conventional CDV vaccine. It was shown that the priming effect develops faster and to higher titers in puppies preimmunized with DNA 14 days after birth than in those vaccinated 28 days after birth. Our results demonstrate that despite the presence of maternal antibodies puppies can be vaccinated using the CDV DNA vaccine, and that this vaccination has a clear priming effect leading to a solid immune response after a booster with a conventional CDV vaccine.

9 CFR 113.306 - Canine Distemper Vaccine.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Canine Distemper Vaccine. 113.306... Virus Vaccines § 113.306 Canine Distemper Vaccine. Canine Distemper Vaccine shall be prepared from virus... distemper virus, each of five canine distemper susceptible ferrets shall be injected with a sample of the...

9 CFR 113.302 - Distemper Vaccine-Mink.

Science.gov (United States)

2010-01-01

... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Distemper Vaccine-Mink. 113.302... Virus Vaccines § 113.302 Distemper Vaccine—Mink. Distemper Vaccine—Mink shall be prepared from virus... follows: (1) To detect virulent canine distemper virus, each of two distemper susceptible mink or ferrets...

Display of neutralizing epitopes of Canine parvovirus and a T-cell epitope of the fusion protein of Canine distemper virus on chimeric tymovirus-like particles and its use as a vaccine candidate both against Canine parvo and Canine distemper.

Science.gov (United States)

Chandran, Dev; Shahana, Pallichera Vijayan; Rani, Gudavelli Sudha; Sugumar, Parthasarthy; Shankar, Chinchkar Ramchandra; Srinivasan, Villuppanoor Alwar

2009-12-10

Expression of Physalis mottle tymovirus coat protein in Escherichia coli was earlier shown to self-assemble into empty capsids that were nearly identical to the capsids formed in vivo. Amino acid substitutions were made at the N-terminus of wild-type Physalis mottle virus coat protein with neutralizing epitopes of Canine parvovirus containing the antigenic sites 1-2, 4 and 6-7 and T-cell epitope of the fusion protein of Canine distemper virus in various combinations to yield PhMV1, PhMV2, PhMV3, PhMV4 and PhMV5. These constructs were cloned and expressed in E. coli. The chimeric proteins self-assembled into chimeric tymovirus-like particles (TVLPs) as determined by electron microscopy. The TVLPs were purified by ultracentrifugation and injected into guinea pigs and dogs to determine their immunogenicity. Initial immunogenicity studies in guinea pigs indicated that PhMV3 gave a higher response in comparison to the other TVLPs for both CPV and CDV and hence all further experiments in dogs were done with PhMV3. HI was done against different isolates obtained from various parts of the country. Protective titres indicated the broad spectrum of the vaccine. In conclusion the study indicated that the above chimeric VLP based vaccine could be used in dogs to generate a protective immune response against diseases caused by both Canine parvo and Canine distemper virus.

Evaluation of oral and subcutaneous delivery of an experimental canarypox recombinant canine distemper vaccine in the Siberian polecate (Mustela eversmanni)

Science.gov (United States)

Wimsatt, Jeffrey; Biggins, Dean E.; Innes, Kim; Taylor, Bobbi; Garell, Della

2003-01-01

We assessed the safety and efficacy of an experimental canarypox-vectored recombinant canine distemper virus (CDV) subunit vaccine in the Siberian polecat (Mustela eversmanni), a close relative of the black-footed ferret, (M. nigripes), an endangered species that is highly susceptible to the virus. Siberian polecats were randomized into six treatment groups. Recombinant canine distemper vaccine was administered s.c. at three dose levels (104.5, 105.0, and 105.5 plaque-forming units [PFU] per dose) and was administered orally by spraying the vaccine into the oropharnyx at two dose levels (105.5, 108.0 PFU per dose). The sixth group of control animals was not vaccinated. For both routes of administration, two 1-ml doses of reconstituted vaccine were delivered 4 wk apart, followed by live virus challenge 3 wk after the second vaccination. During the challenge, Synder Hill test strain CDV obtained from the National Veterinary Services Laboratory in Ames, Iowa, was administered i.p. Serial blood samples for CDV serology were collected immediately before vaccination and challenge, and 10, 15, and 20 days after challenge. Clinical signs and body weights were recorded up to 32 days after challenge. The survival rate in animals receiving vaccine at the highest oral dose (108.0 PFU per dose) was 83.3%. Survival rate was 50.0% in the high s.c. and 60.0% in the medium s.c. groups. All animals in the low–s.c. dose, low–oral dose, and control groups died after exposure. Vaccine dose overall (oral and s.c.) and dose in response to s.c. administration when considered alone were significant predictors of survival (P = 0.006 and P = 0.04, respectively). Among the polecats challenged with virulent virus, those that died became sick sooner than those that survived. Animals that died lost significantly more weight during the 10 days after challenge than did animals that survived (P = 0.02). Survival rates did not differ by sex, founder female status, or breeding pedigree in any of

Effects of body weight on antibody titers against canine parvovirus type 2, canine distemper virus, and canine adenovirus type 1 in vaccinated domestic adult dogs.

Science.gov (United States)

Taguchi, Masayuki; Namikawa, Kazuhiko; Maruo, Takuya; Saito, Miyoko; Lynch, Jonathan; Sahara, Hiroeki

2012-10-01

The objective of this study was to determine whether post-vaccination antibody titers vary according to body weight in adult dogs. Antibody titers against canine parvovirus type 2 (CPV-2), canine distemper virus (CDV), and canine adenovirus type 1 (CAdV-1) were measured for 978 domestic adult dogs from 2 to 6 y of age. The dogs had been vaccinated approximately 12 mo earlier with a commercial combination vaccine. The dogs were divided into groups according to their weight. It was found that mean antibody titers in all weight groups were sufficient to prevent infection. Intergroup comparison, however, revealed that CPV-2 antibody titers were significantly higher in the Super Light ( 20 kg) groups and were also significantly higher in the Light (5 to 9.9 kg) group than in the Heavy group. Antibody titers against CDV were significantly higher in the Super Light, Light, and Medium groups than in the Heavy group. There were no significant differences among the groups for the CAdV-1 antibody titers.

Serologic evaluation, efficacy, and safety of a commerical modified-live canine distemper vaccine in domestic ferrets.

Science.gov (United States)

Wimsatt, J; Jay, M T; Innes, K E; Jessen, M; Collins, J K

2001-05-01

To determine efficacy and safety of a commercial modified-live canine distemper virus (CDV) vaccine used for prophylaxis in domestic ferrets. Sixteen 16-week-old neutered male ferrets. Equal groups of ferrets were inoculated subcutaneously at 16 and 20 weeks of age with saline (0.9% NaCl) solution or a vaccine derived from the Onderstepoort CDV strain and attenuated in a primate cell line. Live virulent CDV was administered to all ferrets intranasally and orally 3 weeks after the second inoculation. Clinical signs and body weights were monitored regularly during the study. Blood samples for serologic examination were drawn prior to each inoculation, before challenge exposure, and 10, 15, and 21 days after exposure. Blood samples for reverse transcriptase polymerase chain reaction (RT-PCR) were obtained 5 days after the first vaccination, and 5, 10, 15, and 21 days after challenge exposure. After challenge exposure, control ferrets had significantly more clinical signs and weight loss, compared with vaccinates. All vaccinated ferrets survived, whereas all control ferrets died. The RT-PCR assay was successful in detecting CDV in blood and fresh or formalin-fixed tissues from infected ferrets. Findings suggest that the vaccine when given SC to domestic ferrets as directed is safe and protective against challenge exposure with virulent CDV. The RT-PCR assay may simplify detection of CDV in fresh and fixed tissues.

Adjuvant effects of recombinant giant panda (Ailuropoda melanoleuca) IL-18 on the canine distemper disease vaccine in mice.

Science.gov (United States)

Yan, Yue; Niu, Lili; Deng, Jiabo; Wang, Qiang; Yu, Jianqiu; Zhang, Yizheng; Wang, Jianxi; Chen, Jiao; Wei, Changhe; Tan, Xuemei

2015-02-01

Canine distemper virus (CDV) is a morbillivirus known to cause morbidity and mortality in a broad range of animals. Giant pandas (Ailuropoda melanoleuca), especially captive ones, are susceptible to natural infection with CDV. Interleukin-18 (IL-18) is a powerful adjuvant molecule that can enhance the development of antigen-specific immunity and vaccine efficacy. In this study, a giant panda IL-18 gene eukaryotic expression plasmid (pcAmIL-18) was constructed. Female BALB/c mice were muscularly inoculated with the plasmids pcAmIL-18, pcDNA3.1 and PBS, respectively. They were subsequently injected with an attenuated CDV vaccine for dogs, and the induced humoral and cellular responses were evaluated. The results showed that pcAmIL-18 remarkably improved the level of specific antibody, IFN-γ and IL-2 in mice sera, the T lymphocyte proliferation index and the percentage of CD4(+) and CD8(+) cells. These data indicated that pcAmIL-18 is a potential adjuvant that promotes specific immunity.

Frequency of Virus Coinfection in Raccoons ( Procyon lotor) and Striped Skunks ( Mephitis mephitis) During a Concurrent Rabies and Canine Distemper Outbreak.

Science.gov (United States)

Jardine, Claire M; Buchanan, Tore; Ojkic, Davor; Campbell, G Douglas; Bowman, Jeff

2018-03-08

Rabies and canine distemper virus infections in wildlife share similar presenting signs. Canine distemper virus was detected using real-time PCR of conjunctival swabs in rabies positive raccoons (22/32) and skunks (7/34) during a concurrent rabies and canine distemper outbreak in Ontario, Canada in 2015-2016. Coinfections with both viruses should be considered, particularly in distemper endemic areas that are at risk of rabies incursion.

Evaluation of a Community's Risk for Canine Parvovirus and Distemper Using Antibody Testing and GIS Mapping of Animal Shelter Intakes.

Science.gov (United States)

Spindel, Miranda E; Krecic, Matthew R; Slater, Margaret R; Vigil, Nicole

2018-03-20

This cross-sectional study aimed to identify where dogs with negative antibody tests to canine parvovirus (CPV) and canine distemper virus (CDV) originated when entering a community shelter, using a commercially available ELISA antibody test and Geographic Information Systems mapping. Of 2745 canines entering during a three-month period, 1056 test results were obtained. Dogs or puppies weighing over 2 lb were eligible if they could be humanely, nonchemically restrained for phlebotomy. Age and minor health issues weren't exclusions. Dogs were excluded if trained personnel were concerned health would be compromised by phlebotomy. Blood samples were collected within 24 hours of entry. Four hundred and twenty-seven (40%) dogs had positive antibody test results for both viruses, 422 (40%) were positive for CPV, 37 (4%) were positive for CDV, and 170 (16%) were negative for both. Mapping revealed geographic patterns for dogs with negative antibody tests. This shelter admitted dogs with negative CPV and/or CDV antibody tests from defined community areas. Targeting vaccination efforts in communities to areas where dogs with negative antibody tests originate could be an effective wellness strategy.

Climate extremes promote fatal co-infections during canine distemper epidemics in African lions.

Science.gov (United States)

Munson, Linda; Terio, Karen A; Kock, Richard; Mlengeya, Titus; Roelke, Melody E; Dubovi, Edward; Summers, Brian; Sinclair, Anthony R E; Packer, Craig

2008-06-25

Extreme climatic conditions may alter historic host-pathogen relationships and synchronize the temporal and spatial convergence of multiple infectious agents, triggering epidemics with far greater mortality than those due to single pathogens. Here we present the first data to clearly illustrate how climate extremes can promote a complex interplay between epidemic and endemic pathogens that are normally tolerated in isolation, but with co-infection, result in catastrophic mortality. A 1994 canine distemper virus (CDV) epidemic in Serengeti lions (Panthera leo) coincided with the death of a third of the population, and a second high-mortality CDV epidemic struck the nearby Ngorongoro Crater lion population in 2001. The extent of adult mortalities was unusual for CDV and prompted an investigation into contributing factors. Serological analyses indicated that at least five "silent" CDV epidemics swept through the same two lion populations between 1976 and 2006 without clinical signs or measurable mortality, indicating that CDV was not necessarily fatal. Clinical and pathology findings suggested that hemoparsitism was a major contributing factor during fatal epidemics. Using quantitative real-time PCR, we measured the magnitude of hemoparasite infections in these populations over 22 years and demonstrated significantly higher levels of Babesia during the 1994 and 2001 epidemics. Babesia levels correlated with mortalities and extent of CDV exposure within prides. The common event preceding the two high mortality CDV outbreaks was extreme drought conditions with wide-spread herbivore die-offs, most notably of Cape buffalo (Syncerus caffer). As a consequence of high tick numbers after the resumption of rains and heavy tick infestations of starving buffalo, the lions were infected by unusually high numbers of Babesia, infections that were magnified by the immunosuppressive effects of coincident CDV, leading to unprecedented mortality. Such mass mortality events may become

Climate extremes promote fatal co-infections during canine distemper epidemics in African lions.

Directory of Open Access Journals (Sweden)

Linda Munson

Full Text Available Extreme climatic conditions may alter historic host-pathogen relationships and synchronize the temporal and spatial convergence of multiple infectious agents, triggering epidemics with far greater mortality than those due to single pathogens. Here we present the first data to clearly illustrate how climate extremes can promote a complex interplay between epidemic and endemic pathogens that are normally tolerated in isolation, but with co-infection, result in catastrophic mortality. A 1994 canine distemper virus (CDV epidemic in Serengeti lions (Panthera leo coincided with the death of a third of the population, and a second high-mortality CDV epidemic struck the nearby Ngorongoro Crater lion population in 2001. The extent of adult mortalities was unusual for CDV and prompted an investigation into contributing factors. Serological analyses indicated that at least five "silent" CDV epidemics swept through the same two lion populations between 1976 and 2006 without clinical signs or measurable mortality, indicating that CDV was not necessarily fatal. Clinical and pathology findings suggested that hemoparsitism was a major contributing factor during fatal epidemics. Using quantitative real-time PCR, we measured the magnitude of hemoparasite infections in these populations over 22 years and demonstrated significantly higher levels of Babesia during the 1994 and 2001 epidemics. Babesia levels correlated with mortalities and extent of CDV exposure within prides. The common event preceding the two high mortality CDV outbreaks was extreme drought conditions with wide-spread herbivore die-offs, most notably of Cape buffalo (Syncerus caffer. As a consequence of high tick numbers after the resumption of rains and heavy tick infestations of starving buffalo, the lions were infected by unusually high numbers of Babesia, infections that were magnified by the immunosuppressive effects of coincident CDV, leading to unprecedented mortality. Such mass mortality

Climate Extremes Promote Fatal Co-Infections during Canine Distemper Epidemics in African Lions

Science.gov (United States)

Munson, Linda; Terio, Karen A.; Kock, Richard; Mlengeya, Titus; Roelke, Melody E.; Dubovi, Edward; Summers, Brian; Sinclair, Anthony R. E.; Packer, Craig

2008-01-01

Extreme climatic conditions may alter historic host-pathogen relationships and synchronize the temporal and spatial convergence of multiple infectious agents, triggering epidemics with far greater mortality than those due to single pathogens. Here we present the first data to clearly illustrate how climate extremes can promote a complex interplay between epidemic and endemic pathogens that are normally tolerated in isolation, but with co-infection, result in catastrophic mortality. A 1994 canine distemper virus (CDV) epidemic in Serengeti lions (Panthera leo) coincided with the death of a third of the population, and a second high-mortality CDV epidemic struck the nearby Ngorongoro Crater lion population in 2001. The extent of adult mortalities was unusual for CDV and prompted an investigation into contributing factors. Serological analyses indicated that at least five “silent” CDV epidemics swept through the same two lion populations between 1976 and 2006 without clinical signs or measurable mortality, indicating that CDV was not necessarily fatal. Clinical and pathology findings suggested that hemoparsitism was a major contributing factor during fatal epidemics. Using quantitative real-time PCR, we measured the magnitude of hemoparasite infections in these populations over 22 years and demonstrated significantly higher levels of Babesia during the 1994 and 2001 epidemics. Babesia levels correlated with mortalities and extent of CDV exposure within prides. The common event preceding the two high mortality CDV outbreaks was extreme drought conditions with wide-spread herbivore die-offs, most notably of Cape buffalo (Syncerus caffer). As a consequence of high tick numbers after the resumption of rains and heavy tick infestations of starving buffalo, the lions were infected by unusually high numbers of Babesia, infections that were magnified by the immunosuppressive effects of coincident CDV, leading to unprecedented mortality. Such mass mortality events may

Phocine distemper Virus: Current knowledge and future directions

NARCIS (Netherlands)

P. Duignan; M.-F. Van Bressem (Marie-Françoise); J.D. Baker (Jason); M. Barbieri (Michelle); K.M. Colegrove (Kathleen M); S. De Guise (Sylvain); R.L. de Swart (Rik); G. di Guardo (Giovanni); A.P. Dobson (Andrew); W.P. Duprex (Paul); G. Early (Greg); D. Fauquier (Deborah); T. Goldstein (Tracey); S.J. Goodman (Simon J.); B.T. Grenfell (Bryan); K.R. Groch (Kátia R.); F. Gulland (Frances); A. Hall (Ailsa); B.A. Jensen (Brenda A.); K. Lamy (Karina); K. Matassa (Keith); S. Mazzariol (Sandro); S.E. Morris (Sinead E.); O. Nielsen (Ole); D. Rotstein (David); T.K. Rowles (Teresa K); J. Saliki (Jeremy); U. Siebert (Ursula); T. Waltzek (Thomas); J.F.X. Wellehan (James F. X.)

2014-01-01

textabstractPhocine distemper virus (PDV) was first recognized in 1988 following a massive epidemic in harbor and grey seals in north-western Europe. Since then, the epidemiology of infection in North Atlantic and Arctic pinnipeds has been investigated. In the western North Atlantic endemic

Serosurvey for canine distemper virus exposure in dogs in communal lands in Zimbabwe

Directory of Open Access Journals (Sweden)

P.J. Kelly

2005-06-01

Full Text Available Sera from 173 apparently healthy, unvaccinated dogs from 4 widely separated communal lands in Zimbabwe were tested by ELISA for antibodies against canine distemper virus. Overall, 82 % were positive with high prevalences found in each communal land. The highest seroprevalence was in dogs between 1 and 2 years of age (91 %; 49/54. These results show dogs in the communal lands of Zimbabwe are commonly exposed to canine distemper virus and that a substantial number survive infection. The role that the virus might play in the high mortality rate of the dog population on communal land warrants further investigation.

Antibody study in canine distemper virus nucleocapsid protein gene-immunized mice.

Science.gov (United States)

Yuan, B; Li, X Y; Zhu, T; Yuan, L; Hu, J P; Chen, J; Gao, W; Ren, W Z

2015-04-10

The gene for the nucleocapsid (N) protein of canine distemper virus was cloned into the pMD-18T vector, and positive recombinant plasmids were obtained by enzyme digestion and sequencing. After digestion by both EcoRI and KpnI, the plasmid was directionally cloned into the eukaryotic expression vector pcDNA; the positive clone pcDNA-N was screened by electrophoresis and then transfected into COS-7 cells. Immunofluorescence analysis results showed that the canine distemper virus N protein was expressed in the cytoplasm of transfected COS-7 cells. After emulsification in Freund's adjuvant, the recombinant plasmid pcDNA-N was injected into the abdominal cavity of 8-week-old BABL/c mice, with the pcDNA original vector used as a negative control. Mice were immunized 3 times every 2 weeks. The blood of immunized mice was drawn 2 weeks after completing the immunizations to measure titer levels. The antibody titer in the pcDNA-N test was 10(1.62 ± 0.164), while in the control group this value was 10(0.52 ± 0.56), indicating that specific humoral immunity was induced in canine distemper virus nucleocapsid protein-immunized mice.

Molecular analysis of the N gene of canine distemper virus in dogs in Brazil

Directory of Open Access Journals (Sweden)

J.G. Castilho

2007-06-01

Full Text Available Eleven central-nervous-system samples collected from stray dogs between 2000 and 2004 were found positive by RT-PCR, which amplified a 480bp fragment of the N gene of canine distemper virus (CDV. Phylogenetic analysis based on partial N-gene sequences showed four major clusters. All dog strains segregated into cluster I, with a mean nucleotide identity of 95.8% and 95.6% with the Onderstepoort and Lederle vaccine strains, respectively. Cluster II contained all the raccoon-related strains, cluster III Orient strains and Cluster IV the Onderstepoort and Lederle vaccine strains, with a mean nucleotide identity of 99.7% between them. This is the first report of phylogenetic analysis of CDV strains in Brazil.Onze amostras de sistema nervoso central de cães coletados entre 2000 e 2004 foram positivas pela RT-PCR, a qual amplificou um fragmento de 480pb do gene N do vírus da cinomose canina (VCC. A análise filogenética baseada na seqüência parcial do gene N mostrou quatro principais agrupamentos genéticos. Todas as amostras de cães segregaram no agrupamento I, com identidade média de nucleotídeos de 95,8% e 95,6% com as amostras vacinais Onderstepoort e Lederle, respectivamente. O agrupamento II agregou todas as amostras relacionadas aos guaxinins. O agrupamento III agregou amostras orientais e o agrupamento IV agregou as amostras vacinais Onderstepoort e Lederle, com identidade média de nucleotídeos de 99,7% entre elas. Este é o primeiro relato de análise filogenética de amostras de VCC no Brasil.

Canine distemper virus detection in asymptomatic and non vaccinated dogs

Directory of Open Access Journals (Sweden)

Helen L. Del Puerto

2010-02-01

Full Text Available A quantitative real time polymerase chain reaction (PCR revealed canine distemper virus presence in peripheral blood samples from asymptomatic and non vaccinated dogs. Samples from eleven domestic dogs with no signs of canine distemper and not vaccinated at the month of collection were used. Canine distemper virus vaccine samples in VERO cells were used as positive controls. RNA was isolated with Trizol®, and treated with a TURBO DNA-free kit. Primers were designed for canine distemper virus nucleocapsid protein coding region fragment amplification (84 bp. Canine b-actin (93 bp was utilized as the endogenous control for normalization. Quantitative results of real time PCR generated by ABI Prism 7000 SDS Software showed that 54.5% of dogs with asymptomatic canine distemper were positive for canine distemper virus. Dissociation curves confirmed the specificity of the real time PCR fragments. This technique could detect even a few copies of viral RNA and identificate subclinically infected dogs providing accurate diagnosis of this disease at an early stage.A reação em cadeia da polimerase (PCR em tempo real revelou a presença do vírus da cinomose canina em amostra de sangue de cães assintomáticos e não vacinados. Amostra de onze cães domésticos sem nenhum sinal clínico de cinomose e que não foram vacinados no mês da coleta de sangue foram utilizados para análise. Amostra vacinal do vírus da cinomose canina em células VERO foi utilizada como controle positivo. O RNA total foi isolado utilizando-se Trizol®, e tratadas com o Kit TURBO DNA-free. Os iniciadores foram desenhados para amplificar a região do nucleocapsídeo viral com 319pb e 84pb para a PCR convencional e PCR em tempo real, respectivamente. O fragmento alvo da b-actina canina com 93pb foi utilizado como controle endógeno e normalizador. Resultados quantitativos da PCR em tempo real gerados pelo programa ABI Prism 7000 SDS demonstraram que 54,5% dos cães assintom

Development of a novel real-time qPCR assay for the dual detection of canine and phocine distemper virus

DEFF Research Database (Denmark)

Nielsen, Linette Buxbom; Hjulsager, Charlotte Kristiane; Larsen, Helene

conventional PCR assays with real-time PCR assays to obtain a uniform assay palette. The present work describes the development of a novel real-time RT-qPCR assay for the dual detection of canine and phocine distemper virus. The assay is relevant for the future detection of outbreaks of canine distemper virus...... in e.g. in farmed mink and wildlife and phocine distemper in seals. A set of primers and dual labelled probe was designed based on an alignment of distemper sequences in GenBank from various species and in-house sequences from recent outbreaks in Danish farmed mink. The assay amplifies a segment of 151...... bp in the Phosphoprotein (P) gene of the distemper virus genome. The dynamic range and PCR efficiency (E) was experimentally determined using 10-fold dilutions of a specially designed distemper DNA-oligo in addition to extracted RNA from clinical samples. E of the real-time assay was shown to range...

Canine distemper virus detection by different methods of One-Step RT-qPCR

Directory of Open Access Journals (Sweden)

Claudia de Camargo Tozato

2016-01-01

Full Text Available ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A and a One-Step RT-qPCR combined with NESTED-qPCR (system B. Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100% urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology.

Lesões histológicas no sistema nervoso central de cães com encefalite e diagnóstico molecular da infecção pelo vírus da cinomose canina Histopathological lesions in the central nervous system of dogs with encephalitis and molecular diagnosis of canine distemper virus infection

Directory of Open Access Journals (Sweden)

C.M.S. Gebara

2004-04-01

Full Text Available Dez amostras de urina de cães que apresentavam sinais clínicos sistêmicos e neurológicos indicativos da infecção pelo vírus da cinomose canina (CDV foram analisadas pela técnica da reação em cadeia pela polimerase precedida de transcrição reversa (RT-PCR para a detecção do RNA do CDV. O exame histopatológico foi realizado em fragmentos de cérebro, cerebelo e bexiga. Como controle negativo foram colhidos fragmentos de órgãos e urina de quatro cães sem sinais clínicos de doença infecciosa e que morreram por outras causas. Todos os cães (9/10 positivos em RT-PCR apresentaram alterações histológicas no cérebro e cerebelo, características de encefalite aguda (5/9 ou crônica (4/9 compatíveis com as causadas pelo CDV. Um dos cães com alterações clínicas neurológicas semelhantes às observadas em cinomose foi negativo na RT-PCR e apresentou alterações histopatológicas inespecíficas. Nas amostras de bexiga não foram observadas lesões histológicas. Todas as amostras biológicas provenientes dos cães-controle foram negativas na RT-PCR (urina e não apresentaram alterações histológicas (fragmentos de órgãos. O trabalho evidenciou a especificidade da RT-PCR no diagnóstico precoce e ante mortem na infecção pelo CDV.The reverse transcription-polymerase chain reaction (RT-PCR was used to detect canine distemper virus (CDV RNA in 10 urine samples from dogs that had died with clinical systemic and neurological signs indicative of CDV infection. Brain, cerebellum and urinary bladder fragments were collected for histopathological examination. For the negative control, urine and organ fragments were collected at necropsy from four dogs without clinical symptoms of infectious diseases that had died from other causes. The dogs positives in RT-PCR (9/10 presented histological lesions in the brain and cerebellum characteristic of acute (5/9 or chronic (4/9 encephalitis compatible with those caused by CDV. One of the dogs

Rabies, canine distemper, and canine parvovirus exposure in large carnivore communities from two Zambian ecosystems.

Science.gov (United States)

Berentsen, Are R; Dunbar, Mike R; Becker, Matthew S; M'soka, Jassiel; Droge, Egil; Sakuya, Nicholas M; Matandiko, Wigganson; McRobb, Rachel; Hanlon, Cathleen A

2013-09-01

Disease transmission within and among wild and domestic carnivores can have significant impacts on populations, particularly for threatened and endangered species. We used serology to evaluate potential exposure to rabies virus, canine distemper virus (CDV), and canine parvovirus (CPV) for populations of African lions (Panthera leo), African wild dogs (Lycaon pictus), and spotted hyenas (Crocuta crocuta) in Zambia's South Luangwa National Park (SLNP) and Liuwa Plain National Park (LPNP) as well as community lands bordering these areas. In addition, domestic dogs in the study region were evaluated for exposure to CDV and rabies. We provide the first comprehensive disease exposure data for these species in these ecosystems. Twenty-one lions, 20 hyenas, 13 wild dogs, and 38 domestic dogs were sampled across both regions from 2009 to 2011. Laboratory results show 10.5% of domestic dogs, 5.0% of hyenas, and 7.7% of wild dogs sampled were positive for CDV exposure. All lions were negative. Exposure to CPV was 10.0% and 4.8% for hyenas and lions, respectively. All wild dogs were negative, and domestic dogs were not tested due to insufficient serum samples. All species sampled were negative for rabies virus neutralizing antibodies except lions. Forty percent of lions tested positive for rabies virus neutralizing antibodies. Because these lions appeared clinically healthy, this finding is consistent with seroconversion following exposure to rabies antigen. To our knowledge, this finding represents the first ever documentation of rabies virus neutralizing antibodies consistent with rabies exposure that did not lead to clinical disease in free-ranging African lions from this region. With ever-increasing human pressure on these ecosystems, understanding disease transmission dynamics is essential for proper management and conservation of these carnivore species.

Fatal vaccine-induced canine distemper virus infection in black-footed ferrets

Science.gov (United States)

Carpenter, J.W.; Appel, M.J.G.; Erickson, R.C.; Novilla, M.N.

1976-01-01

Four black-footed ferrets that were live-trapped in South Dakota and transported to the Patuxent Wildlife Research Center died within 21 days after vaccination with modified live canine distemper virus. Immunofluorescence, European ferret inoculation, virus isolation attempts, and serum-neutralization tests indicated insufficient attenuation of the vaccine for this species.

Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

NARCIS (Netherlands)

I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

1993-01-01

textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

Genetic diversity and phylogenetic analysis of the attachment glycoprotein of phocine distemper viruses of the 2002 and 1988 epizootics

DEFF Research Database (Denmark)

Nielsen, L; Arctander, P; Jensen, T H

2009-01-01

To investigate the possible origin and spread of the dramatic re-emergent 2002 distemper epizootic observed among seals in Danish Waters, we have sequenced wild-type genes of the attachment (H) glycoproteins of viruses from both the 2002 and 1988 epizootics. Phylogenetic analysis of the H genes...... of phocine distemper virus (PDV) together with other morbilliviruses, suggests that the re-emergent 2002 PDV is more closely related to a putative recent ancestral PDV than the 1988 PDV isolates. Moreover, upsurges of distemper disease in land-living carnivores linked in time and locality to the 2002 seal...... epizootic in Danish Waters was investigated and determined to be caused by canine distemper virus, the closest relative of PDV, revealing no direct epidemiological link to the seal epizootics. (C) 2009 Elsevier B.V. All rights reserved....

Duration of immunity in red wolves (Canis rufus) following vaccination with a modified live parvovirus and canine distemper vaccine.

Science.gov (United States)

Anderson, Kadie; Case, Allison; Woodie, Kathleen; Waddell, William; Reed, Holly H

2014-09-01

There is growing information available regarding duration of immunity for core vaccines in both domestic and nondomestic species. Vaccination protocols in nondomestic canids have frequently followed guidelines developed for the domestic dog; however, these protocols can be inappropriate for nondomestic canids such as the African wild dog (Lycaon pictus), leaving some animals susceptible to infectious disease and others at risk for contracting vaccine-induced disease. In this study, red wolves (Canis rufus) were vaccinated against canine distemper virus (CDV) and canine parvovirus (CPV) and vaccination titers were followed annually for 3 yr. One hundred percent of wolves developed and maintained a positive titer to CDV for 3 yr and 96.9% of wolves developed and maintained a positive titer to CPV for 3 yr. Seroconversion for canine adenovirus was sporadic. The results of this study support decreasing the frequency of vaccine administration in the red wolf population to a triennial basis.

Immunohistochemical and transcriptome analyses indicate complex breakdown of axonal transport mechanisms in canine distemper leukoencephalitis.

Science.gov (United States)

Spitzbarth, Ingo; Lempp, Charlotte; Kegler, Kristel; Ulrich, Reiner; Kalkuhl, Arno; Deschl, Ulrich; Baumgärtner, Wolfgang; Seehusen, Frauke

2016-07-01

CDV-DL (Canine distemper virus-induced demyelinating leukoencephalitis) represents a spontaneously occurring animal model for demyelinating disorders. Axonopathy represents a key pathomechanism in this disease; however, its underlying pathogenesis has not been addressed in detail so far. This study aimed at the characterization of axonal cytoskeletal, transport, and potential regenerative changes with a parallel focus upon Schwann cell remyelination. Immunohistochemistry of canine cerebellar tissue as well as a comparative analysis of genes from an independent microarray study were performed. Increased axonal immunoreactivity for nonphosphorylated neurofilament was followed by loss of cytoskeletal and motor proteins. Interestingly, a subset of genes encoding for neurofilament subunits and motor proteins was up-regulated in the chronic stage compared to dogs with subacute CDV-DL. However, immunohistochemically, hints for axonal regeneration were restricted to up-regulated axonal positivity of hypoxia-inducible factor 1 alpha, while growth-associated protein 43, erythropoietin and its receptor were not or even down-regulated. Periaxin-positive structures, indicative of Schwann cell remyelination, were only detected within few advanced lesions. The present findings demonstrate a complex sequence of axonal cytoskeletal breakdown mechanisms. Moreover, though sparse, this is the first report of Schwann cell remyelination in CDV-DL. Facilitation of these very limited endogenous regenerative responses represents an important topic for future research.

The Asia 2 specific signal peptide region and other domains in fusion protein genes characterized Asia 1 and Asia 2 canine distemper viruses

Science.gov (United States)

Sultan, Serageldeen; Charoenvisal, Nataya; Lan, Nguyen Thi; Yamaguchi, Ryoji; Maeda, Ken; Kai, Kazushige

2009-01-01

Background Although the presence of Asia 2 group of canine distemper virus (CDV) was known by the sequencing and phylogenetic analysis of hemagglutinin (H) gene, the fusion (F) protein gene sequence of Asia 2 group had not been identified. So, the sequence analysis of F gene was carried out to elucidate the genotypic varaitons among Asian isolates. Results The phylogenetic analysis of F and H gene sequences from fourteen CDV isolates obtained from diseased dogs in Japan and Thailand indicated that the F genes had a new initiation codon and extra 27 nucleotides upstream of the usual open reading frame (ORF) and the F proteins had extra 9 amino acids at the N-terminal position only in Asia 2 isolates. On the contrary, the Asia 1 isolates had three extra putative N-glycosylation sites (two sites in the signal peptide region and one site in the F1 region) except for two strains of Th12 and Ac96I (two sites in signal peptide region) adding to four putative N-glycosylation sites that were conserved among all Asian isolates and Onderstepoort strain. In addition to this difference in N-glycosylation sites, the signal peptide region had a great diversity between Asia 1 and Asia 2 isolates. Also, characteristic amino acids were detected for some strains. Conclusion Asia 2 isolates were distinguished from other CDV lineages by the extra 27 nucleotide sequence. The signal peptide region of F gene gives a remarkable differentiation between Asia 1 and Asia 2 isolates. Strains Th12 and Ac96I were differentiated from other Asia 1 strains by the F protein glycosylation sites. PMID:19807927

Detecção do gene da nucleoproteína do vírus da cinomose canina por RT-PCR em urina de cães com sinais clínicos de cinomose Detection of canine distemper virus nucleoprotein gene by RT-PCR in urine of dogs with distemper clinical signs

Directory of Open Access Journals (Sweden)

C.M.S. Gebara

2004-08-01

Full Text Available A presença do vírus da cinomose canina (CDV foi avaliada pela reação em cadeia da polimerase, precedida de transcrição reversa (RT-PCR, em 87 amostras de urina de cães que apresentavam sinais clínicos sugestivos de cinomose. Os animais foram distribuídos em três grupos. No grupo A foram incluídos 41 cães com alterações sistêmicas; no grupo B, 37 cães com alterações neurológicas; e no grupo C, nove cães com alterações sistêmicas e neurológicas simultâneas. O grupo D (controle foi composto por 20 cães assintomáticos. Os resultados da RT-PCR foram correlacionados com a forma clínica da infecção e com as alterações hematológicas encontradas. Foi possível a amplificação parcial do gene da nucleoproteína do CDV em 41 (47,1% das 87 amostras de urina provenientes de cães com sinais clínicos sugestivos de cinomose. Todas as amostras obtidas de animais assintomáticos foram negativas na RT-PCR. Amostras positivas foram encontradas nos três grupos de animais com sinais clínicos na proporção de 51,2% (24/41, 29% (11/37 e 100% (9/9 para os grupos A, B e C, respectivamente. A leucocitose foi a alteração hematológica mais freqüente nos três grupos de cães com sinais clínicos porém, não foi possível estabelecer correlação entre o resultado da RT-PCR e as alterações hematológicas. Os resultados demonstraram que, independente da forma de apresentação clínica, a técnica da RT-PCR realizada em urina pode ser utilizada no diagnóstico ante mortem da infecção pelo CDV.The urine of 87 dogs with clinical signs suggestive of canine distemper was analyzed by RT-PCR for detection of canine distemper virus (CDV nucleoprotein gene. The samples were allotted to the following groups: group A- with 41 dogs with systemic symptoms, group B- with 37 dogs with neurological signs, and group C- with 9 dogs with simultaneous systemic and neurological clinical signs. Group D (control included 20 assymptomatic dogs. A chi2

Epidemiology of canine distemper and canine parvovirus in domestic dogs in urban and rural areas of the Araucanía region in Chile.

Science.gov (United States)

Acosta-Jamett, G; Surot, D; Cortés, M; Marambio, V; Valenzuela, C; Vallverdu, A; Ward, M P

2015-08-05

To assess whether the seroprevalence of canine distemper virus (CDV) and canine parvovirus (CPV) in domestic dogs is higher in urban versus rural areas of the Araucanía region in Chile and risk factors for exposure, a serosurvey and questionnaire survey at three, urban-rural paired sites was conducted from 2009 to 2012. Overall, 1161 households were interviewed of which 71% were located in urban areas. A total of 501 blood samples were analysed. The overall CDV and CPV seroprevalences were 61% (CI 90%: 58-70%) and 47% (CI 90%: 40-49%), and 89% (CI 90%: 85-92%) and 72% (CI 90%: 68-76%) in urban and rural areas, respectively. The higher seroprevalence in domestic dogs in urban areas suggests that urban domestic dogs might be a maintenance host for both CDV and CPV in this region. Due to the presence of endangered wild canids populations in areas close to these domestic populations, surveillance and control of these pathogens in urban dog populations is needed a priority. Copyright © 2015 Elsevier B.V. All rights reserved.

Vaccination against Canine Distemper Virus Infection in Infant Ferrets with and without Maternal Antibody Protection, Using Recombinant Attenuated Poxvirus Vaccines

Science.gov (United States)

Welter, Janet; Taylor, Jill; Tartaglia, James; Paoletti, Enzo; Stephensen, Charles B.

2000-01-01

Canine distemper virus (CDV) infection of ferrets is clinically and immunologically similar to measles, making this a useful model for the human disease. The model was used to determine if parenteral or mucosal immunization of infant ferrets at 3 and 6 weeks of age with attenuated vaccinia virus (NYVAC) or canarypox virus (ALVAC) vaccine strains expressing the CDV hemagglutinin (H) and fusion (F) protein genes (NYVAC-HF and ALVAC-HF) would induce serum neutralizing antibody and protect against challenge infection at 12 weeks of age. Ferrets without maternal antibody that were vaccinated parenterally with NYVAC-HF (n = 5) or ALVAC-HF (n = 4) developed significant neutralizing titers (log10 inverse mean titer ± standard deviation of 2.30 ± 0.12 and 2.20 ± 0.34, respectively) by the day of challenge, and all survived with no clinical or virologic evidence of infection. Ferrets without maternal antibody that were vaccinated intranasally (i.n.) developed lower neutralizing titers, with NYVAC-HF producing higher titers at challenge (1.11 ± 0.57 versus 0.40 ± 0.37, P = 0.02) and a better survival rate (6/7 versus 0/5, P = 0.008) than ALVAC-HF. Ferrets with maternal antibody that were vaccinated parenterally with NYVAC-HF (n = 7) and ALVAC-HF (n = 7) developed significantly higher antibody titers (1.64 ± 0.54 and 1.28 ± 0.40, respectively) than did ferrets immunized with an attenuated CDV vaccine (0.46 ± 0.59; n = 7) or the recombinant vectors expressing rabies glycoprotein (RG) (0.19 ± 0.32; n = 8, P = 7 × 10−6). The NYVAC vaccine also protected against weight loss, and both the NYVAC and attenuated CDV vaccines protected against the development of some clinical signs of infection, although survival in each of the three vaccine groups was low (one of seven) and not significantly different from the RG controls (none of eight). Combined i.n.-parenteral immunization of ferrets with maternal antibody using NYVAC-HF (n = 9) produced higher titers (1.63 ± 0

Vaccination against canine distemper virus infection in infant ferrets with and without maternal antibody protection, using recombinant attenuated poxvirus vaccines.

Science.gov (United States)

Welter, J; Taylor, J; Tartaglia, J; Paoletti, E; Stephensen, C B

2000-07-01

Canine distemper virus (CDV) infection of ferrets is clinically and immunologically similar to measles, making this a useful model for the human disease. The model was used to determine if parenteral or mucosal immunization of infant ferrets at 3 and 6 weeks of age with attenuated vaccinia virus (NYVAC) or canarypox virus (ALVAC) vaccine strains expressing the CDV hemagglutinin (H) and fusion (F) protein genes (NYVAC-HF and ALVAC-HF) would induce serum neutralizing antibody and protect against challenge infection at 12 weeks of age. Ferrets without maternal antibody that were vaccinated parenterally with NYVAC-HF (n = 5) or ALVAC-HF (n = 4) developed significant neutralizing titers (log(10) inverse mean titer +/- standard deviation of 2.30 +/- 0.12 and 2.20 +/- 0.34, respectively) by the day of challenge, and all survived with no clinical or virologic evidence of infection. Ferrets without maternal antibody that were vaccinated intranasally (i.n.) developed lower neutralizing titers, with NYVAC-HF producing higher titers at challenge (1.11 +/- 0.57 versus 0.40 +/- 0.37, P = 0.02) and a better survival rate (6/7 versus 0/5, P = 0.008) than ALVAC-HF. Ferrets with maternal antibody that were vaccinated parenterally with NYVAC-HF (n = 7) and ALVAC-HF (n = 7) developed significantly higher antibody titers (1.64 +/- 0. 54 and 1.28 +/- 0.40, respectively) than did ferrets immunized with an attenuated CDV vaccine (0.46 +/- 0.59; n = 7) or the recombinant vectors expressing rabies glycoprotein (RG) (0.19 +/- 0.32; n = 8, P = 7 x 10(-6)). The NYVAC vaccine also protected against weight loss, and both the NYVAC and attenuated CDV vaccines protected against the development of some clinical signs of infection, although survival in each of the three vaccine groups was low (one of seven) and not significantly different from the RG controls (none of eight). Combined i.n.-parenteral immunization of ferrets with maternal antibody using NYVAC-HF (n = 9) produced higher titers (1

[The prevention of distemper in zoo animals].

Science.gov (United States)

Franke, V; Matern, B; Ackermann, O; Danner, K

1989-02-01

The distemper virus infection of different non-domestic carnivorous zoo animals is known since long. All species involved belonged to the suborder Fissipedia. In 1988 a distemper or morbillivirus-like infection occurred in harbour seals, a member of the suborder pinnipedia. For the prophylaxis of distemper in dogs attenuated live vaccines are commonly used. In zoo animals, however, these vaccines caused distemper several times. In contrast, an inactivated virus vaccine proved both its safety and efficacy in more than hundred zoo animals of various species.

Distemper virus as a cause of central nervous disease and death in badgers (Meles meles) in Denmark

DEFF Research Database (Denmark)

Hammer, Anne Sofie; Dietz, H. H.; Andersen, T. H.

2004-01-01

During the summer of 2002 a distemper-like disease was observed in the free-ranging badger population in Denmark. It was characterised by grand seizures, abnormal behaviour and death; the badgers all had severe chronic pneumonia and some had non-suppurative encephalomyelitis. in this study, eight...... of the affected badgers were examined by gross pathological, histological, immunohistological, bacteriological, parasitological and virological methods, and were diagnosed with distemper; canine distemper virus was identified....

Measles vaccination of nonhuman primates provides partial protection against infection with canine distemper virus

NARCIS (Netherlands)

R.D. de Vries (Rory); M. Ludlow (Martin); R.J. Verbugh (Joyce); G. van Amerongen (Geert); S. Yüksel (Selma); D.T. Nguyen (Tien); S. McQuaid (Stephen); A.D.M.E. Osterhaus (Albert); W.P. Duprex (Paul); R.L. de Swart (Rik)

2014-01-01

textabstractMeasles virus (MV) is being considered for global eradication, which would likely reduce compliance with MV vaccination. As a result, children will grow up without MV-specific immunity, creating a potential niche for closely related animal morbilliviruses such as canine distemper virus

Increased reproductive output of Danish red fox females following an outbreak of canine distemper

DEFF Research Database (Denmark)

Pagh, Sussie; Chriél, Mariann; Madsen, Aksel Bo

2018-01-01

A decline in the Danish population of red foxes Vulpes vulpes due to an outbreak of canine distemper (CDV) in 2012 gave us the opportunity to test the hypothesis that the reproductive performance of foxes increases when the population density declines. The reproductive performance of 280 female...

Pesti Des Petits ruminants virus infection in animals

Directory of Open Access Journals (Sweden)

Chauhan H.C.

2009-08-01

Full Text Available For centuries morbillivirus infections have had a huge impact on both human beings and animals. Morbilliviruses are highly contagious pathogens that cause some of the most devastating viral diseases of humans and animals world wide. They include measles virus (MV, canine distemper virus (CDV, rinderpest virus (RPV and peste des petits ruminants (PPRV virus. Furthermore, new emerging infectious diseases of morbilliviruses with significant ecological consequences of marine mammals have been discovered in the past decades. Phocid distemper virus (PDV in seals and the cetacean morbillivirus (CMV have been found in dolphins, whales and porpoises. Peste des petits ruminants (PPR is a highly contagious ,infectious , an acute or sub acute viral disease of domestic and wild small ruminants characterized by fever, oculonasal discharges, stomatitis, conjunctivitis, gastroenteritis and pneumonia. Goats are more severely affected than sheep. It is also known as pseudorinderpest of small ruminants, pest of small ruminants, pest of sheep and goats, kata, stomatitis- pneumoentritis syndrome, contagious pustular stomatitis and pneumoentritis complex. It is one of the major notifiable diseases of the World Organization for Animal Health (OIE. [Vet. World 2009; 2(4.000: 150-155

SURVEILLANCE FOR ANTIBODIES AGAINST SIX CANINE VIRUSES IN WILD RACCOONS (PROCYON LOTOR) IN JAPAN.

Science.gov (United States)

Aoki, Emiko; Soma, Takehisa; Yokoyama, Mayumi; Matsubayashi, Makoto; Sasai, Kazumi

2017-10-01

Raccoons (Procyon lotor) are found worldwide. They are frequently seen in crowded inner cities as well as in forests or wooded areas, often living in proximity to humans and their pets. We examined sera from 100 wild raccoons in Japan for antibodies to six canine viruses with veterinary significance to assess their potential as reservoirs. We also aimed to understand the distribution of potentially infected wildlife. We found that 7% of samples were seropositive for canine distemper virus (CDV), 10% for canine parvovirus type 2, 2% for canine adenovirus type 1, 6% for canine adenovirus type 2, and 7% for canine coronavirus. No samples were found to be seropositive for canine parainfluenza virus. Seropositivity rates for canine distemper virus and canine parvovirus type 2 were significantly different between areas, and younger raccoons (Canis lupus familiaris), our results suggest that they can act as reservoirs for some of these important canine viruses and might be involved in viral transmission. Further study should include isolation and analysis of canine viruses in wild raccoons from a wider area.

Unusual Necrotizing Encephalitis in Raccoons and Skunks Concurrently Infected With Canine Distemper Virus and Sarcocystis sp.

Science.gov (United States)

Kubiski, S V; Sisó, S; Church, M E; Cartoceti, A N; Barr, B; Pesavento, P A

2016-05-01

Canine distemper virus commonly infects free-ranging, terrestrial mesopredators throughout the United States. Due to the immunosuppressive effects of the virus, concurrent opportunistic infections are also common. Among these, secondary systemic protozoal infections have been described in a number of species. We report an unusual presentation of necrotizing encephalitis associated withSarcocystissp in four raccoons and one skunk concurrently infected with canine distemper virus. Lesions were characterized by variably sized necrotizing cavitations composed of abundant mineral admixed with inflammatory cells and protozoa.Sarcocystissp was confirmed via immunohistochemistry using a monoclonal antibody toSarcocystis neurona The pathologic changes are similar to lesions in human AIDS patients infected withToxoplasma gondii. © The Author(s) 2015.

Anticorpos neutralizantes contra os vírus da cinomose e da parainfluenza em cães de canis dos municípios de Novo Hamburgo e Porto Alegre, RS, Brasil Neutralizing antibodies to distemper and parainfluenza viruses in dogs in shelter kennels in the municipalities of Novo Hamburgo and Porto Alegre, RS, Brazil

Directory of Open Access Journals (Sweden)

Tamahine Larronda Schmidt Hartmann

2007-08-01

Full Text Available No presente estudo, foi realizada uma pesquisa em busca de anticorpos neutralizantes contra os vírus da cinomose (CDV e da parainfluenza (CPIV caninos em amostras de soro de 173 cães recolhidos a canis municipais em Novo Hamburgo (n=82 e Porto Alegre (n=91, RS. A pesquisa de anticorpos neutralizantes foi realizada pela técnica de soroneutralização frente a duas amostras vacinais de CDV (Rockborn e Snyder Hill e frente a uma amostra de CPIV (V660. Em relação ao CDV, 95,9% das amostras de soros foram negativas para anticorpos neutralizantes contra a amostra Snyder Hill e 90,7% soronegativas para a amostra Rockborn. Entre os soropositivos (n=20; 11,6%, somente três deles apresentaram anticorpos neutralizantes frente às duas amostras de CDV testadas, indicando pouca reatividade cruzada entre as mesmas. Quanto ao CPIV, a prevalência de anticorpos neutralizantes encontrada frente à amostra V660 foi de 51,4%. Esses achados indicam que a maioria dos cães examinados não teve contato prévio com o CDV, seja por infecção natural ou por imunização prévia. O CPIV, porém, parece estar amplamente difundido na população canina examinada, provavelmente por exposição natural ao vírus.In this report a serological survey was carried out in search for antibodies to canine distemper virus (CDV and canine parainfluenza virus (CPIV in 173 sera from dogs withdraw in kennels of the municipalities of Novo Hamburgo (n=82 and Porto Alegre (n=91, RS, Brazil. Neutralizing antibodies were evaluated against two CDV strains used for vaccine production (Rockborn and Snyder Hill as well as one strain of CPIV (V660. Search for anti-CDV neutralizing antibodies revealed that 95.9% of sera were negative for antibodies to CDV Snyder Hill and 90.7% were negative for antibodies to CDV Rockborn. Among the positive sera (n=20; 11.6 % only three of those had neutralizing antibodies to both CDV strains, indicating a low degree of cross reactivity between those. As

In search of virus carriers of the 1988 and 2002 phocine distemper virus outbreaks in European harbour seals

NARCIS (Netherlands)

Kreutzer, M.; Kreutzer, R.; Siebert, U.; Muller, G.; Reijnders, P.J.H.; Brasseur, S.M.J.M.; Harkonen, T.; Dietz, R.; Sonne, C.; Born, E.W.; Baumgartner, W.

2008-01-01

European harbour seal (Phoca vitulina) populations decreased substantially during the phocine distemper virus (PDV) outbreaks of 1988 and 2002. Different hypotheses have stated that various seals and terrestrial carnivore species might be the source of infection. To further analyse these hypotheses,

Delineating morbillivirus entry, dissemination and airborne transmission by studying in vivo competition of multicolor canine distemper viruses in ferrets.

Directory of Open Access Journals (Sweden)

Rory D de Vries

2017-05-01

Full Text Available Identification of cellular receptors and characterization of viral tropism in animal models have vastly improved our understanding of morbillivirus pathogenesis. However, specific aspects of viral entry, dissemination and transmission remain difficult to recapitulate in animal models. Here, we used three virologically identical but phenotypically distinct recombinant (r canine distemper viruses (CDV expressing different fluorescent reporter proteins for in vivo competition and airborne transmission studies in ferrets (Mustela putorius furo. Six donor ferrets simultaneously received three rCDVs expressing green, red or blue fluorescent proteins via conjunctival (ocular, Oc, intra-nasal (IN or intra-tracheal (IT inoculation. Two days post-inoculation sentinel ferrets were placed in physically separated adjacent cages to assess airborne transmission. All donor ferrets developed lymphopenia, fever and lethargy, showed progressively increasing systemic viral loads and were euthanized 14 to 16 days post-inoculation. Systemic replication of virus inoculated via the Oc, IN and IT routes was detected in 2/6, 5/6 and 6/6 ferrets, respectively. In five donor ferrets the IT delivered virus dominated, although replication of two or three different viruses was detected in 5/6 animals. Single lymphocytes expressing multiple fluorescent proteins were abundant in peripheral blood and lymphoid tissues, demonstrating the occurrence of double and triple virus infections. Transmission occurred efficiently and all recipient ferrets showed evidence of infection between 18 and 22 days post-inoculation of the donor ferrets. In all cases, airborne transmission resulted in replication of a single-colored virus, which was the dominant virus in the donor ferret. This study demonstrates that morbilliviruses can use multiple entry routes in parallel, and co-infection of cells during viral dissemination in the host is common. Airborne transmission was efficient, although

Delineating morbillivirus entry, dissemination and airborne transmission by studying in vivo competition of multicolor canine distemper viruses in ferrets.

Science.gov (United States)

de Vries, Rory D; Ludlow, Martin; de Jong, Alwin; Rennick, Linda J; Verburgh, R Joyce; van Amerongen, Geert; van Riel, Debby; van Run, Peter R W A; Herfst, Sander; Kuiken, Thijs; Fouchier, Ron A M; Osterhaus, Albert D M E; de Swart, Rik L; Duprex, W Paul

2017-05-01

Identification of cellular receptors and characterization of viral tropism in animal models have vastly improved our understanding of morbillivirus pathogenesis. However, specific aspects of viral entry, dissemination and transmission remain difficult to recapitulate in animal models. Here, we used three virologically identical but phenotypically distinct recombinant (r) canine distemper viruses (CDV) expressing different fluorescent reporter proteins for in vivo competition and airborne transmission studies in ferrets (Mustela putorius furo). Six donor ferrets simultaneously received three rCDVs expressing green, red or blue fluorescent proteins via conjunctival (ocular, Oc), intra-nasal (IN) or intra-tracheal (IT) inoculation. Two days post-inoculation sentinel ferrets were placed in physically separated adjacent cages to assess airborne transmission. All donor ferrets developed lymphopenia, fever and lethargy, showed progressively increasing systemic viral loads and were euthanized 14 to 16 days post-inoculation. Systemic replication of virus inoculated via the Oc, IN and IT routes was detected in 2/6, 5/6 and 6/6 ferrets, respectively. In five donor ferrets the IT delivered virus dominated, although replication of two or three different viruses was detected in 5/6 animals. Single lymphocytes expressing multiple fluorescent proteins were abundant in peripheral blood and lymphoid tissues, demonstrating the occurrence of double and triple virus infections. Transmission occurred efficiently and all recipient ferrets showed evidence of infection between 18 and 22 days post-inoculation of the donor ferrets. In all cases, airborne transmission resulted in replication of a single-colored virus, which was the dominant virus in the donor ferret. This study demonstrates that morbilliviruses can use multiple entry routes in parallel, and co-infection of cells during viral dissemination in the host is common. Airborne transmission was efficient, although transmission of

Post-vaccinal distemper encephalitis in two Border Collie cross littermates.

Science.gov (United States)

Fairley, R A; Knesl, O; Pesavento, P A; Elias, B C

2015-03-01

One 4.5-month-old male Border Collie cross presented with aggression and seizures in October 2006. A 16-month-old, female, spayed Border Collie cross presented with hypersalivation and a dropped jaw and rapidly became stuporous in September 2007. The dogs were littermates and developed acute neurological signs 5 and 27 days, respectively, after vaccination with different modified live vaccines containing canine distemper virus. Sections of brain in both dogs showed evidence of encephalitis mainly centred on the grey matter of brainstem nuclei, where there was extensive and intense parenchymal and perivascular infiltration of histiocytes and lymphocytes. Intra-nuclear and intra-cytoplasmic inclusions typical of distemper were plentiful and there was abundant labelling for canine distemper virus using immunohistochemistry. Post-vaccinal canine distemper. Post-vaccinal canine distemper has mainly been attributed to virulent vaccine virus, but it may also occur in dogs whose immunologic nature makes them susceptible to disease induced by a modified-live vaccine virus that is safe and protective for most dogs.

Sequencing of emerging canine distemper virus strain reveals new distinct genetic lineage in the United States associated with disease in wildlife and domestic canine populations.

Science.gov (United States)

Riley, Matthew C; Wilkes, Rebecca P

2015-12-18

Recent outbreaks of canine distemper have prompted examination of strains from clinical samples submitted to the University of Tennessee College of Veterinary Medicine (UTCVM) Clinical Virology Lab. We previously described a new strain of CDV that significantly diverged from all genotypes reported to date including America 2, the genotype proposed to be the main lineage currently circulating in the US. The aim of this study was to determine when this new strain appeared and how widespread it is in animal populations, given that it has also been detected in fully vaccinated adult dogs. Additionally, we sequenced complete viral genomes to characterize the strain and determine if variation is confined to known variable regions of the genome or if the changes are also present in more conserved regions. Archived clinical samples were genotyped using real-time RT-PCR amplification and sequencing. The genomes of two unrelated viruses from a dog and fox each from a different state were sequenced and aligned with previously published genomes. Phylogenetic analysis was performed using coding, non-coding and genome-length sequences. Virus neutralization assays were used to evaluate potential antigenic differences between this strain and a vaccine strain and mixed ANOVA test was used to compare the titers. Genotyping revealed this strain first appeared in 2011 and was detected in dogs from multiple states in the Southeast region of the United States. It was the main strain detected among the clinical samples that were typed from 2011-2013, including wildlife submissions. Genome sequencing demonstrated that it is highly conserved within a new lineage and preliminary serologic testing showed significant differences in neutralizing antibody titers between this strain and the strain commonly used in vaccines. This new strain represents an emerging CDV in domestic dogs in the US, may be associated with a stable reservoir in the wildlife population, and could facilitate vaccine

Phocine Distemper Virus in Seals, East Coast, United States, 2006

Science.gov (United States)

Earle, J.A. Philip; Melia, Mary M.; Doherty, Nadine V.; Nielsen, Ole

2011-01-01

In 2006 and 2007, elevated numbers of deaths among seals, constituting an unusual mortality event, occurred off the coasts of Maine and Massachusetts, United States. We isolated a virus from seal tissue and confirmed it as phocine distemper virus (PDV). We compared the viral hemagglutinin, phosphoprotein, and fusion (F) and matrix (M) protein gene sequences with those of viruses from the 1988 and 2002 PDV epizootics. The virus showed highest similarity with a PDV 1988 Netherlands virus, which raises the possibility that the 2006 isolate from the United States might have emerged independently from 2002 PDVs and that multiple lineages of PDV might be circulating among enzootically infected North American seals. Evidence from comparison of sequences derived from different tissues suggested that mutations in the F and M genes occur in brain tissue that are not present in lung, liver, or blood, which suggests virus persistence in the central nervous system. PMID:21291591

Optic neuritis caused by canine distemper virus in a Jack Russell terrier

Science.gov (United States)

Richards, Tara R.; Whelan, Nick C.; Pinard, Chantale L.; Alcala, Fernanda Castillo; Wolfe, Katheryn C.

2011-01-01

An atypical case of canine distemper (CD) was diagnosed in a vaccinated healthy adult dog. The patient was presented circling, seizuring, and blind. Postmortem examination resulted in a diagnosis of CD. Optic neuritis was diagnosed, a finding not previously described in the context of CD virus infection presenting solely with neurological signs. PMID:21731093

The canine MHC class Ia allele DLA-88*508:01 presents diverse self- and canine distemper virus-origin peptides of varying length that have a conserved binding motif.

Science.gov (United States)

Ross, Peter; Nemec, Paige S; Kapatos, Alexander; Miller, Keith R; Holmes, Jennifer C; Suter, Steven E; Buntzman, Adam S; Soderblom, Erik J; Collins, Edward J; Hess, Paul R

2018-03-01

Ideally, CD8+ T-cell responses against virally infected or malignant cells are defined at the level of the specific peptide and restricting MHC class I element, a determination not yet made in the dog. To advance the discovery of canine CTL epitopes, we sought to determine whether a putative classical MHC class Ia gene, Dog Leukocyte Antigen (DLA)-88, presents peptides from a viral pathogen, canine distemper virus (CDV). To investigate this possibility, DLA-88*508:01, an allele prevalent in Golden Retrievers, was expressed as a FLAG-tagged construct in canine histiocytic cells to allow affinity purification of peptide-DLA-88 complexes and subsequent elution of bound peptides. Pattern analysis of self peptide sequences, which were determined by liquid chromatography-tandem mass spectrometry (LC-MS/MS), permitted binding preferences to be inferred. DLA-88*508:01 binds peptides that are 9-to-12 amino acids in length, with a modest preference for 9- and 11-mers. Hydrophobic residues are favored at positions 2 and 3, as are K, R or F residues at the C-terminus. Testing motif-matched and -unmatched synthetic peptides via peptide-MHC surface stabilization assay using a DLA-88*508:01-transfected, TAP-deficient RMA-S line supported these conclusions. With CDV infection, 22 viral peptides ranging from 9-to-12 residues in length were identified in DLA-88*508:01 eluates by LC-MS/MS. Combined motif analysis and surface stabilization assay data suggested that 11 of these 22 peptides, derived from CDV hemagglutinin, large polymerase, matrix, nucleocapsid, and V proteins, were processed and presented, and thus, potential targets of anti-viral CTL in DLA-88*508:01-bearing dogs. The presentation of diverse self and viral peptides indicates that DLA-88 is a classical MHC class Ia gene. Copyright © 2018 Elsevier B.V. All rights reserved.

[The growth of attenuated strains of canine parvovirus, mink enteritis virus, feline panleukopenia virus, and rabies virus on various types of cell cultures].

Science.gov (United States)

Zuffa, T

1987-10-01

The growth characteristics were studied in the attenuated strains of canine parvovirus CPVA-BN 80/82, mink enteritis virus MEVA-BN 63/82 and feline panleucopenia virus FPVA-BN 110/83 on the stable feline kidney cell line FE, and in the attenuated canine distemper virus CDV-F-BN 10/83 on chicken embryo cell cultures (KEB) and cultures of the stable cell line VERO. When the FE cultures were infected with different parvoviruses in cell suspension at MOI 2-4 TKID50 per cell, the first multiplication of the intracellular virus was recorded 20 hours p. i. In the canine parvovirus, the content of intracellular and extracellular virus continued increasing parallelly until the fourth day; then, from the fourth to the sixth day, the content of extracellular virus still increased whereas that of intracellular virus fell rapidly. In the case of the mink enteritis virus the release of the virus into the culture medium continued parallelly with the production of the cellular virus until the sixth day. In the case of the feline panleucopenia virus the values concerning free virus and virus bound to cells were lower, starting from the second day p. i. When KEB or VERO cultures were infected in cell suspension with the canine distemper virus at MOI about 0.004 per 1 cell, the replicated intracellular virus was first recorded in the KEB cultures five hours after infection but in the VERO cultures only 20 hours after infection, with a timely release of the virus into the culture medium in both kinds of tissue. In the KEB and VERO cultures the highest values of infection titres were recorded on the fourth day p. i., the course of virus multiplication on the cells being parallel with its release into the culture medium.

Analysis of infection epidemiological distemper virus, dogs in the municipality of Garanhuns, Pernambuco, Brazil

Directory of Open Access Journals (Sweden)

Érica Chaves Lúcio

2014-06-01

Full Text Available Distemper is caused by a Morbillivirus and has worldwide distribution, the dog being the major reservoir for this virus. Transmission occurs by aerosols and the virus can be excreted at the end of the acute phase. It is a disease with no predilection for race, age or sex; however the literature suggests that puppies are most affected. In this study were analyzed serum samples from pet dogs in the city districts and neighborhoods of Garanhuns Boa Vista, Cohab 1, Cohab 2, Magano and center during the period from August to December 2012. Samples were collected from dogs older than three months, not vaccinated against distemper. To produce the maps of geographical distribution of animals were collected coordinates for each home visit. Of the samples analyzed, 90.38% were positive, and 28.72% had high antibody concentration, 47.88% and 23.40% average concentration or low. By analyzing the distribution by districts observed a higher prevalence of infection in neighborhoods with Cohab 2 100.00% and Cohab 1 with 96.00%; Boa Vista with 93.10%; Magano with 78.26%; center with 50.00%. This study did not identify any variable associated with infection related to sex and 100.0% of the animals, including positive and negative, were not castrated. It was shown that 75.0% of the animals had never been taken to the veterinarian, and of these, 94.8% were positive, a fact that may be related to higher seropositivity in these animals. The results of this study show that the canine distemper virus is widespread in the canine population of Garanhuns, Pernambuco, highlights the importance of epidemiological studies to characterize the real situation of infection by this virus in canine populations, in order to reduce damage to animal health caused by this agent.

Phocine Distemper Virus in Northern Sea Otters in the Pacific Ocean, Alaska, USA

Science.gov (United States)

Mazet, Jonna A.K.; Gill, Verena A.; Doroff, Angela M.; Burek, Kathy A.; Hammond, John A.

2009-01-01

Phocine distemper virus (PDV) has caused 2 epidemics in harbor seals in the Atlantic Ocean but had never been identified in any Pacific Ocean species. We found that northern sea otters in Alaska are infected with PDV, which has created a disease threat to several sympatric and decreasing Pacific marine mammals. PMID:19523293

Evaluation of the efficacy and duration of immunity of a canine combination vaccine against virulent parvovirus, infectious canine hepatitis virus, and distemper virus experimental challenges.

Science.gov (United States)

Abdelmagid, Omar Y; Larson, Laurie; Payne, Laurie; Tubbs, Anna; Wasmoen, Terri; Schultz, Ronald

2004-01-01

The results of this study confirmed that dogs vaccinated subcutaneously with a commercially available multivalent vaccine containing modified-live canine distemper virus, canine adenovirus type 2, canine parvovirus type 2b, and canine parainfluenza virus antigens were protected against sequential experimental challenge 55 to 57 months after initial vaccination given at 7 to 8 weeks of age. All 10 vaccinates were protected against clinical diseases and mortality following parvovirus and infectious canine hepatitis experimental infections. All vaccinates were protected against mortality and 90% against clinical disease following distemper challenge. These data support at least a 4-year duration of immunity for these three "core" fractions in the combination vaccine.

Immunohistochemical detection of metalloproteinase-9 (MMP-9, anti-oxidant like 1 protein (AOP-1 and synaptosomal-associated protein (SNAP-25 in the cerebella of dogs naturally infected with spontaneous canine distemper

Directory of Open Access Journals (Sweden)

Tereza C. Cardoso

2011-04-01

Full Text Available In most viral infections of the central nervous system (CNS, the integrity of brain extracelluar matrix (ECM, oxidative stress and dysfunction in neuronal transmission may contribute to the observed pathology. The purpose of this study was to investigate the role of these factors in demyelinating canine distemper virus (CDV infections. Regardless of ECM integrity, the expression of metalloproteinase-9 (MMP-9 was visualized in microglial-like cells, whereas the expression of anti-oxidant like-1 (AOP-1 and synaptosomal associated protein (SNAP-25 was frequently detected in Purkinje cells (r² = 0.989; p < 0.05, regardless of whether the lesions were classified as acute or chronic. Increased numbers of immunolabeled microglia-like cells and reactive gliosis were observed in advanced cases of demyelinating CDV, suggesting that the expression of AOP-1 and SNAP-25 is correlated with the ultimate death of affected cells. Our findings bring a new perspective to understanding the role of the AOP-1, MMP-9 and SNAP-25 proteins in mediating chronic leukoencephalitis caused by CDV. (Folia Histochemica et Cytobiologica 2011; Vol. 49, No. 1, pp. 41–48