Autodissociation of a water molecule in liquid water

Energy Technology Data Exchange (ETDEWEB)

Geissler, Phillip L.; Dellago, Christoph; Chandler, David; Hutter, Jurg; Parrinello, Michele

2000-04-01

The dissociation of a water molecule in liquid water is the fundamental event in acid-base chemistry, determining the pH of water.Because the microscopic dynamics of this autodissociation are difficult to probe, both by experiment and by computer simulation, its mechanism has been unknown. Here we report several autodissociation trajectories generated by ab initio molecular dynamics [1]. These trajectories, which were harvested using transition path sampling [2-4], reveal the mechanism for the first time. Rare fluctuations in solvation energies destabilize an oxygen-hydrogen bond. Through the transfer of one or more protons along a hydrogen bond.

The role of water molecules in computational drug design.

Science.gov (United States)

de Beer, Stephanie B A; Vermeulen, Nico P E; Oostenbrink, Chris

2010-01-01

Although water molecules are small and only consist of two different atom types, they play various roles in cellular systems. This review discusses their influence on the binding process between biomacromolecular targets and small molecule ligands and how this influence can be modeled in computational drug design approaches. Both the structure and the thermodynamics of active site waters will be discussed as these influence the binding process significantly. Structurally conserved waters cannot always be determined experimentally and if observed, it is not clear if they will be replaced upon ligand binding, even if sufficient space is available. Methods to predict the presence of water in protein-ligand complexes will be reviewed. Subsequently, we will discuss methods to include water in computational drug research. Either as an additional factor in automated docking experiments, or explicitly in detailed molecular dynamics simulations, the effect of water on the quality of the simulations is significant, but not easily predicted. The most detailed calculations involve estimates of the free energy contribution of water molecules to protein-ligand complexes. These calculations are computationally demanding, but give insight in the versatility and importance of water in ligand binding.

Theoretical investigation of the ultrafast dissociation of core-ionized water and uracil molecules immersed in liquid water

Energy Technology Data Exchange (ETDEWEB)

Stia, C.R.; Fojon, O.A. [Instituto de Fisica Rosario - CONICET-Universidad Nacional de Rosario, Rosario (Argentina); Gaigeot, M.P. [Laboratoire Analyse et Modelisation pour la Biologie et l' Environnement, LAMBE, UMR-CNRS 8587, Universite d' Evry-Val-d' Essonne, 91 - Evry (France); Institut Universitaire de France, 75 - Paris (France); Vuilleumier, R. [Departement de chimie, Ecole Normale Superieure, 75 - Paris (France); Herve du Penhoat, M.A.; Politis, M.F. [Institut de Mineralogie et de Physique des Milieux Condenses, IMPMC, UMR-CNRS 7590, Universite Pierre et Marie Curie, 75 - Paris (France)

2010-10-15

We present a series of ab initio density functional based calculations of the fragmentation dynamics of core-ionized biomolecules. The computations are performed for pure liquid water, aqueous and isolated Uracil. Core ionization is described by replacing the 1s{sup 2} pseudopotential of one atom of the target molecule (C, N or O) with a pseudopotential for a 1s{sup 1} core-hole state. Our results predict that the dissociation of core-ionized water molecules may be reached during the lifetime of inner-shell vacancy (less than 10 fs), leading to OH bond breakage as a primary outcome. We also observe a second fragmentation channel in which total Coulomb explosion of the ionized water molecule occurs. Fragmentation pathways are found similar for pure water or when the water molecule is in the primary hydration shell of the uracil molecule. In the latter case, the proton may be transferred towards the uracil oxygen atoms. When the core hole is located on the uracil molecule, ultrafast dissociation is only observed in the aqueous environment and for nitrogen-K vacancies, resulting in proton transfers towards the hydrogen-bonded water molecule. (authors)

Quantum Behavior of Water Molecules Confined to Nanocavities in Gemstones.

Science.gov (United States)

Gorshunov, Boris P; Zhukova, Elena S; Torgashev, Victor I; Lebedev, Vladimir V; Shakurov, Gil'man S; Kremer, Reinhard K; Pestrjakov, Efim V; Thomas, Victor G; Fursenko, Dimitry A; Dressel, Martin

2013-06-20

When water is confined to nanocavities, its quantum mechanical behavior can be revealed by terahertz spectroscopy. We place H2O molecules in the nanopores of a beryl crystal lattice and observe a rich and highly anisotropic set of absorption lines in the terahertz spectral range. Two bands can be identified, which originate from translational and librational motions of the water molecule isolated within the cage; they correspond to the analogous broad bands in liquid water and ice. In the present case of well-defined and highly symmetric nanocavities, the observed fine structure can be explained by macroscopic tunneling of the H2O molecules within a six-fold potential caused by the interaction of the molecule with the cavity walls.

Studies on the retention mechanism of solutes in hydrophilic interaction chromatography using stoichiometric displacement theory I. The linear relationship of lgk' vs. lg[H2O].

Science.gov (United States)

Wang, Fei; Yang, Fan; Tian, Yang; Liu, Jiawei; Shen, Jiwei; Bai, Quan

2018-01-01

A stoichiometric displacement model for retention (SDM-R) of small solutes and proteins based on hydrophilic interaction chromatography (HILIC) was presented. A linear equation that related the logarithm of the capacity factor of the solute to the logarithm of the concentration of water in the mobile phase was derived. The stoichiometric displacement parameters, Z (the number of water molecules required to displace a solute from ligands) and lgI (containing a number of constants that relate to the affinity of solute to the ligands) could be obtained from the slope and the intercept of the linear plots of lgk' vs. lg[H 2 O]. The retention behaviors and retention mechanism of 15 kinds of small solutes and 6 kinds of proteins on 5 kinds HILIC columns with different ligands were investigated with SDM-R in typical range of water concentration in mobile phase. A good linear relationship between lgk' and lg[H 2 O] demonstrated that the most rational retention mechanism of solute in HILIC was a stoichiometric displacement process between solute and solvent molecules with water as displacing agents, which was not only valid for small solutes, but also could be used to explain the retention mechanism of biopolymers in HILIC. Comparing with the partition and adsorption models in HILIC, SDM-R was superior to them. Copyright © 2017 Elsevier B.V. All rights reserved.

Density, distribution, and orientation of water molecules inside and outside carbon nanotubes.

Science.gov (United States)

Thomas, J A; McGaughey, A J H

2008-02-28

The behavior of water molecules inside and outside 1.1, 2.8, 6.9, and 10.4 nm diameter armchair carbon nanotubes (CNTs) is predicted using molecular dynamics simulations. The effects of CNT diameter on mass density, molecular distribution, and molecular orientation are identified for both the confined and unconfined fluids. Within 1 nm of the CNT surface, unconfined water molecules assume a spatially varying density profile. The molecules distribute nonuniformly around the carbon surface and have preferred orientations. The behavior of the unconfined water molecules is invariant with CNT diameter. The behavior of the confined water, however, can be correlated to tube diameter. Inside the 10.4 nm CNT, the molecular behavior is indistinguishable from that of the unconfined fluid. Within the smaller CNTs, surface curvature effects reduce the equilibrium water density and force water molecules away from the surface. This effect changes both the molecular distribution and preferred molecular orientations.

Structures of water molecules in carbon nanotubes under electric fields

International Nuclear Information System (INIS)

Winarto,; Takaiwa, Daisuke; Yamamoto, Eiji; Yasuoka, Kenji

2015-01-01

Carbon nanotubes (CNTs) are promising for water transport through membranes and for use as nano-pumps. The development of CNT-based nanofluidic devices, however, requires a better understanding of the properties of water molecules in CNTs because they can be very different from those in the bulk. Using all-atom molecular dynamics simulations, we investigate the effect of axial electric fields on the structure of water molecules in CNTs having diameters ranging from (7,7) to (10,10). The water dipole moments were aligned parallel to the electric field, which increases the density of water inside the CNTs and forms ordered ice-like structures. The electric field induces the transition from liquid to ice nanotubes in a wide range of CNT diameters. Moreover, we found an increase in the lifetime of hydrogen bonds for water structures in the CNTs. Fast librational motion breaks some hydrogen bonds, but the molecular pairs do not separate and the hydrogen bonds reform. Thus, hydrogen bonds maintain the water structure in the CNTs, and the water molecules move collectively, decreasing the axial diffusion coefficient and permeation rate

The Roles of Water in the Protein Matrix: A Largely Untapped Resource for Drug Discovery.

Science.gov (United States)

Spyrakis, Francesca; Ahmed, Mostafa H; Bayden, Alexander S; Cozzini, Pietro; Mozzarelli, Andrea; Kellogg, Glen E

2017-08-24

The value of thoroughly understanding the thermodynamics specific to a drug discovery/design study is well known. Over the past decade, the crucial roles of water molecules in protein structure, function, and dynamics have also become increasingly appreciated. This Perspective explores water in the biological environment by adopting its point of view in such phenomena. The prevailing thermodynamic models of the past, where water was seen largely in terms of an entropic gain after its displacement by a ligand, are now known to be much too simplistic. We adopt a set of terminology that describes water molecules as being "hot" and "cold", which we have defined as being easy and difficult to displace, respectively. The basis of these designations, which involve both enthalpic and entropic water contributions, are explored in several classes of biomolecules and structural motifs. The hallmarks for characterizing water molecules are examined, and computational tools for evaluating water-centric thermodynamics are reviewed. This Perspective's summary features guidelines for exploiting water molecules in drug discovery.

Approximative Krieger-Nelkin orientation averaging and anisotropy of water molecules vibrations

International Nuclear Information System (INIS)

Markovic, M.I.

1974-01-01

Quantum-mechanics approach of water molecules dynamics should be taken into account for precise theoretical calculation of differential scattering cross sections of neutrons. Krieger and Nelkin have proposed an approximate method for averaging orientation of molecules regarding directions of incoming and scattered neutron. This paper shows that this approach can be successfully applied for general shape of water molecule vibration anisotropy

Quantum Electric Dipole Lattice - Water Molecules Confined to Nanocavities in Beryl

Science.gov (United States)

Dressel, Martin; Zhukova, Elena S.; Thomas, Victor G.; Gorshunov, Boris P.

2018-02-01

Water is subject to intense investigations due to its importance in biological matter but keeps many of its secrets. Here, we unveil an even other aspect by confining H2O molecules to nanosize cages. Our THz and infrared spectra of water in the gemstone beryl evidence quantum tunneling of H2O molecules in the crystal lattice. The water molecules are spread out when confined in a nanocage. In combination with low-frequency dielectric measurements, we were also able to show that dipolar coupling among the H2O molecules leads towards a ferroelectric state at low temperatures. Upon cooling, a ferroelectric soft mode shifts through the THz range. Only quantum fluctuations prevent perfect macroscopic order to be fully achieved. Beside the significance to life science and possible application, nanoconfined water may become the prime example of a quantum electric dipolar lattice.

The Effect of Basepair Mismatch on DNA Strand Displacement

OpenAIRE

Broadwater, D.?W.?Bo; Kim, Harold?D.

2016-01-01

DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single base pair mismatch. The apparent displacement rate varied si...

Distribution of binding energies of a water molecule in the water liquid-vapor interface

Energy Technology Data Exchange (ETDEWEB)

Chempath, Shaji [Los Alamos National Laboratory; Pratt, Lawrence R [TULANE UNIV

2008-01-01

Distributions of binding energies of a water molecule in the water liquid-vapor interface are obtained on the basis of molecular simulation with the SPC/E model of water. These binding energies together with the observed interfacial density profile are used to test a minimally conditioned Gaussian quasi-chemical statistical thermodynamic theory. Binding energy distributions for water molecules in that interfacial region clearly exhibit a composite structure. A minimally conditioned Gaussian quasi-chemical model that is accurate for the free energy of bulk liquid water breaks down for water molecules in the liquid-vapor interfacial region. This breakdown is associated with the fact that this minimally conditioned Gaussian model would be inaccurate for the statistical thermodynamics of a dilute gas. Aggressive conditioning greatly improves the performance of that Gaussian quasi-chemical model. The analogy between the Gaussian quasi-chemical model and dielectric models of hydration free energies suggests that naive dielectric models without the conditioning features of quasi-chemical theory will be unreliable for these interfacial problems. Multi-Gaussian models that address the composite nature of the binding energy distributions observed in the interfacial region might provide a mechanism for correcting dielectric models for practical applications.

Dynamics of water molecules in the active-site cavity of human cytochromes P450

DEFF Research Database (Denmark)

Rydberg, Patrik; Rod, Thomas Holm; Olsen, Lars

2007-01-01

We have studied the dynamics of water molecules in six crystal structures of four human cytochromes P450, 2A6, 2C8, 2C9, and 3A4, with molecular dynamics simulations. In the crystal structures, only a few water molecules are seen and the reported sizes of the active-site cavity vary a lot....... In the simulations, the cavities are completely filled with water molecules, although with approximately 20% lower density than in bulk water. The 2A6 protein differs from the other three in that it has a very small cavity with only two water molecules and no exchange with the surroundings. The other three proteins...... channels, through which there is a quite frequent exchange of water molecules (one molecule is exchanged every 30-200 ps), except in 2A6. Most of the channels are observed also in the crystal structures, but two to three channels in each protein open only during the simulations. There are no water...

Structural Arrangement of Water Molecules around Highly Charged Nanoparticles: Molecular Dynamics Simulation

International Nuclear Information System (INIS)

Kim, Eunae; Yeom, Min Sun

2014-01-01

Molecular dynamics simulations were performed to understand the structural arrangement of water molecules around highly charged nanoparticles under aqueous conditions. The effect of two highly charged nanoparticles on the solvation charge asymmetry has been examined. We calculated the radial distribution functions of the components of water molecules around nanoparticles which have four charge types at two different salt concentrations. Even though the distributions of water molecules surrounding a sodium ion and a chloride ion are hardly affected by the charges of nanoparticles and the salt concentrations, those around highly charged nanoparticles are strongly influenced by the charges of nanoparticles, but hardly by the charges of nanoparticles and salt concentrations. We find that the distributions of hydrogen atoms in water molecules around one highly charged nanoparticle are dependent on the magnitude of the nanoparticle charge

The Energy and Water Emergency Module; A containerized solution for meeting the energy and water needs in protracted displacement situations

International Nuclear Information System (INIS)

Fuso Nerini, Francesco; Valentini, Francesco; Modi, Anish; Upadhyay, Govinda; Abeysekera, Muditha; Salehin, Sayedus; Appleyard, Eduardo

2015-01-01

Highlights: • Energy and water services are a key need in long-term displacement situations. • At present electricity is supplied mostly with diesel generators and water is imported. • On-site electricity and clean water production can decrease costs and increase security. • The proposed containerized solution produces electricity and purifies water locally. • Model results show the cost-competitiveness and technical potential of the solution. - Abstract: The world has faced many natural and man-made disasters in the past few years, resulting in millions of people living in temporary camps across the globe. The energy and clean water needs of the relief operators in such emergency situations are primarily satisfied by diesel engine based generators and importing clean water to the site, in certain cases even for several years after the emergency. This approach results in problems such as low security of supply and high costs. Especially targeting the prolonged displacement situations, this paper presents an alternative solution – the Energy and Water Emergency Module. The proposed solution aims towards reducing the dependency on fossil fuel in prolonged emergency situations to a minimum while including local energy sources in the energy supply in a flexible and reliable way. The proposed module is built in a standard 20 ft container, and encompasses hybrid generation from solar, wind and biomass, with the possibility of using fossil sources too thanks to a dual fuel gas engine. The module can work both in grid connected and stand-alone mode. In addition the module includes a water purification unit to meet the water needs of displaced population. A demonstration unit was assembled at the Royal Institute of Technology in Stockholm during the year 2012 as a ‘concept proof’, and is now being tested and optimized for future deployment on the field. Preliminary testing and modelling shows that the proposed solution can reliably support emergency

Vibrational properties of water molecules adsorbed in different zeolitic frameworks

International Nuclear Information System (INIS)

Crupi, V; Longo, F; Majolino, D; Venuti, V

2006-01-01

The perturbation of water 'sorbed' in samples of zeolites of different structural type, genesis, and cation composition (K-, Na-, Mg- and Ca-rich zeolites), namely the CHA framework of a synthetic K-chabazite, the LTA framework of synthetic Na-A and Mg50-A zeolites, and the NAT framework of a natural scolecite, has been studied by FTIR-ATR spectroscopy, in the -10 to +80 o C temperature range. The aim was to show how differences in the chemical composition and/or in the topology of the zeolite framework and, in particular, the possibility for the guest water molecules to develop guest-guest and/or host-guest interactions, lead to substantial differences in their vibrational dynamical properties. The spectra, collected in the O-H stretching and H 2 O bending mode regions, are complex, with multiple bands being observed. As far as water in the CHA and LTA frameworks is concerned, whose behaviour is governed by the balance of water-water, water-framework and water-extra-framework cations interactions, the assignment of the resolved components of the O-H stretching band has been discussed by fitting the band shapes into individual components attributed to H 2 O molecules engaged in different degrees of hydrogen bonding. A detailed quantitative picture of the connectivity pattern of water, as a function of temperature and according to the chemical and topological properties of the environment, is furnished. The H 2 O bending vibrational bands give additional information that perfectly agrees with the results obtained from the analysis of the O-H stretching spectral region. In the case of scolecite, a small-pored zeolite where water-water interactions are eliminated, the increased complexity observed in the infrared spectra in the O-H stretching and H 2 O bending regions was explained as due to the hydrogen bonding between the water molecules and the network, and also with the extra-framework cation. Furthermore, these observations have been correlated with the different

Integration or segregation: how do molecules behave at oil/water interfaces?

Science.gov (United States)

Moore, F G; Richmond, G L

2008-06-01

It has been over 250 years since Benjamin Franklin, fascinated with the wave-stilling effect of oil on water, performed his famous oil-drop experiments; nevertheless, the behavior of water molecules adjacent to hydrophobic surfaces continues to fascinate today. In the 18th century, the calming of the seas seemed the most pertinent application of such knowledge; today, we understand that oil-on-water phenomena underlie a range of important chemical, physical, and biological processes, including micelle and membrane formation, protein folding, chemical separation, oil extraction, nanoparticle formation, and interfacial polymerization. Beyond classical experiments of the oil-water interface, recent interest has focused on deriving a molecular-level picture of this interface or, more generally, of water molecules positioned next to any hydrophobic surface. This Account summarizes more than a decade's work from our laboratories aimed at understanding the nature of the hydrogen bonding occurring between water and a series of organic liquids in contact. Although the common perception is that water molecules and oil molecules positioned at the interface between the immiscible liquids want nothing to do with one another, we have found that weak interactions between these hydrophilic and hydrophobic molecules lead to interesting interfacial behavior, including highly oriented water molecules and layering of the organic medium that extends several molecular layers deep into the bulk organic liquid. For some organic liquids, penetration of oriented water into the organic layer is also apparent, facilitated by molecular interactions established at the molecularly thin region of first contact between the two liquids. The studies involve a combined experimental and computational approach. The primary experimental tool that we have used is vibrational sum frequency spectroscopy (VSFS), a powerful surface-specific vibrational spectroscopic method for measuring the molecular

Fast Rotational Diffusion of Water Molecules in a 2D Hydrogen Bond Network at Cryogenic Temperatures

Science.gov (United States)

Prisk, T. R.; Hoffmann, C.; Kolesnikov, A. I.; Mamontov, E.; Podlesnyak, A. A.; Wang, X.; Kent, P. R. C.; Anovitz, L. M.

2018-05-01

Individual water molecules or small clusters of water molecules contained within microporous minerals present an extreme case of confinement where the local structure of hydrogen bond networks are dramatically altered from bulk water. In the zinc silicate hemimorphite, the water molecules form a two-dimensional hydrogen bond network with hydroxyl groups in the crystal framework. Here, we present a combined experimental and theoretical study of the structure and dynamics of water molecules within this network. The water molecules undergo a continuous phase transition in their orientational configuration analogous to a two-dimensional Ising model. The incoherent dynamic structure factor reveals two thermally activated relaxation processes, one on a subpicosecond timescale and another on a 10-100 ps timescale, between 70 and 130 K. The slow process is an in-plane reorientation of the water molecule involving the breaking of hydrogen bonds with a framework that, despite the low temperatures involved, is analogous to rotational diffusion of water molecules in the bulk liquid. The fast process is a localized motion of the water molecule with no apparent analogs among known bulk or confined phases of water.

Hydroxyl and water molecule orientations in trypsin: Comparison to molecular dynamics structures

Energy Technology Data Exchange (ETDEWEB)

McDowell, R.S.; Kossiakoff, A.A. [Genentech, Inc., South San Francisco, CA (United States)

1994-12-31

A comparison is presented of experimentally observed hydroxyl and water hydrogens in trypsin determined from neutron density maps with the results of a 140ps molecular dynamics (MD) simulation. Experimental determination of hydrogen and deuterium atom positions in molecules as large as proteins is a unique capability of neutron diffraction. The comparison addresses the degree to which a standard force-field approach can adequately describe the local electrostatic and van der Waals forces that determine the orientations of these hydrogens. Neutron densities, derived from 2.1{Angstrom} D{sub 2}O-H{sub 2}O difference Fourier maps, provide a database of 27 well-ordered hydroxyl hydrogens. Most of the simulated hydroxyl orientations are within a standard deviation of the experimentally-observed positions, including several examples in which both the simulation and the neutron density indicate that a hydroxyl group is shifted from a {open_quote}standard{close_quote} rotamer. For the most highly ordered water molecules, the hydrogen distributions calculated from the trajectory were in good agreement with neutron density; simulated water molecules that displayed multiple hydrogen bonding networks had correspondingly broadened neutron density profiles. This comparison was facilitated by development of a method to construct a pseudo 2{Angstrom} density map based on the hydrogen atom distributions from the simulation. The degree of disorder of internal water molecules is shown to result primarily from the electrostatic environment surrounding that water molecule as opposed to the cavity size available to the molecule. A method is presented for comparing the discrete observations sampled in a dynamics trajectory with the time- averaged data obtained from X-ray or neutron diffraction studies. This method is particularly useful for statically-disordered water molecules, in which the average location assigned from a trajectory may represent a site of relatively low occupancy.

Transport of water molecules through noncylindrical pores in multilayer nanoporous graphene.

Science.gov (United States)

Shahbabaei, Majid; Kim, Daejoong

2017-08-09

In this study, molecular dynamics (MD) simulations are used to examine the water transport properties through asymmetric hourglass-shaped pores in multilayer nanoporous graphene with a constant interlayer separation of 6 Å. The properties of the tested asymmetric hourglass-shaped pores [with the models having long cone (l 1 , -P) and short cone (l 2 , +P) entrances] are compared to a symmetric pore model. The study findings indicate that the water occupancy increases across the asymmetric pore (l 1 , -P) compared to (l 2 , +P), because of the length effect. The asymmetric pore, (l 1 , -P), yields higher flux compared to (l 2 , +P) and even the symmetric model, which can be attributed to the increase in the hydrogen bonds. In addition, the single-file water molecules across the narrowest pore diameter inside the (l 2 , +P) pore exhibit higher viscosity compared to those in the (l 1 , -P) pore because of the increase in the water layering effect. Moreover, it is found that the permeability inside the multilayer hourglass-shaped pore depends on the length of the flow path of the water molecules before approaching the layer with the smallest pore diameter. The probability of dipole orientation exhibits wider distribution inside the (l 1 , -P) system compared to (l 2 , +P), implying an enhanced formation of hydrogen bonding of water molecules. This results in the fast flow of water molecules. The MD trajectory shows that the dipole orientation across the single-layer graphene has frequently flipped compared to the dipole orientation across the pores in multilayer graphene, which is maintained during the whole simulation time (although the dipole orientation has flipped for a few picoseconds at the beginning of the simulation). This can be attributed to the energy barrier induced by the individual layer. The diffusion coefficient of water molecules inside the (l 2 , +P) system increases with pressure difference, however, it decreases inside the (l 1 , -P) system because

Shear-stress-induced structural arrangement of water molecules in nanoscale Couette flow with slipping at wall boundary

International Nuclear Information System (INIS)

Lin, Jau-Wen

2014-01-01

This study investigated the structuring of water molecules in a nanoscale Couette flow with the upper plate subjected to lateral forces with various magnitudes and water slipping against a metal wall. It was found that when the upper plate is subjected to a force, the water body deforms into a parallelepiped. Water molecules in the channel are then gradually arranged into lattice positions, creating a layered structure. The structural arrangement of water molecules is caused by the water molecules accommodating themselves to the increase in energy under the application of a lateral force on the moving plate. The ordering arrangement of water molecules increases the rotational degree of freedom, allowing the molecules to increase their Coulomb potential energy through polar rotation that accounts for the energy input through the upper plate. With a force continuously applied to the upper plate, the water molecules in contact with the upper plate move forward until slip between the water and upper plate occurs. The relation between the structural arrangement of water molecules, slip at the wall, and the shear force is studied. The relation between the slip and the locking/unlocking of water molecules to metal atoms is also studied

Implication of Crystal Water Molecules in Inhibitor Binding at ALR2 Active Site

Directory of Open Access Journals (Sweden)

Hymavati

2012-01-01

Full Text Available Water molecules play a crucial role in mediating the interaction between a ligand and a macromolecule. The solvent environment around such biomolecule controls their structure and plays important role in protein-ligand interactions. An understanding of the nature and role of these water molecules in the active site of a protein could greatly increase the efficiency of rational drug design approaches. We have performed the comparative crystal structure analysis of aldose reductase to understand the role of crystal water in protein-ligand interaction. Molecular dynamics simulation has shown the versatile nature of water molecules in bridge H bonding during interaction. Occupancy and life time of water molecules depend on the type of cocrystallized ligand present in the structure. The information may be useful in rational approach to customize the ligand, and thereby longer occupancy and life time for bridge H-bonding.

The influence of water disposal method on the property of chemical oil-displacement agent--taking Guan 109-1 area of Dagang oilfield as example

Directory of Open Access Journals (Sweden)

Shengwang Yuan

2018-03-01

Full Text Available Aiming at the actual demand of Guan 109-1 block in Dagang oilfield, by means of instrumental analysis, chemical analysis, modern physical simulation, viewing polymer viscosity and seepage characteristic as evaluation index, the experimental research on the influence of water disposal method on the property of chemical oil-displacement agent was carried out. Results showed that through adding scaling agent, scale was formed because of the reaction between scaling agent and Ca2+, Mg2+ in the flooding water, which could enhance the viscosity of polymer solution. Through comparing the resistance factor and residual resistance factor of polymer solution which was respectively prepared with flooding water, softened water and scale, the resistance factor and residual resistance factor of polymer solution with scale was the largest, that of polymer solution prepared with softened water was second and that of polymer solution prepared with flooding water came last. Furthermore, scaling agent weakened the gelling effect between cross-linking agent Cr3+ and polymer molecule chains. The earlier the cross-linking agent Cr3+ was added, the larger the polymer viscosity, resistance factor and residual resistance factor of Cr3+ polymer were.

Carbon, land, and water footprint accounts for the European Union: consumption, production, and displacements through international trade.

Science.gov (United States)

Steen-Olsen, Kjartan; Weinzettel, Jan; Cranston, Gemma; Ercin, A Ertug; Hertwich, Edgar G

2012-10-16

A nation's consumption of goods and services causes various environmental pressures all over the world due to international trade. We use a multiregional input-output model to assess three kinds of environmental footprints for the member states of the European Union. Footprints are indicators that take the consumer responsibility approach to account for the total direct and indirect effects of a product or consumption activity. We quantify the total environmental pressures (greenhouse gas emissions: carbon footprint; appropriation of biologically productive land and water area: land footprint; and freshwater consumption: water footprint) caused by consumption in the EU. We find that the consumption activities by an average EU citizen in 2004 led to 13.3 tCO(2)e of induced greenhouse gas emissions, appropriation of 2.53 gha (hectares of land with global-average biological productivity), and consumption of 179 m(3) of blue water (ground and surface water). By comparison, the global averages were 5.7 tCO(2)e, 1.23 gha, and 163 m(3) blue water, respectively. Overall, the EU displaced all three types of environmental pressures to the rest of the world, through imports of products with embodied pressures. Looking at intra-EU displacements only, the UK was the most important displacer overall, while the largest net exporters of embodied environmental pressures were Poland (greenhouse gases), France (land), and Spain (freshwater).

Influence of orientation averaging on the anisotropy of thermal neutrons scattering on water molecules

International Nuclear Information System (INIS)

Markovic, M. I.; Radunovic, J. B.

1976-01-01

Determination of spatial distribution of neutron flux in water, most frequently used moderator in thermal reactors, demands microscopic scattering kernels dependence on cosine of thermal neutrons scattering angle when solving the Boltzmann equation. Since spatial orientation of water molecules influences this dependence it is necessary to perform orientation averaging or rotation-vibrational intermediate scattering function for water molecules. The calculations described in this paper and the obtained results showed that methods of orientation averaging do not influence the anisotropy of thermal neutrons scattering on water molecules, but do influence the inelastic scattering

Measurement of interfacial displacement of a liquid film in microchannels using laser focus displacement meter

International Nuclear Information System (INIS)

Hazuku, Tatsuya; Fukamachi, Norihiro; Takamasa, Tomoji; Hibiki, Takashi

2004-01-01

This paper presents a new method for measuring the interfacial displacement of a liquid film in microchannels using a laser focus displacement meter (LFD). The purpose of the study is to clarify the effectiveness of the new method for obtaining detailed information concerning interfacial displacement, especially in the case of a thin liquid film, in micro- and mini-channels. To prevent the tube wall signal from disturbing that of the gas-liquid interface, a fluorocarbon tube with water box was used; the refraction index of this device is same as that for water. With this method, accurate instantaneous measurements of interfacial displacement of the liquid film were achieved. The error caused by refraction of the laser beam passing through the acrylic water box and fluorocarbon tube was estimated analytically and experimentally. The formulated analytical equation can estimate the real interface displacement using measured displacement in a fluorocarbon tube of 25 μm to 2.0 mm I.D. A preliminary test using fluorocarbon tubes of 1 and 2 mm I.D. showed that the corrected interface displacement calculated by the equation agreed with real displacement within a 1% margin of error. It was also confirmed that the LFD in the system could measure a liquid film of 0.25 μm at the thinnest. We made simultaneous measurements of the interface in fluorocarbon tubes of 0.5 and 1 mm I.D. using the LFD and a high-speed video camera with a microscope. These showed that the LFD could measure the interface of a liquid film with high spatial and temporal resolution during annular, slug, and piston flow regimes. The data also clarified the existence of a thin liquid film less than 1 μm in thickness in slug and annular flow regions. (author)

Comparison of the orogenic displacement of sodium caseinate with the caseins from the air-water interface by nonionic surfactants.

Science.gov (United States)

Woodward, N C; Gunning, A P; Mackie, A R; Wilde, P J; Morris, V J

2009-06-16

Displacement of sodium caseinate from the air-water interface by nonionic surfactants Tween 20 and Tween 60 was observed by atomic force microscopy (AFM). The interfacial structure was sampled by Langmuir-Blodgett deposition onto freshly cleaved mica substrates. Protein displacement occurred through an orogenic mechanism: it involved the nucleation and growth of surfactant domains within the protein network, followed by failure of the protein network. The surface pressure at which failure of the protein network occurred was essentially independent of the type of surfactant. The major component of sodium caseinate is beta-casein, and previous studies at the air-water interface have shown that beta-casein networks are weak, failing at surface pressures below that observed for sodium caseinate. The other components of sodium caseinate are alpha(s)- and kappa-caseins. Studies of the displacement of alpha(s)-caseins from air-water interfaces show that these proteins also form weak networks that fail at surface pressures below that observed for sodium caseinate. However, kappa-casein was found to form strong networks that resisted displacement and failed at surface pressures comparable to those observed for sodium caseinate. The AFM images of the displacement suggest that, despite kappa-casein being a minor component, it dominates the failure of sodium caseinate networks: alpha(s)-casein and beta-casein are preferentially desorbed at lower surface pressures, allowing the residual kappa-casein to control the breakdown of the sodium caseinate network at higher surface pressures.

Investigation of the Hydantoin Monomer and its Interaction with Water Molecules

Science.gov (United States)

Gruet, Sébastien; Perez, Cristobal; Schnell, Melanie

2017-06-01

Hydantoin (Imidazolidine-2,4-dione, C_3H_4N_2O_2) is a five-membered heterocyclic compound of astrobiological interest. This molecule has been detected in carbonaceous chondrites [1], and its formation can rise from the presence of glycolic acid and urea, two prebiotic molecules [2]. The hydrolysis of hydantoin under acidic conditions can also produce glycine [3], an amino acid actively searched for in the interstellar medium. Spectroscopic data of hydantoin is very limited and mostly dedicated to the solid phase. The high resolution study in gas phase is restricted to the work recently published by Ozeki et al. reporting the pure rotational spectra of the ground state and two vibrational states of the molecule in the millimeter-wave region (90-370 GHz)[4]. Using chirped-pulse Fourier-transform microwave (CP-FTMW) spectroscopy, we recorded the jet-cooled rotational spectra of hydantoin with water between 2 to 8 GHz. We observed the ground state of hydantoin monomer and several water complexes with one or two water molecules. All the observed species exhibit a hyperfine structure due to the two nitrogen atoms present in the molecule, which were fully resolved and analyzed. Additional experiments with a ^{18}O enriched water sample were realized to determine the oxygen-atom positions of the water monomers. These experiments yielded accurate structural information on the preferred water binding sites. The observed complexes and the interactions that hold them together, mainly strong directional hydrogen bonds, will be presented and discussed. [1] Shimoyama, A. and Ogasawara, R., Orig. Life Evol. Biosph., 32, 165-179, 2002. DOI:10.1023/A:1016015319112. [2] Menor-Salván, C. and Marín-Yaseli, M.R., Chem. Soc. Rev., 41(16), 5404-5415, 2012. DOI:10.1039/c2cs35060b. [3] De Marcellus P., Bertrand M., Nuevo M., Westall F. and Le Sergeant d'Hendecourt L., Astrobiology. 11(9), 847-854, 2011. DOI:10.1089/ast.2011.0677. [4] Ozeki, H., Miyahara R., Ihara H., Todaka S., Kobayashi

Femtosecond spectroscopic study of the solvation of amphiphilic molecules by water

NARCIS (Netherlands)

Rezus, Y.L.A.; Bakker, H.J.

2008-01-01

We use polarization-resolved mid-infrared pump-probe spectroscopy to study the aqueous solvation of proline and N-methylacetamide. These molecules serve as models to study the solvation of proteins. We monitor the orientational dynamics of partly deuterated water molecules (HDO) that are present at

Photoionization of water molecules by high energy photons

Directory of Open Access Journals (Sweden)

Lara Martini

2017-07-01

Full Text Available We theoretically study the photoionization of water molecules by high energy photon impact. We develop a model in which the final state wavefunction is given by a Coulomb continuum wavefunction with effective charges and the water molecule bound states are represented using the Moccia's monocentric wavefunctions. We obtain analytical expressions for the transition matrix element that enable the computation of cross sections by numerical quadratures. We compare our predictions for photon energies between 20 and 300 eV with more elaborated theoretical results and experiments. We obtain a very good agreement with experiments, in particular, at enough high energies where there is a lack of elaborated results due to their high computational cost. Received: 15 March 2017, Accepted: 25 June 2017; Edited by: S. Kais; DOI: http://dx.doi.org/10.4279/PIP.090006 Cite as: L Martini, D I R Boll, O A Fojón, Papers in Physics 9, 090006 (2017

Constant load and constant displacement stress corrosion in simulated water reactor environments

International Nuclear Information System (INIS)

Lloyd, G.J.

1987-02-01

The stress corrosion behaviour of selected water reactor constructional materials, as determined by constant load or constant displacement test techniques, is reviewed. Experimental results obtained using a very wide range of conditions have been collected in a form for easy reference. A discussion is given of some apparent trends in these data. The possible reasons for these trends are considered together with a discussion of how the observed discrepancies may be resolved. (author)

The Energy and Water Emergency Module; A containerized solution for meeting the energy and water needs in protracted displacement situations

DEFF Research Database (Denmark)

Nerini, Francesco Fuso; Valentini, Francesco; Modi, Anish

2015-01-01

The world has faced many natural and man-made disasters in the past few years, resulting in millions of people living in temporary camps across the globe. The energy and clean water needs of the relief operators in such emergency situations are primarily satisfied by diesel engine based generators...... and importing clean water to the site, in certain cases even for several years after the emergency. This approach results in problems such as low security of supply and high costs. Especially targeting the prolonged displacement situations, this paper presents an alternative solution – the Energy and Water...

Scattering of thermal neutron by the water molecule

International Nuclear Information System (INIS)

Rosa, L.P.

The calculation of the differenctial cross section for scattering of thermal neutrons by water, taking into account the translational, rotational and vibrational motions of the water molecule, is presented according to Nelkin' model. Some modifications are presented which have been introduced in the original method to improve the results and an application has been made to reactor physics, by calculating the thermal neutron flux in a homogenous medium containing water and absorver. Thirty thermal energy groups have been used to compute the spectra. Within the limits of error, better agreement has been obtained between theory and experiments by using a modified Nelkin kernel consisting of substituting the asymptotic formulae for the rotational and vibrational motions by more exact expressions, similar to the Buttler model for heavy water

Water molecule-enhanced CO2 insertion in lanthanide coordination polymers

International Nuclear Information System (INIS)

Luo Liushan; Huang Xiaoyuan; Wang Ning; Wu Hongyan; Chen Wenbin; Feng Zihao; Zhu Huiping; Peng Xiaoling; Li Yongxian; Huang Ling; Yue Shantang; Liu Yingliang

2009-01-01

Two new lanthanide coordination polymers H 2 N(CH 3 ) 2 .[Eu III 2 (L 1 ) 3 (L 2 )] (1, L 1 =isophthalic acid dianion, L 2 =formic acid anion) and [La III (2,5-PDC)(L 2 )](2, 2,5-PDC=2,5-pyridinedicarboxylate dianion) were synthesized under solvothermal conditions. It is of interest that the formic ligand (L 2 ) is not contained in the stating materials, but arises from the water molecule-enhanced CO 2 insertion during the solvothermal process. Both of the two compounds exhibit complicated three dimensional sandwich-like frameworks. - Graphical abstract: Two new lanthanide coordination polymers involving water molecule-enhanced CO 2 insertion resulting in the formation of formic anion and dimethylammonium cation were synthesized under solvothermal conditions.

Electric dipole moments of nanosolvated acid molecules in water clusters.

Science.gov (United States)

Guggemos, Nicholas; Slavíček, Petr; Kresin, Vitaly V

2015-01-30

The electric dipole moments of (H2O)nDCl (n=3-9) clusters have been measured by the beam-deflection method. Reflecting the (dynamical) charge distribution within the system, the dipole moment contributes information about the microscopic structure of nanoscale solvation. The addition of a DCl molecule to a water cluster results in a strongly enhanced susceptibility. There is evidence for a noticeable rise in the dipole moment occurring at n≈5-6. This size is consistent with predictions for the onset of ionic dissociation. Additionally, a molecular-dynamics model suggests that even with a nominally bound impurity an enhanced dipole moment can arise due to the thermal and zero-point motion of the proton and the water molecules. The experimental measurements and the calculations draw attention to the importance of fluctuations in defining the polarity of water-based nanoclusters and generally to the essential role played by motional effects in determining the response of fluxional nanoscale systems under realistic conditions.

Influence of the effective mass of water molecule on thermal neutron scattering

International Nuclear Information System (INIS)

Markovic, M.

1981-01-01

The influence of the effective water molecule mass on the thermal neutron scattering on the nucleus of the hydrogen atom has been investigated. Besides the actual water molecule mass (M = 18) the investigations have been carried out with its two effective values (M1 = 16 and M2 = 20). The differential and total cross sections have been calculated for the incident thermal neutron energy E o = 1 eV. Investigation results show different prominence of the quantum effects and for M2 the appearance of peaks in the quasielastic scattering. (author)

A Raman spectroscopy study on the effects of intermolecular hydrogen bonding on water molecules absorbed by borosilicate glass surface

Science.gov (United States)

Li, Fabing; Li, Zhanlong; Wang, Ying; Wang, Shenghan; Wang, Xiaojun; Sun, Chenglin; Men, Zhiwei

2018-05-01

The structural forms of water/deuterated water molecules located on the surface of borosilicate capillaries have been first investigated in this study on the basis of the Raman spectral data obtained at different temperatures and under atmospheric pressure for molecules in bulk and also for molecules absorbed by borosilicate glass surface. The strongest two fundamental bands locating at 3063 cm-1 (2438 cm-1) in the recorded Raman spectra are assigned here to the Osbnd H (Osbnd D) bond stretching vibrations and they are compared with the corresponding bands observed at 3124 cm-1 (2325 cm-1) in the Raman spectrum of ice Ih. Our spectroscopic observations have indicated that the structure of water and deuterated water molecules on borosilicate surface is similar to that of ice Ih (hexagonal phase of ice). These observations have also indicated that water molecules locate on the borosilicate surface so as to construct a bilayer structure and that strong and weak intermolecular hydrogen bonds are formed between water/deuterated molecules and silanol groups on borosilicate surface. In accordance with these findings, water and deuterated water molecules at the interface of capillary have a higher melting temperature.

Transport behavior of water molecules through two-dimensional nanopores

International Nuclear Information System (INIS)

Zhu, Chongqin; Li, Hui; Meng, Sheng

2014-01-01

Water transport through a two-dimensional nanoporous membrane has attracted increasing attention in recent years thanks to great demands in water purification and desalination applications. However, few studies have been reported on the microscopic mechanisms of water transport through structured nanopores, especially at the atomistic scale. Here we investigate the microstructure of water flow through two-dimensional model graphene membrane containing a variety of nanopores of different size by using molecular dynamics simulations. Our results clearly indicate that the continuum flow transits to discrete molecular flow patterns with decreasing pore sizes. While for pores with a diameter ≥15 Å water flux exhibits a linear dependence on the pore area, a nonlinear relationship between water flux and pore area has been identified for smaller pores. We attribute this deviation from linear behavior to the presence of discrete water flow, which is strongly influenced by the water-membrane interaction and hydrogen bonding between water molecules

Chemical reactions of water molecules on Ru(0001) induced by selective excitation of vibrational modes

Energy Technology Data Exchange (ETDEWEB)

Mugarza, Aitor; Shimizu, Tomoko K.; Ogletree, D. Frank; Salmeron, Miquel

2009-05-07

Tunneling electrons in a scanning tunneling microscope were used to excite specific vibrational quantum states of adsorbed water and hydroxyl molecules on a Ru(0 0 0 1) surface. The excited molecules relaxed by transfer of energy to lower energy modes, resulting in diffusion, dissociation, desorption, and surface-tip transfer processes. Diffusion of H{sub 2}O molecules could be induced by excitation of the O-H stretch vibration mode at 445 meV. Isolated molecules required excitation of one single quantum while molecules bonded to a C atom required at least two quanta. Dissociation of single H{sub 2}O molecules into H and OH required electron energies of 1 eV or higher while dissociation of OH required at least 2 eV electrons. In contrast, water molecules forming part of a cluster could be dissociated with electron energies of 0.5 eV.

Hydrogen bonding characterization in water and small molecules

Science.gov (United States)

Silvestrelli, Pier Luigi

2017-06-01

The prototypical hydrogen bond in water dimer and hydrogen bonds in the protonated water dimer, in other small molecules, in water cyclic clusters, and in ice, covering a wide range of bond strengths, are theoretically investigated by first-principles calculations based on density functional theory, considering not only a standard generalized gradient approximation functional but also, for the water dimer, hybrid and van der Waals corrected functionals. We compute structural, energetic, and electrostatic (induced molecular dipole moments) properties. In particular, hydrogen bonds are characterized in terms of differential electron density distributions and profiles, and of the shifts of the centres of maximally localized Wannier functions. The information from the latter quantities can be conveyed to a single geometric bonding parameter that appears to be correlated with the Mayer bond order parameter and can be taken as an estimate of the covalent contribution to the hydrogen bond. By considering the water trimer, the cyclic water hexamer, and the hexagonal phase of ice, we also elucidate the importance of cooperative/anticooperative effects in hydrogen-bonding formation.

Evaluation of Serum for Pathophysiological Effects of Prolonged Low Salinity Water Exposure in Displaced Bottlenose Dolphins (Tursiops truncatus

Directory of Open Access Journals (Sweden)

Ruth Y. Ewing

2017-06-01

Full Text Available We conducted a retrospective study of serum biochemistry and hematologic findings from displaced, out-of-habitat bottlenose dolphins (Tursiops truncatus exposed to various low salinity environments in waters along the southern United States including southeastern Atlantic and northern Gulf of Mexico. Serum sodium, chloride, and calculated osmolality were significantly lower and below reference ranges in displaced animals compared to free-ranging case control animals. This suggests clinical hyponatremia, hypochloremia, and hypo-osmolality due to an uptake of low saline water from the environment. In addition, significant differences were found in other serum chemistry variables, although none were outside of normal reference ranges for non-controlled free-ranging animals. Multiple linear regressions demonstrated the degree of salinity had a greater pathophysiologic response than the duration of fresh water exposure. The Na/Cl ratio and bicarbonate were the only variables that were significantly modulated by exposure duration. These findings suggest that the degree of salinity is a critical factor when assessing and managing care for dolphins chronically exposed to low salinity water. Results from this study indicate that changes in various biochemical parameters can be used to determine fresh water exposure and aid in determining the treatment for animals recovered from low salinity waters.

Carbon nanotubes-based chemiresistive immunosensor for small molecules: detection of nitroaromatic explosives.

Science.gov (United States)

Park, Miso; Cella, Lakshmi N; Chen, Wilfred; Myung, Nosang V; Mulchandani, Ashok

2010-12-15

In recent years, there has been a growing focus on use of one-dimensional (1-D) nanostructures, such as carbon nanotubes and nanowires, as transducer elements for label-free chemiresistive/field-effect transistor biosensors as they provide label-free and high sensitivity detection. While research to-date has elucidated the power of carbon nanotubes- and other 1-D nanostructure-based field effect transistors immunosensors for large charged macromolecules such as proteins and viruses, their application to small uncharged or charged molecules has not been demonstrated. In this paper we report a single-walled carbon nanotubes (SWNTs)-based chemiresistive immunosensor for label-free, rapid, sensitive and selective detection of 2,4,6-trinitrotoluene (TNT), a small molecule. The newly developed immunosensor employed a displacement mode/format in which SWNTs network forming conduction channel of the sensor was first modified with trinitrophenyl (TNP), an analog of TNT, and then ligated with the anti-TNP single chain antibody. Upon exposure to TNT or its derivatives the bound antibodies were displaced producing a large change, several folds higher than the noise, in the resistance/conductance of SWNTs giving excellent limit of detection, sensitivity and selectivity. The sensor detected between 0.5 ppb and 5000 ppb TNT with good selectivity to other nitroaromatic explosives and demonstrated good accuracy for monitoring TNT in untreated environmental water matrix. We believe this new displacement format can be easily generalized to other one-dimensional nanostructure-based chemiresistive immuno/affinity-sensors for detecting small and/or uncharged molecules of interest in environmental monitoring and health care. Copyright © 2010 Elsevier B.V. All rights reserved.

Water-mediated influence of a crowded environment on internal vibrations of a protein molecule.

Science.gov (United States)

Kuffel, Anna; Zielkiewicz, Jan

2016-02-14

The influence of crowding on the protein inner dynamics is examined by putting a single protein molecule close to one or two neighboring protein molecules. The presence of additional molecules influences the amplitudes of protein fluctuations. Also, a weak dynamical coupling of collective velocities of surface atoms of proteins separated by a layer of water is detected. The possible mechanisms of these phenomena are described. The cross-correlation function of the collective velocities of surface atoms of two proteins was decomposed into the Fourier series. The amplitude spectrum displays a peak at low frequencies. Also, the results of principal component analysis suggest that the close presence of an additional protein molecule influences the high-amplitude, low-frequency modes in the most prominent way. This part of the spectrum covers biologically important protein motions. The neighbor-induced changes in the inner dynamics of the protein may be connected with the changes in the velocity power spectrum of interfacial water. The additional protein molecule changes the properties of solvation water and in this way it can influence the dynamics of the second protein. It is suggested that this phenomenon may be described, at first approximation, by a damped oscillator driven by an external random force. This model was successfully applied to conformationally rigid Choristoneura fumiferana antifreeze protein molecules.

Control of DNA strand displacement kinetics using toehold exchange.

Science.gov (United States)

Zhang, David Yu; Winfree, Erik

2009-12-02

DNA is increasingly being used as the engineering material of choice for the construction of nanoscale circuits, structures, and motors. Many of these enzyme-free constructions function by DNA strand displacement reactions. The kinetics of strand displacement can be modulated by toeholds, short single-stranded segments of DNA that colocalize reactant DNA molecules. Recently, the toehold exchange process was introduced as a method for designing fast and reversible strand displacement reactions. Here, we characterize the kinetics of DNA toehold exchange and model it as a three-step process. This model is simple and quantitatively predicts the kinetics of 85 different strand displacement reactions from the DNA sequences. Furthermore, we use toehold exchange to construct a simple catalytic reaction. This work improves the understanding of the kinetics of nucleic acid reactions and will be useful in the rational design of dynamic DNA and RNA circuits and nanodevices.

Slow neutron scattering by water molecules

Energy Technology Data Exchange (ETDEWEB)

Stancic, V [Boris Kidric Institute of Nuclear Sciences Vinca, Beograd (Yugoslavia)

1970-07-01

In this work some new, preliminary formulae for slow neutron scattering cross section calculation by heavy and light water molecules have been done. The idea was to find, from the sum which exists in well known Nelkin model, other cross sections in a more simple analytical form, so that next approximations may be possible. In order to sum a series it was starting from Euler-Mclaurin formula. Some new summation formulae have been derived there, and defined in two theorems. Extensive calculations, especially during the evaluation of residues, have been made at the CDC 3600 computer. validation of derived formulae was done by comparison with the BNL-325 results. Good agreement is shown. (author)

Slow neutron scattering by water molecules

International Nuclear Information System (INIS)

Stancic, V.

1970-01-01

In this work some new, preliminary formulae for slow neutron scattering cross section calculation by heavy and light water molecules have been done. The idea was to find, from the sum which exists in well known Nelkin model, other cross sections in a more simple analytical form, so that next approximations may be possible. In order to sum a series it was starting from Euler-Mclaurin formula. Some new summation formulae have been derived there, and defined in two theorems. Extensive calculations, especially during the evaluation of residues, have been made at the CDC 3600 computer. validation of derived formulae was done by comparison with the BNL-325 results. Good agreement is shown. (author)

Measurements of water molecule density by tunable diode laser absorption spectroscopy in dielectric barrier discharges with gas-water interface

Science.gov (United States)

Tachibana, Kunihide; Nakamura, Toshihiro; Kawasaki, Mitsuo; Morita, Tatsuo; Umekawa, Toyofumi; Kawasaki, Masahiro

2018-01-01

We measured water molecule (H2O) density by tunable diode-laser absorption spectroscopy (TDLAS) for applications in dielectric barrier discharges (DBDs) with a gas-water interface. First, the effects of water temperature and presence of gas flow were tested using a Petri dish filled with water and a gas injection nozzle. Second, the TDLAS system was applied to the measurements of H2O density in two types of DBDs; one was a normal (non-inverted) type with a dielectric-covered electrode above a water-filled counter electrode and the other was an inverted type with a water-suspending mesh electrode above a dielectric-covered counter electrode. The H2O density in the normal DBD was close to the density estimated from the saturated vapor pressure, whereas the density in the inverted DBD was about half of that in the former type. The difference is attributed to the upward gas flow in the latter type, that pushes the water molecules up towards the gas-water interface.

STICKING OF MOLECULES ON NONPOROUS AMORPHOUS WATER ICE

Energy Technology Data Exchange (ETDEWEB)

He, Jiao; Vidali, Gianfranco [Physics Department, Syracuse University, Syracuse, NY 13244 (United States); Acharyya, Kinsuk, E-mail: gvidali@syr.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States)

2016-05-20

Accurate modeling of physical and chemical processes in the interstellar medium (ISM) requires detailed knowledge of how atoms and molecules adsorb on dust grains. However, the sticking coefficient, a number between 0 and 1 that measures the first step in the interaction of a particle with a surface, is usually assumed in simulations of ISM environments to be either 0.5 or 1. Here we report on the determination of the sticking coefficient of H{sub 2}, D{sub 2}, N{sub 2}, O{sub 2}, CO, CH{sub 4}, and CO{sub 2} on nonporous amorphous solid water. The sticking coefficient was measured over a wide range of surface temperatures using a highly collimated molecular beam. We showed that the standard way of measuring the sticking coefficient—the King–Wells method—leads to the underestimation of trapping events in which there is incomplete energy accommodation of the molecule on the surface. Surface scattering experiments with the use of a pulsed molecular beam are used instead to measure the sticking coefficient. Based on the values of the measured sticking coefficient, we suggest a useful general formula of the sticking coefficient as a function of grain temperature and molecule-surface binding energy. We use this formula in a simulation of ISM gas–grain chemistry to find the effect of sticking on the abundance of key molecules both on grains and in the gas phase.

The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

International Nuclear Information System (INIS)

Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

2007-01-01

Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

Displacer Diameter Effect in Displacer Pulse Tube Refrigerator

Science.gov (United States)

Zhu, Shaowei

2017-12-01

Gas driving displacer pulse tube refrigerators are one of the work recovery type of pulse tube refrigerators whose theoretical efficiency is the same as Stirling refrigerators'. Its cooling power is from the displacement of the displacer. Displace diameter, rod diameter and pressure drop of the regenerator influence the displacement, which are investigated by numerical simulation. It is shown that the displacement ratio of the displacer over the piston is almost not affected by the displacer diameter at the same rod diameter ratio, or displacer with different diameters almost has the same performance.

Identification of Carboxylate, Phosphate, and Phenoxide Functionalities in Deprotonated Molecules Related to Drug Metabolites via Ion-Molecule Reactions with water and Diethylhydroxyborane

Science.gov (United States)

Zhu, Hanyu; Ma, Xin; Kong, John Y.; Zhang, Minli; Kenttämaa, Hilkka I.

2017-10-01

Tandem mass spectrometry based on ion-molecule reactions has emerged as a powerful tool for structural elucidation of ionized analytes. However, most currently used reagents were designed to react with protonated analytes, making them suboptimal for acidic analytes that are preferentially detected in negative ion mode. In this work we demonstrate that the phenoxide, carboxylate, and phosphate functionalities can be identified in deprotonated molecules by use of a combination of two reagents, diethylmethoxyborane (DEMB) and water. A novel reagent introduction setup that allowed DEMB and water to be separately introduced into the ion trap region of the mass spectrometer was developed to facilitate fundamental studies of this reaction. A new reagent, diethylhydroxyborane (DEHB), was generated inside the ion trap by hydrolysis of DEMB on introduction of water. Most carboxylates and phenoxides formed a DEHB adduct, followed by addition of one water molecule and subsequent ethane elimination (DEHB adduct +H2O - CH3CH3) as the major product ion. Phenoxides with a hydroxy group adjacent to the deprotonation site and phosphates formed a DEHB adduct, followed by ethane elimination (DEHB adduct - CH3CH3). Deprotonated molecules with strong intramolecular hydrogen bonds or without the aforementioned functionalities, including sulfates, were unreactive toward DEHB/H2O. Reaction mechanisms were explored via isotope labeling experiments and quantum chemical calculations. The mass spectrometry method allowed the differentiation of phenoxide-, carboxylate-, phosphate-, and sulfate-containing analytes. Finally, it was successfully coupled with high-performance liquid chromatography for the analysis of a mixture containing hymecromone, a biliary spasm drug, and its three possible metabolites. [Figure not available: see fulltext.

Control of unidirectional transport of single-file water molecules through carbon nanotubes in an electric field.

Science.gov (United States)

Su, Jiaye; Guo, Hongxia

2011-01-25

The transport of water molecules through nanopores is not only crucial to biological activities but also useful for designing novel nanofluidic devices. Despite considerable effort and progress that has been made, a controllable and unidirectional water flow is still difficult to achieve and the underlying mechanism is far from being understood. In this paper, using molecular dynamics simulations, we systematically investigate the effects of an external electric field on the transport of single-file water molecules through a carbon nanotube (CNT). We find that the orientation of water molecules inside the CNT can be well-tuned by the electric field and is strongly coupled to the water flux. This orientation-induced water flux is energetically due to the asymmetrical water-water interaction along the CNT axis. The wavelike water density profiles are disturbed under strong field strengths. The frequency of flipping for the water dipoles will decrease as the field strength is increased, and the flipping events vanish completely for the relatively large field strengths. Most importantly, a critical field strength E(c) related to the water flux is found. The water flux is increased as E is increased for E ≤ E(c), while it is almost unchanged for E > E(c). Thus, the electric field offers a level of governing for unidirectional water flow, which may have some biological applications and provides a route for designing efficient nanopumps.

The Effect of Basepair Mismatch on DNA Strand Displacement.

Science.gov (United States)

Broadwater, D W Bo; Kim, Harold D

2016-04-12

DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single basepair mismatch. The apparent displacement rate varied significantly when the mismatch was introduced in the invading DNA strand. The rate generally decreased as the mismatch in the invader was encountered earlier in displacement. Our data indicate that a single base pair mismatch in the invader stalls branch migration and displacement occurs via direct dissociation of the destabilized incumbent strand from the substrate strand. We combined both branch migration and direct dissociation into a model, which we term the concurrent displacement model, and used the first passage time approach to quantitatively explain the salient features of the observed relationship. We also introduce the concept of splitting probabilities to justify that the concurrent model can be simplified into a three-step sequential model in the presence of an invader mismatch. We expect our model to become a powerful tool to design DNA-based reaction schemes with broad functionality. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Adsorption of ethyl xanthate on ZnS(110) surface in the presence of water molecules: A DFT study

Energy Technology Data Exchange (ETDEWEB)

Long, Xianhao [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Chen, Jianhua, E-mail: jhchen@gxu.edu.cn [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Guangxi Colleges and University Key Laboratory of Minerals Engineering, 530004 (China); Chen, Ye, E-mail: fby18@126.com [College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China)

2016-05-01

Graphical abstract: - Highlights: • Adsorption of water molecules decreases the reactivity of surface Zn atom. • Copper impurities decrease the band gap of ZnS surface. • Copper impurities enhance the adsorption of xanthate on the ZnS surface. • Water molecules have little influence on the properties of Cu-substituted ZnS surface. • The xanthate S atom can interact with the surface S atom of Cu-substituted ZnS surface. - Abstracts: The interaction of collector with the mineral surface plays a very important role in the froth flotation of sphalerite. The adsorptions occurred at the interface between the mineral surface and waters; however most of DFT simulations are performed in vacuum, without consideration of water effect. Semiconductor surface has an obvious proximity effect, which will greatly influence the surface reactivity. To understand the mechanism of xanthate interacting with sphalerite surface in the presence of water molecules, the ethyl xanthate molecule adsorption on un-activated and Cu-activated ZnS(110) surface in the absence and presence of water molecules were performed using the density functional theory (DFT) method. The calculated results show that the adsorption of water molecules dramatically changes the properties of ZnS surface, resulting in decreasing the reactivity of surface Zn atoms with xanthate. Copper activation of ZnS surface changes the surface properties, leading to the totally different adsorption behaviors of xanthate. The presence of waters has little influence on the properties of Cu-activated ZnS surface. The xanthate S atom can interact with the surface S atom of Cu-substituted ZnS surface, which would result in the formation of dixanthogen.

Analytic vibrational matrix elements for diatomic molecules

International Nuclear Information System (INIS)

Bouanich, J.P.; Ogilvie, J.F.; Tipping, R.H.

1986-01-01

The vibrational matrix elements and expectation values for a diatomic molecule, including the rotational dependence, are calculated for powers of the reduced displacement in terms of the parameters of the Dunham potential-energy function. (orig.)

Cavity mutants of Savinase. Crystal structures and differential scanning calorimetry experiments give hints of the function of the buried water molecules in subtilisins.

Science.gov (United States)

Pedersen, J T; Olsen, O H; Betzel, C; Eschenburg, S; Branner, S; Hastrup, S

1994-09-23

The subtilisin molecule possesses several internal water molecules, which may be characterised as an integral part of the protein structure. We have introduced specific mutations (T71I, T71S, T71V, T71A and T71G) at position 71 in the subtilisin variant Savinase from Bacillus lentus. This position is involved in a hydrogen bonded network with several internal water molecules, forming a water channel. The water channel and most of the other internal water molecules are positioned in the interface between two half-domains of the subtilisin molecule. The data presented here indicate that the internal water molecules are structural, and may be the result of trapping during the folding process.

[Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

Science.gov (United States)

Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

2013-01-01

To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

Continuum simulations of water flow past fullerene molecules

DEFF Research Database (Denmark)

Popadic, A.; Praprotnik, M.; Koumoutsakos, P.

2015-01-01

We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently by continuum flow...

Lateral displacement in small angle multiple scattering

Energy Technology Data Exchange (ETDEWEB)

Bichsel, H.; Hanson, K.M.; Schillaci, K.M. (Los Alamos National Lab., NM (USA))

1982-07-01

Values have been calculated for the average lateral displacement in small angle multiple scattering of protons with energies of several hundred MeV. The calculations incorporate the Moliere distribution which does not make the gaussian approximations of the distribution in projected angle and lateral deflections. Compared to other published data, such approximations can lead to errors in the lateral displacement of up to 10% in water.

The spontaneous synchronized dance of pairs of water molecules

Energy Technology Data Exchange (ETDEWEB)

Roncaratti, Luiz F. [Dipartimento di Chimica, Biologia e Biotecnologie, Università degli Studi di Perugia, 06123 Perugia (Italy); Instituto de Física, Universidade de Brasília, 70910-900 Brasília (Brazil); Cappelletti, David, E-mail: david.cappelletti@unipg.it; Pirani, Fernando [Dipartimento di Chimica, Biologia e Biotecnologie, Università degli Studi di Perugia, 06123 Perugia (Italy)

2014-03-28

Molecular beam scattering experiments have been performed to study the effect of long-range anisotropic forces on the collision dynamics of two small polar molecules. The main focus of this paper is on water, but also ammonia and hydrogen sulphide molecules have been investigated, and some results will be anticipated. The intermolecular distances mainly probed are of the order of 1 nm and therefore much larger than the molecular dimensions. In particular, we have found that the natural electric field gradient, generated by different spatial orientations of the permanent electric dipoles, is able to promote the transformation of free rotations into coupled pendular states, letting the molecular partners involved in the collision complex swinging to and fro around the field direction. This long-ranged concerted motion manifested itself as large increases of the magnitude of the total integral cross section. The experimental findings and the theoretical treatment developed to shed light on the details of the process suggest that the transformation from free rotations to pendular states depends on the rotational level of both molecules, on the impact parameter, on the relative collision velocity, on the dipole moment product and occurs in the time scale of picoseconds. The consequences of this intriguing phenomenon may be important for the interpretation and, in perspective, for the control of elementary chemical and biological processes, given by polar molecules, ions, and free radicals, occurring in several environments under various conditions.

The spontaneous synchronized dance of pairs of water molecules

International Nuclear Information System (INIS)

Roncaratti, Luiz F.; Cappelletti, David; Pirani, Fernando

2014-01-01

Molecular beam scattering experiments have been performed to study the effect of long-range anisotropic forces on the collision dynamics of two small polar molecules. The main focus of this paper is on water, but also ammonia and hydrogen sulphide molecules have been investigated, and some results will be anticipated. The intermolecular distances mainly probed are of the order of 1 nm and therefore much larger than the molecular dimensions. In particular, we have found that the natural electric field gradient, generated by different spatial orientations of the permanent electric dipoles, is able to promote the transformation of free rotations into coupled pendular states, letting the molecular partners involved in the collision complex swinging to and fro around the field direction. This long-ranged concerted motion manifested itself as large increases of the magnitude of the total integral cross section. The experimental findings and the theoretical treatment developed to shed light on the details of the process suggest that the transformation from free rotations to pendular states depends on the rotational level of both molecules, on the impact parameter, on the relative collision velocity, on the dipole moment product and occurs in the time scale of picoseconds. The consequences of this intriguing phenomenon may be important for the interpretation and, in perspective, for the control of elementary chemical and biological processes, given by polar molecules, ions, and free radicals, occurring in several environments under various conditions

Will the Displacement of Zebra Mussels by Quagga Mussels Increase Water Clarity in Shallow Lakes during Summer? Results from a Mesocosm Experiment

OpenAIRE

Mei, Xueying; Zhang, Xiufeng; Kassam, Sinan-Saleh; Rudstam, Lars G.

2016-01-01

Zebra mussels (Dreissena polymorpha) are known to increase water clarity and affect ecosystem processes in invaded lakes. During the last decade, the conspecific quagga mussels (D. rostriformis bugensis) have displaced zebra mussels in many ecosystems including shallow lakes such as Oneida Lake, New York. In this study, an eight-week mesocosm experiment was conducted to test the hypothesis that the displacement of zebra mussels by quagga mussels leads to further decreases in phytoplankton and...

Kinetics of proton migration in liquid water.

Science.gov (United States)

Chen, Hanning; Voth, Gregory A; Agmon, Noam

2010-01-14

We have utilized multistate empirical valence bond (MS-EVB3) simulations of protonated liquid water to calculate the relative mean-square displacement (MSD) and the history-independent time correlation function, c(t), of the hydrated proton center of excess charge (CEC) with respect to the water molecule on which it has initially resided. The MSD is nonlinear for the first 15 ps, suggesting that the relative diffusion coefficient increases from a small value, D(0), at short separations to its larger bulk value, D(infinity), at large separations. With the ensuing distance-dependent diffusion coefficient, D(r), the time dependence of both the MSD and c(t) agrees quantitatively with the solution of a diffusion equation for reversible geminate recombination. This suggests that the relative motion of the CEC is not independent from the nearby water molecules, in agreement with theoretical and experimental observations that large water clusters participate in the mechanism of proton mobility.

Diffusion of flexible, charged, nanoscopic molecules in solution: Size and pH dependence for PAMAM dendrimer

Science.gov (United States)

Maiti, Prabal K.; Bagchi, Biman

2009-12-01

In order to understand self-diffusion (D) of a charged, flexible, and porous nanoscopic molecule in water, we carry out very long, fully atomistic molecular dynamics simulation of PAMAM dendrimer up to eight generations in explicit salt water under varying pH. We find that while the radius of gyration (Rg) varies as N1/3, the self-diffusion constant (D ) scales, surprisingly, as N-α, with α =0.39 at high pH and 0.5 at neutral pH, indicating a dramatic breakdown of Stokes-Einstein relation for diffusion of charged nanoscopic molecules. The variation in D as a function of radius of gyration demonstrates the importance of treating water and ions explicitly in the diffusion process of a flexible nanoscopic molecule. In agreement with recent experiments, the self-diffusion constant increases with pH, revealing the importance of dielectric friction in the diffusion process. The shape of a dendrimer is found to fluctuate on a nanosecond time scale. We argue that this flexibility (and also the porosity) of the dendrimer may play an important role in determining the mean square displacement of the dendrimer and the breakdown of the Stokes-Einstein relation between diffusion constant and the radius.

Effects of Water Molecule on CO Oxidation by OH: Reaction Pathways, Kinetic Barriers, and Rate Constants.

Science.gov (United States)

Zhang, Linyao; Yang, Li; Zhao, Yijun; Zhang, Jiaxu; Feng, Dongdong; Sun, Shaozeng

2017-07-06

The water dilute oxy-fuel combustion is a clean combustion technology for near-zero emission power; and the presence of water molecule could have both kinetic and dynamic effects on combustion reactions. The reaction OH + CO → CO 2 + H, one of the most important elementary reactions, has been investigated by extensive electronic structure calculations. And the effects of a single water molecule on CO oxidation have been studied by considering the preformed OH(H 2 O) complex reacts with CO. The results show little change in the reaction pathways, but the additional water molecule actually increases the vibrationally adiabatic energy barriers (V a G ). Further thermal rate constant calculations in the temperature range of 200 to 2000 K demonstrate that the total low-pressure limit rate constant for the water assisted OH(H 2 O) + CO → CO 2 + H 2 O + H reaction is 1-2 orders lower than that of the water unassisted one, which is consistent with the change of V a G . Therefore, the hydrated radical OH(H 2 O) would actually slow down the oxidation of CO. Meanwhile, comparisons show that the M06-2X/aug-cc-pVDZ method gives a much better estimation in energy and thus is recommended to be employed for direct dynamics simulations.

Analytic vibration-rotational matrix elements for diatomic molecules

International Nuclear Information System (INIS)

Bouanich, J.P.

1987-01-01

The vibration-rotational matrix elements for infrared or Raman transitions vJ → v'J' of diatomic molecules are calculated for powers of the reduced displacement X from parameters of the Dunham potential-energy function. (orig.)

Molecular Dynamics Study of Water Molecules in Interlayer of 14 ^|^Aring; Tobermorite

KAUST Repository

Yoon, Seyoon

2013-01-01

The molecular structure and dynamics of interlayer water of 14 Å tobermorite are investigated based on molecular dynamics (MD) simulations. Calculated structural parameters of the interlayer water configuration are in good agreement with current knowledge of the refined structure. The MD simulations provide detailed information on the position and mobility of the hydrogen and oxygen of interlayer water, as well as its self-diffusion coefficient, through the interlayer of 14 Å tobermorite. Comparison of the MD simulation results at 100 and 300 K demonstrates that water molecules in the interlayer maintain their structure but change their mobility. The dominant configuration and self-diffusion coefficient of interlayer water are obtained in this study. Copyright © 2013 Japan Concrete Institute.

Protection of a PWR nuclear power stations against corrosion using hydrogen molecules to capture oxygen molecules

International Nuclear Information System (INIS)

Nahili, M.

2004-01-01

A protection method for the primary loops metals of nuclear power plants from corrosion was investigated. Hydrogen molecules were added to the primary circuit to eliminate oxygen molecules produced by radiolysis of coolant at the reactor core. The hydrogen molecules were produced by electrolyses of water and then added when the coolant water was passing through the primary coolant circuit. Thermodynamical process and the protection methods from corrosion were discussed, the discussion emphasized on the removal of oxygen molecules as one of the protection methods, and compared with other methods. The amount of hydrogen molecules needed for complete removal of oxygen was estimated in two cases: in the case without passing the water through the oxygen removal system, and in the case of passing water through the system. A pressurized water reactor VVER was chosen to be investigated in this study. The amount of hydrogen molecules was estimated so as to eliminate completely the oxygen molecules from coolant water. The estimated value was found to be less than the permissible range for coolant water for such type of reactors. A simulation study for interaction mechanism between hydrogen and oxygen molecules as water flowing in a tube similar to that of coolant water was performed with different water flow velocities. The interaction between the molecules of hydrogen and oxygen was described. The gas diffusion at the surface of the tube was found to play a major role in the interaction. A mathematical model was found to give full description of the change of oxygen concentration through the tube, as well as, to calculate the length of the tube where the concentration of oxygen reduced to few order of magnitude. (Author)

The importance of hydration thermodynamics in fragment-to-lead optimization.

Science.gov (United States)

Ichihara, Osamu; Shimada, Yuzo; Yoshidome, Daisuke

2014-12-01

Using a computational approach to assess changes in solvation thermodynamics upon ligand binding, we investigated the effects of water molecules on the binding energetics of over 20 fragment hits and their corresponding optimized lead compounds. Binding activity and X-ray crystallographic data of published fragment-to-lead optimization studies from various therapeutically relevant targets were studied. The analysis reveals a distinct difference between the thermodynamic profile of water molecules displaced by fragment hits and those displaced by the corresponding optimized lead compounds. Specifically, fragment hits tend to displace water molecules with notably unfavorable excess entropies-configurationally constrained water molecules-relative to those displaced by the newly added moieties of the lead compound during the course of fragment-to-lead optimization. Herein we describe the details of this analysis with the goal of providing practical guidelines for exploiting thermodynamic signatures of binding site water molecules in the context of fragment-to-lead optimization. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Assessing Climate Change Impacts on Water Resources and Colorado Agriculture Using an Equilibrium Displacement Mathematical Programming Model

OpenAIRE

Fathelrahman, Eihab; Davies, Amalia; Davies, Stephen; Pritchett, James

2014-01-01

This research models selected impacts of climate change on Colorado agriculture several decades in the future, using an Economic Displacement Mathematical Programming model. The agricultural economy in Colorado is dominated by livestock, which accounts for 67% of total receipts. Crops, including feed grains and forages, account for the remainder. Most agriculture is based on irrigated production, which depends on both groundwater, especially from the Ogallala aquifer, and surface water that c...

Investigation of N-acyl homoserine lactone (AHL) molecule production in Gram-negative bacteria isolated from cooling tower water and biofilm samples.

Science.gov (United States)

Haslan, Ezgi; Kimiran-Erdem, Ayten

2013-09-01

In this study, 99 Gram-negative rod bacteria were isolated from cooling tower water, and biofilm samples were examined for cell-to-cell signaling systems, N-acyl homoserine lactone (AHL) signal molecule types, and biofilm formation capacity. Four of 39 (10 %) strains isolated from water samples and 14 of 60 (23 %) strains isolated from biofilm samples were found to be producing a variety of AHL signal molecules. It was determined that the AHL signal molecule production ability and the biofilm formation capacity of sessile bacteria is higher than planktonic bacteria, and there was a statistically significant difference between the AHL signal molecule production of these two groups (p cooling tower water and biofilm samples produced different types of AHL signal molecules and that there were different types of AHL signal molecules in an AHL extract of bacteria. In the present study, it was observed that different isolates of the same strains did not produce the same AHLs or did not produce AHL molecules, and bacteria known as AHL producers did not produce AHL. These findings suggest that detection of signal molecules in bacteria isolated from cooling towers may contribute to prevention of biofilm formation, elimination of communication among bacteria in water systems, and blockage of quorum-sensing controlled virulence of these bacteria.

Molecular hydrogen solvated in water – A computational study

International Nuclear Information System (INIS)

Śmiechowski, Maciej

2015-01-01

The aqueous hydrogen molecule is studied with molecular dynamics simulations at ambient temperature and pressure conditions, using a newly developed flexible and polarizable H 2 molecule model. The design and implementation of this model, compatible with an existing flexible and polarizable force field for water, is presented in detail. The structure of the hydration layer suggests that first-shell water molecules accommodate the H 2 molecule without major structural distortions and two-dimensional, radial-angular distribution functions indicate that as opposed to strictly tangential, the orientation of these water molecules is such that the solute is solvated with one of the free electron pairs of H 2 O. The calculated self-diffusion coefficient of H 2 (aq) agrees very well with experimental results and the time dependence of mean square displacement suggests the presence of caging on a time scale corresponding to hydrogen bond network vibrations in liquid water. Orientational correlation function of H 2 experiences an extremely short-scale decay, making the H 2 –H 2 O interaction potential essentially isotropic by virtue of rotational averaging. The inclusion of explicit polarizability in the model allows for the calculation of Raman spectra that agree very well with available experimental data on H 2 (aq) under differing pressure conditions, including accurate reproduction of the experimentally noted trends with solute pressure or concentration

A theoretical model investigation of peptide bond formation involving two water molecules in ribosome supports the two-step and eight membered ring mechanism

International Nuclear Information System (INIS)

Wang, Qiang; Gao, Jun; Zhang, Dongju; Liu, Chengbu

2015-01-01

Highlights: • We theoretical studied peptide bond formation reaction mechanism with two water molecules. • The first water molecule can decrease the reaction barriers by forming hydrogen bonds. • The water molecule mediated three-proton transfer mechanism is the favorable mechanism. • Our calculation supports the two-step and eight membered ring mechanism. - Abstract: The ribosome is the macromolecular machine that catalyzes protein synthesis. The kinetic isotope effect analysis reported by Strobel group supports the two-step mechanism. However, the destination of the proton originating from the nucleophilic amine is uncertain. A computational simulation of different mechanisms including water molecules is carried out using the same reaction model and theoretical level. Formation the tetrahedral intermediate with proton transfer from nucleophilic nitrogen, is the rate-limiting step when two water molecules participate in peptide bond formation. The first water molecule forming hydrogen bonds with O9′ and H15′ in the A site can decrease the reaction barriers. Combined with results of the solvent isotope effects analysis, we conclude that the three-proton transfer mechanism in which water molecule mediate the proton shuttle between amino and carbon oxygen in rate-limiting step is the favorable mechanism. Our results will shield light on a better understand the reaction mechanism of ribosome

Will the Displacement of Zebra Mussels by Quagga Mussels Increase Water Clarity in Shallow Lakes during Summer? Results from a Mesocosm Experiment.

Directory of Open Access Journals (Sweden)

Xueying Mei

Full Text Available Zebra mussels (Dreissena polymorpha are known to increase water clarity and affect ecosystem processes in invaded lakes. During the last decade, the conspecific quagga mussels (D. rostriformis bugensis have displaced zebra mussels in many ecosystems including shallow lakes such as Oneida Lake, New York. In this study, an eight-week mesocosm experiment was conducted to test the hypothesis that the displacement of zebra mussels by quagga mussels leads to further decreases in phytoplankton and increases in water clarity resulting in increases in benthic algae. We found that the presence of zebra mussels alone (ZM, quagga mussels alone (QM, or an equal number of both species (ZQ reduced total phosphorus (TP and phytoplankton Chl a. Total suspended solids (TSS was reduced in ZM and ZQ treatments. Light intensity at the sediment surface was higher in all three mussel treatments than in the no-mussel controls but there was no difference among the mussel treatments. There was no increase in benthic algae biomass in the mussel treatments compared with the no-mussel controls. Importantly, there was no significant difference in nutrient (TP, soluble reactive phosphorus and NO3- levels, TSS, phytoplankton Chl a, benthic algal Chl a, or light intensity on the sediment surface between ZM, QM and ZQ treatments. These results confirm the strong effect of both mussel species on water clarity and indicate that the displacement of zebra mussel by an equivalent biomass of quagga mussel is not likely to lead to further increases in water clarity, at least for the limnological conditions, including summer temperature, tested in this experiment.

Will the Displacement of Zebra Mussels by Quagga Mussels Increase Water Clarity in Shallow Lakes during Summer? Results from a Mesocosm Experiment.

Science.gov (United States)

Mei, Xueying; Zhang, Xiufeng; Kassam, Sinan-Saleh; Rudstam, Lars G

2016-01-01

Zebra mussels (Dreissena polymorpha) are known to increase water clarity and affect ecosystem processes in invaded lakes. During the last decade, the conspecific quagga mussels (D. rostriformis bugensis) have displaced zebra mussels in many ecosystems including shallow lakes such as Oneida Lake, New York. In this study, an eight-week mesocosm experiment was conducted to test the hypothesis that the displacement of zebra mussels by quagga mussels leads to further decreases in phytoplankton and increases in water clarity resulting in increases in benthic algae. We found that the presence of zebra mussels alone (ZM), quagga mussels alone (QM), or an equal number of both species (ZQ) reduced total phosphorus (TP) and phytoplankton Chl a. Total suspended solids (TSS) was reduced in ZM and ZQ treatments. Light intensity at the sediment surface was higher in all three mussel treatments than in the no-mussel controls but there was no difference among the mussel treatments. There was no increase in benthic algae biomass in the mussel treatments compared with the no-mussel controls. Importantly, there was no significant difference in nutrient (TP, soluble reactive phosphorus and NO3-) levels, TSS, phytoplankton Chl a, benthic algal Chl a, or light intensity on the sediment surface between ZM, QM and ZQ treatments. These results confirm the strong effect of both mussel species on water clarity and indicate that the displacement of zebra mussel by an equivalent biomass of quagga mussel is not likely to lead to further increases in water clarity, at least for the limnological conditions, including summer temperature, tested in this experiment.

Possibilities of crack mouth opening displacement (CMOD) measurement under boiling and pressurized water reactor conditions

International Nuclear Information System (INIS)

Ehling, W.

1984-01-01

Fracture mechanics investigations carried out so far in laboratory conditions cover only part of the material stresses, as effects which occur in nuclear powerstations, in particular, such as corrosion and radioactive radiation are largely left out of account. Therefore experiments including these effects were recently carried out in autoclaves, test rigs simulating reactors (HRD experimental plant) and in experimental reactors. An important parameter of experimental fracture mechanics is the measurement of crack opening displacement (COD). The crack opening is measured with socalled clip gauges (transmitters based on strain gauges, which convert mechanical deformation of springs into electrical signals) on standard samples in the laboratory. It was therefore sensible to use these high temperature strain gauges (HTD) for the development of a measuring system for travel for pressurized water and boiling water reactor conditions. (orig.) [de

Relationship between diffusivity of water molecules inside hydrating tablets and their drug release behavior elucidated by magnetic resonance imaging.

Science.gov (United States)

Kikuchi, Shingo; Onuki, Yoshinori; Kuribayashi, Hideto; Takayama, Kozo

2012-01-01

We reported previously that sustained release matrix tablets showed zero-order drug release without being affected by pH change. To understand drug release mechanisms more fully, we monitored the swelling and erosion of hydrating tablets using magnetic resonance imaging (MRI). Three different types of tablets comprised of polyion complex-forming materials and a hydroxypropyl methylcellulose (HPMC) were used. Proton density- and diffusion-weighted images of the hydrating tablets were acquired at intervals. Furthermore, apparent self-diffusion coefficient maps were generated from diffusion-weighted imaging to evaluate the state of hydrating tablets. Our findings indicated that water penetration into polyion complex tablets was faster than that into HPMC matrix tablets. In polyion complex tablets, water molecules were dispersed homogeneously and their diffusivity was relatively high, whereas in HPMC matrix tablets, water molecule movement was tightly restricted within the gel. An optimal tablet formulation determined in a previous study had water molecule penetration and diffusivity properties that appeared intermediate to those of polyion complex and HPMC matrix tablets; water molecules were capable of penetrating throughout the tablets and relatively high diffusivity was similar to that in the polyion complex tablet, whereas like the HPMC matrix tablet, it was well swollen. This study succeeded in characterizing the tablet hydration process. MRI provides profound insight into the state of water molecules in hydrating tablets; thus, it is a useful tool for understanding drug release mechanisms at a molecular level.

New method to determine initial surface water displacement at tsunami source

Science.gov (United States)

Lavrentyev, Mikhail; Romanenko, Alexey; Tatarintsev, Pavel

2013-04-01

Friday, March 11, 2011 at 05:46:23 UTC, Japan was struck by an 8.9-magnitude earthquake near its Northeastern coast. This is one of the largest earthquakes that Japan has ever experienced. Tsunami waves swept away houses and cars and caused massive human losses. To predict tsunami wave parameters better and faster, we propose to improve data inversion scheme and achieve the performance gain of data processing. One of the reasons of inaccurate predictions of tsunami parameters is that very little information is available about the initial disturbance of the sea bed at tsunami source. In this paper, we suggest a new way of improving the quality of tsunami source parameters prediction. Modern computational technologies can accurately calculate tsunami wave propagation over the deep ocean provided that the initial displacement (perturbation of the sea bed at tsunami source) is known [4]. Direct geophysical measurements provide the location of an earthquake hypocenter and its magnitude (the released energy evaluation). Among the methods of determination of initial displacement the following ones should be considered. Calculation through the known fault structure and available seismic information. This method is widely used and provides useful information. However, even if the exact knowledge about rock blocks shifts is given, recalculation in terms of sea bed displacement is needed. This results in a certain number of errors. GPS data analysis. This method was developed after the December 2004 event in the Indian Ocean. A good correlation between dry land based GPS sensors and tsunami wave parameters was observed in the particular case of the West coast of Sumatra, Indonesia. This approach is very unique and can hardly been used in other geo locations. Satellite image analysis. The resolution of modern satellite images has dramatically improved. In the future, correct data of sea surface displacement will probably be available in real time, right after a tsunamigenic

Selective control of photodissociation in deutereted water molecule HOD

International Nuclear Information System (INIS)

Adhikari, S.; Deshpande, Sarin; Sarma, Manabendra; Kurkal, Vandana; Mishra, M.K.

2006-01-01

Bond dissociation in the deutereted water molecule HOD has been investigated to explore the possibility of selective control of dissociation of O-H and O-D bonds using simple field profiles and initial states that do not require high overtone excitations. Preliminary results indicate that considerable selectivity in dissociation of O-H and O-D bonds can be achieved using fundamental and first overtone excitations only and use of field optimized initial state (FOIST) based scheme with appropriate choice of field parameters and initial states may enhance both selectivity and yield

Energy-switching potential energy surface for the water molecule revisited: A highly accurate singled-sheeted form.

Science.gov (United States)

Galvão, B R L; Rodrigues, S P J; Varandas, A J C

2008-07-28

A global ab initio potential energy surface is proposed for the water molecule by energy-switching/merging a highly accurate isotope-dependent local potential function reported by Polyansky et al. [Science 299, 539 (2003)] with a global form of the many-body expansion type suitably adapted to account explicitly for the dynamical correlation and parametrized from extensive accurate multireference configuration interaction energies extrapolated to the complete basis set limit. The new function mimics also the complicated Sigma/Pi crossing that arises at linear geometries of the water molecule.

Direct numerical solution of the Ornstein-Zernike integral equation and spatial distribution of water around hydrophobic molecules

Science.gov (United States)

Ikeguchi, Mitsunori; Doi, Junta

1995-09-01

The Ornstein-Zernike integral equation (OZ equation) has been used to evaluate the distribution function of solvents around solutes, but its numerical solution is difficult for molecules with a complicated shape. This paper proposes a numerical method to directly solve the OZ equation by introducing the 3D lattice. The method employs no approximation the reference interaction site model (RISM) equation employed. The method enables one to obtain the spatial distribution of spherical solvents around solutes with an arbitrary shape. Numerical accuracy is sufficient when the grid-spacing is less than 0.5 Å for solvent water. The spatial water distribution around a propane molecule is demonstrated as an example of a nonspherical hydrophobic molecule using iso-value surfaces. The water model proposed by Pratt and Chandler is used. The distribution agrees with the molecular dynamics simulation. The distribution increases offshore molecular concavities. The spatial distribution of water around 5α-cholest-2-ene (C27H46) is visualized using computer graphics techniques and a similar trend is observed.

Molecular multipole moments of water molecules in ice Ih

International Nuclear Information System (INIS)

Batista, E.R.; Xantheas, S.S.; Jonsson, H.

1998-01-01

We have used an induction model including dipole, dipole endash quadrupole, quadrupole endash quadrupole polarizability and first hyperpolarizability as well as fixed octopole and hexadecapole moments to study the electric field in ice. The self-consistent induction calculations gave an average total dipole moment of 3.09 D, a 67% increase over the dipole moment of an isolated water molecule. A previous, more approximate induction model study by Coulson and Eisenberg [Proc. R. Soc. Lond. A 291, 445 (1966)] suggested a significantly smaller average value of 2.6 D. This value has been used extensively in recent years as a reference point in the development of various polarizable interaction potentials for water as well as for assessment of the convergence of water cluster properties to those of bulk. The reason for this difference is not due to approximations made in the computational scheme of Coulson and Eisenberg but rather due to the use of less accurate values for the molecular multipoles in these earlier calculations. copyright 1998 American Institute of Physics

Structural analysis on mutation residues and interfacial water molecules for human TIM disease understanding

Science.gov (United States)

2013-01-01

Background Human triosephosphate isomerase (HsTIM) deficiency is a genetic disease caused often by the pathogenic mutation E104D. This mutation, located at the side of an abnormally large cluster of water in the inter-subunit interface, reduces the thermostability of the enzyme. Why and how these water molecules are directly related to the excessive thermolability of the mutant have not been investigated in structural biology. Results This work compares the structure of the E104D mutant with its wild type counterparts. It is found that the water topology in the dimer interface of HsTIM is atypical, having a "wet-core-dry-rim" distribution with 16 water molecules tightly packed in a small deep region surrounded by 22 residues including GLU104. These water molecules are co-conserved with their surrounding residues in non-archaeal TIMs (dimers) but not conserved across archaeal TIMs (tetramers), indicating their importance in preserving the overall quaternary structure. As the structural permutation induced by the mutation is not significant, we hypothesize that the excessive thermolability of the E104D mutant is attributed to the easy propagation of atoms' flexibility from the surface into the core via the large cluster of water. It is indeed found that the B factor increment in the wet region is higher than other regions, and, more importantly, the B factor increment in the wet region is maintained in the deeply buried core. Molecular dynamics simulations revealed that for the mutant structure at normal temperature, a clear increase of the root-mean-square deviation is observed for the wet region contacting with the large cluster of interfacial water. Such increase is not observed for other interfacial regions or the whole protein. This clearly suggests that, in the E104D mutant, the large water cluster is responsible for the subunit interface flexibility and overall thermolability, and it ultimately leads to the deficiency of this enzyme. Conclusions Our study

Displaced Sense: Displacement, Religion and Sense-making

OpenAIRE

Naidu, Maheshvari

2016-01-01

Whether formally categorized as refugees or not, displaced migrants experience varying degrees of vulnerability in relation to where they find themselves displaced. The internally displaced furthermore squat invisibly and outside the boundaries of the legal framework and incentive structures accorded to those classified as 'refugee'. They are thus arguably, by and large, left to source sustaining solutions for themselves. This article works through the theoretical prism of sense-making theory...

Finite-bias electronic transport of molecules in a water solution

KAUST Repository

Rungger, Ivan

2010-06-04

The effects of water wetting conditions on the transport properties of molecular nanojunctions are investigated theoretically by using a combination of empirical-potential molecular-dynamics and first-principles electronic-transport calculations. These are at the level of the nonequilibrium Green’s-function method implemented for self-interaction corrected density-functional theory. We find that water effectively produces electrostatic gating to the molecular junction with a gating potential determined by the time-averaged water dipole field. Such a field is large for the polar benzene-dithiol molecule, resulting in a transmission spectrum shifted by about 0.6 eV with respect to that of the dry junction. The situation is drastically different for carbon nanotubes (CNTs). In fact, because of their hydrophobic nature the gating is almost negligible so that the average transmission spectrum of wet Au/CNT/Au junctions is essentially the same as that in dry conditions. This suggests that CNTs can be used as molecular interconnects also in water-wet situations, for instance, as tips for scanning tunnel microscopy in solution or in biological sensors.

Finite-bias electronic transport of molecules in a water solution

KAUST Repository

Rungger, Ivan; Chen, X.; Sanvito, Stefano; Schwingenschlö gl, Udo

2010-01-01

The effects of water wetting conditions on the transport properties of molecular nanojunctions are investigated theoretically by using a combination of empirical-potential molecular-dynamics and first-principles electronic-transport calculations. These are at the level of the nonequilibrium Green’s-function method implemented for self-interaction corrected density-functional theory. We find that water effectively produces electrostatic gating to the molecular junction with a gating potential determined by the time-averaged water dipole field. Such a field is large for the polar benzene-dithiol molecule, resulting in a transmission spectrum shifted by about 0.6 eV with respect to that of the dry junction. The situation is drastically different for carbon nanotubes (CNTs). In fact, because of their hydrophobic nature the gating is almost negligible so that the average transmission spectrum of wet Au/CNT/Au junctions is essentially the same as that in dry conditions. This suggests that CNTs can be used as molecular interconnects also in water-wet situations, for instance, as tips for scanning tunnel microscopy in solution or in biological sensors.

Mixing of alcohol and water molecules studied by neutron probe. Structure and dynamics

International Nuclear Information System (INIS)

Yoshida, Koji

2001-01-01

Structure of water/alcohol mixing solution was studied by three methods such as an isotope-exchanged neutron scattering method, RISM (Reference Interaction Site Model) integral equation and a neutron spin echo method. The principle of methods, experiments and results were reported. The results of experiments of water/tert-butyl alcohol (TBA) solution by the isotope-exchange neutron scattering method showed TBA molecule associated with each other through end methyl group. Especially this effect was the largest at x TBA = 0.06 and decreased with increasing the concentration of TBA. However, hydrogen bonding of TBA was very rare at x TBA = 0.06. By the partial radial distribution function obtained from RISM integral equation, it indicated that the structure of pure TBA became chain structure by hydrogen bond but changed to the structure contacted directly each hydrophobic group with increasing the concentration of water. Water/2-butoxyethanol (BE) mixing solution was measured by a neutron spin echo method. The activation energy of the diffusion coefficients obtained agreed to the energy of hydrogen bonding. The temperature response of diffusion coefficients showed the inverse of the experimental results obtained by the dynamic light scattering method. The difference between two measurement methods was different time scale and space scale. Namely, the object of the neutron scattering method is nano meter and nano second, but one of light scattering method many times over. It was proved from the above results that there was the cluster consisted of the same kind of molecule in the homogeneous two components solution, but the cluster was not stable and constantly exchanged with molecule, where the production and decay of the cluster is repeated at about nano sec. (S.Y.)

Identification of intrinsic catalytic activity for electrochemical reduction of water molecules to generate hydrogen

KAUST Repository

Shinagawa, Tatsuya

2015-01-01

Insufficient hydronium ion activities at near-neutral pH and under unbuffered conditions induce diffusion-limited currents for hydrogen evolution, followed by a reaction with water molecules to generate hydrogen at elevated potentials. The observed constant current behaviors at near neutral pH reflect the intrinsic electrocatalytic reactivity of the metal electrodes for water reduction. This journal is © the Owner Societies.

Measurement of liquid film in microchannels using a laser focus displacement meter

Science.gov (United States)

Hazuku, Tatsuya; Fukamachi, Norihiro; Takamasa, Tomoji; Hibiki, Takashi; Ishii, Mamoru

2005-06-01

This paper presents a new method for measuring the interfacial displacement of a liquid film in microchannels using a laser focus displacement meter (LFD). The purpose of the study is to clarify the effectiveness of the new method for obtaining detailed information concerning interfacial displacement, especially in the case of a thin liquid film, in microchannels and minichannels. To prevent the tube wall signal from disturbing that of the gas liquid interface, a fluorocarbon tube with a water box was used; the refraction index of this device is the same as that for water. With this method, accurate instantaneous measurements of the interfacial displacement of the liquid film were achieved. The error caused by refraction of the laser beam passing through the acrylic water box and fluorocarbon tube was estimated analytically and experimentally. The formulated analytical equation can estimate the real interface displacement by using the measured displacement in a fluorocarbon tube of 25 μm to 2.0 mm I.D. A preliminary test using fluorocarbon tubes of 1 mm and 2 mm I.D. showed that the corrected interface displacement calculated by the equation agreed with the real displacement to within a 1% margin of error. It was also confirmed that the LFD in the system could measure a liquid film of 0.25 μm at the thinnest. We made simultaneous measurements of the interface in fluorocarbon tubes of 0.5 mm and 1 mm I.D. using the LFD and a high-speed video camera with a microscope. These showed that the LFD could measure the interface of a liquid film with high spatial and temporal resolution during annular, slug, and piston flow regimes. The data also clarified the existence of a thin liquid film of less than 1 μm in thickness in the slug and annular flow regimes.

Measurement of liquid film in microchannels using a laser focus displacement meter

Energy Technology Data Exchange (ETDEWEB)

Hazuku, Tatsuya; Fukamachi, Norihiro; Takamasa, Tomoji [Tokyo University of Marine Science and Technology, Faculty of Marine Technology, Etchujima, Koto, Tokyo (Japan); Hibiki, Takashi [Kyoto University, Research Reactor Institute, Kumatori, Sennan, Osaka (Japan); Ishii, Mamoru [Purdue University, School of Nuclear Engineering, West Lafayette, IN (United States)

2005-06-01

This paper presents a new method for measuring the interfacial displacement of a liquid film in microchannels using a laser focus displacement meter (LFD). The purpose of the study is to clarify the effectiveness of the new method for obtaining detailed information concerning interfacial displacement, especially in the case of a thin liquid film, in microchannels and minichannels. To prevent the tube wall signal from disturbing that of the gas-liquid interface, a fluorocarbon tube with a water box was used; the refraction index of this device is the same as that for water. With this method, accurate instantaneous measurements of the interfacial displacement of the liquid film were achieved. The error caused by refraction of the laser beam passing through the acrylic water box and fluorocarbon tube was estimated analytically and experimentally. The formulated analytical equation can estimate the real interface displacement by using the measured displacement in a fluorocarbon tube of 25 {mu}m to 2.0 mm I.D. A preliminary test using fluorocarbon tubes of 1 mm and 2 mm I.D. showed that the corrected interface displacement calculated by the equation agreed with the real displacement to within a 1% margin of error. It was also confirmed that the LFD in the system could measure a liquid film of 0.25 {mu}m at the thinnest. We made simultaneous measurements of the interface in fluorocarbon tubes of 0.5 mm and 1 mm I.D. using the LFD and a high-speed video camera with a microscope. These showed that the LFD could measure the interface of a liquid film with high spatial and temporal resolution during annular, slug, and piston flow regimes. The data also clarified the existence of a thin liquid film of less than 1 {mu}m in thickness in the slug and annular flow regimes. (orig.)

Human serum albumin binding assay based on displacement of a non selective fluorescent inhibitor.

Science.gov (United States)

Thorarensen, Atli; Sarver, Ronald W; Tian, Fang; Ho, Andrea; Romero, Donna L; Marotti, Keith R

2007-08-15

In this paper, we describe a fluorescent antibacterial analog, 6, with utility as a competition probe to determine affinities of other antibacterial analogs for human serum albumin (HSA). Analog 6 bound to HSA with an affinity of 400+/-100 nM and the fluorescence was environmentally sensitive. With 370 nm excitation, environmental sensitivity was indicated by a quenching of the 530 nm emission when the probe bound to HSA. Displacement of dansylsarcosine from HSA by 6 indicated it competed with compounds that bound at site II (ibuprofen binding site) on HSA. Analog 6 also shifted the NMR peaks of an HSA bound oleic acid molecule that itself was affected by compounds that bound at site II. In addition to binding at site II, 6 interacted at site I (warfarin binding site) as indicated by displacement of dansylamide and the shifting of NMR peaks of an HSA bound oleic acid molecule affected by warfarin site binding. Additional evidence for multiple site interaction was discovered when a percentage of 6 could be displaced by either ibuprofen or phenylbutazone. A competition assay was established using 6 to determine relative affinities of other antibacterial inhibitors for HSA.

Identification of intrinsic catalytic activity for electrochemical reduction of water molecules to generate hydrogen

KAUST Repository

Shinagawa, Tatsuya; Takanabe, Kazuhiro

2015-01-01

Insufficient hydronium ion activities at near-neutral pH and under unbuffered conditions induce diffusion-limited currents for hydrogen evolution, followed by a reaction with water molecules to generate hydrogen at elevated potentials. The observed

The changes of macroscopic features and microscopic structures of water under influence of magnetic field

International Nuclear Information System (INIS)

Pang Xiaofeng; Deng Bo

2008-01-01

Influences of magnetic field on microscopic structures and macroscopic properties of water are studied by the spectrum techniques of infrared, Raman, visible, ultraviolet lights and X-ray. From these investigations, we know that the magnetic fields change the distribution of molecules and electrons, cause displacements and polarization of molecules and atoms, result in changes of dipole-moment transition and vibrational states of molecules and variation of transition probability of electrons, but does not alter the constitution of molecules and atoms. These are helpful in seeking the mechanism of magnetization of water. Meanwhile, we also measure the changed rules of the surface tension force, soaking effect or angle of contact, viscosity, rheology features, refraction index, dielectric constant and electric conductivity of magnetized water relative to that of pure water. The results show that the magnetic fields increase the soaking degree and hydrophobicity of water to materials, depress its surface-tension force, diminish the viscosity of war, enhance the feature of plastic flowing of water, and increase the refraction index, dielectric constant and electric conductivity of water after magnetization. These changes are caused by the above changes of microscopic structures under the action of magnetic field. Therefore, our studies are significant in science and has practical value of applications

Analysis of Citric Acid in Beverages: Use of an Indicator Displacement Assay

Science.gov (United States)

Umali, Alona P.; Anslyn, Eric V.; Wright, Aaron T.; Blieden, Clifford R.; Smith, Carolyne K.; Tian, Tian; Truong, Jennifer A.; Crumm, Caitlin E.; Garcia, Jorge E.; Lee, Soal; Mosier, Meredith; Nguyen, Chester P.

2010-01-01

The use of an indicator displacement assay permits the visualization of binding events between host and guest molecules. An undergraduate laboratory experiment is described to demonstrate the technique in the determination of citric acid content in commercially available beverages such as soda pop and fruit juices. Through the technique, students…

Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

DEFF Research Database (Denmark)

Rønnest, A. K.; Peters, Günther H.J.; Hansen, Flemming Yssing

2016-01-01

Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid...... compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have...... the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic...

Approximative Krieger-Nelkin orientation averaging and anisotropy of water molecules vibrations; Aproksimativno Krieger-Nelkinovo orijentacijsko usrednjenje i anozotropija vibracija molekula lake vode

Energy Technology Data Exchange (ETDEWEB)

Markovic, M I [Elektrothenicki fakultet, Belgrade (Yugoslavia)

1974-07-01

Quantum-mechanics approach of water molecules dynamics should be taken into account for precise theoretical calculation of differential scattering cross sections of neutrons. Krieger and Nelkin have proposed an approximate method for averaging orientation of molecules regarding directions of incoming and scattered neutron. This paper shows that this approach can be successfully applied for general shape of water molecule vibration anisotropy.

Effect of water molecule distribution on the quantitative XRD analysis in the case of Na-montmorillonite exchanged Cu2+

International Nuclear Information System (INIS)

Oueslati, W.; Meftah, M.; Ben Rhaiem, H.; Ben Haj Amara, A.

2010-01-01

Document available in extended abstract form only. Several theoretical models are proposed to describe hydration process for Wyoming-montmorillonite clay exchanged Na + or Cu 2+ . They propose some theoretical distribution and disposition for water molecule in the inter-lamellar space in the case of homogeneous and inter-stratified hydration states. For example, Ben Brahim et al. (1983a) studied the interlayer structure (atomic positions of interlayer cations) and associated H 2 O molecules of Na-saturated montmorillonite and beidellite samples. Moore and Hower (1986) studied ordered structures composed of mono-hydrated and collapsed interlayers in montmorillonite, and Cuadros (1996) estimated the H 2 O content of smectite as a function of the interlayer cation. Using similar approach, Ferrage et al (2005b) proposed a discreet distribution of water molecule layer in the same z coordinate of the exchangeable cation with inhomogeneous distribution. This heterogeneity was attributed to the surface charge. The main objective of this study is to characterize the structural changes in the theoretical XRD profile, induced by different water molecule distribution, used to simulate experimental XRD patterns in the case of Na-montmorillonite exchanged Cu 2+ . This problem was achieved by quantitative XRD analysis using an indirect method based on the comparison of the experimental 001 reflections obtained from oriented films patterns with those calculated from structural models. The starting materials were Ca-montmorillonite originated from bentonites of Wyoming (USA). The XRD patterns were obtained by reflection setting with a D8 ADVANCE Bruker installation using Cu-Kα radiation and equipped with solid state detector. Intensities were measured at an interval of 2Θ 0.04 deg. and 40-50 s counting time per step. The diffracted intensity was calculated according to the matrix formalism detailed by Drits and Tchoubar, (1990). The fitting strategies was detailed by Ferrage et

QSPR Study of the Retention/release Property of Odorant Molecules in Water Using Statistical Methods

Directory of Open Access Journals (Sweden)

Assia Belhassan

2017-10-01

Full Text Available An integrated approach physicochemistry and structures property relationships has been carried out to study the odorant molecules retention/release phenomenon in the water. This study aimed to identify the molecular properties (molecular descriptors that govern this phenomenon assuming that modifying the structure leads automatically to a change in the retention/release property of odorant molecules. ACD/ChemSketch, MarvinSketch, and ChemOffice programs were used to calculate several molecular descriptors of 51 odorant molecules (15 alcohols, 11 aldehydes, 9 ketones and 16 esters. A total of 37 molecules (2/3 of the data set were placed in the training set to build the QSPR models, whereas the remaining, 14 molecules (1/3 of the data set constitute the test set. The best descriptors were selected to establish the quantitative structure property relationship (QSPR of the retention/release property of odorant molecules in water using multiple linear regression (MLR, multiple non-linear regression (MNLR and an artificial neural network (ANN methods. We propose a quantitative model according to these analyses. The models were used to predict the retention/release property of the test set compounds, and agreement between the experimental and predicted values was verified. The descriptors showed by QSPR study are used for study and designing of new compounds. The statistical results indicate that the predicted values are in good agreement with the experimental results. To validate the predictive power of the resulting models, external validation multiple correlation coefficient was calculated and has both in addition to a performant prediction power, a favorable estimation of stability. DOI: http://dx.doi.org/10.17807/orbital.v9i4.978 

Experimental validation of a numerical model of two-phase displacement in porous medium

International Nuclear Information System (INIS)

Genty, A.

1996-01-01

Burial in geological layers appears to be an interesting solution to dispose of radioactive wastes. This thesis analyzes and simulates the behaviour of gas produced by waste barrels corrosion. The released contaminated gas drains the water initially present in the host rock and yields a water-gas two phase flow. A literature survey of two phase flow shows that fluid interfaces may display instabilities for definite flow characteristics. When the displacement is stable a smooth interface proceeds through the porous medium. When the interface shows fingering, the displacement is said to be 'viscous-unstable', and when the front is jagged the displacement is called 'capillary' displacement. A dimensional analysis of classical equations governing two phase flow in porous media is combined with a classification of dominant forces to define an original map of flow regimes that includes gravitational forces. The map is based on three dimensionless numbers and predicts a priori the flow type. For typical data describing a radioactive waste repository a 'viscous-unstable' displacement is predicted by the map. We simulate water-gas displacement with a numerical model previously developed; this code, based on the Muskat model, uses the mixed-hybrid finite elements technique and is therefore well adapted for tracking moving interfaces. Fluxes are well conserved, however instabilities cannot be simulated. We assume that there is always a scale to be found where instabilities can be averaged and we try to validate the model with experimental two phase flows. We performed laboratory water-gas flow experiments for a variety of flow conditions. The observed displacement types are consistent with the map of flow regimes. Good agreement with numerical simulations is obtained when precise parameters of the displacements are available, in particular relative permeability curves. We conclude that our model allows a first approach of migration of gas near a radioactive waste repository

Fractionation of hydrogen and oxygen isotopes between hydrated and free water molecules in aqueous urea solution

International Nuclear Information System (INIS)

Kakiuchi, M.; Matsuo, S.

1985-01-01

Ratios of D/H and 18 O/ 16 O in the vapor phase in equilibrium with aqueous urea solution with different urea molalities were measured at 15 and 25 0 C. Under the assumption that urea solutions consist of two species, i.e., the urea-water cluster and free water, the results are interpreted to give the average hydration number, i.e., the number of water molecules per urea molecule in the urea-water cluster. Good agreement was obtained for the hydration number estimated independently from hydrogen and oxygen isotopic fractions. On the basis of hydrogen isotopic data at 25 0 C, the average hydration number of urea in the cluster is 6.3 +/- 0.8 at 2.1 m and 2.75 +/- 0.08 at saturation (20.15 m). The corresponding average hydration numbers based on oxygen isotopic data were calculated to be 6.7 +/- 2.4 at 2.1 m and 2.75 +/- 0.25 at urea saturation. HD 16 O is enriched in the urea-water cluster and H 2 18 O is enriched in free water. Isotopic partitioning between the cluster and free water is markedly different from those between hydration spheres and free water in aqueous electrolyte solutions. 29 references, 6 figures, 5 tables

Measurement on liquid film in microchannels using laser focus displacements meter

International Nuclear Information System (INIS)

Fukamachi, Norihiro; Tamura, Naohisa; Hazuku, Tatsuya; Takamasa, Tomoji

2003-01-01

To elucidate details of the fascinating nonlinear phenomena of gas-liquid interface in micro- and mini-channels, high spatial temporal knowledge of the interface in gas-liquid two-phase flows is essential. This paper presents a new method for measuring interface of liquid film in microchannels using a laser focus displacement meter(LFD). The purpose of the study was to clarify the effectiveness the new method for obtaining detailed information of interface displacement, especially in the case of thin liquid film, in micro- and mini-channels. In the test, water and nitrogen gas were used as working fluids. To eliminate the signal of tube wall disturbing that of gas-liquid interface, a fluorocarbon tube with water box was used; whose refraction index was the same as one of water. With this method, accurate measurements of the interface of liquid film, in real time, with sensitivity of 0.1 μm and 1 kHz, were achieved. The error caused by the refraction of the laser beam passing through the acrylic water box and fluorocarbon tube was estimated theoretically and experimentally. The formulated theoretical equation can derive the real interface displacement using measured displacement in a fluorocarbon tube of 25 μm -2.0 mm I.D. A preliminary test using fluorocarbon tubes of 1 and 2 mm in I.D. showed that the corrected interface displacement calculated by the equation agreed with real displacement within a 1% margin of error. Simultaneous measurement on the interface in a fluorocarbon tube of 0.5 and 1 mm in I.D. using the LFD and a high-speed camera movie with a microscope was carried out. It showed that the LFD could measure the interface of liquid film in high spatially and temporally in annular, slug and piston flow regions and clarified the existence of thin liquid film thinner than 1 μm in thickness in slug and annular regions. (author)

Double Displacement: an Improved Bioorthogonal Reaction Strategy for Templated Nucleic Acid Detection

OpenAIRE

Kleinbaum, Daniel J.; Miller, Gregory P.; Kool, Eric T.

2010-01-01

Quenched autoligation probes have been employed previously in a target-templated nonenzymatic ligation strategy for detecting nucleic acids in cells by fluorescence. A common source of background signal in such probes is undesired reaction with water and other cellular nucleophiles. Here we describe a new class of self-ligating probes, double displacement (DD) probes, that rely on two displacement reactions to fully unquench a nearby fluorophore. Three potential double displacement architectu...

Sensing single electrons with single molecules

International Nuclear Information System (INIS)

Plakhotnik, Taras

2007-01-01

We propose a new methodology for probing transport of just one electron, a process of great importance both in nature and in artificial devices. Our idea for locating a single electron is analogues to the conventional GPS where signals from several satellites are used to locate a macro object. Using fluorescent molecules as tiny sensors, it is possible to determine 3D displacement vector of an electron

Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

International Nuclear Information System (INIS)

Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

2005-01-01

We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

Stability of metal organic frameworks and interaction of small gas molecules in these materials

Science.gov (United States)

Tan, Kui

The work in this dissertation combines spectroscopy ( in-situ infrared absorption and Raman), powder X-ray diffraction and DFT calculations to study the stability of metal organic frameworks materials (MOFs) in the presence of water vapor and other corrosive gases (e.g., SO 2, NO2 NO), and the interaction and competitive co-adsorption of several gases within MOFs by considering two types of prototypical MOFs: 1) a MOF with saturated metal centers based on paddlewheel secondary building units: M(bdc)(ted)0.5 [M=Cu, Zn, Ni, Co, bdc = 1,4-benzenedicarboxylate, ted = triethylenediamine], and 2) a MOF with unsaturated metal centers: M2(dobdc) [M=Mg2+, Zn2+, Ni2+, Co2+ and dobdc = 2,5-dihydroxybenzenedicarboxylate]. We find that the stability of MOFs to water vapor critically depends on their structure and the specific metal cation in the building units. For M(bdc)(ted)0.5, the metal-bdc bond is the most vulnerable for Cu(bdc)(ted)0.5, while the metal-ted bond is first attacked for the Zn and Co analogs. In contrast, Ni(bdc)(ted)0.5 remains stable under the same conditions. For M2(dobdc), or MOF-74, the weak link is the dobdc-metal bond. The water molecule is dissociatively adsorbed at the metal-oxygen group with OH adsorption directly on the metal center and H adsorption on the bridging O of the phenolate group in the dobdc linker. Other technologically important molecules besides water, such as NO, NO2, SO2, tend to poison M2(dobdc) through dissociative or molecular adsorption onto the open metal sites. A high uptake SO2 capacity was measured in M(bdc)(ted)0.5, attributed to multipoint interactions between the guest SO2 molecule and the MOF host. In the case of competitive co-adsorption between CO2 and other small molecules, we find that binding energy alone is not a good indicator of molecular site occupation within the MOF (i.e., it cannot successfully predict and evaluate the displacement of CO2 by other molecules). Instead, we show that the kinetic barrier for the

Continuum Navier-Stokes modelling of water ow past fullerene molecules

DEFF Research Database (Denmark)

Walther, J. H.; Popadic, A.; Koumoutsakos, P.

We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the computational cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently...

Continuum Navier-Stokes modelling of water flow past fullerene molecules

DEFF Research Database (Denmark)

Walther, J. H.; Popadic, A.; Koumoutsakos, P.

We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the computational cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently...

Strand displacement activated peroxidase activity of hemin for fluorescent DNA sensing.

Science.gov (United States)

Wang, Quanbo; Xu, Nan; Gui, Zhen; Lei, Jianping; Ju, Huangxian; Yan, Feng

2015-10-07

To efficiently regulate the catalytic activity of the peroxidase mimic hemin, this work designs a double-stranded DNA probe containing an intermolecular dimer of hemin, whose peroxidase activity can be activated by a DNA strand displacement reaction. The double-stranded probe is prepared by annealing two strands of hemin labelled DNA oligonucleotides. Using the fluorescent oxidation product of tyramine by H2O2 as a tracing molecule, the low peroxidase activity of the hemin dimer ensures a low fluorescence background. The strand displacement reaction of the target DNA dissociates the hemin dimer and thus significantly increases the catalytic activity of hemin to produce a large amount of dityramine for fluorescence signal readout. Based on the strand displacement regulated peroxidase activity, a simple and sensitive homogeneous fluorescent DNA sensing method is proposed. The detection can conveniently be carried out in a 96-well plate within 20 min with a detection limit of 0.18 nM. This method shows high specificity, which can effectively distinguish single-base mismatched DNA from perfectly matched target DNA. The DNA strand displacement regulated catalytic activity of hemin has promising application in the determination of various DNA analytes.

Sequential strand displacement beacon for detection of DNA coverage on functionalized gold nanoparticles.

Science.gov (United States)

Paliwoda, Rebecca E; Li, Feng; Reid, Michael S; Lin, Yanwen; Le, X Chris

2014-06-17

Functionalizing nanomaterials for diverse analytical, biomedical, and therapeutic applications requires determination of surface coverage (or density) of DNA on nanomaterials. We describe a sequential strand displacement beacon assay that is able to quantify specific DNA sequences conjugated or coconjugated onto gold nanoparticles (AuNPs). Unlike the conventional fluorescence assay that requires the target DNA to be fluorescently labeled, the sequential strand displacement beacon method is able to quantify multiple unlabeled DNA oligonucleotides using a single (universal) strand displacement beacon. This unique feature is achieved by introducing two short unlabeled DNA probes for each specific DNA sequence and by performing sequential DNA strand displacement reactions. Varying the relative amounts of the specific DNA sequences and spacing DNA sequences during their coconjugation onto AuNPs results in different densities of the specific DNA on AuNP, ranging from 90 to 230 DNA molecules per AuNP. Results obtained from our sequential strand displacement beacon assay are consistent with those obtained from the conventional fluorescence assays. However, labeling of DNA with some fluorescent dyes, e.g., tetramethylrhodamine, alters DNA density on AuNP. The strand displacement strategy overcomes this problem by obviating direct labeling of the target DNA. This method has broad potential to facilitate more efficient design and characterization of novel multifunctional materials for diverse applications.

Influence of the water molecules near surface of viral protein on virus activation process

Energy Technology Data Exchange (ETDEWEB)

O, Shepelenko S; S, Salnikov A; V, Rak S; P, Goncharova E; B, Ryzhikov A, E-mail: shep@vector.nsc.r, E-mail: shep@ngs.r [Federal State Research Institution State Research Center of Virology and Biotechnology VECTOR of the Federal Service for Surveillance in Consumer Rights Protection and Human Well-being (FSRI SRC VB VECTOR) Koltsovo, Novosibirsk Region (Russian Federation)

2009-06-01

The infection of a cell with influenza virus comprises the stages of receptor binding to the cell membrane, endocytosis of virus particle, and fusion of the virus envelope and cell endosome membrane, which is determined by the conformational changes in hemagglutinin, a virus envelope protein, caused by pH decrease within the endosome. The pH value that induces conformation rearrangements of hemagglutinin molecule considerably varies for different influenza virus strains, first and foremost, due to the differences in amino acid structure of the corresponding proteins. The main goal of this study was to construct a model making it possible to assess the critical pH value characterizing the fusogenic activity of influenza virus hemagglutinin from the data on hemagglutinin structure and experimental verification of this model. Under this model, we assume that when the electrostatic force between interacting hemagglutinin molecules in the virus envelop exceeds a certain value, the hemagglutinin HA1 subunits are arranged so that they form a cavity sufficient for penetration of water molecules. This event leads to an irreversible hydration of the inner fragments of hemagglutinin molecule in a trimer and to the completion of conformational changes. The geometry of electrostatic field in hemagglutinin trimer was calculated taking into account the polarization effects near the interface of two dielectrics, aqueous medium and protein macromolecule. The critical pH values for the conformational changes in hemagglutinin were measured by the erythrocyte hemolysis induced by influenza virus particles when decreasing pH. The critical pH value conditionally separating the pH range into the regions with and without the conformational changes was calculated for several influenza virus H1N1 and H3N2 strains based on the data on the amino acid structure of the corresponding hemagglutinin molecules. Comparison of the theoretical and experimental values of critical pH values for

Orbiting Water Molecules Dance to Tune Of Galaxy's "Central Engine," Astronomers Say

Science.gov (United States)

2000-01-01

A disk of water molecules orbiting a supermassive black hole at the core of a galaxy 60 million light-years away is "reverberating" in response to variations in the energy output from the galaxy's powerful "central engine" close to the black hole, astronomers say. The team of astronomers used the National Science Foundation's (NSF) Very Large Array (VLA) radio telescope in New Mexico and the 100-meter-diameter radio telescope of the Max Planck Institute for Radio Astronomy at Effelsberg, Germany, to observe the galaxy NGC 1068 in the constellation Cetus. They announced their findings today at the American Astronomical Society's meeting in Atlanta. The water molecules, in a disk some 5 light-years in diameter, are acting as a set of giant cosmic radio-wave amplifiers, called masers. Using energy radiated by the galaxy's "central engine," the molecules strengthen, or brighten, radio emission at a particular frequency as seen from Earth. "We have seen variations in the radio 'brightness' of these cosmic amplifiers that we believe were caused by variations in the energy output of the central engine," said Jack Gallimore, an astronomer at the National Radio Astronomy Observatory (NRAO) in Charlottesville, VA. "This could provide us with a valuable new tool for learning about the central engine itself," he added. Gallimore worked with Stefi Baum of the Space Telescope Science Institute in Baltimore, MD; Christian Henkel of the Max Planck Institute for Radio Astronomy in Bonn, Germany; Ian Glass of the South African Astronomical Observatory; Mark Claussen of the NRAO in Socorro, NM; and Almudena Prieto of the European Southern Observatory in Munich, Germany. "Our observations show that NGC 1068 is the second-known case of a giant disk of water molecules orbiting a supermassive black hole at a galaxy's core," Gallimore said. The first case was the galaxy NGC 4258 (Messier 106), whose disk of radio-amplifying water molecules was measured by the NSF's Very Long Baseline

Shore line displacement in Oeregrundsgrepen

International Nuclear Information System (INIS)

Brydsten, Lars

1999-12-01

This report is a part of the SKB project 'SAFE' (Safety Assessment of the Final Repository of Radioactive Operational Waste). The aim of project SAFE is to update the previous safety analysis of SFR-1. The analysis is to be presented to the Swedish authorities not later than the end of 2000. SFR-1 is a facility for disposal of low and intermediate level radioactive waste and is situated in bedrock beneath the Baltic Sea, 1 km off the coast near the Forsmark nuclear power plant in Northern Uppland. The shore displacement in the Oeregrundsgrepen area is at present approximately 60 cm per 100 years and is slowly decreasing, but will still be substantial for many thousands of years. Since Oeregrundsgrepen is a relatively shallow part of the Bothnian Sea, the positive shore displacement will greatly effect the proportions of land and sea in the future. Within 2000 years (4000 AD) half of the current water area in Oeregrundsgrepen will be land and the water volume will be decreased with two thirds. At 7000 AD, the whole Oeregrundsgrepen area will be without brackish water. The effects on the landscape evolution due to shore displacement in the Oeregrundsgrepen area are illustrated in a chronological series of digital maps in Power Point format available saved on the supplied CD-rom and entitled 'Elevation.ppt '. The bedrock tectonics in the area are in two dominating directions: one northern that can be seen in the west shoreline of the island Graesoe and one in a north-westerly direction seen in the shoreline of the mainland. Many of the large basins that will be established in the area due to the shore displacement will be elongated in one of these directions. Some of the basins are relatively shallow and therefore probably will be totally filled with organic rich sediments and will form peat or bogs. Other basins, especially Graesoeraennan (the deep channel on the west side of Graesoe) are deep basins and will form a long chain of deep lakes. One of the deeper basins

Shore line displacement in Oeregrundsgrepen

Energy Technology Data Exchange (ETDEWEB)

Brydsten, Lars [Umeaa Univ. (Sweden). Dept. of Ecology and Environmental Science

1999-12-15

This report is a part of the SKB project 'SAFE' (Safety Assessment of the Final Repository of Radioactive Operational Waste). The aim of project SAFE is to update the previous safety analysis of SFR-1. The analysis is to be presented to the Swedish authorities not later than the end of 2000. SFR-1 is a facility for disposal of low and intermediate level radioactive waste and is situated in bedrock beneath the Baltic Sea, 1 km off the coast near the Forsmark nuclear power plant in Northern Uppland. The shore displacement in the Oeregrundsgrepen area is at present approximately 60 cm per 100 years and is slowly decreasing, but will still be substantial for many thousands of years. Since Oeregrundsgrepen is a relatively shallow part of the Bothnian Sea, the positive shore displacement will greatly effect the proportions of land and sea in the future. Within 2000 years (4000 AD) half of the current water area in Oeregrundsgrepen will be land and the water volume will be decreased with two thirds. At 7000 AD, the whole Oeregrundsgrepen area will be without brackish water. The effects on the landscape evolution due to shore displacement in the Oeregrundsgrepen area are illustrated in a chronological series of digital maps in Power Point format available saved on the supplied CD-rom and entitled 'Elevation.ppt '. The bedrock tectonics in the area are in two dominating directions: one northern that can be seen in the west shoreline of the island Graesoe and one in a north-westerly direction seen in the shoreline of the mainland. Many of the large basins that will be established in the area due to the shore displacement will be elongated in one of these directions. Some of the basins are relatively shallow and therefore probably will be totally filled with organic rich sediments and will form peat or bogs. Other basins, especially Graesoeraennan (the deep channel on the west side of Graesoe) are deep basins and will form a long chain of deep lakes. One

Displacement Parameter Inversion for a Novel Electromagnetic Underground Displacement Sensor

Directory of Open Access Journals (Sweden)

Nanying Shentu

2014-05-01

Full Text Available Underground displacement monitoring is an effective method to explore deep into rock and soil masses for execution of subsurface displacement measurements. It is not only an important means of geological hazards prediction and forecasting, but also a forefront, hot and sophisticated subject in current geological disaster monitoring. In previous research, the authors had designed a novel electromagnetic underground horizontal displacement sensor (called the H-type sensor by combining basic electromagnetic induction principles with modern sensing techniques and established a mutual voltage measurement theoretical model called the Equation-based Equivalent Loop Approach (EELA. Based on that work, this paper presents an underground displacement inversion approach named “EELA forward modeling-approximate inversion method”. Combining the EELA forward simulation approach with the approximate optimization inversion theory, it can deduce the underground horizontal displacement through parameter inversion of the H-type sensor. Comprehensive and comparative studies have been conducted between the experimentally measured and theoretically inversed values of horizontal displacement under counterpart conditions. The results show when the measured horizontal displacements are in the 0–100 mm range, the horizontal displacement inversion discrepancy is generally tested to be less than 3 mm under varied tilt angles and initial axial distances conditions, which indicates that our proposed parameter inversion method can predict underground horizontal displacement measurements effectively and robustly for the H-type sensor and the technique is applicable for practical geo-engineering applications.

Single-Molecule Imaging of DNAs with Sticky Ends at Water/Fused Silica Interface

Energy Technology Data Exchange (ETDEWEB)

Isailovic, Slavica [Iowa State Univ., Ames, IA (United States)

2005-01-01

Total internal reflection fluorescence microscopy (TIRFM) was used to study intermolecular interactions of DNAs with unpaired (sticky) ends of different lengths at water/fused silica interface at the single-molecule level. Evanescent field residence time, linear velocity and adsorption/desorption frequency were measured in a microchannel for individual DNA molecules from T7, Lambda, and PSP3 phages at various pH values. The longest residence times and the highest adsorption/desorption frequencies at the constant flow at pH 5.5 were found for PSP3 DNA, followed by lower values for Lambda DNA, and the lowest values for T7 DNA. Since T7, Lambda, and PSP3 DNA molecules contain none, twelve and nineteen unpaired bases, respectively, it was concluded that the affinity of DNAs for the surface increases with the length of the sticky ends. This confirms that hydrophobic and hydrogen-bonding interactions between sticky ends and fused-silica surface are driving forces for DNA adsorption at the fused-silica surface. Described single-molecule methodology and results therein can be valuable for investigation of interactions in liquid chromatography, as well as for design of DNA hybridization sensors and drug delivery systems.

Groundwater resources monitoring and population displacement in northern Uganda

Science.gov (United States)

Chalikakis, K.; Hammache, Y.; Nawa, A.; Slinski, K.; Petropoulos, G.; Muteesasira, A.

2009-04-01

Northern Uganda has been devastated by more than 20 years of open conflict by the LRA (Lord's Resistance Army) and the Government of Uganda. This war has been marked by extreme violence against civilians, who had been gathered in protected IDP (Internally Displaced Persons) camps. At the height of the displacement in 2007, the UN office for coordination of humanitarian affairs, estimated that nearly 2.5 million people were interned into approximately 220 camps throughout Northern Uganda. With the improved security since mid-2006, the people displaced by the conflict in Northern Uganda started to move out of the overcrowded camps and return either to their villages/parishes of origin or to resettlement/transit sites. However, basic water, sanitation and hygiene infrastructure in the return areas or any new settlements sites are minimal. People returning to their villages of origin encounter a situation where in many cases there is no access to safe water. Since 1998 ACF (Action Against Hunger, part of the Action Contre la Faim International Network) activities have been concentrated in the Acholi and Lango regions of Northern Uganda. ACF's WASH (Water, sanitation and hygiene) department interventions concern sanitation infrastructure, hygiene education and promotion as well as water points implementation. To ensure safe water access, actions are focused in borehole construction and traditional spring rehabilitation, also called "protected" springs. These activities follow the guidelines as set forth by the international WASH cluster, led by UNICEF. A three year project (2008-2010) is being implemented by ACF, to monitor the available groundwater resources in Northern Uganda. The main objectives are: 1. to monitor the groundwater quality from existing water points during different hydrological seasons, 2. to identify, if any, potential risks of contamination from population concentrations and displacement, lack of basic infrastructure and land use, and finally 3. to

Importance of protamine phosphorylation to histone displacement in spermatids: can the disruption of this process be used for male contraception

Energy Technology Data Exchange (ETDEWEB)

Balhorn, R.; Hud, N.V.; Corzett, M.; Mazrimas, J.

1995-06-01

Protamine is a small protein that packages DNA in the sperm of most vertebrates. Shortly after its synthesis, the serine and threonine residues in each protamine are phosphorylated and the modified proteins are deposited onto DNA, displacing the histones and other chromatin proteins. We have hypothesized that the phosphorylation of protamine 1 induces protamine dimerization and these dimers are required for efficient histone displacement. Histone displacement by protamines in late-step spermatids appears to be essential for the production of fertile sperm in man and other mammals, and the disruption of this process could provide a new approach for male contraception. As a first step towards testing this theory, we have initiated a set of in vitro experiments to determine whether of not protamine phosphorylation is essential for histone displacement. Thee results of these experiments, although incomplete, confirm that unphosphorylated protamine cannot effectively displace histone from DNA. Polyarginine molecules twice the size of a protamine molecule and salmine dimer were found to be more effective. These results are consistent with the theory that the disruption of protamine phosphorylation may prove to be a useful new approach for male contraception if it can be shown to facilitate or induce protamine dimerization.

Experimental Study on the Properties and Displacement Effects of Polymer Surfactant Solution

Directory of Open Access Journals (Sweden)

Ke-Liang Wang

2013-01-01

Full Text Available Based on the characteristics of oil reservoirs and the requirements of further enhancing oil recovery at high water cut stage of Pubei Oilfield, the displacement performance of polymer surfactant is evaluated. Reasonable injection parameters and oil displacement effects after water flooding are also researched. Compared with conventional polymer with intermediate molecular weight, polymer surfactant has the properties of higher viscosity at low concentration condition and lower interfacial tension. Laboratory experiments indicate that the displacement effect of polymer surfactant is much better than that of conventional polymer at a slug size of 0.57 PV. The oil recovery of polymer surfactant increases by more than 10% after water flooding. Considering the actual situation of low-permeability of Pubei Oilfield reservoirs, the system viscosity of 30 mPa·s is chosen. The corresponding concentration of Type III polymer surfactant is 600 mg/L and the injected slug is 0.57 PV and the oil recovery can be increased by 11.69%.

Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes

Energy Technology Data Exchange (ETDEWEB)

Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)

2012-12-19

Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

Enhanced Oil Recovery Using Micron-Size Polyacrylamide Elastic Microspheres (MPEMs): Underlying Mechanisms and Displacement Experiments

KAUST Repository

Yao, Chuanjin; Lei, Guanglun; Hou, Jian; Xu, Xiaohong; Wang, Dan; Steenhuis, Tammo S.

2015-01-01

Micron-size polyacrylamide elastic microsphere (MPEM) is a newly developed profile control and oil displacement agent for enhanced oil recovery in heterogeneous reservoirs. In this study, laboratory experiments were performed to characterize the viscoelastic properties of MPEMs in brine water. A transparent sandpack micromodel was used to observe the microscopic flow and displacement mechanisms, and parallel-sandpack models were used to investigate the profile control and oil displacement performance using MPEMs in heterogeneous reservoirs. The results indicate that MPEMs almost do not increase the viscosity of injection water and can be conveniently injected using the original water injection pipelines. The microscopic profile control and oil displacement mechanisms of MPEMs in porous media mainly behave as selective-plugging in large pores, fluid diversion after MPEMs plugging, oil drainage caused by MPEMs breakthrough, and the mechanism of oil droplets converging into oil flow. MPEMs have a high plugging strength, which can tolerate a long-term water flushing. MPEMs can selectively enter and plug the large pores and pore-throats in high permeability sandpack, but almost do not damage the low permeability sandpack. MPEMs can effectively divert the water flow from the high permeability sandpack to the low permeability sandpack and improve the sweep efficiency of low permeability sandpack and low permeability area in the high permeability sandpack. The results also confirm the dynamic process of profile control and oil displacement using MPEMs in heterogeneous reservoirs.

Enhanced Oil Recovery Using Micron-Size Polyacrylamide Elastic Microspheres (MPEMs): Underlying Mechanisms and Displacement Experiments

KAUST Repository

Yao, Chuanjin

2015-10-12

Micron-size polyacrylamide elastic microsphere (MPEM) is a newly developed profile control and oil displacement agent for enhanced oil recovery in heterogeneous reservoirs. In this study, laboratory experiments were performed to characterize the viscoelastic properties of MPEMs in brine water. A transparent sandpack micromodel was used to observe the microscopic flow and displacement mechanisms, and parallel-sandpack models were used to investigate the profile control and oil displacement performance using MPEMs in heterogeneous reservoirs. The results indicate that MPEMs almost do not increase the viscosity of injection water and can be conveniently injected using the original water injection pipelines. The microscopic profile control and oil displacement mechanisms of MPEMs in porous media mainly behave as selective-plugging in large pores, fluid diversion after MPEMs plugging, oil drainage caused by MPEMs breakthrough, and the mechanism of oil droplets converging into oil flow. MPEMs have a high plugging strength, which can tolerate a long-term water flushing. MPEMs can selectively enter and plug the large pores and pore-throats in high permeability sandpack, but almost do not damage the low permeability sandpack. MPEMs can effectively divert the water flow from the high permeability sandpack to the low permeability sandpack and improve the sweep efficiency of low permeability sandpack and low permeability area in the high permeability sandpack. The results also confirm the dynamic process of profile control and oil displacement using MPEMs in heterogeneous reservoirs.

Prototropic tautomerism of 4-Methyl 1,2,4-Triazole-3-Thione molecule in solvent water medium: DFT and Car–Parrinello molecular dynamics study

International Nuclear Information System (INIS)

Dutta, Bipan; De, Rina; Chowdhury, Joydeep

2015-01-01

Highlights: • The tautomerism of 4-MTTN molecule in solvent water medium has been investigated. • CPMD presage the possibility of PT reactions through the solvent water medium. • Concerted PT processes in 4-MTTN have been estimated from the DFT and NBO analyses. • Percentage evolution and breaking of the concerned bonds are estimated. - Abstract: The ground state prototropic tautomerism of 4-Methyl 1,2,4-Triazole-3-Thione molecule in solvent water medium has been investigated with the aid of DFT and Car–Parrinello molecular dynamics (CPMD) simulation studies. The CPMD simulations envisage the possibility of proton transfer reactions of the molecule through the solvent water medium. Probable proton transfer pathways have been predicted from the DFT calculations which are substantiated by the natural bond orbital analyses. The evolution and breaking of the concerned bonds of the molecule for different proton transfer reaction pathways are also estimated.

Displacement ventilation

DEFF Research Database (Denmark)

Kosonen, Risto; Melikov, Arsen Krikor; Mundt, Elisabeth

The aim of this Guidebook is to give the state-of-the art knowledge of the displacement ventilation technology, and to simplify and improve the practical design procedure. The Guidebook discusses methods of total volume ventilation by mixing ventilation and displacement ventilation and it gives...... insights of the performance of the displacement ventilation. It also shows practical case studies in some typical applications and the latest research findings to create good local micro-climatic conditions....

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

Energy Technology Data Exchange (ETDEWEB)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

Partition Coefficients of Organic Molecules in Squalane and Water/Ethanol Mixtures by Molecular Dynamics Simulations

DEFF Research Database (Denmark)

Lundsgaard, Rasmus; Kontogeorgis, Georgios; Economou, Ioannis G.

2011-01-01

coefficient can be estimated for both a small hydrophilic and a hydrophobic organic molecules between squalane (used here to mimic low density poly ethylene) and water/ethanol solutes using thermodynamic integration to calculate the free energy of solvation. Molecular dynamics simulations are performed, using...... the GROMACS software, by slowly decoupling of firstly the electrostatic and then the Lennard–Jones interactions between molecules in the simulation box. These calculations depend very much on the choice of force field. Two force fields have been tested in this work, the TraPPE-UA (united-atom) and the OPLS...

Modeling the Release Kinetics of Poorly Water-Soluble Drug Molecules from Liposomal Nanocarriers

Directory of Open Access Journals (Sweden)

Stephan Loew

2011-01-01

Full Text Available Liposomes are frequently used as pharmaceutical nanocarriers to deliver poorly water-soluble drugs such as temoporfin, cyclosporine A, amphotericin B, and paclitaxel to their target site. Optimal drug delivery depends on understanding the release kinetics of the drug molecules from the host liposomes during the journey to the target site and at the target site. Transfer of drugs in model systems consisting of donor liposomes and acceptor liposomes is known from experimental work to typically exhibit a first-order kinetics with a simple exponential behavior. In some cases, a fast component in the initial transfer is present, in other cases the transfer is sigmoidal. We present and analyze a theoretical model for the transfer that accounts for two physical mechanisms, collisions between liposomes and diffusion of the drug molecules through the aqueous phase. Starting with the detailed distribution of drug molecules among the individual liposomes, we specify the conditions that lead to an apparent first-order kinetic behavior. We also discuss possible implications on the transfer kinetics of (1 high drug loading of donor liposomes, (2 attractive interactions between drug molecules within the liposomes, and (3 slow transfer of drugs between the inner and outer leaflets of the liposomes.

Job Displacement and Crime

DEFF Research Database (Denmark)

Bennett, Patrick; Ouazad, Amine

We use a detailed employer-employee data set matched with detailed crime information (timing of crime, fines, convictions, crime type) to estimate the impact of job loss on an individual's probability to commit crime. We focus on job losses due to displacement, i.e. job losses in firms losing...... a substantial share of their workers, for workers with at least three years of tenure. Displaced workers are more likely to commit offenses leading to conviction (probation, prison terms) for property crimes and for alcohol-related traffic violations in the two years following displacement. We find no evidence...... that displaced workers' propensity to commit crime is higher than non-displaced workers before the displacement event; but it is significantly higher afterwards. Displacement impacts crime over and above what is explained by earnings losses and weeks of unemployment following displacement....

Multipole moments of water molecules in clusters and ice Ih from first principles calculations

International Nuclear Information System (INIS)

Batista, E.R.; Xantheas, S.S.; Jonsson, H.

1999-01-01

We have calculated molecular multipole moments for water molecules in clusters and in ice Ih by partitioning the charge density obtained from first principles calculations. Various schemes for dividing the electronic charge density among the water molecules were used. They include Bader close-quote s zero flux surfaces and Voronoi partitioning schemes. A comparison was also made with an induction model including dipole, dipole-quadrupole, quadrupole-quadrupole polarizability and first hyperpolarizability as well as fixed octopole and hexadecapole moments. We have found that the different density partitioning schemes lead to widely different values for the molecular multipoles, illustrating how poorly defined molecular multipoles are in clusters and condensed environments. For instance, the magnitude of the molecular dipole moment in ice Ih ranges between 2.3 D and 3.1 D depending on the partitioning scheme used. Within each scheme, though, the value for the molecular dipole moment in ice is larger than in the hexamer. The magnitude of the molecular dipole moment in the clusters shows a monotonic increase from the gas phase value to the one in ice Ih, with the molecular dipole moment in the water ring hexamer being smaller than the one in ice Ih for all the partitioning schemes used. copyright 1999 American Institute of Physics

Double displacement: An improved bioorthogonal reaction strategy for templated nucleic acid detection.

Science.gov (United States)

Kleinbaum, Daniel J; Miller, Gregory P; Kool, Eric T

2010-06-16

Quenched autoligation probes have been employed previously in a target-templated nonenzymatic ligation strategy for detecting nucleic acids in cells by fluorescence. A common source of background signal in such probes is the undesired reaction with water and other cellular nucleophiles. Here, we describe a new class of self-ligating probes, double displacement (DD) probes, that rely on two displacement reactions to fully unquench a nearby fluorophore. Three potential double displacement architectures, all possessing two fluorescence quencher/leaving groups (dabsylate groups), were synthesized and evaluated for templated reaction with nucleophile (phosphorothioate) probes both in vitro and in intact bacterial cells. All three DD probe designs provided substantially better initial quenching than a single-Dabsyl control. In isothermal templated reactions in vitro, double displacement probes yielded considerably lower background signal than previous single displacement probes; investigation into the mechanism revealed that one dabsylate acts as a sacrificial leaving group, reacting nonspecifically with water, but yielding little signal because another quencher group remains. Templated reaction with the specific nucleophile probe is required to activate a signal. The double displacement probes provided a ca. 80-fold turn-on signal and yielded a 2-4-fold improvement in signal/background over single Dabsyl probes. The best-performing probe architecture was demonstrated in a two-color, FRET-based two-allele discrimination system in vitro and was shown to be capable of discriminating between two closely related species of bacteria differing by a single nucleotide at an rRNA target site.

Solvation study of the non-specific lipid transfer protein from wheat by intermolecular NOEs with water and small organic molecules

International Nuclear Information System (INIS)

Liepinsh, Edvards; Sodano, Patrick; Tassin, Severine; Marion, Didier; Vovelle, Francoise; Otting, Gottfried

1999-01-01

Intermolecular nuclear Overhauser effects (NOEs) were measured between the protons of various small solvent or gas molecules and the non-specific lipid transfer protein (ns-LTP) from wheat. Intermolecular NOEs were observed with the hydrophobic pocket in the interior of wheat ns-LTP, which grew in intensity in the order cyclopropane (saturated solution) < methane (140 bar) < ethane (40 bar) < acetonitrile (5% in water) < cyclohexane (saturated solution) < benzene (saturated solution). No intermolecular NOEs were observed with dioxane (5% in water). The intermolecular NOEs were negative for all of the organic molecules tested. Intermolecular NOEs between wheat ns-LTP and water were weak or could not be distinguished from exchange-relayed NOEs. As illustrated by the NOEs with cyclohexane versus dioxane, the hydrophobic pocket in wheat ns-LTP preferably binds non-polar molecules. Yet, polar molecules like acetonitrile can also be accommodated. The pressure dependence of the NOEs between methane and wheat ns-LTP indicated incomplete occupancy, even at 190 bar methane pressure. In general, NOE intensities increased with the size of the ligand molecule and its vapor pressure. NMR of the vapor phase showed excellent resolution between the signals from the gas phase and those from the liquid phase. The vapor concentration of cyclohexane was fivefold higher than that of the dioxane solution, supporting the binding of cyclohexane versus uptake of dioxane

Study on distribution of reservoir endogenous microbe and oil displacement mechanism

Directory of Open Access Journals (Sweden)

Ming Yue

2017-02-01

Full Text Available In order to research oil displacement mechanism by indigenous microbial communities under reservoir conditions, indigenous microbial flooding experiments using the endogenous mixed bacterium from Shengli Oilfield were carried out. Through microscopic simulation visual model, observation and analysis of distribution and flow of the remaining oil in the process of water flooding and microbial oil displacement were conducted under high temperature and high pressure conditions. Research has shown that compared with atmospheric conditions, the growth of the microorganism metabolism and attenuation is slowly under high pressure conditions, and the existence of the porous medium for microbial provides good adhesion, also makes its growth cycle extension. The microbial activities can effectively launch all kinds of residual oil, and can together with metabolites, enter the blind holes off which water flooding, polymer flooding and gas flooding can’t sweep, then swap out remaining oil, increase liquidity of the crude oil and remarkably improve oil displacement effect.

Displacement Ventilation

DEFF Research Database (Denmark)

Nielsen, Peter Vilhelm

Displacement ventilation is an interesting new type of air distribution principle which should be considered in connection with design of comfort ventilation in both smal1 and large spaces. Research activities on displacement ventilation are large all over the world and new knowledge of design...... methods appears continuously. This book gives an easy introduction to the basis of displacement ventilation and the chapters are written in the order which is used in a design procedure. The main text is extended by five appendices which show some of the new research activities taking place at Aalborg...

Water and oxygen induced degradation of small molecule organic solar cells

DEFF Research Database (Denmark)

Hermenau, Martin; Riede, Moritz; Leo, Karl

2011-01-01

Small molecule organic solar cells were studied with respect to water and oxygen induced degradation by mapping the spatial distribution of reaction products in order to elucidate the degradation patterns and failure mechanisms. The active layers consist of a 30 nm bulk heterojunction formed......,4′-diamine p-doped with C60F36 (MeO-TPD:C60F36), which acted as hole transporting layer. Indium-tin-oxide (ITO) and aluminum served as hole and electron collecting electrode, respectively. Time-of-flight secondary ion mass spectrometry (TOF-SIMS) and X-ray photoelectron spectroscopy (XPS) in conjunction...... of aluminum oxide at the BPhen/Al interface, and diffusion of water into the ZnPc:C60 layer where ZnPc becomes oxidized. Finally, diffusion from the electrodes was found to have no or a negligible effect on the device lifetime....

Combined quantum mechanics/molecular mechanics (QM/MM) simulations for protein-ligand complexes: free energies of binding of water molecules in influenza neuraminidase.

Science.gov (United States)

Woods, Christopher J; Shaw, Katherine E; Mulholland, Adrian J

2015-01-22

The applicability of combined quantum mechanics/molecular mechanics (QM/MM) methods for the calculation of absolute binding free energies of conserved water molecules in protein/ligand complexes is demonstrated. Here, we apply QM/MM Monte Carlo simulations to investigate binding of water molecules to influenza neuraminidase. We investigate five different complexes, including those with the drugs oseltamivir and peramivir. We investigate water molecules in two different environments, one more hydrophobic and one hydrophilic. We calculate the free-energy change for perturbation of a QM to MM representation of the bound water molecule. The calculations are performed at the BLYP/aVDZ (QM) and TIP4P (MM) levels of theory, which we have previously demonstrated to be consistent with one another for QM/MM modeling. The results show that the QM to MM perturbation is significant in both environments (greater than 1 kcal mol(-1)) and larger in the more hydrophilic site. Comparison with the same perturbation in bulk water shows that this makes a contribution to binding. The results quantify how electronic polarization differences in different environments affect binding affinity and also demonstrate that extensive, converged QM/MM free-energy simulations, with good levels of QM theory, are now practical for protein/ligand complexes.

(e,3e) and (e,3-1e) differential cross sections for the double ionization of water molecule

International Nuclear Information System (INIS)

Mansouri, A.; Dal Cappello, C.; Kada, I.; Champion, C.; Roy, A.C.

2009-01-01

We report new results for differential cross sections for the double ionization of water molecule by 1 keV electron impact. The present calculation is based on the first Born approximation. We describe the water molecule by a single centre wave function of Moccia. For the final state, an approximation of the well-known 3C wave function is used. An extensive study has been made by varying the angles of detection and the energies of each ejected electron. We have investigated the double ionization of each molecular state (1b 1 , 3a 1 , 1b 2 and 2a 1 ) and identified the mechanisms of this process.

[Intra-articular injections of hyaluronic acid for anterior disc displacement of temporomandibular joint].

Science.gov (United States)

Long, X

2017-03-09

Anterior disc displacement (ADD) of temporomandibular joint (TMJ) is regarded as one of the major findings in temporomandibular disorders (TMD). It is related to joint noise, pain, mandibular dysfunction, degenerative change and osteoarthritis. In the mean time, the pathological changes were found in synovial membrane and synovial fluid. Hyaluronic acid is a principal component of the synovial fluid which plays an important role in nutrition, lubrication, anti-inflammation and cartilage repair. The synthesis, molecule weight, and concentration of hyaluronic acid are decreased during TMD and cause TMJ degenerative changes. The clinical conditions, pathological changes, the mechanism of action for hyaluronic acid and the treatment of anterior disc displacement of TMJ are discussed in this article.

STABILIZATION OF THE NEUTRAL PROTEASE OF BACILLUS-STEAROTHERMOPHILUS BY REMOVAL OF A BURIED WATER MOLECULE

NARCIS (Netherlands)

VRIEND, G; BERENDSEN, HJC; VANDERZEE, [No Value; VANDENBURG, B; VENEMA, G; EIJSINK, VGH

1991-01-01

Using site-directed mutagenesis, Ala166 in the neutral protease of Bacillus stearothermophilus was changed into Ser. Model building and molecular dynamics simulations of the mutant enzyme indicated that the Ser hydroxyl group fits well in a cavity which contains a water molecule in the wild-type

Contact angle hysteresis and motion behaviors of a water nano-droplet on suspended graphene under temperature gradient

Science.gov (United States)

Foroutan, Masumeh; Fatemi, S. Mahmood; Esmaeilian, Farshad; Fadaei Naeini, Vahid; Baniassadi, Majid

2018-05-01

In the present work, the effect of temperature gradient on the behavior of a water nano-droplet resting on a suspended graphene was studied based on a non-equilibrium molecular dynamics simulation. The acquired results indicate that the applied temperature gradient to the suspended graphene drives the water nano-droplet to the colder region. The droplet accelerates its motion toward the cold reservoir as the temperature gradient is increased. In addition to the translational motion of the nano-droplet, the vortical motion of the water molecules was also observed. Contact angle analysis was also utilized to describe the directional motion of the nano-droplet. The translational motion of the droplet leads to the estimation of contact angle hysteresis through advancing and receding contact angles while the rotational motion resulted in the advancing and receding fronts being switched with one another through the simulation. The average displacement vector of the water molecules shows that parts of the droplet seem to stagnate while other parts rotate around them. The reason behind this particular behavior was studied based on interaction energy contours between a water molecule and the suspended graphene. The obtained data indicate that the rotational motion is in agreement with the migration of the water molecules to low interaction energy regions in order to avoid high interaction energy areas.

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

Science.gov (United States)

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

2015-01-01

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.

Science.gov (United States)

Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K

2016-10-24

DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Study of the fluid dynamic and the efficiency of displacement in oil-water systems; Estudo da fluidodinamica e da eficiencia de deslocamento em sistemas agua-oleo

Energy Technology Data Exchange (ETDEWEB)

Fiorese, Eliana K.; Quadri, Marintho B.; Machado, Ricardo A.F.; Nogueira, Andre L.; Lopes, Toni J. [Universidade Federal de Santa Catarina (UFSC), Florianopolis, SC (Brazil). Dept. de Engenharia Quimica e de Alimentos; Baptista, Renan M. [PETROBRAS, Rio de Janeiro, RJ (Brazil). Centro de Pesquisas (CENPES)

2004-07-01

Several operations and procedures in the oil industry are related to immiscible displacement of a fluid by another one. Some examples can be listed: the natural and artificial oil elevation from wells, the pumping of high viscosity oils through pipelines using water injection and secondary oil recovery. The performance of the last one is a direct consequence of the interfacial phenomena inherent to oil/water systems. As occur in oil leakages from submarine pipelines, the phase inversion phenomenon can also be considered in this context. Therefore, it is of major importance to realize experimental analysis of the oil/water interface stability and the facts that leads to the fingering phenomenon appearance. This phenomenon is represented into the other one like one or more fingers. The mathematical model used to describe the immiscible displacement of another one is initially developed to Hele-Shaw cells. Experimental observations with a Hele-Shaw cell enable the evaluation of the proposed model and its capability to adequately describe the viscous fingering phenomenon related to physical (density, viscosity and interfacial tension) and geometric properties of the system. (author)

Programming chemical kinetics: engineering dynamic reaction networks with DNA strand displacement

Science.gov (United States)

Srinivas, Niranjan

Over the last century, the silicon revolution has enabled us to build faster, smaller and more sophisticated computers. Today, these computers control phones, cars, satellites, assembly lines, and other electromechanical devices. Just as electrical wiring controls electromechanical devices, living organisms employ "chemical wiring" to make decisions about their environment and control physical processes. Currently, the big difference between these two substrates is that while we have the abstractions, design principles, verification and fabrication techniques in place for programming with silicon, we have no comparable understanding or expertise for programming chemistry. In this thesis we take a small step towards the goal of learning how to systematically engineer prescribed non-equilibrium dynamical behaviors in chemical systems. We use the formalism of chemical reaction networks (CRNs), combined with mass-action kinetics, as our programming language for specifying dynamical behaviors. Leveraging the tools of nucleic acid nanotechnology (introduced in Chapter 1), we employ synthetic DNA molecules as our molecular architecture and toehold-mediated DNA strand displacement as our reaction primitive. Abstraction, modular design and systematic fabrication can work only with well-understood and quantitatively characterized tools. Therefore, we embark on a detailed study of the "device physics" of DNA strand displacement (Chapter 2). We present a unified view of strand displacement biophysics and kinetics by studying the process at multiple levels of detail, using an intuitive model of a random walk on a 1-dimensional energy landscape, a secondary structure kinetics model with single base-pair steps, and a coarse-grained molecular model that incorporates three-dimensional geometric and steric effects. Further, we experimentally investigate the thermodynamics of three-way branch migration. Our findings are consistent with previously measured or inferred rates for

Aqueous solvation of polyalanine α-helices with specific water molecules and with the CPCM and SM5.2 aqueous continuum models using density functional theory.

Science.gov (United States)

Marianski, Mateusz; Dannenberg, J J

2012-02-02

We present density functional theory (DFT) calculations at the X3LYP/D95(d,p) level on the solvation of polyalanine α-helices in water. The study includes the effects of discrete water molecules and the CPCM and AMSOL SM5.2 solvent continuum model both separately and in combination. We find that individual water molecules cooperatively hydrogen-bond to both the C- and N-termini of the helix, which results in increases in the dipole moment of the helix/water complex to more than the vector sum of their individual dipole moments. These waters are found to be more stable than in bulk solvent. On the other hand, individual water molecules that interact with the backbone lower the dipole moment of the helix/water complex to below that of the helix itself. Small clusters of waters at the termini increase the dipole moments of the helix/water aggregates, but the effect diminishes as more waters are added. We discuss the somewhat complex behavior of the helix with the discrete waters in the continuum models.

Influence of stability of polymer surfactant on oil displacement mechanism

Science.gov (United States)

Liu, Li; Li, Chengliang; Pi, Yanming; Wu, Di; He, Ying; Geng, Liang

2018-02-01

At present, most of the oilfields of China have entered the late stage of high water-cut development, and three oil recovery technique has become the leading technology for improving oil recovery. With the improvement of three oil recovery techniques, the polymer surfactant flooding technology has been widely promoted in oil fields in recent years. But in the actual field experiment, it has been found that the polymer surfactant has chromatographic separation at the extraction end, which indicates that the property of the polymer surfactant has changed during the displacement process. At present, there was few literature about how the stability of polymer surfactant affects the oil displacement mechanism. This paper used HuaDing-I polymer surfactant to conduct a micro photolithography glass flooding experiment, and then compared the oil displacement law of polymer surfactant before and after static setting. Finally, the influence law of stability of polymer surfactant on the oil displacement mechanism is obtained by comprehensive analysis.

Effect of displacement on resistance and capacitance of polyaniline film

International Nuclear Information System (INIS)

Karimov, Khasan Sanginovich; Saeed, Muhammad Tariq; Khalid, Fazal Ahmad; Moiz, Syed Abdul

2011-01-01

This paper investigates the properties of displacement sensors based on polyaniline (PANI) films. About 1 wt% of PANI micropowder is mixed and stirred in a solution of 90 wt% water and 10 wt% alcohol at room temperature. The films of PANI are deposited from solution by drop-casting on Ag electrodes, which are preliminary deposited on glass substrates. The thicknesses of the PANI films are in the range of 20 μm–80 μm. A displacement sensor with polyaniline film as an active material is designed and fabricated. The investigations showed that, on average, the AC resistance of the sensor decreases by 2 times and the capacitance accordingly increases by 1.6 times as the displacement changes in the range of 0 mm–0.5 mm. The polyaniline is the only active material of the displacement sensor. The resistance and capacitance of the PANI changes under the pressure of spring and elastic rubber, and this pressure is created by the downward movement of the micrometer. (general)

In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

Science.gov (United States)

Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

2008-12-15

The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

Gibbs Free Energy of Hydrolytic Water Molecule in Acyl-Enzyme Intermediates of a Serine Protease: A Potential Application for Computer-Aided Discovery of Mechanism-Based Reversible Covalent Inhibitors.

Science.gov (United States)

Masuda, Yosuke; Yamaotsu, Noriyuki; Hirono, Shuichi

2017-01-01

In order to predict the potencies of mechanism-based reversible covalent inhibitors, the relationships between calculated Gibbs free energy of hydrolytic water molecule in acyl-trypsin intermediates and experimentally measured catalytic rate constants (k cat ) were investigated. After obtaining representative solution structures by molecular dynamics (MD) simulations, hydration thermodynamics analyses using WaterMap™ were conducted. Consequently, we found for the first time that when Gibbs free energy of the hydrolytic water molecule was lower, logarithms of k cat were also lower. The hydrolytic water molecule with favorable Gibbs free energy may hydrolyze acylated serine slowly. Gibbs free energy of hydrolytic water molecule might be a useful descriptor for computer-aided discovery of mechanism-based reversible covalent inhibitors of hydrolytic enzymes.

Hydrophobic fluorine mediated switching of the hydrogen bonding site as well as orientation of water molecules in the aqueous mixture of monofluoroethanol: IR, molecular dynamics and quantum chemical studies.

Science.gov (United States)

Mondal, Saptarsi; Biswas, Biswajit; Nandy, Tonima; Singh, Prashant Chandra

2017-09-20

The local structures between water-water, alcohol-water and alcohol-alcohol have been investigated for aqueous mixtures of ethanol (ETH) and monofluoroethanol (MFE) by the deconvolution of IR bands in the OH stretching region, molecular dynamics simulation and quantum chemical calculations. It has been found that the addition of a small amount of ETH into the aqueous medium increases the strength of the hydrogen bonds between water molecules. In an aqueous mixture of MFE, the substitution of a single fluorine induces a change in the orientation as well as the hydrogen bonding site of water molecules from the oxygen to the fluorine terminal of MFE. The switching of the hydrogen bonding site of water in the aqueous mixture of MFE results in comparatively strong hydrogen bonds between MFE and water molecules as well as less clustering of water molecules, unlike the case of the aqueous mixture of ETH. These findings about the modification of a hydrogen bond network by the hydrophobic fluorine group probably make fluorinated molecules useful for pharmaceutical as well as biological applications.

Expressional Changes of Water Transport-related Molecules in the Efferent Ductules and Initial Segment of Mouse Treated with Bisphenol A-Containing Drinking Water for Two Generations.

Science.gov (United States)

Han, Su-Yong; Lee, Ki-Ho

2013-09-01

Bisphenol A (BPA) is an estrogenic endocrine disrupter. However, depending on a way of treatment, the harmful effects of BPA have not been confirmed. Also, trans-generational effects of BPA on male reproduction are still controversial. Because the reabsorption of testicular fluid in the efferent ductules (ED) and initial segment (IS) is important for sperm maturation, the present study was designed to determine trans-generational effect of BPA administrated orally on expression of water transport-related molecules in the mouse ED and IS. Ethanol-dissolved BPA was diluted in water to be 100 ng (low), 10 μg (medium), and 1 mg/Ml water (high). BPA-containing water was provided for two generations. Expression of ion transporters and water channels in the ED and IS were measured by relative real-time PCR analysis. In the ED, BPA treatment caused expressional increases of carbonic anhydrase II, cystic fibrosis transmembrane regulator, Na(+)/K(+) ATPase α1 subunit, and aquaporin (AQP) 1. No change of Na(+)/H(+) exchange (NHE) 3 expression was detected. BPA treatment at medium dose resulted in an increase of AQP9 expression. In the IS, the highest expressional levels of all molecules tested were observed in medium-dose BPA treatment. Generally, high-dose BPA treatment resulted in a decrease or no change of gene expression. Fluctuation of NHE3 gene expression by BPA treatment at different concentrations was detected. These findings suggest that trans-generational exposure to BPA, even at low dose, could affect gene expression of water-transport related molecules. However, such effects of BPA would be differentially occurred in the ED and IS.

Displacement and stress fields around rock fractures opened by irregular overpressure variations

Directory of Open Access Journals (Sweden)

Shigekazu eKusumoto

2014-05-01

Full Text Available Many rock fractures are entirely driven open by fluids such as ground water, geothermal water, gas, oil, and magma. These are a subset of extension fractures (mode I cracks; e.g., dikes, mineral veins and joints referred to as hydrofractures. Field measurements show that many hydrofractures have great variations in aperture. However, most analytical solutions for fracture displacement and stress fields assume the loading to be either constant or with a linear variation. While these solutions have been widely used, it is clear that a fracture hosted by heterogeneous and anisotropic rock is normally subject to loading that is neither constant nor with a linear variation. Here we present new general solutions for the displacement and stress fields around hydrofractures, modelled as two-dimensional elastic cracks, opened by irregular overpressure variations given by the Fourier cosine series. Each solution has two terms. The first term gives the displacement and stress fields due to the average overpressure acting inside the crack; it is given by the initial term of the Fourier coefficients expressing the overpressure variation. The second term gives the displacement and stress fields caused by the overpressure variation; it is given by general terms of the Fourier coefficients and solved through numerical integration. Our numerical examples show that the crack aperture variation closely reflects the overpressure variation. Also, that the general displacement and stress fields close to the crack follow the overpressure variation but tend to be more uniform far from the crack. The present solutions can be used to estimate the displacement and stress fields around any fluid-driven crack, that is, any hydrofracture, as well as its aperture, provided the variation in overpressure can be described by Fourier series. The solutions add to our understanding of local stresses, displacements, and fluid transport associated with hydrofractures in the crust.

Displacement characteristics of a piezoactuator-based prototype microactuator with a hydraulic displacement amplification system

Energy Technology Data Exchange (ETDEWEB)

Muralidhara [NMAMIT, Nitte (India); Rao, Rathnamala [NITK, Surathkal (India)

2015-11-15

In this study, a new piezoactuator-based prototype microactuator is proposed with a hydraulic displacement amplification system. A piezoactuator is used to deflect a diaphragm which displaces a certain volume of hydraulic fluid into a smaller-diameter piston chamber, thereby amplifying the displacement at the other end of the piston. An electro-mechanical model is implemented to estimate the displacement of a multilayer piezoelectric actuator for the applied input voltage considering the hysteresis behavior. The displacement characteristics of the proposed microactuator are studied for triangular actuation voltage signal. Results of the experiments and simulation of the displacement behavior of the stacked piezoactuator and the amplified displacement of the prototype actuator were compared. Experimental results suggest that the mathematical model developed for the new piezoactuator-based prototype actuator is capable of estimating its displacement behavior accurately, within an error of 1.2%.

Displacement characteristics of a piezoactuator-based prototype microactuator with a hydraulic displacement amplification system

International Nuclear Information System (INIS)

Muralidhara; Rao, Rathnamala

2015-01-01

In this study, a new piezoactuator-based prototype microactuator is proposed with a hydraulic displacement amplification system. A piezoactuator is used to deflect a diaphragm which displaces a certain volume of hydraulic fluid into a smaller-diameter piston chamber, thereby amplifying the displacement at the other end of the piston. An electro-mechanical model is implemented to estimate the displacement of a multilayer piezoelectric actuator for the applied input voltage considering the hysteresis behavior. The displacement characteristics of the proposed microactuator are studied for triangular actuation voltage signal. Results of the experiments and simulation of the displacement behavior of the stacked piezoactuator and the amplified displacement of the prototype actuator were compared. Experimental results suggest that the mathematical model developed for the new piezoactuator-based prototype actuator is capable of estimating its displacement behavior accurately, within an error of 1.2%.

Measuring vulnerability to disaster displacement

Science.gov (United States)

Brink, Susan A.; Khazai, Bijan; Power, Christopher; Wenzel, Friedemann

2015-04-01

Large scale disasters can cause devastating impacts in terms of population displacement. Between 2008 and 2013, on average 27 million people were displaced annually by disasters (Yonetani 2014). After large events such as hurricane Katrina or the Port-au-Prince earthquake, images of inadequate public shelter and concerns about large scale and often inequitable migration have been broadcast around the world. Population displacement can often be one of the most devastating and visible impacts of a natural disaster. Despite the importance of population displacement in disaster events, measures to understand the socio-economic vulnerability of a community often use broad metrics to estimate the total socio-economic risk of an event rather than focusing on the specific impacts that a community faces in a disaster. Population displacement is complex and multi-causal with the physical impact of a disaster interacting with vulnerability arising from the response, environmental issues (e.g., weather), cultural concerns (e.g., expectations of adequate shelter), and many individual factors (e.g., mobility, risk perception). In addition to the complexity of the causes, population displacement is difficult to measure because of the wide variety of different terms and definitions and its multi-dimensional nature. When we speak of severe population displacement, we may refer to a large number of displaced people, an extended length of displacement or associated difficulties such as poor shelter quality, risk of violence and crime in shelter communities, discrimination in aid, a lack of access to employment or other difficulties that can be associated with large scale population displacement. We have completed a thorough review of the literature on disaster population displacement. Research has been conducted on historic events to understand the types of negative impacts associated with population displacement and also the vulnerability of different groups to these impacts. We

Torque Measurement at the Single Molecule Level

Science.gov (United States)

Forth, Scott; Sheinin, Maxim Y.; Inman, James; Wang, Michelle D.

2017-01-01

Methods for exerting and measuring forces on single molecules have revolutionized the study of the physics of biology. However, it is often the case that biological processes involve rotation or torque generation, and these parameters have been more difficult to access experimentally. Recent advances in the single molecule field have led to the development of techniques which add the capability of torque measurement. By combining force, displacement, torque, and rotational data, a more comprehensive description of the mechanics of a biomolecule can be achieved. In this review, we highlight a number of biological processes for which torque plays a key mechanical role. We describe the various techniques that have been developed to directly probe the torque experienced by a single molecule, and detail a variety of measurements made to date using these new technologies. We conclude by discussing a number of open questions and propose systems of study which would be well suited for analysis with torsional measurement techniques. PMID:23541162

Studing electronic structure of water molecules in aquocomplexes by the method of pions minus capture by hydrogen

International Nuclear Information System (INIS)

Dezhi, I.; Krumshtejn, Z.V.; Molnar, B.; Petrukhin, V.I.; Rybakov, V.N.; Suvorov, V.M.; Khorvat, D.; Tsisek, Z.; Yutlandov, I.A.

1980-01-01

Using the effect of electron shell state on π-meson capture by chemically bound hydrogen studied has been change of electron density in hydrogen atoms of water molecules bound into aquocomplexes. The fact of depression of π-meson capture probability by hydrogen of water in aquocomplexes has been established. The magnitudes of depression indicate essential decrease of electron density in a hydrogen atom of coordinated water. Interaction of ligands with oxygen-containing anions also essentially contributes to a magnitude of depression

Degradation of Bacterial Quorum Sensing Signaling Molecules by the Microscopic Yeast Trichosporon loubieri Isolated from Tropical Wetland Waters

Directory of Open Access Journals (Sweden)

Cheng-Siang Wong

2013-09-01

Full Text Available Proteobacteria produce N-acylhomoserine lactones as signaling molecules, which will bind to their cognate receptor and activate quorum sensing-mediated phenotypes in a population-dependent manner. Although quorum sensing signaling molecules can be degraded by bacteria or fungi, there is no reported work on the degradation of such molecules by basidiomycetous yeast. By using a minimal growth medium containing N-3-oxohexanoylhomoserine lactone as the sole source of carbon, a wetland water sample from Malaysia was enriched for microbial strains that can degrade N-acylhomoserine lactones, and consequently, a basidiomycetous yeast strain WW1C was isolated. Morphological phenotype and molecular analyses confirmed that WW1C was a strain of Trichosporon loubieri. We showed that WW1C degraded AHLs with N-acyl side chains ranging from 4 to 10 carbons in length, with or without oxo group substitutions at the C3 position. Re-lactonisation bioassays revealed that WW1C degraded AHLs via a lactonase activity. To the best of our knowledge, this is the first report of degradation of N-acyl-homoserine lactones and utilization of N-3-oxohexanoylhomoserine as carbon and nitrogen source for growth by basidiomycetous yeast from tropical wetland water; and the degradation of bacterial quorum sensing molecules by an eukaryotic yeast.

Boron isotopic enrichment by displacement chromatography

International Nuclear Information System (INIS)

Mohapatra, K.K.; Bose, Arun

2014-01-01

10 B enriched boron is used in applications requiring high volumetric neutron absorption (absorption cross section- 3837 barn for thermal and 1 barn for 1 MeV fast neutron). It is used in fast breeder reactor (as control rod material), in neutron counter, in Boron Neutron Capture Therapy etc. Owing to very small separation factor, boron isotopic enrichment is a complex process requiring large number of separation stages. Heavy Water Board has ventured in industrial scale production of 10 B enriched boron using Exchange Distillation Process as well as Ion Displacement Chromatography Process. Ion Displacement Chromatography process is used in Boron Enrichment Plant at HWP, Manuguru. It is based on isotopic exchange between borate ions (B(OH) 4 - ) on anion exchange resin and boric acid passing through resin. The isotopic exchange takes place due to difference in zero point energy of 10 B and 11 B

Resonant neutron-induced atomic displacements

Energy Technology Data Exchange (ETDEWEB)

Elmaghraby, Elsayed K., E-mail: e.m.k.elmaghraby@gmail.com

2017-05-01

Highlights: • Neutron induced atomic displacements was investigated based on scattering of energy of neutron. • Model for cascade function (multiplication of displacements with increasing energy transfer) was proposed and justified. • Parameterizations for the dpa induced in all elements were performed. • Table containing all necessary parameters to calculate the displacement density induced by neutron is given. • Contribution of non resonance displacement and resonant-neutron induced displacements are distinguished. - Abstract: A model for displacement cascade function was modified to account for the continuous variation of displacement density in the material in response to neutron exposure. The model is based on the Gaussian distribution of displacement energies of atoms in a material. Analytical treatment for moderated epithermal neutron field was given in which the displacement density was divided into two terms, discrete-resonance term and continuum term. Calculation are done for all isotopes using ENDF/B VII.1 data files and temperature dependent cross section library. Weighted elemental values were reported a fitting was performed to obtain energy-dependent formula of displacement density and reduce the number of parameters. Results relevant the present specification of the cascade function are tabulated for each element to enable calculation of displacement density at any value of displacement energy in the between 5 eV and 55 eV.

Water Induced Surface Reconstruction of the Oxygen (2x1) covered Ru(0001)

Energy Technology Data Exchange (ETDEWEB)

Maier, Sabine; Cabrera-Sanfelix, Pepa; Stass, Ingeborg; Sanchez-Portal, Daniel; Arnau, Andres; Salmeron, Miquel

2010-08-06

Low temperature scanning tunneling microscopy (STM) and density functional theory (DFT) were used to study the adsorption of water on a Ru(0001) surface covered with half monolayer of oxygen. The oxygen atoms occupy hcp sites in an ordered structure with (2x1) periodicity. DFT predicts that water is weakly bound to the unmodified surface, 86 meV compared to the ~;;200 meV water-water H-bond. Instead, we found that water adsorption causes a shift of half of the oxygen atoms from hcp sites to fcc sites, creating a honeycomb structure where water molecules bind strongly to the exposed Ru atoms. The energy cost of reconstructing the oxygen overlayer, around 230 meV per displaced oxygen atom, is more than compensated by the larger adsorption energy of water on the newly exposed Ru atoms. Water forms hydrogen bonds with the fcc O atoms in a (4x2) superstructure due to alternating orientations of the molecules. Heating to 185 K results in the complete desorption of the water layer, leaving behind the oxygen honeycomb structure, which is metastable relative to the original (2x1). This stable structure is not recovered until after heating to temperatures close to 260K.

Tuning dissociation using isoelectronically doped graphene and hexagonal boron nitride: Water and other small molecules

Energy Technology Data Exchange (ETDEWEB)

Al-Hamdani, Yasmine S. [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Chemistry, University College London, 20 Gordon Street, London WC1H 0AJ (United Kingdom); Alfè, Dario [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Earth Sciences, University College London, Gower Street, London WC1E 6BT (United Kingdom); Lilienfeld, O. Anatole von [Institute of Physical Chemistry and National Center for Computational Design and Discovery of Novel Materials (MARVEL), Department of Chemistry, University of Basel, Klingelbergstrasse 80, CH-4056 Basel (Switzerland); Michaelides, Angelos, E-mail: angelos.michaelides@ucl.ac.uk [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom)

2016-04-21

Novel uses for 2-dimensional materials like graphene and hexagonal boron nitride (h-BN) are being frequently discovered especially for membrane and catalysis applications. Still however, a great deal remains to be understood about the interaction of environmentally and industrially relevant molecules such as water with these materials. Taking inspiration from advances in hybridising graphene and h-BN, we explore using density functional theory, the dissociation of water, hydrogen, methane, and methanol on graphene, h-BN, and their isoelectronic doped counterparts: BN doped graphene and C doped h-BN. We find that doped surfaces are considerably more reactive than their pristine counterparts and by comparing the reactivity of several small molecules, we develop a general framework for dissociative adsorption. From this a particularly attractive consequence of isoelectronic doping emerges: substrates can be doped to enhance their reactivity specifically towards either polar or non-polar adsorbates. As such, these substrates are potentially viable candidates for selective catalysts and membranes, with the implication that a range of tuneable materials can be designed.

Job Displacement and Crime

DEFF Research Database (Denmark)

Bennett, Patrick; Ouazad, Amine

theory of crime. Marital dissolution is more likely post-displacement, and we find small intra-family externalities of adult displacement on younger family members’ crime. The impact of displacement on crime is stronger in municipalities with higher capital and labor income inequalities....

Ab Initio Density Functional Theory Investigation of the Interaction between Carbon Nanotubes and Water Molecules during Water Desalination Process

Directory of Open Access Journals (Sweden)

Loay A. Elalfy

2013-01-01

Full Text Available Density functional theory calculations using B3LYP/3-21G level of theory have been implemented on 6 carbon nanotubes (CNTs structures (3 zigzag and 3 armchair CNTs to study the energetics of the reverse osmosis during water desalination process. Calculations of the band gap, interaction energy, highest occupied molecular orbital, lowest unoccupied molecular orbital, electronegativity, hardness, and pressure of the system are discussed. The calculations showed that the water molecule that exists inside the CNT is about 2-3 Å away from its wall. The calculations have proven that the zigzag CNTs are more efficient for reverse osmosis water desalination process than armchair CNTs as the reverse osmosis process requires pressure of approximately 200 MPa for armchair CNTs, which is consistent with the values used in molecular dynamics simulations, while that needed when using zigzag CNTs was in the order of 60 MPa.

Influence of the effective mass of water molecule on thermal neutron scattering; Uticaj efektivne mase molekula vode na rasejanje termalnih neutrona

Energy Technology Data Exchange (ETDEWEB)

Markovic, M [Belgrade Univ. (Yugoslavia). Elektrotehnicki Fakultet

1981-07-01

The influence of the effective water molecule mass on the thermal neutron scattering on the nucleus of the hydrogen atom has been investigated. Besides the actual water molecule mass (M = 18) the investigations have been carried out with its two effective values (M1 = 16 and M2 = 20). The differential and total cross sections have been calculated for the incident thermal neutron energy E{sub o} = 1 eV. Investigation results show different prominence of the quantum effects and for M2 the appearance of peaks in the quasielastic scattering. (author)

Aqueous Solvation of Polyalanine α-Helices with Specific Water Molecules and with the CPCM and SM5.2 Aqueous Continuum Models using Density Functional Theory

OpenAIRE

Marianski, Mateusz; Dannenberg, J. J.

2012-01-01

We present density functional theory (DFT) calculations at the X3LYP/D95(d,p) level on the solvation of polyalanine α-helices in water. The study includes the effects of discrete water molecules and the CPCM and AMSOL SM5.2 solvent continuum model both separately and in combination. We find that individual water molecules cooperatively hydrogen-bond to both the C- and N-termini of the helix, which results in increases in the dipole moment of the helix/water complex to more than the vector sum...

Analysis of Decomposition for Structure I Methane Hydrate by Molecular Dynamics Simulation

Science.gov (United States)

Wei, Na; Sun, Wan-Tong; Meng, Ying-Feng; Liu, An-Qi; Zhou, Shou-Wei; Guo, Ping; Fu, Qiang; Lv, Xin

2018-05-01

Under multi-nodes of temperatures and pressures, microscopic decomposition mechanisms of structure I methane hydrate in contact with bulk water molecules have been studied through LAMMPS software by molecular dynamics simulation. Simulation system consists of 482 methane molecules in hydrate and 3027 randomly distributed bulk water molecules. Through analyses of simulation results, decomposition number of hydrate cages, density of methane molecules, radial distribution function for oxygen atoms, mean square displacement and coefficient of diffusion of methane molecules have been studied. A significant result shows that structure I methane hydrate decomposes from hydrate-bulk water interface to hydrate interior. As temperature rises and pressure drops, the stabilization of hydrate will weaken, decomposition extent will go deep, and mean square displacement and coefficient of diffusion of methane molecules will increase. The studies can provide important meanings for the microscopic decomposition mechanisms analyses of methane hydrate.

Quantifying Multistate Cytoplasmic Molecular Diffusion in Bacterial Cells via Inverse Transform of Confined Displacement Distribution.

Science.gov (United States)

Chen, Tai-Yen; Jung, Won; Santiago, Ace George; Yang, Feng; Krzemiński, Łukasz; Chen, Peng

2015-11-12

Single-molecule tracking (SMT) of fluorescently tagged cytoplasmic proteins can provide valuable information on the underlying biological processes in living cells via subsequent analysis of the displacement distributions; however, the confinement effect originated from the small size of a bacterial cell skews the protein's displacement distribution and complicates the quantification of the intrinsic diffusive behaviors. Using the inverse transformation method, we convert the skewed displacement distribution (for both 2D and 3D imaging conditions) back to that in free space for systems containing one or multiple (non)interconverting Brownian diffusion states, from which we can reliably extract the number of diffusion states as well as their intrinsic diffusion coefficients and respective fractional populations. We further demonstrate a successful application to experimental SMT data of a transcription factor in living E. coli cells. This work allows a direct quantitative connection between cytoplasmic SMT data with diffusion theory for analyzing molecular diffusive behavior in live bacteria.

Conserved linear dynamics of single-molecule Brownian motion

KAUST Repository

Serag, Maged F.

2017-06-06

Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

Conserved linear dynamics of single-molecule Brownian motion

Science.gov (United States)

Serag, Maged F.; Habuchi, Satoshi

2017-06-01

Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

Conserved linear dynamics of single-molecule Brownian motion

KAUST Repository

Serag, Maged F.; Habuchi, Satoshi

2017-01-01

Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

Internal Displacement: Livelihood saving responses

OpenAIRE

Deborah Hines

2001-01-01

Deborah Hines explores how to assist the internally displaced and those prone to displacement. She considers the major causes of internal displacement, making the case for a more comprehensive set of policy and operational actions in response to situations of internal displacement. Development (2001) 44, 34–39. doi:10.1057/palgrave.development.1110289

Bromide as a tracer for studying water movement and nitrate displacement in soils: comparison with stable isotope tracers

International Nuclear Information System (INIS)

Russow, R.; Knappe, S.

1999-01-01

Tracers are an ideal means of studying water movement and associated nitrate displacement. Often bromide is preferred as a tracer because it is considered a representative tracer for water and because, being a conservative tracer (i.e. not involved in chemical and biological soil processes), it can be used for studying anion transport in soils. Moreover, it is less expensive and easier to measure than the stable isotopes deuterium and 15 N. Its great advantage over radioactive tracers (e.g. tritium), which outweighs their extreme sensitivity and ease of measurement and which it has in common with stable isotopes, is that it does not require radiation protection measures. However, there are also constraints on the use of bromide as a tracer in soil/water/plant systems. Our own studies on different soils using D 2 O, bromide and [ 15 N]-nitrate in lysimeters suggest that the above assumptions on bromide tracers need not always be valid under conditions as they prevail in biologically active soils. As the present paper shows, these studies permit a good assessment of the possibilities and limits to these tracers [de

The photoexcitation of crystalline ice and amorphous solid water: A molecular dynamics study of outcomes at 11 K and 125 K

Energy Technology Data Exchange (ETDEWEB)

Crouse, J.; Loock, H.-P., E-mail: hploock@chem.queensu.ca; Cann, N. M., E-mail: ncann@chem.queensu.ca [Department of Chemistry, Queen’s University, Kingston, Ontario K7L 3N6 (Canada)

2015-07-21

Photoexcitation of crystalline ice Ih and amorphous solid water at 7-9 eV is examined using molecular dynamics simulations and a fully flexible water model. The probabilities of photofragment desorption, trapping, and recombination are examined for crystalline ice at 11 K and at 125 K and for amorphous solid water at 11 K. For 11 K crystalline ice, a fully rigid water model is also employed for comparison. The kinetic energy of desorbed H atoms and the distance travelled by trapped fragments are correlated to the location and the local environment of the photoexcited water molecule. In all cases, H atom desorption is found to be the most likely outcome in the top bilayer while trapping of all photofragments is most probable deeper in the solid where the likelihood for recombination of the fragments into H{sub 2}O molecules also rises. Trajectory analysis indicates that the local hydrogen bonding network in amorphous solid water is more easily distorted by a photodissociation event compared to crystalline ice. Also, simulations indicate that desorption of OH radicals and H{sub 2}O molecules are more probable in amorphous solid water. The kinetic energy distributions for desorbed H atoms show a peak at high energy in crystalline ice, arising from photoexcited water molecules in the top monolayer. This peak is less pronounced in amorphous solid water. H atoms that are trapped may be displaced by up to ∼10 water cages, but migrate on average 3 water cages. Trapped OH fragments tend to stay near the original solvent cage.

Low-temperature FTIR spectroscopy provides evidence for protein-bound water molecules in eubacterial light-driven ion pumps.

Science.gov (United States)

Nomura, Yurika; Ito, Shota; Teranishi, Miwako; Ono, Hikaru; Inoue, Keiichi; Kandori, Hideki

2018-01-31

Light-driven H + , Na + and Cl - pumps have been found in eubacteria, which convert light energy into a transmembrane electrochemical potential. A recent mutation study revealed asymmetric functional conversion between the two pumps, where successful functional conversions are achieved exclusively when mutagenesis reverses the evolutionary amino acid sequence changes. Although this fact suggests that the essential structural mechanism of an ancestral function is retained even after gaining a new function, questions regarding the essential structural mechanism remain unanswered. Light-induced difference FTIR spectroscopy was used to monitor the presence of strongly hydrogen-bonded water molecules for all eubacterial H + , Na + and Cl - pumps, including a functionally converted mutant. This fact suggests that the strongly hydrogen-bonded water molecules are maintained for these new functions during evolution, which could be the reason for successful functional conversion from Na + to H + , and from Cl - to H + pumps. This also explains the successful conversion of the Cl - to the H + pump only for eubacteria, but not for archaea. It is concluded that water-containing hydrogen-bonding networks constitute one of the essential structural mechanisms in eubacterial light-driven ion pumps.

Reply to Comment on 'Diffusion of water and sodium counter-ions in nanopores of β-lactoglobulin crystal: a molecular simulation study'

International Nuclear Information System (INIS)

Malek, Kourosh; Coppens, Marc-Olivier

2008-01-01

The analysis in Hu and Jiang's Comment to our paper cannot reveal long-time diffusion, and incorrectly led the authors to conclude that the diffusion in beta-lactoglobuline is anomalous. In this context, the limitations of applying a mean-square displacement analysis to short, heterogeneous pore channels are discussed. A more appropriate approach based on first-passage time analysis is illustrated by a detailed analysis of water motion in a natural membrane protein channel. The partitioning and the motion of water molecules between core and surface hydration layers is discussed. Finally, the calculation of the water density profile is commented upon. (reply)

Thermodynamic analysis of water molecules at the surface of proteins and applications to binding site prediction and characterization.

Science.gov (United States)

Beuming, Thijs; Che, Ye; Abel, Robert; Kim, Byungchan; Shanmugasundaram, Veerabahu; Sherman, Woody

2012-03-01

Water plays an essential role in determining the structure and function of all biological systems. Recent methodological advances allow for an accurate and efficient estimation of the thermodynamic properties of water molecules at the surface of proteins. In this work, we characterize these thermodynamic properties and relate them to various structural and functional characteristics of the protein. We find that high-energy hydration sites often exist near protein motifs typically characterized as hydrophilic, such as backbone amide groups. We also find that waters around alpha helices and beta sheets tend to be less stable than waters around loops. Furthermore, we find no significant correlation between the hydration site-free energy and the solvent accessible surface area of the site. In addition, we find that the distribution of high-energy hydration sites on the protein surface can be used to identify the location of binding sites and that binding sites of druggable targets tend to have a greater density of thermodynamically unstable hydration sites. Using this information, we characterize the FKBP12 protein and show good agreement between fragment screening hit rates from NMR spectroscopy and hydration site energetics. Finally, we show that water molecules observed in crystal structures are less stable on average than bulk water as a consequence of the high degree of spatial localization, thereby resulting in a significant loss in entropy. These findings should help to better understand the characteristics of waters at the surface of proteins and are expected to lead to insights that can guide structure-based drug design efforts. Copyright © 2011 Wiley Periodicals, Inc.

Effect of the walking speed to the lower limb joint angular displacements, joint moments and ground reaction forces during walking in water.

Science.gov (United States)

Miyoshi, Tasuku; Shirota, Takashi; Yamamoto, Shin-ichiro; Nakazawa, Kimitaka; Akai, Masami

2004-06-17

The purpose of this study was to compare the changes in ground reaction forces (GRF), joint angular displacements (JAD), joint moments (JM) and electromyographic (EMG) activities that occur during walking at various speeds in water and on land. Fifteen healthy adults participated in this study. In the water experiments, the water depth was adjusted so that body weight was reduced by 80%. A video-motion analysis system and waterproof force platform was used to obtain kinematics and kinetics data and to calculate the JMs. Results revealed that (1) the anterior-posterior GRF patterns differed between walking in water and walking on land, whereas the medio-lateral GRF patterns were similar, (2) the JAD patterns of the hip and ankle were similar between water- and land-walking, whereas the range of motion at the knee joint was lower in water than on land, (3) the JMs in all three joints were lower in water than on land throughout the stance phase, and (4) the hip joint extension moment and hip extensor muscle EMG activity were increased as walking speed increase during walking in water. Rehabilitative water-walking exercise could be designed to incorporate large-muscle activities, especially of the lower-limb extensor muscles, through full joint range of motion and minimization of joint moments.

Charge-transfer energy in the water-hydrogen molecular aggregate revealed by molecular-beam scattering experiments, charge displacement analysis, and ab initio calculations.

Science.gov (United States)

Belpassi, Leonardo; Reca, Michael L; Tarantelli, Francesco; Roncaratti, Luiz F; Pirani, Fernando; Cappelletti, David; Faure, Alexandre; Scribano, Yohann

2010-09-22

Integral cross-section measurements for the system water-H(2) in molecular-beam scattering experiments are reported. Their analysis demonstrates that the average attractive component of the water-H(2) intermolecular potential in the well region is about 30% stronger than dispersion and induction forces would imply. An extensive and detailed theoretical analysis of the electron charge displacement accompanying the interaction, over several crucial sections of the potential energy surface (PES), shows that water-H(2) interaction is accompanied by charge transfer (CT) and that the observed stabilization energy correlates quantitatively with CT magnitude at all distances. Based on the experimentally determined potential and the calculated CT, a general theoretical model is devised which reproduces very accurately PES sections obtained at the CCSD(T) level with large basis sets. The energy stabilization associated with CT is calculated to be 2.5 eV per electron transferred. Thus, CT is shown to be a significant, strongly stereospecific component of the interaction, with water functioning as electron donor or acceptor in different orientations. The general relevance of these findings for water's chemistry is discussed.

Water displacement leg volumetry in clinical studies - A discussion of error sources

Science.gov (United States)

2010-01-01

Background Water displacement leg volumetry is a highly reproducible method, allowing the confirmation of efficacy of vasoactive substances. Nevertheless errors of its execution and the selection of unsuitable patients are likely to negatively affect the outcome of clinical studies in chronic venous insufficiency (CVI). Discussion Placebo controlled double-blind drug studies in CVI were searched (Cochrane Review 2005, MedLine Search until December 2007) and assessed with regard to efficacy (volume reduction of the leg), patient characteristics, and potential methodological error sources. Almost every second study reported only small drug effects (≤ 30 mL volume reduction). As the most relevant error source the conduct of volumetry was identified. Because the practical use of available equipment varies, volume differences of more than 300 mL - which is a multifold of a potential treatment effect - have been reported between consecutive measurements. Other potential error sources were insufficient patient guidance or difficulties with the transition from the Widmer CVI classification to the CEAP (Clinical Etiological Anatomical Pathophysiological) grading. Summary Patients should be properly diagnosed with CVI and selected for stable oedema and further clinical symptoms relevant for the specific study. Centres require a thorough training on the use of the volumeter and on patient guidance. Volumetry should be performed under constant conditions. The reproducibility of short term repeat measurements has to be ensured. PMID:20070899

Pre-failure behaviour of an unstable limestone cliff from displacement and seismic data

Directory of Open Access Journals (Sweden)

J.-L. Got

2010-04-01

Full Text Available We monitored the displacement and seismic activity of an unstable vertical rock slice in a natural limestone cliff of the southeast Vercors massif, southeast France, during the months preceding its collapse. Displacement measurements showed an average acceleration of the movement of its top, with clear increases in the displacement velocity and in the discrete seismic event production rate during periods where temperature falls, with more activity when rainfall or frost occurs. Crises of discrete seismic events produce high amplitudes in periodograms, but do not change the high frequency base noise level rate. We infer that these crises express the critical crack growth induced by water weakening (from water vapor condensation or rain of the rock strength rather than to a rapid change in applied stresses. Seismic noise analysis showed a steady increase in the high frequency base noise level and the emergence of spectral modes in the signal recorded by the sensor installed on the unstable rock slice during the weeks preceding the collapse. High frequency seismic noise base level seems to represent subcritical crack growth. It is a smooth and robust parameter whose variations are related to generalized changes in the rupture process. Drop of the seismic noise amplitude was concomitant with the emergence of spectral modes – that are compatible with high-order eigenmodes of the unstable rock slice – during the later stages of its instability. Seismic noise analysis, especially high frequency base noise level analysis may complement that of inverse displacement velocity in early-warning approaches when strong displacement fluctuations occur.

Mechanism of chimera formation during the Multiple Displacement Amplification reaction

Directory of Open Access Journals (Sweden)

Stockwell Timothy B

2007-04-01

Full Text Available Abstract Background Multiple Displacement Amplification (MDA is a method used for amplifying limiting DNA sources. The high molecular weight amplified DNA is ideal for DNA library construction. While this has enabled genomic sequencing from one or a few cells of unculturable microorganisms, the process is complicated by the tendency of MDA to generate chimeric DNA rearrangements in the amplified DNA. Determining the source of the DNA rearrangements would be an important step towards reducing or eliminating them. Results Here, we characterize the major types of chimeras formed by carrying out an MDA whole genome amplification from a single E. coli cell and sequencing by the 454 Life Sciences method. Analysis of 475 chimeras revealed the predominant reaction mechanisms that create the DNA rearrangements. The highly branched DNA synthesized in MDA can assume many alternative secondary structures. DNA strands extended on an initial template can be displaced becoming available to prime on a second template creating the chimeras. Evidence supports a model in which branch migration can displace 3'-ends freeing them to prime on the new templates. More than 85% of the resulting DNA rearrangements were inverted sequences with intervening deletions that the model predicts. Intramolecular rearrangements were favored, with displaced 3'-ends reannealing to single stranded 5'-strands contained within the same branched DNA molecule. In over 70% of the chimeric junctions, the 3' termini had initiated priming at complimentary sequences of 2–21 nucleotides (nts in the new templates. Conclusion Formation of chimeras is an important limitation to the MDA method, particularly for whole genome sequencing. Identification of the mechanism for chimera formation provides new insight into the MDA reaction and suggests methods to reduce chimeras. The 454 sequencing approach used here will provide a rapid method to assess the utility of reaction modifications.

Free and binary rotation of polyatomic molecules

International Nuclear Information System (INIS)

Konyukhov, V K

2003-01-01

A modification of the quantum-mechanical theory of rotation of polyatomic molecules (binary rotation) is proposed, which is based on the algebra and representations of the SO(4) group and allows the introduction of the concept of parity, as in atomic spectroscopy. It is shown that, if an asymmetric top molecule performing binary rotation finds itself in a spatially inhomogeneous electric field, its rotational levels acquire the additional energy due to the quadrupole moment. The existence of the rotational states of polyatomic molecules that cannot transfer to the free rotation state is predicted. In particular, the spin isomers of a water molecule, which corresponds to such states, can have different absolute values of the adsorption energy due to the quadrupole interaction of the molecule with a surface. The difference in the adsorption energies allows one to explain qualitatively the behaviour of the ortho- and para-molecules of water upon their adsorption on the surface of solids in accordance with experimental data. (laser applications and other topics in quantum electronics)

Emerging organic pollutants in the vadose zone of a soil aquifer treatment system: Pore water extraction using positive displacement.

Science.gov (United States)

Sopilniak, Alexander; Elkayam, Roy; Rossin, Anna Voloshenko; Lev, Ovadia

2018-01-01

Trace organic compounds in effluents, water streams and aquifers are amply reported. However, the mobile pool of Emerging Organic Contaminants (EOCs) in the deep parts of the vadose zone is hard to estimate, due to difficulties in extraction of sufficient quantity of pore water. Here, we present a new methodology for depth profiling of EOCs in pore water by Positive Displacement Extraction (PDE): Pore water extraction from unsaturated soil samples is carried out by withdrawal of soil cores by direct-push drilling and infiltrating the core by organics free water. We show that EOC concentrations in the water eluted in the plateau region of the inverse breakthrough curve is equal to their pore water concentrations. The method was previously validated for DOC extraction, and here the scope of the methodology is extended to pore water extraction for organic pollutants analysis. Method characteristics and validation were carried out with atrazine, simazine, carbamazepine, venlafaxine, O-desmethylvenlafaxine and caffeine in the concentration range of several ng to several μg/liter. Validation was carried out by laboratory experiments on three different soils (sandy, sandy-clayey and clayey). Field studies in the vadose zone of a SAT system provided 27 m deep EOC profiles with less than 1.5 m spatial resolution. During the percolation treatment, carbamazepine remained persistent, while the other studied EOCs were attenuated to the extent of 50-99%.The highest degradation rate of all studied EOCs was in the aerobic zone. EOC levels based on PDE and extraction by centrifugation were compared, showing a positive bias for centrifugation. Copyright © 2017 Elsevier Ltd. All rights reserved.

The use of a displacement device negatively affects the performance of dogs (Canis familiaris) in visible object displacement tasks.

Science.gov (United States)

Müller, Corsin A; Riemer, Stefanie; Range, Friederike; Huber, Ludwig

2014-08-01

Visible and invisible displacement tasks have been used widely for comparative studies of animals' understanding of object permanence, with evidence accumulating that some species can solve invisible displacement tasks and, thus, reach Piagetian stage 6 of object permanence. In contrast, dogs appear to rely on associative cues, such as the location of the displacement device, during invisible displacement tasks. It remains unclear, however, whether dogs, and other species that failed in invisible displacement tasks, do so because of their inability to form a mental representation of the target object, or simply because of the involvement of a more salient but potentially misleading associative cue, the displacement device. Here we show that the use of a displacement device impairs the performance of dogs also in visible displacement tasks: their search accuracy was significantly lower when a visible displacement was performed with a displacement device, and only two of initially 42 dogs passed the sham-baiting control conditions. The negative influence of the displacement device in visible displacement tasks may be explained by strong associative cues overriding explicit information about the target object's location, reminiscent of an overshadowing effect, and/or object individuation errors as the target object is placed within the displacement device and moves along a spatiotemporally identical trajectory. Our data suggest that a comprehensive appraisal of a species' performance in object permanence tasks should include visible displacement tasks with the same displacement device used in invisible displacements, which typically has not been done in the past.

Bond rearrangement caused by sudden single and multiple ionization of water molecules

International Nuclear Information System (INIS)

Ben-Itzhak, I.; Sayler, A. Max; Leonard, M.; Maseberg, J.W.; Hathiramani, D.; Wells, E.; Smith, M.A.; Xia, Jiangfan; Wang, Pengqian; Carnes, K.D.; Esry, B.D.

2005-01-01

Bond rearrangement, namely the dissociation of water into H 2 + +O q+ following ionization by fast proton and highly charged ion impact, was investigated. Single ionization by fast proton impact exhibits a strong isotopic effect, the dissociation of H 2 O + ->H 2 + +O being about twice as likely as D 2 O + ->D 2 + +O, with HDO + ->HD + +O in between. This suggests that the bond rearrangement does not happen during the slow dissociation, but rather during the very fast ionization, and thus H 2 + should also be produced when the water molecule is multiply ionized. We observed that the H 2 + +O + and H 2 + +O 2+ production in 1MeV/amu F 7+ +H 2 O collisions are 0.209+/-0.006% and 0.0665+/-0.003%, respectively, of the main double-ionization dissociation product, H 2 O 2+ ->H + +OH + . This ratio is similar to the triple to double ionization ratio in similar collisions with atomic targets thus suggesting that the bond-rearrangement fraction out of each ionization level is approximately constant. Similar dissociation channels in the heavier water isotopes, which are expected to be smaller, are under study. Finally, the fragmentation of HDO exhibits very strong isotopic preference for breaking the OH bond over the OD bond

Displacement of Drugs from Human Serum Albumin: From Molecular Interactions to Clinical Significance.

Science.gov (United States)

Rimac, Hrvoje; Debeljak, Željko; Bojić, Mirza; Miller, Larisa

2017-01-01

Human serum albumin (HSA) is the most abundant protein in human serum. It has numerous functions, one of which is transport of small hydrophobic molecules, including drugs, toxins, nutrients, hormones and metabolites. HSA has the ability to interact with a wide variety of structurally different compounds. This promiscuous, nonspecific affinity can lead to sudden changes in concentrations caused by displacement, when two or more compounds compete for binding to the same molecular site. It is important to consider drug combinations and their binding to HSA when defining dosing regimens, as this can directly influence drug's free, active concentration in blood. In present paper we review drug interactions with potential for displacement from HSA, situations in which they are likely to occur and their clinical significance. We also offer guidelines in designing drugs with decreased binding to HSA. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Displacement data assimilation

Energy Technology Data Exchange (ETDEWEB)

Rosenthal, W. Steven [Pacific Northwest Laboratory, Richland, WA 99354 (United States); Venkataramani, Shankar [Department of Mathematics and Program in Applied Mathematics, University of Arizona, Tucson, AZ 85721 (United States); Mariano, Arthur J. [Rosenstiel School of Marine & Atmospheric Science, University of Miami, Miami, FL 33149 (United States); Restrepo, Juan M., E-mail: restrepo@math.oregonstate.edu [Department of Mathematics, Oregon State University, Corvallis, OR 97331 (United States)

2017-02-01

We show that modifying a Bayesian data assimilation scheme by incorporating kinematically-consistent displacement corrections produces a scheme that is demonstrably better at estimating partially observed state vectors in a setting where feature information is important. While the displacement transformation is generic, here we implement it within an ensemble Kalman Filter framework and demonstrate its effectiveness in tracking stochastically perturbed vortices.

A pressure-induced displacive phase transition in Tris(ethylenediamine) Nickel(II) nitrate

OpenAIRE

Cameron, C.A.; Allan, D.R.; Kamenev, K.V.; Moggach, S.A.; Murrie, M.; Parsons, S.

2014-01-01

[Ni(en)(3)] [NO3](2) undergoes a displacive phase transition from P6(3)22 at ambient pressure to a lower symmetry P6(1)22/P6(5)22 structure between 0.82 and 0.87 GPa, which is characterized by a tripling of the unit cell c-axis and the number of molecules per unit cell. The same transition has been previously observed at 108 K. The application of pressure leads to a general shortening of O H hydrogen bonding interactions in the structure, with the greatest contraction (24%) occurring diagonal...

Two-dimensional crystallography of amphiphilic molecules at the air-water interface

DEFF Research Database (Denmark)

Jacquemain, D.; Grayer Wolf, S.; Leveiller, F.

1992-01-01

The advent of well-collimated, high-intensity synchrotron X-ray sources and the consequent development of surface-specific X-ray diffraction and fluorescence techniques have recently revolutionized the study of Langmuir monolayers at the air-liquid interface. These methods allowed for the first......, and review recent results obtained from them for Langmuir films. The methods have been successfully applied in the elucidation of the structure of crystalline aggregates of amphiphilic molecules such as alcohols, carboxylic acids and their salts, alpha-amino acids, and phospholipids at the water surface....... In addition, it became possible to monitor by diffraction the growth and dissolution of the crystalline self-aggregates as well as structural changes occurring by phase transitions. Furthermore, the surface X-ray methods shed new light on the structure of the underlying ionic layer of attached solvent...

Displacement cascades in diatomic materials

International Nuclear Information System (INIS)

Parkin, D.M.; Coulter, C.A.

1981-01-01

A new function, the specified-projectile displacement function p/sub ijk/ (E), is introduced to describe displacement cascades in polyatomic materials. This function describes the specific collision events that produce displacements and hence adds new information not previously available. Calculations of p/sub ijk/ (E) for MgO, Al 2 O 3 and TaO are presented and discussed. Results show that the parameters that have the largest effect on displacement collision events are the PKA energy and the mass ratio of the atom types in the material. It is further shown that the microscopic nature of the displacement events changes over the entire recoil energy range relevant to fusion neutron spectra and that these changes are different in materials whose mass ratio is near one than in those where it is far from one

A TRLFS Study on the Interactions of Am(III) at the Interface of Water and Silica Nanoparticles

Energy Technology Data Exchange (ETDEWEB)

Kim, Hee-Kyung; Jung, Euo Chang; Cho, Hye-Ryun; Cha, Wansik [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2016-10-15

In this study, we employed time-resolved laser-induced fluorescence spectroscopy (TRLFS) to characterize Am(III) interactions with SiO{sub 2} nanoparticles at a molecular level. TRLFS results show that adsorption of Am(III) onto the silica broadens the luminescence spectra with red-shifts of 2-3 nm. Luminescence lifetime measurements show the increase in the lifetime from 23.5 ± 0.3 ns to ⁓37 ns as the pH increases from 2.5 to 8 or above. The observations indicate that adsorption takes place via inner-sphere bindings by displacing about four inner-sphere bound water molecules. At the pH 7 and above, additional longer lifetime (> 100 ns) component was identified, which corresponds to displacing all the inner-sphere water molecules. We will discuss more details on the spectral characteristics of the adsorbed Am(III) and their implications. Adsorption of Am(III) onto silica nanoparticles was studied as a function of the pH by using batch-sorption experiments and TRLFS. TRLFS results show that adsorbed Am(III) displays broadened luminescence spectra with longer lifetimes compared to those of the aqueous species, indicating that adsorption takes place via formation of inner-sphere surface complexes. Our data also suggest that at least two different types of Am(III)-silica species are present at the pH above 7.

A web-based GPS system for displacement monitoring and failure mechanism analysis of reservoir landslide.

Science.gov (United States)

Li, Yuanyao; Huang, Jinsong; Jiang, Shui-Hua; Huang, Faming; Chang, Zhilu

2017-12-07

It is important to monitor the displacement time series and to explore the failure mechanism of reservoir landslide for early warning. Traditionally, it is a challenge to monitor the landslide displacements real-timely and automatically. Globe Position System (GPS) is considered as the best real-time monitoring technology, however, the accuracies of the landslide displacements monitored by GPS are not assessed effectively. A web-based GPS system is developed to monitor the landslide displacements real-timely and automatically in this study. And the discrete wavelet transform (DWT) is proposed to assess the accuracy of the GPS monitoring displacements. Wangmiao landslide in Three Gorges Reservoir area in China is used as case study. The results show that the web-based GPS system has advantages of high precision, real-time, remote control and automation for landslide monitoring; the Root Mean Square Errors of the monitoring landslide displacements are less than 5 mm. Meanwhile, the results also show that a rapidly falling reservoir water level can trigger the reactivation of Wangmiao landslide. Heavy rainfall is also an important factor, but not a crucial component.

Proton transfer dynamics in a polar nanodroplet: ESIPT of 4'-n,n-dimethylamino-3-hydroxyflavone in AOT/alkane/water reverse micelles

Energy Technology Data Exchange (ETDEWEB)

Ghosh, Deborin [Department of Chemistry, University College of Science & Technology, University of Calcutta, 92, A.P.C. Road, Kolkata 700 009 (India); Batuta, Shaikh; Begum, Naznin Ara [Bio-Organic Chemistry Lab, Department of Chemistry, Visva-Bharati University, Santiniketan 731 235 (India); Mandal, Debabrata, E-mail: dmandal.chemistry@gmail.com [Department of Chemistry, University College of Science & Technology, University of Calcutta, 92, A.P.C. Road, Kolkata 700 009 (India)

2017-04-15

The excited state intramolecular proton transfer (ESIPT) of the well-known fluorophore 4'-N,N-Dimethylamino-3-hydroxyflavone (DMA3HF) was studied in AOT/n-heptane/water reverse micelle solutions. For DMA3HF molecules located inside the AOT encapsulated polar nanodroplets, ESIPT from excited enol (E*) to tautomer (T*) forms was markedly inhibited, yielding time-constants of ≥100 ps, and followed the same trend as solvent relaxation when the ratio W= [H{sub 2}O]/[AOT] was varied. At W=0, the DMA3HF molecules were attached to the ionic AOT headgroups via strong intermolecular H-bonding, which hindered ESIPT. Addition of water changes the situation radically: water molecules form stronger H-bonds with AOT headgroups, displacing the DMA3HF, which are instead engaged in intermolecular H-bonded complexes of the type [DMA3HF···water]. ESIPT of these complex-bound fluorophores involves substantial rearrangement of H-bonding, and is coupled to solvation dynamics. With increasing W-value, solvation becomes faster, and so does ESIPT, reducing the yield of E* species. At the same time, the local environment within the nanodroplets become more more polar with gradual accumulation of water, which causes a monotonic red-shift of the E* emission peak.

Quantification of the Intracellular Life Time of Water Molecules to Measure Transport Rates of Human Aquaglyceroporins.

Science.gov (United States)

Palmgren, Madelene; Hernebring, Malin; Eriksson, Stefanie; Elbing, Karin; Geijer, Cecilia; Lasič, Samo; Dahl, Peter; Hansen, Jesper S; Topgaard, Daniel; Lindkvist-Petersson, Karin

2017-12-01

Orthodox aquaporins are transmembrane channel proteins that facilitate rapid diffusion of water, while aquaglyceroporins facilitate the diffusion of small uncharged molecules such as glycerol and arsenic trioxide. Aquaglyceroporins play important roles in human physiology, in particular for glycerol metabolism and arsenic detoxification. We have developed a unique system applying the strain of the yeast Pichia pastoris, where the endogenous aquaporins/aquaglyceroporins have been removed and human aquaglyceroporins AQP3, AQP7, and AQP9 are recombinantly expressed enabling comparative permeability measurements between the expressed proteins. Using a newly established Nuclear Magnetic Resonance approach based on measurement of the intracellular life time of water, we propose that human aquaglyceroporins are poor facilitators of water and that the water transport efficiency is similar to that of passive diffusion across native cell membranes. This is distinctly different from glycerol and arsenic trioxide, where high glycerol transport efficiency was recorded.

Site-specific binding of a water molecule to the sulfa drugs sulfamethoxazole and sulfisoxazole: a laser-desorption isomer-specific UV and IR study.

Science.gov (United States)

Uhlemann, Thomas; Seidel, Sebastian; Müller, Christian W

2018-03-07

To determine the preferred water molecule binding sites of the polybasic sulfa drugs sulfamethoxazole (SMX) and sulfisoxazole (SIX), we have studied their monomers and monohydrated complexes through laser-desorption conformer-specific UV and IR spectroscopy. Both the SMX and SIX monomer adopt a single conformer in the molecular beam. On the basis of their conformer-specific IR spectra in the NH stretch region, these conformers were assigned to the SMX and SIX global minimum structures, both exhibiting a staggered sulfonamide group and an intramolecular C-HO[double bond, length as m-dash]S hydrogen bond. The SMX-H 2 O and SIX-H 2 O complexes each adopt a single isomer in the molecular beam. Their isomeric structures were determined based on their isomer-specific IR spectra in the NH/OH stretch region. Quantum Theory of Atoms in Molecules analysis of the calculated electron densities revealed that in the SMX-H 2 O complex the water molecule donates an O-HN hydrogen bond to the heterocycle nitrogen atom and accepts an N-HO hydrogen bond from the sulfonamide NH group. In the SIX-H 2 O complex, however, the water molecule does not bind to the heterocycle but instead donates an O-HO[double bond, length as m-dash]S hydrogen bond to the sulfonamide group and accepts an N-HO hydrogen bond from the sulfonamide NH group. Both water complexes are additionally stabilized by a C ph -HOH 2 hydrogen bond. Interacting Quantum Atoms analysis suggests that all intermolecular hydrogen bonds are dominated by the short-range exchange-correlation contribution.

Determination of the displacement cross-section in C-60 fullerene exposed to the gamma rays

International Nuclear Information System (INIS)

Leyva, A.; Pinnera, I.; Leyva, D.; Cruz, C.; Abreu, Y.

2011-01-01

Using the threshold energy values reported in literature for spherical fullerene C-60 molecules and taking into account the McKinley-Feshbach approach, the effective atomic displacement cross-section in C-60 nanostructures exposed to the gamma rays was estimated. The Kinchin-Pease approximation for the damage function was also considered. These calculations were performed using MCCM code system developed by the authors for the study of gamma radiation damage in solid materials. (Author)

Modelling toehold-mediated RNA strand displacement.

Science.gov (United States)

Šulc, Petr; Ouldridge, Thomas E; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A

2015-03-10

We study the thermodynamics and kinetics of an RNA toehold-mediated strand displacement reaction with a recently developed coarse-grained model of RNA. Strand displacement, during which a single strand displaces a different strand previously bound to a complementary substrate strand, is an essential mechanism in active nucleic acid nanotechnology and has also been hypothesized to occur in vivo. We study the rate of displacement reactions as a function of the length of the toehold and temperature and make two experimentally testable predictions: that the displacement is faster if the toehold is placed at the 5' end of the substrate; and that the displacement slows down with increasing temperature for longer toeholds. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Theoretical aspects of electron transfer reactions of complex molecules

DEFF Research Database (Denmark)

Kuznetsov, A. M.; Ulstrup, Jens

2001-01-01

Features of electron transfer involving complex molecules are discussed. This notion presently refers to molecular reactants where charge transfer is accompanied by large molecular reorganization, and commonly used displaced harmonic oscillator models do not apply. It is shown that comprehensive...... theory of charge transfer in polar media offers convenient tools for the treatment of experimental data for such systems, with due account of large-amplitude strongly anharmonic intramolecular reorganization. Equations for the activation barrier and free energy relationships are provided, incorporating...

Explicit Consideration of Water Molecules to Study Vibrational Circular DICHROÎSM of Monosaccharide's

Science.gov (United States)

Moussi, Sofiane; Ouamerali, Ourida

2014-06-01

Carbohydrates have multiples roles in biological systems. It has been found that the glycoside bond is fundamentally important in many aspects of chemistry and biology and forms the basis of carbohydrate chemistry. That means the stereochemical information, namely, glycosidic linkages α or β, gives an significant features of the carbohydrate glycosidation position of the glycosylic acceptor. For these reasons, much effort was made for the synthesis and analysis of the glycoside bond. Vibrational circular dichroism VCD has some advantages over conventional electronic circular dichroism (ECD) due to the applicability to all organic molecules and the reliability of ab initio quantum calculation. However, for a molecule with many chiral centers such as carbohydrates, determination of the absolute configuration tends to be difficult because the information from each stereochemical center is mixed and averaged over the spectrum. In the CH stretching region, only two VCD studies on carbohydrates have been reported and spectra--structure correlation, as determined for the glycoside band, remains to be investigated. T. Taniguchi and collaborators report that methyl glycosides exhibit a characteristic VCD peak, the sign of which solely reflects the C-1 absolute configuration. This work is a theoretical contribution to study the behaviour of VCD spectrum's of the monosaccharides when the water molecules are taken explicitly. This study is focused on six different monosaccharides in theirs absolute configuration R and S. We used the method of density functional theory DFT by means of the B3LYP hybrid functional and 6-31G * basis set.

MRI of displaced meniscal fragments

International Nuclear Information System (INIS)

Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

2012-01-01

A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

MRI of displaced meniscal fragments

Energy Technology Data Exchange (ETDEWEB)

Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)

2012-01-15

A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

Effect of organic molecules on hydrolysis of peptide bond: A DFT study

International Nuclear Information System (INIS)

Makshakova, Olga; Ermakova, Elena

2013-01-01

Highlights: ► DFT study of the effects of small organic molecules on the hydrolysis reactions of peptide bonds. ► Organic molecules can activate nonenzymatic hydrolysis reaction. ► Influence of organic acids on activation energy barrier correlates with their electronegativity. - Abstract: The activation and inhibition effects of small organic molecules on peptide hydrolysis have been studied using a model compound dialanine and DFT approach. Solvent-assisted and non-assisted concerted mechanisms were analyzed. Several transition states for the systems: alanine dipeptide–water molecule in complexes with alcohol molecules, acetonitrile, dimethylsulfoxide, propionic, lactic and pyruvic acids and water molecules were localized. The formation of hydrogen bonds between dipeptide, reactive water molecule and molecules of solvents influences the activation energy barrier of the peptide bond hydrolytic reaction. Strong effect of organic acids on the activation energy barrier correlates with their electronegativity. Acetonitrile can act as an inhibitor of reaction. Mechanisms of regulation of the activation energy barrier are discussed in the terms of donor-acceptor interactions

DNA-mediated strand displacement facilitates sensitive electronic detection of antibodies in human serums.

Science.gov (United States)

Dou, Baoting; Yang, Jianmei; Shi, Kai; Yuan, Ruo; Xiang, Yun

2016-09-15

We describe here the development of a sensitive and convenient electronic sensor for the detection of antibodies in human serums. The sensor is constructed by self-assembly formation of a mixed monolayer containing the small molecule epitope conjugated double stranded DNA probes on gold electrode. The target antibody binds the epitope on the dsDNA probe and lowers the melting temperature of the duplex, which facilitates the displacement of the antibody-linked strand of the duplex probe by an invading methylene blue-tagged single stranded DNA (MB-ssDNA) through the strand displacement reaction and leads to the capture of many MB-ssDNA on the sensor surface. Subsequent electrochemical oxidation of the methylene blue labels results in amplified current response for sensitive monitoring of the antibodies. The antibody assay conditions are optimized and the sensor exhibits a linear range between 1.0 and 25.0nM with a detection limit of 0.67nM for the target antibody. The sensor is also selective and can be employed to detect the target antibodies in human serum samples. With the advantages of using small molecule epitope as the antibody recognition element over traditional antigen, the versatile manipulability of the DNA probes and the unique properties of the electrochemical transduction technique, the developed sensor thus hold great potential for simple and sensitive detection of different antibodies and other proteins in real samples. Copyright © 2016 Elsevier B.V. All rights reserved.

Effects of threshold displacement energy on defect production by displacement cascades in α, β and γ-LiAlO2

International Nuclear Information System (INIS)

Tsuchihira, H.; Oda, T.; Tanaka, S.

2013-01-01

Threshold displacement energy evaluation and a series of displacement cascade simulations in α, β, and γ-LiAlO 2 were performed using molecular dynamics. Threshold displacement energy evaluations indicated that higher absolute ionic charge values and larger densities both increase threshold displacement energy. The displacement cascade simulations suggest that the influence of different crystal structures on the number of interstitial atoms generated in a displacement cascade is explainable almost entirely by the difference of the threshold displacement energy

Effect of displaced versus non-displaced pelvic fractures on long-term racing performance in 31 Thoroughbred racehorses.

Science.gov (United States)

Hennessy, S E; Muurlink, M A; Anderson, G A; Puksmann, T N; Whitton, R C

2013-06-01

To evaluate the long-term racing prognosis for Thoroughbred racehorses with displaced versus non-displaced fractures of the pelvis identified by scintigraphy. Retrospective case analysis. Medical records of 31 Thoroughbred racehorses presenting to the University of Melbourne Equine Centre with fractures of the pelvis that were identified by scintigraphy were reviewed. Pelvic fracture site was determined and defined as displaced or non-displaced based on ultrasound and/or radiographic findings. Race records were analysed for each horse, with a minimum of 24 months' follow-up, and correlated with fracture type to determine long-term prognosis for racing. Results are expressed as median and range. Fractures at a single site were more common (n = 22) than fractures involving two sites (n = 9) and the ilial wing was the most commonly affected (n = 12). Thoroughbred racehorses with displaced pelvic fractures at any site (n = 12) raced fewer times within 24 months of diagnosis than horses with non-displaced fractures (n = 19) (median 0.5, range 0-13 vs 7, 0-24; P = 0.037), but there was no clear statistical difference in race earnings between the two groups (median A$0, range A$0-$123,250 vs A$14,440, A$0-$325,500, respectively; P = 0.080). Four horses with displaced fractures (33%) were euthanased on humane grounds because of persistent severe pain. When these horses were excluded from the analysis, there were no differences in performance variables between horses with a displaced or non-displaced pelvic fracture. Thoroughbred racehorses with a displaced or non-displaced pelvic fracture that survive the initial post-injury period have a good prognosis for racing. © 2013 The Authors. Australian Veterinary Journal © 2013 Australian Veterinary Association.

Time-Lapse Photography of the Edge-of-Water Line Displacements of a Sandbar as a Proxy of Riverine Morphodynamics

Directory of Open Access Journals (Sweden)

Michael Nones

2018-05-01

Full Text Available A simple methodology to track the displacements of a sandbar from a fixed video camera, extracting its morphological features and deriving the associated fluvial morphology is presented, using a small reach of the Po River in Italy as a case study. A camera fixed on a bridge pier acquired images every twelve hours while hourly water levels are derived from a radar hydrometer located upstream of the study area. The quantification of the fluvial bathymetry is achieved by mapping multiple edge-of-water lines of a sandbar before and after high flow conditions in December 2017. Both from video information and 2-D numerical simulations, it is evident that flooding waves can easily remove sediments that accumulated on bars during low flow conditions in this area, redistributing them across the river channel. This video-based methodology—which confirms to be economically attractive if compared to more traditional monitoring systems—proves to be a valuable system to monitor long-term fluvial processes providing detailed indications on how to better plan river management activities.

Selective and Sensitive Detection of Cyanide Based on the Displacement Strategy Using a Water-Soluble Fluorescent Probe

Science.gov (United States)

La, Ming; Hao, Yuanqiang; Wang, Zhaoyang; Han, Guo-Cheng; Qu, Lingbo

2016-01-01

A water-soluble fluorescent probe (C-GGH) was used for the highly sensitive and selective detection of cyanide (CN−) in aqueous media based on the displacement strategy. Due to the presence of the recognition unit GGH (Gly-Gly-His), the probe C-GGH can coordinate with Cu2+ and consequently display ON-OFF type fluorescence response. Furthermore, the in situ formed nonfluorescent C-GGH-Cu2+ complex can act as an effective OFF-ON type fluorescent probe for sensing CN− anion. Due to the strong binding affinity of CN− to Cu2+, CN− can extract Cu2+ from C-GGH-Cu2+ complex, leading to the release of C-GGH and the recovery of fluorescent emission of the system. The probe C-GGH-Cu2+ allowed detection of CN− in aqueous solution with a LOD (limit of detection) of 0.017 μmol/L which is much lower than the maximum contaminant level (1.9 μmol/L) for CN− in drinking water set by the WHO (World Health Organization). The probe also displayed excellent specificity for CN− towards other anions, including F−, Cl−, Br−, I−, SCN−, PO4 3−, N3 −, NO3 −, AcO−, SO4 2−, and CO3 2−. PMID:26881185

Selective and Sensitive Detection of Cyanide Based on the Displacement Strategy Using a Water-Soluble Fluorescent Probe

Directory of Open Access Journals (Sweden)

Ming La

2016-01-01

Full Text Available A water-soluble fluorescent probe (C-GGH was used for the highly sensitive and selective detection of cyanide (CN− in aqueous media based on the displacement strategy. Due to the presence of the recognition unit GGH (Gly-Gly-His, the probe C-GGH can coordinate with Cu2+ and consequently display ON-OFF type fluorescence response. Furthermore, the in situ formed nonfluorescent C-GGH-Cu2+ complex can act as an effective OFF-ON type fluorescent probe for sensing CN− anion. Due to the strong binding affinity of CN− to Cu2+, CN− can extract Cu2+ from C-GGH-Cu2+ complex, leading to the release of C-GGH and the recovery of fluorescent emission of the system. The probe C-GGH-Cu2+ allowed detection of CN− in aqueous solution with a LOD (limit of detection of 0.017 μmol/L which is much lower than the maximum contaminant level (1.9 μmol/L for CN− in drinking water set by the WHO (World Health Organization. The probe also displayed excellent specificity for CN− towards other anions, including F−, Cl−, Br−, I−, SCN−, PO43-, N3-, NO3-, AcO−, SO42-, and CO32-.

Refugees and displaced persons. War, hunger, and public health.

Science.gov (United States)

Toole, M J; Waldman, R J

1993-08-04

The number of refugees and internally displaced persons in need of protection and assistance has increased from 30 million in 1990 to more than 43 million today. War and civil strife have been largely responsible for this epidemic of mass migration that has affected almost every region of the world, including Europe. Since 1990, crude death rates (CDRs) during the early influx of refugees who crossed international borders have been somewhat lower than CDRs reported earlier among Cambodian and Ethiopian refugees. Nevertheless, CDRs among refugees arriving in Ethiopia, Kenya, Nepal, Malawi, and Zimbabwe since 1990 ranged from five to 12 times the baseline CDRs in the countries of origin. Among internally displaced populations in northern Iraq, Somalia, and Sudan, CDRs were extremely high, ranging from 12 to 25 times the baseline CDRs for the nondisplaced. Among both refugees and internally displaced persons, death rates among children less than 5 years of age were far higher than among older children and adults. In Bangladesh, the death rate in female Rohingya refugees was several times higher than in males. Preventable conditions such as diarrheal disease, measles, and acute respiratory infections, exacerbated often by malnutrition, caused most deaths. Although relief programs for refugees have improved since 1990, the situation among the internally displaced may have worsened. The international community should intervene earlier in the evolution of complex disasters involving civil war, human rights abuses, food shortages, and mass displacement. Relief programs need to be based on sound health and nutrition information and should focus on the provision of adequate shelter, food, water, sanitation, and public health programs that prevent mortality from diarrhea, measles, and other communicable diseases, especially among young children and women.

The displaced and dispossessed of Darfur: explaining the sources of a continuing state-led genocide.

Science.gov (United States)

Hagan, John; Kaiser, Joshua

2011-03-01

The millions of survivors who fled from attacks to Sudanese-controlled displacement camps and the refugee camps in Chad are the living ghosts of the Darfur genocide. The 1948 Genocide Convention incorporates extermination by mass killing and elimination through forced migration as two distinct elements of genocide. Genocide scholars and public discourse emphasize extermination by killing, but they give far less explanatory attention to the elimination processes that the Genocide Convention describes as 'deliberately inflicting on the group conditions of life calculated to bring about its physical destruction'. (Article II United Nations 1948.) In Darfur, understanding the latter processes requires theoretical attention to the history of food, water, and famine and detailed methodological attention to temporal processes of displacement. We demonstrate how intentional state-led attacks on food and water massively dislodged Black Africans in Darfur from February 2003 to August 2004. The political leadership of the Sudanese state dehumanized and forcibly displaced Black Africans from their homes in Darfur to camps where they largely remain, not only through mass killings and rapes, but also by destroying life-sustaining access to food and water, leading to the genocidal elimination of group life in this region. © London School of Economics and Political Science 2011.

Activation of a water molecule coordinated to manganese: four study cases

International Nuclear Information System (INIS)

Lassalle-Kaiser, B.

2008-10-01

The daunting energy consumption of western societies calls for the development of renewable energies. Among them, hydrogen stands as a major candidate. The cleanest way of producing hydrogen is water electro- or photolysis. This reaction is carried out in natural photosynthesis by a manganese-oxo cluster, the functioning of which remains unknown. Insight into this mechanism would greatly help the search for low-cost water splitting catalysts. Our contribution to this field is the understanding of the fundamental processes that govern the activation of water by manganese complexes. This manuscript describes our attempts to generate electrochemically mononuclear manganese(IV) complexes bearing a fully deprotonated water molecule (oxo ligand). We have studied four different cases, which reflect different possible coordination spheres capable of stabilizing such species. In the first chapter, we will give a brief overview of the present energetic challenges faced by western societies. In the second chapter, we will present general considerations about manganese chemistry and a description of the structure and functioning of the water oxidizing enzyme. We will also describe the basic requirements for the splitting of water and present the goals of our work. In the third chapter, we will present the synthesis of a new family of tetradentate ligands, together with the synthesis and full characterization of the corresponding nickel(II) complexes. The first results obtained with the manganese analogue will also be shown. Chapter four presents the formation and the full characterization of a mononuclear manganese(IV)-oxo complex, by electrochemical oxidation of a manganese(II)-aqua complex. We will present different pathways to generate this species and show which intermediates are involved in this 2 e - , 2 H + reaction. Chapter five describes the formation of a mononuclear manganese(IV) complex, by electrochemical oxidation of a manganese(III)-hydroxo complex. The

Sloshing of water in annular pressure-suppression pool of boiling water reactors under earthquake ground motions

International Nuclear Information System (INIS)

Aslam, M.; Godden, W.G.; Scalise, D.T.

1979-10-01

This report presents an analytical investigation of the sloshing response of water in annular-circular as well as simple-circular tanks under horizontal earthquake ground motions, and the results are verified with tests. This study was motivated because of the use of annular tanks for pressure-suppression pools in Boiling Water Reactors. Such a pressure-suppression pool would typically have 80 ft and 120 ft inside and outside diameters and a water depth of 20 ft. The analysis was based upon potential flow theory and a computer program was written to obtain time-history plots of sloshing displacements of water and the dynamic pressures. Tests were carried out on 1/80th and 1/15th scale models under sinusoidal as well as simulated earthquake ground motions. Tests and analytical results regarding the natural frequencies, surface water displacements, and dynamic pressures were compared and a good agreement was found for relatively small displacements. The computer program gave satisfactory results as long as the maximum water surface displacements were less than 30 in., which is roughly the value obtained under full intensity of El Centro earthquake

The adsorption and dissociation of water molecule on goethite (010) surface: A DFT approach

Energy Technology Data Exchange (ETDEWEB)

Zhou, Long, E-mail: shuweixia@ouc.edu.cn [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China); Xiu, Fangyuan [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China); Qiu, Meng [Qingdao Institute of Bioenergy and Bioprocess Technology (China); Xia, Shuwei; Yu, Liangmin [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China)

2017-01-15

Graphical abstract: The optimized structure of hydrated goethite (010) surface with medium water coverage (water density about 6.7 H{sub 2}O/nm{sup 2}). - Highlights: • Stable adsorption and dissociation structure of H{sub 2}O on goethite (010) surface was investigated by DFT. • Reasonable path for water dissociation was proposed by transitional state analysis. • The mechanism of water adsorption on goethite and binding nature were revealed by PDOS. - Abstract: Using density functional theory (DFT) calculation, we investigate the configuration, stability and electronic properties of fresh cleaved (010) goethite surface (Pnma) and this surface exposed to water monolayer at low, medium and high coverage. Water is predicted to be chemisorbed to the surface, together with the surface reconstruction. The interaction energy of the most stable configuration of both low and medium coverage per water molecule is almost the same (−1.17 eV), while that of high coverage is much lower (less than 1.03 eV). It indicates that highly hydrated surface is less stable. PDOS analysis reveals the adsorption of H{sub 2}O is due to the formation of Fe−O bond, caused by overlapping of Fe's 3d and O's 2p orbitals. Dissociation processes at low and medium water coverage are non-spontaneous; while at high coverage, it can undertake spontaneously both thermodynamically and dynamically. The dissociation paths of all three water coverage are the similar. The proton from one adsorbed water is likely to dissociate to bind to the vicinal surface μ{sub 3}−O as an intermediate product; the proton belonged to μ{sub 3}−O transferred to the neighbor surface μ{sub 2}−O as the dissociative configuration.

Fundamentals of displacement production in irradiated metals

International Nuclear Information System (INIS)

Doran, D.G.

1975-09-01

Radioinduced displacement damage in metals is described. Discussions are included on the displacement event itself, calculation of displacement rates in general, the manner in which different types of radiation interact with metals to produce displacements, the similarities and differences in the types of damage produced, the current status of computer simulations of displacement cascades, experimental evidence regarding cascades, and aspects of correlating damage produced by different types of radiation

Ethanol oxidation reactions catalyzed by water molecules: CH3CH2OH+n H2O→ CH3CHO+ H2+n H2O (n=0,1,2)

Science.gov (United States)

Takahashi, H.; Hisaoka, S.; Nitta, T.

2002-09-01

Ab initio density functional theory calculations have been performed to investigate the catalytic role of water molecules in the oxidation reaction of ethanol: CH3CH2OH+n H2O→ CH3CHO+ H2+n H2O (n=0,1,2) . The results show that the potential energy barrier for the reaction is 88.0 kcal/mol in case of n=0, while it is reduced by ˜34 kcal/mol when two water molecules are involved ( n=2) in the reaction. As a result, the rate constant increases to 3.31×10 -4 s-1, which shows a significant catalytic role of water molecules in the ethanol oxidation reactions.

MSINDO quantum chemical modeling study of water molecule adsorption at nano-sized anatase TiO2 surfaces

International Nuclear Information System (INIS)

Wahab, Hilal S.; Bredow, Thomas; Aliwi, Salah M.

2008-01-01

In this work, we studied the adsorption of water molecule onto the (1 0 0), (0 1 0) and (0 0 1) surfaces of nano-sized anatase TiO 2 with semiempirical SCF MO method, MSINDO. The anatase TiO 2 particles are modeled with free clusters (TiO 2 ) n, where n = 20-80. Whereas, the surfaces have been modeled with two saturated clusters, Ti 21 O 58 H 32 and Ti 36 O 90 H 36 . The surface lattice fivefold coordinated titanium atoms (Ti 5C ), which represent the Lewis acid sites, are selected as adsorption centers. We also investigated the effect of TiO 2 cluster size on the computed band gap energy. Results reveal that the electronic properties of a cluster in the lowest excited state differ from that of the ground state. Furthermore, the MSINDO band gap energies of 3.68-3.77 eV for the anatase TiO 2 are in a fair accordance with other literature data. In agreement with other computational and experimental studies, the dissociated form of water molecule adsorption on anatase TiO 2 surfaces is always more stabilized than the molecular form

Modelling Toehold-Mediated RNA Strand Displacement

OpenAIRE

Šulc, Petr; Ouldridge, Thomas E.; Romano, Flavio; Doye, Jonathan P.K.; Louis, Ard A.

2015-01-01

We study the thermodynamics and kinetics of an RNA toehold-mediated strand displacement reaction with a recently developed coarse-grained model of RNA. Strand displacement, during which a single strand displaces a different strand previously bound to a complementary substrate strand, is an essential mechanism in active nucleic acid nanotechnology and has also been hypothesized to occur in vivo. We study the rate of displacement reactions as a function of the length of the toehold and temperat...

Electron spectra and mechanism of complexing of uranyl nitrate in water-acetone solutions

International Nuclear Information System (INIS)

Zazhogin, A.A.; Zazhogin, A.P.; Komyak, A.I.; Serafimovich, A.I.

2003-01-01

Based on the analysis of the luminescence and electronic absorption spectra, the processes of complexing in an aqueous solution of UO 2 (NO 3 ) 2 ·6H 2 O with small additions of acetone have been studied. In a pure aqueous solution, uranyl exists as the complex UO 2 ·5H 2 O. It is shown that the addition of acetone to the solution leads to the displacement of some water molecules out of the first coordination sphere of uranyl and the formation of the uranyl nitrate dihydrate complexes UO 2 (NO 3 ) 2 ·2H 2 O. It has been established that the stability of these complexes is determined by the decrease in the water activity and in the degree of hydration of uranyl and nitrate, which is the result of the local increase in the concentration of acetone molecules (due to their hydrophobicity) in the regions of the solution where uranyl and nitrate ions are found. The experimental facts supported the mechanism proposed are presented. (authors)

Solvation in supercritical water

International Nuclear Information System (INIS)

Cochran, H.D.; Cummings, P.T.; Karaborni, S.

1991-01-01

The aim of this work is to determine the solvation structure in supercritical water composed with that in ambient water and in simple supercritical solvents. Molecular dynamics studies have been undertaken of systems that model ionic sodium and chloride, atomic argon, and molecular methanol in supercritical aqueous solutions using the simple point charge model of Berendsen for water. Because of the strong interactions between water and ions, ionic solutes are strongly attractive in supercritical water, forming large clusters of water molecules around each ion. Methanol is found to be a weakly-attractive solute in supercritical water. The cluster of excess water molecules surrounding a dissolved ion or polar molecule in supercritical aqueous solutions is comparable to the solvent clusters surrounding attractive solutes in simple supercritical fluids. Likewise, the deficit of water molecules surrounding a dissolved argon atom in supercritical aqueous solutions is comparable to that surrounding repulsive solutes in simple supercritical fluids. The number of hydrogen bonds per water molecule in supercritical water was found to be about one third the number in ambient water. The number of hydrogen bonds per water molecule surrounding a central particle in supercritical water was only mildly affected by the identify of the central particle--atom, molecule, or ion. These results should be helpful in developing a qualitative understanding of important processes that occur in supercritical water. 29 refs., 6 figs

ON STABILITY OF THE OIL DISPLACEMENT FRONT UNDER CONDITIONS OF THERMOGAS IMPACT ON THE OIL BEARING LAYER

Directory of Open Access Journals (Sweden)

K. V. Dobrego

2016-01-01

Full Text Available The method of thermogas impact on the oil bearing layer is a perspective one to improve oil recovery. It is now under experimental implementation in Belarus. Stability of the thermal front and that of the oil displacement is a point of principle for the given technology. The article offers solution based on the method of small perturbations for the problem of the oil-displacement front stability under thermogas impact on the oil layer. The perturbation growth increment is shown to be quite different from that of the gas filtration combustion. Being determined by the perturbation wave number (or wave length, by difference in speed of the blowing filtration and that of the heat development front, by the ratios of densities, filtration coefficients, compressibility of the displacement agent and the displaced oil mass, and by other parameters. The author analyses the main parameters influencing the stability of the front. Recommendations are given on possible methods and procedures improving stability of the displacement front (neutralizing perturbation growth. The mechanisms of suppression or compensation of the front perturbation growth are as follows: the crude oil viscosity reduction and increase of that of the displacement agent, the displacement agent compressibility increase, increase of the thermogas impact heat-front width in the first instance at the expense of the temperature growth and alteration in the chemism (low temperature catalysts utilization, etc., reduction in speed of the front propagation and/or correspondingly of the displacement agent feed. Utilization of the gas or water-gas displacement agent as well as the agent impregnation with hydrophobic gases provides a relatively better stability of the front as compared to that employing water based compounds. Analytical data and derived recommendations are offered for utilization within the framework of general techniques and procedures of the thermogas impact process management

Controlled switching of single-molecule junctions by mechanical motion of a phenyl ring

Directory of Open Access Journals (Sweden)

Yuya Kitaguchi

2015-10-01

Full Text Available Mechanical methods for single-molecule control have potential for wide application in nanodevices and machines. Here we demonstrate the operation of a single-molecule switch made functional by the motion of a phenyl ring, analogous to the lever in a conventional toggle switch. The switch can be actuated by dual triggers, either by a voltage pulse or by displacement of the electrode, and electronic manipulation of the ring by chemical substitution enables rational control of the on-state conductance. Owing to its simple mechanics, structural robustness, and chemical accessibility, we propose that phenyl rings are promising components in mechanical molecular devices.

Atoms, Molecules, and Compounds

CERN Document Server

Manning, Phillip

2007-01-01

Explores the atoms that govern chemical processes. This book shows how the interactions between simple substances such as salt and water are crucial to life on Earth and how those interactions are predestined by the atoms that make up the molecules.

Displacement functions for diatomic materials

International Nuclear Information System (INIS)

Panrkin, D.M.; Coulter, C.A.

1979-01-01

An extension of the methods of Lindhard et at. was used to calculate the total displacement function n/sub ij/(E) for a number of diatomic materials, where n/sub ij/(E) is defined to be the average number of atoms of type j which are displaced from their sites in a displacement cascade initiated by a PKA of type i and energy E. From the n/sub ij/(E) one can calculate the fraction n/sub ij/(E) of the displacements produced by a type i PKA with energy E which are of type j. Values of the n/sub ij/ for MgO, CaO, Al 2 O 3 , and TaO are presented. It is shown that for diatomic materials with mass ratios reasonably near one (e.g., MgO, Al 2 O 3 ) and equal displacement thresholds for the two species the n/sub ij/ become independent of the PKA type i at energies only a few times threshold. However, for larger mass ratios the n/sub ij/ do not become independent of i until much larger, energies are reached - e.g. > 10 5 eV for TaO. In addition, it is found that the n/sub ij/ depend sensitively on the displacement thresholds, with very dramatic charges occuring when the two thresholds become significantly different from one another

Etiopathogenesis of abomasal displacement in cattle

Directory of Open Access Journals (Sweden)

Šamanc Horea

2003-01-01

Full Text Available Abomasal displacement presents topographic gastropathy, where this organ has changed its position, and there is simultaneous dilatation which can vary in intensity. The incidence of this disorder in herds of high-yield dairy cows varies to a great degree (1 to 18 %. Abomasal displacement was established in herds of East-Frisian cows in 1 to 3% animals, and in Holstein cow herds in 5 to 18 % animals. The most frequent abomasal displacement is to the left (88%. There is significant seasonal variation in the incidence of abomasal displacement. About two-thirds of cases of abomasal displacement are diagnosed from October until April. The disorder appears more frequently in cows with repeated lactations. It has been established that it appears after the first calving in 27.8% cases, after the second to fifth calving in 66.7% cases, and after the sixth and seventh calving in 5.5% of the cows. The response of endocrine pancreas B-cells for insulin secretion to hyperglycaemia caused by applying an excess-glucose test is reduced in cows with left abomasal displacement, and there is constant hyperglycaemia in cows with right abomasal displacement. The excess-glucose test indicates a disrupted function of the endocrine pancreas in diseased animals. It has been determined through examinations of Aml genotypes in Holstein cow herds in connection with the appearance of abomasal displacement, that the occurrence of this disorder cannot be attributed to a genetic predisposition.

Conflict, displacement and health in the Middle East.

Science.gov (United States)

Mowafi, Hani

2011-01-01

Displacement is a hallmark of modern humanitarian emergencies. Displacement itself is a traumatic event that can result in illness or death. Survivors face challenges including lack of adequate shelter, decreased access to health services, food insecurity, loss of livelihoods, social marginalisation as well as economic and sexual exploitation. Displacement takes many forms in the Middle East and the Arab World. Historical conflicts have resulted in long-term displacement of Palestinians. Internal conflicts have driven millions of Somalis and Sudanese from their homes. Iraqis have been displaced throughout the region by invasion and civil strife. In addition, large numbers of migrants transit Middle Eastern countries or live there illegally and suffer similar conditions as forcibly displaced people. Displacement in the Middle East is an urban phenomenon. Many displaced people live hidden among host country populations in poor urban neighbourhoods - often without legal status. This represents a challenge for groups attempting to access displaced populations. Furthermore, health information systems in host countries often do not collect data on displaced people, making it difficult to gather data needed to target interventions towards these vulnerable populations. The following is a discussion of the health impacts of conflict and displacement in the Middle East. A review was conducted of published literature on migration and displacement in the region. Different cases are discussed with an emphasis on the recent, large-scale and urban displacement of Iraqis to illustrate aspects of displacement in this region.

Gender-based violence in conflict and displacement: qualitative findings from displaced women in Colombia.

Science.gov (United States)

Wirtz, Andrea L; Pham, Kiemanh; Glass, Nancy; Loochkartt, Saskia; Kidane, Teemar; Cuspoca, Decssy; Rubenstein, Leonard S; Singh, Sonal; Vu, Alexander

2014-01-01

Gender-based violence (GBV) is prevalent among, though not specific to, conflict affected populations and related to multifarious levels of vulnerability of conflict and displacement. Colombia has been marked with decades of conflict, with an estimated 5.2 million internally displaced persons (IDPs) and ongoing violence. We conducted qualitative research to understand the contexts of conflict, displacement and dynamics with GBV. This as part of a multi-phase, mixed method study, in collaboration with UNHCR, to develop a screening tool to confidentially identify cases of GBV for referral among IDP women who were survivors of GBV. Qualitative research was used to identify the range of GBV, perpetrators, contexts in conflict and displacement, barriers to reporting and service uptake, as well as to understand experiences of service providers. Thirty-five female IDPs, aged 18 years and older, who self-identified as survivors of GBV were enrolled for in-depth interviews in San Jose de Guaviare and Quibdo, Colombia in June 2012. Thirty-one service providers participated in six focus group discussions and four interviews across these sites. Survivors described a range of GBV across conflict and displacement settings. Armed actors in conflict settings perpetrated threats of violence and harm to family members, child recruitment, and, to a lesser degree, rape and forced abortion. Opportunistic violence, including abduction, rape, and few accounts of trafficking were more commonly reported to occur in the displacement setting, often perpetrated by unknown individuals. Intrafamilial violence, intimate partner violence, including physical and sexual violence and reproductive control were salient across settings and may be exacerbated by conflict and displacement. Barriers to reporting and services seeking were reported by survivors and providers alike. Findings highlight the need for early identification of GBV cases, with emphasis on confidential approaches and active

Hydrophilicity and Microsolvation of an Organic Molecule Resolved on the Sub-molecular Level by Scanning Tunneling Microscopy.

Science.gov (United States)

Lucht, Karsten; Loose, Dirk; Ruschmeier, Maximilian; Strotkötter, Valerie; Dyker, Gerald; Morgenstern, Karina

2018-01-26

Low-temperature scanning tunneling microscopy was used to follow the formation of a solvation shell around an adsorbed functionalized azo dye from the attachment of the first water molecule to a fully solvated molecule. Specific functional groups bind initially one water molecule each, which act as anchor points for additional water molecules. Further water attachment occurs in areas close to these functional groups even when the functional groups themselves are already saturated. In contrast, water molecules surround the hydrophobic parts of the molecule only when the two-dimensional solvation shell closes around them. This study thus traces hydrophilic and hydrophobic properties of an organic molecule down to a sub-molecular length scale. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Exploring the role of water in molecular recognition: predicting protein ligandability using a combinatorial search of surface hydration sites

Science.gov (United States)

Vukovic, Sinisa; Brennan, Paul E.; Huggins, David J.

2016-09-01

The interaction between any two biological molecules must compete with their interaction with water molecules. This makes water the most important molecule in medicine, as it controls the interactions of every therapeutic with its target. A small molecule binding to a protein is able to recognize a unique binding site on a protein by displacing bound water molecules from specific hydration sites. Quantifying the interactions of these water molecules allows us to estimate the potential of the protein to bind a small molecule. This is referred to as ligandability. In the study, we describe a method to predict ligandability by performing a search of all possible combinations of hydration sites on protein surfaces. We predict ligandability as the summed binding free energy for each of the constituent hydration sites, computed using inhomogeneous fluid solvation theory. We compared the predicted ligandability with the maximum observed binding affinity for 20 proteins in the human bromodomain family. Based on this comparison, it was determined that effective inhibitors have been developed for the majority of bromodomains, in the range from 10 to 100 nM. However, we predict that more potent inhibitors can be developed for the bromodomains BPTF and BRD7 with relative ease, but that further efforts to develop inhibitors for ATAD2 will be extremely challenging. We have also made predictions for the 14 bromodomains with no reported small molecule K d values by isothermal titration calorimetry. The calculations predict that PBRM1(1) will be a challenging target, while others such as TAF1L(2), PBRM1(4) and TAF1(2), should be highly ligandable. As an outcome of this work, we assembled a database of experimental maximal K d that can serve as a community resource assisting medicinal chemistry efforts focused on BRDs. Effective prediction of ligandability would be a very useful tool in the drug discovery process.

Exploring the role of water in molecular recognition: predicting protein ligandability using a combinatorial search of surface hydration sites.

Science.gov (United States)

Vukovic, Sinisa; Brennan, Paul E; Huggins, David J

2016-09-01

The interaction between any two biological molecules must compete with their interaction with water molecules. This makes water the most important molecule in medicine, as it controls the interactions of every therapeutic with its target. A small molecule binding to a protein is able to recognize a unique binding site on a protein by displacing bound water molecules from specific hydration sites. Quantifying the interactions of these water molecules allows us to estimate the potential of the protein to bind a small molecule. This is referred to as ligandability. In the study, we describe a method to predict ligandability by performing a search of all possible combinations of hydration sites on protein surfaces. We predict ligandability as the summed binding free energy for each of the constituent hydration sites, computed using inhomogeneous fluid solvation theory. We compared the predicted ligandability with the maximum observed binding affinity for 20 proteins in the human bromodomain family. Based on this comparison, it was determined that effective inhibitors have been developed for the majority of bromodomains, in the range from 10 to 100 nM. However, we predict that more potent inhibitors can be developed for the bromodomains BPTF and BRD7 with relative ease, but that further efforts to develop inhibitors for ATAD2 will be extremely challenging. We have also made predictions for the 14 bromodomains with no reported small molecule K d values by isothermal titration calorimetry. The calculations predict that PBRM1(1) will be a challenging target, while others such as TAF1L(2), PBRM1(4) and TAF1(2), should be highly ligandable. As an outcome of this work, we assembled a database of experimental maximal K d that can serve as a community resource assisting medicinal chemistry efforts focused on BRDs. Effective prediction of ligandability would be a very useful tool in the drug discovery process.

Displacement sensing system and method

Science.gov (United States)

VunKannon, Jr., Robert S

2006-08-08

A displacement sensing system and method addresses demanding requirements for high precision sensing of displacement of a shaft, for use typically in a linear electro-dynamic machine, having low failure rates over multi-year unattended operation in hostile environments. Applications include outer space travel by spacecraft having high-temperature, sealed environments without opportunity for servicing over many years of operation. The displacement sensing system uses a three coil sensor configuration, including a reference and sense coils, to provide a pair of ratio-metric signals, which are inputted into a synchronous comparison circuit, which is synchronously processed for a resultant displacement determination. The pair of ratio-metric signals are similarly affected by environmental conditions so that the comparison circuit is able to subtract or nullify environmental conditions that would otherwise cause changes in accuracy to occur.

Effects of Fault Displacement on Emplacement Drifts

International Nuclear Information System (INIS)

Duan, F.

2000-01-01

The purpose of this analysis is to evaluate potential effects of fault displacement on emplacement drifts, including drip shields and waste packages emplaced in emplacement drifts. The output from this analysis not only provides data for the evaluation of long-term drift stability but also supports the Engineered Barrier System (EBS) process model report (PMR) and Disruptive Events Report currently under development. The primary scope of this analysis includes (1) examining fault displacement effects in terms of induced stresses and displacements in the rock mass surrounding an emplacement drift and (2 ) predicting fault displacement effects on the drip shield and waste package. The magnitude of the fault displacement analyzed in this analysis bounds the mean fault displacement corresponding to an annual frequency of exceedance of 10 -5 adopted for the preclosure period of the repository and also supports the postclosure performance assessment. This analysis is performed following the development plan prepared for analyzing effects of fault displacement on emplacement drifts (CRWMS M and O 2000). The analysis will begin with the identification and preparation of requirements, criteria, and inputs. A literature survey on accommodating fault displacements encountered in underground structures such as buried oil and gas pipelines will be conducted. For a given fault displacement, the least favorable scenario in term of the spatial relation of a fault to an emplacement drift is chosen, and the analysis is then performed analytically. Based on the analysis results, conclusions are made regarding the effects and consequences of fault displacement on emplacement drifts. Specifically, the analysis will discuss loads which can be induced by fault displacement on emplacement drifts, drip shield and/or waste packages during the time period of postclosure

High-displacement spiral piezoelectric actuators

Science.gov (United States)

Mohammadi, F.; Kholkin, A. L.; Jadidian, B.; Safari, A.

1999-10-01

A high-displacement piezoelectric actuator, employing spiral geometry of a curved piezoelectric strip is described. The monolithic actuators are fabricated using a layered manufacturing technique, fused deposition of ceramics, which is capable of prototyping electroceramic components with complex shapes. The spiral actuators (2-3 cm in diameter) consisted of 4-5 turns of a lead zirconate titanate ceramic strip with an effective length up to 28 cm. The width was varied from 0.9 to 1.75 mm with a height of 3 mm. When driven by the electric field applied across the width of the spiral wall, the tip of the actuator was found to displace in both radial and tangential directions. The tangential displacement of the tip was about 210 μm under the field of 5 kV/cm. Both the displacement and resonant frequency of the spirals could be tailored by changing the effective length and wall width. The blocking force of the actuator in tangential direction was about 1 N under the field of 5 kV/cm. These properties are advantageous for high-displacement low-force applications where bimorph or monomorph actuators are currently employed.

Water self-diffusion through narrow oxygenated carbon nanotubes

Energy Technology Data Exchange (ETDEWEB)

Striolo, Alberto [School of Chemical Biological and Materials Engineering, University of Oklahoma, Norman, OK 73019 (United States)

2007-11-28

The hydrophobic interior of carbon nanotubes, which is reminiscent of ion channels in cellular membranes, has inspired scientific research directed towards the production of, for example, membranes for water desalination, drug-delivery devices, and nanosyringes. To develop these technologies it is crucial to understand and predict the equilibrium and transport properties of confined water. We present here a series of molecular dynamics simulation results conducted to understand the extent to which the presence of a few oxygenated active sites, modeled as carbonyls, affects the transport properties of confined water. The model for the carbon nanotube is not intended to be realistic. Its only purpose is to allow us to understand the effect of a few oxygenated sites on the transport properties of water confined in a narrow cylindrical pore, which is otherwise hydrophobic. At low hydration levels we found little, if any, water diffusion. The diffusion, which appears to be of the Fickian type for sufficiently large hydration levels, becomes faster as the number of confined water molecules increases, reaches a maximum, and slows as water fills the carbon nanotubes. We explain our findings on the basis of two collective motion mechanisms observed from the analysis of sequences of simulation snapshots. We term the two mechanisms 'cluster-breakage' and 'cluster-libration' mechanisms. We observe that the cluster-breakage mechanism produces longer displacements for the confined water molecules than the cluster-libration one, but deactivates as water fills the carbon nanotube. From a practical point of view, our results are particularly important for two reasons: (1) at low hydration levels the presence of only eight carbonyl groups can prevent the diffusion of water through (8, 8) carbon nanotubes; and (2) the extremely fast self-diffusion coefficients observed for water within narrow carbon nanotubes are significantly decreased in the presence of only a

Water self-diffusion through narrow oxygenated carbon nanotubes

International Nuclear Information System (INIS)

Striolo, Alberto

2007-01-01

The hydrophobic interior of carbon nanotubes, which is reminiscent of ion channels in cellular membranes, has inspired scientific research directed towards the production of, for example, membranes for water desalination, drug-delivery devices, and nanosyringes. To develop these technologies it is crucial to understand and predict the equilibrium and transport properties of confined water. We present here a series of molecular dynamics simulation results conducted to understand the extent to which the presence of a few oxygenated active sites, modeled as carbonyls, affects the transport properties of confined water. The model for the carbon nanotube is not intended to be realistic. Its only purpose is to allow us to understand the effect of a few oxygenated sites on the transport properties of water confined in a narrow cylindrical pore, which is otherwise hydrophobic. At low hydration levels we found little, if any, water diffusion. The diffusion, which appears to be of the Fickian type for sufficiently large hydration levels, becomes faster as the number of confined water molecules increases, reaches a maximum, and slows as water fills the carbon nanotubes. We explain our findings on the basis of two collective motion mechanisms observed from the analysis of sequences of simulation snapshots. We term the two mechanisms 'cluster-breakage' and 'cluster-libration' mechanisms. We observe that the cluster-breakage mechanism produces longer displacements for the confined water molecules than the cluster-libration one, but deactivates as water fills the carbon nanotube. From a practical point of view, our results are particularly important for two reasons: (1) at low hydration levels the presence of only eight carbonyl groups can prevent the diffusion of water through (8, 8) carbon nanotubes; and (2) the extremely fast self-diffusion coefficients observed for water within narrow carbon nanotubes are significantly decreased in the presence of only a few oxygenated active

Phase-Transfer Energetics of Small-Molecule Alcohols Across the Water-Hexane Interface: Molecular Dynamics Simulation Using Charge Equilibration Models

Science.gov (United States)

Bauer, Brad A.; Zhong, Yang; Meninger, David J.; Davis, Joseph E.; Patel, Sandeep

2010-01-01

We study the water-hexane interface using molecular dynamics (MD) and polarizable charge equilibration (CHEQ) force fields. Bulk densities for TIP4P-FQ water and hexane, 1.0086±0.0002 g/cm3 and 0.6378±0.0001 g/cm3, demonstrate excellent agreement with experiment. Interfacial width and interfacial tension are consistent with previously reported values. The in-plane component of the dielectric permittivity (ε∥) for water is shown to decrease from 81.7±0.04 to unity, transitioning longitudinally from bulk water to bulk hexane. ε∥ for hexane reaches a maximum in the interface, but this term represents only a small contribution to the total dielectric constant (as expected for a non-polar species). Structurally, net orientations of the molecules arise in the interfacial region such that hexane lies slightly parallel to the interface and water reorients to maximize hydrogen bonding. Interfacial potentials due to contributions of the water and hexane are calculated to be -567.9±0.13mV and 198.7±0.01mV, respectively, giving rise to a total potential in agreement with the range of values reported from previous simulations of similar systems. Potentials of mean force (PMF) calculated for methanol, ethanol, and 1-propanol for the transfer from water to hexane indicate an interfacial free energy minimum, corresponding to the amphiphilic nature of the molecules. The magnitudes of transfer free energies were further characterized from the solvation free energies of alcohols in water and hexane using thermodynamic integration. This analysis shows that solvation free energies for alcohols in hexane are 0.2-0.3 kcal/mol too unfavorable, whereas solvation of alcohols in water is approximately 1 kcal/mol too favorable. For the pure hexane-water interfacial simulations, we observe a monotonic decrease of the water dipole moment to near-vacuum values. This suggests that the electrostatic component of the desolvation free energy is not as severe for polarizable models than

Attosecond electron dynamics in molecules and liquids

Science.gov (United States)

WöRner, Hans Jakob

The ultrafast motion of electrons and holes following light-matter interaction is fundamental to a broad range of chemical and biophysical processes. In this lecture, I will discuss some of our recent experiments that measure the atomic-scale motion of charge with attosecond temporal resolution (1 as = 10-18s). The first experiment is carried out on isolated, spatially oriented molecules in the gas phase. Using high-harmonic spectroscopy, we resolve the migration of an electron hole across the molecule with a resolution of 100 as and simultaneously demonstrate extensive control over charge migration. In the second class of experiments, we use an attosecond pulse train synchronized with a near-infrared laser pulse to temporally resolve the process of photoemission from molecules in the gas phase and from a liquid-water microjet, resolving electron transport through liquid water on the attosecond time scale.

Anisotropic conductivity tensor imaging in MREIT using directional diffusion rate of water molecules

International Nuclear Information System (INIS)

Kwon, Oh In; Jeong, Woo Chul; Sajib, Saurav Z K; Kim, Hyung Joong; Woo, Eung Je

2014-01-01

Magnetic resonance electrical impedance tomography (MREIT) is an emerging method to visualize electrical conductivity and/or current density images at low frequencies (below 1 KHz). Injecting currents into an imaging object, one component of the induced magnetic flux density is acquired using an MRI scanner for isotropic conductivity image reconstructions. Diffusion tensor MRI (DT-MRI) measures the intrinsic three-dimensional diffusion property of water molecules within a tissue. It characterizes the anisotropic water transport by the effective diffusion tensor. Combining the DT-MRI and MREIT techniques, we propose a novel direct method for absolute conductivity tensor image reconstructions based on a linear relationship between the water diffusion tensor and the electrical conductivity tensor. We first recover the projected current density, which is the best approximation of the internal current density one can obtain from the measured single component of the induced magnetic flux density. This enables us to estimate a scale factor between the diffusion tensor and the conductivity tensor. Combining these values at all pixels with the acquired diffusion tensor map, we can quantitatively recover the anisotropic conductivity tensor map. From numerical simulations and experimental verifications using a biological tissue phantom, we found that the new method overcomes the limitations of each method and successfully reconstructs both the direction and magnitude of the conductivity tensor for both the anisotropic and isotropic regions. (paper)

Peroneal tendon displacement accompanying intra-articular calcaneal fractures.

Science.gov (United States)

Toussaint, Rull James; Lin, Darius; Ehrlichman, Lauren K; Ellington, J Kent; Strasser, Nicholas; Kwon, John Y

2014-02-19

Peroneal tendon displacement (subluxation or dislocation) accompanying an intra-articular calcaneal fracture is often undetected and under-treated. The goals of this study were to determine (1) the prevalence of peroneal tendon displacement accompanying intra-articular calcaneal fractures, (2) the association of tendon displacement with fracture classifications, (3) the association of tendon displacement with heel width, and (4) the rate of missed diagnosis of the tendon displacement on radiographs and computed tomography (CT) scans and the resulting treatment rate. A retrospective radiographic review of all calcaneal fractures presenting at three institutions from June 30, 2006, to June 30, 2011, was performed. CT imaging of 421 intra-articular calcaneal fractures involving the posterior facet was available for review. The prevalence of peroneal tendon displacement was noted and its associations with fracture classification and heel width were evaluated. Peroneal tendon displacement was identified in 118 (28.0%) of the 421 calcaneal fracture cases. The presence of tendon displacement was significantly associated with joint-depression fractures compared with tongue-type fractures (p displacement had been identified in the radiology reports. Although sixty-five (55.1%) of the fractures with tendon displacement had been treated with internal fixation, the tendon displacement was treated surgically in only seven (10.8%) of these cases. Analysis of CT images showed a 28% prevalence of peroneal tendon displacement accompanying intra-articular calcaneal fractures. Surgeons and radiologists are encouraged to consider this association.

Experimental and simulated displacement of oil in sand berea cores using aqueous solutions

International Nuclear Information System (INIS)

Ramirez, A.; Gonzalez, J.L.; Hernandez, F.; Hernandez, H.

2009-01-01

The development of a mathematical algorithm to simulate the displacement of a resident fluid using a displacing one in a saturated anisotropic porous media is shown in this work. The algorithm was included in the simulator developed by the present authors in previous works to represent the anisotropic distribution of the porous media properties and the fluid injection [Ramirez A et al. Mathematical simulation of oil reservoir properties. Chaos, solitons and Fractals 2008;38:778-88, Ramirez A et al. Simulation of uncompressible fluid flow through a porous media. Chaos, Solitons and Fractals 2009;39:1753-63] in a nested loop to analyze the participant nodes in the transport process and calculate the volumes of the resident and new fluids. The new routine developed takes in count the mobility of both fluids. Additionally experimental fluid displacement tests were done using heavy oil from Mexican reservoirs as a resident fluid in sand berea cores. The injection of new fluids in natural oil reservoirs is a part of the Enhanced oil recovery (EOR) methods used to improve the oil displacement and increase production after the primary stage of the oil recovery has been finished. Water is an available and economical resource to be used as a displacing fluid due to many of the producers (off-shores) of the oil industries are placed in the sea near the coast.

Project-induced displacement, secondary stressors, and health.

Science.gov (United States)

Cao, Yue; Hwang, Sean-Shong; Xi, Juan

2012-04-01

It has been estimated that about 15 million people are displaced by development projects around the world each year. Despite the magnitude of people affected, research on the health and other impacts of project-induced displacement is rare. This study extends existing knowledge by exploring the short-term health impact of a large scale population displacement resulting from China's Three Gorges Dam Project. The study is theoretically guided by the stress process model, but we supplement it with Cernea's impoverishment risks and reconstruction (IRR) model widely used in displacement literature. Our panel analysis indicates that the displacement is associated positively with relocatees' depression level, and negatively with their self-rated health measured against a control group. In addition, a path analysis suggests that displacement also affects depression and self-rated health indirectly by changing social integration, socioeconomic status, and community resources. The importance of social integration as a protective mechanism, a factor that has been overlooked in past studies of population displacement, is highlighted in this study. Published by Elsevier Ltd.

Apparatus for controlling a nuclear reactor by vertical displacement of a unit absorbing neutrons

International Nuclear Information System (INIS)

Wiart, A.; Defaucheux, J.; Martin, J.; Pasqualini, G.

1980-01-01

Apparatus is described for controlling a nuclear reactor by vertical displacement of a unit absorbing neutrons, comprising, inside a sealed enclosure in communication with the interior of the reactor, a movable magnetic piece connected to a control shaft which is itself connected to the absorbent unit. This magnetic piece has at least two radial projections. The magnetic piece is displaced by an inductor with at least two pole shoes corresponding to the projections on the magnetic piece and allowing magnetic coupling between the inductor and the magnetic piece. The inductor and its displacement device are disposed outside the sealed enclosure. A control means allows the control shaft to be uncoupled from a member assuring its suspension so as to drop the absorbent unit in the event of emergency shutdown. The apparatus is particularly applicable to control rods of pressurized water nuclear reactors

Corrosion inhibition of brass by aliphatic amines

International Nuclear Information System (INIS)

Taha, K. K.; Sheshadri, B. S; Ahmed, M. F.

2005-01-01

Aliphatic amines hexylamine (HCA), octylamine (OCA) and decylamine (DCA) have been used as corrosion inhibitors for (70/30) brass in 0.I M HCIO 4 . The inhibitor efficiency (%P) calculated using weight loss, Tafel extrapolation, linear polarization and impedance methods was found to be in the order DCA> OCA> HCA. These adsorb on brass surface following bockris-swinkels' isotherm. DCA, OCA and HCA displaced 4, 3 and 2 molecules of water from interface respectively. Displacement of water molecules brought a great reorganization of double layer at the interface. These amines during corrosion form complexes with dissolved zinc and copper ions.(Author)

The initial step of silicate versus aluminosilicate formation in zeolite synthesis: a reaction mechanism in water with a tetrapropylammonium template

KAUST Repository

Trinh, Thuat T.

2012-01-01

The initial step for silicate and aluminosilicate condensation is studied in water in the presence of a realistic tetrapropylammonium template under basic conditions. The model corresponds to the synthesis conditions of ZSM5. The free energy profile for the dimer formation ((OH) 3Si-O-Si-(OH) 2O - or [(OH) 3Al-O-Si-(OH) 3] -) is calculated with ab initio molecular dynamics and thermodynamic integration. The Si-O-Si dimer formation occurs in a two-step manner with an overall free energy barrier of 75 kJ mol -1. The first step is associated with the Si-O bond formation and results in an intermediate with a five-coordinated Si, and the second one concerns the removal of the water molecule. The template is displaced away from the Si centres upon dimer formation, and a shell of water molecules is inserted between the silicate and the template. The main effect of the template is to slow down the backward hydrolysis reaction with respect to the condensation one. The Al-O-Si dimer formation first requires the formation of a metastable precursor state by proton transfer from Si(OH) 4 to Al(OH) 4 - mediated by a solvent molecule. It then proceeds through a single step with an overall barrier of 70 kJ mol -1. The model with water molecules explicitly included is then compared to a simple calculation using an implicit continuum model for the solvent. The results underline the importance of an explicit and dynamical treatment of the water solvent, which plays a key role in assisting the reaction. © the Owner Societies 2012.

The interplay between dynamic heterogeneities and structure of bulk liquid water: A molecular dynamics simulation study

Energy Technology Data Exchange (ETDEWEB)

Demontis, Pierfranco; Suffritti, Giuseppe B. [Dipartimento di Chimica e Farmacia, Università degli studi di Sassari, Sassari (Italy); Consorzio Interuniversitario Nazionale per la Scienza e Tecnologia dei Materiali (INSTM), Unità di ricerca di Sassari, Via Vienna, 2, I-07100 Sassari (Italy); Gulín-González, Jorge [Grupo de Matemática y Física Computacionales, Universidad de las Ciencias Informáticas (UCI), Carretera a San Antonio de los Baños, Km 21/2, La Lisa, La Habana (Cuba); Masia, Marco [Dipartimento di Chimica e Farmacia, Università degli studi di Sassari, Sassari (Italy); Consorzio Interuniversitario Nazionale per la Scienza e Tecnologia dei Materiali (INSTM), Unità di ricerca di Sassari, Via Vienna, 2, I-07100 Sassari (Italy); Istituto Officina dei Materiali del CNR, UOS SLACS, Via Vienna 2, 07100 Sassari (Italy); Sant, Marco [Dipartimento di Chimica e Farmacia, Università degli studi di Sassari, Sassari (Italy)

2015-06-28

In order to study the interplay between dynamical heterogeneities and structural properties of bulk liquid water in the temperature range 130–350 K, thus including the supercooled regime, we use the explicit trend of the distribution functions of some molecular properties, namely, the rotational relaxation constants, the atomic mean-square displacements, the relaxation of the cross correlation functions between the linear and squared displacements of H and O atoms of each molecule, the tetrahedral order parameter q and, finally, the number of nearest neighbors (NNs) and of hydrogen bonds (HBs) per molecule. Two different potentials are considered: TIP4P-Ew and a model developed in this laboratory for the study of nanoconfined water. The results are similar for the dynamical properties, but are markedly different for the structural characteristics. In particular, for temperatures higher than that of the dynamic crossover between “fragile” (at higher temperatures) and “strong” (at lower temperatures) liquid behaviors detected around 207 K, the rotational relaxation of supercooled water appears to be remarkably homogeneous. However, the structural parameters (number of NNs and of HBs, as well as q) do not show homogeneous distributions, and these distributions are different for the two water models. Another dynamic crossover between “fragile” (at lower temperatures) and “strong” (at higher temperatures) liquid behaviors, corresponding to the one found experimentally at T{sup ∗} ∼ 315 ± 5 K, was spotted at T{sup ∗} ∼ 283 K and T{sup ∗} ∼ 276 K for the TIP4P-Ew and the model developed in this laboratory, respectively. It was detected from the trend of Arrhenius plots of dynamic quantities and from the onset of a further heterogeneity in the rotational relaxation. To our best knowledge, it is the first time that this dynamical crossover is detected in computer simulations of bulk water. On the basis of the simulation results, the possible

Observation of interactions between hydrophilic ionic liquid and water on wet agar gels by FE-SEM and its mechanism

International Nuclear Information System (INIS)

Takahashi, Chisato; Shirai, Takashi; Fuji, Masayoshi

2012-01-01

Highlights: ► The mechanism of SEM observation of agar gel using ionic liquid was investigated. ► Weak hydrogen bond between ionic liquid and water exist even under vacuum condition. ► Ionic liquid binding ability with water is useful for observing wet material using FE-SEM. ► We could optimize the water concentrations of sample of IL and wet material mixtures. ► SEM observation of fine morphology of agar gel in optimum water content. - Abstract: In the present study, an attempt is made to understand the mechanism of field emission electron microscopy (FE-SEM) observation of wet agar gel using a typical hydrophilic ionic liquid (IL) 1-butyl-3-methylimidazolium tetrafluoroborate; [BMIM][BF 4 ]. The IL interaction with water molecules within agar gel during sample preparation condition for FE-SEM observation was investigated using Raman spectroscopy. Results showed that water molecules within agar gel form weak hydrogen bond such as BF 4 − ⋯HOH⋯BF 4 − by interaction with BF 4 − of IL, and, it remained stable even under vacuum condition at 60 °C, 24 h. This interaction was found to be helpful for IL displacement of the water molecules within agar gel. From this study, it was found that the exact morphology of gel materials in FE-SEM condition can be observed by optimization of water concentrations of IL and gel mixtures. Thus, using IL, agar gel or any other material under wet condition can be observed without drying in FE-SEM chamber, and, present result gives an insight to the mechanism of FE-SEM observation of agar gel using IL without any conducting coating.

Emittance growth rates for displaced beams

International Nuclear Information System (INIS)

Anderson, O.A.

1993-05-01

Emittance growth rates have been previously analyzed for nonuniform beams in linear channels and for initially uniform mismatched beams in nonlinear channels. These studies were for centered beams. Additional emittance growth can arise in cases where the beam is initially displaced. The purpose of this study is to obtain growth rates for displaced beams. This work differs from studies involving random displacement of electrodes. Our analysis assumes instead that the focusing system is perfectly aligned but that the beam is initially displaced with respect to the equilibrium axis. If the focusing force is slightly nonlinear, we find a gradual transfer of the potential energy of beam displacement into kinetic energy associated with emittance growth. We present explicit results for the emittance growth distance as a function of the nonlinearity of the channel. These results will have practical importance for designers of accelerators and transport systems when setting realistic tolerances for initial beam alignment. These tolerances will depend on the nonlinearity and the length of the system

Is Fibular Fracture Displacement Consistent with Tibiotalar Displacement?

NARCIS (Netherlands)

van den Bekerom, Michel P. J.; van Dijk, C. Niek

2010-01-01

We believed open reduction with internal fixation is required for supination-external rotation ankle fractures located at the level of the distal tibiofibular syndesmosis (Lauge-Hanssen SER II and Weber B) with 2 mm or more fibular fracture displacement. The rationale for surgery for these ankle

Phenomenon of displacement in Arabic language

Directory of Open Access Journals (Sweden)

2015-09-01

Full Text Available Displacement is one of the characteristics of language and common phenomena in the Arabic language. Not only is this phenomenon limited to Arabic poetry and prose, but it is also broadened, so we can see examples of this in the Qur'an. Because of this phenomenon extensively in Arabic literature and also because of its essence that leads to the transmission of the elements for the first visibility to the other visibility in the sentence and sometimes had to change the grammatical role of the words, its identify helps us in a better understanding of text and the correct translation of it and protects the reader from mistakes. This paper in the descriptive analytical approach tries studying of the phenomenon of the displacement in the Arabic language and bringing its instances in Arabic poetry and prose as well as verses contained in the Holy Quran, to show that through the types and characteristics in the Arabic language and to response to several questions, including: how important is the displacement and what is its types in rhetoric, and the reasons of the displacement, and etc... Of the most important results of this study may refer to the undeniable role of the displacement as a rhetorical method to better understanding of the texts including: one of the most important reasons of the displacement in the use of language is to improve speech verbally and morally, and violation of the standard language and create a poetic atmosphere, and the recognition of the occurrence of the phenomenon of displacement in the Arabic language that uphold different interpretations remote and estimates when faced with the displacement in the text and help us to understand it and etc...

Sloshing of water in torus pressure-suppression pool of boiling water reactors under earthquake ground motions

International Nuclear Information System (INIS)

Aslam, M.; Godden, W.G.; Scalise, D.T.

1978-08-01

This report presents an analytical and experimental investigation into the sloshing of water in torus tanks under horizontal earthquake ground motions. This study was motivated because of the use of torus tanks for pressure-suppression pools in Boiling Water Reactors. Such a pressure-suppression pool would typically have 80 ft and 140 ft inside and outside diameters, a 30 ft diameter section, and a water depth of 15 ft. A general finite element analysis was developed for all axisymmetric tanks and a computer program was written to obtain time-history plots of sloshing displacements of water and dynamic pressures. Tests were carried out on a 1/60th scale model under sinusoidal as well as simulated earthquake ground motions. Tests and analytical results regarding natural frequencies, surface water displacements, and dynamic pressures were compared and a good agreement was found within the range of displacements studied. The computer program gave satisfactory results within a maximum range of sloshing displacements in the full-size prototype of 30 in. which is greater than the value obtained under the full intensity of the El Centro earthquake (N-S component 1940). The range of linear behavior was studied experimentally by subjecting the torus model to increasing intensities of the El Centro earthquake

Earthquake related displacement fields near underground facilities

International Nuclear Information System (INIS)

Pratt, H.R.; Zandt, G.; Bouchon, M.

1979-04-01

Relative displacements of rock masses are evaluated in terms of geological evidence, seismological evidence, data from simulation experiments, and analytical predictive models. Numerical models have been developed to determine displacement fields as a function of depth, distance, and azimuth from an earthquake source. Computer calculations for several types of faults indicate that displacements decrease rapidly with distance from the fault, but that displacements can either increase or decrease as a function of depth depending on the type and geometry of the fault. For long shallow vertical strike-slip faults the displacement decreases markedly with depth. For square strike slip faults and for dip slip faults displacement does not decrease as markedly with depth. Geologic structure, material properties, and depth affect the seismic source spectrum. Amplification of the high frequencies of shear waves is larger by a factor of about 2 for layered geologic models than for an elastic half space

A large outbreak of hepatitis E among a displaced population in Darfur, Sudan, 2004: the role of water treatment methods.

Science.gov (United States)

Guthmann, Jean-Paul; Klovstad, Hilde; Boccia, Delia; Hamid, Nuha; Pinoges, Loretxu; Nizou, Jacques-Yves; Tatay, Mercedes; Diaz, Francisco; Moren, Alain; Grais, Rebecca Freeman; Ciglenecki, Iza; Nicand, Elisabeth; Guerin, Philippe Jean

2006-06-15

The conflict in Darfur, Sudan, was responsible for the displacement of 1.8 million civilians. We investigated a large outbreak of hepatitis E virus (HEV) infection in Mornay camp (78,800 inhabitants) in western Darfur. To describe the outbreak, we used clinical and demographic information from cases recorded at the camp between 26 July and 31 December 2004. We conducted a case-cohort study and a retrospective cohort study to identify risk factors for clinical and asymptomatic hepatitis E, respectively. We collected stool and serum samples from animals and performed a bacteriological analysis of water samples. Human samples were tested for immunoglobulin G and immunoglobulin M antibody to HEV (for serum samples) and for amplification of the HEV genome (for serum and stool samples). In 6 months, 2621 hepatitis E cases were recorded (attack rate, 3.3%), with a case-fatality rate of 1.7% (45 deaths, 19 of which involved were pregnant women). Risk factors for clinical HEV infection included age of 15-45 years (odds ratio, 2.13; 95% confidence interval, 1.02-4.46) and drinking chlorinated surface water (odds ratio, 2.49; 95% confidence interval, 1.22-5.08). Both factors were also suggestive of increased risk for asymptomatic HEV infection, although this was not found to be statistically significant. HEV RNA was positively identified in serum samples obtained from 2 donkeys. No bacteria were identified from any sample of chlorinated water tested. Current recommendations to ensure a safe water supply may have been insufficient to inactivate HEV and control this epidemic. This research highlights the need to evaluate current water treatment methods and to identify alternative solutions adapted to complex emergencies.

SOCIAL CAPITAL IN INVOLUNTARY DISPLACEMENT AND RESETTLEMENT

Directory of Open Access Journals (Sweden)

Melissa Quetulio-Navarra

2013-07-01

Full Text Available Social capital is often seen as a substitute for lack of other types of capital amongpoor people. Because of the recognized applicability of the social capital conceptand its correlation with the different dimensions of poverty, it has been used inevaluating the adaptation and integration of involuntarily displaced individualsinto their new environment. This paper presents insights based on a review of thefindings of studies that looked into the role of social capital in conflict- anddevelopment-induced displacement contexts. Althoughboth types of displace-ments are involuntary or forced in nature, they differ in terms of the role of socialcapital regarding its main sources, the formation pattern and its determinants.Social capital studies in forced resettlement appear to be relatively small innumber and are heavily concentrated on first worldcountries and conflict- anddevelopment-induced displacements. The conduct of similar studies in developingcountries and in a disaster-induced resettlement context, the third type ofinvoluntary displacement, should generate new and relevant findings regardingthe role of social capital in resettlement communities.

Effects of Surface Epitope Coverage on the Sensitivity of Displacement Assays that Employ Modified Nanoparticles: Using Bisphenol A as a Model Analyte

Directory of Open Access Journals (Sweden)

Yang Lu

2016-08-01

Full Text Available With the ever-increasing use of nanoparticles in immunosensors, a fundamental study on the effect of epitope density is presented herein, with a small molecule epitope, on the performance of the displacement assay format in an enzyme-linked immunosorbent assay (ELISA. Thiolated bisphenol A (BPA functionalized gold nanoparticles (cysBPAv-AuNPs and specific anti-BPA antibodies are employed for this purpose. It is shown that the displacement of cysBPAv-AuNPs bound to the immobilized antibodies was influenced by both the avidity of bound cysBPAv-AuNPs and the concentration of free BPA to displace it. The importance of surface epitope density was that it changed the number of epitopes in close proximity to the antibody-binding site. This then influenced the avidity of cysBPAv-AuNPs bound to the immobilized antibody. Furthermore, the molar epitope concentration in an assay appears to affect the degree of antibody binding site saturation. Controlling surface epitope density of the functionalized nanoparticles and molar epitope concentration in an assay leads to a decrease of the concentration of free BPA required to displace the bound cysBPAv-AuNP, and hence better assay performance with regards to the D50 value and dynamic range in the displacement assay.

War, forced displacement and growth in Laotian adults.

Science.gov (United States)

Clarkin, Patrick F

2012-01-01

Evidence from several populations suggests that war negatively impacts civilian nutrition, physical growth and overall health. This effect is often enduring or permanent, particularly if experienced early in life. To assess whether the number of lifetime displacement experiences and being displaced in infancy were associated with adult height, sitting height, leg length and the sitting height ratio. Retrospective questionnaires on displacement and resettlement experiences and anthropometric data were collected from a sample of Laotian adult refugees (ethnic Hmong and Lao; n = 365). All were born in Laos or Thailand and had resettled in French Guiana or the US. Many had been displaced several times by military conflict in Laos. In bivariate analyses, being displaced in infancy and the number of lifetime displacement experiences one had were negatively associated with final adult height and leg length in both sexes. The association was stronger in females, particularly Hmong females. There was no significant association between total displacement experiences and the sitting height ratio. In multiple regression analyses, linear growth in males was negatively associated with being displaced in infancy; in females, the number of lifetime displacement experiences was a significant predictor. Forced displacement from war appears to have a lasting effect on final adult height, sitting height and leg length, although not necessarily on the sitting height ratio in this sample.

Reproductive Health Education and Services Needs of Internally Displaced Persons and Refugees following Disaster

Science.gov (United States)

Westhoff, Wayne W.; Lopez, Guillermo E.; Zapata, Lauren B.; Wilke Corvin, Jaime A.; Allen, Peter; McDermott, Robert J.

2008-01-01

Background: Following the occurrence of natural or man-made disaster, relief worker priorities include providing water, food, shelter, and immunizations for displaced persons. Like these essential initiatives, reproductive health education and services must also be incorporated into recovery efforts. Purpose: This study examined reproductive…

Displacement Ventilation

DEFF Research Database (Denmark)

Bjørn, Erik; Mattsson, Magnus; Sandberg, Mats

Full-scale experiments were made in a displacement ventilated room with two breathing thermal manikins to study the effect of movements and breathing on the vertical contaminant distribution, and on the personal exposure of occupants. Concentrations were measured with tracer gas equipment...

Anomalous diffusion of water molecules at grain boundaries in ice Ih.

Science.gov (United States)

Moreira, Pedro Augusto Franco Pinheiro; Veiga, Roberto Gomes de Aguiar; Ribeiro, Ingrid de Almeida; Freitas, Rodrigo; Helfferich, Julian; de Koning, Maurice

2018-05-23

Using ab initio and classical molecular dynamics simulations, we study pre-melting phenomena in pristine coincident-site-lattice grain boundaries (GBs) in proton-disordered hexagonal ice Ih at temperatures just below the melting point Tm. Concerning pre-melt-layer thicknesses, the results are consistent with the available experimental estimates for low-disorder impurity-free GBs. With regard to molecular mobility, the simulations provide a key new insight: the translational motion of the water molecules is found to be subdiffusive for time scales from ∼10 ns up to at least 0.1 μs. Moreover, the fact that the anomalous diffusion occurs even at temperatures just below Tm where the bulk supercooled liquid still diffuses normally suggests that it is related to the confinement of the GB pre-melt layers by the surrounding crystalline environment. Furthermore, we show that this behavior can be characterized by continuous-time random walk models in which the waiting-time distributions decay according to power-laws that are very similar to those describing dynamics in glass-forming systems.

Intercalated Water and Organic Molecules for Electrode Materials of Rechargeable Batteries.

Science.gov (United States)

Lee, Hyeon Jeong; Shin, Jaeho; Choi, Jang Wook

2018-03-24

The intrinsic limitations of lithium-ion batteries (LIBs) with regard to safety, cost, and the availability of raw materials have promoted research on so-called "post-LIBs". The recent intense research of post-LIBs provides an invaluable lesson that existing electrode materials used in LIBs may not perform as well in post-LIBs, calling for new material designs compliant with emerging batteries based on new chemistries. One promising approach in this direction is the development of materials with intercalated water or organic molecules, as these materials demonstrate superior electrochemical performance in emerging battery systems. The enlarged ionic channel dimensions and effective shielding of the electrostatic interaction between carrier ions and the lattice host are the origins of the observed electrochemical performance. Moreover, these intercalants serve as interlayer pillars to sustain the framework for prolonged cycles. Representative examples of such intercalated materials applied to batteries based on Li + , Na + , Mg 2+ , and Zn 2+ ions and supercapacitors are considered, along with their impact in materials research. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Tracking speckle displacement by double Kalman filtering

Institute of Scientific and Technical Information of China (English)

Donghui Li; Li Guo

2006-01-01

@@ A tracking technique using two sequentially-connected Kalman filter for tracking laser speckle displacement is presented. One Kalman filter tracks temporal speckle displacement, while another Kalman filter tracks spatial speckle displacement. The temporal Kalman filter provides a prior for the spatial Kalman filter, and the spatial Kalman filter provides measurements for the temporal Kalman filter. The contribution of a prior to estimations of the spatial Kalman filter is analyzed. An optical analysis system was set up to verify the double-Kalman-filter tracker's ability of tracking laser speckle's constant displacement.

Displaced epithelium after liposuction for gynecomastia.

Science.gov (United States)

McLaughlin, Cristina S; Petrey, Chris; Grant, Shawn; Ransdell, Jill S; Reynolds, Carol

2011-08-01

The authors describe the case of a 36-year-old man with gynecomastia who was previously treated with liposuction of the breast for cosmetic purposes. Histologic examination of a subsequent excisional biopsy revealed nests of displaced epithelial cells in adipose tissue. Epithelial cell displacement is a well-known risk of core needle biopsies and fine-needle aspirations of breast lesions. However, to the authors' knowledge, epithelial displacement in gynecomastia after liposuction, mimicking invasive ductal carcinoma, has not previously been reported.

Synthesis of ZnO particles using water molecules generated in esterification reaction

Science.gov (United States)

Šarić, Ankica; Gotić, Marijan; Štefanić, Goran; Dražić, Goran

2017-07-01

Zinc oxide particles were synthesized without the addition of water by autoclaving (anhydrous) zinc acetate/alcohol and zinc acetate/acetic acid/alcohol solutions at 160 °C. The solvothermal synthesis was performed in ethanol or octanol. The structural, optical and morphological characteristics of ZnO particles were investigated by X-ray diffraction (XRD), UV-Vis spectroscopy, FE-SEM and TEM/STEM microscopy. 13C NMR spectroscopy revealed the presence of ester (ethyl- or octyl-acetate) in the supernatants which directly indicate the reaction mechanism. The formation of ester in this esterification reaction generated water molecule in situ, which hydrolyzed anhydrous zinc acetate and initiated nucleation and formation of ZnO. It was found that the size and shape of ZnO particles depend on the type of alcohol used as a solvent and on the presence of acetic acid in solution. The presence of ethanol in the ;pure; system without acetic acid favoured the formation of fine and uniform spherical ZnO nanoparticles (∼20 nm). With the addition of small amount of acetic acid the size of these small nanoparticles increased significantly up to a few hundred nanometers. The addition of small amount of acetic acid in the presence of octanol caused even more radical changes in the shape of ZnO particles, favouring the growth of huge rod-like particles (∼3 μm).

Multinuclear NMR characterization of CTAB-hexanol-water, sodium oleate-butanol-water and triton X-100-decanol-water microemulsions

International Nuclear Information System (INIS)

Nagy, J.B.; Bodart-Ravet, I.; Derouane, E.G.; Gourgue, A.; Verfaillie, J.P.

1989-01-01

Multinuclear NMR is a very valuable tool to characterize micellar systems or microemulsions. It allows one to determine c.m.c. values, to study the dissolution of organic molecules, the solvation of cations and anions, the structural changes occurring in a ternary diagram, the mobility of the molecules, etc. This review paper essentially deals with the characterization of cationic (CTAB-hexanol-water), anionic (sodium oleate-butanol-water) and neutral (Triton X-100-decanol-water) reversed micelles. The use of paramagnetic ions [Ni(II), CO(II), Fe(III), etc.] is particularly emphasized to characterize the site of solubilization and their interaction with surfactant and cosurfactant molecules 13 C-NMR). It is concluded, that the metallic ions are basically solvated in the inner water cores and one or more hexanol molecules are included in their first coordination shells in the CTAB-hexanol-water microemulsions. In the Triton X-100-decanol-water microemulsions, both decanol and Triton X-100 molecules enter the first coordination shell of Co(II) ions which are dissolved in both aqeous water cores and the organic medium. 19 F-NMR of a fluorinated probe molecule is particularly useful to study the size of the inner water cores. The method is based on the partition of the molecules between the interface and the organic medium. However, this method has to be applied with great care, and the computed data have to be compared to other physico-chemical results. Both 19 F- and 23 Na-NMR results show a great variation of the behaviour of the sodium oleate-butanol-water system in the so-called bicontinuous region. The Na + ions are oriented independently on a hypothetical inverse micellar droplet. (author). 43 refs.; 18 figs.; 7 tabs

The Role of Molecule Clustering by Hydrogen Bond in Hydrous Ethanol on Laminar Burning Velocity

Directory of Open Access Journals (Sweden)

I Made Suarta

2016-01-01

Full Text Available The role of hydrogen bond molecule clustering in laminar burning velocities was observed. The water in hydrous ethanol can change the interaction between water-ethanol molecules. A certain amount of water can become oxygenated which increases the burning velocity. The hydrogen bond interaction pattern of ethanol and water molecules was modeled. Based on the molecular model, azeotropic behavior emerges from ethanol-water hydrogen bond, which is at a 95.1%v composition. The interaction with water molecule causes the ethanol molecule to be clustered with centered oxygenated compound. So, it supplies extra oxygen and provides intermolecular empty spaces that are easily infiltrated by the air. In the azeotropic composition, the molecular bond chain is the shortest, so hypothetically the burning velocity is anticipated to increase. The laminar burning velocity of ethanol fuel was tested in a cylindrical explosion bomb in lean, stoichiometric, and rich mixtures. The experimental result showed that the maximum burning velocity occurred at hydrous ethanol of 95.5%v composition. This discrepancy is the result of the addition of energy from 7.7% free ethanol molecules that are not clustered. At the rich mixture, the burning velocity of this composition is higher than that of anhydrous ethanol.

Direct and indirect methods for the quantification of leg volume: Comparison between water displacement volumetry, the disk model method and the frustum sign model method, using the correlation coefficient and the limits of agreement

NARCIS (Netherlands)

D.M.K.S. Kaulesar Sukul (D. M K S); P.Th. den Hoed (Pieter); T. Johannes (Tanja); R. van Dolder (R.); E. Benda (Eric)

1993-01-01

textabstractVolume changes can be measured either directly by water-displacement volumetry or by various indirect methods in which calculation of the volume is based on circumference measurements. The aim of the present study was to determine the most appropriate indirect method for lower leg volume

Prolonged displacement may compromise resilience in Eritrean mothers.

Science.gov (United States)

Almedom, Astier; Tesfamichael, Berhe; Mohammed, Zein; Mascie-Taylor, Nick; Muller, Jocelyn; Alemu, Zemui

2005-12-01

to assess the impact of prolonged displacement on the resilience of Eritrean mothers. an adapted SOC scale (short form) was administered. Complementary qualitative data were gathered from study participants' spontaneous reactions to and commentaries on the SOC scale. Displaced women's SOC scores were significantly less than those of the non-displaced: Mean = 54.84; SD = 6.48 in internally displaced person (IDP) camps, compared to non-displaced urban and rural/pastoralist: Mean = 48. 94, SD = 11.99; t = 3.831, p urban (non-displaced). Rural but traditionally mobile (pastoralist or transhumant) communities scored more or less the same as the urban non-displaced--i.e., significantly higher than those in IDP camps (p urban and pastoralist/transhumant groups were similar, while women in IDP camps were lower scoring--RR = .268, p < .001. The implications of these findings for health policy are critical. It is incumbent on the international health institutions including the World Health Organization and regional as well as local players to address the plight of internally displaced women, their families and communities in Eritrea and other places of dire conditions such as, for example Darfur in the Sudan.

Competitive displacement of sodium caseinate by low-molecular-weight emulsifiers and the effects on emulsion texture and rheology.

Science.gov (United States)

Munk, M B; Larsen, F H; van den Berg, F W J; Knudsen, J C; Andersen, M L

2014-07-29

Low-molecular-weight (LMW) emulsifiers are used to promote controlled destabilization in many dairy-type emulsions in order to obtain stable foams in whippable products. The relation between fat globule aggregation induced by three LMW emulsifiers, lactic acid ester of monoglyceride (LACTEM), saturated monoglyceride (GMS), and unsaturated monoglyceride (GMU) and their effect on interfacial protein displacement was investigated. It was found that protein displacement by LMW emulsifiers was not necessary for fat globule aggregation in emulsions, and conversely fat globule aggregation was not necessarily accompanied by protein displacement. The three LMW emulsifiers had very different effects on emulsions. LACTEM induced shear instability of emulsions, which was accompanied by protein displacement. High stability was characteristic for emulsions with GMS where protein was displaced from the interface. Emulsions containing GMU were semisolid, but only low concentrations of protein were detected in the separated serum phase. The effects of LACTEM, GMS, and GMU may be explained by three different mechanisms involving formation of interfacial α-gel, pickering stabilization and increased exposure of bound casein to the water phase. The latter may facilitate partial coalescence. Stabilizing hydrocolloids did not have any effect on the LMW emulsifiers' ability to induce protein displacement.

Structure formation in bis(terpyridine) derivative adlayers: molecule-substrate versus molecule-molecule interactions.

Science.gov (United States)

Hoster, Harry E; Roos, Matthias; Breitruck, Achim; Meier, Christoph; Tonigold, Katrin; Waldmann, Thomas; Ziener, Ulrich; Landfester, Katharina; Behm, R Jürgen

2007-11-06

The influence of the substrate and the deposition conditions-vapor deposition versus deposition from solution-on the structures formed upon self-assembly of deposited bis(terpyridine) derivative (2,4'-BTP) monolayers on different hexagonal substrates, including highly oriented pyrolytic graphite (HOPG), Au(111), and (111)-oriented Ag thin films, was investigated by high-resolution scanning tunneling microscopy and by model calculations of the intermolecular energies and the lateral corrugation of the substrate-adsorbate interaction. Similar quasi-quadratic network structures with almost the same lattice constants obtained on all substrates are essentially identical to the optimum configuration expected from an optimization of the adlayer structure with C-H...N-type bridging bonds as a structure-determining factor, which underlines a key role of the intermolecular interactions in adlayer order. Slight distortions from the optimum values to form commensurate adlayer structures on the metal substrates and the preferential orientation of the adlayer with respect to the substrate are attributed to the substrate-adsorbate interactions, specifically, the lateral corrugation in the substrate-adsorbate interaction upon lateral displacement and rotation of the adsorbed BTP molecules. The fact that similar adlayer structures are obtained on HOPG under ultrahigh vacuum conditions (solid|gas interface) and on HOPG in trichlorobenzene (solid|liquid interface) indicates that the intermolecular interactions are not severely affected by the solvent.

Displaced and non-displaced Colombian children's evaluations of moral transgressions, retaliation, and reconciliation

Science.gov (United States)

Ardila-Rey, Alicia; Killen, Melanie; Brenick, Alaina

2015-01-01

In order to assess the effects of displacement and exposure to violence on children's moral reasoning, Colombian children exposed to minimal violence (non-displaced or low-risk) (N = 99) and to extreme violence (displaced or high-risk) (N = 94), evenly divided by gender, at 6-, 9-, and 12 - years of age, were interviewed regarding their evaluation of peer-oriented moral transgressions (hitting and not sharing toys). The vast majority of children evaluated moral transgressions as wrong. Group and age differences were revealed, however, regarding provocation and retaliation. Children who were exposed to violence, in contrast to those with minimum exposure, judged it more legitimate to inflict harm or deny resources when provoked and judged it more okay to retaliate for reasons of retribution. Surprisingly, and somewhat hopefully, all children viewed reconciliation as feasible. The results are informative regarding theories of morality, culture, and the effects of violence on children's social development. PMID:25722543

Displacement of location in illusory line motion.

Science.gov (United States)

Hubbard, Timothy L; Ruppel, Susan E

2013-05-01

Six experiments examined displacement in memory for the location of the line in illusory line motion (ILM; appearance or disappearance of a stationary cue is followed by appearance of a stationary line that is presented all at once, but the stationary line is perceived to "unfold" or "be drawn" from the end closest to the cue to the end most distant from the cue). If ILM was induced by having a single cue appear, then memory for the location of the line was displaced toward the cue, and displacement was larger if the line was closer to the cue. If ILM was induced by having one of two previously visible cues vanish, then memory for the location of the line was displaced away from the cue that vanished. In general, the magnitude of displacement increased and then decreased as retention interval increased from 50 to 250 ms and from 250 to 450 ms, respectively. Displacement of the line (a) is consistent with a combination of a spatial averaging of the locations of the cue and the line with a relatively weaker dynamic in the direction of illusory motion, (b) might be implemented in a spreading activation network similar to networks previously suggested to implement displacement resulting from implied or apparent motion, and (c) provides constraints and challenges for theories of ILM.

The bubble method of water purification

Science.gov (United States)

Smirnov, B. M.; Babaeva, N. Yu.; Naidis, G. V.; Panov, V. A.; Saveliev, A. S.; Son, E. E.; Tereshonok, D. V.

2018-02-01

The processes of water purification from admixture molecules are analyzed. The purification rate is limited due to a low diffusion coefficient of the admixture molecules in water. At non-small concentrations of the admixture molecules, the water purication can proceed through association of molecules in condensed nanoparticles which fall on the bottom of the water volume. The rate of association may be increased in an external electric field, but in reality this cannot change significantly the rate of the purification process. The bubble method of water purification is considered, where air bubbles formed at the bottom of the water volume, transfer admixture molecules to the interface. This method allows one to clean small water volumes fast. This mechanism of water purification is realized experimentally and exhibits the promises of the bubble purification method.

Variable displacement alpha-type Stirling engine

Science.gov (United States)

Homutescu, V. M.; Bălănescu, D. T.; Panaite, C. E.; Atanasiu, M. V.

2016-08-01

The basic design and construction of an alpha-type Stirling engine with on load variable displacement is presented. The variable displacement is obtained through a planar quadrilateral linkage with one on load movable ground link. The physico-mathematical model used for analyzing the variable displacement alpha-type Stirling engine behavior is an isothermal model that takes into account the real movement of the pistons. Performances and power adjustment capabilities of such alpha-type Stirling engine are calculated and analyzed. An exemplification through the use of the numerical simulation was performed in this regard.

An experimental and numerical investigation of crossflow effects in two-phase displacements

DEFF Research Database (Denmark)

Cinar, Y.; Jessen, Kristian; Berenblyum, Roman

2006-01-01

In this paper, we present flow visualization experiments and numerical simulations that demonstrate the combined effects of viscous and capillary forces and gravity segregation on crossflow that occurs in two-phase displacements in layered porous media. We report results of a series of immiscible...... flooding experiments in 2D, two-layered glass bead models. Favorable mobility-ratio imbibition and unfavorable mobility-ratio drainage experiments were performed. We used pre-equilibrated immiscible phases from a ternary isooctane/isopropanol/water system, which allowed control of the interfacial tension....... The experiments also illustrate the complex interplay of capillary, gravity, and viscous forces that controls crossflow. The experimental results confirm that the transition ranges of scaling groups suggested by Zhou et al. (1994) are appropriate/valid. We report also results of simulations of the displacement...

Neutron displacement damage cross sections for SiC

International Nuclear Information System (INIS)

Huang Hanchen; Ghoniem, N.

1993-01-01

Calculations of neutron displacement damage cross sections for SiC are presented. We use Biersack and Haggmark's empirical formula in constructing the electronic stopping power, which combines Lindhard's model at low PKA energies and Bethe-Bloch's model at high PKA energies. The electronic stopping power for polyatomic materials is computed on the basis of Bragg's Additivity Rule. A continuous form of the inverse power law potential is used for nuclear scattering. Coupled integro-differential equations for the number of displaced atoms j, caused by PKA i, are then derived. The procedure outlined above gives partial displacement cross sections, displacement cross sections for each specie of the lattice, and for each PKA type. The corresponding damage rates for several fusion and fission neutron spectra are calculated. The stoichiometry of the irradiated material is investigated by finding the ratio of displacements among various atomic species. The role of each specie in displacing atoms is also investigated by calculating the fraction of displacements caused by each PKA type. The study shows that neutron displacement damage rates of SiC in typical magnetic fusion reactor first walls will be ∝10-15 dpa MW -1 m 2 ; in typical lead-protected inertial confinement fusion reactor first walls they will be ∝15-20 dpa MW -1 m 2 . For fission spectra, we find that the neutron displacement damage rate of SiC is ∝74 dpa per 10 27 n/m 2 in FFTF, ∝39 dpa per 10 27 n/m 2 in HFIR, and 25 dpa per 10 27 n/m 2 in NRU. Approximately 80% of displacement atoms are shown to be of the carbon-type. (orig.)

The effect of water molecules on the thiol collector interaction on the galena (PbS) and sphalerite (ZnS) surfaces: A DFT study

Energy Technology Data Exchange (ETDEWEB)

Long, Xianhao [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Chen, Ye, E-mail: fby18@126.com [College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China); Chen, Jianhua, E-mail: jhchen@gxu.edu.cn [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China); Xu, Zhenghe; Liu, Qingxia [Department of Chemical and Materials Engineering, University of Alberta, Edmonton, AB T6G 2V4 (Canada); Du, Zheng [National Supercomputing Center in Shenzhen, Shenzhen 518055 (China)

2016-12-15

Highlights: • Water adsorption has a greater effect on the electron distribution of ZnS surface than PbS surface. • Water adsorption decreases the reactivity of ZnS surface atoms but improves that of PbS. • Thiol collectors cannot interact with the hydrated ZnS surface. • The hydration has little influence on the interaction of thiol collectors with PbS surface. - Abstracts: In froth flotation the molecular interaction between reagents and mineral surfaces take place at the solid liquid interface. In this paper, the effect of water molecule on the three typical thiol collectors (xanthate, dithiocarbomate and dithiophosphate) interactions at the galena (PbS) and sphalerite (ZnS) surfaces has been studied adopting density functional theory (DFT). The results suggests that the presence of water molecule shows a greater influence on the electron distribution of ZnS surface than PbS surface, and reduce the reactivity of ZnS surface atoms but improves the reactivity of PbS surface atoms during the reaction with xanthate. Water adsorption could also reduce the covalent binding between Zn and S atoms but have little influence on Pb-S bond. In the presence of water, xanthate, dithiocarbomate (DTC) and dithiophosphate (DTP) could not adsorb on the sphalerite surface. And for galena (PbS) surface, the interaction of DTP is the strongest, then the DTC and the interaction of xanthate is the weakest. These results agree well with the flotation practice.

Asymmetric SOL Current in Vertically Displaced Plasma

Science.gov (United States)

Cabrera, J. D.; Navratil, G. A.; Hanson, J. M.

2017-10-01

Experiments at the DIII-D tokamak demonstrate a non-monotonic relationship between measured scrape-off layer (SOL) currents and vertical displacement event (VDE) rates with SOL currents becoming largely n=1 dominant as plasma is displaced by the plasma control system (PCS) at faster rates. The DIII-D PCS is used to displace the magnetic axis 10x slower than the intrinsic growth time of similar instabilities in lower single-null plasmas. Low order (n VDE instabilities observed when vertical control is disabled. Previous inquiry shows VDE asymmetry characterized by SOL current fraction and geometric parameters of tokamak plasmas. We note that, of plasmas displaced by the PCS, short displacement time scales near the limit of the PCS temporal control appear to result in larger n=1/n=2 asymmetries. Work supported under USDOE Cooperative Agreement DE-FC02-04ER54698 and DE-FG02-04ER54761.

Internal displacement in Colombia: Fifteen distinguishing features.

Science.gov (United States)

Shultz, James M; Ceballos, Ángela Milena Gómez; Espinel, Zelde; Oliveros, Sofia Rios; Fonseca, Maria Fernanda; Florez, Luis Jorge Hernandez

2014-01-01

This commentary aims to delineate the distinguishing features of conflict-induced internal displacement in the nation of Colombia, South America. Even as Colombia is currently implementing a spectrum of legal, social, economic, and health programs for "victims of armed conflict," with particular focus on internally displaced persons (IDPs), the dynamics of forced migration on a mass scale within this country are little known beyond national borders.   The authors of this commentary are embarking on a global mental health research program in Bogota, Colombia to define best practices for reaching the displaced population and implementing sustainable, evidence-based screening and intervention for common mental disorders. Presenting the defining characteristics of internal displacement in Colombia provides the context for our work and, more importantly, conveys the compelling and complex nature of this humanitarian crisis. We attempt to demonstrate Colombia's unique position within the global patterning of internal displacement.

Real-time and on-demand buoy observation system for tsunami and crustal displacement

Science.gov (United States)

Takahashi, N.; Imai, K.; Ishihara, Y.; Fukuda, T.; Ochi, H.; Suzuki, K.; Kido, M.; Ohta, Y.; Imano, M.; Hino, R.

2017-12-01

We develop real-time and on-demand buoy observation system for tsunami and crustal displacement. It is indispensable for observation of crustal displacement to understand changes of stress field related to future large earthquakes. The current status of the observation is carried out by using a vessel with an interval of a few times per a year. When a large earthquake occurs, however, we need dense or on-demand observation of the crustal displacement to grasp nature of the slow slip after the rupture. Therefore, we constructed buoy system with a buoy station, wire-end station, seafloor unit and acoustic transponders for crustal displacement, and we installed a pressure sensor on the seafloor unit and GNSS system on the buoy in addition to measurement of e distance between the buoy and the seafloor acoustic transponders. Tsunami is evaluated using GNSS data and pressure data sent from seafloor. Observation error of the GNSS is about 10 cm. The crustal displacement is estimated using pressure sensor for vertical and acoustic measurement for horizontal. Using current slack ratio of 1.58, the observation error for the measurement of the crustal displacement is about 10 cm. We repeated three times sea trials and confirmed the data acquisition with high data quality, mooring without dredging anchor in the strong sea current with a speed of 5.5 knots. Current issues to be resolved we face are removing noises on the acoustic data transmission, data transmission between the buoy and wire-end stations, electrical consumption on the buoy station and large observation error on the crustal displacement due to large slack ratio. We consider the change of the acoustic transmission for pressure data, replace of a GNSS data logger with large electrical consumption, and reduce of the slack ratio, and search method to reduce resistance of the buoy on the sea water. In this presentation, we introduce the current status of the technical development and tsunami waveforms recorded on our

Water permeation through the internal water pathway in activated GPCR rhodopsin.

Directory of Open Access Journals (Sweden)

Katsufumi Tomobe

Full Text Available Rhodopsin is a light-driven G-protein-coupled receptor that mediates signal transduction in eyes. Internal water molecules mediate activation of the receptor in a rhodopsin cascade reaction and contribute to conformational stability of the receptor. However, it remains unclear how internal water molecules exchange between the bulk and protein inside, in particular through a putative solvent pore on the cytoplasmic. Using all-atom molecular dynamics simulations, we identified the solvent pore on cytoplasmic side in both the Meta II state and the Opsin. On the other hand, the solvent pore does not exist in the dark-adapted rhodopsin. We revealed two characteristic narrow regions located within the solvent pore in the Meta II state. The narrow regions distinguish bulk and the internal hydration sites, one of which is adjacent to the conserved structural motif "NPxxY". Water molecules in the solvent pore diffuse by pushing or sometimes jumping a preceding water molecule due to the geometry of the solvent pore. These findings revealed a total water flux between the bulk and the protein inside in the Meta II state, and suggested that these pathways provide water molecules to the crucial sites of the activated rhodopsin.

Force transmissibility versus displacement transmissibility

Science.gov (United States)

Lage, Y. E.; Neves, M. M.; Maia, N. M. M.; Tcherniak, D.

2014-10-01

It is well-known that when a single-degree-of-freedom (sdof) system is excited by a continuous motion of the foundation, the force transmissibility, relating the force transmitted to the foundation to the applied force, equals the displacement transmissibility. Recent developments in the generalization of the transmissibility to multiple-degree-of-freedom (mdof) systems have shown that similar simple and direct relations between both types of transmissibility do not appear naturally from the definitions, as happens in the sdof case. In this paper, the authors present their studies on the conditions under which it is possible to establish a relation between force transmissibility and displacement transmissibility for mdof systems. As far as the authors are aware, such a relation is not currently found in the literature, which is justified by being based on recent developments in the transmissibility concept for mdof systems. Indeed, it does not appear naturally, but the authors observed that the needed link is present when the displacement transmissibility is obtained between the same coordinates where the applied and reaction forces are considered in the force transmissibility case; this implies that the boundary conditions are not exactly the same and instead follow some rules. This work presents a formal derivation of the explicit relation between the force and displacement transmissibilities for mdof systems, and discusses its potential and limitations. The authors show that it is possible to obtain the displacement transmissibility from measured forces, and the force transmissibility from measured displacements, opening new perspectives, for example, in the identification of applied or transmitted forces. With this novel relation, it becomes possible, for example, to estimate the force transmissibility matrix with the structure off its supports, in free boundary conditions, and without measuring the forces. As far as force identification is concerned, this

The Chinese Export Displacement Effect Revisited

DEFF Research Database (Denmark)

Elleby, Christian; Yu, Wusheng; Yu, Qian

China’s global export share has increased dramatically over the past decades. This development has prompted an empirical literature on whether Chinese exports displace those originated from elsewhere in various destination markets. In this paper we focus on the growth of China’s exports to the East...... African Community (EAC) countries and show how it has affected exports from the European Union (EU) to the EAC. Our main contribution to the literature on the displacement effect of Chinese exports is a set of total and relative displacement estimates based on different specifications of the gravity model...... where we control for country-year fixed effects so as to avoid the “gold medal mistake” of not accounting for time varying “multilateral resistance”. Our findings do not support the hypothesis that Chinese exports have displaced exports from other countries in general. Nor do they support the hypothesis...

The Three Gorges: the unexamined toll of development-induced displacement

Directory of Open Access Journals (Sweden)

Martin Stein

1998-04-01

Full Text Available In China, the context of forced displacement in its broadest sense centres on four issues: (1 coercive displacement for development; (2 political persecution resulting in controlled displacement; (3 massive labour dislocations; and (4 disaster-induced displacement. This article looks at the role of the state in displacement, focusing on the first of these issues: development-induced displacement.

Alanine water complexes.

Science.gov (United States)

Vaquero, Vanesa; Sanz, M Eugenia; Peña, Isabel; Mata, Santiago; Cabezas, Carlos; López, Juan C; Alonso, José L

2014-04-10

Two complexes of alanine with water, alanine-(H2O)n (n = 1,2), have been generated by laser ablation of the amino acid in a supersonic jet containing water vapor and characterized using Fourier transform microwave spectroscopy. In the observed complexes, water molecules bind to the carboxylic group of alanine acting as both proton donors and acceptors. In alanine-H2O, the water molecule establishes two intermolecular hydrogen bonds forming a six-membered cycle, while in alanine-(H2O)2 the two water molecules establish three hydrogen bonds forming an eight-membered ring. In both complexes, the amino acid moiety is in its neutral form and shows the conformation observed to be the most stable for the bare molecule. The microsolvation study of alanine-(H2O)n (n = 1,2) can be taken as a first step toward understanding bulk properties at a microscopic level.

Displaced Homemakers: Vo-Tech Workshop Guide.

Science.gov (United States)

Peltier, Wanda Jo

Written for displaced homemaker programs in vocational-technical schools, this curriculum contains material designed so that instructors can prepare student manuals appropriate to almost any educational support situation for displaced homemakers. An overview provides information on special needs groups, curriculum use, and resources and sample…

Buoyant miscible displacement flow of shear-thinning fluids: Experiments and Simulations

Science.gov (United States)

Ale Etrati Khosroshahi, Seyed Ali; Frigaard, Ian

2017-11-01

We study displacement flow of two miscible fluids with density and viscosity contrast in an inclined pipe. Our focus is mainly on displacements where transverse mixing is not significant and thus a two-layer, stratified flow develops. Our experiments are carried out in a long pipe, covering a wide range of flow-rates, inclination angles and viscosity ratios. Density and viscosity contrasts are achieved by adding Glycerol and Xanthan gum to water, respectively. At each angle, flow rate and viscosity ratio are varied and density contrast is fixed. We identify and map different flow regimes, instabilities and front dynamics based on Fr , Re / Frcosβ and viscosity ratio m. The problem is also studied numerically to get a better insight into the flow structure and shear-thinning effects. Numerical simulations are completed using OpenFOAM in both pipe and channel geometries and are compared against the experiments. Schlumberger, NSERC.

[Dynamics of Irreversible Evaporation of a Water-Protein Droplet and a Problem of Structural and Dynamical Experiments with Single Molecules].

Science.gov (United States)

Shaitan, K V; Armeev, G A; Shaytan, A K

2016-01-01

We discuss the effect of isothermal and adiabatic evaporation of water on the state of a water-protein droplet. The discussed problem is of current importance due to development of techniques to perform single molecule experiments using free electron lasers. In such structure-dynamic experiments the delivery of a sample into the X-ray beam is performed using the microdroplet injector. The time between the injection and delivery is in the order of microseconds. In this paper we developed a specialized variant of all-atom molecular dynamics simulations for the study of irreversible isothermal evaporation of the droplet. Using in silico experiments we determined the parameters of isothermal evaporation of the water-protein droplet with the sodium and chloride ions in the concentration range of 0.3 M at different temperatures. The energy of irreversible evaporation determined from in silico experiments at the initial stages of evaporation virtually coincides with the specific heat of evaporation for water. For the kinetics of irreversible adiabatic evaporation an exact analytical solution was obtained in the limit of high thermal conductivity of the droplet (or up to the droplet size of -100 Å). This analytical solution incorporates parameters that are determined using in silico. experiments on isothermal droplet evaporation. We show that the kinetics of adiabatic evaporation and cooling of the droplet scales with the droplet size. Our estimates of the water-protemi droplet. freezing rate in the adiabatic regime in a vacuum chamber show that additional techniques for stabilizing the temperature inside the droplet should be used in order to study the conformational transitions of the protein in single molecules. Isothermal and quasi-isothermal conditions are most suitable for studying the conformational transitions upon object functioning. However, in this case it is necessary to take into account the effects of dehydration and rapid increase of ionic strength in an

Heat transfer during phase change. Evaporation. Application to cooling towers

International Nuclear Information System (INIS)

Merigoux, J.

1973-01-01

Evaporation near a water sheet, without convection, is considered. The displacement of water molecules in the gaseous phase, due to concentration gradients, is especially studied. This displacement governs the development of evaporation. The calculation is made to derive the velocity of water evaporation as a function of the partial pressure of the surrounding air, the temperature and physical properties of the air and steam. Diffusion laws are used. The calculation is applied to cooling towers, according to Merkel theory [fr

5 CFR 330.706 - Notification of displaced employees.

Science.gov (United States)

2010-01-01

... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Notification of displaced employees. 330... RECRUITMENT, SELECTION, AND PLACEMENT (GENERAL) Interagency Career Transition Assistance Plan for Displaced Employees § 330.706 Notification of displaced employees. (a) In addition to meeting the requirements of...

Study of oxide film formed in a pre cracked CT specimen of AISI 304L during a rising displacement test in 288 C water

International Nuclear Information System (INIS)

Diaz S, A.; Castano M, V.

2007-01-01

A study of oxide film formed inside pre cracked CT specimens during a rising displacement test in high temperature water (288 C) was performed in this study, The environmental conditions used during the experiments were similar to these found in Boiling Water Reactors (BWR): Normal Water Condition (NWC - 200 ppb O 2 ) and Hydrogen Water Chemistry (HWC - 125 ppb H2). The oxide films formed were analyzed by scanning electron microscopy (SEM), energy dispersive spectroscopy (EDS) and X-ray diffraction (XRD). In both cases the oxide film consisted of two layers identified as magnetite. In the case of HWC the results agree with previous reports that mention magnetite as a stable phase in reducing conditions. However the stable phase in oxidant conditions is hematite and this work shows the presence of magnetite crystals in the narrow crack of CT specimens in spite of the oxidant environmental condition. This situation confirms that inside the pre-cracked CT specimens the environmental conditions were different from the oxidant bulk, and probably a poor oxygen access and stagnant conditions within the narrow crack promoted a localized reducing environment that permitted the magnetite formation. Is evident that the crack growth studies should consider the conditions inside crack because they are significantly different. (Author)

40 CFR 205.153 - Engine displacement.

Science.gov (United States)

2010-07-01

..., in accordance with American Society for Testing Materials (ASTM) E 29-67. (b) For rotary engines... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Engine displacement. 205.153 Section... TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Motorcycles § 205.153 Engine displacement. (a) Engine...

Dissolved oxygen detection by galvanic displacement-induced

Indian Academy of Sciences (India)

Dissolved oxygen detection by galvanic displacement-induced graphene/silver nanocomposite ... dissolved oxygen (DO) detection based on a galvanic displacement synthesized reduced graphene oxide–silver nanoparticles ... Current Issue

Thermodynamic Characterization of Hydration Sites from Integral Equation-Derived Free Energy Densities: Application to Protein Binding Sites and Ligand Series.

Science.gov (United States)

Güssregen, Stefan; Matter, Hans; Hessler, Gerhard; Lionta, Evanthia; Heil, Jochen; Kast, Stefan M

2017-07-24

Water molecules play an essential role for mediating interactions between ligands and protein binding sites. Displacement of specific water molecules can favorably modulate the free energy of binding of protein-ligand complexes. Here, the nature of water interactions in protein binding sites is investigated by 3D RISM (three-dimensional reference interaction site model) integral equation theory to understand and exploit local thermodynamic features of water molecules by ranking their possible displacement in structure-based design. Unlike molecular dynamics-based approaches, 3D RISM theory allows for fast and noise-free calculations using the same detailed level of solute-solvent interaction description. Here we correlate molecular water entities instead of mere site density maxima with local contributions to the solvation free energy using novel algorithms. Distinct water molecules and hydration sites are investigated in multiple protein-ligand X-ray structures, namely streptavidin, factor Xa, and factor VIIa, based on 3D RISM-derived free energy density fields. Our approach allows the semiquantitative assessment of whether a given structural water molecule can potentially be targeted for replacement in structure-based design. Finally, PLS-based regression models from free energy density fields used within a 3D-QSAR approach (CARMa - comparative analysis of 3D RISM Maps) are shown to be able to extract relevant information for the interpretation of structure-activity relationship (SAR) trends, as demonstrated for a series of serine protease inhibitors.

The effect of micro-environment on luminescence of aequorin: the role of amino acids and explicit water molecules on spectroscopic properties of coelenteramide.

Science.gov (United States)

Li, Zuo-Sheng; Zou, Lu-Yi; Min, Chun-Gang; Ren, Ai-Min

2013-10-05

Despite the fact that the luminescence reaction mechanism of aequorin has been intensively investigated, details in luminescence such as the effect of important amino acids residues and explicit water molecules on spectroscopic properties of coelenteramide remain unclear. In this work, the effect of amino acids residues His16, Tyr82, Trp86, Phe113, Trp129, Tyr132, explicit water molecules Wat505 and Wat405 on the spectral properties of CLM(-) has been studied by CAM-B3LYP, TD M06L and TD CAM-B3LYP methods in hydrophobic environment and aqueous solution. In hydrophobic environment, the amino acids or water molecules have no significant effect on the absorption. Tyr82 and Trp86 move close to CLM(-) changes the hydrogen bond network, and thus, the spectral properties is significantly affected by the hydrogen bonds between His16H(+)+Tyr82+Trp86 and CLM(-). Tyr82, Trp86 hydrogen bonding to CLM(-) upshifts the excited energy and helps emission spectra shift to blue region. Therefore, it is concluded that His16H(+)+Tyr82+Trp86 modify the emission spectra. The molecular electrostatic potential indicated that the greater electron density is located at the oxygen atom of 6-p-hydroxyphenyl group of CLM(-), and it facilitates the formation of hydrogen bond with His16H(+)+Tyr82+Trp86. It is a critical condition for the modification of emission spectra. It is expected to help to understand the interactions between emitter and amino acids in the micro environment. Copyright © 2013 Elsevier B.V. All rights reserved.

Displacement in new economy labor markets: Post-displacement wage loss in high tech versus low tech cities.

Science.gov (United States)

Davis, Daniel J; Rubin, Beth A

2016-11-01

While scholars and politicians tout education as the salve to employment disruptions, we argue that the geography of the new economy, and the social closure mechanisms that geography creates, may be just as important as individuals' characteristics for predicting post-displacement wage loss (or gain). We use data from the 2012 Displaced Workers ement of the Current Population Survey and from the 2010 United States Census to test hypotheses linking local labor markets in different industrial contexts to post-displacement wage loss. Our results point to age as a closure mechanism, and to the partially protective effect of education in high-tech versus low-tech economic sectors. This study is the first to use national level data to examine how employment in high-tech cities influences post-displacement wages. These findings are relevant both for theorizing about the new economy and for public policy. Copyright © 2016 Elsevier Inc. All rights reserved.

The impact of internal displacement on child mortality in post-earthquake Haiti: a difference-in-differences analysis.

Science.gov (United States)

Chen, Bradley; Halliday, Timothy J; Fan, Victoria Y

2016-07-19

The Haiti earthquake in 2010 resulted in 1.5 million internally displaced people (IDP), yet little is known about the impact of displacement on health. In this study, we estimate the impact of displacement on infant and child mortality and key health-behavior mechanisms. We employ a difference-in-differences (DID) design with coarsened exact matching (CEM) to ensure comparability among groups with different displacement status using the 2012 Haiti Demographic and Health Survey (DHS). The participants are 21,417 births reported by a nationally representative sample of 14,287 women aged 15-49. The main independent variables are household displacement status which includes households living in camps, IDP households (not in camps), and households not displaced. The main outcomes are infant and child mortality; health status (height-for-age, anemia); uptake of public health interventions (bed net use, spraying against mosquitoes, and vaccinations); and other conditions (hunger; cholera). Births from the camp households have higher infant mortality (OR = 2.34, 95 % CI 1.15 to 4.75) and child mortality (OR = 2.34, 95 % CI 1.10 to 5.00) than those in non-camp IDP households following the earthquake. These odds are higher despite better access to food, water, bed net use, mosquito spraying, and vaccines among camp households. IDP populations are heterogeneous and households that are displaced outside of camps may be self-selected or self-insured. Meanwhile, even households not displaced by a disaster may face challenges in access to basic necessities and health services. Efforts are needed to identify vulnerable populations to provide targeted assistance in post-disaster relief.

Water-induced ethanol dewetting transition.

Science.gov (United States)

Ren, Xiuping; Zhou, Bo; Wang, Chunlei

2012-07-14

The dewetting transitions of two hydrophobic plates immersed in pure water, aqueous ethanol solutions with concentrations from 25% to 90%, and pure ethanol were investigated by molecular dynamics simulations, where the dewetting transition was analogous to a first-order phase transition from liquid to vapor. It was found that the dewetting transitions occurred except that in the pure ethanol system. Although the ethanol molecules prefer to locate in the vicinity of the two plates, the inter-plate region is unfavorable for water molecules, due to losing more than one hydrogen bond. Moreover, each inter-plate water molecule forms hydrogen bonds on average with about two ethanol molecules. These intermolecular hydrogen bonds cause water and ethanol to cooperatively fill or exit the inter-plate region. Thus, water molecules play a more important role in the inter-plate filling/empty process, and induce the ethanol dewetting transition. Our results provide insight into the effect of water on the ethanol dewetting phenomena.

Displacement measurement system for linear array detector

International Nuclear Information System (INIS)

Zhang Pengchong; Chen Ziyu; Shen Ji

2011-01-01

It presents a set of linear displacement measurement system based on encoder. The system includes displacement encoders, optical lens and read out circuit. Displacement read out unit includes linear CCD and its drive circuit, two amplifier circuits, second order Butterworth low-pass filter and the binarization circuit. The coding way is introduced, and various parts of the experimental signal waveforms are given, and finally a linear experimental test results are given. The experimental results are satisfactory. (authors)

Thon rings from amorphous ice and implications of beam-induced Brownian motion in single particle electron cryo-microscopy

Energy Technology Data Exchange (ETDEWEB)

McMullan, G., E-mail: gm2@mrc-lmb.cam.ac.uk; Vinothkumar, K.R.; Henderson, R.

2015-11-15

We have recorded dose-fractionated electron cryo-microscope images of thin films of pure flash-frozen amorphous ice and pre-irradiated amorphous carbon on a Falcon II direct electron detector using 300 keV electrons. We observe Thon rings [1] in both the power spectrum of the summed frames and the sum of power spectra from the individual frames. The Thon rings from amorphous carbon images are always more visible in the power spectrum of the summed frames whereas those of amorphous ice are more visible in the sum of power spectra from the individual frames. This difference indicates that while pre-irradiated carbon behaves like a solid during the exposure, amorphous ice behaves like a fluid with the individual water molecules undergoing beam-induced motion. Using the measured variation in the power spectra amplitude with number of electrons per image we deduce that water molecules are randomly displaced by a mean squared distance of ∼1.1 Å{sup 2} for every incident 300 keV e{sup −}/Å{sup 2}. The induced motion leads to an optimal exposure with 300 keV electrons of 4.0 e{sup −}/Å{sup 2} per image with which to observe Thon rings centred around the strong 3.7 Å scattering peak from amorphous ice. The beam-induced movement of the water molecules generates pseudo-Brownian motion of embedded macromolecules. The resulting blurring of single particle images contributes an additional term, on top of that from radiation damage, to the minimum achievable B-factor for macromolecular structure determination. - Highlights: • Thon rings can be seen from amorphous ice. • Radiation damage to amorphous ice randomly displaces water molecules. • Each incident 300 keV e{sup −}/Å{sup 2} displaces water molecules on average by ∼1 Å. • Macromolecules embedded in amorphous ice undergo beam induced Brownian motion.

Job Displacement and First Birth Over the Business Cycle.

Science.gov (United States)

Hofmann, Barbara; Kreyenfeld, Michaela; Uhlendorff, Arne

2017-06-01

In this article, we investigate the impact of job displacement on women's first-birth rates as well as the variation in this effect over the business cycle. We use mass layoffs to estimate the causal effects of involuntary job loss on fertility in the short and medium term, up to five years after displacement. Our analysis is based on rich administrative data from Germany, with an observation period spanning more than 20 years. We apply inverse probability weighting (IPW) to flexibly control for the observed differences between women who were and were not displaced. To account for the differences in the composition of the women who were displaced in a downturn and the women who were displaced in an upswing, we use a double weighting estimator. Results show that the extent to which job displacement has adverse effects on fertility depends on the business cycle. The first-birth rates were much lower for women who were displaced in an economic downturn than for those who lost a job in an economic upturn. This result cannot be explained by changes in the observed characteristics of the displaced women over the business cycle.

Attosecond dynamics of electrons in molecules and liquids

Science.gov (United States)

Woerner, Hans Jakob

2016-05-01

The ultrafast motion of electrons and holes following light-matter interaction is fundamental to a broad range of chemical and biophysical processes. In this lecture, I will discuss two recent experiments carried out in our group that measure the atomic-scale motion of charge with attosecond temporal resolution (1 as = 10-18 s). The first experiment is carried out on isolated, spatially oriented molecules in the gas phase. We advance high-harmonic spectroscopy to resolve spatially and temporally the migration of an electron hole immediately following ionization of iodoacetylene, while simultaneously demonstrating extensive control over the process. A multidimensional approach, based on the measurement of both even and odd harmonic orders, enables us to reconstruct both quantum amplitudes and phases of the electronic states with a resolution of ~ 100 as. We separately reconstruct quasi-field-free and laser-controlled charge migration as a function of the spatial orientation of the molecule and determine the shape of the hole created by ionization. The second experiment is carried out on a free-flowing microjet of liquid water. We use an attosecond pulse train synchronized with a near-infrared laser pulse to temporally resolve the process of photoemission from liquid water using the RABBIT technique. We measure a delay on the order of 50 as between electrons emitted from the HOMO of liquid water compared to that of gas-phase water and a substantially reduced modulation contrast of the corresponding sidebands. Since our measurements on solvated water molecules are referenced to isolated ones, the measured delays reflect (i) the photoionization delays caused by electron transport through the aqueous environment and (ii) the effect of solvation on the parent molecule. The relative modulation contrast, in turn, contains information on (iii) the modification of transition amplitudes and (iv) dephasing processes. These experiments make the liquid phase and its fascinating

Stability of Miscible Displacements Across Stratified Porous Media

Energy Technology Data Exchange (ETDEWEB)

Shariati, Maryam; Yortsos, Yanis C.

2000-09-11

This report studied macro-scale heterogeneity effects. Reflecting on their importance, current simulation practices of flow and displacement in porous media were invariably based on heterogeneous permeability fields. Here, it was focused on a specific aspect of such problems, namely the stability of miscible displacements in stratified porous media, where the displacement is perpendicular to the direction of stratification.

Déplacements polyphasiques en milieu poreux. Injection de vapeur en conditions adiabatiques Multiphase Displacements in Porous Media. Steam Flooding under Adiabatic Conditions

Directory of Open Access Journals (Sweden)

Koci X.

2006-11-01

Full Text Available Dans un article antérieur [1], un dispositif expérimental permettant l'étude en milieu poreux des déplacements par fluides chauds, en conditions isothermes, a été présenté, ainsi que les résultats obtenus. Ce mode d'écoulement, qui ne fait pas intervenir A previous paper [1] described an experimental device designed for the study of multiphase displacements by hot fluids in porous media under isothermal conditions together with the results obtained. This type of flow, which does not take into account the progress of temperature fronts, is not representative of what actually happens in the field when a thermal enhanced oil recovery method is applied. In fact in this case, flows may be considered as quasiadiabatic. To gain a better understanding of the phenomena induced by such adiabatic displacements, new equipment was designed to reproduce conditions close to those in the field. Various experiments were modeled with a simulator developed at Institut Français du Pétrole (IFP, using results obtained under isothermal conditions (for instance, relative permeability curves. There is good agreement between experiments and computation. These experimental results were then compared to those obtained under isothermal conditions. Some hypotheses are put forward to explain the differences observed between the two types of flows. Experiments were carried out in unconsolidated cores made of packed sand. This sand mainly consisted of silica (over 99 weight %. Grain size was between 60 and 100 microns; the corresponding permeability was about 4. 10 to the power of (-12 m². The fluids consisted of distilled water and Albelf C-68 oil. New equipment was designed because of problems related to heat losses. For slow displacement rates at high temperatures, a small heat loss results in a decrease in temperature and therefore in steam condensation. Use of nonmetallic parts for the core-holder strongly reduces heat losses radially and longitudinally so

Potential-Flow Predictions of a Semi-Displacement Vessel Including Applications to Calm-Water Broaching

OpenAIRE

Ommani, Babak

2013-01-01

As a marine vehicle’s operational speed increases, hydrodynamic pressure plays an increasingly significant role in carrying the vessel’s weight. The shift of importance from hydrostatic to hydrodynamic pressure may cause a vessel, which is stable at rest or low speeds, to become dynamically unstable at high speeds. The nature of the dynamic instability depends mainly on the vessel’s type and speed. Among high speed vessels, semi-displacement mono-hulls are particularly susceptible to a nonosc...

Atomic displacements in bcc dilute alloys

Indian Academy of Sciences (India)

We present here a systematic investigation of the atomic displacements in bcc transition metal (TM) dilute alloys. We have calculated the atomic displacements in bcc (V, Cr, Fe, Nb, Mo, Ta and W) transition metals (TMs) due to 3d, 4d and 5d TMs at the substitutional site using the Kanzaki lattice static method. Wills and ...

Inactivation of Salmonella spp. on tomatoes by plant molecules.

Science.gov (United States)

Mattson, Tyler E; Johny, Anup Kollanoor; Amalaradjou, Mary Anne Roshni; More, Karen; Schreiber, David T; Patel, Jitu; Venkitanarayanan, Kumar

2011-01-05

The efficacy of carvacrol (CAR), trans-cinnamaldehyde (TC), eugenol (EUG) and β-resorcylic acid (BR) as a wash treatment for reducing Salmonella spp. on tomatoes was investigated. Plum tomatoes inoculated with a six-serotype mixture of Salmonella (10⁸CFU) were subjected to washing in sterile deionized water (control) or deionized water containing chlorine (100 ppm), CAR (0.25 and 0.75%), TC (0.5 and 0.75%), EUG (0.25 and 0.75%), or BR (0.75 and 1.0%) for 15 sec, 1 min, and 3 min. The plant molecules were more effective (Pwashing in water and chlorine. Both concentrations of CAR and TC, and 0.75% EUG decreased Salmonella counts on tomatoes by~6.0 log CFU/ml at 1 min. Both concentrations of BR decreased the pathogen on tomatoes to undetectable levels at 3 min of exposure. Washing of tomatoes in deionized water and chlorine for 3 min reduced Salmonella by ca. 2.0 and 4.0 log CFU/ml, respectively. No Salmonella was detected in the wash water containing the plant molecules or chlorine, whereas a substantial population of the pathogen survived in the control wash water. Moreover, none of the dipping treatments had any effect on the red color of tomatoes (P>0.05). Results indicate that CAR, TC, EUG and BR could effectively be used to kill Salmonella on tomatoes, but additional studies on sensory and quality characteristics of tomatoes treated with plant molecules are warranted. Copyright © 2010 Elsevier B.V. All rights reserved.

Internal Displacement, the Guiding Principles on Internal Displacement, the Principles Normative Status, and the Need for their Effective Domestic Implementation in Colombia.

Directory of Open Access Journals (Sweden)

Robert K. Goldman

2010-05-01

Full Text Available The paper briefly examines the phenomenon of internal displacement world-wide and the genesis of the United Nation’s mandate to deal with this problem. It examines key conclusions of a UN sponsored study which found that existing international law contained signifi cant gaps and grey areas in terms of meeting the needs of internally displaced persons. It also examines the origins and the content of the Guiding Principles on Internal Displacement and the normative status of these Principles. It suggests that, while not binding as such on states, the Guiding Principles have nonetheless become the most authoritative expression of minimum international standards applicable to the internally displaced and that based on state practice many, if not all, of these principles may eventually become part of customary international law. The paper also discusses the need for effective domestic implementation of the Guiding Principles, and examines how governmental authorities, the Constitutional Court and civil society organizations in Colombia, as well as inter-governmental bodies, have responded to the crisis of internal displacement in the country. While noting the adequacy of Colombia’s legislative framework on internal displacement, the paper concludes that the State has not taken the measures required to prevent future displacement or to effectively meet the protection and assistance needs of its displaced citizens.

The role of environmental degradation in population displacement.

Science.gov (United States)

Lonergan, S

1998-01-01

This article answers a series of questions about the role of environmental degradation in population displacement, refugee movement, and migration. The environment tends not to be included in the reasons for migration. Roger's indicators of migration potential include population growth, economic restructuring, increased economic disparities, and increased refugee flows. Myers (1993) estimated that international displacement and internal displacement may amount to about 25 million and may rise to 150 million by 2050. The role of the environment in displacement must be examined in the broader political and cultural context. Definitions of environmental refugees are ambiguous and inconsistent, and research has not answered why people continue to move to Mexico City and Chongqing, China, which both have very high levels of pollution. El-Hinnawi (1985) defined 3 groups of environmental refugees: those displaced due to natural disasters; those displaced due to permanent habitat changes; and those displaced who migrated from areas that cannot support their basic needs and who desire an improved quality of life. Lonergan (1994) identified environmental stresses as natural disasters, cumulative or slow-onset changes, accidental disruptions or industrial accidents, development projects, and conflict and warfare. These 5 causes must be treated separately and not lumped together as environmental degradation. Shoreline erosion, coastal flooding, and agricultural disruption associated with climate change may increase migration. Global measures must address world poverty and promote sustainable development.

A hot water extract of Curcuma longa inhibits adhesion molecule protein expression and monocyte adhesion to TNF-α-stimulated human endothelial cells.

Science.gov (United States)

Kawasaki, Kengo; Muroyama, Koutarou; Yamamoto, Norio; Murosaki, Shinji

2015-01-01

The recruitment of arterial leukocytes to endothelial cells is an important step in the progression of various inflammatory diseases. Therefore, its modulation is thought to be a prospective target for the prevention or treatment of such diseases. Adhesion molecules on endothelial cells are induced by proinflammatory cytokines, including tumor necrosis factor-α (TNF-α), and contribute to the recruitment of leukocytes. In the present study, we investigated the effect of hot water extract of Curcuma longa (WEC) on the protein expression of adhesion molecules, monocyte adhesion induced by TNF-α in human umbilical vascular endothelial cells (HUVECs). Treatment of HUVECs with WEC significantly suppressed both TNF-α-induced protein expression of adhesion molecules and monocyte adhesion. WEC also suppressed phosphorylation and degradation of nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IκBα) induced by TNF-α in HUVECs, suggesting that WEC inhibits the NF-κB signaling pathway.

Improved process for the injection of water for secondary recovery of petroleum

Energy Technology Data Exchange (ETDEWEB)

1967-07-24

In this process for the secondary recovery of petroleum from the formation, an aqueous displacing medium is injected through an injection well in communication with the formation. In this aqueous medium, a polymer is dissolved and the petroleum is thus displaced toward a producing well also in communication with the formation. The polymer is a liquid organic polymer, substantially linear, water-soluble, and having a resistance characteristic of at least 1.5. The polymer is dissolved in water in sufficient quantity such that the viscosity of the displacing medium is 0.5-15% of the viscosity of the crude oil to be displaced. The displacing medium is substantially free of molecular oxygen.

Endothermic decompositions of inorganic monocrystalline thin plates. II. Displacement rate modulation of the reaction front

Science.gov (United States)

Bertrand, G.; Comperat, M.; Lallemant, M.

1980-09-01

Copper sulfate pentahydrate dehydration into trihydrate was investigated using monocrystalline platelets with (110) crystallographic orientation. Temperature and pressure conditions were selected so as to obtain elliptical trihydrate domains. The study deals with the evolution, vs time, of elliptical domain dimensions and the evolution, vs water vapor pressure, of the {D}/{d} ratio of ellipse axes and on the other hand of the interface displacement rate along a given direction. The phenomena observed are not basically different from those yielded by the overall kinetic study of the solid sample. Their magnitude, however, is modulated depending on displacement direction. The results are analyzed within the scope of our study of endothermic decomposition of solids.

Displacement laser interferometry with sub-nanometer uncertainty

NARCIS (Netherlands)

Cosijns, S.J.A.G.

2004-01-01

Development in industry is asking for improved resolution and higher accuracy in mechanical measurement. Together with miniaturization the demand for sub nanometer uncertainty on dimensional metrology is increasing rapidly. Displacement laser interferometers are used widely as precision displacement

Efficiency of a variable displacement open circuit floating cup pump

NARCIS (Netherlands)

Vael, G.E.M.; Achten, P.A.J.; Brink, van den T.L.

2009-01-01

The Floating Cup Displacement principle is a relatively new axial piston displacement principle for hydrostatic pumps, motors and transformers. Since its origin in 2001, it has been mainly applied in fixed displacement pump prototypes. At the SICFP’05, a design for a variable displacement open

Epitaxial growth by monolayer restricted galvanic displacement

Directory of Open Access Journals (Sweden)

Vasilić Rastko

2012-01-01

Full Text Available The development of a new method for epitaxial growth of metals in solution by galvanic displacement of layers pre-deposited by underpotential deposition (UPD was discussed and experimentally illustrated throughout the lecture. Cyclic voltammetry (CV and scanning tunneling microscopy (STM are employed to carry out and monitor a “quasi-perfect”, two-dimensional growth of Ag on Au(111, Cu on Ag(111, and Cu on Au(111 by repetitive galvanic displacement of underpotentially deposited monolayers. A comparative study emphasizes the displacement stoichiometry as an efficient tool for thickness control during the deposition process and as a key parameter that affects the deposit morphology. The excellent quality of layers deposited by monolayer-restricted galvanic displacement is manifested by a steady UPD voltammetry and ascertained by a flat and uniform surface morphology maintained during the entire growth process.

Theoretical study on microhydration of SeO42-: On the number of water molecules necessary to stabilize the dianion

Science.gov (United States)

Pathak, Arup Kumar

2012-01-01

Microhydration of SeO42-·nH2O (n = 1-5) clusters are reported at B3LYP/Aug-cc-pvtz level of theory. Lower size hydrated clusters are stabilized by only double-hydrogen-bonding arrangements and the most stable conformer for higher size cluster (n > 3) contains a cyclic water ring. It is observed that at least one water molecule is necessary to stabilize the dianion in the gas phase against spontaneous electron loss. The microscopic theory based expression provides a route to predict the instability of bare SeO42- and to obtain the VDE for a wide range of cluster sizes including the bulk from the knowledge of the same for a few stable hydrated clusters.

Sol-gel method for encapsulating molecules

Science.gov (United States)

Brinker, C. Jeffrey; Ashley, Carol S.; Bhatia, Rimple; Singh, Anup K.

2002-01-01

A method for encapsulating organic molecules, and in particular, biomolecules using sol-gel chemistry. A silica sol is prepared from an aqueous alkali metal silicate solution, such as a mixture of silicon dioxide and sodium or potassium oxide in water. The pH is adjusted to a suitably low value to stabilize the sol by minimizing the rate of siloxane condensation, thereby allowing storage stability of the sol prior to gelation. The organic molecules, generally in solution, is then added with the organic molecules being encapsulated in the sol matrix. After aging, either a thin film can be prepared or a gel can be formed with the encapsulated molecules. Depending upon the acid used, pH, and other processing conditions, the gelation time can be from one minute up to several days. In the method of the present invention, no alcohols are generated as by-products during the sol-gel and encapsulation steps. The organic molecules can be added at any desired pH value, where the pH value is generally chosen to achieve the desired reactivity of the organic molecules. The method of the present invention thereby presents a sufficiently mild encapsulation method to retain a significant portion of the activity of the biomolecules, compared with the activity of the biomolecules in free solution.

Molecule Matters van der Waals Molecules

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 12. Molecule Matters van der Waals Molecules - Noble Gas Clusters are London Molecules! E Arunan. Feature Article Volume 14 Issue 12 December 2009 pp 1210-1222 ...

Salt concentrations during water production resulting from CO₂ storage

DEFF Research Database (Denmark)

Walter, Lena; Class, Holger; Binning, Philip John

2014-01-01

present in the saline aquifer. The brine can be displaced over large areas and can reach shallower groundwater resources. High salt concentrations could lead to a degradation of groundwater quality. For water suppliers the most important information is whether and how much salt is produced at a water...... displacement and infiltration could result in hazards for human health and the environment and therefore have to be investigated in detail. In this work numerical simulations are performed to estimate the risk related to the displacement of brine. The injected CO2 will displace the brine that is initially...

Serine/threonine phosphatase tapp2cs might be served as an early signal molecule for water stress in wheat

International Nuclear Information System (INIS)

Song, K. H.; Tian, W. L.; Hou, B. Z.; Guo, J. X.; Mei, X. R.; Li, Y. Z.

2015-01-01

Much progress has been made towards understanding the role of serine/threonine phosphatases type 2C (PP2Cs) in abscisic acid (ABA) signaling transduction. However, how the negative regulator, PP2Cs, responds to plant water loss remains unclear. Here, we used a series of relative soil moisture (RSM: 85 percentage (well watered), 65 percentage (moderate stress), 45 percentage (severe stress) potted winter wheat (Triticum aestivum L.) and the detached leaves to detect ABA levels and transcripts of PP2Cs, including PP2C40, PP2C45, PP2C59 and PP2C6 as well as the core downstream signals of ABA, including ABF, SnRK2.4 and SnRK2.5. The results showed that the continual loss of water led to a consistent increase in ABA levels, and that the mRNA expression levels of PP2Cs were dependent on plant water condition. PP2Cs expression could be induced by a slight loss of water, and inhibited under severe loss of water. These results were further confirmed by the transcripts of ABF, SnRK2.4 and SnRK2.5. Furthermore, in slight loss of water, 100 μM exogenous ABA could promote PP2Cs expression; in severe loss of water, it inhibited PP2Cs expression. In conclusion, ABA accumulation is controlled by water condition and the PP2C expression is dependent on plant water condition, suggesting that PP2Cs might be served as an early signal molecule for water stress in wheat. (author)

Fiber-optic couplers as displacement sensors

Science.gov (United States)

Baruch, Martin C.; Gerdt, David W.; Adkins, Charles M.

2003-04-01

We introduce the novel concept of using a fiber-optic coupler as a versatile displacement sensor. Comparatively long fiber-optic couplers, with a coupling region of approximately 10 mm, are manufactured using standard communication SM fiber and placed in a looped-back configuration. The result is a displacement sensor, which is robust and highly sensitive over a wide dynamic range. This displacement sensor resolves 1-2 μm over distances of 1-1.5 mm and is characterized by the essential absence of a 'spring constant' plaguing other strain gauge-type sensors. Consequently, it is possible to couple to extremely weak vibrations, such as the skin displacement affected by arterial heart beat pulsations. Used as a wrist-worn heartbeat monitor, the fidelity of the arterial pulse signal has been shown to be so high that it is possible to not only determine heartbeat and breathing rates, but to implement a new single-point blood pressure measurement scheme which does not squeeze the arm. In an application as a floor vibration sensor for the non-intrusive monitoring of independently living elderly, the sensor has been shown to resolve the distinct vibration spectra of different persons and different events.

Topology synthesis of large-displacement compliant mechanisms

DEFF Research Database (Denmark)

Pedersen, Claus B. Wittendorf; Buhl, Thomas; Sigmund, Ole

2001-01-01

This paper describes the use of topology optimization as a synthesis tool for the design of large-displacement compliant mechanisms. An objective function for the synthesis of large-displacement mechanisms is proposed together with a formulation for synthesis of path-generating compliant mechanisms...

Prolonged displacement may compromise resilience in Eritrean ...

African Journals Online (AJOL)

Objective: to assess the impact of prolonged displacement on the resilience of Eritrean mothers. Methods: an adapted SOC scale (short form) was administered. Complementary qualitative data were gathered from study participants' spontaneous reactions to and commentaries on the SOC scale. Results: Displaced ...

Job displacement and stress-related health outcomes

DEFF Research Database (Denmark)

Browning, Martin; Danø, Anne Møller; Heinesen, Eskil

2006-01-01

We investigate whether job loss as the result of displacement causes hospitalization for stress-related diseases which are widely thought to be associated with unemployment. In doing this, we use much better data than any previous investigators. Our data are a random 10% sample of the male...... group of displaced workers if they had not in fact been displaced. Our results indicate unequivocally that being displaced in Denmark does not cause hospitalization for stress-related disease. An analysis of the power of our test suggests that even though we are looking for a relatively rare outcome...... population of Denmark for the years 1981-1999 with full records on demographics, health and work status for each person, and with a link from every working person to a plant. We use the method of matching on observables to estimate the counter-factual of what would have happened to the health of a particular...

On virtual displacement and virtual work in Lagrangian dynamics

International Nuclear Information System (INIS)

Ray, Subhankar; Shamanna, J

2006-01-01

The confusion and ambiguity encountered by students in understanding virtual displacement and virtual work is discussed in this paper. A definition of virtual displacement is presented that allows one to express them explicitly for holonomic (velocity independent), non-holonomic (velocity dependent), scleronomous (time independent) and rheonomous (time dependent) constraints. It is observed that for holonomic, scleronomous constraints, the virtual displacements are the displacements allowed by the constraints. However, this is not so for a general class of constraints. For simple physical systems, it is shown that the work done by the constraint forces on virtual displacements is zero. This motivates Lagrange's extension of d'Alembert's principle to a system of particles in constrained motion. However, a similar zero work principle does not hold for the allowed displacements. It is also demonstrated that d'Alembert's principle of zero virtual work is necessary for the solvability of a constrained mechanical problem. We identify this special class of constraints, physically realized and solvable, as the ideal constraints. The concept of virtual displacement and the principle of zero virtual work by constraint forces are central to both Lagrange's method of undetermined multipliers and Lagrange's equations in generalized coordinates

2014 and beyond: implications for displacement

Directory of Open Access Journals (Sweden)

Aidan O’Leary

2014-05-01

Full Text Available 2014 marks a watershed for Afghanistan, with the withdrawal of the International Security Assistance Force after twelve years, and the very real risks this withdrawal poses to the capacity of the Afghan state to meet the many internal and external challenges faced by the country. These challenges have significant implications for displaced and returning Afghans and for the potential for displacement in the future.

Displacement Ventilation in a Room with Low-Level Diffusers

DEFF Research Database (Denmark)

Nielsen, Peter V.

Ventilation systems with vertical displacement flow have been used in industrial areas with high thermal loads for many years. Quite resently the vertical displacement flow systems have grown popular as comfort ventilation in rooms with thermal loads e.g. offices.......Ventilation systems with vertical displacement flow have been used in industrial areas with high thermal loads for many years. Quite resently the vertical displacement flow systems have grown popular as comfort ventilation in rooms with thermal loads e.g. offices....

A Rac1--GDP trimer complex binds zinc with tetrahedral and octahedral coordination, displacing magnesium

Energy Technology Data Exchange (ETDEWEB)

Prehna, G.; Stebbins, C

2007-01-01

The Rho family of small GTPases represent well characterized signaling molecules that regulate many cellular functions such as actin cytoskeletal arrangement and the cell cycle by acting as molecular switches. A Rac1-GDP-Zn complex has been crystallized in space group P3221 and its crystal structure has been solved at 1.9 {angstrom} resolution. These trigonal crystals reveal the unexpected ability of Rac1 to coordinate Zn atoms in a tetrahedral fashion by use of its biologically relevant switch I and switch II regions. Upon coordination of zinc, the switch I region is stabilized in the GDP-bound conformation and contributes to a Rac1 trimer in the asymmetric unit. Zinc coordination causes switch II to adopt a novel conformation with a symmetry-related molecule. Additionally, zinc was found to displace magnesium from its octahedral coordination at switch I, although GDP binding remained stable. This structure represents the first reported Rac1-GDP-Zn complex, which further underscores the conformational flexibility and versatility of the small GTPase switch regions.

A Rac1-GDP Trimer Complex Binds Zinc with Tetrahedral and Octahedral Coordination, Displacing Magnesium

Energy Technology Data Exchange (ETDEWEB)

Prehna,G.; Stebbins, E.

2007-01-01

The Rho family of small GTPases represent well characterized signaling molecules that regulate many cellular functions such as actin cytoskeletal arrangement and the cell cycle by acting as molecular switches. A Rac1-GDP-Zn complex has been crystallized in space group P3{sub 2}21 and its crystal structure has been solved at 1.9 {angstrom} resolution. These trigonal crystals reveal the unexpected ability of Rac1 to coordinate Zn atoms in a tetrahedral fashion by use of its biologically relevant switch I and switch II regions. Upon coordination of zinc, the switch I region is stabilized in the GDP-bound conformation and contributes to a Rac1 trimer in the asymmetric unit. Zinc coordination causes switch II to adopt a novel conformation with a symmetry-related molecule. Additionally, zinc was found to displace magnesium from its octahedral coordination at switch I, although GDP binding remained stable. This structure represents the first reported Rac1-GDP-Zn complex, which further underscores the conformational flexibility and versatility of the small GTPase switch regions.

Phenazine–naphthalene-1,5-diamine–water (1/1/2

Directory of Open Access Journals (Sweden)

Maria Gdaniec

2009-12-01

Full Text Available The asymmetric unit of the title compound, C12H8N2·C10H10N2·2H2O, contains one half-molecule of phenazine, one half-molecule of naphthalene-1,5-diamine and one water molecule. The phenazine and naphthalene-1,5-diamine molecules are located on inversion centers. The water molecules serve as bridges between the naphthalene-1,5-diamine molecules and also between the naphthalene-1,5-diamine and phenazine molecules. The naphthalene-1,5-diamine and water molecules are connected via N—H...O and O—H...N hydrogen bonds, forming a T4(2 motif. They are arranged into a two-dimensional polymeric structure parallel to (10overline{1} in which the water molecule is a single donor and a double acceptor, whereas the amino group is a double donor and a single acceptor in the hydrogen bonding. These two-dimensional assemblies alternate with the layers of phenazine molecules arranged into a herringbone motif. Each phenazine molecule is hydrogen bonded to two water molecules and thus a three-dimensional framework of hydrogen-bonded molecules is generated.

MRI of radial displacement of the meniscus in the knee

International Nuclear Information System (INIS)

Chen Jian; Lv Houshan; Lao Shan; Guan Zhenpeng; Hong Nan; Liang Hao

2006-01-01

Objective: To describe the phenomenon of radial displacement of the meniscus of the knees in the study population with MR imaging, and to establish MRI diagnostic criteria for radial displacement of the meniscus and displacement index. Methods: MR signs of radial displacement of the meniscus were evaluated retrospectively in 398 patients with knee symptoms who were examined with non- weight bearing MR images from Jan. 2000 to Feb. 2004. The patients younger than 18 years old, with joint effusion or serious arthropathy were excluded and 312 patients were eligible to be enrolled in this study. The criterion for radial displacement of the meniscus was defined as the location of the edge of meniscal body beyond the femoral and tibial outer border line. A displacement index, defined as the ratio of meniscal overhang to meniscal width, was used to quantify meniscal displacement. Results: The prevalence of radial displacement of the meniscus was 16.7% (52/312) and 13.9% (21/151) in right knee and 19.3% (31/161 )in left knee, respectively. There was no significant difference between left and right knee (χ 2 =1.60, P>0.05) and the ratio between medial and lateral meniscus was 7.8:1. The average displacement index was 0.54±0.24. The displacement indices were significant higher in older group (F=3.63, P<0.05). The incidence and indices of radial displacement of the meniscus for patients under or above 50 year older were 12.0%(17/142), 0.46±0.22 and 20.6% (35/170), 0.64±0.20, respectively. Difference was highly significant (t=0.84, P<0.01). Conclusion: It was concluded that radial displacement of the meniscus in knees was not a rare finding with MR imaging in patients with knee symptoms. The incidence increased in older age group. Further investigations were recommended to understand the etiology and clinical significance of the phenomenon of radial displacement of the meniscus. (authors)

Overtreatment of displaced midshaft clavicle fractures

DEFF Research Database (Denmark)

Ban, Ilija; Nowak, Jan; Virtanen, Kaisa

2016-01-01

Background and purpose - The best treatment for displaced clavicle fractures has been debated for decades. Operative treatment has become more common. However, several randomized trials comparing non-operative and operative treatment have not shown any compelling evidence in favor of surgery. We...... identified the preferred treatment of displaced midshaft clavicle fractures at public hospitals in 3 countries in Scandinavia. Patients and methods - A purpose-made multiple-choice questionnaire in English was sent to all public hospitals in Denmark, Sweden, and Finland. This was addressed to the orthopedic...... surgeon responsible for treatment of clavicle fractures, and completed questionnaires were obtained from 85 of 118 hospitals. Results - In the 3 countries, 69 of the 85 hospitals that responded would treat displaced clavicle fractures operatively. Clear criteria for treatment allocation were used at 58...

Study of degenerate parabolic system modeling the hydrogen displacement in a nuclear waste repository

KAUST Repository

Caro, Florian; Saad, Bilal Mohammed; Saad, Mazen Naufal B M

2013-01-01

Our goal is the mathematical analysis of a two phase (liquid and gas) two components (water and hydrogen) system modeling the hydrogen displacement in a storage site for radioactive waste. We suppose that the water is only in the liquid phase and is incompressible. The hydrogen in the gas phase is supposed compressible and could be dissolved into the water with the Henry law. The flow is described by the conservation of the mass of each components. The model is treated without simplified assumptions on the gas density. This model is degenerated due to vanishing terms. We establish an existence result for the nonlinear degenerate parabolic system based on new energy estimate on pressures.

Study of degenerate parabolic system modeling the hydrogen displacement in a nuclear waste repository

KAUST Repository

Caro, Florian

2013-09-01

Our goal is the mathematical analysis of a two phase (liquid and gas) two components (water and hydrogen) system modeling the hydrogen displacement in a storage site for radioactive waste. We suppose that the water is only in the liquid phase and is incompressible. The hydrogen in the gas phase is supposed compressible and could be dissolved into the water with the Henry law. The flow is described by the conservation of the mass of each components. The model is treated without simplified assumptions on the gas density. This model is degenerated due to vanishing terms. We establish an existence result for the nonlinear degenerate parabolic system based on new energy estimate on pressures.

Axial displacements in external and internal implant-abutment connection.

Science.gov (United States)

Lee, Ji-Hye; Kim, Dae-Gon; Park, Chan-Jin; Cho, Lee-Ra

2014-02-01

The purpose of this study was to evaluate the axial displacement of the abutments during clinical procedures by the tightening torque and cyclic loading. Two different implant-abutment connection systems were used (external butt joint connection [EXT]; internal tapered conical connection [INT]). The master casts with two implant replicas, angulated 10° from each other, were fabricated for each implant connection system. Four types of impression copings were assembled and tightened with the corresponding implants (hex transfer impression coping, non-hex transfer impression coping, hex pick-up impression coping, non-hex pick-up impression coping). Resin splinted abutments and final prosthesis were assembled. The axial displacement was measured from the length of each assembly, which was evaluated repeatedly, after 30 Ncm torque tightening. After 250 N cyclic loading of final prosthesis for 1,000,000 cycles, additional axial displacement was recorded. The mean axial displacement was statistically analyzed (repeated measured ANOVA). There was more axial displacement in the INT group than that of the EXT group in impression copings, resin splinted abutments, and final prosthesis. Less axial displacement was found at 1-piece non-hex transfer type impression coping than other type of impression copings in the INT group. There was more axial displacement at the final prosthesis than resin splinted abutments in the INT and the EXT groups. After 250 N cyclic loading of final prosthesis, the INT group showed more axial displacement than that of the EXT group. Internal tapered conical connection demonstrated a varying amount of axial displacement with tightening torque and cyclic loading. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

Molecule Matters van der Waals Molecules

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Molecule Matters van der Waals Molecules - Rg•••HF Complexes are Debye Molecules! E Arunan. Feature Article Volume 15 Issue 7 July 2010 pp 667-674. Fulltext. Click here to view fulltext PDF. Permanent link:

Employment protection and the consequences for displaced workers

DEFF Research Database (Denmark)

Albæk, Karsten; van Audenrode, Marc; Browning, Martin

We compare the wage and employment consequences of a job displacement in Belgium and Denmark. These two countries both have generous unemployment insurance schemes but job protection laws vary dramatically between the two. Using comparable data we find that the incidence of displacement and the c...... and the consequences for wages are similar in the two countries. The consequences for employment are very different with Danish workers experiencing much less unemployment after a displacement...

Bucky gel actuator displacement: experiment and model

International Nuclear Information System (INIS)

Ghamsari, A K; Zegeye, E; Woldesenbet, E; Jin, Y

2013-01-01

Bucky gel actuator (BGA) is a dry electroactive nanocomposite which is driven with a few volts. BGA’s remarkable features make this tri-layered actuator a potential candidate for morphing applications. However, most of these applications would require a better understanding of the effective parameters that influence the BGA displacement. In this study, various sets of experiments were designed to investigate the effect of several parameters on the maximum lateral displacement of BGA. Two input parameters, voltage and frequency, and three material/design parameters, carbon nanotube type, thickness, and weight fraction of constituents were selected. A new thickness ratio term was also introduced to study the role of individual layers on BGA displacement. A model was established to predict BGA maximum displacement based on the effect of these parameters. This model showed good agreement with reported results from the literature. In addition, an important factor in the design of BGA-based devices, lifetime, was investigated. (paper)

INCAS: an analytical model to describe displacement cascades

Energy Technology Data Exchange (ETDEWEB)

Jumel, Stephanie E-mail: stephanie.jumel@edf.fr; Claude Van-Duysen, Jean E-mail: jean-claude.van-duysen@edf.fr

2004-07-01

REVE (REactor for Virtual Experiments) is an international project aimed at developing tools to simulate neutron irradiation effects in Light Water Reactor materials (Fe, Ni or Zr-based alloys). One of the important steps of the project is to characterise the displacement cascades induced by neutrons. Accordingly, the Department of Material Studies of Electricite de France developed an analytical model based on the binary collision approximation. This model, called INCAS (INtegration of CAScades), was devised to be applied on pure elements; however, it can also be used on diluted alloys (reactor pressure vessel steels, etc.) or alloys composed of atoms with close atomic numbers (stainless steels, etc.). INCAS describes displacement cascades by taking into account the nuclear collisions and electronic interactions undergone by the moving atoms. In particular, it enables to determine the mean number of sub-cascades induced by a PKA (depending on its energy) as well as the mean energy dissipated in each of them. The experimental validation of INCAS requires a large effort and could not be carried out in the framework of the study. However, it was verified that INCAS results are in conformity with those obtained from other approaches. As a first application, INCAS was applied to determine the sub-cascade spectrum induced in iron by the neutron spectrum corresponding to the central channel of the High Flux Irradiation Reactor of Oak Ridge National Laboratory.

INCAS: an analytical model to describe displacement cascades

Science.gov (United States)

Jumel, Stéphanie; Claude Van-Duysen, Jean

2004-07-01

REVE (REactor for Virtual Experiments) is an international project aimed at developing tools to simulate neutron irradiation effects in Light Water Reactor materials (Fe, Ni or Zr-based alloys). One of the important steps of the project is to characterise the displacement cascades induced by neutrons. Accordingly, the Department of Material Studies of Electricité de France developed an analytical model based on the binary collision approximation. This model, called INCAS (INtegration of CAScades), was devised to be applied on pure elements; however, it can also be used on diluted alloys (reactor pressure vessel steels, etc.) or alloys composed of atoms with close atomic numbers (stainless steels, etc.). INCAS describes displacement cascades by taking into account the nuclear collisions and electronic interactions undergone by the moving atoms. In particular, it enables to determine the mean number of sub-cascades induced by a PKA (depending on its energy) as well as the mean energy dissipated in each of them. The experimental validation of INCAS requires a large effort and could not be carried out in the framework of the study. However, it was verified that INCAS results are in conformity with those obtained from other approaches. As a first application, INCAS was applied to determine the sub-cascade spectrum induced in iron by the neutron spectrum corresponding to the central channel of the High Flux Irradiation Reactor of Oak Ridge National Laboratory.

INCAS: an analytical model to describe displacement cascades

International Nuclear Information System (INIS)

Jumel, Stephanie; Claude Van-Duysen, Jean

2004-01-01

REVE (REactor for Virtual Experiments) is an international project aimed at developing tools to simulate neutron irradiation effects in Light Water Reactor materials (Fe, Ni or Zr-based alloys). One of the important steps of the project is to characterise the displacement cascades induced by neutrons. Accordingly, the Department of Material Studies of Electricite de France developed an analytical model based on the binary collision approximation. This model, called INCAS (INtegration of CAScades), was devised to be applied on pure elements; however, it can also be used on diluted alloys (reactor pressure vessel steels, etc.) or alloys composed of atoms with close atomic numbers (stainless steels, etc.). INCAS describes displacement cascades by taking into account the nuclear collisions and electronic interactions undergone by the moving atoms. In particular, it enables to determine the mean number of sub-cascades induced by a PKA (depending on its energy) as well as the mean energy dissipated in each of them. The experimental validation of INCAS requires a large effort and could not be carried out in the framework of the study. However, it was verified that INCAS results are in conformity with those obtained from other approaches. As a first application, INCAS was applied to determine the sub-cascade spectrum induced in iron by the neutron spectrum corresponding to the central channel of the High Flux Irradiation Reactor of Oak Ridge National Laboratory

INMS measures an influx of molecules from Saturn's rings

Science.gov (United States)

Perry, M. E.

2017-12-01

In 1984, Connerney and Waite proposed water influx from Saturn's rings to explain the low electron densities measured during Pioneer and Voyager radio occultation experiments. Charge exchange with this minor species depleted the H+ ions and provided a faster path to electron recombination. With ice the primary constituent of the rings, water was the most likely in-falling molecule. During the Grand Finale orbits, Cassini's Ion and Neutral Mass Spectrometer (INMS) detected and quantified an influx from the rings. Unexpectedly, the primary influx molecules are CH4 and a heavier carbon-bearing species. Water was detected, but quantities were factors of ten lower than these other species. Distribution in both altitude and latitude are consistent with a ring influx. The concentration of the minor species in Saturn's atmosphere shows that they enter Saturn's atmosphere from the top. Both molecules have their highest concentrations at the highest altitudes, with concentrations >0.4% at 3,500 km altitude and only 0.02% at 2,700 km. Molecules from the rings deorbit to Saturn's atmosphere at altitudes near 4,000 km, consistent with the INMS measurements. The latitudinal dependence of the minor species indicates that their source is near the equatorial plane. At high altitudes, the minor species were observed primarily at zero latitude, where the 28u species was six times more concentrated than at 5° latitude. At lower altitudes, the peaking ratio was 1, indicating that the species had diffused and was fully mixed into Saturn's H2 atmosphere. The lighter molecule, CH4, diffuses more rapidly than the 28u species. INMS also detected both of these species during the earlier F-ring passes, finding that the neutrals were centered at the ring plane and extended 3,000 km (half width, half max) north and south.

Capillary filling rules and displacement mechanisms for spontaneous imbibition of CO2 for carbon storage and EOR using micro-model experiments and pore scale simulation

Science.gov (United States)

Chapman, E.; Yang, J.; Crawshaw, J.; Boek, E. S.

2012-04-01

In the 1980s, Lenormand et al. carried out their pioneering work on displacement mechanisms of fluids in etched networks [1]. Here we further examine displacement mechanisms in relation to capillary filling rules for spontaneous imbibition. Understanding the role of spontaneous imbibition in fluid displacement is essential for refining pore network models. Generally, pore network models use simple capillary filling rules and here we examine the validity of these rules for spontaneous imbibition. Improvement of pore network models is vital for the process of 'up-scaling' to the field scale for both enhanced oil recovery (EOR) and carbon sequestration. In this work, we present our experimental microfluidic research into the displacement of both supercritical CO2/deionised water (DI) systems and analogous n-decane/air - where supercritical CO2 and n-decane are the respective wetting fluids - controlled by imbibition at the pore scale. We conducted our experiments in etched PMMA and silicon/glass micro-fluidic hydrophobic chips. We first investigate displacement in single etched pore junctions, followed by displacement in complex network designs representing actual rock thin sections, i.e. Berea sandstone and Sucrosic dolomite. The n-decane/air experiments were conducted under ambient conditions, whereas the supercritical CO2/DI water experiments were conducted under high temperature and pressure in order to replicate reservoir conditions. Fluid displacement in all experiments was captured via a high speed video microscope. The direction and type of displacement the imbibing fluid takes when it enters a junction is dependent on the number of possible channels in which the wetting fluid can imbibe, i.e. I1, I2 and I3 [1]. Depending on the experiment conducted, the micro-models were initially filled with either DI water or air before the wetting fluid was injected. We found that the imbibition of the wetting fluid through a single pore is primarily controlled by the

Estimating Aquifer Transmissivity Using the Recession-Curve-Displacement Method in Tanzania’s Kilombero Valley

Directory of Open Access Journals (Sweden)

William Senkondo

2017-12-01

Full Text Available Information on aquifer processes and characteristics across scales has long been a cornerstone for understanding water resources. However, point measurements are often limited in extent and representativeness. Techniques that increase the support scale (footprint of measurements or leverage existing observations in novel ways can thus be useful. In this study, we used a recession-curve-displacement method to estimate regional-scale aquifer transmissivity (T from streamflow records across the Kilombero Valley of Tanzania. We compare these estimates to local-scale estimates made from pumping tests across the Kilombero Valley. The median T from the pumping tests was 0.18 m2/min. This was quite similar to the median T estimated from the recession-curve-displacement method applied during the wet season for the entire basin (0.14 m2/min and for one of the two sub-basins tested (0.16 m2/min. On the basis of our findings, there appears to be reasonable potential to inform water resource management and hydrologic model development through streamflow-derived transmissivity estimates, which is promising for data-limited environments facing rapid development, such as the Kilombero Valley.

System of forest insect pheromone communication: stability of «information» molecules to environmental factors

Directory of Open Access Journals (Sweden)

V. G. Soukhovolsky

2016-06-01

Full Text Available Features of external environmental factors (such as electromagnetic radiation in certain spectral bands influencing pheromone molecules, which are carriers of information for forest insects in the search of the opposite sex, were examined. Stability of pheromone molecules for external influences has been studied for siberian moth Dendrolimus superans sibiricus Tschetv., pine moth Dendrilimus pini L., gypsy moth Lymantria dispar L., for xylophages Ips typographus L., Monochamus urussovi Fish. and Monochamus galloprovincialis Oliv. Properties of pheromone molecules were evaluated by calculations using quantum-chemical method B3LYP. Existing methods of quantum-chemical calculations are useful for analyzing the properties of quite small and uncomplicated molecules of forest insect pheromones. The calculations showed that the molecules of insect pheromones are able to absorb light in the ultraviolet range and move into an excited state. The values of dipole moments, the wavelengths of the absorption, atomic and molecular electronic properties of pheromones in the ground and excited states were calculated. The calculations showed that for the reaction of pheromones with oxygen an energy barrier is somewhat higher than for reactions of pheromones with water vapor. The worst reaction of pheromones with water molecules likely to pheromones such molecules whose dipole moment is comparable to the dipole moment of water. Quantum-chemical characteristics of the pheromone molecules can be linked to specific behavior of the insects.

Measuring and Modeling the Displacement of Connate Water in Chalk Core Plugs during Water Injection

DEFF Research Database (Denmark)

Korsbech, Uffe C C; Aage, Helle Karina; Andersen, Bertel Lohmann

2006-01-01

and forms a mixed water bank with almost 100% connate water in the front behind which a gradual transition to pure injection water occurs. This result underpins log interpretations from waterflooded chalk reservoirs. An ad hoc model was set up by use of the results, and the process was examined...

Small-molecule AT2 receptor agonists

DEFF Research Database (Denmark)

Hallberg, Mathias; Sumners, Colin; Steckelings, U Muscha

2018-01-01

The discovery of the first selective, small-molecule ATR receptor (AT2R) agonist compound 21 (C21) (8) that is now extensively studied in a large variety of in vitro and in vivo models is described. The sulfonylcarbamate derivative 8, encompassing a phenylthiofen scaffold is the drug-like agonist...... with the highest affinity for the AT2R reported to date (Ki = 0.4 nM). Structure-activity relationships (SAR), regarding different biaryl scaffolds and functional groups attached to these scaffolds and with a particular focus on the impact of various para substituents displacing the methylene imidazole group of 8......, are discussed. Furthermore, the consequences of migration of the methylene imidazole group and presumed structural requirements for ligands that are aimed as AT2R agonists (e.g. 8) or AT2R antagonists (e.g. 9), respectively, are briefly addressed. A summary of the pharmacological actions of C21 (8) is also...

Pore-scale observation and 3D simulation of wettability effects on supercritical CO2 - brine immiscible displacement in drainage

Science.gov (United States)

Hu, R.; Wan, J.; Chen, Y.

2016-12-01

Wettability is a factor controlling the fluid-fluid displacement pattern in porous media and significantly affects the flow and transport of supercritical (sc) CO2 in geologic carbon sequestration. Using a high-pressure micromodel-microscopy system, we performed drainage experiments of scCO2 invasion into brine-saturated water-wet and intermediate-wet micromodels; we visualized the scCO2 invasion morphology at pore-scale under reservoir conditions. We also performed pore-scale numerical simulations of the Navier-Stokes equations to obtain 3D details of fluid-fluid displacement processes. Simulation results are qualitatively consistent with the experiments, showing wider scCO2 fingering, higher percentage of scCO2 and more compact displacement pattern in intermediate-wet micromodel. Through quantitative analysis based on pore-scale simulation, we found that the reduced wettability reduces the displacement front velocity, promotes the pore-filling events in the longitudinal direction, delays the breakthrough time of invading fluid, and then increases the displacement efficiency. Simulated results also show that the fluid-fluid interface area follows a unified power-law relation with scCO2 saturation, and show smaller interface area in intermediate-wet case which suppresses the mass transfer between the phases. These pore-scale results provide insights for the wettability effects on CO2 - brine immiscible displacement in geologic carbon sequestration.

Laser-heating-induced displacement of surfactants on the water surface

NARCIS (Netherlands)

Backus, E.H.G.; Bonn, D.; Cantin, S.; Roke, S.; Bonn, M.

2012-01-01

We report a combined vibrational sum-frequency generation (SFG) spectroscopy, Brewster angle microscopy (BAM), and ellipsometry study of different surfactants on water as a function of surfactant density. Vibrational SFG spectra of surfactants on the water surface in a Langmuir trough have been

A Vision-Based Sensor for Noncontact Structural Displacement Measurement

Science.gov (United States)

Feng, Dongming; Feng, Maria Q.; Ozer, Ekin; Fukuda, Yoshio

2015-01-01

Conventional displacement sensors have limitations in practical applications. This paper develops a vision sensor system for remote measurement of structural displacements. An advanced template matching algorithm, referred to as the upsampled cross correlation, is adopted and further developed into a software package for real-time displacement extraction from video images. By simply adjusting the upsampling factor, better subpixel resolution can be easily achieved to improve the measurement accuracy. The performance of the vision sensor is first evaluated through a laboratory shaking table test of a frame structure, in which the displacements at all the floors are measured by using one camera to track either high-contrast artificial targets or low-contrast natural targets on the structural surface such as bolts and nuts. Satisfactory agreements are observed between the displacements measured by the single camera and those measured by high-performance laser displacement sensors. Then field tests are carried out on a railway bridge and a pedestrian bridge, through which the accuracy of the vision sensor in both time and frequency domains is further confirmed in realistic field environments. Significant advantages of the noncontact vision sensor include its low cost, ease of operation, and flexibility to extract structural displacement at any point from a single measurement. PMID:26184197

The Different Methods of Displacement Monitoring at Loading Tests of Bridges or Different Structures

Directory of Open Access Journals (Sweden)

Kovačič Boštjan

2016-01-01

Full Text Available By measuring the displacements and deformations at different structures we deal in the Faculty of Civil Engineering, transportation Engineering and Architecture in University of Maribor for about 20 years. At that time we measured over 600 structures. Most loading tests of bridges and Viaducts were made. The measurements of movements needed to be as precise and accurate as possible. To do that laboratory test of instruments were made to see which instrument gives us reliable results. Displacements can be determined by geodetic and physical methods, depends of the construction. The use of geodetic methods are still preferable. In the paper the measurements with the total station, the level and rotation level, photogrammetry and solutions on the field by physical methods with inductive transducers are presented. We need to measure displacements as quick as possible but efficiently because we can not repeat the measurements under the same conditions. Also the surveying on the bridge and in the lab with the comparison of methods is presented under the different hard terrain conditions - water beneath the construction, big height of the structure, unapproachability, large span structures.

Neutron-induced displacement damage analysis (with particular reference to zirconium)

International Nuclear Information System (INIS)

Woo, C.H.

1978-10-01

Neutron irradiation produces damage in a solid, initially in the form of atomic displacements. As a first step to understanding the effects of irradiation damage in reactor structural materials, information on the initial atomic displacements is necessary. The computer program DISPKAN, based on an extension and generalization of the program RICE, written at ORNL for such calculations, has been developed and installed on the CDC system at CRNL. Using neutron scattering data from ENDF/B files, DISPKAN performs a displacement and PKO analysis on the initial damage caused by neutrons from a given spectrum. The following quantities are calculated: the displacement rate per unit neutron flux, the PKO spectrum, the displacement spectrum, the fraction of PKO's with energy above T, the fraction of displacements produced by PKO's with energy above T, the average PKO energy, the average number of displacements produced per PKO, and the total number of PKO's produced per atom of the solid per unit fluence. The input and output formats of the program are explained. Sample runs are demonstrated. Results for zirconium, exposed to five neutron spectra typically available to experimentalist, are given to illustrate the spectral dependence of the initial displacement events. (author)

Diagnosing displaced four-part fractures of the proximal humerus

DEFF Research Database (Denmark)

Brorson, Stig; Bagger, Jens; Sylvest, Annette

2009-01-01

Displaced four-part fractures comprise 2-10 % of all proximal humeral fractures. The optimal treatment is unclear and randomised trials are needed. The conduct and interpretation of such trials is facilitated by a reproducible fracture classification. We aimed at quantifying observer agreement...... on the classification of displaced four-part fractures according to the Neer system. Published and unpublished data from five observer studies were reviewed. Observers agreed less on displaced four-part fractures than on the overall Neer classification. Mean kappa values for interobserver agreement ranged from 0.......16 to 0.48. Specialists agreed slightly more than fellows and residents. Advanced imaging modalities (CT and 3D CT) seemed to contribute more to classification of displaced four-part patterns than in less complex fracture patterns. Low observer agreement may challenge the clinical approach to displaced...

Land Restitution and Prevention of Forced Displacement in Colombia

Directory of Open Access Journals (Sweden)

Felipe Gómez-Isa

2010-11-01

Full Text Available The armed conflict in Colombia, which has generated over three million internally displaced persons, has dramatic humanitarian consequences and raises serious issues regarding the protection of displaced peoples’ rights. The underlying reasons for the displacement often lie in the dynamics associated with territorial control and land seizures undertaken for strategic, military or purely economic purposes. Domestic and international legal provisions have established the victims’ right to the restitution of their homes and property as the “preferred remedy” in cases of displacement. However, policies dealing with displacement, both those of the Colombian government and of several international institutions, fail to take this sufficiently into account. A comprehensive reparation policy for victims must necessarily entail the reversion of lands, territories and goods seized in Colombia under the pretext of the internal armed conflict.

Method of making self-calibrated displacement measurements

International Nuclear Information System (INIS)

Pedersen, H.N.

1977-01-01

A method for monitoring the displacement of an object having an acoustically reflective surface at least partially submerged in an acoustically conductive medium is described. The reflective surface is designed to have a stepped interface responsive to an incident acoustic pulse to provide separate discrete reflected pulses to a receiving transducer. The difference in the time of flight of the reflected acoustic signals corresponds to the known step height and the time of travel of the signals to the receiving transducer provides a measure of the displacement of the object. Accordingly, the reference step length enables simultaneous calibration of each displacement measurement. 3 claims, 3 figures

Mental health of internally displaced persons in Jalozai camp, Pakistan.

Science.gov (United States)

Mujeeb, Arooj

2015-11-01

Internal displacement has been a distressing issue of Pakistan for last one decade. Few research works have been conducted on the psychological issues of internally displaced persons in Pakistan. The current research was aimed at determining the psychological effects of internal displacement, that is, psychological well-being, depression, anxiety and stress (internalizing problems) of the individuals who were displaced as a result of an armed conflict in Swat. A sample of 126 internally displaced persons was taken from Jalozai camp which included females (n = 65) and males (n = 61). Age of the sample ranged from 20 to 75 years with a mean of 47.5 years. Translated and adapted versions of Well-Being Affectometer-2 Scale and Depression Anxiety Stress Scale were used in the current research. Results of the study indicated differences between males and females, females being higher on internalizing problems and lower on psychological well-being, whereas family loss during displacement affected the results in the same way. Well-being, gender and family loss emerged as significant predictors of internalizing problems, and gender moderated the relationship between well-being and internalizing problems. Internal displacement may bring psychological issues for internally displaced persons, that is, their well-being may decrease and depression, anxiety and stress may increase during displacement. Limitations and implications of the study were discussed further. © The Author(s) 2015.

Coordination geometries of Zn(II) and Cd(II) in phosphotriesterase: Influence of water molecules in the active site

DEFF Research Database (Denmark)

Krauss, M; Olsen, Lars; Antony, J

2002-01-01

Models of the metal ion binding sites of native ZnZn and of cadmium-substituted ZnCd and CdCd phosphotriesterase, including full amino acid side chains, were geometry optimized with quantum mechanical methods, with effective fragment potentials (EFP) representing the protein environment surroundi...... to the Od1 of the carboxylate of the first-shell aspartate designated M 1, but the energy difference between Cd1Zn2 and the lowest energy Zn1Cd2 structure is only about 2 kcal/mol and decreasing with the addition of water molecules. The Zn1Cd2 arrangement is found experimentally....

[Displacement of the posterior part of the eyeball in myopia].

Science.gov (United States)

Akizawa, Yasuko; Masahiro, Ida

2006-12-01

The principal aim of this study was to investigate displacement of the posterior part of the eyeball within the muscle cone in myopic eyes, particularly in moderately myopic subjects as well as in high myopes. Secondly, the correlation of the amount of displacement and the outer axial length of the globe was studied. The direction of displacement was also examined to clarify whether the eyeball tends to shift toward a certain direction. Seven patients with moderate myopia (moderate myopia group), fifteen patients with high myopia without esotropia (high myopia group), five patients with high myopia and esotropia (myopic esotropia group), and twenty-two controls (control group) were examined. Using magnetic resonance imaging, the outer axial length and the displacement of the posterior portion of the eyeball in the muscle cone were measured. In order to eliminate interindividual differences in the facial configuration, the coronal scanning was done perpendicularly to the orbital axis. The displacement was measured in a plane 4 mm anterior to the globe-optic nerve junction. The displacement was represented by the distance and direction of the globe center from the center of the muscle cone. In the moderate myopia group, there was no displacement of the posterior part of the eyeball in the muscle cone. It was the same as in the control group. But among the three groups, the displacement (mean standard deviation) was significantly greater in the myopic esotropia group (1.53 +/- 0.49 mm) and the high myopia group (0.94 +/- 0.52 mm) than in the control group (0.11 +/- 0.18 mm) (one way ANOVA and multiple comparison). The outer axial length and the distance of the displacement in all cases was significantly correlated (r = 0.87, p = 0.01). Moreover, the posterior part of the eyeball of the myopic esotropia group and the high myopia group was displaced superiorly and temporally. The posterior part of the eyeball of myopic eyes was displaced superotemporally in the muscle

Quantification of the vocal folds’ dynamic displacements

Science.gov (United States)

del Socorro Hernández-Montes, María; Muñoz, Silvino; De La Torre, Manuel; Flores, Mauricio; Pérez, Carlos; Mendoza-Santoyo, Fernando

2016-05-01

Fast dynamic data acquisition techniques are required to investigate the motional behavior of the vocal folds (VFs) when they are subjected to a steady air-flow through the trachea. High-speed digital holographic interferometry (DHI) is a non-invasive full-field-of-view technique that has proved its usefulness to study rapid and non-repetitive object movements. Hence it is an ideal technique used here to measure VF displacements and vibration patterns at 2000 fps. Analyses from a set of 200 displacement images showed that VFs’ vibration cycles are established along their width (y) and length (x). Furthermore, the maximum deformation for the right and left VFs’ area may be quantified from these images, which in itself represents an important result in the characterization of this structure. At a controlled air pressure, VF displacements fall within the range ~100-1740 nm, with a calculated precision and accuracy that yields a variation coefficient of 1.91%. High-speed acquisition of full-field images of VFs and their displacement quantification are on their own significant data in the study of their functional and physiological behavior since voice quality and production depend on how they vibrate, i.e. their displacement amplitude and frequency. Additionally, the use of high speed DHI avoids prolonged examinations and represents a significant scientific and technological alternative contribution in advancing the knowledge and working mechanisms of these tissues.

Lateral vibration analysis of continuous bridges utilizing equal displacement rule

Directory of Open Access Journals (Sweden)

Biao Wei

Full Text Available The application of equal displacement rule simplifies the evaluation of lateral displacement demand forSDOF system. For complex multi-degree-of-freedom (MDOF structures such as continuous bridge systems, however, it requires more investigations. In this paper, a comprehensive parametric study of the ratio of maximum inelastic displacement to maximum elastic displacement for typical continuous bridges is performedto advance the application of equal displacement rule to MDOF systems. Particurlarly for the bridges with long periods, this adapted methodlogy is further simplified. It is concluded that equal displacement rule of MDOF is applicable to continuous bridges when the periods of the main modes are no less than the limiting period, which usually serves as an indication to the level of inelastic deformation for a bridge subjected to an earthquake.

Water diffusion in cytoplasmic streaming in Elodea internodal cells under the effect of antimitotic agents.

Science.gov (United States)

Vorob'ev, Vladimir N; Anisimov, Alexander V; Dautova, Nailya R

2008-07-01

The translational displacement of the cytoplasmic water in Elodea stem cells resulting from protein motor activity was measured using the NMR method. A 24-h treatment with vincristine results in a reduction of the translational displacement of the cytoplasmic water. With a constant cytoplasmic streaming velocity, the dynamics of the translational displacement of the cytoplasmic water under the effect of taxol are characterized by a continuous increase at a concentration of 0.05 mM, and reaching a plateau at a concentration of 0.5 mM.

A geometry-based simulation of the hydration of ions and small molecules

International Nuclear Information System (INIS)

Plumridge, T.H.

2001-01-01

The behaviour of solutes in water is of universal significance, but still not fully understood. This thesis provides details of a new computer simulation technique used to investigate the hydration of ions and small molecules. In contrast to conventional techniques such as molecular dynamics, this is a purely geometric method involving no forcefield or energy terms. Molecules of interest are modelled using crystallographic data to ensure that the structures are accurate. Water molecules are added randomly at any hydrogen bonding site in chains. At each addition the chain is rotated through all available space testing for the possibility of ring formation. The constraints used by the program to decide whether a ring should be conserved, i.e. whether the ring-forming hydrogen bond is viable were derived from a survey of (i) all available ice and clathrate hydrate structures and (ii) the hydrates of small biological molecules from the Cambridge Crystallographic Data Centre. If a ring forms, it is conserved and the process restarted with the addition of another random water. If the chain reaches a certain length and no hydrogen bonding opportunities are detected, the water chain is dissolved, and the process restarted. Using these techniques structure makers such as sulfate will readily allow structured water to form around them leading to large networks, whereas structure breakers such as urea will not allow any water chains to bridge the hydrogen bonding groups. The software has been tested with a set of twenty widely varying solutes and has produced results which generally agree with experimental data for structure makers and breakers, and also agrees well with traditional techniques such as molecular dynamics and Monte Carlo techniques. (author)

Statistical survey of the buried waters in the Protein Data Bank.

Science.gov (United States)

Carugo, Oliviero

2016-01-01

The structures of buried water molecules were studied in an ensemble of high-quality and non-redundant protein crystal structures. Buried water molecules were clustered and classified in lake-like clusters, which are completely isolated from the bulk solvent, and bay-like clusters, which are in contact with the bulk solvent through a surface water molecule. Buried water molecules are extremely common: lake-like clusters are found in 89 % of the protein crystal structures and bay-like clusters in 93 %. Clusters with only one water molecule are much more common than larger clusters. Both cluster types incline to be surrounded by loop residues, and to a minor extent by residues in extended secondary structure. Helical residues on the contrary do not tend to surround clusters of buried water molecules. One buried water molecule is found every 30-50 amino acid residues, depending on the secondary structures that are more abundant in the protein. Both main- and side-chain atoms are in contact with buried waters; they form four hydrogen bonds with the first water and 1-1.5 additional hydrogen bond for each additional water in the cluster. Consequently, buried water molecules appear to be firmly packed and rigid like the protein atoms. In this regard, it is remarkable to observe that prolines often surround water molecules buried in the protein interior. Interestingly, clusters of buried water molecules tend to be just beneath the protein surface. Moreover, water molecules tend to form a one-dimensional wire rather than more compact arrangements. This agrees with recent evidence of the mechanisms of solvent exchange between internal cavities and bulk solvent.

Large scale chromatographic separations using continuous displacement chromatography (CDC)

International Nuclear Information System (INIS)

Taniguchi, V.T.; Doty, A.W.; Byers, C.H.

1988-01-01

A process for large scale chromatographic separations using a continuous chromatography technique is described. The process combines the advantages of large scale batch fixed column displacement chromatography with conventional analytical or elution continuous annular chromatography (CAC) to enable large scale displacement chromatography to be performed on a continuous basis (CDC). Such large scale, continuous displacement chromatography separations have not been reported in the literature. The process is demonstrated with the ion exchange separation of a binary lanthanide (Nd/Pr) mixture. The process is, however, applicable to any displacement chromatography separation that can be performed using conventional batch, fixed column chromatography

Effect of excavation method on rock mass displacement

International Nuclear Information System (INIS)

Sato, Toshinori; Kikuchi, Tadashi; Sugihara, Kozo

1998-01-01

Rock mass displacement measurements have been performed to understand rock mass behavior and its dependence on excavation method during drift excavation at the Tono mine. Rock mass displacements of 1.46 mm and 0.67 mm have been measured at one meter (0.33D: blasting, 0.42D: machine, D: width of drift) from the walls of drifts excavated by the drill and blasting method and machine, respectively. Numerical analysis of rock mass displacements with Finite Element Method has been performed assuming an excavation disturbed zone. Measured and analysed rock mass displacements are consistent with each other for the drift excavation by the drill and blasting method. The excavation disturbed zone was narrower for the drift excavated by machine than for the drift excavated by the drill and blasting method. (author)

Toehold strand displacement-driven assembly of G-quadruplex DNA for enzyme-free and non-label sensitive fluorescent detection of thrombin.

Science.gov (United States)

Xu, Yunying; Zhou, Wenjiao; Zhou, Ming; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

2015-02-15

Based on a new signal amplification strategy by the toehold strand displacement-driven cyclic assembly of G-quadruplex DNA, the development of an enzyme-free and non-label aptamer sensing approach for sensitive fluorescent detection of thrombin is described. The target thrombin associates with the corresponding aptamer of the partial dsDNA probes and liberates single stranded initiation sequences, which trigger the toehold strand displacement assembly of two G-quadruplex containing hairpin DNAs. This toehold strand displacement reaction leads to the cyclic reuse of the initiation sequences and the production of DNA assemblies with numerous G-quadruplex structures. The fluorescent dye, N-Methyl mesoporphyrin IX, binds to these G-quadruplex structures and generates significantly amplified fluorescent signals to achieve highly sensitive detection of thrombin down to 5 pM. Besides, this method shows high selectivity towards the target thrombin against other control proteins. The developed thrombin sensing method herein avoids the modification of the probes and the involvement of any enzyme or nanomaterial labels for signal amplification. With the successful demonstration for thrombin detection, our approach can be easily adopted to monitor other target molecules in a simple, low-cost, sensitive and selective way by choosing appropriate aptamer/ligand pairs. Copyright © 2014 Elsevier B.V. All rights reserved.

Enhanced piezo-humidity sensing of a Cd-ZnO nanowire nanogenerator as a self-powered/active gas sensor by coupling the piezoelectric screening effect and dopant displacement mechanism.

Science.gov (United States)

Yu, Binwei; Fu, Yongming; Wang, Penglei; Zhao, Yayu; Xing, Lili; Xue, Xinyu

2015-04-28

Highly sensitive humidity sensing has been realized from a Cd-doped ZnO nanowire (NW) nanogenerator (NG) as a self-powered/active gas sensor. The piezoelectric output of the device acts not only as a power source, but also as a response signal to the relative humidity (RH) in the environment. The response of Cd-ZnO (1 : 10) NWs reached up to 85.7 upon exposure to 70% relative humidity, much higher than that of undoped ZnO NWs. Cd dopant can increase the number of oxygen vacancies in the NWs, resulting in more adsorption sites on the surface of the NWs. Upon exposure to a humid environment, a large amount of water molecules can displace the adsorbed oxygen ions on the surface of Cd-ZnO NWs. This procedure can influence the carrier density in Cd-ZnO NWs and vary the screening effect on the piezoelectric output. Our study can stimulate a research trend on exploring composite materials for piezo-gas sensing.

Pitot-probe displacement in a supersonic turbulent boundary layer

Science.gov (United States)

Allen, J. M.

1972-01-01

Eight circular pitot probes ranging in size from 2 to 70 percent of the boundary-layer thickness were tested to provide experimental probe displacement results in a two-dimensional turbulent boundary layer at a nominal free-stream Mach number of 2 and unit Reynolds number of 8 million per meter. The displacement obtained in the study was larger than that reported by previous investigators in either an incompressible turbulent boundary layer or a supersonic laminar boundary layer. The large probes indicated distorted Mach number profiles, probably due to separation. When the probes were small enough to cause no appreciable distortion, the displacement was constant over most of the boundary layer. The displacement in the near-wall region decreased to negative displacement in some cases. This near-wall region was found to extend to about one probe diameter from the test surface.

Miscible fluid displacement: an answer to increasing oil recovery

Energy Technology Data Exchange (ETDEWEB)

Rodriguez, N R; Rivera, R J

1976-01-01

This study presents the state of the art on miscible and miscible-type processes. It is well known that when these processes are applied under ideal laboratory conditions, the oil recovery obtained from linear cores approaches 100% of the total oil contained in the porous structure which is contacted by the displacing fluids. In the past few years, a worldwide shortage of crude oil supplies produced an increased interest in new oil recovery methods. Because of this situation, the oil industry turned its eyes back toward the miscible processes. This study discusses the following miscible fluid displacement processes: (1) high-pressure dry gas displacement; (2) enriched gas displacement; (3) GLP slug flooding; and (4) carbon dioxide displacement. In addition to the processes aforementioned, this work presents the main features of the micellar solution flooding process. (17 refs.)

Histone displacement during nucleotide excision repair

DEFF Research Database (Denmark)

Dinant, C.; Bartek, J.; Bekker-Jensen, S.

2012-01-01

Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

Development of [18F]halofluorination and [18F]fluoride ion displacement reactions for the synthesis of F-18 labelled radiopharmaceuticals

International Nuclear Information System (INIS)

Chi, D.Y.

1986-01-01

Two fluorine-18 labeling methods, [ 18 F]halofluorination and [ 18 F]fluoride ion displacement reactions, have been developed to assess their potential for labeling molecules with the positron-emitting radionuclide fluorine-18 at the no-carrier-added level. Olefin halofluorination involves the in situ generation of a halogen-fluoride reagent and subsequent addition to an olefin. The characteristics of this reaction were investigated with three model olefins (allylbenzene, 1-hexene, and propene). A two-step method for the preparation of fluoroalkyl substituted amines and amides has been achieved. The sequence involves fluoride ion displacement of trifluoromethanesulfonates (triflates) from short-chain haloalkyl triflates, followed by fluoroalkylation of the amine or amide. Alternatively, short-chain fluoroalkyl halides can be prepared by halofluorination of a terminal olefin. These reactions have been used to prepare various fluoroalkyl derivatives of 1-phenylpiperazine and N-fluoroalkyl derivatives of the neuroleptic agent spiperone. A series of fluorine-18 labeled N-fluoroalkylated spiperone derivatives were synthesized by N-alkylation of spiperone with fluoroalkyl halides

Static loading and vertical displacement at southern Siberia

Directory of Open Access Journals (Sweden)

Anton V. Timofeev

2017-05-01

Full Text Available Seismic method is usually used for elastic parametric estimation. This is why this method presents dynamic parameters of Earth. Frequency seismic range changes greatly from geodynamic modelling time. Now we have opportunity to use geodesy result for some years for elastic parameters estimation. Static solution from elastic theory may be used for the interpretation of long term results. It presents static elastic parameter. The inverse problem for different types of vertical surface loading on one year period is calculated. Two cases of loading with maximal and minimal area are presented. Results are determined by space geodesy and leveling methods. Current relation between atmospheric pressure and vertical displacements was estimated at the center of Siberian Anti Cyclone with size varied from 2000 km to 3000 km. Pressure-displacement coefficients (PDC can be achieved by three years observation (0.997 mm/mbar for NVSK GPS station. It is used for elastic module study of geology medium with maximum thickness up to 600 km. In the context of elastic model, the modulus of rigidity is estimated to be 113 GPa. Vast expanse of anti-cyclone may relate with rheology of crust and upper mantle. Smaller size of surface loading – local loading is seasonal variation of water reservoir. Annual vertical changes were obtained by leveling near the dam of the reservoir. PDC ratio was 1.15 mm/bar for these places. In elastic theory, the Young modulus E = 80 GPa (Poisson ratio = 0.25, the modulus of rigidity = 32 GPa was calculated by sixteen years of leveling measurements. This result can effectively be represented for upper crust. Our results were checked by solution for coseismic displacement of Chyia-Altai earthquake (Sep. 27, 2003, M = 7.3. Coseismic results calculated by static modules agree with experimental coseismic GPS data at 10% level.

Video Games, Adolescents, and the Displacement Effect

Science.gov (United States)

Fisher, Carla Christine

2012-01-01

The displacement effect (the idea that time spent in one activity displaces time spent in other activities) was examined within the lens of adolescents' video game use and their time spent reading, doing homework, in physically active sports and activities, in creative play, and with parents and friends. Data were drawn from the Panel Study…

Method to separate and enrich molecules containing deuterium

International Nuclear Information System (INIS)

Benson, S.W.

1978-01-01

Organic molecules having a normal H and D content and the general formula RX, in which R is chosen from ethyl, isopropyl, tert. butyl or cyclopentenyl groups and X is a functional group such as F, Cl, Br or OH and can even be H in the special case of cyclopentene, are exposed to an infra-red laser radiation. By careful adjustment, bundling and pulsing of an infrared laser, D-contained RX molecules exposed to the laserbeam, can dissociate or decompose. A D-contained olefin and HX is formed under suitable conditions after exposure to laser radiation. The D-contained olefin is drawn off and combusted to obtain D-contained water or D-contained hydrogen. The non-decomposed or non-reacted RX molecules which are deuterium-impoverished can be decomposed to deuterium impoverished olefins and HX in a further process step by heating on a catalyst. The latter products can then be separated off and be catylytically exchanged with normal water in order to reproduce the normal isotopic composition. They may then where necessary be catalytically recombined to form normal RX which can be recycled. (GG) [de

Measuring displacement signal with an accelerometer

International Nuclear Information System (INIS)

Han, Sang Bo

2010-01-01

An effective and simple way to reconstruct displacement signal from a measured acceleration signal is proposed in this paper. To reconstruct displacement signal by means of double-integrating the time domain acceleration signal, the Nyquist frequency of the digital sampling of the acceleration signal should be much higher than the highest frequency component of the signal. On the other hand, to reconstruct displacement signal by taking the inverse Fourier transform, the magnitude of the significant frequency components of the Fourier transform of the acceleration signal should be greater than the 6 dB increment line along the frequency axis. With a predetermined resolution in time and frequency domain, determined by the sampling rate to measure and record the original signal, reconstructing high-frequency signals in the time domain and reconstructing low-frequency signals in the frequency domain will produce biased errors. Furthermore, because of the DC components inevitably included in the sampling process, low-frequency components of the signals are overestimated when displacement signals are reconstructed from the Fourier transform of the acceleration signal. The proposed method utilizes curve-fitting around the significant frequency components of the Fourier transform of the acceleration signal before it is inverse-Fourier transformed. Curve-fitting around the dominant frequency components provides much better results than simply ignoring the insignificant frequency components of the signal

Overhead Transmission Lines Deicing under Different Incentive Displacement

Directory of Open Access Journals (Sweden)

Qing He

2014-01-01

Full Text Available Overhead transmission line icing is one of the main factors affecting safety and reliability of power grid. This paper proposed an excitation deicing method of iced wire and theoretically revealed the ice removal mechanism under displacement excitation conditions, by taking the LGJ-70/10 glaze icing wire as the 3D model and analyzing and studying its dynamic response under the effect of displacement excitation. The simulation results show that the stress of wire icing area is enlarged with the increase of excitation displacement and frequency. Through the comparison of the compression strength experimental results on a series of different iced wires in low temperature environment, the authors found out that the stress generated from the wire icing area is greater than the crushing strength of the ice within the scope of the calculation parameters, which proved the validity and the feasibility of the method, and finally the suitable excitation displacement is determined. Following studies show that, as far as possible, it is necessary to reduce the incentive displacement and also to select the appropriate constraint length in order to avoid the line jumping that may be caused by large span ice shedding.

Particle displacement tracking for PIV

Science.gov (United States)

Wernet, Mark P.

1990-01-01

A new Particle Imaging Velocimetry (PIV) data acquisition and analysis system, which is an order of magnitude faster than any previously proposed system has been constructed and tested. The new Particle Displacement Tracing (PDT) system is an all electronic technique employing a video camera and a large memory buffer frame-grabber board. Using a simple encoding scheme, a time sequence of single exposure images are time coded into a single image and then processed to track particle displacements and determine velocity vectors. Application of the PDT technique to a counter-rotating vortex flow produced over 1100 velocity vectors in 110 seconds when processed on an 80386 PC.

Displacement of the posterior part of the eyeball in myopia

International Nuclear Information System (INIS)

Akizawa, Yasuko; Ida, Masahiro

2006-01-01

The principal aim of this study was to investigate displacement of the posterior part of the eyeball within the muscle cone in myopic eyes, particularly in moderately myopic subjects as well as in high myopes. Secondly, the correlation of the amount of displacement and the outer axial length of the globe was studied. The direction of displacement was also examined to clarify whether the eyeball tends to shift toward a certain direction. Seven patients with moderate myopia (moderate myopia group), fifteen patients with high myopia without esotropia (high myopia group), five patients with high myopia and esotropia (myopic esotropia group), and twenty-two controls (control group) were examined. Using magnetic resonance imaging, the outer axial length and the displacement of the posterior portion of the eyeball in the muscle cone were measured. In order to eliminate interindividual differences in the facial configuration, the coronal scanning was done perpendicularly to the orbital axis. The displacement was measured in a plane 4 mm anterior to the globe-optic nerve junction. The displacement was represented by the distance and direction of the globe center from the center of the muscle cone. In the moderate myopia group, there was no displacement of the posterior part of the eyeball in the muscle cone. It was the same as in the control group. But among the three groups, the displacement (mean±standard deviation) was significantly greater in the myopic esotropia group (1.53±0.49 mm) and the high myopia group (0.94±0.52 mm) than in the control group (0.11±0.18 mm) (one way ANOVA and multiple comparison). The outer axial length and the distance of the displacement in all cases was significantly correlated (r=0.87, p=0.01). Moreover, the posterior part of the eyeball of the myopic esotropia group and the high myopia group was displaced superiorly and temporally. The posterior part of the eyeball of myopic eyes was displaced superotemporally in the muscle cone

The Banality of Displacement: Turning a (ColourBlind Eye on the Ethnic Representation of the Internally Displaced in Colombia

Directory of Open Access Journals (Sweden)

Ulrich Oslender

2010-01-01

Full Text Available Colombia has one of the highest numbers of internally displaced persons, or IDPs, world-wide. Yet, there exists a conundrum. While latest NGO figures put the total number of IDPs since 1985 at 4 million, Colombian government figures show much lower estimates of 1.9 million. In fact, there are significant discrepancies in the ways how IDPs are identified, counted and categorised. Moreover, whereas it is now commonly argued that displacement has affected black populations proportionately higher than mestizo populations, no data exists to sustain such a view. The displaced population has simply not been accounted for in terms of its ethnic composition. In this article, drawing on Hannah Arendt’s work on terror and evil, I propose the notion of the “banality of displacement” to explain such a colour-blind approach in the discourses and representation of displacement in Colombia. I will refer in particular to the case of the Afro-Colombian population, drawing on fieldwork data collected since 1996, when I begun to work with the social movement of black communities in Colombia

Magnetic field modification of ultracold molecule-molecule collisions

International Nuclear Information System (INIS)

Tscherbul, T V; Suleimanov, Yu V; Aquilanti, V; Krems, R V

2009-01-01

We present an accurate quantum mechanical study of molecule-molecule collisions in the presence of a magnetic field. The work focuses on the analysis of elastic scattering and spin relaxation in collisions of O 2 ( 3 Σ g - ) molecules at cold (∼0.1 K) and ultracold (∼10 -6 K) temperatures. Our calculations show that magnetic spin relaxation in molecule-molecule collisions is extremely efficient except at magnetic fields below 1 mT. The rate constant for spin relaxation at T=0.1 K and a magnetic field of 0.1 T is found to be as large as 6.1x10 -11 cm -3 s -1 . The magnetic field dependence of elastic and inelastic scattering cross sections at ultracold temperatures is dominated by a manifold of Feshbach resonances with the density of ∼100 resonances per Tesla for collisions of molecules in the absolute ground state. This suggests that the scattering length of ultracold molecules in the absolute ground state can be effectively tuned in a very wide range of magnetic fields. Our calculations demonstrate that the number and properties of the magnetic Feshbach resonances are dramatically different for molecules in the absolute ground and excited spin states. The density of Feshbach resonances for molecule-molecule scattering in the low-field-seeking Zeeman state is reduced by a factor of 10.

Quantification of the vocal folds’ dynamic displacements

International Nuclear Information System (INIS)

Hernández-Montes, María del Socorro; Muñoz, Silvino; De La Torre, Manuel; Flores, Mauricio; Pérez, Carlos; Mendoza-Santoyo, Fernando

2016-01-01

Fast dynamic data acquisition techniques are required to investigate the motional behavior of the vocal folds (VFs) when they are subjected to a steady air-flow through the trachea. High-speed digital holographic interferometry (DHI) is a non-invasive full-field-of-view technique that has proved its usefulness to study rapid and non-repetitive object movements. Hence it is an ideal technique used here to measure VF displacements and vibration patterns at 2000 fps. Analyses from a set of 200 displacement images showed that VFs’ vibration cycles are established along their width (y) and length (x). Furthermore, the maximum deformation for the right and left VFs’ area may be quantified from these images, which in itself represents an important result in the characterization of this structure. At a controlled air pressure, VF displacements fall within the range ∼100–1740 nm, with a calculated precision and accuracy that yields a variation coefficient of 1.91%. High-speed acquisition of full-field images of VFs and their displacement quantification are on their own significant data in the study of their functional and physiological behavior since voice quality and production depend on how they vibrate, i.e. their displacement amplitude and frequency. Additionally, the use of high speed DHI avoids prolonged examinations and represents a significant scientific and technological alternative contribution in advancing the knowledge and working mechanisms of these tissues. (paper)

Pectins filled with LDH-antimicrobial molecules: preparation, characterization and physical properties.

Science.gov (United States)

Gorrasi, Giuliana; Bugatti, Valeria; Vittoria, Vittoria

2012-06-05

Nanohybrids of layered double hydroxide (LDH) with intercalated active molecules: benzoate, 2,4-dichlorobenzoate, para-hydroxybenzoate and ortho-hydroxybenzoate, were incorporated into pectins from apples through high energy ball milling in the presence of water. Cast films were obtained and analysed. X-ray diffraction analysis showed a complete destructuration of all nanohybrids in the pectin matrix. Thermogravimetric analysis showed a better thermal resistance of pectin in the presence of fillers, especially para-hydroxybenzoate and ortho-hydroxybenzoate. Mechanical properties showed an improvement of elastic modulus in particular for LDH-para-hydroxybenzoate nanohybrid, due probably to a better interaction between pectin matrix and nanohybrid layers. Barrier properties (sorption and diffusion) to water vapour showed improvement in the dependence on the intercalated active molecule, the best improvement was achieved for composites containing para-hydroxybenzoate molecules, suggesting that the interaction between the filler phase and the polymer plays an important role in sorption and diffusion phenomena. Incorporation of these active molecules gave antimicrobial properties to the composite films giving opportunities in the field of active packaging. Copyright © 2012 Elsevier Ltd. All rights reserved.

The effect of multi-component adsorption on selectivity in ion exchange displacement systems.

Science.gov (United States)

Tugcu, N; Cramer, S M

2005-01-21

This paper examines chemically selective displacement chromatography using affinity ranking plots, batch displacer screening experiments, column displacements, multi-component adsorption isotherms and spectroscopy. The affinity ranking plot indicated that the displacers, sucrose octasulfate (SOS) and tatrazine, should possess sufficient affinity to displace the proteins amyloglucosidase and apoferritin over a wide range of operating conditions. In addition, the plots indicated that the separation of these proteins by displacement chromatography would be extremely difficult. Further, the two proteins were shown to have very similar retention times under shallow linear gradient conditions. When batch displacement experiments were carried out, both tartrazine and SOS exhibited significant selectivity differences with respect to their ability to displace these two proteins, in contrast to the affinity ranking plot results. Column displacement experiments carried out with sucrose octasulfate agreed with the predictions of the affinity ranking plots, with both proteins being displaced but poorly resolved under several column displacement conditions. On the other hand, column displacement with tartrazine as the displacer resulted in the selective displacement and partial purification of apoferritin. Single- and multi-component isotherms of the proteins with or without the presence of displacers were determined and were used to help explain the selectivity reversals observed in the column and batch displacement experiments. In addition, fluorescence and CD spectra suggested that the displacers did not induce any structural changes to either of the proteins. The results in this paper indicate that multi-component adsorption behavior can be exploited for creating chemically selective displacement separations.

Earthquake damage to underground facilities and earthquake related displacement fields

International Nuclear Information System (INIS)

Pratt, H.R.; Stephenson, D.E.; Zandt, G.; Bouchon, M.; Hustrulid, W.A.

1982-01-01

The potential seismic risk for an underground facility is considered in the evaluation of its location and design. The possible damage resulting from either large-scale displacements or high accelerations should be considered in evaluating potential sites of underground facilities. Scattered through the available literature are statements to the effect that below a few hundred meters shaking and damage in mines is less than at the surface; however, data for decreased damage underground have not been completely reported or explained. In order to assess the seismic risk for an underground facility, a data base was established and analyzed to evaluate the potential for seismic disturbance. Substantial damage to underground facilities is usually the result of displacements primarily along pre-existing faults and fractures, or at the surface entrance to these facilities. Evidence of this comes from both earthquakes as a function of depth is important in the evaluation of the hazard to underground facilities. To evaluate potential displacements due to seismic effects of block motions along pre-existing or induced fractures, the displacement fields surrounding two types of faults were investigated. Analytical models were used to determine relative displacements of shafts and near-surface displacement of large rock masses. Numerical methods were used to determine the displacement fields associated with pure strike-slip and vertical normal faults. Results are presented as displacements for various fault lengths as a function of depth and distance. This provides input to determine potential displacements in terms of depth and distance for underground facilities, important for assessing potential sites and design parameters

Studying Landslide Displacements in Megamendung (Indonesia Using GPS Survey Method

Directory of Open Access Journals (Sweden)

Hasanuddin Z. Abidin

2004-11-01

Full Text Available Landslide is one of prominent geohazards that frequently affects Indonesia, especially in the rainy season. It destroys not only environment and property, but usually also causes deaths. Landslide monitoring is therefore very crucial and should be continuously done. One of the methods that can have a contribution in studying landslide phenomena is repeated GPS survey method. This paper presents and discusses the operational performances, constraints and results of GPS surveys conducted in a well known landslide prone area in West Java (Indonesia, namely Megamendung, the hilly region close to Bogor. Three GPS surveys involving 8 GPS points have been conducted, namely on April 2002, May 2003 and May 2004, respectively. The estimated landslide displacements in the area are relatively quite large in the level of a few dm to a few m. Displacements up to about 2-3 m were detected in the April 2002 to May 2003 period, and up to about 3-4 dm in the May 2003 to May 2004 period. In both periods, landslides in general show the northwest direction of displacements. Displacements vary both spatially and temporally. This study also suggested that in order to conclude the existence of real and significant displacements of GPS points, the GPS estimated displacements should be subjected to three types of testing namely: the congruency test on spatial displacements, testing on the agreement between the horizontal distance changes with the predicted direction of landslide displacement, and testing on the consistency of displacement directions on two consecutive periods.

Surface displacement imaging by interferometry with a light emitting diode

International Nuclear Information System (INIS)

Dilhaire, Stefan; Grauby, Stephane; Jorez, Sebastien; Lopez, Luis David Patino; Rampnoux, Jean-Michel; Claeys, Wilfrid

2002-01-01

We present an imaging technique to measure static surface displacements of electronic components. A device is supplied by a transient current that creates a variation of temperature, thus a surface displacement. To measure the latter, a setup that is based on a Michelson interferometer is used. To avoid the phenomenon of speckle and the drawbacks inherent to it, we use a light emitting diode as the light source for the interferometer. The detector is a visible CCD camera that analyzes the optical signal containing the information of surface displacement of the device. Combining images, we extract the amplitude of the surface displacement. Out-of-plane surface-displacement images of a thermoelectric device are presented

Marginal greenhouse gas emissions displacement of wind power in Great Britain

International Nuclear Information System (INIS)

Thomson, R. Camilla; Harrison, Gareth P.; Chick, John P.

2017-01-01

There is considerable uncertainty over the effect of wind power on the operation of power systems, and the consequent greenhouse gas (GHG) emissions displacement; this is used to project emissions reductions that inform energy policy. Currently, it is approximated as the average emissions of the whole system, despite an acknowledgement that wind will actually displace only the generators operating on the margin. This article presents a methodology to isolate the marginal emissions displacement of wind power from historical empirical data, taking into account the impact on the operating efficiency of coal and CCGT plants. For Great Britain over 2009–2014, it was found that marginal emissions displacement has generally been underestimated with, for example, the emissions displacement factor for wind being 21% higher than that the average emissions factor in 2010. The actual displacement depends upon the relative merit of coal and CCGT, with a greater discrepancy between marginal displacement and average emissions during more normal system operation, suggesting that policies to penalise high-carbon generation can increase the effectiveness of wind at reducing GHG emissions. Furthermore, it was also identified that wind power is almost as technically effective as demand-side reductions at decreasing GHG emissions from power generation. - Highlights: • Marginal emissions displacement was calculated from operational data for 2009–2014. • Existing estimates of emissions displacement are generally low. • Emissions displacement is a function of the relative merit of coal and CCGT plants. • Policies to penalise high-carbon generation should increase emissions displacement. • Wind almost as effective as demand-reduction at reducing emissions.

Water masses in the Humboldt Current System: Properties, distribution, and the nitrate deficit as a chemical water mass tracer for Equatorial Subsurface Water off Chile

Science.gov (United States)

Silva, Nelson; Rojas, Nora; Fedele, Aldo

2009-07-01

Three sections are used to analyze the physical and chemical characteristics of the water masses in the eastern South Pacific and their distributions. Oceanographic data were taken from the SCORPIO (May-June 1967), PIQUERO (May-June 1969), and KRILL (June 1974) cruises. Vertical sections of temperature, salinity, σ θ, dissolved oxygen, nitrate, nitrite, phosphate, and silicate were used to analyze the water column structure. Five water masses were identified in the zone through T- S diagrams: Subantarctic Water, Subtropical Water, Equatorial Subsurface Water, Antarctic Intermediate Water, and Pacific Deep Water. Their proportions in the sea water mixture are calculated using the mixing triangle method. Vertical sections were used to describe the geographical distributions of the water mass cores in the upper 1500 m. Several characteristic oceanographic features in the study area were analyzed: the shallow salinity minimum displacement towards the equator, the equatorial subsurface salinity maximum associated with a dissolved oxygen minimum zone and a high nutrient content displacement towards the south, and the equatorward intermediate Antarctic salinity minimum associated with a dissolved oxygen maximum. The nitrate deficit generated in the denitrification area off Peru and northern Chile is proposed as a conservative chemical tracer for the Equatorial Subsurface Waters off the coast of Chile, south of 25°S.

[The effect of spermine on acid-base equilibrium in DNA molecule].

Science.gov (United States)

Slonitskiĭ, S V; Kuptsov, V Iu

1990-01-01

The influence of spermine (Sp) on the acid-induced predenaturational and denaturational transitions in the DNA molecule structure has been studied by means of circular dichroism, spectrophotometric and viscometric titration at supporting electrolyte concentration 10 mM NaCl. The data available indicate that at [N]/[P] less than or equal to 0.60 (here [N] and [P] are molar concentrations of Sp nitrogen and DNA phosphours, respectively) the cooperative structural B----B(+)----S transitions are accompanied by the DNA double-helice winding. No competition for proton acceptor sites in the DNA molecule between H+ and Sp4+ cations has been observed when binding to neutral macromolecule. At 0.60 less than or equal to [N]/[P] less than or equal to 0.75 the displacement of the B----B(+)----S transitions midpoints to acidic pH region has been established. This is accompanied by DNA condensation and the appearance of differential scattering of circularly polarized light. The calculations carried out in the framework of the two-variable Manning theory have shown that the acid-induced reduction of the effective polyion charge density facilitates the Sp-induced DNA condensation. It has been shown that the acid-base equilibrium in the DNA molecule is determined by local [H+] in the 2-3 A hydrated monolayer of the macromolecule. An adequate estimation of [H+] can be obtained on the basis of the Poisson-Boltzman approach. The data obtained are consistent with recently proposed hypothesis of polyelectrolyte invariance of the acid-base equilibrium in the DNA molecule.

Carbonic anhydrase inhibitors. Comparison of chlorthalidone, indapamide, trichloromethiazide, and furosemide X-ray crystal structures in adducts with isozyme II, when several water molecules make the difference.

Science.gov (United States)

Temperini, Claudia; Cecchi, Alessandro; Scozzafava, Andrea; Supuran, Claudiu T

2009-02-01

Thiazide and high ceiling diuretics were recently shown to inhibit all mammalian isoforms of carbonic anhydrase (CA, EC 4.2.1.1) with a very different profile as compared to classical inhibitors, such as acetazolamide, methazolamide, and ethoxzolamide. Some of these structurally related compounds have a very different behavior against the widespread isozyme CA II, with chlorthalidone, trichloromethiazide, and furosemide being efficient inhibitors against CA II (K(I)s of 65-138 nM), whereas indapamide is a much weaker one (K(I) of 2520 nM). Furthermore, some of these diuretics are quite efficient (low nanomolar) inhibitors of other isoforms, for example, chlorthalidone against hCA VB, VII, IX, and XIII; indapamide against CA VII, IX, XII, and XIII, trichloromethiazide against CA VII and IX, and furosemide against CA I and XIV. Examining the four X-ray crystal structures of their CA II adducts, we observed several (2-3) active site water molecules interacting with the chlorthalidone, trichloromethiazide, and furosemide scaffolds which may be responsible for this important difference of activity. Indeed, indapamide bound to CA II has no interactions with active site water molecules. Chlorthalidone bound within the CA II active site is in an enolic (lactimic) tautomeric form, with the enolic OH also participating in two strong hydrogen bonds with Asn67 and a water molecule. The newly evidenced binding modes of these diuretics may be exploited for designing better CA II inhibitors as well as compounds with selectivity/affinity for various isoforms with medicinal chemistry applications.

Possible heterogeneity of centres of binding 1,8-ANS in molecules of oxygenated hemoglobin

International Nuclear Information System (INIS)

Parul', D.A.; Bokut', S.B.; Milyutin, A.A.; Petrov, E.P.; Nemkovich, N.A.; Sobchuk, A.N.; Dzhagarov, B.M.

1999-01-01

Forming of oxygenated hemoglobin is one of effects of ionizing radiation action on organism. It was revealed heterogeneity of centers of binding of 1,8-ANS in intact molecule of oxygenated hemoglobin. Two types of binding centers possible reflect the existence of two regions in protein molecule with different accessibility to molecules of water

Lateral displacement and pile instability due to soil liquefaction using numerical model

Directory of Open Access Journals (Sweden)

Abdel-Salam Ahmed Mokhtar

2014-12-01

Extensive studies were performed to investigate the effects of soil submergence, pile diameter, earthquake magnitude and duration on pile lateral deformation and developed bending moment along pile shaft. Study results show that earthquake magnitude and time duration have a particular effect on the pore water pressure generation and hence pile lateral deformation and bending moments. They also show the benefits of using relatively large piles to control the lateral displacement. Recommendations are presented for designers to perform comprehensive analysis and avoid buckling and plastic hinge failures.

Single molecule microscopy and spectroscopy: concluding remarks.

Science.gov (United States)

van Hulst, Niek F

2015-01-01

Chemistry is all about molecules: control, synthesis, interaction and reaction of molecules. All too easily on a blackboard, one draws molecules, their structures and dynamics, to create an insightful picture. The dream is to see these molecules in reality. This is exactly what "Single Molecule Detection" provides: a look at molecules in action at ambient conditions; a breakthrough technology in chemistry, physics and biology. Within the realms of the Royal Society of Chemistry, the Faraday Discussion on "Single Molecule Microscopy and Spectroscopy" was a very appropriate topic for presentation, deliberation and debate. Undoubtedly, the Faraday Discussions have a splendid reputation in stimulating scientific debates along the traditions set by Michael Faraday. Interestingly, back in the 1830's, Faraday himself pursued an experiment that led to the idea that atoms in a compound were joined by an electrical component. He placed two opposite electrodes in a solution of water containing a dissolved compound, and observed that one of the elements of the compound accumulated on one electrode, while the other was deposited on the opposite electrode. Although Faraday was deeply opposed to atomism, he had to recognize that electrical forces were responsible for the joining of atoms. Probably a direct view on the atoms or molecules in his experiment would have convinced him. As such, Michael Faraday might have liked the gathering at Burlington House in September 2015 (). Surely, with the questioning eyes of his bust on the 1st floor corridor, the non-believer Michael Faraday has incited each passer-by to enter into discussion and search for deeper answers at the level of single molecules. In these concluding remarks, highlights of the presented papers and discussions are summarized, complemented by a conclusion on future perspectives.

Radiation displacement damage estimates for a radionuclide waste stabilization material

International Nuclear Information System (INIS)

Dolan, K.W.

1977-01-01

Estimates of the number of atomic displacements produced in pollucite by the radioactive decay of Cs-134 are made. Pollucite is a candidate material for radionuclide waste stabilization, while Cs-134 is one of the radionuclide products which would be chemically bound in the pollucite lattice. At the maximum concentration of Cs-134 in pollucite, assuming a threshold displacement energy of 15.0 eV, the displacement rate is estimated to be 4.3 x 10 12 atoms/cm 3 /second which includes all atomic species in the pollucite lattice. It was found that most of the displacements, 85 percent, were caused by elastic scattering of photoelectrons and Compton electrons which are products of γ-ray interactions in the material. Most of the remaining displacements are caused by elastic scattering of β-particles. Recoil energies of the Ba daughter product are insufficient to cause displacement. Atomic displacements of nearest neighbors, atoms within one lattice spacing of the decay site, are estimated to be 2.7 x 10 6 atoms/cm 3 /second. These estimates provide a starting point for assessing the long term stability of pollucite to radiation damage

[Management of disk displacement with condylar fracture].

Science.gov (United States)

Yu, Shi-bin; Li, Zu-bing; Yang, Xue-wen; Zhao, Ji-hong; Dong, Yao-jun

2003-07-01

To investigate clinical features of disk displacement during the course of condylar fracture and to explore the techniques of disk reposition and suturation. 32 patients (10 females and 22 males) who had disk displacements with condylar fractures were followed up. Reduction and reposition of the dislocated disks simultaneously with fixation of fractures were performed. 7 patients underwent intermaxillary fixation with elastic bands for 1 to 2 weeks. The occlusions were satisfactory in all cases but one for the reason of ramus height loss. No TMJ symptom was found when examined 3 months post operation. Anterior disk displacements were most occurred with high condylar process fractures. Surgical reposition and suturation of disk play an important role for the later TMJ-function.

Monitoring of pipe displacements in French LMFBR SUPERPHENIX

International Nuclear Information System (INIS)

Foucher, N.; Debaene, J.P.; Renault, Y.; Blin, B.

1993-01-01

In order to check that pipe supports work properly and that the locking of snubbers or the loss of supports do not put a pipe in unacceptable loading conditions, a monitoring of the behaviour of the main pipes of SUPERPHENIX is planned. This monitoring system consists in measuring the displacements at selected points of the pipe by means of measuring rods and checking that these displacements remain inside allowable domains. These allowable domains are defined so that, if the displacements of the pipe are inside all these domains, the plant operator is sure that the stresses verify the allowable limits and then no additional inspection is carried out. In the opposite case, the operator will inspect the pipe in detail in order to determine the consequences and repair if necessary before restarting. Selection of points for monitoring was done with the to minimize the number of measures to be carried out and to use as far as possible the measuring rods that were installed to check that pipe displacements were consistent with what has been obtained in design calculations. However, it appears necessary to ensure that any incident occurring at any point of the pipe can be detected and, if necessary, additional measuring rods may be installed. An incident is said detectable if it induces on at least one measuring rod a deviation with respect to expected displacement not lower than 5 mm. It has been chosen so that small normal changes in measured displacements are not mistaken as incidents. The incidents that are supposed likely to occur are: 1) loss of a support which induces mainly primary stresses, 2) locking of a snubber which induces mainly secondary stresses. Monitoring of pipe displacements is a simple and effective way of checking that no damaging perturbation has occurred on the pipe. Calculations carried out on the DHR loops of SUPERPHENIX show that allowable domains of acceptable size may be obtained using a relatively small number of measuring rods. The method

Dielectric properties of water in Triton X-100 (nonionic detergent)-water mixtures

International Nuclear Information System (INIS)

Asami, Koji

2007-01-01

Dielectric measurements were carried out for mixtures of Triton X-100 (TX, a nonionic detergent with a poly(ethylene oxide) chain) and water with or without electrolytes over a frequency range of 1 MHz to 10 GHz to study the structure and dynamics of water molecules in the mixtures. Dielectric relaxation was found above 100 MHz, being assigned to the dielectric relaxation of water. The intensity of the dielectric relaxation was proportional to the water content above 0 deg. C. Below the freezing temperature of bulk water, the relaxation intensity decreased at TX concentrations (C TX ) below 50 wt% at -10 deg. Cand below 60 wt% at -20 deg. Cbecause frozen water shifts the dielectric relaxation to a frequency region far below 1 MHz. This indicated that there is no bulk water at C TX above 50 wt% and that at least two water molecules per ethylene oxide (EO) unit are tightly associated with the ethylene oxide chain. The low-frequency conductivity of the mixtures of TX and electrolyte solutions was well represented by Bruggeman's mixture equation at C TX below 40 wt%, if two water molecules per EO unit form an insulating shell surrounding TX micelles

Cold guided beams of polar molecules

International Nuclear Information System (INIS)

Motsch, Michael

2010-01-01

This thesis reports on experiments characterizing cold guided beams of polar molecules which are produced by electrostatic velocity filtering. This filtering method exploits the interaction between the polar molecules and the electric field provided by an electrostatic quadrupole guide to extract efficiently the slow molecules from a thermal reservoir. For molecules with large and linear Stark shifts such as deuterated ammonia (ND 3 ) or formaldehyde (H 2 CO), fluxes of guided molecules of 10 10 -10 11 molecules/s are produced. The velocities of the molecules in these beams are in the range of 10-200 m/s and correspond to typical translational temperatures of a few Kelvin. The maximum velocity of the guided molecules depends on the Stark shift, the molecular mass, the geometry of the guide, and the applied electrode voltage. Although the source is operated in the near-effusive regime, the number density of the slowest molecules is sensitive to collisions. A theoretical model, taking into account this velocity-dependent collisional loss of molecules in the vicinity of the nozzle, reproduces the density of the guided molecules over a wide pressure range. A careful adjustment of pressure allows an increase in the total number of molecules, whilst yet minimizing losses due to collisions of the sought-for slow molecules. This is an important issue for future applications. Electrostatic velocity filtering is suited for different molecular species. This is demonstrated by producing cold guided beams of the water isotopologs H 2 O, D 2 O, and HDO. Although these are chemically similar, they show linear and quadratic Stark shifts, respectively, when exposed to external electric fields. As a result, the flux of HDO is larger by one order of magnitude, and the flux of the individual isotopologs shows a characteristic dependence on the guiding electric field. The internal-state distribution of guided molecules is studied with a newly developed diagnostic method: depletion