WorldWideScience

Sample records for displace water molecules

  1. Water displacement mercury pump

    Nielsen, M.G.

    1984-04-20

    A water displacement mercury pump has a fluid inlet conduit and diffuser, a valve, a pressure cannister, and a fluid outlet conduit. The valve has a valve head which seats in an opening in the cannister. The entire assembly is readily insertable into a process vessel which produces mercury as a product. As the mercury settles, it flows into the opening in the cannister displacing lighter material. When the valve is in a closed position, the pressure cannister is sealed except for the fluid inlet conduit and the fluid outlet conduit. Introduction of a lighter fluid into the cannister will act to displace a heavier fluid from the cannister via the fluid outlet conduit. The entire pump assembly penetrates only a top wall of the process vessel, and not the sides or the bottom wall of the process vessel. This insures a leak-proof environment and is especially suitable for processing of hazardous materials.

  2. Rapid and accurate prediction and scoring of water molecules in protein binding sites.

    Gregory A Ross

    Full Text Available Water plays a critical role in ligand-protein interactions. However, it is still challenging to predict accurately not only where water molecules prefer to bind, but also which of those water molecules might be displaceable. The latter is often seen as a route to optimizing affinity of potential drug candidates. Using a protocol we call WaterDock, we show that the freely available AutoDock Vina tool can be used to predict accurately the binding sites of water molecules. WaterDock was validated using data from X-ray crystallography, neutron diffraction and molecular dynamics simulations and correctly predicted 97% of the water molecules in the test set. In addition, we combined data-mining, heuristic and machine learning techniques to develop probabilistic water molecule classifiers. When applied to WaterDock predictions in the Astex Diverse Set of protein ligand complexes, we could identify whether a water molecule was conserved or displaced to an accuracy of 75%. A second model predicted whether water molecules were displaced by polar groups or by non-polar groups to an accuracy of 80%. These results should prove useful for anyone wishing to undertake rational design of new compounds where the displacement of water molecules is being considered as a route to improved affinity.

  3. Sub-ensemble monitoring of DNA strand displacement using multiparameter single-molecule FRET

    Baltierra Jasso, Laura; Morten, Michael; Magennis, Steven William

    2018-01-01

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constan...

  4. Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

    Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

    2018-03-05

    Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Conserved water molecules in bacterial serine hydroxymethyltransferases.

    Milano, Teresa; Di Salvo, Martino Luigi; Angelaccio, Sebastiana; Pascarella, Stefano

    2015-10-01

    Water molecules occurring in the interior of protein structures often are endowed with key structural and functional roles. We report the results of a systematic analysis of conserved water molecules in bacterial serine hydroxymethyltransferases (SHMTs). SHMTs are an important group of pyridoxal-5'-phosphate-dependent enzymes that catalyze the reversible conversion of l-serine and tetrahydropteroylglutamate to glycine and 5,10-methylenetetrahydropteroylglutamate. The approach utilized in this study relies on two programs, ProACT2 and WatCH. The first software is able to categorize water molecules in a protein crystallographic structure as buried, positioned in clefts or at the surface. The other program finds, in a set of superposed homologous proteins, water molecules that occur approximately in equivalent position in each of the considered structures. These groups of molecules are referred to as 'clusters' and represent structurally conserved water molecules. Several conserved clusters of buried or cleft water molecules were found in the set of 11 bacterial SHMTs we took into account for this work. The majority of these clusters were not described previously. Possible structural and functional roles for the conserved water molecules are envisaged. This work provides a map of the conserved water molecules helpful for deciphering SHMT mechanism and for rational design of molecular engineering experiments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  6. Molecular dynamics study of water molecule diffusion in oil-paper insulation materials

    Liao Ruijin; Zhu Mengzhao; Yang Lijun; Zhou Xin; Gong Chunyan

    2011-01-01

    Moisture is an important factor that influences the safe operation of transformers. In this study, molecular dynamics was employed to investigate the diffusion behavior of water molecules in the oil-paper insulation materials of transformers. Two oil-cellulose models were built. In the first model, water molecules were initially distributed in oil, and in the second model, water molecules were distributed in cellulose. The non-bonding energies of interaction between water molecules and oil, and between water molecules and cellulose, were calculated by the Dreiding force field. The interaction energy was found to play a dominant role in influencing the equilibrium distribution of water molecules. The radial direction functions of water molecules toward oil and cellulose indicate that the hydrogen bonds between water molecules and cellulose are sufficiently strong to withstand the operating temperature of the transformer. Mean-square displacement analysis of water molecules diffusion suggests that water molecules initially distributed in oil showed anisotropic diffusion; they tended to diffuse toward cellulose. Water molecules initially distributed in cellulose diffused isotropically. This study provides a theoretical contribution for improvements in online monitoring of water in transformers, and for subsequent research on new insulation materials.

  7. Molecular dynamics study of water molecule diffusion in oil-paper insulation materials

    Liao Ruijin [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Zhu Mengzhao, E-mail: xiaozhupost@163.co [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China); Yang Lijun; Zhou Xin; Gong Chunyan [State Key Laboratory of Power Transmission Equipment and System Security and New Technology, Chongqing University, Chongqing 400044 (China)

    2011-03-01

    Moisture is an important factor that influences the safe operation of transformers. In this study, molecular dynamics was employed to investigate the diffusion behavior of water molecules in the oil-paper insulation materials of transformers. Two oil-cellulose models were built. In the first model, water molecules were initially distributed in oil, and in the second model, water molecules were distributed in cellulose. The non-bonding energies of interaction between water molecules and oil, and between water molecules and cellulose, were calculated by the Dreiding force field. The interaction energy was found to play a dominant role in influencing the equilibrium distribution of water molecules. The radial direction functions of water molecules toward oil and cellulose indicate that the hydrogen bonds between water molecules and cellulose are sufficiently strong to withstand the operating temperature of the transformer. Mean-square displacement analysis of water molecules diffusion suggests that water molecules initially distributed in oil showed anisotropic diffusion; they tended to diffuse toward cellulose. Water molecules initially distributed in cellulose diffused isotropically. This study provides a theoretical contribution for improvements in online monitoring of water in transformers, and for subsequent research on new insulation materials.

  8. Formation of intercalation compound of kaolinite-glycine via displacing guest water by glycine.

    Zheng, Wan; Zhou, Jing; Zhang, Zhenqian; Chen, Likun; Zhang, Zhongfei; Li, Yong; Ma, Ning; Du, Piyi

    2014-10-15

    The kaolinite-glycine intercalation compound was successfully formed by displacing intercalated guest water molecules in kaolinite hydrate as a precursor. The microstructure of the compound was characterized by X-ray diffraction, Fourier Transform Infrared Spectroscopy and Scanning Electron Microscope. Results show that glycine can only be intercalated into hydrated kaolinite to form glycine-kaolinite by utilizing water molecules as a transition phase. The intercalated glycine molecules were squeezed partially into the ditrigonal holes in the silicate layer, resulting in the interlayer distance of kaolinite reaching 1.03nm. The proper intercalation temperature range was between 20°C and 80°C. An intercalation time of 24h or above was necessary to ensure the complete formation of kaolinite-glycine. The highest intercalation degree of about 84% appeared when the system was reacted at the temperature of 80°C for 48h. There were two activation energies for the intercalation of glycine into kaolinite, one being 21kJ/mol within the temperature range of 20-65°C and the other 5.8kJ/mol between 65°C and 80°C. The intercalation degree (N) and intercalation velocity (v) of as a function of intercalation time (t) can be empirically expressed as N=-79.35e(-)(t)(/14.8)+80.1 and v=5.37e(-)(t)(/14.8), respectively. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Autodissociation of a water molecule in liquid water

    Geissler, Phillip L.; Dellago, Christoph; Chandler, David; Hutter, Jurg; Parrinello, Michele

    2000-04-01

    The dissociation of a water molecule in liquid water is the fundamental event in acid-base chemistry, determining the pH of water.Because the microscopic dynamics of this autodissociation are difficult to probe, both by experiment and by computer simulation, its mechanism has been unknown. Here we report several autodissociation trajectories generated by ab initio molecular dynamics [1]. These trajectories, which were harvested using transition path sampling [2-4], reveal the mechanism for the first time. Rare fluctuations in solvation energies destabilize an oxygen-hydrogen bond. Through the transfer of one or more protons along a hydrogen bond.

  10. Slow neutron scattering by water molecules

    Stancic, V [Boris Kidric Institute of Nuclear Sciences Vinca, Beograd (Yugoslavia)

    1970-07-01

    In this work some new, preliminary formulae for slow neutron scattering cross section calculation by heavy and light water molecules have been done. The idea was to find, from the sum which exists in well known Nelkin model, other cross sections in a more simple analytical form, so that next approximations may be possible. In order to sum a series it was starting from Euler-Mclaurin formula. Some new summation formulae have been derived there, and defined in two theorems. Extensive calculations, especially during the evaluation of residues, have been made at the CDC 3600 computer. validation of derived formulae was done by comparison with the BNL-325 results. Good agreement is shown. (author)

  11. Slow neutron scattering by water molecules

    Stancic, V.

    1970-01-01

    In this work some new, preliminary formulae for slow neutron scattering cross section calculation by heavy and light water molecules have been done. The idea was to find, from the sum which exists in well known Nelkin model, other cross sections in a more simple analytical form, so that next approximations may be possible. In order to sum a series it was starting from Euler-Mclaurin formula. Some new summation formulae have been derived there, and defined in two theorems. Extensive calculations, especially during the evaluation of residues, have been made at the CDC 3600 computer. validation of derived formulae was done by comparison with the BNL-325 results. Good agreement is shown. (author)

  12. In-gel multiple displacement amplification of long DNA fragments diluted to the single molecule level.

    Michikawa, Yuichi; Sugahara, Keisuke; Suga, Tomo; Ohtsuka, Yoshimi; Ishikawa, Kenichi; Ishikawa, Atsuko; Shiomi, Naoko; Shiomi, Tadahiro; Iwakawa, Mayumi; Imai, Takashi

    2008-12-15

    The isolation and multiple genotyping of long individual DNA fragments are needed to obtain haplotype information for diploid organisms. Limiting dilution of sample DNA followed by multiple displacement amplification is a useful technique but is restricted to short (reaction (PCR)-ready form. The haplotypes of seven SNPs spanning 240 kb of the DNA surrounding the human ATM gene region on chromosome 11 were determined for 10 individuals, demonstrating the feasibility of this new method.

  13. Oil/water displacement in microfluidic packed beds under weakly water-wetting conditions: competition between precursor film flow and piston-like displacement

    Tanino, Yukie; Zacarias-Hernandez, Xanat; Christensen, Magali

    2018-02-01

    Optical microscopy was used to measure depth-averaged oil distribution in a quasi-monolayer of crushed marble packed in a microfluidic channel as it was displaced by water. By calibrating the transmitted light intensity to oil thickness, we account for depth variation in the fluid distribution. Experiments reveal that oil saturation at water breakthrough decreases with increasing Darcy velocity, U_{ {w}}, between capillary numbers {Ca} = μ _{ {w}} U_{ {w}}/σ = 9× 10^{-7} and 9× 10^{-6}, where μ _{ {w}} is the dynamic viscosity of water and σ is the oil/water interfacial tension, under the conditions considered presently. In contrast, end-point (long-time) remaining oil saturation depends only weakly on U_{ {w}}. This transient dependence on velocity is attributed to the competition between precursor film flow, which controls early time invasion dynamics but is inefficient at displacing oil, and piston-like displacement, which controls ultimate oil recovery. These results demonstrate that microfluidic experiments using translucent grains and fluids are a convenient tool for quantitative investigation of sub-resolution liquid/liquid displacement in porous media.

  14. Comparison of total body water determinations in lactating women by anthropometry, water displacement, and deuterium isotope dilution

    Wong, W.; Butte, N.; Lee, L.; Garza, C.; Klein, P.

    1986-01-01

    To expand the limited data on the total body water in lactating women, the authors have determined total body water contents, in eight subjects from anthropometric measurements, water displacement, and isotope dilution of deuterium oxide. On the day of the study, their skinfold thicknesses were measured over the biceps and triceps muscles and at the suprailiac and subscapular areas. Their body densities were measured by water displacement. Deuterium oxide was administered orally at 100 mg/kg of body weight. One predose milk sample was collected from each subject. The milk samples were defatted by centrifugation and the milk water was reduced to hydrogen gas for hydrogen isotope ratio measurements by gas-isotope-ratio mass spectrometry. The results indicated that total body water in lactating women estimated from anthropometric measurements was 49.7 +/- 3.3% of body weight, by water displacement was 54.9 +/- 7.2%, and by isotope dilution was 50.8 +/- 3.7%

  15. On the Several Molecules and Nanostructures of Water

    Cynthia Kolb Whitney

    2012-01-01

    Full Text Available This paper investigates the water molecule from a variety of viewpoints. Water can involve different isotopes of Hydrogen and Oxygen, it can form differently shaped isomer molecules, and, when frozen, it occupies space differently than most other substances do. The tool for conducting the investigation of all this is called ‘Algebraic Chemistry’. This tool is a quantitative model for predicting the energy budget for all sorts of changes between different ionization states of atoms that are involved in chemical reactions and in changes of physical state. The model is based on consistent patterns seen in empirical data about ionization potentials, together with rational scaling laws that can interpolate and extrapolate for situations where no data are available. The results of the investigation of the water molecule include comments, both positive and negative, about technologies involving heavy water, poly water, Brown’s gas, and cold fusion.

  16. Quantum Behavior of Water Molecules Confined to Nanocavities in Gemstones.

    Gorshunov, Boris P; Zhukova, Elena S; Torgashev, Victor I; Lebedev, Vladimir V; Shakurov, Gil'man S; Kremer, Reinhard K; Pestrjakov, Efim V; Thomas, Victor G; Fursenko, Dimitry A; Dressel, Martin

    2013-06-20

    When water is confined to nanocavities, its quantum mechanical behavior can be revealed by terahertz spectroscopy. We place H2O molecules in the nanopores of a beryl crystal lattice and observe a rich and highly anisotropic set of absorption lines in the terahertz spectral range. Two bands can be identified, which originate from translational and librational motions of the water molecule isolated within the cage; they correspond to the analogous broad bands in liquid water and ice. In the present case of well-defined and highly symmetric nanocavities, the observed fine structure can be explained by macroscopic tunneling of the H2O molecules within a six-fold potential caused by the interaction of the molecule with the cavity walls.

  17. Experimental research on microscopic displacement mechanism of CO2-water alternative flooding in low permeability reservoir

    Han, Hongyan; Zhu, Weiyao; Long, Yunqian; Song, Hongqing; Huang, Kun

    2018-02-01

    This paper provides an experimental method to deal with the problems of low oil recovery ratio faced with water flooding utilizing the CO2/water alternate displacement technology. A series of CO2/water alternate flooding experiments were carried out under 60°C and 18.4MPa using high temperature / pressure microscopic visualization simulation system. Then, we used the image processing technique and software to analyze the proportion of remaining oil in the displacement process. The results show that CO2 can extract the lighter chemical components in the crude oil and make it easier to form miscible phase, which can reduce the viscosity and favorable mobility ratio of oil. What’s more, the displacement reduces the impact of gas channeling, which can achieve an enlarged sweeping efficiency to improve filtration ability. In addition, the CO2 dissolved in oil and water can greatly reduce the interfacial tension, which can increase the oil displacement efficiency in a large extent. Generally speaking, the recovery rate of residual oil in the micro - model can be elevated up to 15.89% ∼ 16.48% under formation condition by alternate displacement.

  18. Towards ligand docking including explicit interface water molecules.

    Gordon Lemmon

    Full Text Available Small molecule docking predicts the interaction of a small molecule ligand with a protein at atomic-detail accuracy including position and conformation the ligand but also conformational changes of the protein upon ligand binding. While successful in the majority of cases, docking algorithms including RosettaLigand fail in some cases to predict the correct protein/ligand complex structure. In this study we show that simultaneous docking of explicit interface water molecules greatly improves Rosetta's ability to distinguish correct from incorrect ligand poses. This result holds true for both protein-centric water docking wherein waters are located relative to the protein binding site and ligand-centric water docking wherein waters move with the ligand during docking. Protein-centric docking is used to model 99 HIV-1 protease/protease inhibitor structures. We find protease inhibitor placement improving at a ratio of 9:1 when one critical interface water molecule is included in the docking simulation. Ligand-centric docking is applied to 341 structures from the CSAR benchmark of diverse protein/ligand complexes [1]. Across this diverse dataset we see up to 56% recovery of failed docking studies, when waters are included in the docking simulation.

  19. Transport behavior of water molecules through two-dimensional nanopores

    Zhu, Chongqin; Li, Hui; Meng, Sheng

    2014-01-01

    Water transport through a two-dimensional nanoporous membrane has attracted increasing attention in recent years thanks to great demands in water purification and desalination applications. However, few studies have been reported on the microscopic mechanisms of water transport through structured nanopores, especially at the atomistic scale. Here we investigate the microstructure of water flow through two-dimensional model graphene membrane containing a variety of nanopores of different size by using molecular dynamics simulations. Our results clearly indicate that the continuum flow transits to discrete molecular flow patterns with decreasing pore sizes. While for pores with a diameter ≥15 Å water flux exhibits a linear dependence on the pore area, a nonlinear relationship between water flux and pore area has been identified for smaller pores. We attribute this deviation from linear behavior to the presence of discrete water flow, which is strongly influenced by the water-membrane interaction and hydrogen bonding between water molecules

  20. Structures of water molecules in carbon nanotubes under electric fields

    Winarto,; Takaiwa, Daisuke; Yamamoto, Eiji; Yasuoka, Kenji

    2015-01-01

    Carbon nanotubes (CNTs) are promising for water transport through membranes and for use as nano-pumps. The development of CNT-based nanofluidic devices, however, requires a better understanding of the properties of water molecules in CNTs because they can be very different from those in the bulk. Using all-atom molecular dynamics simulations, we investigate the effect of axial electric fields on the structure of water molecules in CNTs having diameters ranging from (7,7) to (10,10). The water dipole moments were aligned parallel to the electric field, which increases the density of water inside the CNTs and forms ordered ice-like structures. The electric field induces the transition from liquid to ice nanotubes in a wide range of CNT diameters. Moreover, we found an increase in the lifetime of hydrogen bonds for water structures in the CNTs. Fast librational motion breaks some hydrogen bonds, but the molecular pairs do not separate and the hydrogen bonds reform. Thus, hydrogen bonds maintain the water structure in the CNTs, and the water molecules move collectively, decreasing the axial diffusion coefficient and permeation rate

  1. The role of water molecules in computational drug design.

    de Beer, Stephanie B A; Vermeulen, Nico P E; Oostenbrink, Chris

    2010-01-01

    Although water molecules are small and only consist of two different atom types, they play various roles in cellular systems. This review discusses their influence on the binding process between biomacromolecular targets and small molecule ligands and how this influence can be modeled in computational drug design approaches. Both the structure and the thermodynamics of active site waters will be discussed as these influence the binding process significantly. Structurally conserved waters cannot always be determined experimentally and if observed, it is not clear if they will be replaced upon ligand binding, even if sufficient space is available. Methods to predict the presence of water in protein-ligand complexes will be reviewed. Subsequently, we will discuss methods to include water in computational drug research. Either as an additional factor in automated docking experiments, or explicitly in detailed molecular dynamics simulations, the effect of water on the quality of the simulations is significant, but not easily predicted. The most detailed calculations involve estimates of the free energy contribution of water molecules to protein-ligand complexes. These calculations are computationally demanding, but give insight in the versatility and importance of water in ligand binding.

  2. Water-assisted dehalogenation of thionyl chloride in the presence of water molecules.

    Yeung, Chi Shun; Ng, Ping Leung; Guan, Xiangguo; Phillips, David Lee

    2010-04-01

    A second-order Møller-Plesset perturbation theory (MP2) and density functional theory (DFT) investigation of the dehalogenation reactions of thionyl chloride is reported, in which water molecules (up to seven) were explicitly involved in the reaction complex. The dehalogenation processes of thionyl chloride were found to be dramatically catalyzed by water molecules. The reaction rate became significantly faster as more water molecules became involved in the reaction complex. The dehalogenation processes can be reasonably simulated by the gas-phase water cluster models, which reveals that water molecules can help to solvate the thionyl chloride molecules and activate the release of the Cl(-) leaving group. The computed activation energies were used to compare the calculations to available experimental data.

  3. Vibrational properties of water molecules adsorbed in different zeolitic frameworks

    Crupi, V; Longo, F; Majolino, D; Venuti, V

    2006-01-01

    The perturbation of water 'sorbed' in samples of zeolites of different structural type, genesis, and cation composition (K-, Na-, Mg- and Ca-rich zeolites), namely the CHA framework of a synthetic K-chabazite, the LTA framework of synthetic Na-A and Mg50-A zeolites, and the NAT framework of a natural scolecite, has been studied by FTIR-ATR spectroscopy, in the -10 to +80 o C temperature range. The aim was to show how differences in the chemical composition and/or in the topology of the zeolite framework and, in particular, the possibility for the guest water molecules to develop guest-guest and/or host-guest interactions, lead to substantial differences in their vibrational dynamical properties. The spectra, collected in the O-H stretching and H 2 O bending mode regions, are complex, with multiple bands being observed. As far as water in the CHA and LTA frameworks is concerned, whose behaviour is governed by the balance of water-water, water-framework and water-extra-framework cations interactions, the assignment of the resolved components of the O-H stretching band has been discussed by fitting the band shapes into individual components attributed to H 2 O molecules engaged in different degrees of hydrogen bonding. A detailed quantitative picture of the connectivity pattern of water, as a function of temperature and according to the chemical and topological properties of the environment, is furnished. The H 2 O bending vibrational bands give additional information that perfectly agrees with the results obtained from the analysis of the O-H stretching spectral region. In the case of scolecite, a small-pored zeolite where water-water interactions are eliminated, the increased complexity observed in the infrared spectra in the O-H stretching and H 2 O bending regions was explained as due to the hydrogen bonding between the water molecules and the network, and also with the extra-framework cation. Furthermore, these observations have been correlated with the different

  4. Constant load and constant displacement stress corrosion in simulated water reactor environments

    Lloyd, G.J.

    1987-02-01

    The stress corrosion behaviour of selected water reactor constructional materials, as determined by constant load or constant displacement test techniques, is reviewed. Experimental results obtained using a very wide range of conditions have been collected in a form for easy reference. A discussion is given of some apparent trends in these data. The possible reasons for these trends are considered together with a discussion of how the observed discrepancies may be resolved. (author)

  5. Photoionization of water molecules by high energy photons

    Lara Martini

    2017-07-01

    Full Text Available We theoretically study the photoionization of water molecules by high energy photon impact. We develop a model in which the final state wavefunction is given by a Coulomb continuum wavefunction with effective charges and the water molecule bound states are represented using the Moccia's monocentric wavefunctions. We obtain analytical expressions for the transition matrix element that enable the computation of cross sections by numerical quadratures. We compare our predictions for photon energies between 20 and 300 eV with more elaborated theoretical results and experiments. We obtain a very good agreement with experiments, in particular, at enough high energies where there is a lack of elaborated results due to their high computational cost. Received: 15 March 2017, Accepted: 25 June 2017; Edited by: S. Kais; DOI: http://dx.doi.org/10.4279/PIP.090006 Cite as: L Martini, D I R Boll, O A Fojón, Papers in Physics 9, 090006 (2017

  6. Scattering of thermal neutron by the water molecule

    Rosa, L.P.

    The calculation of the differenctial cross section for scattering of thermal neutrons by water, taking into account the translational, rotational and vibrational motions of the water molecule, is presented according to Nelkin' model. Some modifications are presented which have been introduced in the original method to improve the results and an application has been made to reactor physics, by calculating the thermal neutron flux in a homogenous medium containing water and absorver. Thirty thermal energy groups have been used to compute the spectra. Within the limits of error, better agreement has been obtained between theory and experiments by using a modified Nelkin kernel consisting of substituting the asymptotic formulae for the rotational and vibrational motions by more exact expressions, similar to the Buttler model for heavy water

  7. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y.; Taub, H.; Miskowiec, A.

    2016-01-01

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10 8 –10 9 V m −1 , which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10 8 V m −1 ) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10 8 V m −1 ) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1,2-dimyristoyl-sn-glycero-3

  8. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    Rønnest, A. K.; Peters, G. H.; Hansen, F. Y., E-mail: flemming@kemi.dtu.dk [Department of Chemistry, Technical University of Denmark, IK 207 DTU, DK-2800 Lyngby (Denmark); Taub, H.; Miskowiec, A. [Department of Physics and Astronomy and the University of Missouri Research Reactor,University of Missouri, Columbia, Missouri 65211 (United States)

    2016-04-14

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid phase with a monovalent counter-ion and in the gel phase with a divalent counter-ion. The diffusion constant of water as a function of its depth in the membrane has been determined from mean-square-displacement calculations. Also, calculated incoherent quasielastic neutron scattering functions have been compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic potential within phospholipid membranes imply an enormous electric field of 10{sup 8}–10{sup 9} V m{sup −1}, which is likely to have great significance in controlling the conformation of translocating membrane proteins and in the transfer of ions and molecules across the membrane. We have calculated the membrane potential for DMPG bilayers and found ∼1 V (∼2 ⋅ 10{sup 8} V m{sup −1}) when in the fluid phase with a monovalent counter-ion and ∼1.4 V (∼2.8 ⋅ 10{sup 8} V m{sup −1}) when in the gel phase with a divalent counter-ion. The number of water molecules for a fully hydrated DMPG membrane has been estimated to be 9.7 molecules per lipid in the gel phase and 17.5 molecules in the fluid phase, considerably smaller than inferred experimentally for 1

  9. STICKING OF MOLECULES ON NONPOROUS AMORPHOUS WATER ICE

    He, Jiao; Vidali, Gianfranco [Physics Department, Syracuse University, Syracuse, NY 13244 (United States); Acharyya, Kinsuk, E-mail: gvidali@syr.edu [Department of Chemistry, University of Virginia, Charlottesville, VA 22904 (United States)

    2016-05-20

    Accurate modeling of physical and chemical processes in the interstellar medium (ISM) requires detailed knowledge of how atoms and molecules adsorb on dust grains. However, the sticking coefficient, a number between 0 and 1 that measures the first step in the interaction of a particle with a surface, is usually assumed in simulations of ISM environments to be either 0.5 or 1. Here we report on the determination of the sticking coefficient of H{sub 2}, D{sub 2}, N{sub 2}, O{sub 2}, CO, CH{sub 4}, and CO{sub 2} on nonporous amorphous solid water. The sticking coefficient was measured over a wide range of surface temperatures using a highly collimated molecular beam. We showed that the standard way of measuring the sticking coefficient—the King–Wells method—leads to the underestimation of trapping events in which there is incomplete energy accommodation of the molecule on the surface. Surface scattering experiments with the use of a pulsed molecular beam are used instead to measure the sticking coefficient. Based on the values of the measured sticking coefficient, we suggest a useful general formula of the sticking coefficient as a function of grain temperature and molecule-surface binding energy. We use this formula in a simulation of ISM gas–grain chemistry to find the effect of sticking on the abundance of key molecules both on grains and in the gas phase.

  10. The spontaneous synchronized dance of pairs of water molecules

    Roncaratti, Luiz F.; Cappelletti, David; Pirani, Fernando

    2014-01-01

    Molecular beam scattering experiments have been performed to study the effect of long-range anisotropic forces on the collision dynamics of two small polar molecules. The main focus of this paper is on water, but also ammonia and hydrogen sulphide molecules have been investigated, and some results will be anticipated. The intermolecular distances mainly probed are of the order of 1 nm and therefore much larger than the molecular dimensions. In particular, we have found that the natural electric field gradient, generated by different spatial orientations of the permanent electric dipoles, is able to promote the transformation of free rotations into coupled pendular states, letting the molecular partners involved in the collision complex swinging to and fro around the field direction. This long-ranged concerted motion manifested itself as large increases of the magnitude of the total integral cross section. The experimental findings and the theoretical treatment developed to shed light on the details of the process suggest that the transformation from free rotations to pendular states depends on the rotational level of both molecules, on the impact parameter, on the relative collision velocity, on the dipole moment product and occurs in the time scale of picoseconds. The consequences of this intriguing phenomenon may be important for the interpretation and, in perspective, for the control of elementary chemical and biological processes, given by polar molecules, ions, and free radicals, occurring in several environments under various conditions

  11. The spontaneous synchronized dance of pairs of water molecules

    Roncaratti, Luiz F. [Dipartimento di Chimica, Biologia e Biotecnologie, Università degli Studi di Perugia, 06123 Perugia (Italy); Instituto de Física, Universidade de Brasília, 70910-900 Brasília (Brazil); Cappelletti, David, E-mail: david.cappelletti@unipg.it; Pirani, Fernando [Dipartimento di Chimica, Biologia e Biotecnologie, Università degli Studi di Perugia, 06123 Perugia (Italy)

    2014-03-28

    Molecular beam scattering experiments have been performed to study the effect of long-range anisotropic forces on the collision dynamics of two small polar molecules. The main focus of this paper is on water, but also ammonia and hydrogen sulphide molecules have been investigated, and some results will be anticipated. The intermolecular distances mainly probed are of the order of 1 nm and therefore much larger than the molecular dimensions. In particular, we have found that the natural electric field gradient, generated by different spatial orientations of the permanent electric dipoles, is able to promote the transformation of free rotations into coupled pendular states, letting the molecular partners involved in the collision complex swinging to and fro around the field direction. This long-ranged concerted motion manifested itself as large increases of the magnitude of the total integral cross section. The experimental findings and the theoretical treatment developed to shed light on the details of the process suggest that the transformation from free rotations to pendular states depends on the rotational level of both molecules, on the impact parameter, on the relative collision velocity, on the dipole moment product and occurs in the time scale of picoseconds. The consequences of this intriguing phenomenon may be important for the interpretation and, in perspective, for the control of elementary chemical and biological processes, given by polar molecules, ions, and free radicals, occurring in several environments under various conditions.

  12. The Energy and Water Emergency Module; A containerized solution for meeting the energy and water needs in protracted displacement situations

    Nerini, Francesco Fuso; Valentini, Francesco; Modi, Anish

    2015-01-01

    The world has faced many natural and man-made disasters in the past few years, resulting in millions of people living in temporary camps across the globe. The energy and clean water needs of the relief operators in such emergency situations are primarily satisfied by diesel engine based generators...... and importing clean water to the site, in certain cases even for several years after the emergency. This approach results in problems such as low security of supply and high costs. Especially targeting the prolonged displacement situations, this paper presents an alternative solution – the Energy and Water...

  13. Electric dipole moments of nanosolvated acid molecules in water clusters.

    Guggemos, Nicholas; Slavíček, Petr; Kresin, Vitaly V

    2015-01-30

    The electric dipole moments of (H2O)nDCl (n=3-9) clusters have been measured by the beam-deflection method. Reflecting the (dynamical) charge distribution within the system, the dipole moment contributes information about the microscopic structure of nanoscale solvation. The addition of a DCl molecule to a water cluster results in a strongly enhanced susceptibility. There is evidence for a noticeable rise in the dipole moment occurring at n≈5-6. This size is consistent with predictions for the onset of ionic dissociation. Additionally, a molecular-dynamics model suggests that even with a nominally bound impurity an enhanced dipole moment can arise due to the thermal and zero-point motion of the proton and the water molecules. The experimental measurements and the calculations draw attention to the importance of fluctuations in defining the polarity of water-based nanoclusters and generally to the essential role played by motional effects in determining the response of fluxional nanoscale systems under realistic conditions.

  14. Hydrogen bonding characterization in water and small molecules

    Silvestrelli, Pier Luigi

    2017-06-01

    The prototypical hydrogen bond in water dimer and hydrogen bonds in the protonated water dimer, in other small molecules, in water cyclic clusters, and in ice, covering a wide range of bond strengths, are theoretically investigated by first-principles calculations based on density functional theory, considering not only a standard generalized gradient approximation functional but also, for the water dimer, hybrid and van der Waals corrected functionals. We compute structural, energetic, and electrostatic (induced molecular dipole moments) properties. In particular, hydrogen bonds are characterized in terms of differential electron density distributions and profiles, and of the shifts of the centres of maximally localized Wannier functions. The information from the latter quantities can be conveyed to a single geometric bonding parameter that appears to be correlated with the Mayer bond order parameter and can be taken as an estimate of the covalent contribution to the hydrogen bond. By considering the water trimer, the cyclic water hexamer, and the hexagonal phase of ice, we also elucidate the importance of cooperative/anticooperative effects in hydrogen-bonding formation.

  15. Continuum simulations of water flow past fullerene molecules

    Popadic, A.; Praprotnik, M.; Koumoutsakos, P.

    2015-01-01

    We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently by continuum flow...

  16. Selective control of photodissociation in deutereted water molecule HOD

    Adhikari, S.; Deshpande, Sarin; Sarma, Manabendra; Kurkal, Vandana; Mishra, M.K.

    2006-01-01

    Bond dissociation in the deutereted water molecule HOD has been investigated to explore the possibility of selective control of dissociation of O-H and O-D bonds using simple field profiles and initial states that do not require high overtone excitations. Preliminary results indicate that considerable selectivity in dissociation of O-H and O-D bonds can be achieved using fundamental and first overtone excitations only and use of field optimized initial state (FOIST) based scheme with appropriate choice of field parameters and initial states may enhance both selectivity and yield

  17. The Energy and Water Emergency Module; A containerized solution for meeting the energy and water needs in protracted displacement situations

    Fuso Nerini, Francesco; Valentini, Francesco; Modi, Anish; Upadhyay, Govinda; Abeysekera, Muditha; Salehin, Sayedus; Appleyard, Eduardo

    2015-01-01

    Highlights: • Energy and water services are a key need in long-term displacement situations. • At present electricity is supplied mostly with diesel generators and water is imported. • On-site electricity and clean water production can decrease costs and increase security. • The proposed containerized solution produces electricity and purifies water locally. • Model results show the cost-competitiveness and technical potential of the solution. - Abstract: The world has faced many natural and man-made disasters in the past few years, resulting in millions of people living in temporary camps across the globe. The energy and clean water needs of the relief operators in such emergency situations are primarily satisfied by diesel engine based generators and importing clean water to the site, in certain cases even for several years after the emergency. This approach results in problems such as low security of supply and high costs. Especially targeting the prolonged displacement situations, this paper presents an alternative solution – the Energy and Water Emergency Module. The proposed solution aims towards reducing the dependency on fossil fuel in prolonged emergency situations to a minimum while including local energy sources in the energy supply in a flexible and reliable way. The proposed module is built in a standard 20 ft container, and encompasses hybrid generation from solar, wind and biomass, with the possibility of using fossil sources too thanks to a dual fuel gas engine. The module can work both in grid connected and stand-alone mode. In addition the module includes a water purification unit to meet the water needs of displaced population. A demonstration unit was assembled at the Royal Institute of Technology in Stockholm during the year 2012 as a ‘concept proof’, and is now being tested and optimized for future deployment on the field. Preliminary testing and modelling shows that the proposed solution can reliably support emergency

  18. Possibilities of crack mouth opening displacement (CMOD) measurement under boiling and pressurized water reactor conditions

    Ehling, W.

    1984-01-01

    Fracture mechanics investigations carried out so far in laboratory conditions cover only part of the material stresses, as effects which occur in nuclear powerstations, in particular, such as corrosion and radioactive radiation are largely left out of account. Therefore experiments including these effects were recently carried out in autoclaves, test rigs simulating reactors (HRD experimental plant) and in experimental reactors. An important parameter of experimental fracture mechanics is the measurement of crack opening displacement (COD). The crack opening is measured with socalled clip gauges (transmitters based on strain gauges, which convert mechanical deformation of springs into electrical signals) on standard samples in the laboratory. It was therefore sensible to use these high temperature strain gauges (HTD) for the development of a measuring system for travel for pressurized water and boiling water reactor conditions. (orig.) [de

  19. Measuring and Modeling the Displacement of Connate Water in Chalk Core Plugs during Water Injection

    Korsbech, Uffe C C; Aage, Helle Karina; Andersen, Bertel Lohmann

    2006-01-01

    and forms a mixed water bank with almost 100% connate water in the front behind which a gradual transition to pure injection water occurs. This result underpins log interpretations from waterflooded chalk reservoirs. An ad hoc model was set up by use of the results, and the process was examined...

  20. Molecular multipole moments of water molecules in ice Ih

    Batista, E.R.; Xantheas, S.S.; Jonsson, H.

    1998-01-01

    We have used an induction model including dipole, dipole endash quadrupole, quadrupole endash quadrupole polarizability and first hyperpolarizability as well as fixed octopole and hexadecapole moments to study the electric field in ice. The self-consistent induction calculations gave an average total dipole moment of 3.09 D, a 67% increase over the dipole moment of an isolated water molecule. A previous, more approximate induction model study by Coulson and Eisenberg [Proc. R. Soc. Lond. A 291, 445 (1966)] suggested a significantly smaller average value of 2.6 D. This value has been used extensively in recent years as a reference point in the development of various polarizable interaction potentials for water as well as for assessment of the convergence of water cluster properties to those of bulk. The reason for this difference is not due to approximations made in the computational scheme of Coulson and Eisenberg but rather due to the use of less accurate values for the molecular multipoles in these earlier calculations. copyright 1998 American Institute of Physics

  1. Approximative Krieger-Nelkin orientation averaging and anisotropy of water molecules vibrations

    Markovic, M.I.

    1974-01-01

    Quantum-mechanics approach of water molecules dynamics should be taken into account for precise theoretical calculation of differential scattering cross sections of neutrons. Krieger and Nelkin have proposed an approximate method for averaging orientation of molecules regarding directions of incoming and scattered neutron. This paper shows that this approach can be successfully applied for general shape of water molecule vibration anisotropy

  2. Distribution of binding energies of a water molecule in the water liquid-vapor interface

    Chempath, Shaji [Los Alamos National Laboratory; Pratt, Lawrence R [TULANE UNIV

    2008-01-01

    Distributions of binding energies of a water molecule in the water liquid-vapor interface are obtained on the basis of molecular simulation with the SPC/E model of water. These binding energies together with the observed interfacial density profile are used to test a minimally conditioned Gaussian quasi-chemical statistical thermodynamic theory. Binding energy distributions for water molecules in that interfacial region clearly exhibit a composite structure. A minimally conditioned Gaussian quasi-chemical model that is accurate for the free energy of bulk liquid water breaks down for water molecules in the liquid-vapor interfacial region. This breakdown is associated with the fact that this minimally conditioned Gaussian model would be inaccurate for the statistical thermodynamics of a dilute gas. Aggressive conditioning greatly improves the performance of that Gaussian quasi-chemical model. The analogy between the Gaussian quasi-chemical model and dielectric models of hydration free energies suggests that naive dielectric models without the conditioning features of quasi-chemical theory will be unreliable for these interfacial problems. Multi-Gaussian models that address the composite nature of the binding energy distributions observed in the interfacial region might provide a mechanism for correcting dielectric models for practical applications.

  3. Comparison of the orogenic displacement of sodium caseinate with the caseins from the air-water interface by nonionic surfactants.

    Woodward, N C; Gunning, A P; Mackie, A R; Wilde, P J; Morris, V J

    2009-06-16

    Displacement of sodium caseinate from the air-water interface by nonionic surfactants Tween 20 and Tween 60 was observed by atomic force microscopy (AFM). The interfacial structure was sampled by Langmuir-Blodgett deposition onto freshly cleaved mica substrates. Protein displacement occurred through an orogenic mechanism: it involved the nucleation and growth of surfactant domains within the protein network, followed by failure of the protein network. The surface pressure at which failure of the protein network occurred was essentially independent of the type of surfactant. The major component of sodium caseinate is beta-casein, and previous studies at the air-water interface have shown that beta-casein networks are weak, failing at surface pressures below that observed for sodium caseinate. The other components of sodium caseinate are alpha(s)- and kappa-caseins. Studies of the displacement of alpha(s)-caseins from air-water interfaces show that these proteins also form weak networks that fail at surface pressures below that observed for sodium caseinate. However, kappa-casein was found to form strong networks that resisted displacement and failed at surface pressures comparable to those observed for sodium caseinate. The AFM images of the displacement suggest that, despite kappa-casein being a minor component, it dominates the failure of sodium caseinate networks: alpha(s)-casein and beta-casein are preferentially desorbed at lower surface pressures, allowing the residual kappa-casein to control the breakdown of the sodium caseinate network at higher surface pressures.

  4. Effects of the conjugation of whey proteins with gellan polysaccharides on surfactant-induced competitive displacement from the air-water interface.

    Cai, B; Ikeda, S

    2016-08-01

    Whey proteins can be used to stabilize foams and emulsions against coalescence because of their ability to form viscoelastic films at the interface that resist film rupture on collision between colloidal particles. However, whey proteins are competitively displaced from the interface if small-molecule surfactants are added, leading to destabilization of the entire system. This is because surfactants are more effective in molecular packing at the interface, and they lower interfacial tension to a greater degree than whey proteins do, but their interfacial films are poor in viscoelasticity. We hypothesized that whey proteins would become more resistant to surfactant-induced competitive displacement if they were conjugated with network-forming polysaccharides. The protein moiety of the conjugate would be expected to enable its adsorption to the interface, and the polysaccharide moiety would be expected to form self-assembled networks, strengthening the interfacial film as a whole. In this study, whey proteins were conjugated with gellan polysaccharides using the Maillard reaction. Atomic force microscopy images of interfacial films formed by the whey protein-gellan conjugate at the air-water interface and transferred onto mica sheets using the Langmuir-Blodgett method revealed that gellan did form self-assembled networks at the interface and that interfacial films also contained a large number of unconjugated whey protein molecules. Following the addition of a small-molecule surfactant (Tween 20) to the sub-phase, surface pressure increased, indicating spontaneous adsorption of surfactants to the interface. Atomic force microscopy images showed decreases in interfacial area coverage by whey proteins as surface pressure increased. At a given surface pressure, the interfacial area coverage by whey protein-gellan conjugates was greater than coverage by unconjugated whey proteins, confirming that whey proteins became more resistant to surfactant-induced displacement after

  5. Fast Rotational Diffusion of Water Molecules in a 2D Hydrogen Bond Network at Cryogenic Temperatures

    Prisk, T. R.; Hoffmann, C.; Kolesnikov, A. I.; Mamontov, E.; Podlesnyak, A. A.; Wang, X.; Kent, P. R. C.; Anovitz, L. M.

    2018-05-01

    Individual water molecules or small clusters of water molecules contained within microporous minerals present an extreme case of confinement where the local structure of hydrogen bond networks are dramatically altered from bulk water. In the zinc silicate hemimorphite, the water molecules form a two-dimensional hydrogen bond network with hydroxyl groups in the crystal framework. Here, we present a combined experimental and theoretical study of the structure and dynamics of water molecules within this network. The water molecules undergo a continuous phase transition in their orientational configuration analogous to a two-dimensional Ising model. The incoherent dynamic structure factor reveals two thermally activated relaxation processes, one on a subpicosecond timescale and another on a 10-100 ps timescale, between 70 and 130 K. The slow process is an in-plane reorientation of the water molecule involving the breaking of hydrogen bonds with a framework that, despite the low temperatures involved, is analogous to rotational diffusion of water molecules in the bulk liquid. The fast process is a localized motion of the water molecule with no apparent analogs among known bulk or confined phases of water.

  6. Density, distribution, and orientation of water molecules inside and outside carbon nanotubes.

    Thomas, J A; McGaughey, A J H

    2008-02-28

    The behavior of water molecules inside and outside 1.1, 2.8, 6.9, and 10.4 nm diameter armchair carbon nanotubes (CNTs) is predicted using molecular dynamics simulations. The effects of CNT diameter on mass density, molecular distribution, and molecular orientation are identified for both the confined and unconfined fluids. Within 1 nm of the CNT surface, unconfined water molecules assume a spatially varying density profile. The molecules distribute nonuniformly around the carbon surface and have preferred orientations. The behavior of the unconfined water molecules is invariant with CNT diameter. The behavior of the confined water, however, can be correlated to tube diameter. Inside the 10.4 nm CNT, the molecular behavior is indistinguishable from that of the unconfined fluid. Within the smaller CNTs, surface curvature effects reduce the equilibrium water density and force water molecules away from the surface. This effect changes both the molecular distribution and preferred molecular orientations.

  7. Water displacement leg volumetry in clinical studies - A discussion of error sources

    2010-01-01

    Background Water displacement leg volumetry is a highly reproducible method, allowing the confirmation of efficacy of vasoactive substances. Nevertheless errors of its execution and the selection of unsuitable patients are likely to negatively affect the outcome of clinical studies in chronic venous insufficiency (CVI). Discussion Placebo controlled double-blind drug studies in CVI were searched (Cochrane Review 2005, MedLine Search until December 2007) and assessed with regard to efficacy (volume reduction of the leg), patient characteristics, and potential methodological error sources. Almost every second study reported only small drug effects (≤ 30 mL volume reduction). As the most relevant error source the conduct of volumetry was identified. Because the practical use of available equipment varies, volume differences of more than 300 mL - which is a multifold of a potential treatment effect - have been reported between consecutive measurements. Other potential error sources were insufficient patient guidance or difficulties with the transition from the Widmer CVI classification to the CEAP (Clinical Etiological Anatomical Pathophysiological) grading. Summary Patients should be properly diagnosed with CVI and selected for stable oedema and further clinical symptoms relevant for the specific study. Centres require a thorough training on the use of the volumeter and on patient guidance. Volumetry should be performed under constant conditions. The reproducibility of short term repeat measurements has to be ensured. PMID:20070899

  8. The influence of water disposal method on the property of chemical oil-displacement agent--taking Guan 109-1 area of Dagang oilfield as example

    Shengwang Yuan

    2018-03-01

    Full Text Available Aiming at the actual demand of Guan 109-1 block in Dagang oilfield, by means of instrumental analysis, chemical analysis, modern physical simulation, viewing polymer viscosity and seepage characteristic as evaluation index, the experimental research on the influence of water disposal method on the property of chemical oil-displacement agent was carried out. Results showed that through adding scaling agent, scale was formed because of the reaction between scaling agent and Ca2+, Mg2+ in the flooding water, which could enhance the viscosity of polymer solution. Through comparing the resistance factor and residual resistance factor of polymer solution which was respectively prepared with flooding water, softened water and scale, the resistance factor and residual resistance factor of polymer solution with scale was the largest, that of polymer solution prepared with softened water was second and that of polymer solution prepared with flooding water came last. Furthermore, scaling agent weakened the gelling effect between cross-linking agent Cr3+ and polymer molecule chains. The earlier the cross-linking agent Cr3+ was added, the larger the polymer viscosity, resistance factor and residual resistance factor of Cr3+ polymer were.

  9. Chemical reactions of water molecules on Ru(0001) induced by selective excitation of vibrational modes

    Mugarza, Aitor; Shimizu, Tomoko K.; Ogletree, D. Frank; Salmeron, Miquel

    2009-05-07

    Tunneling electrons in a scanning tunneling microscope were used to excite specific vibrational quantum states of adsorbed water and hydroxyl molecules on a Ru(0 0 0 1) surface. The excited molecules relaxed by transfer of energy to lower energy modes, resulting in diffusion, dissociation, desorption, and surface-tip transfer processes. Diffusion of H{sub 2}O molecules could be induced by excitation of the O-H stretch vibration mode at 445 meV. Isolated molecules required excitation of one single quantum while molecules bonded to a C atom required at least two quanta. Dissociation of single H{sub 2}O molecules into H and OH required electron energies of 1 eV or higher while dissociation of OH required at least 2 eV electrons. In contrast, water molecules forming part of a cluster could be dissociated with electron energies of 0.5 eV.

  10. New method to determine initial surface water displacement at tsunami source

    Lavrentyev, Mikhail; Romanenko, Alexey; Tatarintsev, Pavel

    2013-04-01

    Friday, March 11, 2011 at 05:46:23 UTC, Japan was struck by an 8.9-magnitude earthquake near its Northeastern coast. This is one of the largest earthquakes that Japan has ever experienced. Tsunami waves swept away houses and cars and caused massive human losses. To predict tsunami wave parameters better and faster, we propose to improve data inversion scheme and achieve the performance gain of data processing. One of the reasons of inaccurate predictions of tsunami parameters is that very little information is available about the initial disturbance of the sea bed at tsunami source. In this paper, we suggest a new way of improving the quality of tsunami source parameters prediction. Modern computational technologies can accurately calculate tsunami wave propagation over the deep ocean provided that the initial displacement (perturbation of the sea bed at tsunami source) is known [4]. Direct geophysical measurements provide the location of an earthquake hypocenter and its magnitude (the released energy evaluation). Among the methods of determination of initial displacement the following ones should be considered. Calculation through the known fault structure and available seismic information. This method is widely used and provides useful information. However, even if the exact knowledge about rock blocks shifts is given, recalculation in terms of sea bed displacement is needed. This results in a certain number of errors. GPS data analysis. This method was developed after the December 2004 event in the Indian Ocean. A good correlation between dry land based GPS sensors and tsunami wave parameters was observed in the particular case of the West coast of Sumatra, Indonesia. This approach is very unique and can hardly been used in other geo locations. Satellite image analysis. The resolution of modern satellite images has dramatically improved. In the future, correct data of sea surface displacement will probably be available in real time, right after a tsunamigenic

  11. Carbon, land, and water footprint accounts for the European Union: consumption, production, and displacements through international trade.

    Steen-Olsen, Kjartan; Weinzettel, Jan; Cranston, Gemma; Ercin, A Ertug; Hertwich, Edgar G

    2012-10-16

    A nation's consumption of goods and services causes various environmental pressures all over the world due to international trade. We use a multiregional input-output model to assess three kinds of environmental footprints for the member states of the European Union. Footprints are indicators that take the consumer responsibility approach to account for the total direct and indirect effects of a product or consumption activity. We quantify the total environmental pressures (greenhouse gas emissions: carbon footprint; appropriation of biologically productive land and water area: land footprint; and freshwater consumption: water footprint) caused by consumption in the EU. We find that the consumption activities by an average EU citizen in 2004 led to 13.3 tCO(2)e of induced greenhouse gas emissions, appropriation of 2.53 gha (hectares of land with global-average biological productivity), and consumption of 179 m(3) of blue water (ground and surface water). By comparison, the global averages were 5.7 tCO(2)e, 1.23 gha, and 163 m(3) blue water, respectively. Overall, the EU displaced all three types of environmental pressures to the rest of the world, through imports of products with embodied pressures. Looking at intra-EU displacements only, the UK was the most important displacer overall, while the largest net exporters of embodied environmental pressures were Poland (greenhouse gases), France (land), and Spain (freshwater).

  12. Influence of orientation averaging on the anisotropy of thermal neutrons scattering on water molecules

    Markovic, M. I.; Radunovic, J. B.

    1976-01-01

    Determination of spatial distribution of neutron flux in water, most frequently used moderator in thermal reactors, demands microscopic scattering kernels dependence on cosine of thermal neutrons scattering angle when solving the Boltzmann equation. Since spatial orientation of water molecules influences this dependence it is necessary to perform orientation averaging or rotation-vibrational intermediate scattering function for water molecules. The calculations described in this paper and the obtained results showed that methods of orientation averaging do not influence the anisotropy of thermal neutrons scattering on water molecules, but do influence the inelastic scattering

  13. The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows

    Shen Zigang; Huang Yibo; Li Bin; Zhang Yi

    2007-01-01

    Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)

  14. Implication of Crystal Water Molecules in Inhibitor Binding at ALR2 Active Site

    Hymavati

    2012-01-01

    Full Text Available Water molecules play a crucial role in mediating the interaction between a ligand and a macromolecule. The solvent environment around such biomolecule controls their structure and plays important role in protein-ligand interactions. An understanding of the nature and role of these water molecules in the active site of a protein could greatly increase the efficiency of rational drug design approaches. We have performed the comparative crystal structure analysis of aldose reductase to understand the role of crystal water in protein-ligand interaction. Molecular dynamics simulation has shown the versatile nature of water molecules in bridge H bonding during interaction. Occupancy and life time of water molecules depend on the type of cocrystallized ligand present in the structure. The information may be useful in rational approach to customize the ligand, and thereby longer occupancy and life time for bridge H-bonding.

  15. Maillard Conjugation of Sodium Alginate to Whey Protein for Enhanced Resistance to Surfactant-Induced Competitive Displacement from Air-Water Interfaces.

    Cai, Bingqing; Saito, Anna; Ikeda, Shinya

    2018-01-24

    Whey protein adsorbed to an interface forms a viscoelastic interfacial film but is displaced competitively from the interface by a small-molecule surfactant added afterward. The present study evaluated the impact of the covalent conjugation of high- or low-molecular-weight sodium alginate (HA or LA) to whey protein isolate (WPI) via the Maillard reaction on the ability of whey protein to resist surfactant-induced competitive displacement from the air-water interface. Surfactant added after the pre-adsorption of conjugate to the interface increased surface pressure. At a given surface pressure, the WPI-LA conjugate showed a significantly higher interfacial area coverage and lower interfacial film thickness compared to those of the WPI-HA conjugate or unconjugated WPI. The addition of LA to the aqueous phase had little effect on the interfacial area and thickness of pre-adsorbed WPI. These results suggest the importance of the molecular weight of the polysaccharide moiety in determining interfacial properties of whey protein-alginate conjugates.

  16. Assessing Climate Change Impacts on Water Resources and Colorado Agriculture Using an Equilibrium Displacement Mathematical Programming Model

    Fathelrahman, Eihab; Davies, Amalia; Davies, Stephen; Pritchett, James

    2014-01-01

    This research models selected impacts of climate change on Colorado agriculture several decades in the future, using an Economic Displacement Mathematical Programming model. The agricultural economy in Colorado is dominated by livestock, which accounts for 67% of total receipts. Crops, including feed grains and forages, account for the remainder. Most agriculture is based on irrigated production, which depends on both groundwater, especially from the Ogallala aquifer, and surface water that c...

  17. Theoretical investigation of the ultrafast dissociation of core-ionized water and uracil molecules immersed in liquid water

    Stia, C.R.; Fojon, O.A. [Instituto de Fisica Rosario - CONICET-Universidad Nacional de Rosario, Rosario (Argentina); Gaigeot, M.P. [Laboratoire Analyse et Modelisation pour la Biologie et l' Environnement, LAMBE, UMR-CNRS 8587, Universite d' Evry-Val-d' Essonne, 91 - Evry (France); Institut Universitaire de France, 75 - Paris (France); Vuilleumier, R. [Departement de chimie, Ecole Normale Superieure, 75 - Paris (France); Herve du Penhoat, M.A.; Politis, M.F. [Institut de Mineralogie et de Physique des Milieux Condenses, IMPMC, UMR-CNRS 7590, Universite Pierre et Marie Curie, 75 - Paris (France)

    2010-10-15

    We present a series of ab initio density functional based calculations of the fragmentation dynamics of core-ionized biomolecules. The computations are performed for pure liquid water, aqueous and isolated Uracil. Core ionization is described by replacing the 1s{sup 2} pseudopotential of one atom of the target molecule (C, N or O) with a pseudopotential for a 1s{sup 1} core-hole state. Our results predict that the dissociation of core-ionized water molecules may be reached during the lifetime of inner-shell vacancy (less than 10 fs), leading to OH bond breakage as a primary outcome. We also observe a second fragmentation channel in which total Coulomb explosion of the ionized water molecule occurs. Fragmentation pathways are found similar for pure water or when the water molecule is in the primary hydration shell of the uracil molecule. In the latter case, the proton may be transferred towards the uracil oxygen atoms. When the core hole is located on the uracil molecule, ultrafast dissociation is only observed in the aqueous environment and for nitrogen-K vacancies, resulting in proton transfers towards the hydrogen-bonded water molecule. (authors)

  18. Femtosecond spectroscopic study of the solvation of amphiphilic molecules by water

    Rezus, Y.L.A.; Bakker, H.J.

    2008-01-01

    We use polarization-resolved mid-infrared pump-probe spectroscopy to study the aqueous solvation of proline and N-methylacetamide. These molecules serve as models to study the solvation of proteins. We monitor the orientational dynamics of partly deuterated water molecules (HDO) that are present at

  19. Evaluation of Serum for Pathophysiological Effects of Prolonged Low Salinity Water Exposure in Displaced Bottlenose Dolphins (Tursiops truncatus

    Ruth Y. Ewing

    2017-06-01

    Full Text Available We conducted a retrospective study of serum biochemistry and hematologic findings from displaced, out-of-habitat bottlenose dolphins (Tursiops truncatus exposed to various low salinity environments in waters along the southern United States including southeastern Atlantic and northern Gulf of Mexico. Serum sodium, chloride, and calculated osmolality were significantly lower and below reference ranges in displaced animals compared to free-ranging case control animals. This suggests clinical hyponatremia, hypochloremia, and hypo-osmolality due to an uptake of low saline water from the environment. In addition, significant differences were found in other serum chemistry variables, although none were outside of normal reference ranges for non-controlled free-ranging animals. Multiple linear regressions demonstrated the degree of salinity had a greater pathophysiologic response than the duration of fresh water exposure. The Na/Cl ratio and bicarbonate were the only variables that were significantly modulated by exposure duration. These findings suggest that the degree of salinity is a critical factor when assessing and managing care for dolphins chronically exposed to low salinity water. Results from this study indicate that changes in various biochemical parameters can be used to determine fresh water exposure and aid in determining the treatment for animals recovered from low salinity waters.

  20. Dynamics of water molecules in the active-site cavity of human cytochromes P450

    Rydberg, Patrik; Rod, Thomas Holm; Olsen, Lars

    2007-01-01

    We have studied the dynamics of water molecules in six crystal structures of four human cytochromes P450, 2A6, 2C8, 2C9, and 3A4, with molecular dynamics simulations. In the crystal structures, only a few water molecules are seen and the reported sizes of the active-site cavity vary a lot....... In the simulations, the cavities are completely filled with water molecules, although with approximately 20% lower density than in bulk water. The 2A6 protein differs from the other three in that it has a very small cavity with only two water molecules and no exchange with the surroundings. The other three proteins...... channels, through which there is a quite frequent exchange of water molecules (one molecule is exchanged every 30-200 ps), except in 2A6. Most of the channels are observed also in the crystal structures, but two to three channels in each protein open only during the simulations. There are no water...

  1. Structural Arrangement of Water Molecules around Highly Charged Nanoparticles: Molecular Dynamics Simulation

    Kim, Eunae; Yeom, Min Sun

    2014-01-01

    Molecular dynamics simulations were performed to understand the structural arrangement of water molecules around highly charged nanoparticles under aqueous conditions. The effect of two highly charged nanoparticles on the solvation charge asymmetry has been examined. We calculated the radial distribution functions of the components of water molecules around nanoparticles which have four charge types at two different salt concentrations. Even though the distributions of water molecules surrounding a sodium ion and a chloride ion are hardly affected by the charges of nanoparticles and the salt concentrations, those around highly charged nanoparticles are strongly influenced by the charges of nanoparticles, but hardly by the charges of nanoparticles and salt concentrations. We find that the distributions of hydrogen atoms in water molecules around one highly charged nanoparticle are dependent on the magnitude of the nanoparticle charge

  2. Quantum Electric Dipole Lattice - Water Molecules Confined to Nanocavities in Beryl

    Dressel, Martin; Zhukova, Elena S.; Thomas, Victor G.; Gorshunov, Boris P.

    2018-02-01

    Water is subject to intense investigations due to its importance in biological matter but keeps many of its secrets. Here, we unveil an even other aspect by confining H2O molecules to nanosize cages. Our THz and infrared spectra of water in the gemstone beryl evidence quantum tunneling of H2O molecules in the crystal lattice. The water molecules are spread out when confined in a nanocage. In combination with low-frequency dielectric measurements, we were also able to show that dipolar coupling among the H2O molecules leads towards a ferroelectric state at low temperatures. Upon cooling, a ferroelectric soft mode shifts through the THz range. Only quantum fluctuations prevent perfect macroscopic order to be fully achieved. Beside the significance to life science and possible application, nanoconfined water may become the prime example of a quantum electric dipolar lattice.

  3. Identification of intrinsic catalytic activity for electrochemical reduction of water molecules to generate hydrogen

    Shinagawa, Tatsuya; Takanabe, Kazuhiro

    2015-01-01

    Insufficient hydronium ion activities at near-neutral pH and under unbuffered conditions induce diffusion-limited currents for hydrogen evolution, followed by a reaction with water molecules to generate hydrogen at elevated potentials. The observed

  4. Docking ligands into flexible and solvated macromolecules. 7. Impact of protein flexibility and water molecules on docking-based virtual screening accuracy.

    Therrien, Eric; Weill, Nathanael; Tomberg, Anna; Corbeil, Christopher R; Lee, Devin; Moitessier, Nicolas

    2014-11-24

    The use of predictive computational methods in the drug discovery process is in a state of continual growth. Over the last two decades, an increasingly large number of docking tools have been developed to identify hits or optimize lead molecules through in-silico screening of chemical libraries to proteins. In recent years, the focus has been on implementing protein flexibility and water molecules. Our efforts led to the development of Fitted first reported in 2007 and further developed since then. In this study, we wished to evaluate the impact of protein flexibility and occurrence of water molecules on the accuracy of the Fitted docking program to discriminate active compounds from inactive compounds in virtual screening (VS) campaigns. For this purpose, a total of 171 proteins cocrystallized with small molecules representing 40 unique enzymes and receptors as well as sets of known ligands and decoys were selected from the Protein Data Bank (PDB) and the Directory of Useful Decoys (DUD), respectively. This study revealed that implementing displaceable crystallographic or computationally placed particle water molecules and protein flexibility can improve the enrichment in active compounds. In addition, an informed decision based on library diversity or research objectives (hit discovery vs lead optimization) on which implementation to use may lead to significant improvements.

  5. Adsorptionof polar organic molecules at oil/water interfaces

    Aveyard, R; Chapman, J

    1975-03-15

    A study has been made of the adsorption of several esters of dicarboxylic acids at the alkane/water and the air/water interface. The adsorption of n-butanol and n-heptanol at the air/water surface also has been investigated. The surface pressure (pi) -surface area (A) isotherms are compared for the various films, and standard free energies of adsorption have been determined. Attempts have been made to fit the pi, A isotherms using surface equations of state based on the models, of both a 2-dimensional gas and a 2-dimensional solution. The solution model has proved reasonably successful for fairly dilute films at the air/water surface. At higher coverages, an equation derived by Smith for liquid expanded monolayers gives a moderately good description of films of heptanol on water. A simple application of the solution model on adsorbed monolayers at the liquid; liquid interface met with little success. However, it is found that 2-dimensional gas equations describe such systems surprisingly well for fairly low surface concentrations. (20 refs.)

  6. Roles of water molecules in bacteria and viruses

    Cox, C. S.

    1993-02-01

    In addition to water, microbes mainly comprise lipids, carbohydrates, proteins and nucleic acids. Their structure and function singularly and conjointly is affected by water activity. Desiccation leads to dramatic lipid phase changes whereas carbohydrates, proteins and nucleic acids initially suffer spontaneous, reversible low activation energy Maillard reactions forming products that more slowly re-arrange, cross-link etc. to give non-native states. While initial products spontaneously may reverse to native states by raising water activity, later products only do so through energy consumption and enzymatic activity eg. repair. Yet, native states of lipid membranes and associated enzymes are required to generate energy. Consequently, good reserves of high energy compounds (e.g. ATP) and of membrane stabilisers (e.g. trehalose) may be expected to enhance survival following drying and rehydration (e.g. anhydrobiotic organisms).

  7. Contamination of boreholes water by 76 pesticides molecules in the ...

    user2

    to be the cause of the degradation of the quality of sur- face and ground waters ... network and the nature of the soil generally clay lateritic with high permeability. .... 0.006 0.008 0.004 0.004 0.004 0.007 0.008 0.004 0.004 0.004 Malathion.

  8. Hydroxyl and water molecule orientations in trypsin: Comparison to molecular dynamics structures

    McDowell, R.S.; Kossiakoff, A.A. [Genentech, Inc., South San Francisco, CA (United States)

    1994-12-31

    A comparison is presented of experimentally observed hydroxyl and water hydrogens in trypsin determined from neutron density maps with the results of a 140ps molecular dynamics (MD) simulation. Experimental determination of hydrogen and deuterium atom positions in molecules as large as proteins is a unique capability of neutron diffraction. The comparison addresses the degree to which a standard force-field approach can adequately describe the local electrostatic and van der Waals forces that determine the orientations of these hydrogens. Neutron densities, derived from 2.1{Angstrom} D{sub 2}O-H{sub 2}O difference Fourier maps, provide a database of 27 well-ordered hydroxyl hydrogens. Most of the simulated hydroxyl orientations are within a standard deviation of the experimentally-observed positions, including several examples in which both the simulation and the neutron density indicate that a hydroxyl group is shifted from a {open_quote}standard{close_quote} rotamer. For the most highly ordered water molecules, the hydrogen distributions calculated from the trajectory were in good agreement with neutron density; simulated water molecules that displayed multiple hydrogen bonding networks had correspondingly broadened neutron density profiles. This comparison was facilitated by development of a method to construct a pseudo 2{Angstrom} density map based on the hydrogen atom distributions from the simulation. The degree of disorder of internal water molecules is shown to result primarily from the electrostatic environment surrounding that water molecule as opposed to the cavity size available to the molecule. A method is presented for comparing the discrete observations sampled in a dynamics trajectory with the time- averaged data obtained from X-ray or neutron diffraction studies. This method is particularly useful for statically-disordered water molecules, in which the average location assigned from a trajectory may represent a site of relatively low occupancy.

  9. Water-mediated influence of a crowded environment on internal vibrations of a protein molecule.

    Kuffel, Anna; Zielkiewicz, Jan

    2016-02-14

    The influence of crowding on the protein inner dynamics is examined by putting a single protein molecule close to one or two neighboring protein molecules. The presence of additional molecules influences the amplitudes of protein fluctuations. Also, a weak dynamical coupling of collective velocities of surface atoms of proteins separated by a layer of water is detected. The possible mechanisms of these phenomena are described. The cross-correlation function of the collective velocities of surface atoms of two proteins was decomposed into the Fourier series. The amplitude spectrum displays a peak at low frequencies. Also, the results of principal component analysis suggest that the close presence of an additional protein molecule influences the high-amplitude, low-frequency modes in the most prominent way. This part of the spectrum covers biologically important protein motions. The neighbor-induced changes in the inner dynamics of the protein may be connected with the changes in the velocity power spectrum of interfacial water. The additional protein molecule changes the properties of solvation water and in this way it can influence the dynamics of the second protein. It is suggested that this phenomenon may be described, at first approximation, by a damped oscillator driven by an external random force. This model was successfully applied to conformationally rigid Choristoneura fumiferana antifreeze protein molecules.

  10. FORMATION OF ORGANIC MOLECULES AND WATER IN WARM DISK ATMOSPHERES

    Najita, Joan R. [National Optical Astronomy Observatory, 950 N. Cherry Avenue, Tucson, AZ 85719 (United States); Adamkovics, Mate; Glassgold, Alfred E. [Astronomy Department, University of California, Berkeley, CA 94720 (United States)

    2011-12-20

    Observations from Spitzer and ground-based infrared spectroscopy reveal significant diversity in the molecular emission from the inner few AU of T Tauri disks. We explore theoretically the possible origin of this diversity by expanding on our earlier thermal-chemical model of disk atmospheres. We consider how variations in grain settling, X-ray irradiation, accretion-related mechanical heating, and the oxygen-to-carbon ratio can affect the thermal and chemical properties of the atmosphere at 0.25-40 AU. We find that these model parameters can account for many properties of the detected molecular emission. The column density of the warm (200-2000 K) molecular atmosphere is sensitive to grain settling and the efficiency of accretion-related heating, which may account, at least in part, for the large range in molecular emission fluxes that have been observed. The dependence of the atmospheric properties on the model parameters may also help to explain trends that have been reported in the literature between molecular emission strength and mid-infrared color, stellar accretion rate, and disk mass. We discuss whether some of the differences between our model results and the observations (e.g., for water) indicate a role for vertical transport and freezeout in the disk midplane. We also discuss how planetesimal formation in the outer disk (beyond the snowline) may imprint a chemical signature on the inner few AU of the disk and speculate on possible observational tracers of this process.

  11. FORMATION OF ORGANIC MOLECULES AND WATER IN WARM DISK ATMOSPHERES

    Najita, Joan R.; Ádámkovics, Máté; Glassgold, Alfred E.

    2011-01-01

    Observations from Spitzer and ground-based infrared spectroscopy reveal significant diversity in the molecular emission from the inner few AU of T Tauri disks. We explore theoretically the possible origin of this diversity by expanding on our earlier thermal-chemical model of disk atmospheres. We consider how variations in grain settling, X-ray irradiation, accretion-related mechanical heating, and the oxygen-to-carbon ratio can affect the thermal and chemical properties of the atmosphere at 0.25-40 AU. We find that these model parameters can account for many properties of the detected molecular emission. The column density of the warm (200-2000 K) molecular atmosphere is sensitive to grain settling and the efficiency of accretion-related heating, which may account, at least in part, for the large range in molecular emission fluxes that have been observed. The dependence of the atmospheric properties on the model parameters may also help to explain trends that have been reported in the literature between molecular emission strength and mid-infrared color, stellar accretion rate, and disk mass. We discuss whether some of the differences between our model results and the observations (e.g., for water) indicate a role for vertical transport and freezeout in the disk midplane. We also discuss how planetesimal formation in the outer disk (beyond the snowline) may imprint a chemical signature on the inner few AU of the disk and speculate on possible observational tracers of this process.

  12. Influence of the effective mass of water molecule on thermal neutron scattering

    Markovic, M.

    1981-01-01

    The influence of the effective water molecule mass on the thermal neutron scattering on the nucleus of the hydrogen atom has been investigated. Besides the actual water molecule mass (M = 18) the investigations have been carried out with its two effective values (M1 = 16 and M2 = 20). The differential and total cross sections have been calculated for the incident thermal neutron energy E o = 1 eV. Investigation results show different prominence of the quantum effects and for M2 the appearance of peaks in the quasielastic scattering. (author)

  13. Shear-stress-induced structural arrangement of water molecules in nanoscale Couette flow with slipping at wall boundary

    Lin, Jau-Wen

    2014-01-01

    This study investigated the structuring of water molecules in a nanoscale Couette flow with the upper plate subjected to lateral forces with various magnitudes and water slipping against a metal wall. It was found that when the upper plate is subjected to a force, the water body deforms into a parallelepiped. Water molecules in the channel are then gradually arranged into lattice positions, creating a layered structure. The structural arrangement of water molecules is caused by the water molecules accommodating themselves to the increase in energy under the application of a lateral force on the moving plate. The ordering arrangement of water molecules increases the rotational degree of freedom, allowing the molecules to increase their Coulomb potential energy through polar rotation that accounts for the energy input through the upper plate. With a force continuously applied to the upper plate, the water molecules in contact with the upper plate move forward until slip between the water and upper plate occurs. The relation between the structural arrangement of water molecules, slip at the wall, and the shear force is studied. The relation between the slip and the locking/unlocking of water molecules to metal atoms is also studied

  14. Laser-heating-induced displacement of surfactants on the water surface

    Backus, E.H.G.; Bonn, D.; Cantin, S.; Roke, S.; Bonn, M.

    2012-01-01

    We report a combined vibrational sum-frequency generation (SFG) spectroscopy, Brewster angle microscopy (BAM), and ellipsometry study of different surfactants on water as a function of surfactant density. Vibrational SFG spectra of surfactants on the water surface in a Langmuir trough have been

  15. Emerging organic pollutants in the vadose zone of a soil aquifer treatment system: Pore water extraction using positive displacement.

    Sopilniak, Alexander; Elkayam, Roy; Rossin, Anna Voloshenko; Lev, Ovadia

    2018-01-01

    Trace organic compounds in effluents, water streams and aquifers are amply reported. However, the mobile pool of Emerging Organic Contaminants (EOCs) in the deep parts of the vadose zone is hard to estimate, due to difficulties in extraction of sufficient quantity of pore water. Here, we present a new methodology for depth profiling of EOCs in pore water by Positive Displacement Extraction (PDE): Pore water extraction from unsaturated soil samples is carried out by withdrawal of soil cores by direct-push drilling and infiltrating the core by organics free water. We show that EOC concentrations in the water eluted in the plateau region of the inverse breakthrough curve is equal to their pore water concentrations. The method was previously validated for DOC extraction, and here the scope of the methodology is extended to pore water extraction for organic pollutants analysis. Method characteristics and validation were carried out with atrazine, simazine, carbamazepine, venlafaxine, O-desmethylvenlafaxine and caffeine in the concentration range of several ng to several μg/liter. Validation was carried out by laboratory experiments on three different soils (sandy, sandy-clayey and clayey). Field studies in the vadose zone of a SAT system provided 27 m deep EOC profiles with less than 1.5 m spatial resolution. During the percolation treatment, carbamazepine remained persistent, while the other studied EOCs were attenuated to the extent of 50-99%.The highest degradation rate of all studied EOCs was in the aerobic zone. EOC levels based on PDE and extraction by centrifugation were compared, showing a positive bias for centrifugation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Will the Displacement of Zebra Mussels by Quagga Mussels Increase Water Clarity in Shallow Lakes during Summer? Results from a Mesocosm Experiment

    Mei, Xueying; Zhang, Xiufeng; Kassam, Sinan-Saleh; Rudstam, Lars G.

    2016-01-01

    Zebra mussels (Dreissena polymorpha) are known to increase water clarity and affect ecosystem processes in invaded lakes. During the last decade, the conspecific quagga mussels (D. rostriformis bugensis) have displaced zebra mussels in many ecosystems including shallow lakes such as Oneida Lake, New York. In this study, an eight-week mesocosm experiment was conducted to test the hypothesis that the displacement of zebra mussels by quagga mussels leads to further decreases in phytoplankton and...

  17. Transport of water molecules through noncylindrical pores in multilayer nanoporous graphene.

    Shahbabaei, Majid; Kim, Daejoong

    2017-08-09

    In this study, molecular dynamics (MD) simulations are used to examine the water transport properties through asymmetric hourglass-shaped pores in multilayer nanoporous graphene with a constant interlayer separation of 6 Å. The properties of the tested asymmetric hourglass-shaped pores [with the models having long cone (l 1 , -P) and short cone (l 2 , +P) entrances] are compared to a symmetric pore model. The study findings indicate that the water occupancy increases across the asymmetric pore (l 1 , -P) compared to (l 2 , +P), because of the length effect. The asymmetric pore, (l 1 , -P), yields higher flux compared to (l 2 , +P) and even the symmetric model, which can be attributed to the increase in the hydrogen bonds. In addition, the single-file water molecules across the narrowest pore diameter inside the (l 2 , +P) pore exhibit higher viscosity compared to those in the (l 1 , -P) pore because of the increase in the water layering effect. Moreover, it is found that the permeability inside the multilayer hourglass-shaped pore depends on the length of the flow path of the water molecules before approaching the layer with the smallest pore diameter. The probability of dipole orientation exhibits wider distribution inside the (l 1 , -P) system compared to (l 2 , +P), implying an enhanced formation of hydrogen bonding of water molecules. This results in the fast flow of water molecules. The MD trajectory shows that the dipole orientation across the single-layer graphene has frequently flipped compared to the dipole orientation across the pores in multilayer graphene, which is maintained during the whole simulation time (although the dipole orientation has flipped for a few picoseconds at the beginning of the simulation). This can be attributed to the energy barrier induced by the individual layer. The diffusion coefficient of water molecules inside the (l 2 , +P) system increases with pressure difference, however, it decreases inside the (l 1 , -P) system because

  18. Identification of intrinsic catalytic activity for electrochemical reduction of water molecules to generate hydrogen

    Shinagawa, Tatsuya

    2015-01-01

    Insufficient hydronium ion activities at near-neutral pH and under unbuffered conditions induce diffusion-limited currents for hydrogen evolution, followed by a reaction with water molecules to generate hydrogen at elevated potentials. The observed constant current behaviors at near neutral pH reflect the intrinsic electrocatalytic reactivity of the metal electrodes for water reduction. This journal is © the Owner Societies.

  19. STABILIZATION OF THE NEUTRAL PROTEASE OF BACILLUS-STEAROTHERMOPHILUS BY REMOVAL OF A BURIED WATER MOLECULE

    VRIEND, G; BERENDSEN, HJC; VANDERZEE, [No Value; VANDENBURG, B; VENEMA, G; EIJSINK, VGH

    1991-01-01

    Using site-directed mutagenesis, Ala166 in the neutral protease of Bacillus stearothermophilus was changed into Ser. Model building and molecular dynamics simulations of the mutant enzyme indicated that the Ser hydroxyl group fits well in a cavity which contains a water molecule in the wild-type

  20. Displacement ventilation

    Kosonen, Risto; Melikov, Arsen Krikor; Mundt, Elisabeth

    The aim of this Guidebook is to give the state-of-the art knowledge of the displacement ventilation technology, and to simplify and improve the practical design procedure. The Guidebook discusses methods of total volume ventilation by mixing ventilation and displacement ventilation and it gives...... insights of the performance of the displacement ventilation. It also shows practical case studies in some typical applications and the latest research findings to create good local micro-climatic conditions....

  1. Effects of Water Molecule on CO Oxidation by OH: Reaction Pathways, Kinetic Barriers, and Rate Constants.

    Zhang, Linyao; Yang, Li; Zhao, Yijun; Zhang, Jiaxu; Feng, Dongdong; Sun, Shaozeng

    2017-07-06

    The water dilute oxy-fuel combustion is a clean combustion technology for near-zero emission power; and the presence of water molecule could have both kinetic and dynamic effects on combustion reactions. The reaction OH + CO → CO 2 + H, one of the most important elementary reactions, has been investigated by extensive electronic structure calculations. And the effects of a single water molecule on CO oxidation have been studied by considering the preformed OH(H 2 O) complex reacts with CO. The results show little change in the reaction pathways, but the additional water molecule actually increases the vibrationally adiabatic energy barriers (V a G ). Further thermal rate constant calculations in the temperature range of 200 to 2000 K demonstrate that the total low-pressure limit rate constant for the water assisted OH(H 2 O) + CO → CO 2 + H 2 O + H reaction is 1-2 orders lower than that of the water unassisted one, which is consistent with the change of V a G . Therefore, the hydrated radical OH(H 2 O) would actually slow down the oxidation of CO. Meanwhile, comparisons show that the M06-2X/aug-cc-pVDZ method gives a much better estimation in energy and thus is recommended to be employed for direct dynamics simulations.

  2. Integration or segregation: how do molecules behave at oil/water interfaces?

    Moore, F G; Richmond, G L

    2008-06-01

    It has been over 250 years since Benjamin Franklin, fascinated with the wave-stilling effect of oil on water, performed his famous oil-drop experiments; nevertheless, the behavior of water molecules adjacent to hydrophobic surfaces continues to fascinate today. In the 18th century, the calming of the seas seemed the most pertinent application of such knowledge; today, we understand that oil-on-water phenomena underlie a range of important chemical, physical, and biological processes, including micelle and membrane formation, protein folding, chemical separation, oil extraction, nanoparticle formation, and interfacial polymerization. Beyond classical experiments of the oil-water interface, recent interest has focused on deriving a molecular-level picture of this interface or, more generally, of water molecules positioned next to any hydrophobic surface. This Account summarizes more than a decade's work from our laboratories aimed at understanding the nature of the hydrogen bonding occurring between water and a series of organic liquids in contact. Although the common perception is that water molecules and oil molecules positioned at the interface between the immiscible liquids want nothing to do with one another, we have found that weak interactions between these hydrophilic and hydrophobic molecules lead to interesting interfacial behavior, including highly oriented water molecules and layering of the organic medium that extends several molecular layers deep into the bulk organic liquid. For some organic liquids, penetration of oriented water into the organic layer is also apparent, facilitated by molecular interactions established at the molecularly thin region of first contact between the two liquids. The studies involve a combined experimental and computational approach. The primary experimental tool that we have used is vibrational sum frequency spectroscopy (VSFS), a powerful surface-specific vibrational spectroscopic method for measuring the molecular

  3. Fractionation of hydrogen and oxygen isotopes between hydrated and free water molecules in aqueous urea solution

    Kakiuchi, M.; Matsuo, S.

    1985-01-01

    Ratios of D/H and 18 O/ 16 O in the vapor phase in equilibrium with aqueous urea solution with different urea molalities were measured at 15 and 25 0 C. Under the assumption that urea solutions consist of two species, i.e., the urea-water cluster and free water, the results are interpreted to give the average hydration number, i.e., the number of water molecules per urea molecule in the urea-water cluster. Good agreement was obtained for the hydration number estimated independently from hydrogen and oxygen isotopic fractions. On the basis of hydrogen isotopic data at 25 0 C, the average hydration number of urea in the cluster is 6.3 +/- 0.8 at 2.1 m and 2.75 +/- 0.08 at saturation (20.15 m). The corresponding average hydration numbers based on oxygen isotopic data were calculated to be 6.7 +/- 2.4 at 2.1 m and 2.75 +/- 0.25 at urea saturation. HD 16 O is enriched in the urea-water cluster and H 2 18 O is enriched in free water. Isotopic partitioning between the cluster and free water is markedly different from those between hydration spheres and free water in aqueous electrolyte solutions. 29 references, 6 figures, 5 tables

  4. Structure and dynamics of water and lipid molecules in charged anionic DMPG lipid bilayer membranes

    Rønnest, A. K.; Peters, Günther H.J.; Hansen, Flemming Yssing

    2016-01-01

    Molecular dynamics simulations have been used to investigate the influence of the valency of counter-ions on the structure of freestanding bilayer membranes of the anionic 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) lipid at 310 K and 1 atm. At this temperature, the membrane is in the fluid...... compared to experimental results and used to determine an average diffusion constant for all water molecules in the system. On extrapolating the diffusion constants inferred experimentally to a temperature of 310 K, reasonable agreement with the simulations is obtained. However, the experiments do not have...... the sensitivity to confirm the diffusion of a small component of water bound to the lipids as found in the simulations. In addition, the orientation of the dipole moment of the water molecules has been determined as a function of their depth in the membrane. Previous indirect estimates of the electrostatic...

  5. Partition Coefficients of Organic Molecules in Squalane and Water/Ethanol Mixtures by Molecular Dynamics Simulations

    Lundsgaard, Rasmus; Kontogeorgis, Georgios; Economou, Ioannis G.

    2011-01-01

    coefficient can be estimated for both a small hydrophilic and a hydrophobic organic molecules between squalane (used here to mimic low density poly ethylene) and water/ethanol solutes using thermodynamic integration to calculate the free energy of solvation. Molecular dynamics simulations are performed, using...... the GROMACS software, by slowly decoupling of firstly the electrostatic and then the Lennard–Jones interactions between molecules in the simulation box. These calculations depend very much on the choice of force field. Two force fields have been tested in this work, the TraPPE-UA (united-atom) and the OPLS...

  6. Bromide as a tracer for studying water movement and nitrate displacement in soils: comparison with stable isotope tracers

    Russow, R.; Knappe, S.

    1999-01-01

    Tracers are an ideal means of studying water movement and associated nitrate displacement. Often bromide is preferred as a tracer because it is considered a representative tracer for water and because, being a conservative tracer (i.e. not involved in chemical and biological soil processes), it can be used for studying anion transport in soils. Moreover, it is less expensive and easier to measure than the stable isotopes deuterium and 15 N. Its great advantage over radioactive tracers (e.g. tritium), which outweighs their extreme sensitivity and ease of measurement and which it has in common with stable isotopes, is that it does not require radiation protection measures. However, there are also constraints on the use of bromide as a tracer in soil/water/plant systems. Our own studies on different soils using D 2 O, bromide and [ 15 N]-nitrate in lysimeters suggest that the above assumptions on bromide tracers need not always be valid under conditions as they prevail in biologically active soils. As the present paper shows, these studies permit a good assessment of the possibilities and limits to these tracers [de

  7. Measurements of water molecule density by tunable diode laser absorption spectroscopy in dielectric barrier discharges with gas-water interface

    Tachibana, Kunihide; Nakamura, Toshihiro; Kawasaki, Mitsuo; Morita, Tatsuo; Umekawa, Toyofumi; Kawasaki, Masahiro

    2018-01-01

    We measured water molecule (H2O) density by tunable diode-laser absorption spectroscopy (TDLAS) for applications in dielectric barrier discharges (DBDs) with a gas-water interface. First, the effects of water temperature and presence of gas flow were tested using a Petri dish filled with water and a gas injection nozzle. Second, the TDLAS system was applied to the measurements of H2O density in two types of DBDs; one was a normal (non-inverted) type with a dielectric-covered electrode above a water-filled counter electrode and the other was an inverted type with a water-suspending mesh electrode above a dielectric-covered counter electrode. The H2O density in the normal DBD was close to the density estimated from the saturated vapor pressure, whereas the density in the inverted DBD was about half of that in the former type. The difference is attributed to the upward gas flow in the latter type, that pushes the water molecules up towards the gas-water interface.

  8. A large outbreak of hepatitis E among a displaced population in Darfur, Sudan, 2004: the role of water treatment methods.

    Guthmann, Jean-Paul; Klovstad, Hilde; Boccia, Delia; Hamid, Nuha; Pinoges, Loretxu; Nizou, Jacques-Yves; Tatay, Mercedes; Diaz, Francisco; Moren, Alain; Grais, Rebecca Freeman; Ciglenecki, Iza; Nicand, Elisabeth; Guerin, Philippe Jean

    2006-06-15

    The conflict in Darfur, Sudan, was responsible for the displacement of 1.8 million civilians. We investigated a large outbreak of hepatitis E virus (HEV) infection in Mornay camp (78,800 inhabitants) in western Darfur. To describe the outbreak, we used clinical and demographic information from cases recorded at the camp between 26 July and 31 December 2004. We conducted a case-cohort study and a retrospective cohort study to identify risk factors for clinical and asymptomatic hepatitis E, respectively. We collected stool and serum samples from animals and performed a bacteriological analysis of water samples. Human samples were tested for immunoglobulin G and immunoglobulin M antibody to HEV (for serum samples) and for amplification of the HEV genome (for serum and stool samples). In 6 months, 2621 hepatitis E cases were recorded (attack rate, 3.3%), with a case-fatality rate of 1.7% (45 deaths, 19 of which involved were pregnant women). Risk factors for clinical HEV infection included age of 15-45 years (odds ratio, 2.13; 95% confidence interval, 1.02-4.46) and drinking chlorinated surface water (odds ratio, 2.49; 95% confidence interval, 1.22-5.08). Both factors were also suggestive of increased risk for asymptomatic HEV infection, although this was not found to be statistically significant. HEV RNA was positively identified in serum samples obtained from 2 donkeys. No bacteria were identified from any sample of chlorinated water tested. Current recommendations to ensure a safe water supply may have been insufficient to inactivate HEV and control this epidemic. This research highlights the need to evaluate current water treatment methods and to identify alternative solutions adapted to complex emergencies.

  9. QSPR Study of the Retention/release Property of Odorant Molecules in Water Using Statistical Methods

    Assia Belhassan

    2017-10-01

    Full Text Available An integrated approach physicochemistry and structures property relationships has been carried out to study the odorant molecules retention/release phenomenon in the water. This study aimed to identify the molecular properties (molecular descriptors that govern this phenomenon assuming that modifying the structure leads automatically to a change in the retention/release property of odorant molecules. ACD/ChemSketch, MarvinSketch, and ChemOffice programs were used to calculate several molecular descriptors of 51 odorant molecules (15 alcohols, 11 aldehydes, 9 ketones and 16 esters. A total of 37 molecules (2/3 of the data set were placed in the training set to build the QSPR models, whereas the remaining, 14 molecules (1/3 of the data set constitute the test set. The best descriptors were selected to establish the quantitative structure property relationship (QSPR of the retention/release property of odorant molecules in water using multiple linear regression (MLR, multiple non-linear regression (MNLR and an artificial neural network (ANN methods. We propose a quantitative model according to these analyses. The models were used to predict the retention/release property of the test set compounds, and agreement between the experimental and predicted values was verified. The descriptors showed by QSPR study are used for study and designing of new compounds. The statistical results indicate that the predicted values are in good agreement with the experimental results. To validate the predictive power of the resulting models, external validation multiple correlation coefficient was calculated and has both in addition to a performant prediction power, a favorable estimation of stability. DOI: http://dx.doi.org/10.17807/orbital.v9i4.978 

  10. Displacement Ventilation

    Nielsen, Peter Vilhelm

    Displacement ventilation is an interesting new type of air distribution principle which should be considered in connection with design of comfort ventilation in both smal1 and large spaces. Research activities on displacement ventilation are large all over the world and new knowledge of design...... methods appears continuously. This book gives an easy introduction to the basis of displacement ventilation and the chapters are written in the order which is used in a design procedure. The main text is extended by five appendices which show some of the new research activities taking place at Aalborg...

  11. Molecular Dynamics Study of Water Molecules in Interlayer of 14 ^|^Aring; Tobermorite

    Yoon, Seyoon

    2013-01-01

    The molecular structure and dynamics of interlayer water of 14 Å tobermorite are investigated based on molecular dynamics (MD) simulations. Calculated structural parameters of the interlayer water configuration are in good agreement with current knowledge of the refined structure. The MD simulations provide detailed information on the position and mobility of the hydrogen and oxygen of interlayer water, as well as its self-diffusion coefficient, through the interlayer of 14 Å tobermorite. Comparison of the MD simulation results at 100 and 300 K demonstrates that water molecules in the interlayer maintain their structure but change their mobility. The dominant configuration and self-diffusion coefficient of interlayer water are obtained in this study. Copyright © 2013 Japan Concrete Institute.

  12. Selective and Sensitive Detection of Cyanide Based on the Displacement Strategy Using a Water-Soluble Fluorescent Probe

    La, Ming; Hao, Yuanqiang; Wang, Zhaoyang; Han, Guo-Cheng; Qu, Lingbo

    2016-01-01

    A water-soluble fluorescent probe (C-GGH) was used for the highly sensitive and selective detection of cyanide (CN−) in aqueous media based on the displacement strategy. Due to the presence of the recognition unit GGH (Gly-Gly-His), the probe C-GGH can coordinate with Cu2+ and consequently display ON-OFF type fluorescence response. Furthermore, the in situ formed nonfluorescent C-GGH-Cu2+ complex can act as an effective OFF-ON type fluorescent probe for sensing CN− anion. Due to the strong binding affinity of CN− to Cu2+, CN− can extract Cu2+ from C-GGH-Cu2+ complex, leading to the release of C-GGH and the recovery of fluorescent emission of the system. The probe C-GGH-Cu2+ allowed detection of CN− in aqueous solution with a LOD (limit of detection) of 0.017 μmol/L which is much lower than the maximum contaminant level (1.9 μmol/L) for CN− in drinking water set by the WHO (World Health Organization). The probe also displayed excellent specificity for CN− towards other anions, including F−, Cl−, Br−, I−, SCN−, PO4 3−, N3 −, NO3 −, AcO−, SO4 2−, and CO3 2−. PMID:26881185

  13. Selective and Sensitive Detection of Cyanide Based on the Displacement Strategy Using a Water-Soluble Fluorescent Probe

    Ming La

    2016-01-01

    Full Text Available A water-soluble fluorescent probe (C-GGH was used for the highly sensitive and selective detection of cyanide (CN− in aqueous media based on the displacement strategy. Due to the presence of the recognition unit GGH (Gly-Gly-His, the probe C-GGH can coordinate with Cu2+ and consequently display ON-OFF type fluorescence response. Furthermore, the in situ formed nonfluorescent C-GGH-Cu2+ complex can act as an effective OFF-ON type fluorescent probe for sensing CN− anion. Due to the strong binding affinity of CN− to Cu2+, CN− can extract Cu2+ from C-GGH-Cu2+ complex, leading to the release of C-GGH and the recovery of fluorescent emission of the system. The probe C-GGH-Cu2+ allowed detection of CN− in aqueous solution with a LOD (limit of detection of 0.017 μmol/L which is much lower than the maximum contaminant level (1.9 μmol/L for CN− in drinking water set by the WHO (World Health Organization. The probe also displayed excellent specificity for CN− towards other anions, including F−, Cl−, Br−, I−, SCN−, PO43-, N3-, NO3-, AcO−, SO42-, and CO32-.

  14. Water molecule-enhanced CO2 insertion in lanthanide coordination polymers

    Luo Liushan; Huang Xiaoyuan; Wang Ning; Wu Hongyan; Chen Wenbin; Feng Zihao; Zhu Huiping; Peng Xiaoling; Li Yongxian; Huang Ling; Yue Shantang; Liu Yingliang

    2009-01-01

    Two new lanthanide coordination polymers H 2 N(CH 3 ) 2 .[Eu III 2 (L 1 ) 3 (L 2 )] (1, L 1 =isophthalic acid dianion, L 2 =formic acid anion) and [La III (2,5-PDC)(L 2 )](2, 2,5-PDC=2,5-pyridinedicarboxylate dianion) were synthesized under solvothermal conditions. It is of interest that the formic ligand (L 2 ) is not contained in the stating materials, but arises from the water molecule-enhanced CO 2 insertion during the solvothermal process. Both of the two compounds exhibit complicated three dimensional sandwich-like frameworks. - Graphical abstract: Two new lanthanide coordination polymers involving water molecule-enhanced CO 2 insertion resulting in the formation of formic anion and dimethylammonium cation were synthesized under solvothermal conditions.

  15. Tests of dielectric model descriptions of chemical charge displacements in water

    Tawa, G.J.; Pratt, L.R.

    1994-01-01

    A dielectric model of electrostatic solvation is applied to describe potentials of mean force in water along reaction paths for (a) pairing of sodium and/or chloride ions; (b) the symmetric S N 2 exchange of chloride in methylchloride; (c) nucleophilic attack of formaldehyde by hydroxide anion. For these cases simulation and XRISM results are available for comparison. The accuracy of model predictions varies from spectacular to poor. It is argued that: (a) dielectric models are physical models, even though simplistic and empirical; (b) their successes suggest that second-order perturbation theory is a physically sound description of free energies of electrostatic solvation; and (c) the most serious deficiency of the dielectric models lies in the definition of cavity volumes. Second-order perturbation theory should therefore be used to refine the dielectric models. These dielectric models make no attempt to assess the role of packing effects but for salvation of classical electrostatic interactions the dielectric models appear to perform as well as the more detailed XRISM theory

  16. Investigation of the Hydantoin Monomer and its Interaction with Water Molecules

    Gruet, Sébastien; Perez, Cristobal; Schnell, Melanie

    2017-06-01

    Hydantoin (Imidazolidine-2,4-dione, C_3H_4N_2O_2) is a five-membered heterocyclic compound of astrobiological interest. This molecule has been detected in carbonaceous chondrites [1], and its formation can rise from the presence of glycolic acid and urea, two prebiotic molecules [2]. The hydrolysis of hydantoin under acidic conditions can also produce glycine [3], an amino acid actively searched for in the interstellar medium. Spectroscopic data of hydantoin is very limited and mostly dedicated to the solid phase. The high resolution study in gas phase is restricted to the work recently published by Ozeki et al. reporting the pure rotational spectra of the ground state and two vibrational states of the molecule in the millimeter-wave region (90-370 GHz)[4]. Using chirped-pulse Fourier-transform microwave (CP-FTMW) spectroscopy, we recorded the jet-cooled rotational spectra of hydantoin with water between 2 to 8 GHz. We observed the ground state of hydantoin monomer and several water complexes with one or two water molecules. All the observed species exhibit a hyperfine structure due to the two nitrogen atoms present in the molecule, which were fully resolved and analyzed. Additional experiments with a ^{18}O enriched water sample were realized to determine the oxygen-atom positions of the water monomers. These experiments yielded accurate structural information on the preferred water binding sites. The observed complexes and the interactions that hold them together, mainly strong directional hydrogen bonds, will be presented and discussed. [1] Shimoyama, A. and Ogasawara, R., Orig. Life Evol. Biosph., 32, 165-179, 2002. DOI:10.1023/A:1016015319112. [2] Menor-Salván, C. and Marín-Yaseli, M.R., Chem. Soc. Rev., 41(16), 5404-5415, 2012. DOI:10.1039/c2cs35060b. [3] De Marcellus P., Bertrand M., Nuevo M., Westall F. and Le Sergeant d'Hendecourt L., Astrobiology. 11(9), 847-854, 2011. DOI:10.1089/ast.2011.0677. [4] Ozeki, H., Miyahara R., Ihara H., Todaka S., Kobayashi

  17. A Raman spectroscopy study on the effects of intermolecular hydrogen bonding on water molecules absorbed by borosilicate glass surface

    Li, Fabing; Li, Zhanlong; Wang, Ying; Wang, Shenghan; Wang, Xiaojun; Sun, Chenglin; Men, Zhiwei

    2018-05-01

    The structural forms of water/deuterated water molecules located on the surface of borosilicate capillaries have been first investigated in this study on the basis of the Raman spectral data obtained at different temperatures and under atmospheric pressure for molecules in bulk and also for molecules absorbed by borosilicate glass surface. The strongest two fundamental bands locating at 3063 cm-1 (2438 cm-1) in the recorded Raman spectra are assigned here to the Osbnd H (Osbnd D) bond stretching vibrations and they are compared with the corresponding bands observed at 3124 cm-1 (2325 cm-1) in the Raman spectrum of ice Ih. Our spectroscopic observations have indicated that the structure of water and deuterated water molecules on borosilicate surface is similar to that of ice Ih (hexagonal phase of ice). These observations have also indicated that water molecules locate on the borosilicate surface so as to construct a bilayer structure and that strong and weak intermolecular hydrogen bonds are formed between water/deuterated molecules and silanol groups on borosilicate surface. In accordance with these findings, water and deuterated water molecules at the interface of capillary have a higher melting temperature.

  18. Quantification of the Intracellular Life Time of Water Molecules to Measure Transport Rates of Human Aquaglyceroporins.

    Palmgren, Madelene; Hernebring, Malin; Eriksson, Stefanie; Elbing, Karin; Geijer, Cecilia; Lasič, Samo; Dahl, Peter; Hansen, Jesper S; Topgaard, Daniel; Lindkvist-Petersson, Karin

    2017-12-01

    Orthodox aquaporins are transmembrane channel proteins that facilitate rapid diffusion of water, while aquaglyceroporins facilitate the diffusion of small uncharged molecules such as glycerol and arsenic trioxide. Aquaglyceroporins play important roles in human physiology, in particular for glycerol metabolism and arsenic detoxification. We have developed a unique system applying the strain of the yeast Pichia pastoris, where the endogenous aquaporins/aquaglyceroporins have been removed and human aquaglyceroporins AQP3, AQP7, and AQP9 are recombinantly expressed enabling comparative permeability measurements between the expressed proteins. Using a newly established Nuclear Magnetic Resonance approach based on measurement of the intracellular life time of water, we propose that human aquaglyceroporins are poor facilitators of water and that the water transport efficiency is similar to that of passive diffusion across native cell membranes. This is distinctly different from glycerol and arsenic trioxide, where high glycerol transport efficiency was recorded.

  19. Single-Molecule Imaging of DNAs with Sticky Ends at Water/Fused Silica Interface

    Isailovic, Slavica [Iowa State Univ., Ames, IA (United States)

    2005-01-01

    Total internal reflection fluorescence microscopy (TIRFM) was used to study intermolecular interactions of DNAs with unpaired (sticky) ends of different lengths at water/fused silica interface at the single-molecule level. Evanescent field residence time, linear velocity and adsorption/desorption frequency were measured in a microchannel for individual DNA molecules from T7, Lambda, and PSP3 phages at various pH values. The longest residence times and the highest adsorption/desorption frequencies at the constant flow at pH 5.5 were found for PSP3 DNA, followed by lower values for Lambda DNA, and the lowest values for T7 DNA. Since T7, Lambda, and PSP3 DNA molecules contain none, twelve and nineteen unpaired bases, respectively, it was concluded that the affinity of DNAs for the surface increases with the length of the sticky ends. This confirms that hydrophobic and hydrogen-bonding interactions between sticky ends and fused-silica surface are driving forces for DNA adsorption at the fused-silica surface. Described single-molecule methodology and results therein can be valuable for investigation of interactions in liquid chromatography, as well as for design of DNA hybridization sensors and drug delivery systems.

  20. Modeling the Release Kinetics of Poorly Water-Soluble Drug Molecules from Liposomal Nanocarriers

    Stephan Loew

    2011-01-01

    Full Text Available Liposomes are frequently used as pharmaceutical nanocarriers to deliver poorly water-soluble drugs such as temoporfin, cyclosporine A, amphotericin B, and paclitaxel to their target site. Optimal drug delivery depends on understanding the release kinetics of the drug molecules from the host liposomes during the journey to the target site and at the target site. Transfer of drugs in model systems consisting of donor liposomes and acceptor liposomes is known from experimental work to typically exhibit a first-order kinetics with a simple exponential behavior. In some cases, a fast component in the initial transfer is present, in other cases the transfer is sigmoidal. We present and analyze a theoretical model for the transfer that accounts for two physical mechanisms, collisions between liposomes and diffusion of the drug molecules through the aqueous phase. Starting with the detailed distribution of drug molecules among the individual liposomes, we specify the conditions that lead to an apparent first-order kinetic behavior. We also discuss possible implications on the transfer kinetics of (1 high drug loading of donor liposomes, (2 attractive interactions between drug molecules within the liposomes, and (3 slow transfer of drugs between the inner and outer leaflets of the liposomes.

  1. Structural analysis on mutation residues and interfacial water molecules for human TIM disease understanding

    2013-01-01

    Background Human triosephosphate isomerase (HsTIM) deficiency is a genetic disease caused often by the pathogenic mutation E104D. This mutation, located at the side of an abnormally large cluster of water in the inter-subunit interface, reduces the thermostability of the enzyme. Why and how these water molecules are directly related to the excessive thermolability of the mutant have not been investigated in structural biology. Results This work compares the structure of the E104D mutant with its wild type counterparts. It is found that the water topology in the dimer interface of HsTIM is atypical, having a "wet-core-dry-rim" distribution with 16 water molecules tightly packed in a small deep region surrounded by 22 residues including GLU104. These water molecules are co-conserved with their surrounding residues in non-archaeal TIMs (dimers) but not conserved across archaeal TIMs (tetramers), indicating their importance in preserving the overall quaternary structure. As the structural permutation induced by the mutation is not significant, we hypothesize that the excessive thermolability of the E104D mutant is attributed to the easy propagation of atoms' flexibility from the surface into the core via the large cluster of water. It is indeed found that the B factor increment in the wet region is higher than other regions, and, more importantly, the B factor increment in the wet region is maintained in the deeply buried core. Molecular dynamics simulations revealed that for the mutant structure at normal temperature, a clear increase of the root-mean-square deviation is observed for the wet region contacting with the large cluster of interfacial water. Such increase is not observed for other interfacial regions or the whole protein. This clearly suggests that, in the E104D mutant, the large water cluster is responsible for the subunit interface flexibility and overall thermolability, and it ultimately leads to the deficiency of this enzyme. Conclusions Our study

  2. Mixing of alcohol and water molecules studied by neutron probe. Structure and dynamics

    Yoshida, Koji

    2001-01-01

    Structure of water/alcohol mixing solution was studied by three methods such as an isotope-exchanged neutron scattering method, RISM (Reference Interaction Site Model) integral equation and a neutron spin echo method. The principle of methods, experiments and results were reported. The results of experiments of water/tert-butyl alcohol (TBA) solution by the isotope-exchange neutron scattering method showed TBA molecule associated with each other through end methyl group. Especially this effect was the largest at x TBA = 0.06 and decreased with increasing the concentration of TBA. However, hydrogen bonding of TBA was very rare at x TBA = 0.06. By the partial radial distribution function obtained from RISM integral equation, it indicated that the structure of pure TBA became chain structure by hydrogen bond but changed to the structure contacted directly each hydrophobic group with increasing the concentration of water. Water/2-butoxyethanol (BE) mixing solution was measured by a neutron spin echo method. The activation energy of the diffusion coefficients obtained agreed to the energy of hydrogen bonding. The temperature response of diffusion coefficients showed the inverse of the experimental results obtained by the dynamic light scattering method. The difference between two measurement methods was different time scale and space scale. Namely, the object of the neutron scattering method is nano meter and nano second, but one of light scattering method many times over. It was proved from the above results that there was the cluster consisted of the same kind of molecule in the homogeneous two components solution, but the cluster was not stable and constantly exchanged with molecule, where the production and decay of the cluster is repeated at about nano sec. (S.Y.)

  3. Influence of the water molecules near surface of viral protein on virus activation process

    O, Shepelenko S; S, Salnikov A; V, Rak S; P, Goncharova E; B, Ryzhikov A, E-mail: shep@vector.nsc.r, E-mail: shep@ngs.r [Federal State Research Institution State Research Center of Virology and Biotechnology VECTOR of the Federal Service for Surveillance in Consumer Rights Protection and Human Well-being (FSRI SRC VB VECTOR) Koltsovo, Novosibirsk Region (Russian Federation)

    2009-06-01

    The infection of a cell with influenza virus comprises the stages of receptor binding to the cell membrane, endocytosis of virus particle, and fusion of the virus envelope and cell endosome membrane, which is determined by the conformational changes in hemagglutinin, a virus envelope protein, caused by pH decrease within the endosome. The pH value that induces conformation rearrangements of hemagglutinin molecule considerably varies for different influenza virus strains, first and foremost, due to the differences in amino acid structure of the corresponding proteins. The main goal of this study was to construct a model making it possible to assess the critical pH value characterizing the fusogenic activity of influenza virus hemagglutinin from the data on hemagglutinin structure and experimental verification of this model. Under this model, we assume that when the electrostatic force between interacting hemagglutinin molecules in the virus envelop exceeds a certain value, the hemagglutinin HA1 subunits are arranged so that they form a cavity sufficient for penetration of water molecules. This event leads to an irreversible hydration of the inner fragments of hemagglutinin molecule in a trimer and to the completion of conformational changes. The geometry of electrostatic field in hemagglutinin trimer was calculated taking into account the polarization effects near the interface of two dielectrics, aqueous medium and protein macromolecule. The critical pH values for the conformational changes in hemagglutinin were measured by the erythrocyte hemolysis induced by influenza virus particles when decreasing pH. The critical pH value conditionally separating the pH range into the regions with and without the conformational changes was calculated for several influenza virus H1N1 and H3N2 strains based on the data on the amino acid structure of the corresponding hemagglutinin molecules. Comparison of the theoretical and experimental values of critical pH values for

  4. Ab Initio Density Functional Theory Investigation of the Interaction between Carbon Nanotubes and Water Molecules during Water Desalination Process

    Loay A. Elalfy

    2013-01-01

    Full Text Available Density functional theory calculations using B3LYP/3-21G level of theory have been implemented on 6 carbon nanotubes (CNTs structures (3 zigzag and 3 armchair CNTs to study the energetics of the reverse osmosis during water desalination process. Calculations of the band gap, interaction energy, highest occupied molecular orbital, lowest unoccupied molecular orbital, electronegativity, hardness, and pressure of the system are discussed. The calculations showed that the water molecule that exists inside the CNT is about 2-3 Å away from its wall. The calculations have proven that the zigzag CNTs are more efficient for reverse osmosis water desalination process than armchair CNTs as the reverse osmosis process requires pressure of approximately 200 MPa for armchair CNTs, which is consistent with the values used in molecular dynamics simulations, while that needed when using zigzag CNTs was in the order of 60 MPa.

  5. The adsorption and dissociation of water molecule on goethite (010) surface: A DFT approach

    Zhou, Long, E-mail: shuweixia@ouc.edu.cn [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China); Xiu, Fangyuan [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China); Qiu, Meng [Qingdao Institute of Bioenergy and Bioprocess Technology (China); Xia, Shuwei; Yu, Liangmin [Key Laboratory of Marine Chemistry Theory and Technology, Ministry of Education, Ocean University of China, College of Chemistry and Chemical Engineering (China)

    2017-01-15

    Graphical abstract: The optimized structure of hydrated goethite (010) surface with medium water coverage (water density about 6.7 H{sub 2}O/nm{sup 2}). - Highlights: • Stable adsorption and dissociation structure of H{sub 2}O on goethite (010) surface was investigated by DFT. • Reasonable path for water dissociation was proposed by transitional state analysis. • The mechanism of water adsorption on goethite and binding nature were revealed by PDOS. - Abstract: Using density functional theory (DFT) calculation, we investigate the configuration, stability and electronic properties of fresh cleaved (010) goethite surface (Pnma) and this surface exposed to water monolayer at low, medium and high coverage. Water is predicted to be chemisorbed to the surface, together with the surface reconstruction. The interaction energy of the most stable configuration of both low and medium coverage per water molecule is almost the same (−1.17 eV), while that of high coverage is much lower (less than 1.03 eV). It indicates that highly hydrated surface is less stable. PDOS analysis reveals the adsorption of H{sub 2}O is due to the formation of Fe−O bond, caused by overlapping of Fe's 3d and O's 2p orbitals. Dissociation processes at low and medium water coverage are non-spontaneous; while at high coverage, it can undertake spontaneously both thermodynamically and dynamically. The dissociation paths of all three water coverage are the similar. The proton from one adsorbed water is likely to dissociate to bind to the vicinal surface μ{sub 3}−O as an intermediate product; the proton belonged to μ{sub 3}−O transferred to the neighbor surface μ{sub 2}−O as the dissociative configuration.

  6. Multipole moments of water molecules in clusters and ice Ih from first principles calculations

    Batista, E.R.; Xantheas, S.S.; Jonsson, H.

    1999-01-01

    We have calculated molecular multipole moments for water molecules in clusters and in ice Ih by partitioning the charge density obtained from first principles calculations. Various schemes for dividing the electronic charge density among the water molecules were used. They include Bader close-quote s zero flux surfaces and Voronoi partitioning schemes. A comparison was also made with an induction model including dipole, dipole-quadrupole, quadrupole-quadrupole polarizability and first hyperpolarizability as well as fixed octopole and hexadecapole moments. We have found that the different density partitioning schemes lead to widely different values for the molecular multipoles, illustrating how poorly defined molecular multipoles are in clusters and condensed environments. For instance, the magnitude of the molecular dipole moment in ice Ih ranges between 2.3 D and 3.1 D depending on the partitioning scheme used. Within each scheme, though, the value for the molecular dipole moment in ice is larger than in the hexamer. The magnitude of the molecular dipole moment in the clusters shows a monotonic increase from the gas phase value to the one in ice Ih, with the molecular dipole moment in the water ring hexamer being smaller than the one in ice Ih for all the partitioning schemes used. copyright 1999 American Institute of Physics

  7. Displacement Ventilation

    Bjørn, Erik; Mattsson, Magnus; Sandberg, Mats

    Full-scale experiments were made in a displacement ventilated room with two breathing thermal manikins to study the effect of movements and breathing on the vertical contaminant distribution, and on the personal exposure of occupants. Concentrations were measured with tracer gas equipment...

  8. Continuum Navier-Stokes modelling of water ow past fullerene molecules

    Walther, J. H.; Popadic, A.; Koumoutsakos, P.

    We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the computational cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently...

  9. Continuum Navier-Stokes modelling of water flow past fullerene molecules

    Walther, J. H.; Popadic, A.; Koumoutsakos, P.

    We present continuum simulations of water flow past fullerene molecules. The governing Navier-Stokes equations are complemented with the Navier slip boundary condition with a slip length that is extracted from related molecular dynamics simulations. We find that several quantities of interest...... as computed by the present model are in good agreement with results from atomistic and atomistic-continuum simulations at a fraction of the computational cost. We simulate the flow past a single fullerene and an array of fullerenes and demonstrate that such nanoscale flows can be computed efficiently...

  10. Microflow Mechanism of Oil Displacement by Viscoelastic Hydrophobically Associating Water-Soluble Polymers in Enhanced Oil Recovery

    Huiying Zhong

    2018-06-01

    Full Text Available Polymer flooding plays an important role in enhanced oil recovery (EOR, particularly in China, where partially hydrolyzed polyacrylamide (HPAM and hydrophobically associating water-soluble polymers (HAWP are used in onshore and offshore reservoirs, respectively. Many researchers have highlighted the elasticity of HPAM, which can be used to improve the sweep efficiency, i.e., the ratio of the area swept by an injected fluid to the oil area. On the other hand, fewer studies exist on the elasticity of HAWP. In this study, we investigate the flow of HAWP and Xanthan solutions with identical viscosities in core experiments in terms of elasticity; results reveal that the HAWP can produce shear thickening in the core. The constitutive equation for the HAWP can be obtained using the simulation results matched with the experimental data. On the basis of these experiments, we established a two-phase flow model of a polymer and oil, including the continuity, momentum, constitutive, and phase equations. The volume-of-fluid (VOF method was used to track the interface between the two phases. A complex pore model was established based on the glass-etched model used in the experiment. We used the OpenFOAM platform to solve the mathematical model. The saturation, pressure, and stress tensor distributions were obtained. The results show that the displacement efficiency increased as the elasticity of the polymer increased; accordingly, the elasticity can enlarge the sweep area and decrease the residual oil saturation. As the elasticity increases, the stresses (the first normal stress, second normal stress, and shear stress increase. Finally, the results obtained in this study can be used as a guideline in polymer design, screening, and optimization in the polymer flooding oilfields.

  11. Explicit Consideration of Water Molecules to Study Vibrational Circular DICHROÎSM of Monosaccharide's

    Moussi, Sofiane; Ouamerali, Ourida

    2014-06-01

    Carbohydrates have multiples roles in biological systems. It has been found that the glycoside bond is fundamentally important in many aspects of chemistry and biology and forms the basis of carbohydrate chemistry. That means the stereochemical information, namely, glycosidic linkages α or β, gives an significant features of the carbohydrate glycosidation position of the glycosylic acceptor. For these reasons, much effort was made for the synthesis and analysis of the glycoside bond. Vibrational circular dichroism VCD has some advantages over conventional electronic circular dichroism (ECD) due to the applicability to all organic molecules and the reliability of ab initio quantum calculation. However, for a molecule with many chiral centers such as carbohydrates, determination of the absolute configuration tends to be difficult because the information from each stereochemical center is mixed and averaged over the spectrum. In the CH stretching region, only two VCD studies on carbohydrates have been reported and spectra--structure correlation, as determined for the glycoside band, remains to be investigated. T. Taniguchi and collaborators report that methyl glycosides exhibit a characteristic VCD peak, the sign of which solely reflects the C-1 absolute configuration. This work is a theoretical contribution to study the behaviour of VCD spectrum's of the monosaccharides when the water molecules are taken explicitly. This study is focused on six different monosaccharides in theirs absolute configuration R and S. We used the method of density functional theory DFT by means of the B3LYP hybrid functional and 6-31G * basis set.

  12. Water and oxygen induced degradation of small molecule organic solar cells

    Hermenau, Martin; Riede, Moritz; Leo, Karl

    2011-01-01

    Small molecule organic solar cells were studied with respect to water and oxygen induced degradation by mapping the spatial distribution of reaction products in order to elucidate the degradation patterns and failure mechanisms. The active layers consist of a 30 nm bulk heterojunction formed......,4′-diamine p-doped with C60F36 (MeO-TPD:C60F36), which acted as hole transporting layer. Indium-tin-oxide (ITO) and aluminum served as hole and electron collecting electrode, respectively. Time-of-flight secondary ion mass spectrometry (TOF-SIMS) and X-ray photoelectron spectroscopy (XPS) in conjunction...... of aluminum oxide at the BPhen/Al interface, and diffusion of water into the ZnPc:C60 layer where ZnPc becomes oxidized. Finally, diffusion from the electrodes was found to have no or a negligible effect on the device lifetime....

  13. Conserved hydrogen bonds and water molecules in MDR HIV-1 protease substrate complexes

    Liu, Zhigang [Wayne State Univ., Detroit, MI (United States); Case Western Reserve Univ., Cleveland, OH (United States); Harbor Hospital Baltimore, MD (United States); Wang, Yong [Wayne State Univ., Detroit, MI (United States); Yedidi, Ravikiran S. [Wayne State Univ., Detroit, MI (United States); National Institutes of Health, Bethesda, MD (United States); Dewdney, Tamaria G. [Wayne State Univ., Detroit, MI (United States); Reiter, Samuel J. [Wayne State Univ., Detroit, MI (United States); Brunzelle, Joseph S. [Northwestern Univ. Feinberg School of Medicine, Chicago, IL (United States); Kovari, Iulia A. [Wayne State Univ., Detroit, MI (United States); Kovari, Ladislau C. [Wayne State Univ., Detroit, MI (United States)

    2012-12-19

    Success of highly active antiretroviral therapy (HAART) in anti-HIV therapy is severely compromised by the rapidly developing drug resistance. HIV-1 protease inhibitors, part of HAART, are losing their potency and efficacy in inhibiting the target. Multi-drug resistant (MDR) 769 HIV-1 protease (resistant mutations at residues 10, 36, 46, 54, 62, 63, 71, 82, 84, 90) was selected for the present study to understand the binding to its natural substrates. The nine crystal structures of MDR769 HIV-1 protease substrate hepta-peptide complexes were analyzed in order to reveal the conserved structural elements for the purpose of drug design against MDR HIV-1 protease. Our structural studies demonstrated that highly conserved hydrogen bonds between the protease and substrate peptides, together with the conserved crystallographic water molecules, played a crucial role in the substrate recognition, substrate stabilization and protease stabilization. Additionally, the absence of the key flap-ligand bridging water molecule might imply a different catalytic mechanism of MDR769 HIV-1 protease compared to that of wild type (WT) HIV-1 protease.

  14. Tuning dissociation using isoelectronically doped graphene and hexagonal boron nitride: Water and other small molecules

    Al-Hamdani, Yasmine S. [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Chemistry, University College London, 20 Gordon Street, London WC1H 0AJ (United Kingdom); Alfè, Dario [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Earth Sciences, University College London, Gower Street, London WC1E 6BT (United Kingdom); Lilienfeld, O. Anatole von [Institute of Physical Chemistry and National Center for Computational Design and Discovery of Novel Materials (MARVEL), Department of Chemistry, University of Basel, Klingelbergstrasse 80, CH-4056 Basel (Switzerland); Michaelides, Angelos, E-mail: angelos.michaelides@ucl.ac.uk [Thomas Young Centre and London Centre for Nanotechnology, 17–19 Gordon Street, London WC1H 0AH (United Kingdom); Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom)

    2016-04-21

    Novel uses for 2-dimensional materials like graphene and hexagonal boron nitride (h-BN) are being frequently discovered especially for membrane and catalysis applications. Still however, a great deal remains to be understood about the interaction of environmentally and industrially relevant molecules such as water with these materials. Taking inspiration from advances in hybridising graphene and h-BN, we explore using density functional theory, the dissociation of water, hydrogen, methane, and methanol on graphene, h-BN, and their isoelectronic doped counterparts: BN doped graphene and C doped h-BN. We find that doped surfaces are considerably more reactive than their pristine counterparts and by comparing the reactivity of several small molecules, we develop a general framework for dissociative adsorption. From this a particularly attractive consequence of isoelectronic doping emerges: substrates can be doped to enhance their reactivity specifically towards either polar or non-polar adsorbates. As such, these substrates are potentially viable candidates for selective catalysts and membranes, with the implication that a range of tuneable materials can be designed.

  15. Identification of Carboxylate, Phosphate, and Phenoxide Functionalities in Deprotonated Molecules Related to Drug Metabolites via Ion-Molecule Reactions with water and Diethylhydroxyborane

    Zhu, Hanyu; Ma, Xin; Kong, John Y.; Zhang, Minli; Kenttämaa, Hilkka I.

    2017-10-01

    Tandem mass spectrometry based on ion-molecule reactions has emerged as a powerful tool for structural elucidation of ionized analytes. However, most currently used reagents were designed to react with protonated analytes, making them suboptimal for acidic analytes that are preferentially detected in negative ion mode. In this work we demonstrate that the phenoxide, carboxylate, and phosphate functionalities can be identified in deprotonated molecules by use of a combination of two reagents, diethylmethoxyborane (DEMB) and water. A novel reagent introduction setup that allowed DEMB and water to be separately introduced into the ion trap region of the mass spectrometer was developed to facilitate fundamental studies of this reaction. A new reagent, diethylhydroxyborane (DEHB), was generated inside the ion trap by hydrolysis of DEMB on introduction of water. Most carboxylates and phenoxides formed a DEHB adduct, followed by addition of one water molecule and subsequent ethane elimination (DEHB adduct +H2O - CH3CH3) as the major product ion. Phenoxides with a hydroxy group adjacent to the deprotonation site and phosphates formed a DEHB adduct, followed by ethane elimination (DEHB adduct - CH3CH3). Deprotonated molecules with strong intramolecular hydrogen bonds or without the aforementioned functionalities, including sulfates, were unreactive toward DEHB/H2O. Reaction mechanisms were explored via isotope labeling experiments and quantum chemical calculations. The mass spectrometry method allowed the differentiation of phenoxide-, carboxylate-, phosphate-, and sulfate-containing analytes. Finally, it was successfully coupled with high-performance liquid chromatography for the analysis of a mixture containing hymecromone, a biliary spasm drug, and its three possible metabolites. [Figure not available: see fulltext.

  16. Control of unidirectional transport of single-file water molecules through carbon nanotubes in an electric field.

    Su, Jiaye; Guo, Hongxia

    2011-01-25

    The transport of water molecules through nanopores is not only crucial to biological activities but also useful for designing novel nanofluidic devices. Despite considerable effort and progress that has been made, a controllable and unidirectional water flow is still difficult to achieve and the underlying mechanism is far from being understood. In this paper, using molecular dynamics simulations, we systematically investigate the effects of an external electric field on the transport of single-file water molecules through a carbon nanotube (CNT). We find that the orientation of water molecules inside the CNT can be well-tuned by the electric field and is strongly coupled to the water flux. This orientation-induced water flux is energetically due to the asymmetrical water-water interaction along the CNT axis. The wavelike water density profiles are disturbed under strong field strengths. The frequency of flipping for the water dipoles will decrease as the field strength is increased, and the flipping events vanish completely for the relatively large field strengths. Most importantly, a critical field strength E(c) related to the water flux is found. The water flux is increased as E is increased for E ≤ E(c), while it is almost unchanged for E > E(c). Thus, the electric field offers a level of governing for unidirectional water flow, which may have some biological applications and provides a route for designing efficient nanopumps.

  17. [Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

    Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

    2013-01-01

    To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

  18. Finite-bias electronic transport of molecules in a water solution

    Rungger, Ivan; Chen, X.; Sanvito, Stefano; Schwingenschlö gl, Udo

    2010-01-01

    The effects of water wetting conditions on the transport properties of molecular nanojunctions are investigated theoretically by using a combination of empirical-potential molecular-dynamics and first-principles electronic-transport calculations. These are at the level of the nonequilibrium Green’s-function method implemented for self-interaction corrected density-functional theory. We find that water effectively produces electrostatic gating to the molecular junction with a gating potential determined by the time-averaged water dipole field. Such a field is large for the polar benzene-dithiol molecule, resulting in a transmission spectrum shifted by about 0.6 eV with respect to that of the dry junction. The situation is drastically different for carbon nanotubes (CNTs). In fact, because of their hydrophobic nature the gating is almost negligible so that the average transmission spectrum of wet Au/CNT/Au junctions is essentially the same as that in dry conditions. This suggests that CNTs can be used as molecular interconnects also in water-wet situations, for instance, as tips for scanning tunnel microscopy in solution or in biological sensors.

  19. Finite-bias electronic transport of molecules in a water solution

    Rungger, Ivan

    2010-06-04

    The effects of water wetting conditions on the transport properties of molecular nanojunctions are investigated theoretically by using a combination of empirical-potential molecular-dynamics and first-principles electronic-transport calculations. These are at the level of the nonequilibrium Green’s-function method implemented for self-interaction corrected density-functional theory. We find that water effectively produces electrostatic gating to the molecular junction with a gating potential determined by the time-averaged water dipole field. Such a field is large for the polar benzene-dithiol molecule, resulting in a transmission spectrum shifted by about 0.6 eV with respect to that of the dry junction. The situation is drastically different for carbon nanotubes (CNTs). In fact, because of their hydrophobic nature the gating is almost negligible so that the average transmission spectrum of wet Au/CNT/Au junctions is essentially the same as that in dry conditions. This suggests that CNTs can be used as molecular interconnects also in water-wet situations, for instance, as tips for scanning tunnel microscopy in solution or in biological sensors.

  20. Orbiting Water Molecules Dance to Tune Of Galaxy's "Central Engine," Astronomers Say

    2000-01-01

    A disk of water molecules orbiting a supermassive black hole at the core of a galaxy 60 million light-years away is "reverberating" in response to variations in the energy output from the galaxy's powerful "central engine" close to the black hole, astronomers say. The team of astronomers used the National Science Foundation's (NSF) Very Large Array (VLA) radio telescope in New Mexico and the 100-meter-diameter radio telescope of the Max Planck Institute for Radio Astronomy at Effelsberg, Germany, to observe the galaxy NGC 1068 in the constellation Cetus. They announced their findings today at the American Astronomical Society's meeting in Atlanta. The water molecules, in a disk some 5 light-years in diameter, are acting as a set of giant cosmic radio-wave amplifiers, called masers. Using energy radiated by the galaxy's "central engine," the molecules strengthen, or brighten, radio emission at a particular frequency as seen from Earth. "We have seen variations in the radio 'brightness' of these cosmic amplifiers that we believe were caused by variations in the energy output of the central engine," said Jack Gallimore, an astronomer at the National Radio Astronomy Observatory (NRAO) in Charlottesville, VA. "This could provide us with a valuable new tool for learning about the central engine itself," he added. Gallimore worked with Stefi Baum of the Space Telescope Science Institute in Baltimore, MD; Christian Henkel of the Max Planck Institute for Radio Astronomy in Bonn, Germany; Ian Glass of the South African Astronomical Observatory; Mark Claussen of the NRAO in Socorro, NM; and Almudena Prieto of the European Southern Observatory in Munich, Germany. "Our observations show that NGC 1068 is the second-known case of a giant disk of water molecules orbiting a supermassive black hole at a galaxy's core," Gallimore said. The first case was the galaxy NGC 4258 (Messier 106), whose disk of radio-amplifying water molecules was measured by the NSF's Very Long Baseline

  1. Relationship between diffusivity of water molecules inside hydrating tablets and their drug release behavior elucidated by magnetic resonance imaging.

    Kikuchi, Shingo; Onuki, Yoshinori; Kuribayashi, Hideto; Takayama, Kozo

    2012-01-01

    We reported previously that sustained release matrix tablets showed zero-order drug release without being affected by pH change. To understand drug release mechanisms more fully, we monitored the swelling and erosion of hydrating tablets using magnetic resonance imaging (MRI). Three different types of tablets comprised of polyion complex-forming materials and a hydroxypropyl methylcellulose (HPMC) were used. Proton density- and diffusion-weighted images of the hydrating tablets were acquired at intervals. Furthermore, apparent self-diffusion coefficient maps were generated from diffusion-weighted imaging to evaluate the state of hydrating tablets. Our findings indicated that water penetration into polyion complex tablets was faster than that into HPMC matrix tablets. In polyion complex tablets, water molecules were dispersed homogeneously and their diffusivity was relatively high, whereas in HPMC matrix tablets, water molecule movement was tightly restricted within the gel. An optimal tablet formulation determined in a previous study had water molecule penetration and diffusivity properties that appeared intermediate to those of polyion complex and HPMC matrix tablets; water molecules were capable of penetrating throughout the tablets and relatively high diffusivity was similar to that in the polyion complex tablet, whereas like the HPMC matrix tablet, it was well swollen. This study succeeded in characterizing the tablet hydration process. MRI provides profound insight into the state of water molecules in hydrating tablets; thus, it is a useful tool for understanding drug release mechanisms at a molecular level.

  2. Displacing use

    Kelly, Janet; Matthews, Ben

    2014-01-01

    -centred design process. We identified alternative design-relevant relationships between people and devices that are not specifically tied to the functions/uses of the devices, e.g. relationships between the healthcare professional and the device, between doctors and patients, and between patients and their own......This paper critically discusses the concept of use in design, suggesting that relevant relationships other than use are sometimes obscured by the usercentredness of design processes. We present a design case from the medical device domain that displaced the concept of use from the centre of a human...

  3. Anisotropic conductivity tensor imaging in MREIT using directional diffusion rate of water molecules

    Kwon, Oh In; Jeong, Woo Chul; Sajib, Saurav Z K; Kim, Hyung Joong; Woo, Eung Je

    2014-01-01

    Magnetic resonance electrical impedance tomography (MREIT) is an emerging method to visualize electrical conductivity and/or current density images at low frequencies (below 1 KHz). Injecting currents into an imaging object, one component of the induced magnetic flux density is acquired using an MRI scanner for isotropic conductivity image reconstructions. Diffusion tensor MRI (DT-MRI) measures the intrinsic three-dimensional diffusion property of water molecules within a tissue. It characterizes the anisotropic water transport by the effective diffusion tensor. Combining the DT-MRI and MREIT techniques, we propose a novel direct method for absolute conductivity tensor image reconstructions based on a linear relationship between the water diffusion tensor and the electrical conductivity tensor. We first recover the projected current density, which is the best approximation of the internal current density one can obtain from the measured single component of the induced magnetic flux density. This enables us to estimate a scale factor between the diffusion tensor and the conductivity tensor. Combining these values at all pixels with the acquired diffusion tensor map, we can quantitatively recover the anisotropic conductivity tensor map. From numerical simulations and experimental verifications using a biological tissue phantom, we found that the new method overcomes the limitations of each method and successfully reconstructs both the direction and magnitude of the conductivity tensor for both the anisotropic and isotropic regions. (paper)

  4. Bond rearrangement caused by sudden single and multiple ionization of water molecules

    Ben-Itzhak, I.; Sayler, A. Max; Leonard, M.; Maseberg, J.W.; Hathiramani, D.; Wells, E.; Smith, M.A.; Xia, Jiangfan; Wang, Pengqian; Carnes, K.D.; Esry, B.D.

    2005-01-01

    Bond rearrangement, namely the dissociation of water into H 2 + +O q+ following ionization by fast proton and highly charged ion impact, was investigated. Single ionization by fast proton impact exhibits a strong isotopic effect, the dissociation of H 2 O + ->H 2 + +O being about twice as likely as D 2 O + ->D 2 + +O, with HDO + ->HD + +O in between. This suggests that the bond rearrangement does not happen during the slow dissociation, but rather during the very fast ionization, and thus H 2 + should also be produced when the water molecule is multiply ionized. We observed that the H 2 + +O + and H 2 + +O 2+ production in 1MeV/amu F 7+ +H 2 O collisions are 0.209+/-0.006% and 0.0665+/-0.003%, respectively, of the main double-ionization dissociation product, H 2 O 2+ ->H + +OH + . This ratio is similar to the triple to double ionization ratio in similar collisions with atomic targets thus suggesting that the bond-rearrangement fraction out of each ionization level is approximately constant. Similar dissociation channels in the heavier water isotopes, which are expected to be smaller, are under study. Finally, the fragmentation of HDO exhibits very strong isotopic preference for breaking the OH bond over the OD bond

  5. Adsorption of ethyl xanthate on ZnS(110) surface in the presence of water molecules: A DFT study

    Long, Xianhao [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Chen, Jianhua, E-mail: jhchen@gxu.edu.cn [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Guangxi Colleges and University Key Laboratory of Minerals Engineering, 530004 (China); Chen, Ye, E-mail: fby18@126.com [College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China)

    2016-05-01

    Graphical abstract: - Highlights: • Adsorption of water molecules decreases the reactivity of surface Zn atom. • Copper impurities decrease the band gap of ZnS surface. • Copper impurities enhance the adsorption of xanthate on the ZnS surface. • Water molecules have little influence on the properties of Cu-substituted ZnS surface. • The xanthate S atom can interact with the surface S atom of Cu-substituted ZnS surface. - Abstracts: The interaction of collector with the mineral surface plays a very important role in the froth flotation of sphalerite. The adsorptions occurred at the interface between the mineral surface and waters; however most of DFT simulations are performed in vacuum, without consideration of water effect. Semiconductor surface has an obvious proximity effect, which will greatly influence the surface reactivity. To understand the mechanism of xanthate interacting with sphalerite surface in the presence of water molecules, the ethyl xanthate molecule adsorption on un-activated and Cu-activated ZnS(110) surface in the absence and presence of water molecules were performed using the density functional theory (DFT) method. The calculated results show that the adsorption of water molecules dramatically changes the properties of ZnS surface, resulting in decreasing the reactivity of surface Zn atoms with xanthate. Copper activation of ZnS surface changes the surface properties, leading to the totally different adsorption behaviors of xanthate. The presence of waters has little influence on the properties of Cu-activated ZnS surface. The xanthate S atom can interact with the surface S atom of Cu-substituted ZnS surface, which would result in the formation of dixanthogen.

  6. Two-dimensional crystallography of amphiphilic molecules at the air-water interface

    Jacquemain, D.; Grayer Wolf, S.; Leveiller, F.

    1992-01-01

    The advent of well-collimated, high-intensity synchrotron X-ray sources and the consequent development of surface-specific X-ray diffraction and fluorescence techniques have recently revolutionized the study of Langmuir monolayers at the air-liquid interface. These methods allowed for the first......, and review recent results obtained from them for Langmuir films. The methods have been successfully applied in the elucidation of the structure of crystalline aggregates of amphiphilic molecules such as alcohols, carboxylic acids and their salts, alpha-amino acids, and phospholipids at the water surface....... In addition, it became possible to monitor by diffraction the growth and dissolution of the crystalline self-aggregates as well as structural changes occurring by phase transitions. Furthermore, the surface X-ray methods shed new light on the structure of the underlying ionic layer of attached solvent...

  7. Approximative Krieger-Nelkin orientation averaging and anisotropy of water molecules vibrations; Aproksimativno Krieger-Nelkinovo orijentacijsko usrednjenje i anozotropija vibracija molekula lake vode

    Markovic, M I [Elektrothenicki fakultet, Belgrade (Yugoslavia)

    1974-07-01

    Quantum-mechanics approach of water molecules dynamics should be taken into account for precise theoretical calculation of differential scattering cross sections of neutrons. Krieger and Nelkin have proposed an approximate method for averaging orientation of molecules regarding directions of incoming and scattered neutron. This paper shows that this approach can be successfully applied for general shape of water molecule vibration anisotropy.

  8. Potential-Flow Predictions of a Semi-Displacement Vessel Including Applications to Calm-Water Broaching

    Ommani, Babak

    2013-01-01

    As a marine vehicle’s operational speed increases, hydrodynamic pressure plays an increasingly significant role in carrying the vessel’s weight. The shift of importance from hydrostatic to hydrodynamic pressure may cause a vessel, which is stable at rest or low speeds, to become dynamically unstable at high speeds. The nature of the dynamic instability depends mainly on the vessel’s type and speed. Among high speed vessels, semi-displacement mono-hulls are particularly susceptible to a nonosc...

  9. Will the Displacement of Zebra Mussels by Quagga Mussels Increase Water Clarity in Shallow Lakes during Summer? Results from a Mesocosm Experiment.

    Xueying Mei

    Full Text Available Zebra mussels (Dreissena polymorpha are known to increase water clarity and affect ecosystem processes in invaded lakes. During the last decade, the conspecific quagga mussels (D. rostriformis bugensis have displaced zebra mussels in many ecosystems including shallow lakes such as Oneida Lake, New York. In this study, an eight-week mesocosm experiment was conducted to test the hypothesis that the displacement of zebra mussels by quagga mussels leads to further decreases in phytoplankton and increases in water clarity resulting in increases in benthic algae. We found that the presence of zebra mussels alone (ZM, quagga mussels alone (QM, or an equal number of both species (ZQ reduced total phosphorus (TP and phytoplankton Chl a. Total suspended solids (TSS was reduced in ZM and ZQ treatments. Light intensity at the sediment surface was higher in all three mussel treatments than in the no-mussel controls but there was no difference among the mussel treatments. There was no increase in benthic algae biomass in the mussel treatments compared with the no-mussel controls. Importantly, there was no significant difference in nutrient (TP, soluble reactive phosphorus and NO3- levels, TSS, phytoplankton Chl a, benthic algal Chl a, or light intensity on the sediment surface between ZM, QM and ZQ treatments. These results confirm the strong effect of both mussel species on water clarity and indicate that the displacement of zebra mussel by an equivalent biomass of quagga mussel is not likely to lead to further increases in water clarity, at least for the limnological conditions, including summer temperature, tested in this experiment.

  10. Will the Displacement of Zebra Mussels by Quagga Mussels Increase Water Clarity in Shallow Lakes during Summer? Results from a Mesocosm Experiment.

    Mei, Xueying; Zhang, Xiufeng; Kassam, Sinan-Saleh; Rudstam, Lars G

    2016-01-01

    Zebra mussels (Dreissena polymorpha) are known to increase water clarity and affect ecosystem processes in invaded lakes. During the last decade, the conspecific quagga mussels (D. rostriformis bugensis) have displaced zebra mussels in many ecosystems including shallow lakes such as Oneida Lake, New York. In this study, an eight-week mesocosm experiment was conducted to test the hypothesis that the displacement of zebra mussels by quagga mussels leads to further decreases in phytoplankton and increases in water clarity resulting in increases in benthic algae. We found that the presence of zebra mussels alone (ZM), quagga mussels alone (QM), or an equal number of both species (ZQ) reduced total phosphorus (TP) and phytoplankton Chl a. Total suspended solids (TSS) was reduced in ZM and ZQ treatments. Light intensity at the sediment surface was higher in all three mussel treatments than in the no-mussel controls but there was no difference among the mussel treatments. There was no increase in benthic algae biomass in the mussel treatments compared with the no-mussel controls. Importantly, there was no significant difference in nutrient (TP, soluble reactive phosphorus and NO3-) levels, TSS, phytoplankton Chl a, benthic algal Chl a, or light intensity on the sediment surface between ZM, QM and ZQ treatments. These results confirm the strong effect of both mussel species on water clarity and indicate that the displacement of zebra mussel by an equivalent biomass of quagga mussel is not likely to lead to further increases in water clarity, at least for the limnological conditions, including summer temperature, tested in this experiment.

  11. Synthesis of ZnO particles using water molecules generated in esterification reaction

    Šarić, Ankica; Gotić, Marijan; Štefanić, Goran; Dražić, Goran

    2017-07-01

    Zinc oxide particles were synthesized without the addition of water by autoclaving (anhydrous) zinc acetate/alcohol and zinc acetate/acetic acid/alcohol solutions at 160 °C. The solvothermal synthesis was performed in ethanol or octanol. The structural, optical and morphological characteristics of ZnO particles were investigated by X-ray diffraction (XRD), UV-Vis spectroscopy, FE-SEM and TEM/STEM microscopy. 13C NMR spectroscopy revealed the presence of ester (ethyl- or octyl-acetate) in the supernatants which directly indicate the reaction mechanism. The formation of ester in this esterification reaction generated water molecule in situ, which hydrolyzed anhydrous zinc acetate and initiated nucleation and formation of ZnO. It was found that the size and shape of ZnO particles depend on the type of alcohol used as a solvent and on the presence of acetic acid in solution. The presence of ethanol in the ;pure; system without acetic acid favoured the formation of fine and uniform spherical ZnO nanoparticles (∼20 nm). With the addition of small amount of acetic acid the size of these small nanoparticles increased significantly up to a few hundred nanometers. The addition of small amount of acetic acid in the presence of octanol caused even more radical changes in the shape of ZnO particles, favouring the growth of huge rod-like particles (∼3 μm).

  12. Effect of the walking speed to the lower limb joint angular displacements, joint moments and ground reaction forces during walking in water.

    Miyoshi, Tasuku; Shirota, Takashi; Yamamoto, Shin-ichiro; Nakazawa, Kimitaka; Akai, Masami

    2004-06-17

    The purpose of this study was to compare the changes in ground reaction forces (GRF), joint angular displacements (JAD), joint moments (JM) and electromyographic (EMG) activities that occur during walking at various speeds in water and on land. Fifteen healthy adults participated in this study. In the water experiments, the water depth was adjusted so that body weight was reduced by 80%. A video-motion analysis system and waterproof force platform was used to obtain kinematics and kinetics data and to calculate the JMs. Results revealed that (1) the anterior-posterior GRF patterns differed between walking in water and walking on land, whereas the medio-lateral GRF patterns were similar, (2) the JAD patterns of the hip and ankle were similar between water- and land-walking, whereas the range of motion at the knee joint was lower in water than on land, (3) the JMs in all three joints were lower in water than on land throughout the stance phase, and (4) the hip joint extension moment and hip extensor muscle EMG activity were increased as walking speed increase during walking in water. Rehabilitative water-walking exercise could be designed to incorporate large-muscle activities, especially of the lower-limb extensor muscles, through full joint range of motion and minimization of joint moments.

  13. Activation of a water molecule coordinated to manganese: four study cases

    Lassalle-Kaiser, B.

    2008-10-01

    The daunting energy consumption of western societies calls for the development of renewable energies. Among them, hydrogen stands as a major candidate. The cleanest way of producing hydrogen is water electro- or photolysis. This reaction is carried out in natural photosynthesis by a manganese-oxo cluster, the functioning of which remains unknown. Insight into this mechanism would greatly help the search for low-cost water splitting catalysts. Our contribution to this field is the understanding of the fundamental processes that govern the activation of water by manganese complexes. This manuscript describes our attempts to generate electrochemically mononuclear manganese(IV) complexes bearing a fully deprotonated water molecule (oxo ligand). We have studied four different cases, which reflect different possible coordination spheres capable of stabilizing such species. In the first chapter, we will give a brief overview of the present energetic challenges faced by western societies. In the second chapter, we will present general considerations about manganese chemistry and a description of the structure and functioning of the water oxidizing enzyme. We will also describe the basic requirements for the splitting of water and present the goals of our work. In the third chapter, we will present the synthesis of a new family of tetradentate ligands, together with the synthesis and full characterization of the corresponding nickel(II) complexes. The first results obtained with the manganese analogue will also be shown. Chapter four presents the formation and the full characterization of a mononuclear manganese(IV)-oxo complex, by electrochemical oxidation of a manganese(II)-aqua complex. We will present different pathways to generate this species and show which intermediates are involved in this 2 e - , 2 H + reaction. Chapter five describes the formation of a mononuclear manganese(IV) complex, by electrochemical oxidation of a manganese(III)-hydroxo complex. The

  14. (e,3e) and (e,3-1e) differential cross sections for the double ionization of water molecule

    Mansouri, A.; Dal Cappello, C.; Kada, I.; Champion, C.; Roy, A.C.

    2009-01-01

    We report new results for differential cross sections for the double ionization of water molecule by 1 keV electron impact. The present calculation is based on the first Born approximation. We describe the water molecule by a single centre wave function of Moccia. For the final state, an approximation of the well-known 3C wave function is used. An extensive study has been made by varying the angles of detection and the energies of each ejected electron. We have investigated the double ionization of each molecular state (1b 1 , 3a 1 , 1b 2 and 2a 1 ) and identified the mechanisms of this process.

  15. Energy-switching potential energy surface for the water molecule revisited: A highly accurate singled-sheeted form.

    Galvão, B R L; Rodrigues, S P J; Varandas, A J C

    2008-07-28

    A global ab initio potential energy surface is proposed for the water molecule by energy-switching/merging a highly accurate isotope-dependent local potential function reported by Polyansky et al. [Science 299, 539 (2003)] with a global form of the many-body expansion type suitably adapted to account explicitly for the dynamical correlation and parametrized from extensive accurate multireference configuration interaction energies extrapolated to the complete basis set limit. The new function mimics also the complicated Sigma/Pi crossing that arises at linear geometries of the water molecule.

  16. Study of the fluid dynamic and the efficiency of displacement in oil-water systems; Estudo da fluidodinamica e da eficiencia de deslocamento em sistemas agua-oleo

    Fiorese, Eliana K.; Quadri, Marintho B.; Machado, Ricardo A.F.; Nogueira, Andre L.; Lopes, Toni J. [Universidade Federal de Santa Catarina (UFSC), Florianopolis, SC (Brazil). Dept. de Engenharia Quimica e de Alimentos; Baptista, Renan M. [PETROBRAS, Rio de Janeiro, RJ (Brazil). Centro de Pesquisas (CENPES)

    2004-07-01

    Several operations and procedures in the oil industry are related to immiscible displacement of a fluid by another one. Some examples can be listed: the natural and artificial oil elevation from wells, the pumping of high viscosity oils through pipelines using water injection and secondary oil recovery. The performance of the last one is a direct consequence of the interfacial phenomena inherent to oil/water systems. As occur in oil leakages from submarine pipelines, the phase inversion phenomenon can also be considered in this context. Therefore, it is of major importance to realize experimental analysis of the oil/water interface stability and the facts that leads to the fingering phenomenon appearance. This phenomenon is represented into the other one like one or more fingers. The mathematical model used to describe the immiscible displacement of another one is initially developed to Hele-Shaw cells. Experimental observations with a Hele-Shaw cell enable the evaluation of the proposed model and its capability to adequately describe the viscous fingering phenomenon related to physical (density, viscosity and interfacial tension) and geometric properties of the system. (author)

  17. Cavity mutants of Savinase. Crystal structures and differential scanning calorimetry experiments give hints of the function of the buried water molecules in subtilisins.

    Pedersen, J T; Olsen, O H; Betzel, C; Eschenburg, S; Branner, S; Hastrup, S

    1994-09-23

    The subtilisin molecule possesses several internal water molecules, which may be characterised as an integral part of the protein structure. We have introduced specific mutations (T71I, T71S, T71V, T71A and T71G) at position 71 in the subtilisin variant Savinase from Bacillus lentus. This position is involved in a hydrogen bonded network with several internal water molecules, forming a water channel. The water channel and most of the other internal water molecules are positioned in the interface between two half-domains of the subtilisin molecule. The data presented here indicate that the internal water molecules are structural, and may be the result of trapping during the folding process.

  18. Anomalous diffusion of water molecules at grain boundaries in ice Ih.

    Moreira, Pedro Augusto Franco Pinheiro; Veiga, Roberto Gomes de Aguiar; Ribeiro, Ingrid de Almeida; Freitas, Rodrigo; Helfferich, Julian; de Koning, Maurice

    2018-05-23

    Using ab initio and classical molecular dynamics simulations, we study pre-melting phenomena in pristine coincident-site-lattice grain boundaries (GBs) in proton-disordered hexagonal ice Ih at temperatures just below the melting point Tm. Concerning pre-melt-layer thicknesses, the results are consistent with the available experimental estimates for low-disorder impurity-free GBs. With regard to molecular mobility, the simulations provide a key new insight: the translational motion of the water molecules is found to be subdiffusive for time scales from ∼10 ns up to at least 0.1 μs. Moreover, the fact that the anomalous diffusion occurs even at temperatures just below Tm where the bulk supercooled liquid still diffuses normally suggests that it is related to the confinement of the GB pre-melt layers by the surrounding crystalline environment. Furthermore, we show that this behavior can be characterized by continuous-time random walk models in which the waiting-time distributions decay according to power-laws that are very similar to those describing dynamics in glass-forming systems.

  19. Intercalated Water and Organic Molecules for Electrode Materials of Rechargeable Batteries.

    Lee, Hyeon Jeong; Shin, Jaeho; Choi, Jang Wook

    2018-03-24

    The intrinsic limitations of lithium-ion batteries (LIBs) with regard to safety, cost, and the availability of raw materials have promoted research on so-called "post-LIBs". The recent intense research of post-LIBs provides an invaluable lesson that existing electrode materials used in LIBs may not perform as well in post-LIBs, calling for new material designs compliant with emerging batteries based on new chemistries. One promising approach in this direction is the development of materials with intercalated water or organic molecules, as these materials demonstrate superior electrochemical performance in emerging battery systems. The enlarged ionic channel dimensions and effective shielding of the electrostatic interaction between carrier ions and the lattice host are the origins of the observed electrochemical performance. Moreover, these intercalants serve as interlayer pillars to sustain the framework for prolonged cycles. Representative examples of such intercalated materials applied to batteries based on Li + , Na + , Mg 2+ , and Zn 2+ ions and supercapacitors are considered, along with their impact in materials research. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. NO Exchange for a Water Molecule Favorably Changes Iontophoretic Release of Ruthenium Complexes to the Skin

    Danielle C. A. S. de Santana

    2017-01-01

    Full Text Available Ruthenium (Ru complexes have been studied as promising anticancer agents. Ru nitrosyl complex (Ru-NO is one which acts as a pro-drug for the release of nitric oxide (NO. The Ru-aqueous complex formed by the exchange of NO for a water molecule after NO release could also possess therapeutic effects. This study evaluates the influence of iontophoresis on enhancing the skin penetration of Ru-NO and Ru-aqueous and assesses its applicability as a tool in treating diverse skin diseases. Passive and iontophoretic (0.5 mA·cm−2 skin permeation of the complexes were performed for 4 h. The amount of Ru and NO in the stratum corneum (SC, viable epidermis (VE, and receptor solution was quantified while the influence of iontophoresis and irradiation on NO release from Ru-NO complex was also evaluated. Iontophoresis increased the amount of Ru-NO and Ru-aqueous recovered from the receptor solution by 15 and 400 times, respectively, as compared to passive permeation. Iontophoresis produced a higher accumulation of Ru-aqueous in the skin layers as compared to Ru-NO. At least 50% of Ru-NO penetrated the SC was stable after 4 h. The presence of Ru-NO in this skin layer suggests that further controlled release of NO can be achieved by photo-stimulation after iontophoresis.

  1. Studing electronic structure of water molecules in aquocomplexes by the method of pions minus capture by hydrogen

    Dezhi, I.; Krumshtejn, Z.V.; Molnar, B.; Petrukhin, V.I.; Rybakov, V.N.; Suvorov, V.M.; Khorvat, D.; Tsisek, Z.; Yutlandov, I.A.

    1980-01-01

    Using the effect of electron shell state on π-meson capture by chemically bound hydrogen studied has been change of electron density in hydrogen atoms of water molecules bound into aquocomplexes. The fact of depression of π-meson capture probability by hydrogen of water in aquocomplexes has been established. The magnitudes of depression indicate essential decrease of electron density in a hydrogen atom of coordinated water. Interaction of ligands with oxygen-containing anions also essentially contributes to a magnitude of depression

  2. Charge-transfer energy in the water-hydrogen molecular aggregate revealed by molecular-beam scattering experiments, charge displacement analysis, and ab initio calculations.

    Belpassi, Leonardo; Reca, Michael L; Tarantelli, Francesco; Roncaratti, Luiz F; Pirani, Fernando; Cappelletti, David; Faure, Alexandre; Scribano, Yohann

    2010-09-22

    Integral cross-section measurements for the system water-H(2) in molecular-beam scattering experiments are reported. Their analysis demonstrates that the average attractive component of the water-H(2) intermolecular potential in the well region is about 30% stronger than dispersion and induction forces would imply. An extensive and detailed theoretical analysis of the electron charge displacement accompanying the interaction, over several crucial sections of the potential energy surface (PES), shows that water-H(2) interaction is accompanied by charge transfer (CT) and that the observed stabilization energy correlates quantitatively with CT magnitude at all distances. Based on the experimentally determined potential and the calculated CT, a general theoretical model is devised which reproduces very accurately PES sections obtained at the CCSD(T) level with large basis sets. The energy stabilization associated with CT is calculated to be 2.5 eV per electron transferred. Thus, CT is shown to be a significant, strongly stereospecific component of the interaction, with water functioning as electron donor or acceptor in different orientations. The general relevance of these findings for water's chemistry is discussed.

  3. Effect of water molecule distribution on the quantitative XRD analysis in the case of Na-montmorillonite exchanged Cu2+

    Oueslati, W.; Meftah, M.; Ben Rhaiem, H.; Ben Haj Amara, A.

    2010-01-01

    Document available in extended abstract form only. Several theoretical models are proposed to describe hydration process for Wyoming-montmorillonite clay exchanged Na + or Cu 2+ . They propose some theoretical distribution and disposition for water molecule in the inter-lamellar space in the case of homogeneous and inter-stratified hydration states. For example, Ben Brahim et al. (1983a) studied the interlayer structure (atomic positions of interlayer cations) and associated H 2 O molecules of Na-saturated montmorillonite and beidellite samples. Moore and Hower (1986) studied ordered structures composed of mono-hydrated and collapsed interlayers in montmorillonite, and Cuadros (1996) estimated the H 2 O content of smectite as a function of the interlayer cation. Using similar approach, Ferrage et al (2005b) proposed a discreet distribution of water molecule layer in the same z coordinate of the exchangeable cation with inhomogeneous distribution. This heterogeneity was attributed to the surface charge. The main objective of this study is to characterize the structural changes in the theoretical XRD profile, induced by different water molecule distribution, used to simulate experimental XRD patterns in the case of Na-montmorillonite exchanged Cu 2+ . This problem was achieved by quantitative XRD analysis using an indirect method based on the comparison of the experimental 001 reflections obtained from oriented films patterns with those calculated from structural models. The starting materials were Ca-montmorillonite originated from bentonites of Wyoming (USA). The XRD patterns were obtained by reflection setting with a D8 ADVANCE Bruker installation using Cu-Kα radiation and equipped with solid state detector. Intensities were measured at an interval of 2Θ 0.04 deg. and 40-50 s counting time per step. The diffracted intensity was calculated according to the matrix formalism detailed by Drits and Tchoubar, (1990). The fitting strategies was detailed by Ferrage et

  4. Direct numerical solution of the Ornstein-Zernike integral equation and spatial distribution of water around hydrophobic molecules

    Ikeguchi, Mitsunori; Doi, Junta

    1995-09-01

    The Ornstein-Zernike integral equation (OZ equation) has been used to evaluate the distribution function of solvents around solutes, but its numerical solution is difficult for molecules with a complicated shape. This paper proposes a numerical method to directly solve the OZ equation by introducing the 3D lattice. The method employs no approximation the reference interaction site model (RISM) equation employed. The method enables one to obtain the spatial distribution of spherical solvents around solutes with an arbitrary shape. Numerical accuracy is sufficient when the grid-spacing is less than 0.5 Å for solvent water. The spatial water distribution around a propane molecule is demonstrated as an example of a nonspherical hydrophobic molecule using iso-value surfaces. The water model proposed by Pratt and Chandler is used. The distribution agrees with the molecular dynamics simulation. The distribution increases offshore molecular concavities. The spatial distribution of water around 5α-cholest-2-ene (C27H46) is visualized using computer graphics techniques and a similar trend is observed.

  5. Study of oxide film formed in a pre cracked CT specimen of AISI 304L during a rising displacement test in 288 C water

    Diaz S, A.; Castano M, V.

    2007-01-01

    A study of oxide film formed inside pre cracked CT specimens during a rising displacement test in high temperature water (288 C) was performed in this study, The environmental conditions used during the experiments were similar to these found in Boiling Water Reactors (BWR): Normal Water Condition (NWC - 200 ppb O 2 ) and Hydrogen Water Chemistry (HWC - 125 ppb H2). The oxide films formed were analyzed by scanning electron microscopy (SEM), energy dispersive spectroscopy (EDS) and X-ray diffraction (XRD). In both cases the oxide film consisted of two layers identified as magnetite. In the case of HWC the results agree with previous reports that mention magnetite as a stable phase in reducing conditions. However the stable phase in oxidant conditions is hematite and this work shows the presence of magnetite crystals in the narrow crack of CT specimens in spite of the oxidant environmental condition. This situation confirms that inside the pre-cracked CT specimens the environmental conditions were different from the oxidant bulk, and probably a poor oxygen access and stagnant conditions within the narrow crack promoted a localized reducing environment that permitted the magnetite formation. Is evident that the crack growth studies should consider the conditions inside crack because they are significantly different. (Author)

  6. Degradation of Bacterial Quorum Sensing Signaling Molecules by the Microscopic Yeast Trichosporon loubieri Isolated from Tropical Wetland Waters

    Cheng-Siang Wong

    2013-09-01

    Full Text Available Proteobacteria produce N-acylhomoserine lactones as signaling molecules, which will bind to their cognate receptor and activate quorum sensing-mediated phenotypes in a population-dependent manner. Although quorum sensing signaling molecules can be degraded by bacteria or fungi, there is no reported work on the degradation of such molecules by basidiomycetous yeast. By using a minimal growth medium containing N-3-oxohexanoylhomoserine lactone as the sole source of carbon, a wetland water sample from Malaysia was enriched for microbial strains that can degrade N-acylhomoserine lactones, and consequently, a basidiomycetous yeast strain WW1C was isolated. Morphological phenotype and molecular analyses confirmed that WW1C was a strain of Trichosporon loubieri. We showed that WW1C degraded AHLs with N-acyl side chains ranging from 4 to 10 carbons in length, with or without oxo group substitutions at the C3 position. Re-lactonisation bioassays revealed that WW1C degraded AHLs via a lactonase activity. To the best of our knowledge, this is the first report of degradation of N-acyl-homoserine lactones and utilization of N-3-oxohexanoylhomoserine as carbon and nitrogen source for growth by basidiomycetous yeast from tropical wetland water; and the degradation of bacterial quorum sensing molecules by an eukaryotic yeast.

  7. A theoretical model investigation of peptide bond formation involving two water molecules in ribosome supports the two-step and eight membered ring mechanism

    Wang, Qiang; Gao, Jun; Zhang, Dongju; Liu, Chengbu

    2015-01-01

    Highlights: • We theoretical studied peptide bond formation reaction mechanism with two water molecules. • The first water molecule can decrease the reaction barriers by forming hydrogen bonds. • The water molecule mediated three-proton transfer mechanism is the favorable mechanism. • Our calculation supports the two-step and eight membered ring mechanism. - Abstract: The ribosome is the macromolecular machine that catalyzes protein synthesis. The kinetic isotope effect analysis reported by Strobel group supports the two-step mechanism. However, the destination of the proton originating from the nucleophilic amine is uncertain. A computational simulation of different mechanisms including water molecules is carried out using the same reaction model and theoretical level. Formation the tetrahedral intermediate with proton transfer from nucleophilic nitrogen, is the rate-limiting step when two water molecules participate in peptide bond formation. The first water molecule forming hydrogen bonds with O9′ and H15′ in the A site can decrease the reaction barriers. Combined with results of the solvent isotope effects analysis, we conclude that the three-proton transfer mechanism in which water molecule mediate the proton shuttle between amino and carbon oxygen in rate-limiting step is the favorable mechanism. Our results will shield light on a better understand the reaction mechanism of ribosome

  8. Water Scarcity, Food Insecurity and Drought Induced Displacement in an Arid Ecosystem: A Case Study in Indian Desert

    Rehman Siddiqui, Azizur

    2017-04-01

    Indian Arid Ecosystem is characterised by scare as well as seasonal precipitation that have led to long term stress in a fragile ecosystem. In addition to this, over the years, Indian desert has experienced varying magnitude of drought, which have considerably influenced food and fodder production and led to the depletion of surface and ground water table. All these factors mean that the production potential of land is hardly sufficient to feed human as well as livestock population of the desert and this has led to extensive rural to urban migration in Indian Desert. In the present study, satellite data from Landsat TM, AWiFS, NOAA AVHRR have been used to detect the intensity and severity of drought condition, and data collected through primary survey has been used to measure the impact of water scarcity on food insecurity and drought induced migration. Rainfall trend analysis of the study area has been done with the help of Man Kendall Method to assess the meteorological vulnerability. In addition to these, NDVI, VCI, TCI, and VHI have also been used to find out the long term vegetation health in the study area. With the help of these scientific techniques, the paper focuses on the moisture deficiency during growing period and its effect on human population and livestock population. Keywords: Arid Ecosystem, Indian Desert, Drought, Migration

  9. Molecular Dynamics Study of Water Molecules in Interlayer of 14 ^|^Aring; Tobermorite

    Yoon, Seyoon; Monteiro, Paulo J.M.

    2013-01-01

    The molecular structure and dynamics of interlayer water of 14 Å tobermorite are investigated based on molecular dynamics (MD) simulations. Calculated structural parameters of the interlayer water configuration are in good agreement with current

  10. Thermodynamic analysis of water molecules at the surface of proteins and applications to binding site prediction and characterization.

    Beuming, Thijs; Che, Ye; Abel, Robert; Kim, Byungchan; Shanmugasundaram, Veerabahu; Sherman, Woody

    2012-03-01

    Water plays an essential role in determining the structure and function of all biological systems. Recent methodological advances allow for an accurate and efficient estimation of the thermodynamic properties of water molecules at the surface of proteins. In this work, we characterize these thermodynamic properties and relate them to various structural and functional characteristics of the protein. We find that high-energy hydration sites often exist near protein motifs typically characterized as hydrophilic, such as backbone amide groups. We also find that waters around alpha helices and beta sheets tend to be less stable than waters around loops. Furthermore, we find no significant correlation between the hydration site-free energy and the solvent accessible surface area of the site. In addition, we find that the distribution of high-energy hydration sites on the protein surface can be used to identify the location of binding sites and that binding sites of druggable targets tend to have a greater density of thermodynamically unstable hydration sites. Using this information, we characterize the FKBP12 protein and show good agreement between fragment screening hit rates from NMR spectroscopy and hydration site energetics. Finally, we show that water molecules observed in crystal structures are less stable on average than bulk water as a consequence of the high degree of spatial localization, thereby resulting in a significant loss in entropy. These findings should help to better understand the characteristics of waters at the surface of proteins and are expected to lead to insights that can guide structure-based drug design efforts. Copyright © 2011 Wiley Periodicals, Inc.

  11. Melting and evaporation analysis of the first wall in a water-cooled breeding blanket module under vertical displacement event by using the MARS code

    Kim, Geon-Woo [Department of Nuclear Engineering, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 08826 (Korea, Republic of); Cho, Hyoung-Kyu, E-mail: chohk@snu.ac.kr [Department of Nuclear Engineering, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 08826 (Korea, Republic of); Park, Goon-Cherl [Department of Nuclear Engineering, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 08826 (Korea, Republic of); Im, Kihak [National Fusion Research Institute, 169-148 Gwahak-ro, Yuseong-gu, Daejeon 34133 (Korea, Republic of)

    2017-05-15

    Highlights: • Material phase change of first wall was simulated for vertical displacement event. • An in-house first wall module was developed to simulate melting and evaporation. • Effective heat capacity method and evaporation model were proposed. • MARS code was proposed to predict two-phase phenomena in coolant channel. • Phase change simulation was performed by coupling MARS and in-house module. - Abstract: Plasma facing components of tokamak reactors such as ITER or the Korean fusion demonstration reactor (K-DEMO) can be subjected to damage by plasma instabilities. Plasma disruptions like vertical displacement event (VDE) with high heat flux, can cause melting and vaporization of plasma facing materials and burnout of coolant channels. In this study, to simulate melting and vaporization of the first wall in a water-cooled breeding blanket under VDE, one-dimensional heat equations were solved numerically by using an in-house first wall module, including phase change models, effective heat capacity method, and evaporation model. For thermal-hydraulics, the in-house first wall analysis module was coupled with the nuclear reactor safety analysis code, MARS, to take advantage of its prediction capability for two-phase flow and critical heat flux (CHF) occurrence. The first wall was proposed for simulation according to the conceptual design of the K-DEMO, and the heat flux of plasma disruption with a value of 600 MW/m{sup 2} for 0.1 s was applied. The phase change simulation results were analyzed in terms of the melting and evaporation thicknesses and the occurrence of CHF. The thermal integrity of the blanket first wall is discussed to confirm whether the structural material melts for the given conditions.

  12. The Effect of Basepair Mismatch on DNA Strand Displacement

    Broadwater, D.?W.?Bo; Kim, Harold?D.

    2016-01-01

    DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single base pair mismatch. The apparent displacement rate varied si...

  13. Serine/threonine phosphatase tapp2cs might be served as an early signal molecule for water stress in wheat

    Song, K. H.; Tian, W. L.; Hou, B. Z.; Guo, J. X.; Mei, X. R.; Li, Y. Z.

    2015-01-01

    Much progress has been made towards understanding the role of serine/threonine phosphatases type 2C (PP2Cs) in abscisic acid (ABA) signaling transduction. However, how the negative regulator, PP2Cs, responds to plant water loss remains unclear. Here, we used a series of relative soil moisture (RSM: 85 percentage (well watered), 65 percentage (moderate stress), 45 percentage (severe stress) potted winter wheat (Triticum aestivum L.) and the detached leaves to detect ABA levels and transcripts of PP2Cs, including PP2C40, PP2C45, PP2C59 and PP2C6 as well as the core downstream signals of ABA, including ABF, SnRK2.4 and SnRK2.5. The results showed that the continual loss of water led to a consistent increase in ABA levels, and that the mRNA expression levels of PP2Cs were dependent on plant water condition. PP2Cs expression could be induced by a slight loss of water, and inhibited under severe loss of water. These results were further confirmed by the transcripts of ABF, SnRK2.4 and SnRK2.5. Furthermore, in slight loss of water, 100 μM exogenous ABA could promote PP2Cs expression; in severe loss of water, it inhibited PP2Cs expression. In conclusion, ABA accumulation is controlled by water condition and the PP2C expression is dependent on plant water condition, suggesting that PP2Cs might be served as an early signal molecule for water stress in wheat. (author)

  14. Time-Lapse Photography of the Edge-of-Water Line Displacements of a Sandbar as a Proxy of Riverine Morphodynamics

    Michael Nones

    2018-05-01

    Full Text Available A simple methodology to track the displacements of a sandbar from a fixed video camera, extracting its morphological features and deriving the associated fluvial morphology is presented, using a small reach of the Po River in Italy as a case study. A camera fixed on a bridge pier acquired images every twelve hours while hourly water levels are derived from a radar hydrometer located upstream of the study area. The quantification of the fluvial bathymetry is achieved by mapping multiple edge-of-water lines of a sandbar before and after high flow conditions in December 2017. Both from video information and 2-D numerical simulations, it is evident that flooding waves can easily remove sediments that accumulated on bars during low flow conditions in this area, redistributing them across the river channel. This video-based methodology—which confirms to be economically attractive if compared to more traditional monitoring systems—proves to be a valuable system to monitor long-term fluvial processes providing detailed indications on how to better plan river management activities.

  15. Differential and total cross sections for the ionization of water molecule by electron impact

    Houamer, S.; Dal Cappello, C.; Mansouri, A.

    2007-01-01

    A theoretical approach is presented to calculate multiply differential and total cross sections of the ionization of H 2 O molecule in the vapour phase. The wave function of the target is described by molecular orbitals consisting of a linear combination of slater type atomic orbitals centered on the heaviest atom which is the oxygen atom in this case. The calculations are carried out in the first Born approximation where the projectile is described by a plane wave while the ejected electron is described by a coulomb wave taking into account its interaction with the residual ion. The spherical average over the Euler solid angle due to the randomly oriented gaseous target molecule is carried out analytically using the rotation matrix properties. The differential and total cross sections are thus evaluated without any special difficulty and compared with experiments and distorted wave calculations. Fair agreements are observed

  16. Expressional Changes of Water Transport-related Molecules in the Efferent Ductules and Initial Segment of Mouse Treated with Bisphenol A-Containing Drinking Water for Two Generations.

    Han, Su-Yong; Lee, Ki-Ho

    2013-09-01

    Bisphenol A (BPA) is an estrogenic endocrine disrupter. However, depending on a way of treatment, the harmful effects of BPA have not been confirmed. Also, trans-generational effects of BPA on male reproduction are still controversial. Because the reabsorption of testicular fluid in the efferent ductules (ED) and initial segment (IS) is important for sperm maturation, the present study was designed to determine trans-generational effect of BPA administrated orally on expression of water transport-related molecules in the mouse ED and IS. Ethanol-dissolved BPA was diluted in water to be 100 ng (low), 10 μg (medium), and 1 mg/Ml water (high). BPA-containing water was provided for two generations. Expression of ion transporters and water channels in the ED and IS were measured by relative real-time PCR analysis. In the ED, BPA treatment caused expressional increases of carbonic anhydrase II, cystic fibrosis transmembrane regulator, Na(+)/K(+) ATPase α1 subunit, and aquaporin (AQP) 1. No change of Na(+)/H(+) exchange (NHE) 3 expression was detected. BPA treatment at medium dose resulted in an increase of AQP9 expression. In the IS, the highest expressional levels of all molecules tested were observed in medium-dose BPA treatment. Generally, high-dose BPA treatment resulted in a decrease or no change of gene expression. Fluctuation of NHE3 gene expression by BPA treatment at different concentrations was detected. These findings suggest that trans-generational exposure to BPA, even at low dose, could affect gene expression of water-transport related molecules. However, such effects of BPA would be differentially occurred in the ED and IS.

  17. Molecular motion of water molecules in lyotropic mesophases formed from fatty acid soaps

    Olszewski, K.J.; Pislewski, N.

    1980-01-01

    The results of study of self-diffusion coefficients and relaxation times for the mesophases formed from water mixtures of potassium laurate (denoted by C 12 K), myristate (C 14 K), and palmitate (C 16 K), are presented. The samples containing by weight 70% of soaps and 30% of water as well as samples containing 30% of soaps and 70% of water were examined. It allowed to obtain lamellar and middle phase respectively. (author)

  18. Investigation of N-acyl homoserine lactone (AHL) molecule production in Gram-negative bacteria isolated from cooling tower water and biofilm samples.

    Haslan, Ezgi; Kimiran-Erdem, Ayten

    2013-09-01

    In this study, 99 Gram-negative rod bacteria were isolated from cooling tower water, and biofilm samples were examined for cell-to-cell signaling systems, N-acyl homoserine lactone (AHL) signal molecule types, and biofilm formation capacity. Four of 39 (10 %) strains isolated from water samples and 14 of 60 (23 %) strains isolated from biofilm samples were found to be producing a variety of AHL signal molecules. It was determined that the AHL signal molecule production ability and the biofilm formation capacity of sessile bacteria is higher than planktonic bacteria, and there was a statistically significant difference between the AHL signal molecule production of these two groups (p cooling tower water and biofilm samples produced different types of AHL signal molecules and that there were different types of AHL signal molecules in an AHL extract of bacteria. In the present study, it was observed that different isolates of the same strains did not produce the same AHLs or did not produce AHL molecules, and bacteria known as AHL producers did not produce AHL. These findings suggest that detection of signal molecules in bacteria isolated from cooling towers may contribute to prevention of biofilm formation, elimination of communication among bacteria in water systems, and blockage of quorum-sensing controlled virulence of these bacteria.

  19. Low-temperature FTIR spectroscopy provides evidence for protein-bound water molecules in eubacterial light-driven ion pumps.

    Nomura, Yurika; Ito, Shota; Teranishi, Miwako; Ono, Hikaru; Inoue, Keiichi; Kandori, Hideki

    2018-01-31

    Light-driven H + , Na + and Cl - pumps have been found in eubacteria, which convert light energy into a transmembrane electrochemical potential. A recent mutation study revealed asymmetric functional conversion between the two pumps, where successful functional conversions are achieved exclusively when mutagenesis reverses the evolutionary amino acid sequence changes. Although this fact suggests that the essential structural mechanism of an ancestral function is retained even after gaining a new function, questions regarding the essential structural mechanism remain unanswered. Light-induced difference FTIR spectroscopy was used to monitor the presence of strongly hydrogen-bonded water molecules for all eubacterial H + , Na + and Cl - pumps, including a functionally converted mutant. This fact suggests that the strongly hydrogen-bonded water molecules are maintained for these new functions during evolution, which could be the reason for successful functional conversion from Na + to H + , and from Cl - to H + pumps. This also explains the successful conversion of the Cl - to the H + pump only for eubacteria, but not for archaea. It is concluded that water-containing hydrogen-bonding networks constitute one of the essential structural mechanisms in eubacterial light-driven ion pumps.

  20. Bibliography of electron and photon cross sections with atoms and molecules published in the 20th century. Water vapour

    Hayashi, Makoto

    2003-12-01

    Bibliographies of original and review reports of experiments or theories of electron and photon cross sections and also electron swarm data are presented for atomic or molecular species with specified targets. These works covered 17 atoms and 51 molecules. The present bibliography is only for water vapour (H 2 O, D 2 O and HDO). About 1200 papers were compiled. A comprehensive author index is included. The bibliography covers the period 1915 through 2000 for H 2 O. Finally, author's comments for electron collision cross sections and photodissociation processes of H 2 O are given. (author)

  1. Coordination geometries of Zn(II) and Cd(II) in phosphotriesterase: Influence of water molecules in the active site

    Krauss, M; Olsen, Lars; Antony, J

    2002-01-01

    Models of the metal ion binding sites of native ZnZn and of cadmium-substituted ZnCd and CdCd phosphotriesterase, including full amino acid side chains, were geometry optimized with quantum mechanical methods, with effective fragment potentials (EFP) representing the protein environment surroundi...... to the Od1 of the carboxylate of the first-shell aspartate designated M 1, but the energy difference between Cd1Zn2 and the lowest energy Zn1Cd2 structure is only about 2 kcal/mol and decreasing with the addition of water molecules. The Zn1Cd2 arrangement is found experimentally....

  2. Direct and indirect methods for the quantification of leg volume: Comparison between water displacement volumetry, the disk model method and the frustum sign model method, using the correlation coefficient and the limits of agreement

    D.M.K.S. Kaulesar Sukul (D. M K S); P.Th. den Hoed (Pieter); T. Johannes (Tanja); R. van Dolder (R.); E. Benda (Eric)

    1993-01-01

    textabstractVolume changes can be measured either directly by water-displacement volumetry or by various indirect methods in which calculation of the volume is based on circumference measurements. The aim of the present study was to determine the most appropriate indirect method for lower leg volume

  3. Job Displacement and Crime

    Bennett, Patrick; Ouazad, Amine

    We use a detailed employer-employee data set matched with detailed crime information (timing of crime, fines, convictions, crime type) to estimate the impact of job loss on an individual's probability to commit crime. We focus on job losses due to displacement, i.e. job losses in firms losing...... a substantial share of their workers, for workers with at least three years of tenure. Displaced workers are more likely to commit offenses leading to conviction (probation, prison terms) for property crimes and for alcohol-related traffic violations in the two years following displacement. We find no evidence...... that displaced workers' propensity to commit crime is higher than non-displaced workers before the displacement event; but it is significantly higher afterwards. Displacement impacts crime over and above what is explained by earnings losses and weeks of unemployment following displacement....

  4. Prototropic tautomerism of 4-Methyl 1,2,4-Triazole-3-Thione molecule in solvent water medium: DFT and Car–Parrinello molecular dynamics study

    Dutta, Bipan; De, Rina; Chowdhury, Joydeep

    2015-01-01

    Highlights: • The tautomerism of 4-MTTN molecule in solvent water medium has been investigated. • CPMD presage the possibility of PT reactions through the solvent water medium. • Concerted PT processes in 4-MTTN have been estimated from the DFT and NBO analyses. • Percentage evolution and breaking of the concerned bonds are estimated. - Abstract: The ground state prototropic tautomerism of 4-Methyl 1,2,4-Triazole-3-Thione molecule in solvent water medium has been investigated with the aid of DFT and Car–Parrinello molecular dynamics (CPMD) simulation studies. The CPMD simulations envisage the possibility of proton transfer reactions of the molecule through the solvent water medium. Probable proton transfer pathways have been predicted from the DFT calculations which are substantiated by the natural bond orbital analyses. The evolution and breaking of the concerned bonds of the molecule for different proton transfer reaction pathways are also estimated.

  5. Boltzmann equation analysis of electron-molecule collision cross sections in water vapor and ammonia

    Yousfi, M.; Benabdessadok, M.D.

    1996-01-01

    Sets of electron-molecule collision cross sections for H 2 O and NH 3 have been determined from a classical technique of electron swarm parameter unfolding. This deconvolution method is based on a simplex algorithm using a powerful multiterm Boltzmann equation analysis established in the framework of the classical hydrodynamic approximation. It is well adapted for the simulation of the different classes of swarm experiments (i.e., time resolved, time of flight, and steady state experiments). The sets of collision cross sections that exist in the literature are reviewed and analyzed. Fitted sets of cross sections are determined for H 2 O and NH 3 which exhibit features characteristic of polar molecules such as high rotational excitation collision cross sections. The hydrodynamic swarm parameters (i.e., drift velocity, longitudinal and transverse diffusion coefficients, ionization and attachment coefficients) calculated from the fitted sets are in excellent agreement with the measured ones. These sets are finally used to calculate the transport and reaction coefficients needed for discharge modeling in two cases of typical gas mixtures for which experimental swarm data are very sparse or nonexistent (i.e., flue gas mixtures and gas mixtures for rf plasma surface treatment). copyright 1996 American Institute of Physics

  6. Job Displacement and Crime

    Bennett, Patrick; Ouazad, Amine

    theory of crime. Marital dissolution is more likely post-displacement, and we find small intra-family externalities of adult displacement on younger family members’ crime. The impact of displacement on crime is stronger in municipalities with higher capital and labor income inequalities....

  7. Theoretical study on microhydration of SeO42-: On the number of water molecules necessary to stabilize the dianion

    Pathak, Arup Kumar

    2012-01-01

    Microhydration of SeO42-·nH2O (n = 1-5) clusters are reported at B3LYP/Aug-cc-pvtz level of theory. Lower size hydrated clusters are stabilized by only double-hydrogen-bonding arrangements and the most stable conformer for higher size cluster (n > 3) contains a cyclic water ring. It is observed that at least one water molecule is necessary to stabilize the dianion in the gas phase against spontaneous electron loss. The microscopic theory based expression provides a route to predict the instability of bare SeO42- and to obtain the VDE for a wide range of cluster sizes including the bulk from the knowledge of the same for a few stable hydrated clusters.

  8. Aqueous Solvation of Polyalanine α-Helices with Specific Water Molecules and with the CPCM and SM5.2 Aqueous Continuum Models using Density Functional Theory

    Marianski, Mateusz; Dannenberg, J. J.

    2012-01-01

    We present density functional theory (DFT) calculations at the X3LYP/D95(d,p) level on the solvation of polyalanine α-helices in water. The study includes the effects of discrete water molecules and the CPCM and AMSOL SM5.2 solvent continuum model both separately and in combination. We find that individual water molecules cooperatively hydrogen-bond to both the C- and N-termini of the helix, which results in increases in the dipole moment of the helix/water complex to more than the vector sum...

  9. MSINDO quantum chemical modeling study of water molecule adsorption at nano-sized anatase TiO2 surfaces

    Wahab, Hilal S.; Bredow, Thomas; Aliwi, Salah M.

    2008-01-01

    In this work, we studied the adsorption of water molecule onto the (1 0 0), (0 1 0) and (0 0 1) surfaces of nano-sized anatase TiO 2 with semiempirical SCF MO method, MSINDO. The anatase TiO 2 particles are modeled with free clusters (TiO 2 ) n, where n = 20-80. Whereas, the surfaces have been modeled with two saturated clusters, Ti 21 O 58 H 32 and Ti 36 O 90 H 36 . The surface lattice fivefold coordinated titanium atoms (Ti 5C ), which represent the Lewis acid sites, are selected as adsorption centers. We also investigated the effect of TiO 2 cluster size on the computed band gap energy. Results reveal that the electronic properties of a cluster in the lowest excited state differ from that of the ground state. Furthermore, the MSINDO band gap energies of 3.68-3.77 eV for the anatase TiO 2 are in a fair accordance with other literature data. In agreement with other computational and experimental studies, the dissociated form of water molecule adsorption on anatase TiO 2 surfaces is always more stabilized than the molecular form

  10. Effect of anodizing voltage on the sorption of water molecules on porous alumina

    Vrublevsky, I., E-mail: vrublevsky@bsuir.edu.by [Belarusian State University of Informatics and Radioelectronics, Department of Micro and Nanoelectronics, 220013 Minsk (Belarus); Chernyakova, K. [Belarusian State University of Informatics and Radioelectronics, Department of Micro and Nanoelectronics, 220013 Minsk (Belarus); Bund, A.; Ispas, A.; Schmidt, U. [Fachgebiet Elektrochemie und Galvanotechnik, Technische Universitaet Ilmenau, 98693 Ilmenau (Germany)

    2012-05-01

    The amount of water adsorbed on different centers on the surface of oxalic acid alumina films is a function of the anodizing voltage. It is decreased with increasing the anodizing voltage from 20 up to 50 V, came up to maximum value at 20-30 V and slightly increased at voltages above 50 V. Water adsorption by oxide films formed at voltages below 50 V can be due to the negative surface charge that is present on the alumina surface. The negative surface charge disappears in the films formed at voltages higher than 50 V, and thus, the water is adsorbed on aluminum ions in a tetrahedral and octahedral environment. The correlation between anodizing conditions of aluminum in oxalic acid and the structure and composition of anodic alumina was established by Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM), thermogravimetric and differential thermal analyses (TG/DTA).

  11. Distinguishing Biologically Relevant Hexoses by Water Adduction to the Lithium-Cationized Molecule.

    Campbell, Matthew T; Chen, Dazhe; Wallbillich, Nicholas J; Glish, Gary L

    2017-10-03

    A method to distinguish the four most common biologically relevant underivatized hexoses, d-glucose, d-galactose, d-mannose, and d-fructose, using only mass spectrometry with no prior separation/derivatization step has been developed. Electrospray of a solution containing hexose and a lithium salt generates [Hexose+Li] + . The lithium-cationized hexoses adduct water in a quadrupole ion trap. The rate of this water adduction reaction can be used to distinguish the four hexoses. Additionally, for each hexose, multiple lithiation sites are possible, allowing for multiple structures of [Hexose+Li] + . Electrospray produces at least one structure that reacts with water and at least one that does not. The ratio of unreactive lithium-cationized hexose to total lithium-cationized hexose is unique for the four hexoses studied, providing a second method for distinguishing the isomers. Use of the water adduction reaction rate or the unreactive ratio provides two separate methods for confidently (p ≤ 0.02) distinguishing the most common biologically relevant hexoses using only femtomoles of hexose. Additionally, binary mixtures of glucose and fructose were studied. A calibration curve was created by measuring the reaction rate of various samples with different ratios of fructose and glucose. The calibration curve was used to accurately measure the percentage of fructose in three samples of high fructose corn syrup (<4% error).

  12. Incipient ferroelectricity of water molecules confined to nano-channels of beryl

    Gorshunov, B. P.; Torgashev, V. I.; Zhukova, E.S.; Thomas, V.G.; Belyanchikov, M. A.; Kadlec, Christelle; Kadlec, Filip; Savinov, Maxim; Ostapchuk, Tetyana; Petzelt, Jan; Prokleška, J.; Tomas, P. V.; Pestrjakov, E.V.; Fursenko, D.A.; Shakurov, G.S.; Prokhorov, A. S.; Gorelik, V. S.; Kadyrov, L.S.; Uskov, V.V.; Kremer, R. K.; Dressel, M.

    2016-01-01

    Roč. 7, Sep (2016), 1-10, č. článku 12842. ISSN 2041-1723 R&D Projects: GA ČR(CZ) GA14-25639S Institutional support: RVO:68378271 Keywords : water * beryl * ferroelectricity * quantum fluctuations * Curie–Weiss behaviour Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 12.124, year: 2016

  13. Validation of lower limb segmental volumetry with hand-held, self-positioning three-dimensional laser scanner against water displacement.

    Mestre, Sandrine; Veye, Florent; Perez-Martin, Antonia; Behar, Thomas; Triboulet, Jean; Berron, Nicolas; Demattei, Christophe; Quéré, Isabelle

    2014-01-01

    Measurement of limb volume is helpful for the evaluation and follow-up of edema, especially in patients with chronic venous insufficiency (CVI) or lymphedema. Water displacement (WD) is the reference method for limb volumetry but is not really suitable for clinical routine. Indirect volumetry based on circumference measurements as well as the more expansive but automatic optoelectronic techniques do not allow detailed measurement at the extremity of the limb. We used a self-positioning laser scanner with dynamic referencing for acquisition and real-time three-dimensional (3D) reconstruction of the lower limb volume in 30 patients with CVI, 30 patients with lymphedema, and 30 healthy controls. Two independent observers performed either one or two laser scans, whose results were tested for intra- and interobserver reproducibility and compared with WD volumetry by Lin's concordance correlation coefficient and Bland and Altman graphic analysis. Automatic volume calculation from 3D laser scanning data failed in one patient with major lymphedema. Lin's concordance correlation coefficient was 0.99 and 0.98, respectively, for intraobserver no. 1 and no. 2, 0.98 for interobserver reproducibility, and 0.98 and 0.96, respectively, for observer no. 1 and observer no. 2 vs WD comparison. The 3D laser scanning yielded 1.99% precision. Accuracy was 3.12% for observer no. 1 and 2.71% for observer no. 2, laser scanning values being 90 mL higher than WD, which could be attributed to the different posture during measurement. Three-dimensional laser scanning is accurate and reproducible, and appears suitable for the evaluation of limb volume in patients with CVI or lymphedema. Copyright © 2014 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

  14. Water-displacement plethysmography: a technique for the simultaneous thermal manipulation and measurement of whole-hand and whole-foot blood flows

    Caldwell, Joanne N; Taylor, Nigel A S

    2014-01-01

    The purpose of this project was to design, construct and validate water-displacement plethysmographs for the forearm, hand and foot that could clamp segmental skin temperature whilst simultaneously measuring cutaneous blood flow. Two experiments were performed. In the first, the forearm plethysmograph was validated against a mercury-in-silastic plethysmograph under thermoneutral conditions, with and without forearm heating. Cutaneous vascular conductance was elevated almost three-fold by this treatment, however, there were no significant differences between the two forms of plethysmography in either state (P > 0.05). In study two, hand and foot blood flows were measured under clamped thermoneutral conditions, but with three local skin temperature treatments (5, 25, 40 °C). The hand had significantly higher blood flows than the foot at both 25 °C (4.07 versus 2.20 mL.100 mL  − 1 .min  − 1 ; P < 0.05) and 40 °C (8.20 versus 4.47 mL.100 mL  − 1 .min  − 1 ; P < 0.05). The foot was maximally constricted during the two lower temperatures, yet the cutaneous thermal sensitivity of the hand was almost two-fold greater (P < 0.05). This evidence supports the significant role played by these appendages in heat loss and conservation, and these plethysmographs will now be used to map cutaneous vascular responses (forearm, hand, calf, foot) across combinations of core and local skin temperatures. (paper)

  15. Aqueous solvation of polyalanine α-helices with specific water molecules and with the CPCM and SM5.2 aqueous continuum models using density functional theory.

    Marianski, Mateusz; Dannenberg, J J

    2012-02-02

    We present density functional theory (DFT) calculations at the X3LYP/D95(d,p) level on the solvation of polyalanine α-helices in water. The study includes the effects of discrete water molecules and the CPCM and AMSOL SM5.2 solvent continuum model both separately and in combination. We find that individual water molecules cooperatively hydrogen-bond to both the C- and N-termini of the helix, which results in increases in the dipole moment of the helix/water complex to more than the vector sum of their individual dipole moments. These waters are found to be more stable than in bulk solvent. On the other hand, individual water molecules that interact with the backbone lower the dipole moment of the helix/water complex to below that of the helix itself. Small clusters of waters at the termini increase the dipole moments of the helix/water aggregates, but the effect diminishes as more waters are added. We discuss the somewhat complex behavior of the helix with the discrete waters in the continuum models.

  16. Ubiquitous water-soluble molecules in aquatic plant exudates determine specific insect attraction.

    Sérandour, Julien; Reynaud, Stéphane; Willison, John; Patouraux, Joëlle; Gaude, Thierry; Ravanel, Patrick; Lempérière, Guy; Raveton, Muriel

    2008-10-08

    Plants produce semio-chemicals that directly influence insect attraction and/or repulsion. Generally, this attraction is closely associated with herbivory and has been studied mainly under atmospheric conditions. On the other hand, the relationship between aquatic plants and insects has been little studied. To determine whether the roots of aquatic macrophytes release attractive chemical mixtures into the water, we studied the behaviour of mosquito larvae using olfactory experiments with root exudates. After testing the attraction on Culex and Aedes mosquito larvae, we chose to work with Coquillettidia species, which have a complex behaviour in nature and need to be attached to plant roots in order to obtain oxygen. This relationship is non-destructive and can be described as commensal behaviour. Commonly found compounds seemed to be involved in insect attraction since root exudates from different plants were all attractive. Moreover, chemical analysis allowed us to identify a certain number of commonly found, highly water-soluble, low-molecular-weight compounds, several of which (glycerol, uracil, thymine, uridine, thymidine) were able to induce attraction when tested individually but at concentrations substantially higher than those found in nature. However, our principal findings demonstrated that these compounds appeared to act synergistically, since a mixture of these five compounds attracted larvae at natural concentrations (0.7 nM glycerol, insect relationships in aquatic eco-systems.

  17. Open challenges in structure-based virtual screening: Receptor modeling, target flexibility consideration and active site water molecules description.

    Spyrakis, Francesca; Cavasotto, Claudio N

    2015-10-01

    Structure-based virtual screening is currently an established tool in drug lead discovery projects. Although in the last years the field saw an impressive progress in terms of algorithm development, computational performance, and retrospective and prospective applications in ligand identification, there are still long-standing challenges where further improvement is needed. In this review, we consider the conceptual frame, state-of-the-art and recent developments of three critical "structural" issues in structure-based drug lead discovery: the use of homology modeling to accurately model the binding site when no experimental structures are available, the necessity of accounting for the dynamics of intrinsically flexible systems as proteins, and the importance of considering active site water molecules in lead identification and optimization campaigns. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

    Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in [Molecular Modeling Laboratory, Department of Chemistry, Indian Institute of Technology, Kharagpur 721302 (India)

    2015-07-28

    Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging the ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.

  19. Ubiquitous water-soluble molecules in aquatic plant exudates determine specific insect attraction.

    Julien Sérandour

    Full Text Available Plants produce semio-chemicals that directly influence insect attraction and/or repulsion. Generally, this attraction is closely associated with herbivory and has been studied mainly under atmospheric conditions. On the other hand, the relationship between aquatic plants and insects has been little studied. To determine whether the roots of aquatic macrophytes release attractive chemical mixtures into the water, we studied the behaviour of mosquito larvae using olfactory experiments with root exudates. After testing the attraction on Culex and Aedes mosquito larvae, we chose to work with Coquillettidia species, which have a complex behaviour in nature and need to be attached to plant roots in order to obtain oxygen. This relationship is non-destructive and can be described as commensal behaviour. Commonly found compounds seemed to be involved in insect attraction since root exudates from different plants were all attractive. Moreover, chemical analysis allowed us to identify a certain number of commonly found, highly water-soluble, low-molecular-weight compounds, several of which (glycerol, uracil, thymine, uridine, thymidine were able to induce attraction when tested individually but at concentrations substantially higher than those found in nature. However, our principal findings demonstrated that these compounds appeared to act synergistically, since a mixture of these five compounds attracted larvae at natural concentrations (0.7 nM glycerol, <0.5 nM uracil, 0.6 nM thymine, 2.8 nM uridine, 86 nM thymidine, much lower than those found for each compound tested individually. These results provide strong evidence that a mixture of polyols (glycerol, pyrimidines (uracil, thymine, and nucleosides (uridine, thymidine functions as an efficient attractive signal in nature for Coquillettidia larvae. We therefore show for the first time, that such commonly found compounds may play an important role in plant-insect relationships in aquatic eco-systems.

  20. Physical capture and release of drug molecules, water and cations by a smectite clay

    Carvalho dos Santos, Éverton

    -fluorohectorite (LiFh, Li1.2(Mg4.8Li1.2)Si8O20F4), a synthetic clay mineral from the smectite family, have been experimentally analyzed. By means of X-rays powder diffraction (XRD), using both an in-house instrument and synchrotron radiation, UV-Vis spectroscopy, Thermogravimetric Analysis coupled to an Infrared......-analysis and inelastic neutron scattering data we established that the drug presence into the interlayer space of Fh is weakening the water-clay interactions. Furthermore, CIPRO’s release from Fh in synthetic gastric acid juice (SGA) as a function of time and temperature was also carefully followed. Our studies showed...... and toxicological tests, we demonstrated that the effectiveness and toxicity of pure CIPRO is unaffected in the clay-drug complex. To conclude, the high drug adsorption capacity as well as the slow and gradual release from CIPRO when intercalated in Fh adds this synthetic smectite to the list of promising drug...

  1. Displacement data assimilation

    Rosenthal, W. Steven [Pacific Northwest Laboratory, Richland, WA 99354 (United States); Venkataramani, Shankar [Department of Mathematics and Program in Applied Mathematics, University of Arizona, Tucson, AZ 85721 (United States); Mariano, Arthur J. [Rosenstiel School of Marine & Atmospheric Science, University of Miami, Miami, FL 33149 (United States); Restrepo, Juan M., E-mail: restrepo@math.oregonstate.edu [Department of Mathematics, Oregon State University, Corvallis, OR 97331 (United States)

    2017-02-01

    We show that modifying a Bayesian data assimilation scheme by incorporating kinematically-consistent displacement corrections produces a scheme that is demonstrably better at estimating partially observed state vectors in a setting where feature information is important. While the displacement transformation is generic, here we implement it within an ensemble Kalman Filter framework and demonstrate its effectiveness in tracking stochastically perturbed vortices.

  2. Detecting Darwinism from Molecules in the Enceladus Plumes, Jupiter's Moons, and Other Planetary Water Lagoons.

    Benner, Steven A

    2017-09-01

    To the astrobiologist, Enceladus offers easy access to a potential subsurface biosphere via the intermediacy of a plume of water emerging directly into space. A direct question follows: If we were to collect a sample of this plume, what in that sample, through its presence or its absence, would suggest the presence and/or absence of life in this exotic locale? This question is, of course, relevant for life detection in any aqueous lagoon that we might be able to sample. This manuscript reviews physical chemical constraints that must be met by a genetic polymer for it to support Darwinism, a process believed to be required for a chemical system to generate properties that we value in biology. We propose that the most important of these is a repeating backbone charge; a Darwinian genetic biopolymer must be a "polyelectrolyte." Relevant to mission design, such biopolymers are especially easy to recover and concentrate from aqueous mixtures for detection, simply by washing the aqueous mixtures across a polycharged support. Several device architectures are described to ensure that, once captured, the biopolymer meets two other requirements for Darwinism, homochirality and a small building block "alphabet." This approach is compared and contrasted with alternative biomolecule detection approaches that seek homochirality and constrained alphabets in non-encoded biopolymers. This discussion is set within a model for the history of the terran biosphere, identifying points in that natural history where these alternative approaches would have failed to detect terran life. Key Words: Enceladus-Life detection-Europa-Icy moon-Biosignatures-Polyelectrolyte theory of the gene. Astrobiology 17, 840-851.

  3. Displacer Diameter Effect in Displacer Pulse Tube Refrigerator

    Zhu, Shaowei

    2017-12-01

    Gas driving displacer pulse tube refrigerators are one of the work recovery type of pulse tube refrigerators whose theoretical efficiency is the same as Stirling refrigerators'. Its cooling power is from the displacement of the displacer. Displace diameter, rod diameter and pressure drop of the regenerator influence the displacement, which are investigated by numerical simulation. It is shown that the displacement ratio of the displacer over the piston is almost not affected by the displacer diameter at the same rod diameter ratio, or displacer with different diameters almost has the same performance.

  4. Influence of the effective mass of water molecule on thermal neutron scattering; Uticaj efektivne mase molekula vode na rasejanje termalnih neutrona

    Markovic, M [Belgrade Univ. (Yugoslavia). Elektrotehnicki Fakultet

    1981-07-01

    The influence of the effective water molecule mass on the thermal neutron scattering on the nucleus of the hydrogen atom has been investigated. Besides the actual water molecule mass (M = 18) the investigations have been carried out with its two effective values (M1 = 16 and M2 = 20). The differential and total cross sections have been calculated for the incident thermal neutron energy E{sub o} = 1 eV. Investigation results show different prominence of the quantum effects and for M2 the appearance of peaks in the quasielastic scattering. (author)

  5. Dihydrogen phosphate-water tape and layers vs dihydrogen phosphate layers tuned by hydrophobic isomeric pyridine-diamine functionalized molecules

    Huang, Jing; Liu, Tong-Peng; Huo, Li-Hua; Deng, Zhao-Peng; Gao, Shan

    2017-01-01

    Assembly of six isomeric pyridine-diamine-based molecules, N,N‧-bis(pyridin-4-ylmethyl)ethane-1,2-diamine (M1), N,N‧-bis(pyridin-3-ylmethyl)ethane-1,2-diamine (M2), N,N‧-bis(pyridin-2-ylmethyl)ethane-1,2-diamine (M3), N,N‧-bis(pyridin-4-ylmethyl)propane-1,3-diamine (M4), N,N‧-bis(pyridin-3-ylmethyl)propane-1,2-diamine (M5), and N,N‧-bis(pyridin-2-ylmethyl)propane-1,3-diamine (M6), with phosphoric acid (H3PO4) in different ratio (1:2 and 1:4), leads to the formation of nine salts, H2M12+·2H2PO4-·4H2O (1), H2M22+·2H2PO4-·2H2O (2), H2M32+·2H2PO4-·2H2O (3), H4M14+·4H2PO4- (4), H4M24+·4H2PO4- (5), H4M34+·4H2PO4- (6), H2M42+·2H2PO4-·3H2O (7), 2H2M52+·4H2PO4-·2H3PO4 (8), and H2M62+·2H2PO4- (9), which have been characterized by elemental analysis, IR, TG, PL, powder and single-crystal X-ray diffraction. Structural analyses indicate that hydrogen-bonding patterns of H2PO4- anions, conformation of protonated cations can effectively influence the supramolecular architectures through diverse non-covalent interactions. Hydrous salts 1-3 and 7 present 2D and 3D host-guest supramolecular networks, in which the connection of H2PO4- anions and water molecules generates diverse tape and layer motifs. H2PO4- anions in anhydrous salts 4-6 interconnect with each other through hydrogen bonds to form two types of layers, which are joined by discrete H4M4+ cations into 3D inorganic-organic hybrid supramolecular networks. Salts 8-9 also present 2D and 3D host-guest supramolecular networks where the interconnection of H2PO4- anions and its combination with H3PO4 molecules leads to diverse layers. Luminescent analyses indicate that salts 1-9 exhibit violet and blue emission maximum in the range of 390-467 nm at room temperature.

  6. Combined quantum mechanics/molecular mechanics (QM/MM) simulations for protein-ligand complexes: free energies of binding of water molecules in influenza neuraminidase.

    Woods, Christopher J; Shaw, Katherine E; Mulholland, Adrian J

    2015-01-22

    The applicability of combined quantum mechanics/molecular mechanics (QM/MM) methods for the calculation of absolute binding free energies of conserved water molecules in protein/ligand complexes is demonstrated. Here, we apply QM/MM Monte Carlo simulations to investigate binding of water molecules to influenza neuraminidase. We investigate five different complexes, including those with the drugs oseltamivir and peramivir. We investigate water molecules in two different environments, one more hydrophobic and one hydrophilic. We calculate the free-energy change for perturbation of a QM to MM representation of the bound water molecule. The calculations are performed at the BLYP/aVDZ (QM) and TIP4P (MM) levels of theory, which we have previously demonstrated to be consistent with one another for QM/MM modeling. The results show that the QM to MM perturbation is significant in both environments (greater than 1 kcal mol(-1)) and larger in the more hydrophilic site. Comparison with the same perturbation in bulk water shows that this makes a contribution to binding. The results quantify how electronic polarization differences in different environments affect binding affinity and also demonstrate that extensive, converged QM/MM free-energy simulations, with good levels of QM theory, are now practical for protein/ligand complexes.

  7. Solvation study of the non-specific lipid transfer protein from wheat by intermolecular NOEs with water and small organic molecules

    Liepinsh, Edvards; Sodano, Patrick; Tassin, Severine; Marion, Didier; Vovelle, Francoise; Otting, Gottfried

    1999-01-01

    Intermolecular nuclear Overhauser effects (NOEs) were measured between the protons of various small solvent or gas molecules and the non-specific lipid transfer protein (ns-LTP) from wheat. Intermolecular NOEs were observed with the hydrophobic pocket in the interior of wheat ns-LTP, which grew in intensity in the order cyclopropane (saturated solution) < methane (140 bar) < ethane (40 bar) < acetonitrile (5% in water) < cyclohexane (saturated solution) < benzene (saturated solution). No intermolecular NOEs were observed with dioxane (5% in water). The intermolecular NOEs were negative for all of the organic molecules tested. Intermolecular NOEs between wheat ns-LTP and water were weak or could not be distinguished from exchange-relayed NOEs. As illustrated by the NOEs with cyclohexane versus dioxane, the hydrophobic pocket in wheat ns-LTP preferably binds non-polar molecules. Yet, polar molecules like acetonitrile can also be accommodated. The pressure dependence of the NOEs between methane and wheat ns-LTP indicated incomplete occupancy, even at 190 bar methane pressure. In general, NOE intensities increased with the size of the ligand molecule and its vapor pressure. NMR of the vapor phase showed excellent resolution between the signals from the gas phase and those from the liquid phase. The vapor concentration of cyclohexane was fivefold higher than that of the dioxane solution, supporting the binding of cyclohexane versus uptake of dioxane

  8. Studies on the retention mechanism of solutes in hydrophilic interaction chromatography using stoichiometric displacement theory I. The linear relationship of lgk' vs. lg[H2O].

    Wang, Fei; Yang, Fan; Tian, Yang; Liu, Jiawei; Shen, Jiwei; Bai, Quan

    2018-01-01

    A stoichiometric displacement model for retention (SDM-R) of small solutes and proteins based on hydrophilic interaction chromatography (HILIC) was presented. A linear equation that related the logarithm of the capacity factor of the solute to the logarithm of the concentration of water in the mobile phase was derived. The stoichiometric displacement parameters, Z (the number of water molecules required to displace a solute from ligands) and lgI (containing a number of constants that relate to the affinity of solute to the ligands) could be obtained from the slope and the intercept of the linear plots of lgk' vs. lg[H 2 O]. The retention behaviors and retention mechanism of 15 kinds of small solutes and 6 kinds of proteins on 5 kinds HILIC columns with different ligands were investigated with SDM-R in typical range of water concentration in mobile phase. A good linear relationship between lgk' and lg[H 2 O] demonstrated that the most rational retention mechanism of solute in HILIC was a stoichiometric displacement process between solute and solvent molecules with water as displacing agents, which was not only valid for small solutes, but also could be used to explain the retention mechanism of biopolymers in HILIC. Comparing with the partition and adsorption models in HILIC, SDM-R was superior to them. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Lateral displacement in small angle multiple scattering

    Bichsel, H.; Hanson, K.M.; Schillaci, K.M. (Los Alamos National Lab., NM (USA))

    1982-07-01

    Values have been calculated for the average lateral displacement in small angle multiple scattering of protons with energies of several hundred MeV. The calculations incorporate the Moliere distribution which does not make the gaussian approximations of the distribution in projected angle and lateral deflections. Compared to other published data, such approximations can lead to errors in the lateral displacement of up to 10% in water.

  10. Photoluminescence behaviors of single CdSe/ZnS/TOPO nanocrystals: Adsorption effects of water molecules onto nanocrystal surfaces

    Oda, Masaru; Hasegawa, Atsushi; Iwami, Noriya; Nishiura, Ken; Ando, Naohisa; Nishiyama, Akira; Horiuchi, Hiromi; Tani, Toshiro

    2007-01-01

    We report here the distinctive modifications of photoluminescence (PL) behaviors in single CdSe/ZnS/TOPO nanocrystals depending on their environments. Long-time traces of PL intensity from single nanocrystals have been obtained in both vacuum and a wet nitrogen atmosphere. While all of the nanocrystals in both environments exhibit PL blinking behaviors, i.e. on-off intermittency of PL intensity, as usual, some of the nanocrystals in the wet nitrogen atmosphere show significant increase in duration time of on-events. As for the duration time of blinking off-events, it is for the moment associated with the occasional events of carrier capturing at trap sites on or near the nanocrystal surfaces. We propose a model in which adsorbed water molecules at the trap sites on the nanocrystal surfaces transform them under light irradiation, which eventually decreases the occurrence of the trapping events due to their inactivation. It in turn increases the PL on-times. In addition to the drastic modification of the blinking profile, we also found that in the PL time traces some kinds of undulated behaviors, i.e. continuous and rather low frequency fluctuation of PL intensity, appear during each on-event in vacuum while they disappear totally in the wet nitrogen atmosphere. These results are also described on the basis of the inactivation model of the trap sites introduced above

  11. Capacitive Sensing of Intercalated H2O Molecules Using Graphene.

    Olson, Eric J; Ma, Rui; Sun, Tao; Ebrish, Mona A; Haratipour, Nazila; Min, Kyoungmin; Aluru, Narayana R; Koester, Steven J

    2015-11-25

    Understanding the interactions of ambient molecules with graphene and adjacent dielectrics is of fundamental importance for a range of graphene-based devices, particularly sensors, where such interactions could influence the operation of the device. It is well-known that water can be trapped underneath graphene and its host substrate; however, the electrical effect of water beneath graphene and the dynamics of how the interfacial water changes with different ambient conditions has not been quantified. Here, using a metal-oxide-graphene variable-capacitor (varactor) structure, we show that graphene can be used to capacitively sense the intercalation of water between graphene and HfO2 and that this process is reversible on a fast time scale. Atomic force microscopy is used to confirm the intercalation and quantify the displacement of graphene as a function of humidity. Density functional theory simulations are used to quantify the displacement of graphene induced by intercalated water and also explain the observed Dirac point shifts as being due to the combined effect of water and oxygen on the carrier concentration in the graphene. Finally, molecular dynamics simulations indicate that a likely mechanism for the intercalation involves adsorption and lateral diffusion of water molecules beneath the graphene.

  12. Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

    Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

    2015-01-01

    In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

  13. A nonpolar, nonamphiphilic molecule can accelerate adsorption of phospholipids and lower their surface tension at the air/water interface.

    Nguyen, Phuc Nghia; Trinh Dang, Thuan Thao; Waton, Gilles; Vandamme, Thierry; Krafft, Marie Pierre

    2011-10-04

    The adsorption dynamics of a series of phospholipids (PLs) at the interface between an aqueous solution or dispersion of the PL and a gas phase containing the nonpolar, nonamphiphilic linear perfluorocarbon perfluorohexane (PFH) was studied by bubble profile analysis tensiometry. The PLs investigated were dioctanoylphosphatidylcholine (DiC(8)-PC), dilaurylphosphatidylcholine, dimyristoylphosphatidylcholine, and dipalmitoylphosphatidylcholine. The gas phase consisted of air or air saturated with PFH. The perfluorocarbon gas was found to have an unexpected, strong effect on both the adsorption rate and the equilibrium interfacial tension (γ(eq)) of the PLs. First, for all of the PLs, and at all concentrations investigated, the γ(eq) values were significantly lower (by up to 10 mN m(-1)) when PFH was present in the gas phase. The efficacy of PFH in decreasing γ(eq) depends on the ability of PLs to form micelles or vesicles in water. For vesicles, it also depends on the gel or fluid state of the membranes. Second, the adsorption rates of all the PLs at the interface (as assessed by the time required for the initial interfacial tension to be reduced by 30%) are significantly accelerated (by up to fivefold) by the presence of PFH for the lower PL concentrations. Both the surface-tension reducing effect and the adsorption rate increasing effect establish that PFH has a strong interaction with the PL monolayer and acts as a cosurfactant at the interface, despite the absence of any amphiphilic character. Fitting the adsorption profiles of DiC(8)-PC at the PFH-saturated air/aqueous solution interface with the modified Frumkin model indicated that the PFH molecule lay horizontally at the interface. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Inorganics in Organics: Tracking down the Intrinsic Equilibriums between Organic Molecules and Trace Elements in Oceanic Waters

    Lechtenfeld, O. J.; Koch, B. P.; Kattner, G.

    2010-12-01

    Recent developments in analytical instrumentation enable to describe biogeochemical processes in oceanic waters on a molecular level. This is the prerequisite to integrate biological and geochemical parameters and to develop chemical cycles on a global perspective. The state-of-the-art Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR-MS) applications for dissolved organic matter (DOM) focus mainly on carbon, hydrogen, oxygen and nitrogen isotopes. Implementation of sulfur and especially phosphorus in the molecular formula assignment has been questionable because of ambiguous calculated elemental formulas. On the other hand, many compounds bearing these elements are well known to occur in the dissolved state as part of the permanent recycling processes (e.g. phospholipids, phosphonates) but analytics of dissolved organic phosphorus (DOP) and sulfur (DOS) are often hampered by the large inorganic P and S pools. Even less is known about complexation characteristics of the DOM moieties. Although electrochemical methods provide some information about trace metal speciation, the high amount of organic molecules and its insufficient description as chemical functional classes prevent the assignment of trace metals to ligand classes. Nevertheless, it is undoubtful that a varying but extensive amount of transition metals is bond in form of organic complexes. Hyphenation of reversed phase high performance liquid chromatography (RP-HPLC) with high resolution inductively coupled plasma mass spectrometry (HR-ICP-MS) is a valuable tool to study these metal-organic interactions in a qualitative and quantitative approach. We established a desolvation method that allows direct transfer of high organic solvent loads into the plasma. Thus, in combination with internal standardization and external calibration, the investigation of a broad polarity scale was possible. This approach overcomes previous restrictions to non-organic solvent separation techniques like size

  15. Analytic vibrational matrix elements for diatomic molecules

    Bouanich, J.P.; Ogilvie, J.F.; Tipping, R.H.

    1986-01-01

    The vibrational matrix elements and expectation values for a diatomic molecule, including the rotational dependence, are calculated for powers of the reduced displacement in terms of the parameters of the Dunham potential-energy function. (orig.)

  16. Internal Displacement: Livelihood saving responses

    Deborah Hines

    2001-01-01

    Deborah Hines explores how to assist the internally displaced and those prone to displacement. She considers the major causes of internal displacement, making the case for a more comprehensive set of policy and operational actions in response to situations of internal displacement. Development (2001) 44, 34–39. doi:10.1057/palgrave.development.1110289

  17. A hot water extract of Curcuma longa inhibits adhesion molecule protein expression and monocyte adhesion to TNF-α-stimulated human endothelial cells.

    Kawasaki, Kengo; Muroyama, Koutarou; Yamamoto, Norio; Murosaki, Shinji

    2015-01-01

    The recruitment of arterial leukocytes to endothelial cells is an important step in the progression of various inflammatory diseases. Therefore, its modulation is thought to be a prospective target for the prevention or treatment of such diseases. Adhesion molecules on endothelial cells are induced by proinflammatory cytokines, including tumor necrosis factor-α (TNF-α), and contribute to the recruitment of leukocytes. In the present study, we investigated the effect of hot water extract of Curcuma longa (WEC) on the protein expression of adhesion molecules, monocyte adhesion induced by TNF-α in human umbilical vascular endothelial cells (HUVECs). Treatment of HUVECs with WEC significantly suppressed both TNF-α-induced protein expression of adhesion molecules and monocyte adhesion. WEC also suppressed phosphorylation and degradation of nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha (IκBα) induced by TNF-α in HUVECs, suggesting that WEC inhibits the NF-κB signaling pathway.

  18. Displacement compressors - acceptance tests

    International Organization for Standardization. Geneva

    1996-01-01

    ISO 1217:2009 specifies methods for acceptance tests regarding volume rate of flow and power requirements of displacement compressors. It also specifies methods for testing liquid-ring type compressors and the operating and testing conditions which apply when a full performance test is specified.

  19. Piezoelectric displacement in ceramics

    Stewart, M.; Cain, M.; Gee, M.

    1999-01-01

    This Good Practice Guide is intended to aid a user to perform displacement measurements on piezoelectric ceramic materials such as PZT (lead zirconium titanate) in either monolithic or multilayer form. The various measurement issues that the user must consider are addressed, and good measurement practise is described for the four most suitable methods. (author)

  20. Molecule nanoweaver

    Gerald, II; Rex, E [Brookfield, IL; Klingler, Robert J [Glenview, IL; Rathke, Jerome W [Homer Glen, IL; Diaz, Rocio [Chicago, IL; Vukovic, Lela [Westchester, IL

    2009-03-10

    A method, apparatus, and system for constructing uniform macroscopic films with tailored geometric assemblies of molecules on the nanometer scale. The method, apparatus, and system include providing starting molecules of selected character, applying one or more force fields to the molecules to cause them to order and condense with NMR spectra and images being used to monitor progress in creating the desired geometrical assembly and functionality of molecules that comprise the films.

  1. The effect of water molecules on the thiol collector interaction on the galena (PbS) and sphalerite (ZnS) surfaces: A DFT study

    Long, Xianhao [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); Chen, Ye, E-mail: fby18@126.com [College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China); Chen, Jianhua, E-mail: jhchen@gxu.edu.cn [School of Chemistry and Chemical Engineering, Guangxi University, Nanning 530004 (China); College of Resources and Metallurgy, Guangxi University, Nanning 530004 (China); Xu, Zhenghe; Liu, Qingxia [Department of Chemical and Materials Engineering, University of Alberta, Edmonton, AB T6G 2V4 (Canada); Du, Zheng [National Supercomputing Center in Shenzhen, Shenzhen 518055 (China)

    2016-12-15

    Highlights: • Water adsorption has a greater effect on the electron distribution of ZnS surface than PbS surface. • Water adsorption decreases the reactivity of ZnS surface atoms but improves that of PbS. • Thiol collectors cannot interact with the hydrated ZnS surface. • The hydration has little influence on the interaction of thiol collectors with PbS surface. - Abstracts: In froth flotation the molecular interaction between reagents and mineral surfaces take place at the solid liquid interface. In this paper, the effect of water molecule on the three typical thiol collectors (xanthate, dithiocarbomate and dithiophosphate) interactions at the galena (PbS) and sphalerite (ZnS) surfaces has been studied adopting density functional theory (DFT). The results suggests that the presence of water molecule shows a greater influence on the electron distribution of ZnS surface than PbS surface, and reduce the reactivity of ZnS surface atoms but improves the reactivity of PbS surface atoms during the reaction with xanthate. Water adsorption could also reduce the covalent binding between Zn and S atoms but have little influence on Pb-S bond. In the presence of water, xanthate, dithiocarbomate (DTC) and dithiophosphate (DTP) could not adsorb on the sphalerite surface. And for galena (PbS) surface, the interaction of DTP is the strongest, then the DTC and the interaction of xanthate is the weakest. These results agree well with the flotation practice.

  2. The Comparative Study of the Effects of Extremely Low Frequency Electromagnetic Fields and Infrasound on Water Molecule Dissociation and Generation of Reactive Oxygen Species

    2008-11-01

    ISTC Project No. #1592P The Comparative Study of The Effects of Extremely Low Frequency Electromagnetic Fields and Infrasound on Water Molecule...performed under the agreement with the International Science and Technology Center ( ISTC ), Moscow. REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704...dissociation and generation of reactive oxygen spaces. 5a. CONTRACT NUMBER ISTC Registration No: A-1592p 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  3. Site-specific binding of a water molecule to the sulfa drugs sulfamethoxazole and sulfisoxazole: a laser-desorption isomer-specific UV and IR study.

    Uhlemann, Thomas; Seidel, Sebastian; Müller, Christian W

    2018-03-07

    To determine the preferred water molecule binding sites of the polybasic sulfa drugs sulfamethoxazole (SMX) and sulfisoxazole (SIX), we have studied their monomers and monohydrated complexes through laser-desorption conformer-specific UV and IR spectroscopy. Both the SMX and SIX monomer adopt a single conformer in the molecular beam. On the basis of their conformer-specific IR spectra in the NH stretch region, these conformers were assigned to the SMX and SIX global minimum structures, both exhibiting a staggered sulfonamide group and an intramolecular C-HO[double bond, length as m-dash]S hydrogen bond. The SMX-H 2 O and SIX-H 2 O complexes each adopt a single isomer in the molecular beam. Their isomeric structures were determined based on their isomer-specific IR spectra in the NH/OH stretch region. Quantum Theory of Atoms in Molecules analysis of the calculated electron densities revealed that in the SMX-H 2 O complex the water molecule donates an O-HN hydrogen bond to the heterocycle nitrogen atom and accepts an N-HO hydrogen bond from the sulfonamide NH group. In the SIX-H 2 O complex, however, the water molecule does not bind to the heterocycle but instead donates an O-HO[double bond, length as m-dash]S hydrogen bond to the sulfonamide group and accepts an N-HO hydrogen bond from the sulfonamide NH group. Both water complexes are additionally stabilized by a C ph -HOH 2 hydrogen bond. Interacting Quantum Atoms analysis suggests that all intermolecular hydrogen bonds are dominated by the short-range exchange-correlation contribution.

  4. Shore line displacement in Oeregrundsgrepen

    Brydsten, Lars

    1999-12-01

    This report is a part of the SKB project 'SAFE' (Safety Assessment of the Final Repository of Radioactive Operational Waste). The aim of project SAFE is to update the previous safety analysis of SFR-1. The analysis is to be presented to the Swedish authorities not later than the end of 2000. SFR-1 is a facility for disposal of low and intermediate level radioactive waste and is situated in bedrock beneath the Baltic Sea, 1 km off the coast near the Forsmark nuclear power plant in Northern Uppland. The shore displacement in the Oeregrundsgrepen area is at present approximately 60 cm per 100 years and is slowly decreasing, but will still be substantial for many thousands of years. Since Oeregrundsgrepen is a relatively shallow part of the Bothnian Sea, the positive shore displacement will greatly effect the proportions of land and sea in the future. Within 2000 years (4000 AD) half of the current water area in Oeregrundsgrepen will be land and the water volume will be decreased with two thirds. At 7000 AD, the whole Oeregrundsgrepen area will be without brackish water. The effects on the landscape evolution due to shore displacement in the Oeregrundsgrepen area are illustrated in a chronological series of digital maps in Power Point format available saved on the supplied CD-rom and entitled 'Elevation.ppt '. The bedrock tectonics in the area are in two dominating directions: one northern that can be seen in the west shoreline of the island Graesoe and one in a north-westerly direction seen in the shoreline of the mainland. Many of the large basins that will be established in the area due to the shore displacement will be elongated in one of these directions. Some of the basins are relatively shallow and therefore probably will be totally filled with organic rich sediments and will form peat or bogs. Other basins, especially Graesoeraennan (the deep channel on the west side of Graesoe) are deep basins and will form a long chain of deep lakes. One of the deeper basins

  5. Shore line displacement in Oeregrundsgrepen

    Brydsten, Lars [Umeaa Univ. (Sweden). Dept. of Ecology and Environmental Science

    1999-12-15

    This report is a part of the SKB project 'SAFE' (Safety Assessment of the Final Repository of Radioactive Operational Waste). The aim of project SAFE is to update the previous safety analysis of SFR-1. The analysis is to be presented to the Swedish authorities not later than the end of 2000. SFR-1 is a facility for disposal of low and intermediate level radioactive waste and is situated in bedrock beneath the Baltic Sea, 1 km off the coast near the Forsmark nuclear power plant in Northern Uppland. The shore displacement in the Oeregrundsgrepen area is at present approximately 60 cm per 100 years and is slowly decreasing, but will still be substantial for many thousands of years. Since Oeregrundsgrepen is a relatively shallow part of the Bothnian Sea, the positive shore displacement will greatly effect the proportions of land and sea in the future. Within 2000 years (4000 AD) half of the current water area in Oeregrundsgrepen will be land and the water volume will be decreased with two thirds. At 7000 AD, the whole Oeregrundsgrepen area will be without brackish water. The effects on the landscape evolution due to shore displacement in the Oeregrundsgrepen area are illustrated in a chronological series of digital maps in Power Point format available saved on the supplied CD-rom and entitled 'Elevation.ppt '. The bedrock tectonics in the area are in two dominating directions: one northern that can be seen in the west shoreline of the island Graesoe and one in a north-westerly direction seen in the shoreline of the mainland. Many of the large basins that will be established in the area due to the shore displacement will be elongated in one of these directions. Some of the basins are relatively shallow and therefore probably will be totally filled with organic rich sediments and will form peat or bogs. Other basins, especially Graesoeraennan (the deep channel on the west side of Graesoe) are deep basins and will form a long chain of deep lakes. One

  6. Measurement of interfacial displacement of a liquid film in microchannels using laser focus displacement meter

    Hazuku, Tatsuya; Fukamachi, Norihiro; Takamasa, Tomoji; Hibiki, Takashi

    2004-01-01

    This paper presents a new method for measuring the interfacial displacement of a liquid film in microchannels using a laser focus displacement meter (LFD). The purpose of the study is to clarify the effectiveness of the new method for obtaining detailed information concerning interfacial displacement, especially in the case of a thin liquid film, in micro- and mini-channels. To prevent the tube wall signal from disturbing that of the gas-liquid interface, a fluorocarbon tube with water box was used; the refraction index of this device is same as that for water. With this method, accurate instantaneous measurements of interfacial displacement of the liquid film were achieved. The error caused by refraction of the laser beam passing through the acrylic water box and fluorocarbon tube was estimated analytically and experimentally. The formulated analytical equation can estimate the real interface displacement using measured displacement in a fluorocarbon tube of 25 μm to 2.0 mm I.D. A preliminary test using fluorocarbon tubes of 1 and 2 mm I.D. showed that the corrected interface displacement calculated by the equation agreed with real displacement within a 1% margin of error. It was also confirmed that the LFD in the system could measure a liquid film of 0.25 μm at the thinnest. We made simultaneous measurements of the interface in fluorocarbon tubes of 0.5 and 1 mm I.D. using the LFD and a high-speed video camera with a microscope. These showed that the LFD could measure the interface of a liquid film with high spatial and temporal resolution during annular, slug, and piston flow regimes. The data also clarified the existence of a thin liquid film less than 1 μm in thickness in slug and annular flow regions. (author)

  7. Gibbs Free Energy of Hydrolytic Water Molecule in Acyl-Enzyme Intermediates of a Serine Protease: A Potential Application for Computer-Aided Discovery of Mechanism-Based Reversible Covalent Inhibitors.

    Masuda, Yosuke; Yamaotsu, Noriyuki; Hirono, Shuichi

    2017-01-01

    In order to predict the potencies of mechanism-based reversible covalent inhibitors, the relationships between calculated Gibbs free energy of hydrolytic water molecule in acyl-trypsin intermediates and experimentally measured catalytic rate constants (k cat ) were investigated. After obtaining representative solution structures by molecular dynamics (MD) simulations, hydration thermodynamics analyses using WaterMap™ were conducted. Consequently, we found for the first time that when Gibbs free energy of the hydrolytic water molecule was lower, logarithms of k cat were also lower. The hydrolytic water molecule with favorable Gibbs free energy may hydrolyze acylated serine slowly. Gibbs free energy of hydrolytic water molecule might be a useful descriptor for computer-aided discovery of mechanism-based reversible covalent inhibitors of hydrolytic enzymes.

  8. Molecule Matters

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 4. Molecule Matters – van der Waals Molecules - History and Some Perspectives on Intermolecular Forces. E Arunan. Feature Article Volume 14 Issue 4 April 2009 pp 346-356 ...

  9. Phase-Transfer Energetics of Small-Molecule Alcohols Across the Water-Hexane Interface: Molecular Dynamics Simulation Using Charge Equilibration Models

    Bauer, Brad A.; Zhong, Yang; Meninger, David J.; Davis, Joseph E.; Patel, Sandeep

    2010-01-01

    We study the water-hexane interface using molecular dynamics (MD) and polarizable charge equilibration (CHEQ) force fields. Bulk densities for TIP4P-FQ water and hexane, 1.0086±0.0002 g/cm3 and 0.6378±0.0001 g/cm3, demonstrate excellent agreement with experiment. Interfacial width and interfacial tension are consistent with previously reported values. The in-plane component of the dielectric permittivity (ε∥) for water is shown to decrease from 81.7±0.04 to unity, transitioning longitudinally from bulk water to bulk hexane. ε∥ for hexane reaches a maximum in the interface, but this term represents only a small contribution to the total dielectric constant (as expected for a non-polar species). Structurally, net orientations of the molecules arise in the interfacial region such that hexane lies slightly parallel to the interface and water reorients to maximize hydrogen bonding. Interfacial potentials due to contributions of the water and hexane are calculated to be -567.9±0.13mV and 198.7±0.01mV, respectively, giving rise to a total potential in agreement with the range of values reported from previous simulations of similar systems. Potentials of mean force (PMF) calculated for methanol, ethanol, and 1-propanol for the transfer from water to hexane indicate an interfacial free energy minimum, corresponding to the amphiphilic nature of the molecules. The magnitudes of transfer free energies were further characterized from the solvation free energies of alcohols in water and hexane using thermodynamic integration. This analysis shows that solvation free energies for alcohols in hexane are 0.2-0.3 kcal/mol too unfavorable, whereas solvation of alcohols in water is approximately 1 kcal/mol too favorable. For the pure hexane-water interfacial simulations, we observe a monotonic decrease of the water dipole moment to near-vacuum values. This suggests that the electrostatic component of the desolvation free energy is not as severe for polarizable models than

  10. Use of water as displacing agent in ion exchange chromatographic separation of isotope of boron using weak base ion exchange resin

    Sharma, B.K.; Mohanakrishnan, G.; Anand Babu, C.; Krishna Prabhu, R.

    2008-01-01

    Experiments were undertaken to study the feasibility of using weakly basic anion exchange resin for enrichment of isotopes of boron by ion exchange chromatography and water as eluent. The results of experiments carried out to determine total chloride capacity (TCC), strong base capacity (SBC) of the resin at different concentrations of boric acid and enrichment profiles are reported in this paper. (author)

  11. Control rod displacement

    Nakazato, S.

    1987-01-01

    This patent describes a nuclear reactor including a core, cylindrical control rods, a single support means supporting the control rods from their upper ends in spaced apart positions and movable for displacing the control rods in their longitudinal direction between a first end position in which the control rods are fully inserted into the core and a second end position in which the control rods are retracted from the core, and guide means contacting discrete regions of the outer surface of each control rod at least when the control rods are in the vicinity of the second end position. The control rods are supported by the support means for longitudinal movement without rotation into and out of the core relative to the guide means to thereby cause the outer surface of the control rods to experience wear as a result of sliding contact with the guide means. The support means are so arranged with respect to the core and the guide means that it is incapable of rotation relative to the guide means. The improvement comprises displacement means being operatively coupled to a respective one of the control rods for periodically rotating the control rod in a single angular direction through an angle selected to change the locations on the outer surfaces of the control rods at which the control rods are contacted by the guide means during subsequent longitudinal movement of the control rods

  12. Dual reorientation relaxation routes of water molecules in oxyanion’s hydration shell: A molecular geometry perspective

    Xie, Wen Jun; Yang, Yi Isaac; Gao, Yi Qin, E-mail: gaoyq@pku.edu.cn [Institute of Theoretical and Computational Chemistry, College of Chemistry and Molecular Engineering and Biodynamic Optical Imaging Center, Peking University, Beijing 100871 (China)

    2015-12-14

    In this study, we examine how complex ions such as oxyanions influence the dynamic properties of water and whether differences exist between simple halide anions and oxyanions. Nitrate anion is taken as an example to investigate the hydration properties of oxyanions. Reorientation relaxation of its hydration water can occur through two different routes: water can either break its hydrogen bond with the nitrate to form one with another water or switch between two oxygen atoms of the same nitrate. The latter molecular mechanism increases the residence time of oxyanion’s hydration water and thus nitrate anion slows down the translational motion of neighbouring water. But it is also a “structure breaker” in that it accelerates the reorientation relaxation of hydration water. Such a result illustrates that differences do exist between the hydration of oxyanions and simple halide anions as a result of different molecular geometries. Furthermore, the rotation of the nitrate solute is coupled with the hydrogen bond rearrangement of its hydration water. The nitrate anion can either tilt along the axis perpendicularly to the plane or rotate in the plane. We find that the two reorientation relaxation routes of the hydration water lead to different relaxation dynamics in each of the two above movements of the nitrate solute. The current study suggests that molecular geometry could play an important role in solute hydration and dynamics.

  13. Dual reorientation relaxation routes of water molecules in oxyanion’s hydration shell: A molecular geometry perspective

    Xie, Wen Jun; Yang, Yi Isaac; Gao, Yi Qin

    2015-01-01

    In this study, we examine how complex ions such as oxyanions influence the dynamic properties of water and whether differences exist between simple halide anions and oxyanions. Nitrate anion is taken as an example to investigate the hydration properties of oxyanions. Reorientation relaxation of its hydration water can occur through two different routes: water can either break its hydrogen bond with the nitrate to form one with another water or switch between two oxygen atoms of the same nitrate. The latter molecular mechanism increases the residence time of oxyanion’s hydration water and thus nitrate anion slows down the translational motion of neighbouring water. But it is also a “structure breaker” in that it accelerates the reorientation relaxation of hydration water. Such a result illustrates that differences do exist between the hydration of oxyanions and simple halide anions as a result of different molecular geometries. Furthermore, the rotation of the nitrate solute is coupled with the hydrogen bond rearrangement of its hydration water. The nitrate anion can either tilt along the axis perpendicularly to the plane or rotate in the plane. We find that the two reorientation relaxation routes of the hydration water lead to different relaxation dynamics in each of the two above movements of the nitrate solute. The current study suggests that molecular geometry could play an important role in solute hydration and dynamics

  14. Carbonic anhydrase inhibitors. Comparison of chlorthalidone, indapamide, trichloromethiazide, and furosemide X-ray crystal structures in adducts with isozyme II, when several water molecules make the difference.

    Temperini, Claudia; Cecchi, Alessandro; Scozzafava, Andrea; Supuran, Claudiu T

    2009-02-01

    Thiazide and high ceiling diuretics were recently shown to inhibit all mammalian isoforms of carbonic anhydrase (CA, EC 4.2.1.1) with a very different profile as compared to classical inhibitors, such as acetazolamide, methazolamide, and ethoxzolamide. Some of these structurally related compounds have a very different behavior against the widespread isozyme CA II, with chlorthalidone, trichloromethiazide, and furosemide being efficient inhibitors against CA II (K(I)s of 65-138 nM), whereas indapamide is a much weaker one (K(I) of 2520 nM). Furthermore, some of these diuretics are quite efficient (low nanomolar) inhibitors of other isoforms, for example, chlorthalidone against hCA VB, VII, IX, and XIII; indapamide against CA VII, IX, XII, and XIII, trichloromethiazide against CA VII and IX, and furosemide against CA I and XIV. Examining the four X-ray crystal structures of their CA II adducts, we observed several (2-3) active site water molecules interacting with the chlorthalidone, trichloromethiazide, and furosemide scaffolds which may be responsible for this important difference of activity. Indeed, indapamide bound to CA II has no interactions with active site water molecules. Chlorthalidone bound within the CA II active site is in an enolic (lactimic) tautomeric form, with the enolic OH also participating in two strong hydrogen bonds with Asn67 and a water molecule. The newly evidenced binding modes of these diuretics may be exploited for designing better CA II inhibitors as well as compounds with selectivity/affinity for various isoforms with medicinal chemistry applications.

  15. The effect of micro-environment on luminescence of aequorin: the role of amino acids and explicit water molecules on spectroscopic properties of coelenteramide.

    Li, Zuo-Sheng; Zou, Lu-Yi; Min, Chun-Gang; Ren, Ai-Min

    2013-10-05

    Despite the fact that the luminescence reaction mechanism of aequorin has been intensively investigated, details in luminescence such as the effect of important amino acids residues and explicit water molecules on spectroscopic properties of coelenteramide remain unclear. In this work, the effect of amino acids residues His16, Tyr82, Trp86, Phe113, Trp129, Tyr132, explicit water molecules Wat505 and Wat405 on the spectral properties of CLM(-) has been studied by CAM-B3LYP, TD M06L and TD CAM-B3LYP methods in hydrophobic environment and aqueous solution. In hydrophobic environment, the amino acids or water molecules have no significant effect on the absorption. Tyr82 and Trp86 move close to CLM(-) changes the hydrogen bond network, and thus, the spectral properties is significantly affected by the hydrogen bonds between His16H(+)+Tyr82+Trp86 and CLM(-). Tyr82, Trp86 hydrogen bonding to CLM(-) upshifts the excited energy and helps emission spectra shift to blue region. Therefore, it is concluded that His16H(+)+Tyr82+Trp86 modify the emission spectra. The molecular electrostatic potential indicated that the greater electron density is located at the oxygen atom of 6-p-hydroxyphenyl group of CLM(-), and it facilitates the formation of hydrogen bond with His16H(+)+Tyr82+Trp86. It is a critical condition for the modification of emission spectra. It is expected to help to understand the interactions between emitter and amino acids in the micro environment. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. [Dynamics of Irreversible Evaporation of a Water-Protein Droplet and a Problem of Structural and Dynamical Experiments with Single Molecules].

    Shaitan, K V; Armeev, G A; Shaytan, A K

    2016-01-01

    We discuss the effect of isothermal and adiabatic evaporation of water on the state of a water-protein droplet. The discussed problem is of current importance due to development of techniques to perform single molecule experiments using free electron lasers. In such structure-dynamic experiments the delivery of a sample into the X-ray beam is performed using the microdroplet injector. The time between the injection and delivery is in the order of microseconds. In this paper we developed a specialized variant of all-atom molecular dynamics simulations for the study of irreversible isothermal evaporation of the droplet. Using in silico experiments we determined the parameters of isothermal evaporation of the water-protein droplet with the sodium and chloride ions in the concentration range of 0.3 M at different temperatures. The energy of irreversible evaporation determined from in silico experiments at the initial stages of evaporation virtually coincides with the specific heat of evaporation for water. For the kinetics of irreversible adiabatic evaporation an exact analytical solution was obtained in the limit of high thermal conductivity of the droplet (or up to the droplet size of -100 Å). This analytical solution incorporates parameters that are determined using in silico. experiments on isothermal droplet evaporation. We show that the kinetics of adiabatic evaporation and cooling of the droplet scales with the droplet size. Our estimates of the water-protemi droplet. freezing rate in the adiabatic regime in a vacuum chamber show that additional techniques for stabilizing the temperature inside the droplet should be used in order to study the conformational transitions of the protein in single molecules. Isothermal and quasi-isothermal conditions are most suitable for studying the conformational transitions upon object functioning. However, in this case it is necessary to take into account the effects of dehydration and rapid increase of ionic strength in an

  17. Displaced Sense: Displacement, Religion and Sense-making

    Naidu, Maheshvari

    2016-01-01

    Whether formally categorized as refugees or not, displaced migrants experience varying degrees of vulnerability in relation to where they find themselves displaced. The internally displaced furthermore squat invisibly and outside the boundaries of the legal framework and incentive structures accorded to those classified as 'refugee'. They are thus arguably, by and large, left to source sustaining solutions for themselves. This article works through the theoretical prism of sense-making theory...

  18. Displacing the Patient

    Pors, Anja Svejgaard

    as an affective care recipient, as a citizen with rights and as an individual need-oriented user on the one hand. On the other hand, the goal of patient satisfaction also deploys market perceptions of patients as homogeneous target groups to which information can be standardised. In the latter (market orientation......), the patient is also a resource for organizational development and a customer with consumer behavior. Overall, the strategy presents an information-pursuing patient figure making it possible to streamline the organization's care orientation on market conditions. In contrast to Annemarie Mol’s dichotomy of care......The analysis is based on an empirical study of a hospital’s communication strategy entitled: 'The Perspective of the Patient'. The paper asks how the strategy organizes communication work as situated displacements of the patient. Based on methodological elements from situational analysis (Clarke...

  19. Feature displacement interpolation

    Nielsen, Mads; Andresen, Per Rønsholt

    1998-01-01

    Given a sparse set of feature matches, we want to compute an interpolated dense displacement map. The application may be stereo disparity computation, flow computation, or non-rigid medical registration. Also estimation of missing image data, may be phrased in this framework. Since the features...... often are very sparse, the interpolation model becomes crucial. We show that a maximum likelihood estimation based on the covariance properties (Kriging) show properties more expedient than methods such as Gaussian interpolation or Tikhonov regularizations, also including scale......-selection. The computational complexities are identical. We apply the maximum likelihood interpolation to growth analysis of the mandibular bone. Here, the features used are the crest-lines of the object surface....

  20. Strategies for displacing oil

    Rao, Vikram; Gupta, Raghubir

    2015-03-01

    Oil currently holds a monopoly on transportation fuels. Until recently biofuels were seen as the means to break this stranglehold. They will still have a part to play, but the lead role has been handed to natural gas, almost solely due to the increased availability of shale gas. The spread between oil and gas prices, unprecedented in its scale and duration, will cause a secular shift away from oil as a raw material. In the transport fuel sector, natural gas will gain traction first in the displacement of diesel fuel. Substantial innovation is occurring in the methods of producing liquid fuel from shale gas at the well site, in particular in the development of small scale distributed processes. In some cases, the financing of such small-scale plants may require new business models.

  1. Atkins' molecules

    Atkins, Peters

    2003-01-01

    Originally published in 2003, this is the second edition of a title that was called 'the most beautiful chemistry book ever written'. In it, we see the molecules responsible for the experiences of our everyday life - including fabrics, drugs, plastics, explosives, detergents, fragrances, tastes, and sex. With engaging prose Peter Atkins gives a non-technical account of an incredible range of aspects of the world around us, showing unexpected connections, and giving an insight into how this amazing world can be understood in terms of the atoms and molecules from which it is built. The second edition includes dozens of extra molecules, graphical presentation, and an even more accessible and enthralling account of the molecules themselves.

  2. Interstellar Molecules

    Solomon, Philip M.

    1973-01-01

    Radioastronomy reveals that clouds between the stars, once believed to consist of simple atoms, contain molecules as complex as seven atoms and may be the most massive objects in our Galaxy. (Author/DF)

  3. Displacement Parameter Inversion for a Novel Electromagnetic Underground Displacement Sensor

    Nanying Shentu

    2014-05-01

    Full Text Available Underground displacement monitoring is an effective method to explore deep into rock and soil masses for execution of subsurface displacement measurements. It is not only an important means of geological hazards prediction and forecasting, but also a forefront, hot and sophisticated subject in current geological disaster monitoring. In previous research, the authors had designed a novel electromagnetic underground horizontal displacement sensor (called the H-type sensor by combining basic electromagnetic induction principles with modern sensing techniques and established a mutual voltage measurement theoretical model called the Equation-based Equivalent Loop Approach (EELA. Based on that work, this paper presents an underground displacement inversion approach named “EELA forward modeling-approximate inversion method”. Combining the EELA forward simulation approach with the approximate optimization inversion theory, it can deduce the underground horizontal displacement through parameter inversion of the H-type sensor. Comprehensive and comparative studies have been conducted between the experimentally measured and theoretically inversed values of horizontal displacement under counterpart conditions. The results show when the measured horizontal displacements are in the 0–100 mm range, the horizontal displacement inversion discrepancy is generally tested to be less than 3 mm under varied tilt angles and initial axial distances conditions, which indicates that our proposed parameter inversion method can predict underground horizontal displacement measurements effectively and robustly for the H-type sensor and the technique is applicable for practical geo-engineering applications.

  4. Measuring vulnerability to disaster displacement

    Brink, Susan A.; Khazai, Bijan; Power, Christopher; Wenzel, Friedemann

    2015-04-01

    Large scale disasters can cause devastating impacts in terms of population displacement. Between 2008 and 2013, on average 27 million people were displaced annually by disasters (Yonetani 2014). After large events such as hurricane Katrina or the Port-au-Prince earthquake, images of inadequate public shelter and concerns about large scale and often inequitable migration have been broadcast around the world. Population displacement can often be one of the most devastating and visible impacts of a natural disaster. Despite the importance of population displacement in disaster events, measures to understand the socio-economic vulnerability of a community often use broad metrics to estimate the total socio-economic risk of an event rather than focusing on the specific impacts that a community faces in a disaster. Population displacement is complex and multi-causal with the physical impact of a disaster interacting with vulnerability arising from the response, environmental issues (e.g., weather), cultural concerns (e.g., expectations of adequate shelter), and many individual factors (e.g., mobility, risk perception). In addition to the complexity of the causes, population displacement is difficult to measure because of the wide variety of different terms and definitions and its multi-dimensional nature. When we speak of severe population displacement, we may refer to a large number of displaced people, an extended length of displacement or associated difficulties such as poor shelter quality, risk of violence and crime in shelter communities, discrimination in aid, a lack of access to employment or other difficulties that can be associated with large scale population displacement. We have completed a thorough review of the literature on disaster population displacement. Research has been conducted on historic events to understand the types of negative impacts associated with population displacement and also the vulnerability of different groups to these impacts. We

  5. Linking Species Traits to the Abiotic Template of Flowing Waters: Contrasting Eco physiologies Underlie Displacement of Zebra Mussels by Quagga Mussels in a Large River-Estuary

    Casper, A. F.

    2005-05-01

    The St. Lawrence River-Estuary was the gateway of entry for dreissenids to North America and holds some of the oldest populations. The St. Lawrence also has four distinct physical-chemical water masses (a regional scale abiotic template) that both species inhabit. Despite their ecological similarities, quagga mussels are supplanting zebra mussels in much of their shared range. In order to try to better understand the changing distributions of these two species we compared glycogen, shell mass and tissue biomass in each of the water masses. This comparative physiological combined with experimental approaches (estuarine salinity experiments and reciprocal transplants) showed that while quagga mussels should dominate in most habitats, that abiotic/bioenergetic constraints in two regions (the Ottawa River plume and the freshwater-marine transition zone) might prevent them from dominating these locations. These findings are an example of how the interaction of landscape scale abiotic heterogeneity and a species-specific physiology can have strong impacts of distribution of biota large rivers.

  6. Hydrophobic fluorine mediated switching of the hydrogen bonding site as well as orientation of water molecules in the aqueous mixture of monofluoroethanol: IR, molecular dynamics and quantum chemical studies.

    Mondal, Saptarsi; Biswas, Biswajit; Nandy, Tonima; Singh, Prashant Chandra

    2017-09-20

    The local structures between water-water, alcohol-water and alcohol-alcohol have been investigated for aqueous mixtures of ethanol (ETH) and monofluoroethanol (MFE) by the deconvolution of IR bands in the OH stretching region, molecular dynamics simulation and quantum chemical calculations. It has been found that the addition of a small amount of ETH into the aqueous medium increases the strength of the hydrogen bonds between water molecules. In an aqueous mixture of MFE, the substitution of a single fluorine induces a change in the orientation as well as the hydrogen bonding site of water molecules from the oxygen to the fluorine terminal of MFE. The switching of the hydrogen bonding site of water in the aqueous mixture of MFE results in comparatively strong hydrogen bonds between MFE and water molecules as well as less clustering of water molecules, unlike the case of the aqueous mixture of ETH. These findings about the modification of a hydrogen bond network by the hydrophobic fluorine group probably make fluorinated molecules useful for pharmaceutical as well as biological applications.

  7. Symposium report: the Waters Bioanalysis World Tour: the broadening impact and future of the DMPK laboratory--addressing large-molecule therapeutics.

    De Vooght-Johnson, Ryan

    2011-03-01

    An evening symposium was held at the Museu de Historia de Catalunya (Barcelona, Spain) as a precursor to the European Bioanalysis Forum meeting, as part of the Waters Corporation Bioanalysis World Tour. The symposium was chaired by Robert Plumb and Jing Lin (Waters Corporation, MA, USA) with a focus on the future of the DMPK laboratory and its role in addressing large-molecule therapeutics and biomarkers. Lieve Dillen (Johnson and Johnson, Belgium) spoke on ultra-sensitive peptide quantification, Richard Kay (Quotient Bioresearch, UK) discussed quantifying proteins and peptides in plasma, Ian Wilson (AstraZeneca, UK) covered metabolic biomarkers and Robert Plumb concluded the evening with a presentation on the future of MS in DMPK studies. Following the presentations, all the speakers took questions from the audience and continued lively discussion over a cocktails and canapés reception.

  8. In-situ X-ray diffraction reveals the degradation of crystalline CH3NH3PbI3 by water-molecule collisions at room temperature

    Hada, Masaki; Hasegawa, Yoichi; Nagaoka, Ryota; Miyake, Tomoya; Abdullaev, Ulugbek; Ota, Hiromi; Nishikawa, Takeshi; Yamashita, Yoshifumi; Hayashi, Yasuhiko

    2018-02-01

    We have developed a vacuum-compatible chamber for in-situ X-ray diffraction (XRD) studies and have used it to characterize the changing crystal structure of an inorganic-organic hybrid perovskite material, CH3NH3PbI3 (MAPbI3), during interactions with water vapor at room temperature. In the XRD spectra, we have observed the degradation of MAPbI3 and the creation of MAPbI3 hydrates, which follow simple rate equations. The time constant for the degradation of MAPbI3 during accelerated aging suggests that multiple collisions of water molecules with the MAPbI3 crystal trigger the degradation of the crystal.

  9. Ligand uptake in Mycobacterium tuberculosis truncated hemoglobins is controlled by both internal tunnels and active site water molecules [version 2; referees: 2 approved

    Ignacio Boron

    2015-07-01

    Full Text Available Mycobacterium tuberculosis, the causative agent of human tuberculosis, has two proteins belonging to the truncated hemoglobin (trHb family. Mt-trHbN presents well-defined internal hydrophobic tunnels that allow O2 and •ŸNO to migrate easily from the solvent to the active site, whereas Mt-trHbO possesses tunnels interrupted by a few bulky residues, particularly a tryptophan at position G8. Differential ligand migration rates allow Mt-trHbN to detoxify Ÿ•NO, a crucial step for pathogen survival once under attack by the immune system, much more efficiently than Mt-trHbO. In order to investigate the differences between these proteins, we performed experimental kinetic measurements, Ÿ•NO decomposition, as well as molecular dynamics simulations of the wild type Mt-trHbN and two mutants, VG8F and VG8W. These mutations affect both the tunnels accessibility as well as the affinity of distal site water molecules, thus modifying the ligand access to the iron. We found that a single mutation allows Mt-trHbN to acquire ligand migration rates comparable to those observed for Mt-trHbO, confirming that ligand migration is regulated by the internal tunnel architecture as well as by water molecules stabilized in the active site.

  10. MRI of displaced meniscal fragments

    Dunoski, Brian; Zbojniewicz, Andrew M.; Laor, Tal

    2012-01-01

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  11. MRI of displaced meniscal fragments

    Dunoski, Brian [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States); Children' s Hospital of Michigan, Department of Radiology, Detroit, MI (United States); Zbojniewicz, Andrew M.; Laor, Tal [University of Cincinnati College of Medicine, Department of Radiology, Cincinnati Children' s Hospital Medical Center, Cincinnati, OH (United States)

    2012-01-15

    A torn meniscus frequently requires surgical fixation or debridement as definitive treatment. Meniscal tears with associated fragment displacement, such as bucket handle and flap tears, can be difficult to recognize and accurately describe on MRI, and displaced fragments can be challenging to identify at surgery. A displaced meniscal fragment can be obscured by synovium or be in a location not usually evaluated at arthroscopy. We present a pictorial essay of meniscal tears with displaced fragments in patients referred to a pediatric hospital in order to increase recognition and accurate interpretation by the radiologist, who in turn can help assist the surgeon in planning appropriate therapy. (orig.)

  12. Control of DNA strand displacement kinetics using toehold exchange.

    Zhang, David Yu; Winfree, Erik

    2009-12-02

    DNA is increasingly being used as the engineering material of choice for the construction of nanoscale circuits, structures, and motors. Many of these enzyme-free constructions function by DNA strand displacement reactions. The kinetics of strand displacement can be modulated by toeholds, short single-stranded segments of DNA that colocalize reactant DNA molecules. Recently, the toehold exchange process was introduced as a method for designing fast and reversible strand displacement reactions. Here, we characterize the kinetics of DNA toehold exchange and model it as a three-step process. This model is simple and quantitatively predicts the kinetics of 85 different strand displacement reactions from the DNA sequences. Furthermore, we use toehold exchange to construct a simple catalytic reaction. This work improves the understanding of the kinetics of nucleic acid reactions and will be useful in the rational design of dynamic DNA and RNA circuits and nanodevices.

  13. Correlation between mechanical behavior of protein films at the air/water interface and intrinsic stability of protein molecules

    Martin, A.H.; Cohen Stuart, M.A.; Bos, M.A.; Vliet, T. van

    2005-01-01

    The relation between mechanical film properties of various adsorbed protein layers at the air/water interface and intrinsic stability of the corresponding proteins is discussed. Mechanical film properties were determined by surface deformation in shear and dilation. In shear, fracture stress, σf,

  14. The Effect of Basepair Mismatch on DNA Strand Displacement.

    Broadwater, D W Bo; Kim, Harold D

    2016-04-12

    DNA strand displacement is a key reaction in DNA homologous recombination and DNA mismatch repair and is also heavily utilized in DNA-based computation and locomotion. Despite its ubiquity in science and engineering, sequence-dependent effects of displacement kinetics have not been extensively characterized. Here, we measured toehold-mediated strand displacement kinetics using single-molecule fluorescence in the presence of a single basepair mismatch. The apparent displacement rate varied significantly when the mismatch was introduced in the invading DNA strand. The rate generally decreased as the mismatch in the invader was encountered earlier in displacement. Our data indicate that a single base pair mismatch in the invader stalls branch migration and displacement occurs via direct dissociation of the destabilized incumbent strand from the substrate strand. We combined both branch migration and direct dissociation into a model, which we term the concurrent displacement model, and used the first passage time approach to quantitatively explain the salient features of the observed relationship. We also introduce the concept of splitting probabilities to justify that the concurrent model can be simplified into a three-step sequential model in the presence of an invader mismatch. We expect our model to become a powerful tool to design DNA-based reaction schemes with broad functionality. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  15. Adhesion molecules

    Preedy, Victor R

    2016-01-01

    This book covers the structure and classification of adhesion molecules in relation to signaling pathways and gene expression. It discusses immunohistochemical localization, neutrophil migration, and junctional, functional, and inflammatory adhesion molecules in pathologies such as leukocyte decompression sickness and ischemia reperfusion injury. Highlighting the medical applications of current research, chapters cover diabetes, obesity, and metabolic syndrome; hypoxia; kidney disease; smoking, atrial fibrillation, and heart disease, the brain and dementia; and tumor proliferation. Finally, it looks at molecular imaging and bioinformatics, high-throughput technologies, and chemotherapy.

  16. Production and characterization of protonated molecular clusters containing a given number of water molecules with the DIAM set-up

    Bruny, G.

    2010-01-01

    nano-scale characterization of irradiation in bio-molecular systems requires observation of novel features which are now achievable with the recent technical progress. This work is a central part in the development of DIAM which is a new experimental set-up devoted to irradiation of bio-molecular clusters at the Institut de Physique Nucleaire de Lyon. The development of the cluster source and of a double focusing mass spectrometer leads to the production of intense beams of mass selected protonated molecular clusters. Combined with this mass selected cluster beams an innovative detection technique is demonstrated in collision induced dissociation experiments. The results contribute to the knowledge of the stability and the structure of the small protonated water clusters and mixed clusters of water and pyridine. (author)

  17. Ab initio calculations of dissociative excitation of water and methane molecules upon electron impact at low energies

    Gil, T.J.; McCurdy, C.W.; Rescigno, T.N.; Lengsfield, B.H. III

    1994-01-01

    The authors are reporting results of ab-initio calculations of electron-impact excitation of water and methane occurring at scattering energies up to 60 eV. The authors consider dissociative excited states of both systems since the understanding of their chemistry has considerable importance in plasma technology and atmospheric research. In the case of methane the authors are dealing with the promotion of a valence electron into Rydberg orbitals, while in water the excited states have one electron in an antibonding unoccupied valence orbital and support Feshbach resonances. The authors discuss issues related to convergence of the close-coupling expansion in the case of Rydberg excitation, where the authors have coupled up to 16 channels. The practical realization of the calculation within the framework of the complex Kohn variational principle represents merging of quantum chemistry and quantum scattering theory and is also discussed

  18. Atoms, Molecules, and Compounds

    Manning, Phillip

    2007-01-01

    Explores the atoms that govern chemical processes. This book shows how the interactions between simple substances such as salt and water are crucial to life on Earth and how those interactions are predestined by the atoms that make up the molecules.

  19. Displacement cascades in diatomic materials

    Parkin, D.M.; Coulter, C.A.

    1981-01-01

    A new function, the specified-projectile displacement function p/sub ijk/ (E), is introduced to describe displacement cascades in polyatomic materials. This function describes the specific collision events that produce displacements and hence adds new information not previously available. Calculations of p/sub ijk/ (E) for MgO, Al 2 O 3 and TaO are presented and discussed. Results show that the parameters that have the largest effect on displacement collision events are the PKA energy and the mass ratio of the atom types in the material. It is further shown that the microscopic nature of the displacement events changes over the entire recoil energy range relevant to fusion neutron spectra and that these changes are different in materials whose mass ratio is near one than in those where it is far from one

  20. Molecule Matters

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule Matters - Dinitrogen. A G Samuelson J Jabadurai. Volume 16 Issue 12 ... Author Affiliations. A G Samuelson1 J Jabadurai1. Department of Inroganic and Physical Chemistry, Indian Institute of Science, Bangalore 560 012, India.

  1. Molecule Matters

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 9. Molecule Matters - A Chromium Compound with a Quintuple Bond. K C Kumara Swamy. Feature Article Volume 11 Issue 9 September 2006 pp 72-75. Fulltext. Click here to view fulltext PDF. Permanent link:

  2. A comparison of the mechanisms of photooxidative degradation of organic molecules on irradiated semiconductor powders and in aerated supercritical water

    Fox, Marye Anne [Department of Chemistry and Biochemistry, University of Texas at Austin, Austin, TX (United States)

    1995-08-01

    It is the purpose of this paper to survey evidence that suggests that control of the local environment is important in both heterogeneous TiO{sub 2} photocatalysis and in thermal oxidation reactions taking place in supercritical fluids, i.e. that the expected influences of these very different methods for microcompartmentalization do indeed influence the observed reaction kinetics in an easily observable way. Variations in reaction kinetics and the photophysical properties are described for (1) small semiconductor clusters, including their altered photocatalytic activity in and on inert supports; and (2) molecular probes dispersed within the self-aggregating clusters formed within supercritical water

  3. Sorption Characteristics of Mixed Molecules of Glutaraldehyde from Water on Mesoporous Acid-Amine Modified Low-Cost Activated Carbon: Mechanism, Isotherm, and Kinetics

    Mukosha Lloyd

    2015-01-01

    Full Text Available The environmental discharge of inefficiently treated waste solutions of the strong biocide glutaraldehyde (GA from hospitals has potential toxic impact on aquatic organisms. The adsorption characteristics of mixed polarized monomeric and polymeric molecules of GA from water on mesoporous acid-amine modified low-cost activated carbon (AC were investigated. It was found that the adsorption strongly depended on pH and surface chemistry. In acidic pH, the adsorption mechanism was elaborated to involve chemical sorption of mainly hydroxyl GA monomeric molecules on acidic surface groups, while in alkaline pH, the adsorption was elaborated to involve both chemical and physical sorption of GA polymeric forms having mixed functional groups (aldehyde, carboxyl, and hydroxyl on acidic and amine surface groups. The optimum pH of adsorption was about 12 with significant contribution by cooperative adsorption, elucidated in terms of hydrogen bonding and aldol condensation. Freundlich and Dubinin-Radushkevich models were fitted to isotherm data. The adsorption kinetics was dependent on initial concentration and temperature and described by the Elovich model. The adsorption was endothermic, while the intraparticle diffusion model suggested significant contribution by film diffusion. The developed low-cost AC could be used to supplement the GA alkaline deactivation process for efficient removal of residual GA aquatic toxicity.

  4. Fabrication of PLA/CaCO3 hybrid micro-particles as carriers for water-soluble bioactive molecules.

    Kudryavtseva, Valeriya L; Zhao, Li; Tverdokhlebov, Sergei I; Sukhorukov, Gleb B

    2017-09-01

    We propose the use of polylactic acid/calcium carbonate (PLA/CaCO 3 ) hybrid micro-particles for achieving improved encapsulation of water-soluble substances. Biodegradable porous CaCO 3 microparticles can be loaded with wide range of bioactive substance. Thus, the formation of hydrophobic polymeric shell on surface of these loaded microparticles results on encapsulation and, hence, sealing internal cargo and preventing their release in aqueous media. In this study, to encapsulate proteins, we explore the solid-in-oil-in-water emulsion method for fabricating core/shell PLA/CaCO 3 systems. We used CaCO 3 particles as a protective core for encapsulated bovine serum albumin, which served as a model protein system. We prepared a PLA coating using dichloromethane as an organic solvent and polyvinyl alcohol as a surfactant for emulsification; in addition, we varied experimental parameters such as surfactant concentration and polymer-to-CaCO 3 ratio to determine their effect on particle-size distribution, encapsulation efficiency and capsule permeability. The results show that the particle size decreased and the size distribution narrowed as the surfactant concentration increased in the external aqueous phase. In addition, when the CaCO 3 /PLA mass ratio dropped below 0.8, the hybrid micro-particles were more likely to resist treatment by ethylenediaminetetraacetic acid and thus retained their bioactive cargos within the polymer-coated micro-particles. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Formation of the prebiotic molecule NH2CHO on astronomical amorphous solid water surfaces: accurate tunneling rate calculations.

    Song, Lei; Kästner, Johannes

    2016-10-26

    Investigating how formamide forms in the interstellar medium is a hot topic in astrochemistry, which can contribute to our understanding of the origin of life on Earth. We have constructed a QM/MM model to simulate the hydrogenation of isocyanic acid on amorphous solid water surfaces to form formamide. The binding energy of HNCO on the ASW surface varies significantly between different binding sites, we found values between ∼0 and 100 kJ mol -1 . The barrier for the hydrogenation reaction is almost independent of the binding energy, though. We calculated tunneling rate constants of H + HNCO → NH 2 CO at temperatures down to 103 K combining QM/MM with instanton theory. Tunneling dominates the reaction at such low temperatures. The tunneling reaction is hardly accelerated by the amorphous solid water surface compared to the gas phase for this system, even though the activation energy of the surface reaction is lower than the one of the gas-phase reaction. Both the height and width of the barrier affect the tunneling rate in practice. Strong kinetic isotope effects were observed by comparing to rate constants of D + HNCO → NHDCO. At 103 K we found a KIE of 231 on the surface and 146 in the gas phase. Furthermore, we investigated the gas-phase reaction NH 2 + H 2 CO → NH 2 CHO + H and found it unlikely to occur at cryogenic temperatures. The data of our tunneling rate constants are expected to significantly influence astrochemical models.

  6. Tar removal from biosyngas in the biomass gasification process. (Liquid + liquid) equilibrium {water + solvent (paraxylene and methyl hexadecanoate) + model molecules of tar (benzene, toluene, phenol)}

    Bassil, Georgio; Mokbel, Ilham; Abou Naccoul, Ramy; Stephan, Juliette; Jose, Jacques; Goutaudier, Christelle

    2012-01-01

    Highlights: ► (Liquid + liquid) equilibria at atmospheric pressure. ► Solubility of benzene (or toluene or phenol) in paraxylene at (303 to 343) K. ► Solubility of benzene (or toluene or phenol) in methyl palmitate or methyl hexadecanoate at (303 to 343) K. ► Correlation of LLE using NRTL model. - Abstract: Tar is generated in the process by the condensation of the gas resulting from biomass gasification. The objective of this work is a contribution to the database on thermodynamic quantity which will be useful at the operation of tar removal from aqueous medium. With this aim, (liquid + liquid) equilibrium of {water + solvent (paraxylene and methyl hexadecanoate) + model molecules of tar (benzene, toluene, phenol)} was studied at temperatures (303.2, 323.2, and 343.2) K. The data obtained were correlated with the non-random two-liquid (NRTL) model.

  7. Emission spectra of the species ablated from a solid target submerged in liquid: vibrational temperature of C2 molecules in water-confined geometry

    Sakka, Tetsuo; Saito, Kotaro; Ogata, Yukio H.

    2002-01-01

    Emission spectra of C 2 molecules produced at the water-graphite interface by pulsed laser irradiation were obtained at various delay times from the irradiation. Vibrational temperature was determined by the Boltzmann plot based on the vibrational bands in Δν=-1 branch of the Swan system. The results show that it was ca. 5000 K and did not change significantly with the delay time. With increasing the delay time up to ca. 500 ns the signal from the Swan band disappeared before the decrease of the vibrational temperature. The results were explained by the formation of a gas cavity and its collapse at several hundreds of nanoseconds from the laser pulse

  8. Effects of Buoyancy Forces on Immiscible Water/Oil Displacements in a Vertically Oriented Porous Medium Effets des facteurs de flottabilité sur les déplacements non-miscibles eau/huile dans un milieu poreux vertical

    Thirunavu S. R.

    2006-11-01

    Full Text Available The effects of buoyancy forces on liquid-liquid displacement processes occurring in porous media are important in a variety of practical situations, in particular during the displacement of oil from partially-depleted underground reservoirs by means of aqueous solutions. Most previous studies involving the visualization of water/oil displacements in porous media have been undertaken in horizontal two-dimensional porous medium cells. The objective of the present work was to determine the effects of buoyancy forces; on the fingering pattern and oil recovery by conducting immiscible displacement experiments in two-dimensional consolidated porous medium cells aligned in the vertical plane. In order to obtain a clear understanding of the favourable and unfavourable effects of buoyancy forces, experiments were carried out in three different flow modes, namely horizontal, vertical upward, and vertical downward. As the effects of buoyancy forces are negligible for two-dimensional porous media in the horizontal flow mode, the recoveries obtained in this mode were used as a reference for comparison with those obtained in the two vertical modes. Displacements using five different density ratios were studied. The breakthrough time and percentage oil recovery were measured in each case. The effects of buoyancy forces, viscous forces, and capillary forces, as well as the injection flow rate, were also recorded. The results obtained indicate that the effects of buoyancy forces are very pronounced at low flow rates and low oil/water density ratios, and that even a slight increase in the flow rate causes the buoyancy forces to rapidly become less significant. Les facteurs de flottabilité exercent un effet important sur les déplacements liquide/liquide en milieu poreux dans toute une gamme de situations pratiques, en particulier lorsqu'on veut déplacer l'huile de roches réservoirs partiellement épuisées à l'aide de solutions aqueuses. La plupart des

  9. Boron isotopic enrichment by displacement chromatography

    Mohapatra, K.K.; Bose, Arun

    2014-01-01

    10 B enriched boron is used in applications requiring high volumetric neutron absorption (absorption cross section- 3837 barn for thermal and 1 barn for 1 MeV fast neutron). It is used in fast breeder reactor (as control rod material), in neutron counter, in Boron Neutron Capture Therapy etc. Owing to very small separation factor, boron isotopic enrichment is a complex process requiring large number of separation stages. Heavy Water Board has ventured in industrial scale production of 10 B enriched boron using Exchange Distillation Process as well as Ion Displacement Chromatography Process. Ion Displacement Chromatography process is used in Boron Enrichment Plant at HWP, Manuguru. It is based on isotopic exchange between borate ions (B(OH) 4 - ) on anion exchange resin and boric acid passing through resin. The isotopic exchange takes place due to difference in zero point energy of 10 B and 11 B

  10. Analytic vibration-rotational matrix elements for diatomic molecules

    Bouanich, J.P.

    1987-01-01

    The vibration-rotational matrix elements for infrared or Raman transitions vJ → v'J' of diatomic molecules are calculated for powers of the reduced displacement X from parameters of the Dunham potential-energy function. (orig.)

  11. Diffusion-weighted magnetic resonance imaging reveals the effects of different cooling temperatures on the diffusion of water molecules and perfusion within human skeletal muscle

    Yanagisawa, O.; Fukubayashi, T.

    2010-01-01

    Aim: To evaluate the effect of local cooling on the diffusion of water molecules and perfusion within muscle at different cooling temperatures. Materials and methods: Magnetic resonance diffusion-weighted (DW) images of the leg (seven males) were obtained before and after 30 min cooling (0, 10, and 20 o C), and after a 30 min recovery period. Two types of apparent diffusion coefficient (ADC; ADC1, reflecting both water diffusion and perfusion within muscle, and ADC2, approximating the true water diffusion coefficient) of the ankle dorsiflexors were calculated from DW images. T2-weighted images were also obtained to calculate T2 values of the ankle dorsiflexors. The skin temperature was measured before, during, and after cooling. Results: Both ADC values significantly decreased after cooling under all cooling conditions; the rate of decrease depended on the cooling temperature used (ADC1: -36% at 0 o C, -27.8% at 10 o C, and -22.6% at 20 o C; ADC2: -26% at 0 o C, -21.1% at 10 o C, and -14.6% at 20 o C). These significant decreases were maintained during the recovery period. Conversely, the T2 value showed no significant changes. Under all cooling conditions, skin temperature significantly decreased during cooling; the rate of decrease depended on the cooling temperature used (-74.8% at 0 o C, -51.1% at 10 o C, and -26.8% at 20 o C). Decreased skin temperatures were not restored to pre-cooling values during the recovery period under any cooling conditions. Conclusion: Local cooling decreased the water diffusion and perfusion within muscle with decreased skin temperature; the rates of decrease depended on the cooling temperature used. These decreases were maintained for 30 min after cooling.

  12. Displacement sensing system and method

    VunKannon, Jr., Robert S

    2006-08-08

    A displacement sensing system and method addresses demanding requirements for high precision sensing of displacement of a shaft, for use typically in a linear electro-dynamic machine, having low failure rates over multi-year unattended operation in hostile environments. Applications include outer space travel by spacecraft having high-temperature, sealed environments without opportunity for servicing over many years of operation. The displacement sensing system uses a three coil sensor configuration, including a reference and sense coils, to provide a pair of ratio-metric signals, which are inputted into a synchronous comparison circuit, which is synchronously processed for a resultant displacement determination. The pair of ratio-metric signals are similarly affected by environmental conditions so that the comparison circuit is able to subtract or nullify environmental conditions that would otherwise cause changes in accuracy to occur.

  13. Ethanol oxidation reactions catalyzed by water molecules: CH3CH2OH+n H2O→ CH3CHO+ H2+n H2O (n=0,1,2)

    Takahashi, H.; Hisaoka, S.; Nitta, T.

    2002-09-01

    Ab initio density functional theory calculations have been performed to investigate the catalytic role of water molecules in the oxidation reaction of ethanol: CH3CH2OH+n H2O→ CH3CHO+ H2+n H2O (n=0,1,2) . The results show that the potential energy barrier for the reaction is 88.0 kcal/mol in case of n=0, while it is reduced by ˜34 kcal/mol when two water molecules are involved ( n=2) in the reaction. As a result, the rate constant increases to 3.31×10 -4 s-1, which shows a significant catalytic role of water molecules in the ethanol oxidation reactions.

  14. PHOTOCHEMISTRY IN THE INNER LAYERS OF CLUMPY CIRCUMSTELLAR ENVELOPES: FORMATION OF WATER IN C-RICH OBJECTS AND OF C-BEARING MOLECULES IN O-RICH OBJECTS

    Agundez, Marcelino; Cernicharo, Jose; Guelin, Michel

    2010-01-01

    A mechanism based on the penetration of interstellar ultraviolet photons into the inner layers of clumpy circumstellar envelopes (CSEs) around asymptotic giant branch stars is proposed to explain the non-equilibrium chemistry observed in such objects. We show through a simple modeling approach that in CSEs with a certain degree of clumpiness or with moderately low mass loss rates (a few 10 -7 M sun yr -1 ) a photochemistry can take place in the warm and dense inner layers, inducing important changes in the chemical composition. In carbon-rich objects water vapor and ammonia would be formed with abundances of 10 -8 -10 -6 relative to H 2 , while in oxygen-rich envelopes ammonia and carbon-bearing molecules such as HCN and CS would form with abundances of 10 -9 -10 -7 relative to H 2 . The proposed mechanism would explain the recent observation of warm water vapor in the carbon-rich envelope IRC+10216 with the Herschel Space Observatory and predict that H 2 O should be detectable in other carbon-rich objects.

  15. Displacement functions for diatomic materials

    Panrkin, D.M.; Coulter, C.A.

    1979-01-01

    An extension of the methods of Lindhard et at. was used to calculate the total displacement function n/sub ij/(E) for a number of diatomic materials, where n/sub ij/(E) is defined to be the average number of atoms of type j which are displaced from their sites in a displacement cascade initiated by a PKA of type i and energy E. From the n/sub ij/(E) one can calculate the fraction n/sub ij/(E) of the displacements produced by a type i PKA with energy E which are of type j. Values of the n/sub ij/ for MgO, CaO, Al 2 O 3 , and TaO are presented. It is shown that for diatomic materials with mass ratios reasonably near one (e.g., MgO, Al 2 O 3 ) and equal displacement thresholds for the two species the n/sub ij/ become independent of the PKA type i at energies only a few times threshold. However, for larger mass ratios the n/sub ij/ do not become independent of i until much larger, energies are reached - e.g. > 10 5 eV for TaO. In addition, it is found that the n/sub ij/ depend sensitively on the displacement thresholds, with very dramatic charges occuring when the two thresholds become significantly different from one another

  16. Bromide as a tracer for studying water movement and nitrate displacement in soils: comparison with stable isotope tracers; Bromid als Tracer zur Untersuchung der Wasserbewegung und der Nitratverlagerung in Boeden: Vergleich mit stabilisotopen Tracern

    Russow, R.; Knappe, S. [UFZ - Umweltforschungszentrum Leipzig-Halle GmbH, Bad Lauchstaedt (Germany). Sektion Bodenforschung

    1999-02-01

    Tracers are an ideal means of studying water movement and associated nitrate displacement. Often bromide is preferred as a tracer because it is considered a representative tracer for water and because, being a conservative tracer (i.e. not involved in chemical and biological soil processes), it can be used for studying anion transport in soils. Moreover, it is less expensive and easier to measure than the stable isotopes deuterium and {sup 15}N. Its great advantage over radioactive tracers (e.g. tritium), which outweighs their extreme sensitivity and ease of measurement and which it has in common with stable isotopes, is that it does not require radiation protection measures. However, there are also constraints on the use of bromide as a tracer in soil/water/plant systems. Our own studies on different soils using D{sub 2}O, bromide and [{sup 15}N]-nitrate in lysimeters suggest that the above assumptions on bromide tracers need not always be valid under conditions as they prevail in biologically active soils. As the present paper shows, these studies permit a good assessment of the possibilities and limits to these tracers. [Deutsch] Fuer die Untersuchung der Wasserbewegung sowie der daran gekoppelten Nitrat-Verlagerung ist der Einsatz von Tracern das Mittel der Wahl. Dabei wird Bromid als Tracer haeufig bevorzugt, da es allgemein als ein repraesentativer Tracer fuer Wasser und als konservativer Tracer (nicht involviert in chemische und biologische Bodenprozesse) zur Untersuchung des Anionentransportes in Boeden angesehen wird und es gegenueber den stabilen Isotopen Deuterium und {sup 15}N billiger und einfacher zu bestimmen ist. Gegenueber den radioaktiven Tracern (z.B. Tritium), die zwar sehr empfindlich und einfach messbar sind, besteht der grosse Vorteil, dass, wie bei den stabilen Isotopen, keine Strahlenschutzmassnahmen ergriffen werden muessen. Es gibt jedoch auch einschraenkende Hinweise fuer die Verwendung von Bromid als Tracer im System Boden

  17. Molecule Matters van der Waals Molecules

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 12. Molecule Matters van der Waals Molecules - Noble Gas Clusters are London Molecules! E Arunan. Feature Article Volume 14 Issue 12 December 2009 pp 1210-1222 ...

  18. Influence of stability of polymer surfactant on oil displacement mechanism

    Liu, Li; Li, Chengliang; Pi, Yanming; Wu, Di; He, Ying; Geng, Liang

    2018-02-01

    At present, most of the oilfields of China have entered the late stage of high water-cut development, and three oil recovery technique has become the leading technology for improving oil recovery. With the improvement of three oil recovery techniques, the polymer surfactant flooding technology has been widely promoted in oil fields in recent years. But in the actual field experiment, it has been found that the polymer surfactant has chromatographic separation at the extraction end, which indicates that the property of the polymer surfactant has changed during the displacement process. At present, there was few literature about how the stability of polymer surfactant affects the oil displacement mechanism. This paper used HuaDing-I polymer surfactant to conduct a micro photolithography glass flooding experiment, and then compared the oil displacement law of polymer surfactant before and after static setting. Finally, the influence law of stability of polymer surfactant on the oil displacement mechanism is obtained by comprehensive analysis.

  19. Communication: Toward an improved control of the fixed-node error in quantum Monte Carlo: The case of the water molecule

    Caffarel, Michel; Applencourt, Thomas; Scemama, Anthony; Giner, Emmanuel

    2016-01-01

    All-electron Fixed-node Diffusion Monte Carlo calculations for the nonrelativistic ground-state energy of the water molecule at equilibrium geometry are presented. The determinantal part of the trial wavefunction is obtained from a selected Configuration Interaction calculation [Configuration Interaction using a Perturbative Selection done Iteratively (CIPSI) method] including up to about 1.4 × 10 6 of determinants. Calculations are made using the cc-pCVnZ family of basis sets, with n = 2 to 5. In contrast with most quantum Monte Carlo works no re-optimization of the determinantal part in presence of a Jastrow is performed. For the largest cc-pCV5Z basis set the lowest upper bound for the ground-state energy reported so far of −76.437 44(18) is obtained. The fixed-node energy is found to decrease regularly as a function of the cardinal number n and the Complete Basis Set limit associated with exact nodes is easily extracted. The resulting energy of −76.438 94(12) — in perfect agreement with the best experimentally derived value — is the most accurate theoretical estimate reported so far. We emphasize that employing selected configuration interaction nodes of increasing quality in a given family of basis sets may represent a simple, deterministic, reproducible, and systematic way of controlling the fixed-node error in diffusion Monte Carlo.

  20. Communication: Toward an improved control of the fixed-node error in quantum Monte Carlo: The case of the water molecule

    Caffarel, Michel; Applencourt, Thomas; Scemama, Anthony [Laboratoire de Chimie et Physique Quantique, CNRS-Université de Toulouse, Toulouse (France); Giner, Emmanuel [Dipartimento di Scienze Chimiche e Farmaceutiche, Universit degli Studi di Ferrara, Ferrara (Italy)

    2016-04-21

    All-electron Fixed-node Diffusion Monte Carlo calculations for the nonrelativistic ground-state energy of the water molecule at equilibrium geometry are presented. The determinantal part of the trial wavefunction is obtained from a selected Configuration Interaction calculation [Configuration Interaction using a Perturbative Selection done Iteratively (CIPSI) method] including up to about 1.4 × 10{sup 6} of determinants. Calculations are made using the cc-pCVnZ family of basis sets, with n = 2 to 5. In contrast with most quantum Monte Carlo works no re-optimization of the determinantal part in presence of a Jastrow is performed. For the largest cc-pCV5Z basis set the lowest upper bound for the ground-state energy reported so far of −76.437 44(18) is obtained. The fixed-node energy is found to decrease regularly as a function of the cardinal number n and the Complete Basis Set limit associated with exact nodes is easily extracted. The resulting energy of −76.438 94(12) — in perfect agreement with the best experimentally derived value — is the most accurate theoretical estimate reported so far. We emphasize that employing selected configuration interaction nodes of increasing quality in a given family of basis sets may represent a simple, deterministic, reproducible, and systematic way of controlling the fixed-node error in diffusion Monte Carlo.

  1. Molecular Properties by Quantum Monte Carlo: An Investigation on the Role of the Wave Function Ansatz and the Basis Set in the Water Molecule

    Zen, Andrea; Luo, Ye; Sorella, Sandro; Guidoni, Leonardo

    2014-01-01

    Quantum Monte Carlo methods are accurate and promising many body techniques for electronic structure calculations which, in the last years, are encountering a growing interest thanks to their favorable scaling with the system size and their efficient parallelization, particularly suited for the modern high performance computing facilities. The ansatz of the wave function and its variational flexibility are crucial points for both the accurate description of molecular properties and the capabilities of the method to tackle large systems. In this paper, we extensively analyze, using different variational ansatzes, several properties of the water molecule, namely, the total energy, the dipole and quadrupole momenta, the ionization and atomization energies, the equilibrium configuration, and the harmonic and fundamental frequencies of vibration. The investigation mainly focuses on variational Monte Carlo calculations, although several lattice regularized diffusion Monte Carlo calculations are also reported. Through a systematic study, we provide a useful guide to the choice of the wave function, the pseudopotential, and the basis set for QMC calculations. We also introduce a new method for the computation of forces with finite variance on open systems and a new strategy for the definition of the atomic orbitals involved in the Jastrow-Antisymmetrised Geminal power wave function, in order to drastically reduce the number of variational parameters. This scheme significantly improves the efficiency of QMC energy minimization in case of large basis sets. PMID:24526929

  2. Is Fibular Fracture Displacement Consistent with Tibiotalar Displacement?

    van den Bekerom, Michel P. J.; van Dijk, C. Niek

    2010-01-01

    We believed open reduction with internal fixation is required for supination-external rotation ankle fractures located at the level of the distal tibiofibular syndesmosis (Lauge-Hanssen SER II and Weber B) with 2 mm or more fibular fracture displacement. The rationale for surgery for these ankle

  3. Particle displacement tracking for PIV

    Wernet, Mark P.

    1990-01-01

    A new Particle Imaging Velocimetry (PIV) data acquisition and analysis system, which is an order of magnitude faster than any previously proposed system has been constructed and tested. The new Particle Displacement Tracing (PDT) system is an all electronic technique employing a video camera and a large memory buffer frame-grabber board. Using a simple encoding scheme, a time sequence of single exposure images are time coded into a single image and then processed to track particle displacements and determine velocity vectors. Application of the PDT technique to a counter-rotating vortex flow produced over 1100 velocity vectors in 110 seconds when processed on an 80386 PC.

  4. Hangman Catalysis for Photo–and Photoelectro–Chemical Activation of Water Proton-Coupled Electron Transfer Mechanisms of Small Molecule Activation

    Nocera, Daniel G. [Harvard Univ., Cambridge, MA (United States)

    2013-03-15

    The weakest link for the large-scale deployment of solar energy and for that matter, any renewable energy source, is its storage. The energy needs of future society demands are so large that storage must be in the form of fuels owing to their high energy density. Indeed, society has intuitively understood this disparity in energy density as it has developed over the last century as all large-scale energy storage in our society is in the form of fuels. But these fuels are carbon-based. The imperative for the discipline of chemistry, and more generally science, is to develop fuel storage methods that are easily scalable, carbon-neutral and sustainable. These methods demand the creation of catalysts to manage the multi-electron, multi-proton transformations of the conversion of small molecules into fuels. The splitting of water using solar light is a fuel-forming reaction that meets the imperative of large scale energy storage. As light does not directly act on water to engender its splitting into its elemental components, we have designed “hangman” catalysts to effect the energy conversion processes needed for the fuel forming reactions. The hangman construct utilizes a pendant acid/base functionality within the secondary coordination sphere that is “hung” above the redox platform onto which substrate binds. In this way, we can precisely control the delivery of a proton to the substrate, thus ensuring efficient coupling between the proton and electron. An emphasis was on the coupling of electron and proton in the hydrogen evolution reaction (HER) on Ni, Co and Fe porphyrin platforms. Electrokinetic rate laws were developed to define the proton-coupled electron transfer (PCET) mechanism. The HER of Co and Fe porphyrins was metal-centered. Surprisingly, HER this was not the case for Ni porphyrins. In this system, the PCET occurred at the porphyrin platform to give rise to a phlorin. This is one of the first examples of an HER occurring via ligand non

  5. Fundamentals of displacement production in irradiated metals

    Doran, D.G.

    1975-09-01

    Radioinduced displacement damage in metals is described. Discussions are included on the displacement event itself, calculation of displacement rates in general, the manner in which different types of radiation interact with metals to produce displacements, the similarities and differences in the types of damage produced, the current status of computer simulations of displacement cascades, experimental evidence regarding cascades, and aspects of correlating damage produced by different types of radiation

  6. Urban displaced youth in Kabul

    Nassim Majidi

    2014-05-01

    Full Text Available Displaced young people in Kabul are waiting to see what the coming year brings for Afghanistan before making a decision as whether to move on again. This provides a window of opportunity to develop youth-sensitive programming.

  7. 187 DISPLACEMENT AND ENVIRONMENTAL PROTECTION

    Fr. Ikenga

    The national and international communities are confronted with the monumental task of ... displacement and environmental protection present a vicious cycle which today has ... Thus, issues of environmental protection viz-a-viz investment and .... out the conditions for product or process standards, the use of best available ...

  8. Tapping mode AFM study on the surface dynamics of a single glucose oxidase molecule on a Au(1 1 1) surface in water with implication for a surface-induced unfolding pathway

    Otsuka, Ichiro; Yaoita, Masashi; Higano, Michi; Nagashima, Seiiichi; Kataoka, Ryoichi

    2004-01-01

    We have investigated a surface-induced unfolding dynamics of a single glucose oxidase (GO) molecule on Au(1 1 1) in air-saturated water, using tapping mode atomic force microscopy (TMAFM). We followed the unfolding process by measuring the maximum height of a well-isolated GO molecule on a terrace near a step-edge of the surface as a function of contact time. We find three linear portions with two intersections in a power-law fit to the selected values of the observed heights. The kinetic TMAFM result implies that there exist at least two distinct dynamic regimes in the unfolding

  9. Force transmissibility versus displacement transmissibility

    Lage, Y. E.; Neves, M. M.; Maia, N. M. M.; Tcherniak, D.

    2014-10-01

    It is well-known that when a single-degree-of-freedom (sdof) system is excited by a continuous motion of the foundation, the force transmissibility, relating the force transmitted to the foundation to the applied force, equals the displacement transmissibility. Recent developments in the generalization of the transmissibility to multiple-degree-of-freedom (mdof) systems have shown that similar simple and direct relations between both types of transmissibility do not appear naturally from the definitions, as happens in the sdof case. In this paper, the authors present their studies on the conditions under which it is possible to establish a relation between force transmissibility and displacement transmissibility for mdof systems. As far as the authors are aware, such a relation is not currently found in the literature, which is justified by being based on recent developments in the transmissibility concept for mdof systems. Indeed, it does not appear naturally, but the authors observed that the needed link is present when the displacement transmissibility is obtained between the same coordinates where the applied and reaction forces are considered in the force transmissibility case; this implies that the boundary conditions are not exactly the same and instead follow some rules. This work presents a formal derivation of the explicit relation between the force and displacement transmissibilities for mdof systems, and discusses its potential and limitations. The authors show that it is possible to obtain the displacement transmissibility from measured forces, and the force transmissibility from measured displacements, opening new perspectives, for example, in the identification of applied or transmitted forces. With this novel relation, it becomes possible, for example, to estimate the force transmissibility matrix with the structure off its supports, in free boundary conditions, and without measuring the forces. As far as force identification is concerned, this

  10. Double Displacement: an Improved Bioorthogonal Reaction Strategy for Templated Nucleic Acid Detection

    Kleinbaum, Daniel J.; Miller, Gregory P.; Kool, Eric T.

    2010-01-01

    Quenched autoligation probes have been employed previously in a target-templated nonenzymatic ligation strategy for detecting nucleic acids in cells by fluorescence. A common source of background signal in such probes is undesired reaction with water and other cellular nucleophiles. Here we describe a new class of self-ligating probes, double displacement (DD) probes, that rely on two displacement reactions to fully unquench a nearby fluorophore. Three potential double displacement architectu...

  11. Channels with ordered water and bipyridine molecules in the porous coordination polymer {[Cu(SiF6(C10H8N22]·2C10N2H8·5H2O}n

    Emmanuel Aubert

    2016-11-01

    Full Text Available The coordination polymer {[Cu(SiF6(C10H8N22]·2C10H8N2·5H2O}n, systematic name: poly[[bis(μ2-4,4′-bipyridine(μ2-hexafluoridosilicatocopper(II] 4,4′-bipyridine disolvate pentahydrate], contains pores which are filled with water and 4,4′-bipyridine molecules. As a result of the presence of these ordered species, the framework changes its symmetry from P4/mmm to P21/c. The 4,4′-bipyridine guest molecules form chains inside the 6.5 × 6.9 Å pores parallel to [100] in which the molecules interact through π–π stacking. Ordered water molecules form infinite hydrogen-bonded chains inside a second pore system (1.6 × 5.3 Å free aperture perpendicular to the 4,4′-bipyridine channels.

  12. Molecule Matters van der Waals Molecules

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Molecule Matters van der Waals Molecules - Rg•••HF Complexes are Debye Molecules! E Arunan. Feature Article Volume 15 Issue 7 July 2010 pp 667-674. Fulltext. Click here to view fulltext PDF. Permanent link:

  13. Modelling Toehold-Mediated RNA Strand Displacement

    Šulc, Petr; Ouldridge, Thomas E.; Romano, Flavio; Doye, Jonathan P.K.; Louis, Ard A.

    2015-01-01

    We study the thermodynamics and kinetics of an RNA toehold-mediated strand displacement reaction with a recently developed coarse-grained model of RNA. Strand displacement, during which a single strand displaces a different strand previously bound to a complementary substrate strand, is an essential mechanism in active nucleic acid nanotechnology and has also been hypothesized to occur in vivo. We study the rate of displacement reactions as a function of the length of the toehold and temperat...

  14. Resonant neutron-induced atomic displacements

    Elmaghraby, Elsayed K., E-mail: e.m.k.elmaghraby@gmail.com

    2017-05-01

    Highlights: • Neutron induced atomic displacements was investigated based on scattering of energy of neutron. • Model for cascade function (multiplication of displacements with increasing energy transfer) was proposed and justified. • Parameterizations for the dpa induced in all elements were performed. • Table containing all necessary parameters to calculate the displacement density induced by neutron is given. • Contribution of non resonance displacement and resonant-neutron induced displacements are distinguished. - Abstract: A model for displacement cascade function was modified to account for the continuous variation of displacement density in the material in response to neutron exposure. The model is based on the Gaussian distribution of displacement energies of atoms in a material. Analytical treatment for moderated epithermal neutron field was given in which the displacement density was divided into two terms, discrete-resonance term and continuum term. Calculation are done for all isotopes using ENDF/B VII.1 data files and temperature dependent cross section library. Weighted elemental values were reported a fitting was performed to obtain energy-dependent formula of displacement density and reduce the number of parameters. Results relevant the present specification of the cascade function are tabulated for each element to enable calculation of displacement density at any value of displacement energy in the between 5 eV and 55 eV.

  15. Kinetics of proton migration in liquid water.

    Chen, Hanning; Voth, Gregory A; Agmon, Noam

    2010-01-14

    We have utilized multistate empirical valence bond (MS-EVB3) simulations of protonated liquid water to calculate the relative mean-square displacement (MSD) and the history-independent time correlation function, c(t), of the hydrated proton center of excess charge (CEC) with respect to the water molecule on which it has initially resided. The MSD is nonlinear for the first 15 ps, suggesting that the relative diffusion coefficient increases from a small value, D(0), at short separations to its larger bulk value, D(infinity), at large separations. With the ensuing distance-dependent diffusion coefficient, D(r), the time dependence of both the MSD and c(t) agrees quantitatively with the solution of a diffusion equation for reversible geminate recombination. This suggests that the relative motion of the CEC is not independent from the nearby water molecules, in agreement with theoretical and experimental observations that large water clusters participate in the mechanism of proton mobility.

  16. Electromagnetic device of linear displacement

    Savary, F.; Le Saulnier, G.

    1986-01-01

    The device moves a rod integral with a nuclear reactor control element. It has a grab for the rod operated by a mobil pole drive by a coil carried by a surrounding sealed casing, a second grab with fixed and mobile poles with facing surfaces shaped to limit the variation of magnetic force with distance between them, and a plunger driven by a coil to bear against another mobile pole moved by a coil. The invention proposes a device ensuring a displacement while the impact forces at the different level of the mechanism are reduced [fr

  17. Sensing single electrons with single molecules

    Plakhotnik, Taras

    2007-01-01

    We propose a new methodology for probing transport of just one electron, a process of great importance both in nature and in artificial devices. Our idea for locating a single electron is analogues to the conventional GPS where signals from several satellites are used to locate a macro object. Using fluorescent molecules as tiny sensors, it is possible to determine 3D displacement vector of an electron

  18. The Roles of Water in the Protein Matrix: A Largely Untapped Resource for Drug Discovery.

    Spyrakis, Francesca; Ahmed, Mostafa H; Bayden, Alexander S; Cozzini, Pietro; Mozzarelli, Andrea; Kellogg, Glen E

    2017-08-24

    The value of thoroughly understanding the thermodynamics specific to a drug discovery/design study is well known. Over the past decade, the crucial roles of water molecules in protein structure, function, and dynamics have also become increasingly appreciated. This Perspective explores water in the biological environment by adopting its point of view in such phenomena. The prevailing thermodynamic models of the past, where water was seen largely in terms of an entropic gain after its displacement by a ligand, are now known to be much too simplistic. We adopt a set of terminology that describes water molecules as being "hot" and "cold", which we have defined as being easy and difficult to displace, respectively. The basis of these designations, which involve both enthalpic and entropic water contributions, are explored in several classes of biomolecules and structural motifs. The hallmarks for characterizing water molecules are examined, and computational tools for evaluating water-centric thermodynamics are reviewed. This Perspective's summary features guidelines for exploiting water molecules in drug discovery.

  19. Carbon nanotubes-based chemiresistive immunosensor for small molecules: detection of nitroaromatic explosives.

    Park, Miso; Cella, Lakshmi N; Chen, Wilfred; Myung, Nosang V; Mulchandani, Ashok

    2010-12-15

    In recent years, there has been a growing focus on use of one-dimensional (1-D) nanostructures, such as carbon nanotubes and nanowires, as transducer elements for label-free chemiresistive/field-effect transistor biosensors as they provide label-free and high sensitivity detection. While research to-date has elucidated the power of carbon nanotubes- and other 1-D nanostructure-based field effect transistors immunosensors for large charged macromolecules such as proteins and viruses, their application to small uncharged or charged molecules has not been demonstrated. In this paper we report a single-walled carbon nanotubes (SWNTs)-based chemiresistive immunosensor for label-free, rapid, sensitive and selective detection of 2,4,6-trinitrotoluene (TNT), a small molecule. The newly developed immunosensor employed a displacement mode/format in which SWNTs network forming conduction channel of the sensor was first modified with trinitrophenyl (TNP), an analog of TNT, and then ligated with the anti-TNP single chain antibody. Upon exposure to TNT or its derivatives the bound antibodies were displaced producing a large change, several folds higher than the noise, in the resistance/conductance of SWNTs giving excellent limit of detection, sensitivity and selectivity. The sensor detected between 0.5 ppb and 5000 ppb TNT with good selectivity to other nitroaromatic explosives and demonstrated good accuracy for monitoring TNT in untreated environmental water matrix. We believe this new displacement format can be easily generalized to other one-dimensional nanostructure-based chemiresistive immuno/affinity-sensors for detecting small and/or uncharged molecules of interest in environmental monitoring and health care. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Primary shield displacement and bowing

    Scott, K.V.

    1978-01-01

    The reactor primary shield is constructed of high density concrete and surrounds the reactor core. The inlet, outlet and side primary shields were constructed in-place using 2.54 cm (1 in) thick steel plates as the forms. The plates remained as an integral part of the shields. The elongation of the pressure tubes due to thermal expansion and pressurization is not moving through the inlet nozzle hardware as designed but is accommodated by outward displacement and bowing of the inlet and outlet shields. Excessive distortion of the shields may result in gas seal failures, intolerable helium gas leaks, increased argon-41 emissions, and shield cooling tube failures. The shield surveillance and testing results are presented

  1. An ion displacement membrame model.

    Hladky, S B; Harris, J D

    1967-09-01

    The usual assumption in treating the diffusion of ions in an electric field has been that the movement of each ion is independent of the movement of the others. The resulting equation for diffusion by a succession of spontaneous jumps has been well stated by Parlin and Eyring. This paper will consider one simple case in which a different assumption is reasonable. Diffusion of monovalent positive ions is considered as a series of jumps from one fixed negative site to another. The sites are assumed to be full (electrical neutrality). Interaction occurs by the displacement of one ion by another. An ion leaves a site if and only if another ion, not necessarily of the same species, attempts to occupy the same site. Flux ratios and net fluxes are given as functions of the electrical potential, concentration ratios, and number of sites encountered in crossing the membrane. Quantitative comparisons with observations of Hodgkin and Keynes are presented.

  2. Displacement Based Seismic Design Criteria

    Costello, J.F.; Hofmayer, C.; Park, Y.J.

    1999-01-01

    The USNRC has initiated a project to determine if any of the likely revisions to traditional earthquake engineering practice are relevant to seismic design of the specialized structures, systems and components of nuclear power plants and of such significance to suggest that a change in design practice might be warranted. As part of the initial phase of this study, a literature survey was conducted on the recent changes in seismic design codes/standards, on-going activities of code-writing organizations/communities, and published documents on displacement-based design methods. This paper provides a summary of recent changes in building codes and on-going activities for future codes. It also discusses some technical issues for further consideration

  3. Possible displacement of mercury's dipole

    Ng, K.H.; Beard, D.B.

    1979-01-01

    Earlier attempts to model the Hermean magnetospheric field based on a planet-centered magnetic multipole field have required the addition of a quadrupole moment to obtain a good fit to space vehicle observations. In this work we obtain an equally satisfactory fit by assuming a null quadrupole moment and least squares fitting of the displacement of the planetary dipole from the center of the planet. We find a best fit for a dipole displacement from the planet center of 0.033 R/sub m/ away from the solar direction, 0.025 R/sub m/ toward dawn in the magnetic equatorial plane, and 0.189 R/sub m/ northward along the magnetic dipole axis, where R/sub m/ is the planet radius. Therefore the presence of a magnetic quadrupole moment is not ruled out. The compressed dipole field more completely represents the field in the present work than in previous work where the intrinsic quadrupole field was not included in the magnetopause surface and field calculations. Moreover, we have corrected a programing error in previous work in the computation of dipole tilt lambda away from the sun. We find a slight increase for the planet dipole moment of 190γR/sub m/ 3 and a dipole tilt angle lambda away from the sun. We find a slight increase for the planet moment of 190γR/sub m/ 3 and a dipole tilt angle lambda of only 1.2 0 away from the sun. All other parameters are essentially unchanged

  4. Physical state of poorly water soluble therapeutic molecules loaded into SBA-15 ordered mesoporous silica carriers: a case study with itraconazole and ibuprofen.

    Mellaerts, Randy; Jammaer, Jasper A G; Van Speybroeck, Michiel; Chen, Hong; Van Humbeeck, Jan; Augustijns, Patrick; Van den Mooter, Guy; Martens, Johan A

    2008-08-19

    The ordered mesoporous silica material SBA-15 was loaded with the model drugs itraconazole and ibuprofen using three different procedures: (i) adsorption from solution, (ii) incipient wetness impregnation, and (iii) heating of a mixture of drug and SBA-15 powder. The location of the drug molecules in the SBA-15 particles and molecular interactions were investigated using nitrogen adsorption, TGA, DSC, DRS UV-vis, and XPS. The in vitro release of hydrophobic model drugs was evaluated in an aqueous environment simulating gastric fluid. The effectiveness of the loading method was found to be strongly compound dependent. Incipient wetness impregnation using a concentrated itraconazole solution in dichloromethane followed by solvent evaporation was most efficient for dispersing itraconazole in SBA-15. The itraconazole molecules were located on the mesopore walls and inside micropores of the mesopore walls. When SBA-15 was loaded by slurrying it in a diluted itraconazole solution from which the solvent was evaporated, the itraconazole molecules ended up in the mesopores that they plugged locally. At a loading of 30 wt %, itraconazole exhibited intermolecular interactions inside the mesopores revealed by UV spectroscopy and endothermic events traced with DSC. The physical mixing of itraconazole and SBA-15 powder followed by heating above the itraconazole melting temperature resulted in formulations in which glassy itraconazole particles were deposited externally on the SBA-15 particles. Loading with ibuprofen was successful with each of the three loading procedures. Ibuprofen preferably is positioned inside the micropores. In vitro release experiments showed fast release kinetics provided the drug molecules were evenly deposited over the mesoporous surface.

  5. Earthquake related displacement fields near underground facilities

    Pratt, H.R.; Zandt, G.; Bouchon, M.

    1979-04-01

    Relative displacements of rock masses are evaluated in terms of geological evidence, seismological evidence, data from simulation experiments, and analytical predictive models. Numerical models have been developed to determine displacement fields as a function of depth, distance, and azimuth from an earthquake source. Computer calculations for several types of faults indicate that displacements decrease rapidly with distance from the fault, but that displacements can either increase or decrease as a function of depth depending on the type and geometry of the fault. For long shallow vertical strike-slip faults the displacement decreases markedly with depth. For square strike slip faults and for dip slip faults displacement does not decrease as markedly with depth. Geologic structure, material properties, and depth affect the seismic source spectrum. Amplification of the high frequencies of shear waves is larger by a factor of about 2 for layered geologic models than for an elastic half space

  6. Modelling toehold-mediated RNA strand displacement.

    Šulc, Petr; Ouldridge, Thomas E; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A

    2015-03-10

    We study the thermodynamics and kinetics of an RNA toehold-mediated strand displacement reaction with a recently developed coarse-grained model of RNA. Strand displacement, during which a single strand displaces a different strand previously bound to a complementary substrate strand, is an essential mechanism in active nucleic acid nanotechnology and has also been hypothesized to occur in vivo. We study the rate of displacement reactions as a function of the length of the toehold and temperature and make two experimentally testable predictions: that the displacement is faster if the toehold is placed at the 5' end of the substrate; and that the displacement slows down with increasing temperature for longer toeholds. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  7. Displacement measurement system for linear array detector

    Zhang Pengchong; Chen Ziyu; Shen Ji

    2011-01-01

    It presents a set of linear displacement measurement system based on encoder. The system includes displacement encoders, optical lens and read out circuit. Displacement read out unit includes linear CCD and its drive circuit, two amplifier circuits, second order Butterworth low-pass filter and the binarization circuit. The coding way is introduced, and various parts of the experimental signal waveforms are given, and finally a linear experimental test results are given. The experimental results are satisfactory. (authors)

  8. Displaced epithelium after liposuction for gynecomastia.

    McLaughlin, Cristina S; Petrey, Chris; Grant, Shawn; Ransdell, Jill S; Reynolds, Carol

    2011-08-01

    The authors describe the case of a 36-year-old man with gynecomastia who was previously treated with liposuction of the breast for cosmetic purposes. Histologic examination of a subsequent excisional biopsy revealed nests of displaced epithelial cells in adipose tissue. Epithelial cell displacement is a well-known risk of core needle biopsies and fine-needle aspirations of breast lesions. However, to the authors' knowledge, epithelial displacement in gynecomastia after liposuction, mimicking invasive ductal carcinoma, has not previously been reported.

  9. Analysis of Citric Acid in Beverages: Use of an Indicator Displacement Assay

    Umali, Alona P.; Anslyn, Eric V.; Wright, Aaron T.; Blieden, Clifford R.; Smith, Carolyne K.; Tian, Tian; Truong, Jennifer A.; Crumm, Caitlin E.; Garcia, Jorge E.; Lee, Soal; Mosier, Meredith; Nguyen, Chester P.

    2010-01-01

    The use of an indicator displacement assay permits the visualization of binding events between host and guest molecules. An undergraduate laboratory experiment is described to demonstrate the technique in the determination of citric acid content in commercially available beverages such as soda pop and fruit juices. Through the technique, students…

  10. Tracking speckle displacement by double Kalman filtering

    Donghui Li; Li Guo

    2006-01-01

    @@ A tracking technique using two sequentially-connected Kalman filter for tracking laser speckle displacement is presented. One Kalman filter tracks temporal speckle displacement, while another Kalman filter tracks spatial speckle displacement. The temporal Kalman filter provides a prior for the spatial Kalman filter, and the spatial Kalman filter provides measurements for the temporal Kalman filter. The contribution of a prior to estimations of the spatial Kalman filter is analyzed. An optical analysis system was set up to verify the double-Kalman-filter tracker's ability of tracking laser speckle's constant displacement.

  11. Point Coupled Displacement Sensor, Phase I

    National Aeronautics and Space Administration — Real-time displacement measurement techniques are needed to acquire aerodynamic and structural system characteristics in flight. This proposal describes the...

  12. The Displaced ‘Dispositif’

    Guy Edmonds

    2017-11-01

    Full Text Available “Dispositif” is a term used in film studies since the 1970s to describe the entire system of mechanical and human factors which together bring about the cinema experience. It therefore refers to (amongst other things the space of the auditorium, the screen, the projection technology and the physiology of the spectator. Many of its qualifying components are masked from the view of participants in the system. The dispositif’s purpose is to set up the conditions for a specific type of cognitive experience, one which mirrors and extends (and in some readings, controls the experience of its participants. The Displaced Dispositif is a performance designed for the space of a cinema theatre, but featuring the projection of fragments of early silent cinema on a coeval (1910s film projector from the auditorium. The film fragments are live-scored by the sound artist, Shaun Lewin, using a combination of closely mic’d sources on the projector itself, luminance data from the projected image and EEG brainwave data recorded from participants during previous projections of the film. Displacing elements in the dispositif in this way, by shifting modalities, situating in parallel, feeding back and layering, draws attention to its hidden existence and creates the potential for a more knowing and informed participation in the cinema experience. It also serves to demonstrate the degree to which dispositifs of modern cinema spectatorship, which have morphed and proliferated since the widespread digitization of film heritage, have radically altered both the technological and experiential qualities of the medium. By integrating EEG data, the performance adds the dimension of electrophysiological experience to the long tradition within experimental cinema of artists calling attention to Cinema’s hidden structures. As well as challenging the dominance of the worldview propagated by the film industry, the performance also signals a means of re-engaging with the

  13. Torque Measurement at the Single Molecule Level

    Forth, Scott; Sheinin, Maxim Y.; Inman, James; Wang, Michelle D.

    2017-01-01

    Methods for exerting and measuring forces on single molecules have revolutionized the study of the physics of biology. However, it is often the case that biological processes involve rotation or torque generation, and these parameters have been more difficult to access experimentally. Recent advances in the single molecule field have led to the development of techniques which add the capability of torque measurement. By combining force, displacement, torque, and rotational data, a more comprehensive description of the mechanics of a biomolecule can be achieved. In this review, we highlight a number of biological processes for which torque plays a key mechanical role. We describe the various techniques that have been developed to directly probe the torque experienced by a single molecule, and detail a variety of measurements made to date using these new technologies. We conclude by discussing a number of open questions and propose systems of study which would be well suited for analysis with torsional measurement techniques. PMID:23541162

  14. On the Coulomb displacement energy

    Sato, H.

    1976-01-01

    The Coulomb displacement energies of the T=1/2 mirror nuclei (A=15,17,27,29,31,33,39 and 41) are re-examined with the best available HF wave functions (the DME and the Skyrme II interaction), with the inclusion of all electromagnetic corrections. The results are compared with the experimental s.p. charge dependent energies extracted from the experimental data taking into account admixtures of core-excitation corrections with the help of present shell-model and co-existence model calculations. Although the so-called Nolen-Schiffer anomaly is not removed by these improvements, it is found that the remaining observed anomalies in the ground states of s.p. and s.h. systems can be resolved with the introduction of a simple, phenomenological charge symmetry breaking nucleon-nucleon force. This force can also account for the observed anomalies in the higher excited s.p. states, while those of the deeper s.h. states need further explanation. (Auth.)

  15. Effects of Fault Displacement on Emplacement Drifts

    Duan, F.

    2000-01-01

    The purpose of this analysis is to evaluate potential effects of fault displacement on emplacement drifts, including drip shields and waste packages emplaced in emplacement drifts. The output from this analysis not only provides data for the evaluation of long-term drift stability but also supports the Engineered Barrier System (EBS) process model report (PMR) and Disruptive Events Report currently under development. The primary scope of this analysis includes (1) examining fault displacement effects in terms of induced stresses and displacements in the rock mass surrounding an emplacement drift and (2 ) predicting fault displacement effects on the drip shield and waste package. The magnitude of the fault displacement analyzed in this analysis bounds the mean fault displacement corresponding to an annual frequency of exceedance of 10 -5 adopted for the preclosure period of the repository and also supports the postclosure performance assessment. This analysis is performed following the development plan prepared for analyzing effects of fault displacement on emplacement drifts (CRWMS M and O 2000). The analysis will begin with the identification and preparation of requirements, criteria, and inputs. A literature survey on accommodating fault displacements encountered in underground structures such as buried oil and gas pipelines will be conducted. For a given fault displacement, the least favorable scenario in term of the spatial relation of a fault to an emplacement drift is chosen, and the analysis is then performed analytically. Based on the analysis results, conclusions are made regarding the effects and consequences of fault displacement on emplacement drifts. Specifically, the analysis will discuss loads which can be induced by fault displacement on emplacement drifts, drip shield and/or waste packages during the time period of postclosure

  16. Displacement characteristics of a piezoactuator-based prototype microactuator with a hydraulic displacement amplification system

    Muralidhara; Rao, Rathnamala

    2015-01-01

    In this study, a new piezoactuator-based prototype microactuator is proposed with a hydraulic displacement amplification system. A piezoactuator is used to deflect a diaphragm which displaces a certain volume of hydraulic fluid into a smaller-diameter piston chamber, thereby amplifying the displacement at the other end of the piston. An electro-mechanical model is implemented to estimate the displacement of a multilayer piezoelectric actuator for the applied input voltage considering the hysteresis behavior. The displacement characteristics of the proposed microactuator are studied for triangular actuation voltage signal. Results of the experiments and simulation of the displacement behavior of the stacked piezoactuator and the amplified displacement of the prototype actuator were compared. Experimental results suggest that the mathematical model developed for the new piezoactuator-based prototype actuator is capable of estimating its displacement behavior accurately, within an error of 1.2%.

  17. Displacement characteristics of a piezoactuator-based prototype microactuator with a hydraulic displacement amplification system

    Muralidhara [NMAMIT, Nitte (India); Rao, Rathnamala [NITK, Surathkal (India)

    2015-11-15

    In this study, a new piezoactuator-based prototype microactuator is proposed with a hydraulic displacement amplification system. A piezoactuator is used to deflect a diaphragm which displaces a certain volume of hydraulic fluid into a smaller-diameter piston chamber, thereby amplifying the displacement at the other end of the piston. An electro-mechanical model is implemented to estimate the displacement of a multilayer piezoelectric actuator for the applied input voltage considering the hysteresis behavior. The displacement characteristics of the proposed microactuator are studied for triangular actuation voltage signal. Results of the experiments and simulation of the displacement behavior of the stacked piezoactuator and the amplified displacement of the prototype actuator were compared. Experimental results suggest that the mathematical model developed for the new piezoactuator-based prototype actuator is capable of estimating its displacement behavior accurately, within an error of 1.2%.

  18. Effect of displacement on resistance and capacitance of polyaniline film

    Karimov, Khasan Sanginovich; Saeed, Muhammad Tariq; Khalid, Fazal Ahmad; Moiz, Syed Abdul

    2011-01-01

    This paper investigates the properties of displacement sensors based on polyaniline (PANI) films. About 1 wt% of PANI micropowder is mixed and stirred in a solution of 90 wt% water and 10 wt% alcohol at room temperature. The films of PANI are deposited from solution by drop-casting on Ag electrodes, which are preliminary deposited on glass substrates. The thicknesses of the PANI films are in the range of 20 μm–80 μm. A displacement sensor with polyaniline film as an active material is designed and fabricated. The investigations showed that, on average, the AC resistance of the sensor decreases by 2 times and the capacitance accordingly increases by 1.6 times as the displacement changes in the range of 0 mm–0.5 mm. The polyaniline is the only active material of the displacement sensor. The resistance and capacitance of the PANI changes under the pressure of spring and elastic rubber, and this pressure is created by the downward movement of the micrometer. (general)

  19. Theoretical study of the interaction of N2 with water molecules. (H2O)/sub n/:N2, n = 1--8

    Curtiss, L.A.; Eisgruber, C.L.

    1984-01-01

    Ab initio molecular orbital calculations including correlation energy have been carried out on the interaction of a single H 2 O molecule with N 2 . The potential energy surface for H 2 O:N 2 is found to have a minimum corresponding to a HOH xxx N 2 structure with a weak ( -1 ) hydrogen bond. A second, less stable, configuration corresponding to a H 2 O xxx N 2 structure with N 2 bonded side on to the oxygen of H 2 O was found to be either a minimum or a saddle point in the potential energy surface depending on the level of calculation. The minimal STO-3G basis set was used to investigate the interaction of up to eight H 2 O molecules with N 2 . Two types of clusters, one containing only HOH xxx N 2 interactions and the other containing both HOH xxxN 2 and H 2 O xxx N 2 interactions, were investigated for [N 2 :(H 2 O)/sub n/, n = 2--8

  20. Mechanism of chimera formation during the Multiple Displacement Amplification reaction

    Stockwell Timothy B

    2007-04-01

    Full Text Available Abstract Background Multiple Displacement Amplification (MDA is a method used for amplifying limiting DNA sources. The high molecular weight amplified DNA is ideal for DNA library construction. While this has enabled genomic sequencing from one or a few cells of unculturable microorganisms, the process is complicated by the tendency of MDA to generate chimeric DNA rearrangements in the amplified DNA. Determining the source of the DNA rearrangements would be an important step towards reducing or eliminating them. Results Here, we characterize the major types of chimeras formed by carrying out an MDA whole genome amplification from a single E. coli cell and sequencing by the 454 Life Sciences method. Analysis of 475 chimeras revealed the predominant reaction mechanisms that create the DNA rearrangements. The highly branched DNA synthesized in MDA can assume many alternative secondary structures. DNA strands extended on an initial template can be displaced becoming available to prime on a second template creating the chimeras. Evidence supports a model in which branch migration can displace 3'-ends freeing them to prime on the new templates. More than 85% of the resulting DNA rearrangements were inverted sequences with intervening deletions that the model predicts. Intramolecular rearrangements were favored, with displaced 3'-ends reannealing to single stranded 5'-strands contained within the same branched DNA molecule. In over 70% of the chimeric junctions, the 3' termini had initiated priming at complimentary sequences of 2–21 nucleotides (nts in the new templates. Conclusion Formation of chimeras is an important limitation to the MDA method, particularly for whole genome sequencing. Identification of the mechanism for chimera formation provides new insight into the MDA reaction and suggests methods to reduce chimeras. The 454 sequencing approach used here will provide a rapid method to assess the utility of reaction modifications.

  1. Prolonged displacement may compromise resilience in Eritrean ...

    Objective: to assess the impact of prolonged displacement on the resilience of Eritrean mothers. Methods: an adapted SOC scale (short form) was administered. Complementary qualitative data were gathered from study participants' spontaneous reactions to and commentaries on the SOC scale. Results: Displaced ...

  2. Video Games, Adolescents, and the Displacement Effect

    Fisher, Carla Christine

    2012-01-01

    The displacement effect (the idea that time spent in one activity displaces time spent in other activities) was examined within the lens of adolescents' video game use and their time spent reading, doing homework, in physically active sports and activities, in creative play, and with parents and friends. Data were drawn from the Panel Study…

  3. Etiopathogenesis of abomasal displacement in cattle

    Šamanc Horea

    2003-01-01

    Full Text Available Abomasal displacement presents topographic gastropathy, where this organ has changed its position, and there is simultaneous dilatation which can vary in intensity. The incidence of this disorder in herds of high-yield dairy cows varies to a great degree (1 to 18 %. Abomasal displacement was established in herds of East-Frisian cows in 1 to 3% animals, and in Holstein cow herds in 5 to 18 % animals. The most frequent abomasal displacement is to the left (88%. There is significant seasonal variation in the incidence of abomasal displacement. About two-thirds of cases of abomasal displacement are diagnosed from October until April. The disorder appears more frequently in cows with repeated lactations. It has been established that it appears after the first calving in 27.8% cases, after the second to fifth calving in 66.7% cases, and after the sixth and seventh calving in 5.5% of the cows. The response of endocrine pancreas B-cells for insulin secretion to hyperglycaemia caused by applying an excess-glucose test is reduced in cows with left abomasal displacement, and there is constant hyperglycaemia in cows with right abomasal displacement. The excess-glucose test indicates a disrupted function of the endocrine pancreas in diseased animals. It has been determined through examinations of Aml genotypes in Holstein cow herds in connection with the appearance of abomasal displacement, that the occurrence of this disorder cannot be attributed to a genetic predisposition.

  4. Atomic displacements in bcc dilute alloys

    We present here a systematic investigation of the atomic displacements in bcc transition metal (TM) dilute alloys. We have calculated the atomic displacements in bcc (V, Cr, Fe, Nb, Mo, Ta and W) transition metals (TMs) due to 3d, 4d and 5d TMs at the substitutional site using the Kanzaki lattice static method. Wills and ...

  5. Displaced Homemakers: Vo-Tech Workshop Guide.

    Peltier, Wanda Jo

    Written for displaced homemaker programs in vocational-technical schools, this curriculum contains material designed so that instructors can prepare student manuals appropriate to almost any educational support situation for displaced homemakers. An overview provides information on special needs groups, curriculum use, and resources and sample…

  6. 40 CFR 205.153 - Engine displacement.

    2010-07-01

    ..., in accordance with American Society for Testing Materials (ASTM) E 29-67. (b) For rotary engines... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Engine displacement. 205.153 Section... TRANSPORTATION EQUIPMENT NOISE EMISSION CONTROLS Motorcycles § 205.153 Engine displacement. (a) Engine...

  7. Water

    ... www.girlshealth.gov/ Home Nutrition Nutrition basics Water Water Did you know that water makes up more ... to drink more water Other drinks How much water do you need? top Water is very important, ...

  8. Internal displacement in Colombia: Fifteen distinguishing features.

    Shultz, James M; Ceballos, Ángela Milena Gómez; Espinel, Zelde; Oliveros, Sofia Rios; Fonseca, Maria Fernanda; Florez, Luis Jorge Hernandez

    2014-01-01

    This commentary aims to delineate the distinguishing features of conflict-induced internal displacement in the nation of Colombia, South America. Even as Colombia is currently implementing a spectrum of legal, social, economic, and health programs for "victims of armed conflict," with particular focus on internally displaced persons (IDPs), the dynamics of forced migration on a mass scale within this country are little known beyond national borders.   The authors of this commentary are embarking on a global mental health research program in Bogota, Colombia to define best practices for reaching the displaced population and implementing sustainable, evidence-based screening and intervention for common mental disorders. Presenting the defining characteristics of internal displacement in Colombia provides the context for our work and, more importantly, conveys the compelling and complex nature of this humanitarian crisis. We attempt to demonstrate Colombia's unique position within the global patterning of internal displacement.

  9. Asymmetric SOL Current in Vertically Displaced Plasma

    Cabrera, J. D.; Navratil, G. A.; Hanson, J. M.

    2017-10-01

    Experiments at the DIII-D tokamak demonstrate a non-monotonic relationship between measured scrape-off layer (SOL) currents and vertical displacement event (VDE) rates with SOL currents becoming largely n=1 dominant as plasma is displaced by the plasma control system (PCS) at faster rates. The DIII-D PCS is used to displace the magnetic axis 10x slower than the intrinsic growth time of similar instabilities in lower single-null plasmas. Low order (n VDE instabilities observed when vertical control is disabled. Previous inquiry shows VDE asymmetry characterized by SOL current fraction and geometric parameters of tokamak plasmas. We note that, of plasmas displaced by the PCS, short displacement time scales near the limit of the PCS temporal control appear to result in larger n=1/n=2 asymmetries. Work supported under USDOE Cooperative Agreement DE-FC02-04ER54698 and DE-FG02-04ER54761.

  10. Protection of a PWR nuclear power stations against corrosion using hydrogen molecules to capture oxygen molecules

    Nahili, M.

    2004-01-01

    A protection method for the primary loops metals of nuclear power plants from corrosion was investigated. Hydrogen molecules were added to the primary circuit to eliminate oxygen molecules produced by radiolysis of coolant at the reactor core. The hydrogen molecules were produced by electrolyses of water and then added when the coolant water was passing through the primary coolant circuit. Thermodynamical process and the protection methods from corrosion were discussed, the discussion emphasized on the removal of oxygen molecules as one of the protection methods, and compared with other methods. The amount of hydrogen molecules needed for complete removal of oxygen was estimated in two cases: in the case without passing the water through the oxygen removal system, and in the case of passing water through the system. A pressurized water reactor VVER was chosen to be investigated in this study. The amount of hydrogen molecules was estimated so as to eliminate completely the oxygen molecules from coolant water. The estimated value was found to be less than the permissible range for coolant water for such type of reactors. A simulation study for interaction mechanism between hydrogen and oxygen molecules as water flowing in a tube similar to that of coolant water was performed with different water flow velocities. The interaction between the molecules of hydrogen and oxygen was described. The gas diffusion at the surface of the tube was found to play a major role in the interaction. A mathematical model was found to give full description of the change of oxygen concentration through the tube, as well as, to calculate the length of the tube where the concentration of oxygen reduced to few order of magnitude. (Author)

  11. Refugees and displaced persons. War, hunger, and public health.

    Toole, M J; Waldman, R J

    1993-08-04

    The number of refugees and internally displaced persons in need of protection and assistance has increased from 30 million in 1990 to more than 43 million today. War and civil strife have been largely responsible for this epidemic of mass migration that has affected almost every region of the world, including Europe. Since 1990, crude death rates (CDRs) during the early influx of refugees who crossed international borders have been somewhat lower than CDRs reported earlier among Cambodian and Ethiopian refugees. Nevertheless, CDRs among refugees arriving in Ethiopia, Kenya, Nepal, Malawi, and Zimbabwe since 1990 ranged from five to 12 times the baseline CDRs in the countries of origin. Among internally displaced populations in northern Iraq, Somalia, and Sudan, CDRs were extremely high, ranging from 12 to 25 times the baseline CDRs for the nondisplaced. Among both refugees and internally displaced persons, death rates among children less than 5 years of age were far higher than among older children and adults. In Bangladesh, the death rate in female Rohingya refugees was several times higher than in males. Preventable conditions such as diarrheal disease, measles, and acute respiratory infections, exacerbated often by malnutrition, caused most deaths. Although relief programs for refugees have improved since 1990, the situation among the internally displaced may have worsened. The international community should intervene earlier in the evolution of complex disasters involving civil war, human rights abuses, food shortages, and mass displacement. Relief programs need to be based on sound health and nutrition information and should focus on the provision of adequate shelter, food, water, sanitation, and public health programs that prevent mortality from diarrhea, measles, and other communicable diseases, especially among young children and women.

  12. Displacement of location in illusory line motion.

    Hubbard, Timothy L; Ruppel, Susan E

    2013-05-01

    Six experiments examined displacement in memory for the location of the line in illusory line motion (ILM; appearance or disappearance of a stationary cue is followed by appearance of a stationary line that is presented all at once, but the stationary line is perceived to "unfold" or "be drawn" from the end closest to the cue to the end most distant from the cue). If ILM was induced by having a single cue appear, then memory for the location of the line was displaced toward the cue, and displacement was larger if the line was closer to the cue. If ILM was induced by having one of two previously visible cues vanish, then memory for the location of the line was displaced away from the cue that vanished. In general, the magnitude of displacement increased and then decreased as retention interval increased from 50 to 250 ms and from 250 to 450 ms, respectively. Displacement of the line (a) is consistent with a combination of a spatial averaging of the locations of the cue and the line with a relatively weaker dynamic in the direction of illusory motion, (b) might be implemented in a spreading activation network similar to networks previously suggested to implement displacement resulting from implied or apparent motion, and (c) provides constraints and challenges for theories of ILM.

  13. Variable displacement alpha-type Stirling engine

    Homutescu, V. M.; Bălănescu, D. T.; Panaite, C. E.; Atanasiu, M. V.

    2016-08-01

    The basic design and construction of an alpha-type Stirling engine with on load variable displacement is presented. The variable displacement is obtained through a planar quadrilateral linkage with one on load movable ground link. The physico-mathematical model used for analyzing the variable displacement alpha-type Stirling engine behavior is an isothermal model that takes into account the real movement of the pistons. Performances and power adjustment capabilities of such alpha-type Stirling engine are calculated and analyzed. An exemplification through the use of the numerical simulation was performed in this regard.

  14. Dipole Correlation of the Electronic Structures of theConformations of Water Molecule Evolving Through theNormal Modes of Vibrations Between Angular (C2v to Linear(D∝h Shapes

    Arindam Chakraborty

    2006-03-01

    Full Text Available In order to settle the issue of equivalence or non-equivalence of the two lone pairsof electrons on oxygen atom in water molecule, a quantum chemical study of the dipolecorrelation of the electronic structure of the molecule as a function of conformationsgenerated following the normal modes of vibrations between the two extremeconformations, C2v (∠HOH at 90o and D∝h (∠HOH at 180o, including the equilibrium one,has been performed. The study invokes quantum mechanical partitioning of moleculardipoles into bond moment and lone pair moment and localization of delocalized canonicalmolecular orbitals, CMO’s into localized molecular orbitals, LMO’s. An earlier suggestion,on the basis of photoelectron spectroscopy, that one lone pair is in p-type and the other is ins-type orbital of O atom of water molecule at its equilibrium shape, and also the qualitative“Squirrel Ears” structure are brought under serious scrutiny. A large number ofconformations are generated and the charge density matrix, dipole moment of eachconformation is computed in terms of the generated canonical molecular orbitals, CMO’sand then Sinanoğlu’s localization method is invoked to localize the CMO’s of eachconformation and the quantum mechanical hybridizations of all the bonds and lone pairs onO center are evaluated in terms of the localized molecular orbitals. Computed datademonstrate that the electronic structures i.e. two bond pairs and two lone pairs and itshybridization status of all conformations of water molecule are straightforward in terms ofthe LMO’s. It is further revealed that the pattern of orbital hybridization changescontinuously as a function of evolution of molecular shape. The close analysis of thegenerated LMO’s reveals that one lone pair is accommodated in a pure p orbital and anotherlone pair is in a hybrid

  15. Formation of Ultracold Molecules

    Cote, Robin [Univ. of Connecticut, Storrs, CT (United States)

    2016-01-28

    Advances in our ability to slow down and cool atoms and molecules to ultracold temperatures have paved the way to a revolution in basic research on molecules. Ultracold molecules are sensitive of very weak interactions, even when separated by large distances, which allow studies of the effect of those interactions on the behavior of molecules. In this program, we have explored ways to form ultracold molecules starting from pairs of atoms that have already reached the ultracold regime. We devised methods that enhance the efficiency of ultracold molecule production, for example by tuning external magnetic fields and using appropriate laser excitations. We also investigates the properties of those ultracold molecules, especially their de-excitation into stable molecules. We studied the possibility of creating new classes of ultra-long range molecules, named macrodimers, thousand times more extended than regular molecules. Again, such objects are possible because ultra low temperatures prevent their breakup by collision. Finally, we carried out calculations on how chemical reactions are affected and modified at ultracold temperatures. Normally, reactions become less effective as the temperature decreases, but at ultracold temperatures, they can become very effective. We studied this counter-intuitive behavior for benchmark chemical reactions involving molecular hydrogen.

  16. Effects of Magnetized Water with Small Molecules Mass on Albumin Extraction from Kidney Bean%小分子团磁化水对芸豆清蛋白浸出效果的影响

    包国凤; 刁静静; 井雪莲; 张丽萍

    2015-01-01

    以垦芸2号芸豆品种为原料,以自来水和纯净水作对比试验,研究小分子团磁化水促进芸豆清蛋白的浸出作用,并优化了提取技术参数。通过对提取温度、提取时间、液料比和粉碎粒度四个因素的单因素试验和响应面分析,结果表明:提取温度31℃,提取时间2 h,液料比22∶1,粉碎粒度60目时芸豆清蛋白的提取率均最高,其中小分子团磁化水组提取率为48.96%,高于自来水组(42.79%)和纯净水组(40.87%);并对小分子团磁化水提取的芸豆清蛋白进行SDS-PAGE电泳测试,得出分子量排布主要集中在42.01 kDa左右,说明所得蛋白为清蛋白。%Using Kenyun 2 kidney beans as raw material and tap water and pure water as comparison tests,the infusion effects of magnetized water with small molecules mass to kidney bean were studied,and the extraction parameters of albumin from kidney bean were optimized. Through single factor and response surface analysis of four factors such as extraction temperature,extraction time, ratio of liquid to material and particle size,the results showed that the optimum extraction conditions was as follows:extraction temperature 31 ℃,extraction time 2 h,ratio of liquid to material 22∶1,particle size 60 mesh. Under such conditions,the extraction yield of magnetized water with small molecules group was 48.96% and higher than that of tap water group (42.79%)and purified water group (40.87%).SDS-PAGE result showed that the molecular weight of the extracted protein was about 42.01 kDa,and the protein was albumin.

  17. Stability of metal organic frameworks and interaction of small gas molecules in these materials

    Tan, Kui

    The work in this dissertation combines spectroscopy ( in-situ infrared absorption and Raman), powder X-ray diffraction and DFT calculations to study the stability of metal organic frameworks materials (MOFs) in the presence of water vapor and other corrosive gases (e.g., SO 2, NO2 NO), and the interaction and competitive co-adsorption of several gases within MOFs by considering two types of prototypical MOFs: 1) a MOF with saturated metal centers based on paddlewheel secondary building units: M(bdc)(ted)0.5 [M=Cu, Zn, Ni, Co, bdc = 1,4-benzenedicarboxylate, ted = triethylenediamine], and 2) a MOF with unsaturated metal centers: M2(dobdc) [M=Mg2+, Zn2+, Ni2+, Co2+ and dobdc = 2,5-dihydroxybenzenedicarboxylate]. We find that the stability of MOFs to water vapor critically depends on their structure and the specific metal cation in the building units. For M(bdc)(ted)0.5, the metal-bdc bond is the most vulnerable for Cu(bdc)(ted)0.5, while the metal-ted bond is first attacked for the Zn and Co analogs. In contrast, Ni(bdc)(ted)0.5 remains stable under the same conditions. For M2(dobdc), or MOF-74, the weak link is the dobdc-metal bond. The water molecule is dissociatively adsorbed at the metal-oxygen group with OH adsorption directly on the metal center and H adsorption on the bridging O of the phenolate group in the dobdc linker. Other technologically important molecules besides water, such as NO, NO2, SO2, tend to poison M2(dobdc) through dissociative or molecular adsorption onto the open metal sites. A high uptake SO2 capacity was measured in M(bdc)(ted)0.5, attributed to multipoint interactions between the guest SO2 molecule and the MOF host. In the case of competitive co-adsorption between CO2 and other small molecules, we find that binding energy alone is not a good indicator of molecular site occupation within the MOF (i.e., it cannot successfully predict and evaluate the displacement of CO2 by other molecules). Instead, we show that the kinetic barrier for the

  18. The status of molecules

    Barnes, T.; Oak Ridge National Lab., TN; Tennessee Univ., Knoxville, TN

    1994-06-01

    This report summarizes the experimental and theoretical status of hadronic molecules, which are weakly-bound states of two or more hadrons. We begin with a brief history of the subject and discuss a few good candidates, and then abstract some signatures for molecules which may be of interest in the classification of possible molecule states. Next we argue that a more general understanding of 2 → 2 hadron-hadron scattering amplitudes will be crucial for molecule searches, and discuss some of our recent work in this area. We conclude with a discussion of a few more recent molecule candidates (notably the f o (1710)) which are not well established as molecules but satisfy some of the expected signatures. (Author)

  19. Sequential strand displacement beacon for detection of DNA coverage on functionalized gold nanoparticles.

    Paliwoda, Rebecca E; Li, Feng; Reid, Michael S; Lin, Yanwen; Le, X Chris

    2014-06-17

    Functionalizing nanomaterials for diverse analytical, biomedical, and therapeutic applications requires determination of surface coverage (or density) of DNA on nanomaterials. We describe a sequential strand displacement beacon assay that is able to quantify specific DNA sequences conjugated or coconjugated onto gold nanoparticles (AuNPs). Unlike the conventional fluorescence assay that requires the target DNA to be fluorescently labeled, the sequential strand displacement beacon method is able to quantify multiple unlabeled DNA oligonucleotides using a single (universal) strand displacement beacon. This unique feature is achieved by introducing two short unlabeled DNA probes for each specific DNA sequence and by performing sequential DNA strand displacement reactions. Varying the relative amounts of the specific DNA sequences and spacing DNA sequences during their coconjugation onto AuNPs results in different densities of the specific DNA on AuNP, ranging from 90 to 230 DNA molecules per AuNP. Results obtained from our sequential strand displacement beacon assay are consistent with those obtained from the conventional fluorescence assays. However, labeling of DNA with some fluorescent dyes, e.g., tetramethylrhodamine, alters DNA density on AuNP. The strand displacement strategy overcomes this problem by obviating direct labeling of the target DNA. This method has broad potential to facilitate more efficient design and characterization of novel multifunctional materials for diverse applications.

  20. Displacement pile installation effects in sand

    Beijer-Lundberg, A.

    2015-01-01

    Installation effects govern the post-installation behaviour of displacement piles in sand. These effects are currently not completely understood. Suitable experimental techniques to model these installation effects include field, laboratory and experimental models. In the current thesis a

  1. Geometric interpretation of density displacements and charge ...

    Unknown

    The “geometric” interpretation of the electronic density displacements in the Hilbert space is ... an attitude is also close to the chemical thinking ..... These vectors explicitly define the corresponding ..... chain-rule for implicit functionals: p p. N p.

  2. Epitaxial growth by monolayer restricted galvanic displacement

    Vasilić Rastko

    2012-01-01

    Full Text Available The development of a new method for epitaxial growth of metals in solution by galvanic displacement of layers pre-deposited by underpotential deposition (UPD was discussed and experimentally illustrated throughout the lecture. Cyclic voltammetry (CV and scanning tunneling microscopy (STM are employed to carry out and monitor a “quasi-perfect”, two-dimensional growth of Ag on Au(111, Cu on Ag(111, and Cu on Au(111 by repetitive galvanic displacement of underpotentially deposited monolayers. A comparative study emphasizes the displacement stoichiometry as an efficient tool for thickness control during the deposition process and as a key parameter that affects the deposit morphology. The excellent quality of layers deposited by monolayer-restricted galvanic displacement is manifested by a steady UPD voltammetry and ascertained by a flat and uniform surface morphology maintained during the entire growth process.

  3. Bucky gel actuator displacement: experiment and model

    Ghamsari, A K; Zegeye, E; Woldesenbet, E; Jin, Y

    2013-01-01

    Bucky gel actuator (BGA) is a dry electroactive nanocomposite which is driven with a few volts. BGA’s remarkable features make this tri-layered actuator a potential candidate for morphing applications. However, most of these applications would require a better understanding of the effective parameters that influence the BGA displacement. In this study, various sets of experiments were designed to investigate the effect of several parameters on the maximum lateral displacement of BGA. Two input parameters, voltage and frequency, and three material/design parameters, carbon nanotube type, thickness, and weight fraction of constituents were selected. A new thickness ratio term was also introduced to study the role of individual layers on BGA displacement. A model was established to predict BGA maximum displacement based on the effect of these parameters. This model showed good agreement with reported results from the literature. In addition, an important factor in the design of BGA-based devices, lifetime, was investigated. (paper)

  4. The Chinese Export Displacement Effect Revisited

    Elleby, Christian; Yu, Wusheng; Yu, Qian

    China’s global export share has increased dramatically over the past decades. This development has prompted an empirical literature on whether Chinese exports displace those originated from elsewhere in various destination markets. In this paper we focus on the growth of China’s exports to the East...... African Community (EAC) countries and show how it has affected exports from the European Union (EU) to the EAC. Our main contribution to the literature on the displacement effect of Chinese exports is a set of total and relative displacement estimates based on different specifications of the gravity model...... where we control for country-year fixed effects so as to avoid the “gold medal mistake” of not accounting for time varying “multilateral resistance”. Our findings do not support the hypothesis that Chinese exports have displaced exports from other countries in general. Nor do they support the hypothesis...

  5. Groundwater resources monitoring and population displacement in northern Uganda

    Chalikakis, K.; Hammache, Y.; Nawa, A.; Slinski, K.; Petropoulos, G.; Muteesasira, A.

    2009-04-01

    Northern Uganda has been devastated by more than 20 years of open conflict by the LRA (Lord's Resistance Army) and the Government of Uganda. This war has been marked by extreme violence against civilians, who had been gathered in protected IDP (Internally Displaced Persons) camps. At the height of the displacement in 2007, the UN office for coordination of humanitarian affairs, estimated that nearly 2.5 million people were interned into approximately 220 camps throughout Northern Uganda. With the improved security since mid-2006, the people displaced by the conflict in Northern Uganda started to move out of the overcrowded camps and return either to their villages/parishes of origin or to resettlement/transit sites. However, basic water, sanitation and hygiene infrastructure in the return areas or any new settlements sites are minimal. People returning to their villages of origin encounter a situation where in many cases there is no access to safe water. Since 1998 ACF (Action Against Hunger, part of the Action Contre la Faim International Network) activities have been concentrated in the Acholi and Lango regions of Northern Uganda. ACF's WASH (Water, sanitation and hygiene) department interventions concern sanitation infrastructure, hygiene education and promotion as well as water points implementation. To ensure safe water access, actions are focused in borehole construction and traditional spring rehabilitation, also called "protected" springs. These activities follow the guidelines as set forth by the international WASH cluster, led by UNICEF. A three year project (2008-2010) is being implemented by ACF, to monitor the available groundwater resources in Northern Uganda. The main objectives are: 1. to monitor the groundwater quality from existing water points during different hydrological seasons, 2. to identify, if any, potential risks of contamination from population concentrations and displacement, lack of basic infrastructure and land use, and finally 3. to

  6. Experimental validation of a numerical model of two-phase displacement in porous medium

    Genty, A.

    1996-01-01

    Burial in geological layers appears to be an interesting solution to dispose of radioactive wastes. This thesis analyzes and simulates the behaviour of gas produced by waste barrels corrosion. The released contaminated gas drains the water initially present in the host rock and yields a water-gas two phase flow. A literature survey of two phase flow shows that fluid interfaces may display instabilities for definite flow characteristics. When the displacement is stable a smooth interface proceeds through the porous medium. When the interface shows fingering, the displacement is said to be 'viscous-unstable', and when the front is jagged the displacement is called 'capillary' displacement. A dimensional analysis of classical equations governing two phase flow in porous media is combined with a classification of dominant forces to define an original map of flow regimes that includes gravitational forces. The map is based on three dimensionless numbers and predicts a priori the flow type. For typical data describing a radioactive waste repository a 'viscous-unstable' displacement is predicted by the map. We simulate water-gas displacement with a numerical model previously developed; this code, based on the Muskat model, uses the mixed-hybrid finite elements technique and is therefore well adapted for tracking moving interfaces. Fluxes are well conserved, however instabilities cannot be simulated. We assume that there is always a scale to be found where instabilities can be averaged and we try to validate the model with experimental two phase flows. We performed laboratory water-gas flow experiments for a variety of flow conditions. The observed displacement types are consistent with the map of flow regimes. Good agreement with numerical simulations is obtained when precise parameters of the displacements are available, in particular relative permeability curves. We conclude that our model allows a first approach of migration of gas near a radioactive waste repository

  7. Phenomenon of displacement in Arabic language

    2015-09-01

    Full Text Available Displacement is one of the characteristics of language and common phenomena in the Arabic language. Not only is this phenomenon limited to Arabic poetry and prose, but it is also broadened, so we can see examples of this in the Qur'an. Because of this phenomenon extensively in Arabic literature and also because of its essence that leads to the transmission of the elements for the first visibility to the other visibility in the sentence and sometimes had to change the grammatical role of the words, its identify helps us in a better understanding of text and the correct translation of it and protects the reader from mistakes. This paper in the descriptive analytical approach tries studying of the phenomenon of the displacement in the Arabic language and bringing its instances in Arabic poetry and prose as well as verses contained in the Holy Quran, to show that through the types and characteristics in the Arabic language and to response to several questions, including: how important is the displacement and what is its types in rhetoric, and the reasons of the displacement, and etc... Of the most important results of this study may refer to the undeniable role of the displacement as a rhetorical method to better understanding of the texts including: one of the most important reasons of the displacement in the use of language is to improve speech verbally and morally, and violation of the standard language and create a poetic atmosphere, and the recognition of the occurrence of the phenomenon of displacement in the Arabic language that uphold different interpretations remote and estimates when faced with the displacement in the text and help us to understand it and etc...

  8. Histone displacement during nucleotide excision repair

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

  9. 2014 and beyond: implications for displacement

    Aidan O’Leary

    2014-05-01

    Full Text Available 2014 marks a watershed for Afghanistan, with the withdrawal of the International Security Assistance Force after twelve years, and the very real risks this withdrawal poses to the capacity of the Afghan state to meet the many internal and external challenges faced by the country. These challenges have significant implications for displaced and returning Afghans and for the potential for displacement in the future.

  10. Cold Rydberg molecules

    Raithel, Georg; Zhao, Jianming

    2017-04-01

    Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).

  11. SOCIAL CAPITAL IN INVOLUNTARY DISPLACEMENT AND RESETTLEMENT

    Melissa Quetulio-Navarra

    2013-07-01

    Full Text Available Social capital is often seen as a substitute for lack of other types of capital amongpoor people. Because of the recognized applicability of the social capital conceptand its correlation with the different dimensions of poverty, it has been used inevaluating the adaptation and integration of involuntarily displaced individualsinto their new environment. This paper presents insights based on a review of thefindings of studies that looked into the role of social capital in conflict- anddevelopment-induced displacement contexts. Althoughboth types of displace-ments are involuntary or forced in nature, they differ in terms of the role of socialcapital regarding its main sources, the formation pattern and its determinants.Social capital studies in forced resettlement appear to be relatively small innumber and are heavily concentrated on first worldcountries and conflict- anddevelopment-induced displacements. The conduct of similar studies in developingcountries and in a disaster-induced resettlement context, the third type ofinvoluntary displacement, should generate new and relevant findings regardingthe role of social capital in resettlement communities.

  12. Diffusion of flexible, charged, nanoscopic molecules in solution: Size and pH dependence for PAMAM dendrimer

    Maiti, Prabal K.; Bagchi, Biman

    2009-12-01

    In order to understand self-diffusion (D) of a charged, flexible, and porous nanoscopic molecule in water, we carry out very long, fully atomistic molecular dynamics simulation of PAMAM dendrimer up to eight generations in explicit salt water under varying pH. We find that while the radius of gyration (Rg) varies as N1/3, the self-diffusion constant (D ) scales, surprisingly, as N-α, with α =0.39 at high pH and 0.5 at neutral pH, indicating a dramatic breakdown of Stokes-Einstein relation for diffusion of charged nanoscopic molecules. The variation in D as a function of radius of gyration demonstrates the importance of treating water and ions explicitly in the diffusion process of a flexible nanoscopic molecule. In agreement with recent experiments, the self-diffusion constant increases with pH, revealing the importance of dielectric friction in the diffusion process. The shape of a dendrimer is found to fluctuate on a nanosecond time scale. We argue that this flexibility (and also the porosity) of the dendrimer may play an important role in determining the mean square displacement of the dendrimer and the breakdown of the Stokes-Einstein relation between diffusion constant and the radius.

  13. Enhanced Oil Recovery Using Micron-Size Polyacrylamide Elastic Microspheres (MPEMs): Underlying Mechanisms and Displacement Experiments

    Yao, Chuanjin; Lei, Guanglun; Hou, Jian; Xu, Xiaohong; Wang, Dan; Steenhuis, Tammo S.

    2015-01-01

    Micron-size polyacrylamide elastic microsphere (MPEM) is a newly developed profile control and oil displacement agent for enhanced oil recovery in heterogeneous reservoirs. In this study, laboratory experiments were performed to characterize the viscoelastic properties of MPEMs in brine water. A transparent sandpack micromodel was used to observe the microscopic flow and displacement mechanisms, and parallel-sandpack models were used to investigate the profile control and oil displacement performance using MPEMs in heterogeneous reservoirs. The results indicate that MPEMs almost do not increase the viscosity of injection water and can be conveniently injected using the original water injection pipelines. The microscopic profile control and oil displacement mechanisms of MPEMs in porous media mainly behave as selective-plugging in large pores, fluid diversion after MPEMs plugging, oil drainage caused by MPEMs breakthrough, and the mechanism of oil droplets converging into oil flow. MPEMs have a high plugging strength, which can tolerate a long-term water flushing. MPEMs can selectively enter and plug the large pores and pore-throats in high permeability sandpack, but almost do not damage the low permeability sandpack. MPEMs can effectively divert the water flow from the high permeability sandpack to the low permeability sandpack and improve the sweep efficiency of low permeability sandpack and low permeability area in the high permeability sandpack. The results also confirm the dynamic process of profile control and oil displacement using MPEMs in heterogeneous reservoirs.

  14. Enhanced Oil Recovery Using Micron-Size Polyacrylamide Elastic Microspheres (MPEMs): Underlying Mechanisms and Displacement Experiments

    Yao, Chuanjin

    2015-10-12

    Micron-size polyacrylamide elastic microsphere (MPEM) is a newly developed profile control and oil displacement agent for enhanced oil recovery in heterogeneous reservoirs. In this study, laboratory experiments were performed to characterize the viscoelastic properties of MPEMs in brine water. A transparent sandpack micromodel was used to observe the microscopic flow and displacement mechanisms, and parallel-sandpack models were used to investigate the profile control and oil displacement performance using MPEMs in heterogeneous reservoirs. The results indicate that MPEMs almost do not increase the viscosity of injection water and can be conveniently injected using the original water injection pipelines. The microscopic profile control and oil displacement mechanisms of MPEMs in porous media mainly behave as selective-plugging in large pores, fluid diversion after MPEMs plugging, oil drainage caused by MPEMs breakthrough, and the mechanism of oil droplets converging into oil flow. MPEMs have a high plugging strength, which can tolerate a long-term water flushing. MPEMs can selectively enter and plug the large pores and pore-throats in high permeability sandpack, but almost do not damage the low permeability sandpack. MPEMs can effectively divert the water flow from the high permeability sandpack to the low permeability sandpack and improve the sweep efficiency of low permeability sandpack and low permeability area in the high permeability sandpack. The results also confirm the dynamic process of profile control and oil displacement using MPEMs in heterogeneous reservoirs.

  15. Molecular hydrogen solvated in water – A computational study

    Śmiechowski, Maciej

    2015-01-01

    The aqueous hydrogen molecule is studied with molecular dynamics simulations at ambient temperature and pressure conditions, using a newly developed flexible and polarizable H 2 molecule model. The design and implementation of this model, compatible with an existing flexible and polarizable force field for water, is presented in detail. The structure of the hydration layer suggests that first-shell water molecules accommodate the H 2 molecule without major structural distortions and two-dimensional, radial-angular distribution functions indicate that as opposed to strictly tangential, the orientation of these water molecules is such that the solute is solvated with one of the free electron pairs of H 2 O. The calculated self-diffusion coefficient of H 2 (aq) agrees very well with experimental results and the time dependence of mean square displacement suggests the presence of caging on a time scale corresponding to hydrogen bond network vibrations in liquid water. Orientational correlation function of H 2 experiences an extremely short-scale decay, making the H 2 –H 2 O interaction potential essentially isotropic by virtue of rotational averaging. The inclusion of explicit polarizability in the model allows for the calculation of Raman spectra that agree very well with available experimental data on H 2 (aq) under differing pressure conditions, including accurate reproduction of the experimentally noted trends with solute pressure or concentration

  16. Molecule of the Month

    Atoms in a molecule generally prefer, particularly among the neighbouring ones, certain optimmn geometrical relationships. These are manifested in specific ranges of bond lengths, bond angles, torsion angles etc. As it always happens, chemists are interested in making molecules where these 'standard relationships' are ...

  17. Molecule of the Month

    Cyclo bu tadiene (1) has been one of the most popular molecules for experimentalists and theoreticians. This molecule is unstable as . it is antiaromatic ( 4,n electrons in a cyclic array). Even though some highly substituted cyclobutadienes, for example, compound 2 and the Fe(CO)3 complex of cyclobutadiene (3) are ...

  18. Single-Molecule Spectroscopy

    Home; Journals; Resonance – Journal of Science Education; Volume 20; Issue 2. Single-Molecule Spectroscopy: Every Molecule is Different! Kankan Bhattacharyya. General Article Volume 20 Issue 2 February 2015 pp 151-164. Fulltext. Click here to view fulltext PDF. Permanent link:

  19. Single molecule conductance

    Willems, R.

    2008-01-01

    This thesis represents an excursion into the world of molecular electronics, i.e. the field of research trying to use individual (organic) molecules as electronic components; in this work various experimental methods have been explored to connect individual molecules to metallic contacts and

  20. Surface species formed by the adsorption and dissociation of water molecules on Ru(0001) surface containing a small coverage of carbon atoms studied by scanning tunneling microscopy

    Dept of Materials Science and Engineering UCB; Dept of Applied Science and Technology, UCB; Institut de Ciencia de Materials de Barcelona, Barcelona, Spain; Instituto de Ciencia de Materiales de Madrid, Madrid, Spain; Department of Mechanical Engineering, Yale University; Salmeron, Miquel; Shimizu, Tomoko K.; Mugarza, Aitor; Cerda, Jorge I.; Heyde, Markus; Qi, Yabing; Schwarz, Udo D.; Ogletree, D. Frank; Salmeron, Miquel

    2008-04-26

    The adsorption and dissociation of water on a Ru(0001) surface containing a small amount ({le} 3 %) of carbon impurities was studied by scanning tunneling microscopy (STM). Various surface species are formed depending on the temperature. These include molecular H{sub 2}O, H{sub 2}O-C complexes, H, O, OH and CH. Clusters of either pure H{sub 2}O or mixed H{sub 2}O-OH species are also formed. Each of these species produces a characteristic contrast in the STM images and can be identified by experiment and by ab initio total energy calculations coupled with STM image simulations. Manipulation of individual species via excitation of vibrational modes with the tunneling electrons has been used as supporting evidence.

  1. Molecules in stars

    Tsuji, T.

    1986-01-01

    Recently, research related to molecules in stars has rapidly expanded because of progress in related fields. For this reason, it is almost impossible to cover all the topics related to molecules in stars. Thus, here the authors focus their attention on molecules in the atmospheres of cool stars and do not cover in any detail topics related to circumstellar molecules originating from expanding envelopes located far from the stellar surface. However, the authors do discuss molecules in quasi-static circumstellar envelopes (a recently discovered new component of circumstellar envelopes) located near the stellar surface, since molecular lines originating from such envelopes show little velocity shift relative to photospheric lines, and hence they directly affect the interpretation and analysis of stellar spectra

  2. Measurement of liquid film in microchannels using a laser focus displacement meter

    Hazuku, Tatsuya; Fukamachi, Norihiro; Takamasa, Tomoji; Hibiki, Takashi; Ishii, Mamoru

    2005-06-01

    This paper presents a new method for measuring the interfacial displacement of a liquid film in microchannels using a laser focus displacement meter (LFD). The purpose of the study is to clarify the effectiveness of the new method for obtaining detailed information concerning interfacial displacement, especially in the case of a thin liquid film, in microchannels and minichannels. To prevent the tube wall signal from disturbing that of the gas liquid interface, a fluorocarbon tube with a water box was used; the refraction index of this device is the same as that for water. With this method, accurate instantaneous measurements of the interfacial displacement of the liquid film were achieved. The error caused by refraction of the laser beam passing through the acrylic water box and fluorocarbon tube was estimated analytically and experimentally. The formulated analytical equation can estimate the real interface displacement by using the measured displacement in a fluorocarbon tube of 25 μm to 2.0 mm I.D. A preliminary test using fluorocarbon tubes of 1 mm and 2 mm I.D. showed that the corrected interface displacement calculated by the equation agreed with the real displacement to within a 1% margin of error. It was also confirmed that the LFD in the system could measure a liquid film of 0.25 μm at the thinnest. We made simultaneous measurements of the interface in fluorocarbon tubes of 0.5 mm and 1 mm I.D. using the LFD and a high-speed video camera with a microscope. These showed that the LFD could measure the interface of a liquid film with high spatial and temporal resolution during annular, slug, and piston flow regimes. The data also clarified the existence of a thin liquid film of less than 1 μm in thickness in the slug and annular flow regimes.

  3. Measurement of liquid film in microchannels using a laser focus displacement meter

    Hazuku, Tatsuya; Fukamachi, Norihiro; Takamasa, Tomoji [Tokyo University of Marine Science and Technology, Faculty of Marine Technology, Etchujima, Koto, Tokyo (Japan); Hibiki, Takashi [Kyoto University, Research Reactor Institute, Kumatori, Sennan, Osaka (Japan); Ishii, Mamoru [Purdue University, School of Nuclear Engineering, West Lafayette, IN (United States)

    2005-06-01

    This paper presents a new method for measuring the interfacial displacement of a liquid film in microchannels using a laser focus displacement meter (LFD). The purpose of the study is to clarify the effectiveness of the new method for obtaining detailed information concerning interfacial displacement, especially in the case of a thin liquid film, in microchannels and minichannels. To prevent the tube wall signal from disturbing that of the gas-liquid interface, a fluorocarbon tube with a water box was used; the refraction index of this device is the same as that for water. With this method, accurate instantaneous measurements of the interfacial displacement of the liquid film were achieved. The error caused by refraction of the laser beam passing through the acrylic water box and fluorocarbon tube was estimated analytically and experimentally. The formulated analytical equation can estimate the real interface displacement by using the measured displacement in a fluorocarbon tube of 25 {mu}m to 2.0 mm I.D. A preliminary test using fluorocarbon tubes of 1 mm and 2 mm I.D. showed that the corrected interface displacement calculated by the equation agreed with the real displacement to within a 1% margin of error. It was also confirmed that the LFD in the system could measure a liquid film of 0.25 {mu}m at the thinnest. We made simultaneous measurements of the interface in fluorocarbon tubes of 0.5 mm and 1 mm I.D. using the LFD and a high-speed video camera with a microscope. These showed that the LFD could measure the interface of a liquid film with high spatial and temporal resolution during annular, slug, and piston flow regimes. The data also clarified the existence of a thin liquid film of less than 1 {mu}m in thickness in the slug and annular flow regimes. (orig.)

  4. Quantifying Multistate Cytoplasmic Molecular Diffusion in Bacterial Cells via Inverse Transform of Confined Displacement Distribution.

    Chen, Tai-Yen; Jung, Won; Santiago, Ace George; Yang, Feng; Krzemiński, Łukasz; Chen, Peng

    2015-11-12

    Single-molecule tracking (SMT) of fluorescently tagged cytoplasmic proteins can provide valuable information on the underlying biological processes in living cells via subsequent analysis of the displacement distributions; however, the confinement effect originated from the small size of a bacterial cell skews the protein's displacement distribution and complicates the quantification of the intrinsic diffusive behaviors. Using the inverse transformation method, we convert the skewed displacement distribution (for both 2D and 3D imaging conditions) back to that in free space for systems containing one or multiple (non)interconverting Brownian diffusion states, from which we can reliably extract the number of diffusion states as well as their intrinsic diffusion coefficients and respective fractional populations. We further demonstrate a successful application to experimental SMT data of a transcription factor in living E. coli cells. This work allows a direct quantitative connection between cytoplasmic SMT data with diffusion theory for analyzing molecular diffusive behavior in live bacteria.

  5. Emittance growth rates for displaced beams

    Anderson, O.A.

    1993-05-01

    Emittance growth rates have been previously analyzed for nonuniform beams in linear channels and for initially uniform mismatched beams in nonlinear channels. These studies were for centered beams. Additional emittance growth can arise in cases where the beam is initially displaced. The purpose of this study is to obtain growth rates for displaced beams. This work differs from studies involving random displacement of electrodes. Our analysis assumes instead that the focusing system is perfectly aligned but that the beam is initially displaced with respect to the equilibrium axis. If the focusing force is slightly nonlinear, we find a gradual transfer of the potential energy of beam displacement into kinetic energy associated with emittance growth. We present explicit results for the emittance growth distance as a function of the nonlinearity of the channel. These results will have practical importance for designers of accelerators and transport systems when setting realistic tolerances for initial beam alignment. These tolerances will depend on the nonlinearity and the length of the system

  6. Quantification of the vocal folds’ dynamic displacements

    Hernández-Montes, María del Socorro; Muñoz, Silvino; De La Torre, Manuel; Flores, Mauricio; Pérez, Carlos; Mendoza-Santoyo, Fernando

    2016-01-01

    Fast dynamic data acquisition techniques are required to investigate the motional behavior of the vocal folds (VFs) when they are subjected to a steady air-flow through the trachea. High-speed digital holographic interferometry (DHI) is a non-invasive full-field-of-view technique that has proved its usefulness to study rapid and non-repetitive object movements. Hence it is an ideal technique used here to measure VF displacements and vibration patterns at 2000 fps. Analyses from a set of 200 displacement images showed that VFs’ vibration cycles are established along their width (y) and length (x). Furthermore, the maximum deformation for the right and left VFs’ area may be quantified from these images, which in itself represents an important result in the characterization of this structure. At a controlled air pressure, VF displacements fall within the range ∼100–1740 nm, with a calculated precision and accuracy that yields a variation coefficient of 1.91%. High-speed acquisition of full-field images of VFs and their displacement quantification are on their own significant data in the study of their functional and physiological behavior since voice quality and production depend on how they vibrate, i.e. their displacement amplitude and frequency. Additionally, the use of high speed DHI avoids prolonged examinations and represents a significant scientific and technological alternative contribution in advancing the knowledge and working mechanisms of these tissues. (paper)

  7. High-displacement spiral piezoelectric actuators

    Mohammadi, F.; Kholkin, A. L.; Jadidian, B.; Safari, A.

    1999-10-01

    A high-displacement piezoelectric actuator, employing spiral geometry of a curved piezoelectric strip is described. The monolithic actuators are fabricated using a layered manufacturing technique, fused deposition of ceramics, which is capable of prototyping electroceramic components with complex shapes. The spiral actuators (2-3 cm in diameter) consisted of 4-5 turns of a lead zirconate titanate ceramic strip with an effective length up to 28 cm. The width was varied from 0.9 to 1.75 mm with a height of 3 mm. When driven by the electric field applied across the width of the spiral wall, the tip of the actuator was found to displace in both radial and tangential directions. The tangential displacement of the tip was about 210 μm under the field of 5 kV/cm. Both the displacement and resonant frequency of the spirals could be tailored by changing the effective length and wall width. The blocking force of the actuator in tangential direction was about 1 N under the field of 5 kV/cm. These properties are advantageous for high-displacement low-force applications where bimorph or monomorph actuators are currently employed.

  8. Quantification of the vocal folds’ dynamic displacements

    del Socorro Hernández-Montes, María; Muñoz, Silvino; De La Torre, Manuel; Flores, Mauricio; Pérez, Carlos; Mendoza-Santoyo, Fernando

    2016-05-01

    Fast dynamic data acquisition techniques are required to investigate the motional behavior of the vocal folds (VFs) when they are subjected to a steady air-flow through the trachea. High-speed digital holographic interferometry (DHI) is a non-invasive full-field-of-view technique that has proved its usefulness to study rapid and non-repetitive object movements. Hence it is an ideal technique used here to measure VF displacements and vibration patterns at 2000 fps. Analyses from a set of 200 displacement images showed that VFs’ vibration cycles are established along their width (y) and length (x). Furthermore, the maximum deformation for the right and left VFs’ area may be quantified from these images, which in itself represents an important result in the characterization of this structure. At a controlled air pressure, VF displacements fall within the range ~100-1740 nm, with a calculated precision and accuracy that yields a variation coefficient of 1.91%. High-speed acquisition of full-field images of VFs and their displacement quantification are on their own significant data in the study of their functional and physiological behavior since voice quality and production depend on how they vibrate, i.e. their displacement amplitude and frequency. Additionally, the use of high speed DHI avoids prolonged examinations and represents a significant scientific and technological alternative contribution in advancing the knowledge and working mechanisms of these tissues.

  9. Comparison of arsenic acid with phosphoric acid in the interaction with a water molecule and an alkali/alkaline-earth metal cation.

    Park, Sung Woo; Kim, Chang Woo; Lee, Ji Hyun; Shim, Giwoong; Kim, Kwang S

    2011-10-20

    Recently, Wolfe-Simon has discovered a bacterium which is able to survive using arsenic(V) rather than phosphorus(V) in its DNA. Thus it is important to investigate some important structural and chemical similarities and dissimilarities between phosphate and arsenate. We compared the monohydrated structures and the alkali/alkaline-earth metal (Na(+), K(+), Mg(2+) and Ca(2+)) complexes of the arsenic acid/anions with those of the phosphoric acid/anions [i.e., H(m)PO(4)(-(3-m)) vs H(m)AsO(4)(-(3-m)) (m = 1-3)]. We carried out geometry optimization along with harmonic frequency calculations using ab initio calculations. Despite the increased van der Waals radius of As, the hydrated structures of both P and As systems show very close similarity (within 0.25 Å in the P/As···O(water) distance and within a few kJ/mol in binding energy) because of the increased induction energies by more polar arsenic acid/anons and slightly increased dispersion energy by a larger size of the As atom. In the metal complexes, the arsenic acid has a slightly larger binding distance (by 0.07-1.0 Å) and weaker binding energy because the As(V) ion has a slightly larger radius than the P(V) ion, and the electrostatic interaction is the dominating feature in these systems.

  10. Anisotropic and sub-diffusive water motion at the surface of DNA and of an anionic micelle CsPFO

    Pal, Subrata; Maiti, Prabal K; Bagchi, Biman

    2005-01-01

    We use long atomistic molecular dynamics simulations to address certain fundamental issues regarding water dynamics in the hydration layer of a 38 base long (GCCGCGAGGTGTCAGGGATTGCAGCCAGCATCTCGTCG) negatively charged hydrated DNA duplex. The rotational time correlation function of surface water dipoles is found to be markedly non-exponential, with a slow component at long time, whose magnitude depends on the initial (t = 0) residence of the water in the major or minor groove of the DNA. The surface water molecules are also found to exhibit anisotropic diffusion in both the major and minor grooves: diffusion in the direction parallel to the DNA surface exhibits a crossover from higher to lower than that in the direction normal to the surface at short-to-intermediate times. In the same time window, translational motion of water molecules in the minor groove is sub-diffusive, with mean square displacement (MSD) growing as t α with α ∼ 0.43. In general, water molecules in the major group exhibit faster dynamics than those in the minor groove, in agreement with earlier results (Bonvin et al 1998 J. Mol. Biol. 282 859-73). We compare these results with dynamics of water molecules at the surface of an anionic micelle, cesium perfluorooctanoate (CsPFO). Water molecules on the surface of CsPFO also exhibit slow translation and non-exponential orientational dynamics

  11. Dynamics of Activated Molecules

    Mullin, Amy S. [Univ. of Maryland, College Park, MD (United States)

    2016-11-16

    Experimental studies have been performed to investigate the collisional energy transfer processes of gas-phase molecules that contain large amounts of internal energy. Such molecules are prototypes for molecules under high temperature conditions relevant in combustion and information about their energy transfer mechanisms is needed for a detailed understanding and modeling of the chemistry. We use high resolution transient IR absorption spectroscopy to measure the full, nascent product distributions for collisions of small bath molecules that relax highly vibrationally excited pyrazine molecules with E=38000 cm-1 of vibrational energy. To perform these studies, we developed new instrumentation based on modern IR light sources to expand our experimental capabilities to investigate new molecules as collision partners. This final report describes our research in four areas: the characterization of a new transient absorption spectrometer and the results of state-resolved collision studies of pyrazine(E) with HCl, methane and ammonia. Through this research we have gained fundamental new insights into the microscopic details of relatively large complex molecules at high energy as they undergo quenching collisions and redistribute their energy.

  12. Sugar Blowing-Induced Porous Cobalt Phosphide/Nitrogen-Doped Carbon Nanostructures with Enhanced Electrochemical Oxidation Performance toward Water and Other Small Molecules

    Zhu, Chengzhou [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA; Fu, Shaofang [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA; Xu, Bo Z. [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA; Song, Junhua [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA; Shi, Qiurong [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA; Engelhard, Mark H. [Environmental Molecular Science Laboratory, Pacific Northwest National Laboratory, Richland WA 99352 USA; Li, Xiaolin [Energy and Environmental Directory, Pacific Northwest National Laboratory, Richland WA 99352 USA; Beckman, Scott P. [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA; Sun, Junming [The Gene and Linda Voiland School of Chemical Engineering and Bioengineering, Washington State University, Pullman WA 99164 USA; Du, Dan [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA; Lin, Yuehe [School of Mechanical and Materials Engineering, Washington State University, Pullman WA 99164 USA

    2017-06-28

    Finely controlled synthesis of high active and robust nonprecious metal catalysts with excellent catalytic efficiency in oxygen evolution reaction (OER) is extremely vital for making the water splitting process more energy-efficient and economical. Among these noble metal-free catalysts, transition-metal-based nanomaterials are considered as one of the most promising OER catalysts due to their relatively low-cost intrinsic activities, high abundance and diversity in terms of structure and morphology. In this work, we reported a facile sugar-blowing technique and low-temperature phosphorization to generate 3D self-supported metal involved carbon nanostructures, which termed as Co2P@Co/nitrogen-doped carbon (Co2P@Co/N-C). By capitalizing on the 3D porous nanostructures with high surface area, generously dispersed active sites, the intimate interaction between active sites and 3D N-doped carbon, the resultant Co2P@Co/N-C exhibited satisfying OER performance superior to CoO@Co/N-C, delivering 10 mA cm-2 at overpotential of 0.32 V. It is noting that in contrast to the substantial current density loss of RuO2, Co2P@Co/N-C showed much enhanced catalytic activity during the stability test and the 1.8-fold increase in current density was observed after stability test. Furthermore, the obtained Co2P@Co/N-C can also be served as an excellent nonprecious metal catalyst for methanol and glucose electrooxidation in alkaline media, further extending their potential applications.

  13. Dissociation in small molecules

    Dehmer, P.M.

    1982-01-01

    The study of molecular dissociation processes is one of the most interesting areas of modern spectroscopy owing to the challenges presented bt even the simplest of diatomic molecules. This paper reviews the commonly used descriptions of molecular dissociation processes for diatomic molecules, the selection rules for predissociation, and a few of the principles to be remembered when one is forced to speculate about dissociation mechanisms in a new molecule. Some of these points will be illustrated by the example of dissociative ionization in O 2

  14. Structure formation in bis(terpyridine) derivative adlayers: molecule-substrate versus molecule-molecule interactions.

    Hoster, Harry E; Roos, Matthias; Breitruck, Achim; Meier, Christoph; Tonigold, Katrin; Waldmann, Thomas; Ziener, Ulrich; Landfester, Katharina; Behm, R Jürgen

    2007-11-06

    The influence of the substrate and the deposition conditions-vapor deposition versus deposition from solution-on the structures formed upon self-assembly of deposited bis(terpyridine) derivative (2,4'-BTP) monolayers on different hexagonal substrates, including highly oriented pyrolytic graphite (HOPG), Au(111), and (111)-oriented Ag thin films, was investigated by high-resolution scanning tunneling microscopy and by model calculations of the intermolecular energies and the lateral corrugation of the substrate-adsorbate interaction. Similar quasi-quadratic network structures with almost the same lattice constants obtained on all substrates are essentially identical to the optimum configuration expected from an optimization of the adlayer structure with C-H...N-type bridging bonds as a structure-determining factor, which underlines a key role of the intermolecular interactions in adlayer order. Slight distortions from the optimum values to form commensurate adlayer structures on the metal substrates and the preferential orientation of the adlayer with respect to the substrate are attributed to the substrate-adsorbate interactions, specifically, the lateral corrugation in the substrate-adsorbate interaction upon lateral displacement and rotation of the adsorbed BTP molecules. The fact that similar adlayer structures are obtained on HOPG under ultrahigh vacuum conditions (solid|gas interface) and on HOPG in trichlorobenzene (solid|liquid interface) indicates that the intermolecular interactions are not severely affected by the solvent.

  15. Determination of the displacement cross-section in C-60 fullerene exposed to the gamma rays

    Leyva, A.; Pinnera, I.; Leyva, D.; Cruz, C.; Abreu, Y.

    2011-01-01

    Using the threshold energy values reported in literature for spherical fullerene C-60 molecules and taking into account the McKinley-Feshbach approach, the effective atomic displacement cross-section in C-60 nanostructures exposed to the gamma rays was estimated. The Kinchin-Pease approximation for the damage function was also considered. These calculations were performed using MCCM code system developed by the authors for the study of gamma radiation damage in solid materials. (Author)

  16. Overtreatment of displaced midshaft clavicle fractures

    Ban, Ilija; Nowak, Jan; Virtanen, Kaisa

    2016-01-01

    Background and purpose - The best treatment for displaced clavicle fractures has been debated for decades. Operative treatment has become more common. However, several randomized trials comparing non-operative and operative treatment have not shown any compelling evidence in favor of surgery. We...... identified the preferred treatment of displaced midshaft clavicle fractures at public hospitals in 3 countries in Scandinavia. Patients and methods - A purpose-made multiple-choice questionnaire in English was sent to all public hospitals in Denmark, Sweden, and Finland. This was addressed to the orthopedic...... surgeon responsible for treatment of clavicle fractures, and completed questionnaires were obtained from 85 of 118 hospitals. Results - In the 3 countries, 69 of the 85 hospitals that responded would treat displaced clavicle fractures operatively. Clear criteria for treatment allocation were used at 58...

  17. Forced displacement and women's security in Colombia.

    Meertens, Donny

    2010-04-01

    In the protracted Colombian conflict, assistance to internally displaced persons has developed in the context of contradictory political processes. The Colombian government's launching of a transitional justice process in the midst of armed conflict has generated a complex situation displaying both conflict and post-conflict characteristics. The progressive Constitutional Court rulings on internal displacement, in particular the gender-sensitive Auto 092, constitute an attempt to bring together humanitarian interventions and transitional justice measures in a rights-based framework. However, the national government is reluctant to adopt them fully and local realities still hamper their integrated implementation. Displaced women, therefore, remain in an especially vulnerable position. This paper argues that gender-sensitive humanitarian interventions must take into account all of these complexities of scale and political process in order to make legal frameworks more effective at the local level. In these contexts, interventions should pay particular attention to strategies that contribute to transforming pre-existing gender regimes.

  18. [Management of disk displacement with condylar fracture].

    Yu, Shi-bin; Li, Zu-bing; Yang, Xue-wen; Zhao, Ji-hong; Dong, Yao-jun

    2003-07-01

    To investigate clinical features of disk displacement during the course of condylar fracture and to explore the techniques of disk reposition and suturation. 32 patients (10 females and 22 males) who had disk displacements with condylar fractures were followed up. Reduction and reposition of the dislocated disks simultaneously with fixation of fractures were performed. 7 patients underwent intermaxillary fixation with elastic bands for 1 to 2 weeks. The occlusions were satisfactory in all cases but one for the reason of ramus height loss. No TMJ symptom was found when examined 3 months post operation. Anterior disk displacements were most occurred with high condylar process fractures. Surgical reposition and suturation of disk play an important role for the later TMJ-function.

  19. DNA fork displacement rates in human cells

    Kapp, L.N.; Painter, R.B.

    1981-01-01

    DNA fork displacement rates were measured in 20 human cell lines by a bromodeoxyuridine-313 nm photolysis technique. Cell lines included representatives of normal diploid, Fanconi's anemia, ataxia telangiectasia, xeroderma pigmentosum, trisomy-21 and several transformed lines. The average value for all the cell lines was 0.53 +- 0.08 μm/min. The average value for individual cell lines, however, displayed a 30% variation. Less than 10% of variation in the fork displacement rate appears to be due to the experimental technique; the remainder is probably due to true variation among the cell types and to culture conditions. (Auth.)

  20. DNA fork displacement rates in human cells

    Kapp, L.N.; Painter, R.B. (California Univ., San Francisco (USA). Lab. of Radiobiology)

    1981-11-27

    DNA fork displacement rates were measured in 20 human cell lines by a bromodeoxyuridine-313 nm photolysis technique. Cell lines included representatives of normal diploid, Fanconi's anemia, ataxia telangiectasia, xeroderma pigmentosum, trisomy-21 and several transformed lines. The average value for all the cell lines was 0.53 +- 0.08 ..mu..m/min. The average value for individual cell lines, however, displayed a 30% variation. Less than 10% of variation in the fork displacement rate appears to be due to the experimental technique; the remainder is probably due to true variation among the cell types and to culture conditions.

  1. Bucket Foundation Response Under Various Displacement Rates

    Vaitkunaite, Evelina; Nielsen, Benjaminn Nordahl; Ibsen, Lars Bo

    2016-01-01

    in a multi-bucket foundation system. The foundation model is at a scale of approximately 1:20 prototype foundation size. The tests are performed in a pressure tank with the foundation model installed in dense sand. Based on the data, the conclusion is that the bucket foundation design in a storm case should......The present testing program aims at showing the pore pressure response around a bucket foundation skirt as well as the load and displacement change due to ten different displacement rates. Research findings are useful for a numerical model calibration focusing on the design of the upwind foundation...

  2. Constant displacement rate testing at elevated temperatures

    Pepe, J.J.; Gonyea, D.C.

    1989-01-01

    A short time test has been developed which is capable of determining the long time notch sensitivity tendencies of CrMoV rotor forging materials. This test is based on Constant Displacement Rate (CDR) testing of a specific notch bar specimen at 1200 0 F at 2 mils/in/hour displacement rate. These data were correlated to conventional smooth and notch bar rupture behavior for a series of CrMoV materials with varying long time ductility tendencies. The purpose of this paper is to describe the details of this new test procedure and some of the relevant mechanics of material information generated during its development

  3. Passive Smoking in a Displacement Ventilated Room

    Bjørn, Erik; Nielsen, Peter V.

    The aim of this research is to see if the displacement ventilation principle can protect a person from exposure to passive tobacco smoking. This is done by full-scale experiments with two breathing thermal manikins, smoke visualisations, and tracer gas measurements. In some situations, exhaled...... smoke will stratify in a certain height due to the vertical temperature gradient. This horizontal layer of exhaled tobacco smoke may lead to exposure. In other situations, the smoke is mixed into the upper zone, and the passive smoker is protected to some extent by the displacement principle...

  4. Performance of displacement ventilation in practice

    Naidenov, K.; Pitchurov, G.; Langkilde, Gunnar

    2002-01-01

    This paper presents results of a field study in offices with displacement ventilation. It comprises detailed physical measurements of the thermal environment and collection of occupants´ response at 227 workplaces. The results, both physical measurements and human response, identified draught...... as the major local discomfort in the rooms with displacement ventilation. Twenty-three percent of the occupants were daily bothered by draught. In some buildings the maintenance personnel tried to improve occupants´ thermal comfort by raising the supply air temperature or office workers themselves blocked...

  5. Single molecules and nanotechnology

    Vogel, Horst

    2007-01-01

    This book focuses on recent advances in the rapidly evolving field of single molecule research. These advances are of importance for the investigation of biopolymers and cellular biochemical reactions, and are essential to the development of quantitative biology. Written by leading experts in the field, the articles cover a broad range of topics, including: quantum photonics of organic dyes and inorganic nanoparticles their use in detecting properties of single molecules the monitoring of single molecule (enzymatic) reactions single protein (un)folding in nanometer-sized confined volumes the dynamics of molecular interactions in biological cells The book is written for advanced students and scientists who wish to survey the concepts, techniques and results of single molecule research and assess them for their own scientific activities.

  6. Electron-molecule collisions

    Takayanagi, Kazuo

    1984-01-01

    Scattering phenomena play an important role in modern physics. Many significant discoveries have been made through collision experiments. Amongst diverse kinds of collision systems, this book sheds light on the collision of an electron with a molecule. The electron-molecule collision provides a basic scattering problem. It is scattering by a nonspherical, multicentered composite particle with its centers having degrees of freedom of motion. The molecule can even disintegrate, Le., dissociate or ionize into fragments, some or all of which may also be molecules. Although it is a difficult problem, the recent theoretical, experimental, and computational progress has been so significant as to warrant publication of a book that specializes in this field. The progress owes partly to technical develop­ ments in measurements and computations. No less important has been the great and continuing stimulus from such fields of application as astrophysics, the physics of the earth's upper atmosphere, laser physics, radiat...

  7. Molecules to Materials

    evolved as a new line of thinking wherein a single molecule or perhaps a collection .... In photonic communication processes, laser light has to be modulated and .... The author wishes to thank G Rajaram for a critical reading of the manuscript.

  8. Single-Molecule Spectroscopy

    IAS Admin

    overall absorption spectrum of a molecule is a superposition of many such sharp lines .... dilute solution of the enzyme and the substrate over few drops of silicone oil placed ..... Near-field Scanning Optical Microscopy (NSOM): Development.

  9. Quantum dot molecules

    Wu, Jiang

    2014-01-01

    This book reviews recent advances in the exciting and rapidly growing field of quantum dot molecules (QDMs). It offers state-of-the-art coverage of novel techniques and connects fundamental physical properties with device design.

  10. Molecule of the Month

    Molecule of the Month - Adamantane - A Plastic Piece of Diamond. J Chandrasekhar. Volume 16 Issue 12 ... Keywords. Adamantane; diamondoid systems; plastic crystals. ... Resonance – Journal of Science Education | News. © 2017 Indian ...

  11. Efficiency of a variable displacement open circuit floating cup pump

    Vael, G.E.M.; Achten, P.A.J.; Brink, van den T.L.

    2009-01-01

    The Floating Cup Displacement principle is a relatively new axial piston displacement principle for hydrostatic pumps, motors and transformers. Since its origin in 2001, it has been mainly applied in fixed displacement pump prototypes. At the SICFP’05, a design for a variable displacement open

  12. Rotational melting in displacive quantum paraelectrics

    Martonak, R.; Tosatti, E.

    1994-06-01

    Displacive quantum paraelectrics are discussed as possible realizations of rotational quantum melting. The phenomenology of SrTiO 3 and KTaO 3 is discussed in this light. Both old and fresh theoretical work on two-dimensional lattice models for quantum paraelectricity is reviewed. (author). 73 refs, 15 figs

  13. Page | 187 DISPLACEMENT AND ENVIRONMENTAL PROTECTION

    Fr. Ikenga

    development remain one of the greatest concerns of human beings globally.4. This urbanization which most often result in conflicts, ethnic violence, communal rife and clashes, and incessant tussle for natural and artificial resources, has also contributed to the displacement of persons. * By Obinna MBANUGO, LLM, BL, ...

  14. Earthquake source model using strong motion displacement

    The strong motion displacement records available during an earthquake can be treated as the response of the earth as the a structural system to unknown forces acting at unknown locations. Thus, if the part of the earth participating in ground motion is modelled as a known finite elastic medium, one can attempt to model the ...

  15. Public policy to address displacement in Mexico

    José Ramón Cossío Díaz

    2014-11-01

    Full Text Available At hearings of the Inter-American Commission on Human Rights in November 2013 on the human rights situation in Mexico, the issue of the internally displaced in particular caught my attention, both due to its current serious level and for its potential impact in the not too distant future.

  16. Insect Wing Displacement Measurement Using Digital Holography

    Aguayo, Daniel D.; Mendoza Santoyo, Fernando; Torre I, Manuel H. de la; Caloca Mendez, Cristian I.

    2008-01-01

    Insects in flight have been studied with optical non destructive techniques with the purpose of using meaningful results in aerodynamics. With the availability of high resolution and large dynamic range CCD sensors the so called interferometric digital holographic technique was used to measure the surface displacement of in flight insect wings, such as butterflies. The wings were illuminated with a continuous wave Verdi laser at 532 nm, and observed with a CCD Pixelfly camera that acquire images at a rate of 11.5 frames per second at a resolution of 1392x1024 pixels and 12 Bit dynamic range. At this frame rate digital holograms of the wings were captured and processed in the usual manner, namely, each individual hologram is Fourier processed in order to find the amplitude and phase corresponding to the digital hologram. The wings displacement is obtained when subtraction between two digital holograms is performed for two different wings position, a feature applied to all consecutive frames recorded. The result of subtracting is seen as a wrapped phase fringe pattern directly related to the wing displacement. The experimental data for different butterfly flying conditions and exposure times are shown as wire mesh plots in a movie of the wings displacement

  17. Microbial adhesion in flow displacement systems

    Busscher, HJ; van der Mei, HC

    Flow displacement systems are superior to many other (static) systems for studying microbial adhesion to surfaces because mass transport and prevailing shear conditions can be adequately controlled and notoriously ill-defined slight rinsing steps to remove so-called "loosely adhering organisms" can

  18. Heterodyne displacement interferometer, insensitive for input polarization

    Meskers, A.J.H.; Spronck, J.W.; Munnig Schmidt, R.H.

    2014-01-01

    Periodic nonlinearity (PNL) in displacement interferometers is a systematic error source that limits measurement accuracy. The PNL of coaxial heterodyne interferometers is highly influenced by the polarization state and orientation of the source frequencies. In this Letter, we investigate this error

  19. Isolated Displaced Fracture of the Lesser Tuberosity

    publication of this report. The authors declare no competing interests. Discussion. A delay in diagnosis of a lesser tuberosity fracture may lead to significant future clinical disability (2). In one such case the patient presented with axillary nerve neuropraxia while another case reported displacement of the biceps tendon (4).

  20. Comb-drive actuators for large displacements

    Legtenberg, Rob; Legtenberg, R.; Groeneveld, A.W.; Elwenspoek, Michael Curt

    The design, fabrication and experimental results of lateral-comb-drive actuators for large displacements at low driving voltages is presented. A comparison of several suspension designs is given, and the lateral large deflection behaviour of clamped-clamped beams and a folded flexure design is

  1. Fiber-optic couplers as displacement sensors

    Baruch, Martin C.; Gerdt, David W.; Adkins, Charles M.

    2003-04-01

    We introduce the novel concept of using a fiber-optic coupler as a versatile displacement sensor. Comparatively long fiber-optic couplers, with a coupling region of approximately 10 mm, are manufactured using standard communication SM fiber and placed in a looped-back configuration. The result is a displacement sensor, which is robust and highly sensitive over a wide dynamic range. This displacement sensor resolves 1-2 μm over distances of 1-1.5 mm and is characterized by the essential absence of a 'spring constant' plaguing other strain gauge-type sensors. Consequently, it is possible to couple to extremely weak vibrations, such as the skin displacement affected by arterial heart beat pulsations. Used as a wrist-worn heartbeat monitor, the fidelity of the arterial pulse signal has been shown to be so high that it is possible to not only determine heartbeat and breathing rates, but to implement a new single-point blood pressure measurement scheme which does not squeeze the arm. In an application as a floor vibration sensor for the non-intrusive monitoring of independently living elderly, the sensor has been shown to resolve the distinct vibration spectra of different persons and different events.

  2. Displacing Media: LCD LAB Artistic Residency

    Filipe Pais

    2012-12-01

    Full Text Available This review refers to an artistic residency which took place at LCD LAB -  CAAA at Guimarães, in March, exploring a strategy for media art called Media Displacement. The text introduces the strategy very briefly and describes the residency's organization, structure, processses and the results produced.

  3. Measuring displacement signal with an accelerometer

    Han, Sang Bo

    2010-01-01

    An effective and simple way to reconstruct displacement signal from a measured acceleration signal is proposed in this paper. To reconstruct displacement signal by means of double-integrating the time domain acceleration signal, the Nyquist frequency of the digital sampling of the acceleration signal should be much higher than the highest frequency component of the signal. On the other hand, to reconstruct displacement signal by taking the inverse Fourier transform, the magnitude of the significant frequency components of the Fourier transform of the acceleration signal should be greater than the 6 dB increment line along the frequency axis. With a predetermined resolution in time and frequency domain, determined by the sampling rate to measure and record the original signal, reconstructing high-frequency signals in the time domain and reconstructing low-frequency signals in the frequency domain will produce biased errors. Furthermore, because of the DC components inevitably included in the sampling process, low-frequency components of the signals are overestimated when displacement signals are reconstructed from the Fourier transform of the acceleration signal. The proposed method utilizes curve-fitting around the significant frequency components of the Fourier transform of the acceleration signal before it is inverse-Fourier transformed. Curve-fitting around the dominant frequency components provides much better results than simply ignoring the insignificant frequency components of the signal

  4. The use of a displacement device negatively affects the performance of dogs (Canis familiaris) in visible object displacement tasks.

    Müller, Corsin A; Riemer, Stefanie; Range, Friederike; Huber, Ludwig

    2014-08-01

    Visible and invisible displacement tasks have been used widely for comparative studies of animals' understanding of object permanence, with evidence accumulating that some species can solve invisible displacement tasks and, thus, reach Piagetian stage 6 of object permanence. In contrast, dogs appear to rely on associative cues, such as the location of the displacement device, during invisible displacement tasks. It remains unclear, however, whether dogs, and other species that failed in invisible displacement tasks, do so because of their inability to form a mental representation of the target object, or simply because of the involvement of a more salient but potentially misleading associative cue, the displacement device. Here we show that the use of a displacement device impairs the performance of dogs also in visible displacement tasks: their search accuracy was significantly lower when a visible displacement was performed with a displacement device, and only two of initially 42 dogs passed the sham-baiting control conditions. The negative influence of the displacement device in visible displacement tasks may be explained by strong associative cues overriding explicit information about the target object's location, reminiscent of an overshadowing effect, and/or object individuation errors as the target object is placed within the displacement device and moves along a spatiotemporally identical trajectory. Our data suggest that a comprehensive appraisal of a species' performance in object permanence tasks should include visible displacement tasks with the same displacement device used in invisible displacements, which typically has not been done in the past.

  5. Free and binary rotation of polyatomic molecules

    Konyukhov, V K

    2003-01-01

    A modification of the quantum-mechanical theory of rotation of polyatomic molecules (binary rotation) is proposed, which is based on the algebra and representations of the SO(4) group and allows the introduction of the concept of parity, as in atomic spectroscopy. It is shown that, if an asymmetric top molecule performing binary rotation finds itself in a spatially inhomogeneous electric field, its rotational levels acquire the additional energy due to the quadrupole moment. The existence of the rotational states of polyatomic molecules that cannot transfer to the free rotation state is predicted. In particular, the spin isomers of a water molecule, which corresponds to such states, can have different absolute values of the adsorption energy due to the quadrupole interaction of the molecule with a surface. The difference in the adsorption energies allows one to explain qualitatively the behaviour of the ortho- and para-molecules of water upon their adsorption on the surface of solids in accordance with experimental data. (laser applications and other topics in quantum electronics)

  6. Water

    ... drink and water in food (like fruits and vegetables). 6. Of all the earth’s water, how much is ocean or seas? 97 percent of the earth’s water is ocean or seas. 7. How much of the world’s water is frozen? Of all the water on earth, about 2 percent is frozen. 8. How much ...

  7. HTR-10GT AMBs displacement sensor design

    Shi Zhengang; Zha Meisheng; Zhao Lei; Sun Zhuo

    2005-01-01

    The 10 MW high temperature gas-cooled test module reactor (HTR-10GT) with the core made of spherical fuel elements was designed and constructed by the Institute of Nuclear and New Energy Technology of Tsinghua University in China. In the HTR-10GT, turbo-compressor and generator rotors are connected by a flexible coupling. The rotors, restricted by actual instruments and working environment, must be supported without any contact and lubrication. Active magnetic bearing (AMB), known as its advantages over the conventional bearings., such as contact-free, no-lubricating and active damping vibration, is the best way to suspend and stabilize the position of rotors of HTR-10GT. Each rotor is suspended by two radial and one axial AMBs. The radial AMB's radial gap is 0.15 mm considering the gap of 0.4 mm between the compressor stator and blades in order to protect the compressor. The control system controls the rotor position to meet the required gaps between rotor and stator through windings current. All the position information concerning radial and axial AMB is generated by sensors for measuring the displacement of the levitated body. Some typical sensors, i.e. eddy current displacement sensor, capacitive displacement sensor, can provide position information, but, quite often, unsatisfactory anti-jamming, which is a key issue for AMB systems near generator and other electric devices in HTR-10GT. Therefore, a kind of new type sensor is designed to measure the radial and axial displacements and the vibration of the rotors. This paper focuses on the design characteristics of the HTR-10GT AMBs displacement sensors and introduction of the related experiments to demonstrate its performance. (authors)

  8. Sequential water molecule binding enthalpies for aqueous nanodrops containing a mono-, di- or trivalent ion and between 20 and 500 water molecules† †Electronic supplementary information (ESI) available: Detailed description of the experimental and computational modeling methods. Isolation, BIRD and UVPD sequence for [Ru(NH3)6]3+·(H2O)169–171, nanoESI spectra for 2+ and 3+ ions. Detailed description of the isotope distribution simulation program. Comparison between experimental and simulated 1+, 2+ and 3+ ion isotope distributions. Wavelength dependence of the deduced sequential binding enthalpies. Comparison of experimental UVPD binding enthalpies to the liquid drop model at different temperatures. Complete list of binding enthalpies and average number of water molecules lost upon UVPD. See DOI: 10.1039/c6sc04957e Click here for additional data file.

    Heiles, Sven; Cooper, Richard J.; DiTucci, Matthew J.

    2017-01-01

    Sequential water molecule binding enthalpies, ΔH n,n–1, are important for a detailed understanding of competitive interactions between ions, water and solute molecules, and how these interactions affect physical properties of ion-containing nanodrops that are important in aerosol chemistry. Water molecule binding enthalpies have been measured for small clusters of many different ions, but these values for ion-containing nanodrops containing more than 20 water molecules are scarce. Here, ΔH n,n–1 values are deduced from high-precision ultraviolet photodissociation (UVPD) measurements as a function of ion identity, charge state and cluster size between 20–500 water molecules and for ions with +1, +2 and +3 charges. The ΔH n,n–1 values are obtained from the number of water molecules lost upon photoexcitation at a known wavelength, and modeling of the release of energy into the translational, rotational and vibrational motions of the products. The ΔH n,n–1 values range from 36.82 to 50.21 kJ mol–1. For clusters containing more than ∼250 water molecules, the binding enthalpies are between the bulk heat of vaporization (44.8 kJ mol–1) and the sublimation enthalpy of bulk ice (51.0 kJ mol–1). These values depend on ion charge state for clusters with fewer than 150 water molecules, but there is a negligible dependence at larger size. There is a minimum in the ΔH n,n–1 values that depends on the cluster size and ion charge state, which can be attributed to the competing effects of ion solvation and surface energy. The experimental ΔH n,n–1 values can be fit to the Thomson liquid drop model (TLDM) using bulk ice parameters. By optimizing the surface tension and temperature change of the logarithmic partial pressure for the TLDM, the experimental sequential water molecule binding enthalpies can be fit with an accuracy of ±3.3 kJ mol–1 over the entire range of cluster sizes. PMID:28451364

  9. Electron-molecule collisions

    Shimamura, I.; Takayanagi, K.

    1984-01-01

    The study of collision processes plays an important research role in modern physics. Many significant discoveries have been made by means of collision experiments. Based on theoretical, experimental, and computational studies, this volume presents an overview detailing the basic processes of electron-molecule collisions. The editors have collected papers-written by a group of international experts-that consider a diverse range of phenomena occurring in electronmolecule collisions. The volume discusses first the basic formulation for scattering problems and then gives an outline of the physics of electron-molecule collisions. The main topics covered are rotational transitions, vibrational transitions, dissociation of molecules in slow collisions, the electron-molecule collision as a spectroscopic tool for studying molecular electronic structures, and experimental and computational techniques for determining the cross sections. These well-referenced chapters are self-contained and can be read independently or consecutively. Authoritative and up-to-date, Electron-Molecule Collisions is a useful addition to the libraries of students and researchers in the fields of atomic, molecular, and chemical physics, and physical chemistry

  10. Theoretical aspects of electron transfer reactions of complex molecules

    Kuznetsov, A. M.; Ulstrup, Jens

    2001-01-01

    Features of electron transfer involving complex molecules are discussed. This notion presently refers to molecular reactants where charge transfer is accompanied by large molecular reorganization, and commonly used displaced harmonic oscillator models do not apply. It is shown that comprehensive...... theory of charge transfer in polar media offers convenient tools for the treatment of experimental data for such systems, with due account of large-amplitude strongly anharmonic intramolecular reorganization. Equations for the activation barrier and free energy relationships are provided, incorporating...

  11. Study on distribution of reservoir endogenous microbe and oil displacement mechanism

    Ming Yue

    2017-02-01

    Full Text Available In order to research oil displacement mechanism by indigenous microbial communities under reservoir conditions, indigenous microbial flooding experiments using the endogenous mixed bacterium from Shengli Oilfield were carried out. Through microscopic simulation visual model, observation and analysis of distribution and flow of the remaining oil in the process of water flooding and microbial oil displacement were conducted under high temperature and high pressure conditions. Research has shown that compared with atmospheric conditions, the growth of the microorganism metabolism and attenuation is slowly under high pressure conditions, and the existence of the porous medium for microbial provides good adhesion, also makes its growth cycle extension. The microbial activities can effectively launch all kinds of residual oil, and can together with metabolites, enter the blind holes off which water flooding, polymer flooding and gas flooding can’t sweep, then swap out remaining oil, increase liquidity of the crude oil and remarkably improve oil displacement effect.

  12. GRAVI-2 space experiment: investigating statoliths displacement and location effects on early stages of gravity perception pathways in lentil roots.

    Bizet, François; Eche, Brigitte; Pereda Loth, Veronica; Badel, Eric; Legue, Valerie; Brunel, Nicole; Label, Philippe; Gérard, Joëlle

    2016-07-01

    The plants ability to orient their growth with respect to external stimuli such as gravity is a key factor for survival and acclimation to their environment. Belowground, plant roots modulate their growth towards gravity, allowing soil exploration and uptake of water and nutrients. In roots, gravity sensing cells called statocytes are located in the center of the root cap. Statocytes contain starch-filled plastids denser than the cytoplasm, which sedimentation along the direction of gravity is widely accepted as being involved into early stages of gravity perception (the starch-statolith hypothesis; Sack, 1991). Root gravitropism following statoliths displacement is based on auxin redistribution in the root apex, inducing differential growth between the root upward and downward sides. However at the cell scale, the chain of transduction starting from statoliths displacement and leading to auxin redistribution remains poorly documented. Signaling molecules such as calcium, reactive oxygen species, nitric oxide and inositol 1,4,5-triphosphate are serious candidates previously shown to be involved within minutes before modification of the expression of auxin-related genes (Morita, 2010; Sato et al., 2015). Here, we observe and quantify statoliths displacements and locations at various levels of gravity to investigate two hypothesis: (i) Are contacts between statoliths and the endoplasmic reticulum necessary to induce gravitropism? (ii) Are very low displacements of statoliths sufficient to initiate transduction pathways such as the calcium's one? These questionings have led to an experiment called GRAVI-2 which took place aboard the ISS in 2014. During the experiment, lentil roots were grown in the European modular cultivation system for several hours in microgravity and were then submitted to short high gravity stimulus (5 and 15 minutes at 2 g) before the return to Earth for analyses. Ongoing cytological measurements will reveal the effects of statoliths

  13. The changes of macroscopic features and microscopic structures of water under influence of magnetic field

    Pang Xiaofeng; Deng Bo

    2008-01-01

    Influences of magnetic field on microscopic structures and macroscopic properties of water are studied by the spectrum techniques of infrared, Raman, visible, ultraviolet lights and X-ray. From these investigations, we know that the magnetic fields change the distribution of molecules and electrons, cause displacements and polarization of molecules and atoms, result in changes of dipole-moment transition and vibrational states of molecules and variation of transition probability of electrons, but does not alter the constitution of molecules and atoms. These are helpful in seeking the mechanism of magnetization of water. Meanwhile, we also measure the changed rules of the surface tension force, soaking effect or angle of contact, viscosity, rheology features, refraction index, dielectric constant and electric conductivity of magnetized water relative to that of pure water. The results show that the magnetic fields increase the soaking degree and hydrophobicity of water to materials, depress its surface-tension force, diminish the viscosity of war, enhance the feature of plastic flowing of water, and increase the refraction index, dielectric constant and electric conductivity of water after magnetization. These changes are caused by the above changes of microscopic structures under the action of magnetic field. Therefore, our studies are significant in science and has practical value of applications

  14. MOLECULES IN η CARINAE

    Loinard, Laurent; Menten, Karl M.; Güsten, Rolf; Zapata, Luis A.; Rodríguez, Luis F.

    2012-01-01

    We report the detection toward η Carinae of six new molecules, CO, CN, HCO + , HCN, HNC, and N 2 H + , and of two of their less abundant isotopic counterparts, 13 CO and H 13 CN. The line profiles are moderately broad (∼100 km s –1 ), indicating that the emission originates in the dense, possibly clumpy, central arcsecond of the Homunculus Nebula. Contrary to previous claims, CO and HCO + do not appear to be underabundant in η Carinae. On the other hand, molecules containing nitrogen or the 13 C isotope of carbon are overabundant by about one order of magnitude. This demonstrates that, together with the dust responsible for the dimming of η Carinae following the Great Eruption, the molecules detected here must have formed in situ out of CNO-processed stellar material.

  15. Water

    Chovanec, A.; Grath, J.; Kralik, M.; Vogel, W.

    2002-01-01

    An up-date overview of the situation of the Austrian waters is given by analyzing the status of the water quality (groundwater, surface waters) and water protection measures. Maps containing information of nitrate and atrazine in groundwaters (analyses at monitoring stations), nitrate contents and biological water quality of running waters are included. Finally, pollutants (nitrate, orthophosphate, ammonium, nitrite, atrazine etc.) trends in annual mean values and median values for the whole country for the years 1992-1999 are presented in tables. Figs. 5. (nevyjel)

  16. A web-based GPS system for displacement monitoring and failure mechanism analysis of reservoir landslide.

    Li, Yuanyao; Huang, Jinsong; Jiang, Shui-Hua; Huang, Faming; Chang, Zhilu

    2017-12-07

    It is important to monitor the displacement time series and to explore the failure mechanism of reservoir landslide for early warning. Traditionally, it is a challenge to monitor the landslide displacements real-timely and automatically. Globe Position System (GPS) is considered as the best real-time monitoring technology, however, the accuracies of the landslide displacements monitored by GPS are not assessed effectively. A web-based GPS system is developed to monitor the landslide displacements real-timely and automatically in this study. And the discrete wavelet transform (DWT) is proposed to assess the accuracy of the GPS monitoring displacements. Wangmiao landslide in Three Gorges Reservoir area in China is used as case study. The results show that the web-based GPS system has advantages of high precision, real-time, remote control and automation for landslide monitoring; the Root Mean Square Errors of the monitoring landslide displacements are less than 5 mm. Meanwhile, the results also show that a rapidly falling reservoir water level can trigger the reactivation of Wangmiao landslide. Heavy rainfall is also an important factor, but not a crucial component.

  17. Electron Accumulative Molecules.

    Buades, Ana B; Sanchez Arderiu, Víctor; Olid-Britos, David; Viñas, Clara; Sillanpää, Reijo; Haukka, Matti; Fontrodona, Xavier; Paradinas, Markos; Ocal, Carmen; Teixidor, Francesc

    2018-02-28

    With the goal to produce molecules with high electron accepting capacity and low reorganization energy upon gaining one or more electrons, a synthesis procedure leading to the formation of a B-N(aromatic) bond in a cluster has been developed. The research was focused on the development of a molecular structure able to accept and release a specific number of electrons without decomposing or change in its structural arrangement. The synthetic procedure consists of a parallel decomposition reaction to generate a reactive electrophile and a synthesis reaction to generate the B-N(aromatic) bond. This procedure has paved the way to produce the metallacarboranylviologen [M(C 2 B 9 H 11 )(C 2 B 9 H 10 )-NC 5 H 4 -C 5 H 4 N-M'(C 2 B 9 H 11 )(C 2 B 9 H 10 )] (M = M' = Co, Fe and M = Co and M' = Fe) and semi(metallacarboranyl)viologen [3,3'-M(8-(NC 5 H 4 -C 5 H 4 N-1,2-C 2 B 9 H 10 )(1',2'-C 2 B 9 H 11 )] (M = Co, Fe) electron cumulative molecules. These molecules are able to accept up to five electrons and to donate one in single electron steps at accessible potentials and in a reversible way. By targeted synthesis and corresponding electrochemical tests each electron transfer (ET) step has been assigned to specific fragments of the molecules. The molecules have been carefully characterized, and the electronic communication between both metal centers (when this situation applies) has been definitely observed through the coplanarity of both pyridine fragments. The structural characteristics of these molecules imply a low reorganization energy that is a necessary requirement for low energy ET processes. This makes them electronically comparable to fullerenes, but on their side, they have a wide range of possible solvents. The ET from one molecule to another has been clearly demonstrated as well as their self-organizing capacity. We consider that these molecules, thanks to their easy synthesis, ET, self-organizing capacity, wide range of solubility, and easy processability, can

  18. Attosecond electron dynamics in molecules and liquids

    WöRner, Hans Jakob

    The ultrafast motion of electrons and holes following light-matter interaction is fundamental to a broad range of chemical and biophysical processes. In this lecture, I will discuss some of our recent experiments that measure the atomic-scale motion of charge with attosecond temporal resolution (1 as = 10-18s). The first experiment is carried out on isolated, spatially oriented molecules in the gas phase. Using high-harmonic spectroscopy, we resolve the migration of an electron hole across the molecule with a resolution of 100 as and simultaneously demonstrate extensive control over charge migration. In the second class of experiments, we use an attosecond pulse train synchronized with a near-infrared laser pulse to temporally resolve the process of photoemission from molecules in the gas phase and from a liquid-water microjet, resolving electron transport through liquid water on the attosecond time scale.

  19. Conflict, displacement and health in the Middle East.

    Mowafi, Hani

    2011-01-01

    Displacement is a hallmark of modern humanitarian emergencies. Displacement itself is a traumatic event that can result in illness or death. Survivors face challenges including lack of adequate shelter, decreased access to health services, food insecurity, loss of livelihoods, social marginalisation as well as economic and sexual exploitation. Displacement takes many forms in the Middle East and the Arab World. Historical conflicts have resulted in long-term displacement of Palestinians. Internal conflicts have driven millions of Somalis and Sudanese from their homes. Iraqis have been displaced throughout the region by invasion and civil strife. In addition, large numbers of migrants transit Middle Eastern countries or live there illegally and suffer similar conditions as forcibly displaced people. Displacement in the Middle East is an urban phenomenon. Many displaced people live hidden among host country populations in poor urban neighbourhoods - often without legal status. This represents a challenge for groups attempting to access displaced populations. Furthermore, health information systems in host countries often do not collect data on displaced people, making it difficult to gather data needed to target interventions towards these vulnerable populations. The following is a discussion of the health impacts of conflict and displacement in the Middle East. A review was conducted of published literature on migration and displacement in the region. Different cases are discussed with an emphasis on the recent, large-scale and urban displacement of Iraqis to illustrate aspects of displacement in this region.

  20. Water

    ... can be found in some metal water taps, interior water pipes, or pipes connecting a house to ... reduce or eliminate lead. See resources below. 5. Children and pregnant women are especially vulnerable to the ...

  1. Application of harmonic pulse testing to water-oil displacement

    Fokker, P.A.; Verga, F.

    2011-01-01

    Harmonic pulse testing is a well testing technique in which the injection or production rate is varied in a periodic way. The pressure response to the imposed rates, both in the pulser well and in the observer wells, can be analyzed in the frequency domain to evaluate the reservoir properties. The

  2. Single molecule microscopy and spectroscopy: concluding remarks.

    van Hulst, Niek F

    2015-01-01

    Chemistry is all about molecules: control, synthesis, interaction and reaction of molecules. All too easily on a blackboard, one draws molecules, their structures and dynamics, to create an insightful picture. The dream is to see these molecules in reality. This is exactly what "Single Molecule Detection" provides: a look at molecules in action at ambient conditions; a breakthrough technology in chemistry, physics and biology. Within the realms of the Royal Society of Chemistry, the Faraday Discussion on "Single Molecule Microscopy and Spectroscopy" was a very appropriate topic for presentation, deliberation and debate. Undoubtedly, the Faraday Discussions have a splendid reputation in stimulating scientific debates along the traditions set by Michael Faraday. Interestingly, back in the 1830's, Faraday himself pursued an experiment that led to the idea that atoms in a compound were joined by an electrical component. He placed two opposite electrodes in a solution of water containing a dissolved compound, and observed that one of the elements of the compound accumulated on one electrode, while the other was deposited on the opposite electrode. Although Faraday was deeply opposed to atomism, he had to recognize that electrical forces were responsible for the joining of atoms. Probably a direct view on the atoms or molecules in his experiment would have convinced him. As such, Michael Faraday might have liked the gathering at Burlington House in September 2015 (). Surely, with the questioning eyes of his bust on the 1st floor corridor, the non-believer Michael Faraday has incited each passer-by to enter into discussion and search for deeper answers at the level of single molecules. In these concluding remarks, highlights of the presented papers and discussions are summarized, complemented by a conclusion on future perspectives.

  3. Static loading and vertical displacement at southern Siberia

    Anton V. Timofeev

    2017-05-01

    Full Text Available Seismic method is usually used for elastic parametric estimation. This is why this method presents dynamic parameters of Earth. Frequency seismic range changes greatly from geodynamic modelling time. Now we have opportunity to use geodesy result for some years for elastic parameters estimation. Static solution from elastic theory may be used for the interpretation of long term results. It presents static elastic parameter. The inverse problem for different types of vertical surface loading on one year period is calculated. Two cases of loading with maximal and minimal area are presented. Results are determined by space geodesy and leveling methods. Current relation between atmospheric pressure and vertical displacements was estimated at the center of Siberian Anti Cyclone with size varied from 2000 km to 3000 km. Pressure-displacement coefficients (PDC can be achieved by three years observation (0.997 mm/mbar for NVSK GPS station. It is used for elastic module study of geology medium with maximum thickness up to 600 km. In the context of elastic model, the modulus of rigidity is estimated to be 113 GPa. Vast expanse of anti-cyclone may relate with rheology of crust and upper mantle. Smaller size of surface loading – local loading is seasonal variation of water reservoir. Annual vertical changes were obtained by leveling near the dam of the reservoir. PDC ratio was 1.15 mm/bar for these places. In elastic theory, the Young modulus E = 80 GPa (Poisson ratio = 0.25, the modulus of rigidity = 32 GPa was calculated by sixteen years of leveling measurements. This result can effectively be represented for upper crust. Our results were checked by solution for coseismic displacement of Chyia-Altai earthquake (Sep. 27, 2003, M = 7.3. Coseismic results calculated by static modules agree with experimental coseismic GPS data at 10% level.

  4. Displacement and stress fields around rock fractures opened by irregular overpressure variations

    Shigekazu eKusumoto

    2014-05-01

    Full Text Available Many rock fractures are entirely driven open by fluids such as ground water, geothermal water, gas, oil, and magma. These are a subset of extension fractures (mode I cracks; e.g., dikes, mineral veins and joints referred to as hydrofractures. Field measurements show that many hydrofractures have great variations in aperture. However, most analytical solutions for fracture displacement and stress fields assume the loading to be either constant or with a linear variation. While these solutions have been widely used, it is clear that a fracture hosted by heterogeneous and anisotropic rock is normally subject to loading that is neither constant nor with a linear variation. Here we present new general solutions for the displacement and stress fields around hydrofractures, modelled as two-dimensional elastic cracks, opened by irregular overpressure variations given by the Fourier cosine series. Each solution has two terms. The first term gives the displacement and stress fields due to the average overpressure acting inside the crack; it is given by the initial term of the Fourier coefficients expressing the overpressure variation. The second term gives the displacement and stress fields caused by the overpressure variation; it is given by general terms of the Fourier coefficients and solved through numerical integration. Our numerical examples show that the crack aperture variation closely reflects the overpressure variation. Also, that the general displacement and stress fields close to the crack follow the overpressure variation but tend to be more uniform far from the crack. The present solutions can be used to estimate the displacement and stress fields around any fluid-driven crack, that is, any hydrofracture, as well as its aperture, provided the variation in overpressure can be described by Fourier series. The solutions add to our understanding of local stresses, displacements, and fluid transport associated with hydrofractures in the crust.

  5. Remarks about the displaced spectra techniques

    Behringer, K.; Pineyro, J.

    1989-01-01

    In a recent paper a new method, called displaced spectra techniques, was presented for distinguishing between sinusoidal components and narrowband random noise contributions in otherwise random noise data. It is based on Fourier transform techniques, and uses the power spectral density (PSD) and a newly-introduced second-order displaced power spectra density (SDPSD) function. In order to distinguish between the two peak types, a validation criterion has been established. In this note, three topics are covered: a) improved numerical data for the validation criterion are given by using the refined estimation procedure of the PSD and SDPSD functions by the Welch method; b) the validation criterion requires the subtraction of the background below the peaks. A semiautomatic procedure is described; c) it was observed that peaks in the real part of the SDPSD function can be accompanied by fine structure phenomena which are unresolved in the PSD function. A few remarks are made about this problem. (author)

  6. OSPAR 30'' displacement; Esvaziamento do OSPAR 30''

    Rocha, Jose Carlos [White Martins Gases Industriais do Nordeste S.A., Recife, PE (Brazil); Souza, Antonio Geraldo de [TRANSPETRO - PETROBRAS Transportes, Rio de Janeiro, RJ (Brazil)

    2005-07-01

    Crude oil pipeline OSPAR that unites Sao Francisco do Sul-SC to Araucaria-PR, with 30 inches in diameter and extension of 118 km (74 mi) was displaced in May 2004. Nitrogen at high flow rate and a pig were used to remove the crude oil, liberating the line to maintenance. Logistic restrictions prevented that the displacement followed the normal flow direction, so the option was to do the job in the reverse direction. To make viable our operation, a maneuver was performed; which we suppose was never done before in Brazil, at an intermediate pumping station, allowing a pressure reduction at the line end, maintaining it at permissible levels. Despite logistical and operational difficulties, the job was performed with success in 47 hours. (author)

  7. Lepton flavor violation with displaced vertices

    Julian Heeck

    2018-01-01

    Full Text Available If light new physics with lepton-flavor-violating couplings exists, the prime discovery channel might not be ℓ→ℓ′γ but rather ℓ→ℓ′X, where the new boson X could be an axion, majoron, familon or Z′ gauge boson. The most conservative bound then comes from ℓ→ℓ′+inv, but if the on-shell X can decay back into leptons or photons, displaced-vertex searches could give much better limits. We show that only a narrow region in parameter space allows for displaced vertices in muon decays, μ→eX,X→γγ,ee, whereas tauon decays can have much more interesting signatures.

  8. Personal Exposure in Displacement Ventilated Rooms

    Brohus, Henrik; Nielsen, Peter Vilhelm

    1996-01-01

    in the lower part of the room close to the occupant. A personal exposure model for displacement ventilated rooms is proposed. The model takes the influence of gradients and the human thermal boundary layer into account. Two new quantities describing the interaction between a person and the ventilation......Personal exposure in a displacement ventilated room is examined. The stratified flow and the considerable concentration gradients necessitate an improvement of the widely used fully mixing compartmental approach. The exposure of a seated and a standing person in proportion to the stratification...... contaminant sources, this entrainment improves the indoor air quality. Measurements of exposure due to a passive contaminant source show a significant dependence on the flow field as well as on the contaminant source location. Poor system performance is found in the case of a passive contaminant released...

  9. Neogene displacements in the Solomon Islands Arc

    Ridgway, J.

    1987-02-01

    The geology and present configuration of the Solomon Island arc can be explained in terms of the Neogene displacement of a single linear chain of islands. The central part of an original arc consisting of Bougainville, Choiseul, Santa Ysabel, Guadalcanal and San Cristobal was displaced to the northeast as a consequence of the attempted subduction of the Woodlark spreading system. Malaita arose on the northeastern side of the arc as a result of interaction between the arc and the Pacific Ocean floor and the volcanic islands of the New Georgia group formed to the southwest in response to the subduction of a spreading ridge, thus giving rise to the present double chain structure of the arc.

  10. Molecule of the Month

    Home; Journals; Resonance – Journal of Science Education; Volume 1; Issue 2. Molecule of the Month Isomers of Benzene - Still Pursuing Dreams. J Chandrasekhar. Feature Article Volume 1 Issue 2 February 1996 pp 80-83. Fulltext. Click here to view fulltext PDF. Permanent link:

  11. Electrons in Molecules

    structure and properties (includingreactivt'ty) - both static (independent of time) and ... Furthermore, since the energy of H2 + in the ground state must be lower than that of .... (Figure 2b); note also that dp is positive in parts of the antibinding regions behind the two ... But, now both the sizes and shapes of molecules enter into.

  12. Molecule of the Month

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule of the Month - A Stable Dibismuthene - A Compound with a Bi-Bi Double Bond. V Chandrasekhar. Volume 16 ... Author Affiliations. V Chandrasekhar1. Department of Chemistry, Indian Institute of Technology, Kanpur 208 016, India.

  13. OMG: Open molecule generator

    Peironcely, J.E.; Rojas-Chertó, M.; Fichera, D.; Reijmers, T.; Coulier, L.; Faulon, J.-L.; Hankemeier, T.

    2012-01-01

    Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical

  14. Molecule-based magnets

    Administrator

    Employing self-assembly methods, it is possible to engineer a bulk molecular material ... synthesis of molecular magnets in 1986, a large variety of them have been synthesized, which can be catego- ... maintained stably per organic molecule, stabilization of a ..... rotating freely under an applied field because it is a magne-.

  15. Molecule of the Month

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 5. Molecule of the Month Molecular–Chameleon: Solvatochromism at its Iridescent Best! Photon Rao. Feature Article Volume 2 Issue 5 May 1997 pp 69-72. Fulltext. Click here to view fulltext PDF. Permanent link:

  16. Nuclear sizes and the Coulomb Displacement Energy

    Van der Werf, S.Y.

    1997-01-01

    Data on Coulomb Displacement Energies in the mass range A = 40 - 240 are analyzed in the deformed Liquid Drop model and in the independent particle model. Reduced half-widths of Woods-Saxon mean-field potential of the resulting neutron-excess distributions are deduced. It is argued that the Nolen-Schiffer anomaly may be lifted by allowing for a slight binding-energy dependence of the mean-field potential geometry. (author)

  17. Computer simulation of displacement cascades in copper

    Heinisch, H.L.

    1983-06-01

    More than 500 displacement cascades in copper have been generated with the computer simulation code MARLOWE over an energy range pertinent to both fission and fusion neutron spectra. Three-dimensional graphical depictions of selected cascades, as well as quantitative analysis of cascade shapes and sizes and defect densities, illustrate cascade behavior as a function of energy. With increasing energy, the transition from production of single compact damage regions to widely spaced multiple damage regions is clearly demonstrated

  18. Displaced abomasum and ketosis in dairy cows

    Stengärde, Lena

    2010-01-01

    High producing dairy cows struggle to meet energy demands and handle various transitional changes in late gestation and early lactation. Negative energy balance in early lactation is inevitable and metabolic disorders may follow as a consequence of a deep negative energy balance. This thesis studies associations between blood profiles and body condition score (BCS) in dairy cows, and displaced abomasum (DA) or clinical ketosis, and investigates risk factors for the two diseases at the herd le...

  19. Environmentally-induced displacement and human security

    Terminski, Bogumil

    2012-01-01

    We can distinguish two general causes of internal displacement worldwide: 1. the impact of threats to and ensuing decline in the level of human security below that needed for normal existence in the homeland territory, 2. administrative compulsion to leave the current place of residence. Every year, at least tens of millions of people on all continents are forced to leave their places of residence. The predominant cause is the occurrence of natural disasters, creating the most dynamic categor...

  20. Reproductive Health Education and Services Needs of Internally Displaced Persons and Refugees following Disaster

    Westhoff, Wayne W.; Lopez, Guillermo E.; Zapata, Lauren B.; Wilke Corvin, Jaime A.; Allen, Peter; McDermott, Robert J.

    2008-01-01

    Background: Following the occurrence of natural or man-made disaster, relief worker priorities include providing water, food, shelter, and immunizations for displaced persons. Like these essential initiatives, reproductive health education and services must also be incorporated into recovery efforts. Purpose: This study examined reproductive…

  1. Contactless sub-millimeter displacement measurements

    Sliepen, Guus; Jägers, Aswin P. L.; Bettonvil, Felix C. M.; Hammerschlag, Robert H.

    2008-07-01

    Weather effects on foldable domes, as used at the DOT and GREGOR, are investigated, in particular the correlation between the wind field and the stresses caused to both metal framework and tent clothing. Camera systems measure contactless the displacement of several dome points. The stresses follow from the measured deformation pattern. The cameras placed near the dome floor do not disturb telescope operations. In the set-ups of DOT and GREGOR, these cameras are up to 8 meters away from the measured points and must be able to detect displacements of less than 0.1 mm. The cameras have a FireWire (IEEE1394) interface to eliminate the need for frame grabbers. Each camera captures 15 images of 640 × 480 pixels per second. All data is processed on-site in real-time. In order to get the best estimate for the displacement within the constraints of available processing power, all image processing is done in Fourier-space, with all convolution operations being pre-computed once. A sub-pixel estimate of the peak of the correlation function is made. This enables to process the images of four cameras using only one commodity PC with a dual-core processor, and achieve an effective sensitivity of up to 0.01 mm. The deformation measurements are well correlated to the simultaneous wind measurements. The results are of high interest to upscaling the dome design (ELTs and solar telescopes).

  2. International Monetary Fund and aid displacement.

    Stuckler, David; Basu, Sanjay; McKee, Martin

    2011-01-01

    Several recent papers find evidence that global health aid is being diverted to reserves, education, military, or other sectors, and is displacing government spending. This is suggested to occur because ministers of finance have competing, possibly corrupt, priorities and deprive the health sector of resources. Studies have found that development assistance for health routed to governments has a negative impact on health spending and that similar assistance routed to private nongovernmental organizations has a positive impact. An alternative hypothesis is that World Bank and IMF macro-economic policies, which specifically advise governments to divert aid to reserves to cope with aid volatility and keep government spending low, could be causing the displacement of health aid. This article evaluates whether aid displacement was greater when countries undertook a new borrowing program from the IMF between 1996 and 2006. As found in existing studies, for each $1 of development assistance for health, about $0.37 is added to the health system. However, evaluating IMF-borrowing versus non-IMF-borrowing countries reveals that non-borrowers add about $0.45 whereas borrowers add less than $0.01 to the health system. On average, health system spending grew at about half the speed when countries were exposed to the IMF than when they were not. It is important to take account of the political economy of global health finance when interpreting data on financial flows.

  3. Overloaded CDMA Systems with Displaced Binary Signatures

    Vanhaverbeke Frederik

    2004-01-01

    Full Text Available We extend three types of overloaded CDMA systems, by displacing in time the binary signature sequences of these systems: (1 random spreading (PN, (2 multiple-OCDMA (MO, and (3 PN/OCDMA (PN/O. For each of these systems, we determine the time shifts that minimize the overall multiuser interference power. The achievable channel load with coded and uncoded data is evaluated for the conventional (without displacement and improved (with displacement systems, as well as for systems based on quasi-Welch-bound-equality (QWBE sequences, by means of several types of turbo detectors. For each system, the best performing turbo detector is selected in order to compare the performance of these systems. It is found that the improved systems substantially outperform their original counterparts. With uncoded data, (improved PN/O yields the highest acceptable channel load. For coded data, MO allows for the highest acceptable channel load over all considered systems, both for the conventional and the improved systems. In the latter case, channel loads of about 280% are achievable with a low degradation as compared to a single user system.

  4. Comparing Teaching Approaches About Maxwell's Displacement Current

    Karam, Ricardo; Coimbra, Debora; Pietrocola, Maurício

    2014-08-01

    Due to its fundamental role for the consolidation of Maxwell's equations, the displacement current is one of the most important topics of any introductory course on electromagnetism. Moreover, this episode is widely used by historians and philosophers of science as a case study to investigate several issues (e.g. the theory-experiment relationship). Despite the consensus among physics educators concerning the relevance of the topic, there are many possible ways to interpret and justify the need for the displacement current term. With the goal of understanding the didactical transposition of this topic more deeply, we investigate three of its domains: (1) The historical development of Maxwell's reasoning; (2) Different approaches to justify the term insertion in physics textbooks; and (3) Four lectures devoted to introduce the topic in undergraduate level given by four different professors. By reflecting on the differences between these three domains, significant evidence for the knowledge transformation caused by the didactization of this episode is provided. The main purpose of this comparative analysis is to assist physics educators in developing an epistemological surveillance regarding the teaching and learning of the displacement current.

  5. Exotic helium molecules

    Portier, M.

    2007-12-01

    We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range 4 He 2 (2 3 S 1 -2 3 P 0 ) molecule, or a 4 He 2 (2 3 S 1 -2 3 S 1 ) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 ± 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range 4 He 2 (2 3 S 1 -2 3 S 1 ) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime τ = (1.4 ± 0.3) μs is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)

  6. OMG: Open Molecule Generator.

    Peironcely, Julio E; Rojas-Chertó, Miguel; Fichera, Davide; Reijmers, Theo; Coulier, Leon; Faulon, Jean-Loup; Hankemeier, Thomas

    2012-09-17

    Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.

  7. OMG: Open Molecule Generator

    Peironcely Julio E

    2012-09-01

    Full Text Available Abstract Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG, which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.

  8. Density functional theory studies on the solvent effects in Al(H2O)63+ water-exchange reactions: the number and arrangement of outer-sphere water molecules.

    Liu, Li; Zhang, Jing; Dong, Shaonan; Zhang, Fuping; Wang, Ye; Bi, Shuping

    2018-03-07

    Density functional theory (DFT) calculations combined with cluster models are performed at the B3LYP/6-311+G(d,p) level for investigating the solvent effects in Al(H 2 O) 6 3+ water-exchange reactions. A "One-by-one" method is proposed to obtain the most representative number and arrangement of explicit H 2 Os in the second hydration sphere. First, all the possible ways to locate one explicit H 2 O in second sphere (N m ' = 1) based on the gas phase structure (N m ' = 0) are examined, and the optimal pathway (with the lowest energy barrier) for N m ' = 1 is determined. Next, more explicit H 2 Os are added one by one until the inner-sphere is fully hydrogen bonded. Finally, the optimal pathways with N m ' = 0-7 are obtained. The structural and energetic parameters as well as the lifetimes of the transition states are compared with the results obtained with the "Independent-minimum" method and the "Independent-average" method, and all three methods show that the pathway with N m ' = 6 may be representative. Our results give a new idea for finding the representative pathway for water-exchange reactions in other hydrated metal ion systems.

  9. Importance of protamine phosphorylation to histone displacement in spermatids: can the disruption of this process be used for male contraception

    Balhorn, R.; Hud, N.V.; Corzett, M.; Mazrimas, J.

    1995-06-01

    Protamine is a small protein that packages DNA in the sperm of most vertebrates. Shortly after its synthesis, the serine and threonine residues in each protamine are phosphorylated and the modified proteins are deposited onto DNA, displacing the histones and other chromatin proteins. We have hypothesized that the phosphorylation of protamine 1 induces protamine dimerization and these dimers are required for efficient histone displacement. Histone displacement by protamines in late-step spermatids appears to be essential for the production of fertile sperm in man and other mammals, and the disruption of this process could provide a new approach for male contraception. As a first step towards testing this theory, we have initiated a set of in vitro experiments to determine whether of not protamine phosphorylation is essential for histone displacement. Thee results of these experiments, although incomplete, confirm that unphosphorylated protamine cannot effectively displace histone from DNA. Polyarginine molecules twice the size of a protamine molecule and salmine dimer were found to be more effective. These results are consistent with the theory that the disruption of protamine phosphorylation may prove to be a useful new approach for male contraception if it can be shown to facilitate or induce protamine dimerization.

  10. INCAS: an analytical model to describe displacement cascades

    Jumel, Stephanie E-mail: stephanie.jumel@edf.fr; Claude Van-Duysen, Jean E-mail: jean-claude.van-duysen@edf.fr

    2004-07-01

    REVE (REactor for Virtual Experiments) is an international project aimed at developing tools to simulate neutron irradiation effects in Light Water Reactor materials (Fe, Ni or Zr-based alloys). One of the important steps of the project is to characterise the displacement cascades induced by neutrons. Accordingly, the Department of Material Studies of Electricite de France developed an analytical model based on the binary collision approximation. This model, called INCAS (INtegration of CAScades), was devised to be applied on pure elements; however, it can also be used on diluted alloys (reactor pressure vessel steels, etc.) or alloys composed of atoms with close atomic numbers (stainless steels, etc.). INCAS describes displacement cascades by taking into account the nuclear collisions and electronic interactions undergone by the moving atoms. In particular, it enables to determine the mean number of sub-cascades induced by a PKA (depending on its energy) as well as the mean energy dissipated in each of them. The experimental validation of INCAS requires a large effort and could not be carried out in the framework of the study. However, it was verified that INCAS results are in conformity with those obtained from other approaches. As a first application, INCAS was applied to determine the sub-cascade spectrum induced in iron by the neutron spectrum corresponding to the central channel of the High Flux Irradiation Reactor of Oak Ridge National Laboratory.

  11. INCAS: an analytical model to describe displacement cascades

    Jumel, Stéphanie; Claude Van-Duysen, Jean

    2004-07-01

    REVE (REactor for Virtual Experiments) is an international project aimed at developing tools to simulate neutron irradiation effects in Light Water Reactor materials (Fe, Ni or Zr-based alloys). One of the important steps of the project is to characterise the displacement cascades induced by neutrons. Accordingly, the Department of Material Studies of Electricité de France developed an analytical model based on the binary collision approximation. This model, called INCAS (INtegration of CAScades), was devised to be applied on pure elements; however, it can also be used on diluted alloys (reactor pressure vessel steels, etc.) or alloys composed of atoms with close atomic numbers (stainless steels, etc.). INCAS describes displacement cascades by taking into account the nuclear collisions and electronic interactions undergone by the moving atoms. In particular, it enables to determine the mean number of sub-cascades induced by a PKA (depending on its energy) as well as the mean energy dissipated in each of them. The experimental validation of INCAS requires a large effort and could not be carried out in the framework of the study. However, it was verified that INCAS results are in conformity with those obtained from other approaches. As a first application, INCAS was applied to determine the sub-cascade spectrum induced in iron by the neutron spectrum corresponding to the central channel of the High Flux Irradiation Reactor of Oak Ridge National Laboratory.

  12. INCAS: an analytical model to describe displacement cascades

    Jumel, Stephanie; Claude Van-Duysen, Jean

    2004-01-01

    REVE (REactor for Virtual Experiments) is an international project aimed at developing tools to simulate neutron irradiation effects in Light Water Reactor materials (Fe, Ni or Zr-based alloys). One of the important steps of the project is to characterise the displacement cascades induced by neutrons. Accordingly, the Department of Material Studies of Electricite de France developed an analytical model based on the binary collision approximation. This model, called INCAS (INtegration of CAScades), was devised to be applied on pure elements; however, it can also be used on diluted alloys (reactor pressure vessel steels, etc.) or alloys composed of atoms with close atomic numbers (stainless steels, etc.). INCAS describes displacement cascades by taking into account the nuclear collisions and electronic interactions undergone by the moving atoms. In particular, it enables to determine the mean number of sub-cascades induced by a PKA (depending on its energy) as well as the mean energy dissipated in each of them. The experimental validation of INCAS requires a large effort and could not be carried out in the framework of the study. However, it was verified that INCAS results are in conformity with those obtained from other approaches. As a first application, INCAS was applied to determine the sub-cascade spectrum induced in iron by the neutron spectrum corresponding to the central channel of the High Flux Irradiation Reactor of Oak Ridge National Laboratory

  13. DNA aptamer selection and aptamer-based fluorometric displacement assay for the hepatotoxin microcystin-RR

    Wu, Shijia; Li, Qi; Duan, Nuo; Wang, Zhouping; Ma, Haile

    2016-01-01

    Microcystin-RR (MC-RR) is a highly acute hepatotoxin produced by cyanobacteria. It is harmful to both humans and the environment. A novel aptamer was identified by the systemic evolution of ligands by exponential enrichment (SELEX) method as a recognition element for determination of MC-RR in aquatic products. The graphene oxide (GO) SELEX strategy was adopted to generate aptamers with high affinity and specificity. Of the 50 aptamer candidates tested, sequence RR-33 was found to display high affinity and selectivity, with a dissociation constant of 45.7 ± 6.8 nM. Aptamer RR-33 therefore was used as the recognition element in a fluorometric assay that proceeds as follows: (1) Biotinylated aptamer RR-33 is immobilized on the streptavidinylated wells of a microtiterplate, and carboxyfluorescein (FAM) labelled complementary DNA is then allowed to hybridize. (2) After removal of excess (unbound) cDNA, sample containing MC-RR is added and incubated at 37 °C for 2 h. (3) Displaced free cDNA is washed away and fluorescence intensity measured at excitation/emission wavelengths of 490/515 nm. The calibration plot is linear in the 0.20 to 2.5 ng·mL −1 concentration range, and the limit of detection is 80 pg·mL −1 . The results indicate that the GO-SELEX technology is appropriate for the screening of aptamers against small-molecule toxins. The detection scheme was applied to the determination of MC-RR in (spiked) water, mussel and fish and gave recoveries between 91 and 98 %. The method compares favorably to a known ELISA. Conceivably, this kind of assay is applicable to other toxins for which appropriate aptamers are available. (author)

  14. Small-molecule AT2 receptor agonists

    Hallberg, Mathias; Sumners, Colin; Steckelings, U Muscha

    2018-01-01

    The discovery of the first selective, small-molecule ATR receptor (AT2R) agonist compound 21 (C21) (8) that is now extensively studied in a large variety of in vitro and in vivo models is described. The sulfonylcarbamate derivative 8, encompassing a phenylthiofen scaffold is the drug-like agonist...... with the highest affinity for the AT2R reported to date (Ki = 0.4 nM). Structure-activity relationships (SAR), regarding different biaryl scaffolds and functional groups attached to these scaffolds and with a particular focus on the impact of various para substituents displacing the methylene imidazole group of 8......, are discussed. Furthermore, the consequences of migration of the methylene imidazole group and presumed structural requirements for ligands that are aimed as AT2R agonists (e.g. 8) or AT2R antagonists (e.g. 9), respectively, are briefly addressed. A summary of the pharmacological actions of C21 (8) is also...

  15. Human serum albumin binding assay based on displacement of a non selective fluorescent inhibitor.

    Thorarensen, Atli; Sarver, Ronald W; Tian, Fang; Ho, Andrea; Romero, Donna L; Marotti, Keith R

    2007-08-15

    In this paper, we describe a fluorescent antibacterial analog, 6, with utility as a competition probe to determine affinities of other antibacterial analogs for human serum albumin (HSA). Analog 6 bound to HSA with an affinity of 400+/-100 nM and the fluorescence was environmentally sensitive. With 370 nm excitation, environmental sensitivity was indicated by a quenching of the 530 nm emission when the probe bound to HSA. Displacement of dansylsarcosine from HSA by 6 indicated it competed with compounds that bound at site II (ibuprofen binding site) on HSA. Analog 6 also shifted the NMR peaks of an HSA bound oleic acid molecule that itself was affected by compounds that bound at site II. In addition to binding at site II, 6 interacted at site I (warfarin binding site) as indicated by displacement of dansylamide and the shifting of NMR peaks of an HSA bound oleic acid molecule affected by warfarin site binding. Additional evidence for multiple site interaction was discovered when a percentage of 6 could be displaced by either ibuprofen or phenylbutazone. A competition assay was established using 6 to determine relative affinities of other antibacterial inhibitors for HSA.

  16. Sol-gel method for encapsulating molecules

    Brinker, C. Jeffrey; Ashley, Carol S.; Bhatia, Rimple; Singh, Anup K.

    2002-01-01

    A method for encapsulating organic molecules, and in particular, biomolecules using sol-gel chemistry. A silica sol is prepared from an aqueous alkali metal silicate solution, such as a mixture of silicon dioxide and sodium or potassium oxide in water. The pH is adjusted to a suitably low value to stabilize the sol by minimizing the rate of siloxane condensation, thereby allowing storage stability of the sol prior to gelation. The organic molecules, generally in solution, is then added with the organic molecules being encapsulated in the sol matrix. After aging, either a thin film can be prepared or a gel can be formed with the encapsulated molecules. Depending upon the acid used, pH, and other processing conditions, the gelation time can be from one minute up to several days. In the method of the present invention, no alcohols are generated as by-products during the sol-gel and encapsulation steps. The organic molecules can be added at any desired pH value, where the pH value is generally chosen to achieve the desired reactivity of the organic molecules. The method of the present invention thereby presents a sufficiently mild encapsulation method to retain a significant portion of the activity of the biomolecules, compared with the activity of the biomolecules in free solution.

  17. Cold guided beams of polar molecules

    Motsch, Michael

    2010-01-01

    This thesis reports on experiments characterizing cold guided beams of polar molecules which are produced by electrostatic velocity filtering. This filtering method exploits the interaction between the polar molecules and the electric field provided by an electrostatic quadrupole guide to extract efficiently the slow molecules from a thermal reservoir. For molecules with large and linear Stark shifts such as deuterated ammonia (ND 3 ) or formaldehyde (H 2 CO), fluxes of guided molecules of 10 10 -10 11 molecules/s are produced. The velocities of the molecules in these beams are in the range of 10-200 m/s and correspond to typical translational temperatures of a few Kelvin. The maximum velocity of the guided molecules depends on the Stark shift, the molecular mass, the geometry of the guide, and the applied electrode voltage. Although the source is operated in the near-effusive regime, the number density of the slowest molecules is sensitive to collisions. A theoretical model, taking into account this velocity-dependent collisional loss of molecules in the vicinity of the nozzle, reproduces the density of the guided molecules over a wide pressure range. A careful adjustment of pressure allows an increase in the total number of molecules, whilst yet minimizing losses due to collisions of the sought-for slow molecules. This is an important issue for future applications. Electrostatic velocity filtering is suited for different molecular species. This is demonstrated by producing cold guided beams of the water isotopologs H 2 O, D 2 O, and HDO. Although these are chemically similar, they show linear and quadratic Stark shifts, respectively, when exposed to external electric fields. As a result, the flux of HDO is larger by one order of magnitude, and the flux of the individual isotopologs shows a characteristic dependence on the guiding electric field. The internal-state distribution of guided molecules is studied with a newly developed diagnostic method: depletion

  18. Displaced, Homeless and Abused: The Dynamics of Gender-Based ...

    based abuse (SPGBV) experienced by displaced Zimbabwean refugees, perpetrators of such abuses and the gender of perpetrators in South Africa. Refugee and Internally displaced persons are interchangeably used in this study. Through in-depth ...

  19. Displacement laser interferometry with sub-nanometer uncertainty

    Cosijns, S.J.A.G.

    2004-01-01

    Development in industry is asking for improved resolution and higher accuracy in mechanical measurement. Together with miniaturization the demand for sub nanometer uncertainty on dimensional metrology is increasing rapidly. Displacement laser interferometers are used widely as precision displacement

  20. Dissolved oxygen detection by galvanic displacement-induced

    Dissolved oxygen detection by galvanic displacement-induced graphene/silver nanocomposite ... dissolved oxygen (DO) detection based on a galvanic displacement synthesized reduced graphene oxide–silver nanoparticles ... Current Issue

  1. Comparação entre as medidas inferenciais de edema de membros inferiores utilizando o Leg-O-Meter e o deslocador de água Comparison between inferential measurements of lower limb edema utilizing the Leg-O-Meter and water displacement

    ABC Oliveira

    2006-01-01

    Full Text Available INTRODUÇÃO: A quantificação precisa da severidade e extensão de edema periférico é necessária antes e após a intervenção fisioterapêutica para avaliar a eficiência do tratamento. O objetivo deste estudo foi comparar as medidas de volume em membros inferiores (MMII obtidas com dois instrumentos o Leg-O-Meter (LM e o deslocador de água (DA em um período de 2 semanas. Materiais e métodos: Trinta e uma mulheres portadoras de edema de MMII com idade entre 20 e 70 anos participaram deste estudo. O edema foi inicialmente avaliado pela perimetria (LM dos MMII ao nível do tornozelo e pelo volume de água deslocada após imersão do membro (DA. Após 2 semanas as medidas foram repetidas sem que houvesse alteração na medicação ou na rotina diária. Resultado: O percentual de alteração de edema no membro inferior direito (MID com o LM e com o DA foi 0,3±4,18% e 0,9±3,31% (p=0,21, respectivamente. Para o membro inferior esquerdo o percentual de alteração foi de 0,7±3,44% e 0,5±3,84% (p=0,29, com o LM e o DA, respectivamente. A magnitude da correlação entre as medidas obtidas com o LM e o DL foi alta e significativa, variando de r=0,73 a r=0,83 (pBackground: Precise quantification of the severity and extent of edema is necessary before and after physiotherapeutic intervention, in order to evaluate the efficiency of the treatment. The objective of this study was to compare lower limb (LL volume measurements from two methods: Leg-O-Meter (LM and water displacement (WD, over a two-week interval. Method: Thirty-one women with LL edema, aged between 20 and 70 years, participated in this study. Edema was initially evaluated by circumference measurement (LM at the ankle level, and by means of the volume of water displaced upon immersion of the limb (WD. After 2 weeks, these measurements were repeated without there having been any change in daily routines or medication intake. Results: the percent changes in edema in the right lower

  2. Hydride Molecules towards Nearby Galaxies

    Monje, Raquel R.; La, Ngoc; Goldsmith, Paul

    2018-06-01

    Observations carried out by the Herschel Space Observatory revealed strong spectroscopic signatures from light hydride molecules within the Milky Way and nearby active galaxies. To better understand the chemical and physical conditions of the interstellar medium, we conducted the first comprehensive survey of hydrogen fluoride (HF) and water molecular lines observed through the SPIRE Fourier Transform Spectrometer. By collecting and analyzing the sub-millimeter spectra of over two hundred sources, we found that the HF J = 1 - 0 rotational transition which occurs at approximately 1232 GHz was detected in a total of 39 nearby galaxies both in absorption and emission. The analysis will determine the main excitation mechanism of HF in nearby galaxies and provide steady templates of the chemistry and physical conditions of the ISM to be used in the early universe, where observations of hydrides are more scarce.

  3. Strand displacement activated peroxidase activity of hemin for fluorescent DNA sensing.

    Wang, Quanbo; Xu, Nan; Gui, Zhen; Lei, Jianping; Ju, Huangxian; Yan, Feng

    2015-10-07

    To efficiently regulate the catalytic activity of the peroxidase mimic hemin, this work designs a double-stranded DNA probe containing an intermolecular dimer of hemin, whose peroxidase activity can be activated by a DNA strand displacement reaction. The double-stranded probe is prepared by annealing two strands of hemin labelled DNA oligonucleotides. Using the fluorescent oxidation product of tyramine by H2O2 as a tracing molecule, the low peroxidase activity of the hemin dimer ensures a low fluorescence background. The strand displacement reaction of the target DNA dissociates the hemin dimer and thus significantly increases the catalytic activity of hemin to produce a large amount of dityramine for fluorescence signal readout. Based on the strand displacement regulated peroxidase activity, a simple and sensitive homogeneous fluorescent DNA sensing method is proposed. The detection can conveniently be carried out in a 96-well plate within 20 min with a detection limit of 0.18 nM. This method shows high specificity, which can effectively distinguish single-base mismatched DNA from perfectly matched target DNA. The DNA strand displacement regulated catalytic activity of hemin has promising application in the determination of various DNA analytes.

  4. Displacement Ventilation in a Room with Low-Level Diffusers

    Nielsen, Peter V.

    Ventilation systems with vertical displacement flow have been used in industrial areas with high thermal loads for many years. Quite resently the vertical displacement flow systems have grown popular as comfort ventilation in rooms with thermal loads e.g. offices.......Ventilation systems with vertical displacement flow have been used in industrial areas with high thermal loads for many years. Quite resently the vertical displacement flow systems have grown popular as comfort ventilation in rooms with thermal loads e.g. offices....

  5. Single-Molecule Nanomagnets

    Friedman, Jonathan R.; Sarachik, Myriam P.

    2010-04-01

    Single-molecule magnets straddle the classical and quantum mechanical worlds, displaying many fascinating phenomena. They may have important technological applications in information storage and quantum computation. We review the physical properties of two prototypical molecular nanomagnets, Mn12-acetate and Fe8: Each behaves as a rigid, spin-10 object and exhibits tunneling between up and down directions. As temperature is lowered, the spin-reversal process evolves from thermal activation to pure quantum tunneling. At low temperatures, magnetic avalanches occur in which the magnetization of an entire sample rapidly reverses. We discuss the important role that symmetry-breaking fields play in driving tunneling and in producing Berry-phase interference. Recent experimental advances indicate that quantum coherence can be maintained on timescales sufficient to allow a meaningful number of quantum computing operations to be performed. Efforts are under way to create monolayers and to address and manipulate individual molecules.

  6. Superexcited states of molecules

    Nakamura, Hiroki; Takagi, Hidekazu.

    1990-01-01

    The report addresses the nature and major features of molecule's superexcited states, focusing on their involvement in dynamic processes. It also outlines the quantum defect theory which allows various processes involving these states to be treated in a unified way. The Rydberg state has close relation with an ionized state with a positive energy. The quantum defect theory interprets such relation. Specifically, the report first describes the quantum defect theory focusing on its basic principle. The multi-channel quantum defect theory is then outlined centering on how to describe a Rydberg-type superexcited state. Description of a dissociative double-electron excited state is also discussed. The quantum defect theory is based on the fact that the physics of the motion of a Rydberg electron vary with the region in the electron's coordinate space. Finally, various molecular processes that involve a superexcited state are addressed focusing on autoionization, photoionization, dissociative recombination and bonding ionization of diatomic molecules. (N.K.)

  7. Endothermic decompositions of inorganic monocrystalline thin plates. II. Displacement rate modulation of the reaction front

    Bertrand, G.; Comperat, M.; Lallemant, M.

    1980-09-01

    Copper sulfate pentahydrate dehydration into trihydrate was investigated using monocrystalline platelets with (110) crystallographic orientation. Temperature and pressure conditions were selected so as to obtain elliptical trihydrate domains. The study deals with the evolution, vs time, of elliptical domain dimensions and the evolution, vs water vapor pressure, of the {D}/{d} ratio of ellipse axes and on the other hand of the interface displacement rate along a given direction. The phenomena observed are not basically different from those yielded by the overall kinetic study of the solid sample. Their magnitude, however, is modulated depending on displacement direction. The results are analyzed within the scope of our study of endothermic decomposition of solids.

  8. Using NJOY99 and MCNP4B2 to Estimate the Radiation Damage Displacements per Atom per Second in Steel Within the Boiling Water Reactor Core Shroud and Vessel Wall from Reactor-Grade Mixed-Oxide/Uranium Oxide Fuel for the Nuclear Power Plant at Laguna Verde, Veracruz, Mexico

    Vickers, Lisa

    2003-01-01

    The government of Mexico has expressed interest in utilizing the Laguna Verde boiling water reactor (BWR) nuclear power plant for the disposition of reprocessed spent uranium oxide (UOX) fuel in the form of reactor-grade mixed-oxide (MOX) fuel. MOX fuel would replace spent UOX fuel as a fraction in the core from 18 to 30% depending on the fuel loading cycle. MOX fuel is expected to increase the neutron fluence, flux, fuel centerline temperature, reactor core pressure, and yield higher energy neutrons.There is concern that a core with a fraction of MOX fuel (i.e., increased 239 Pu wt%) would increase the radiation damage displacements per atom per second (dpa-s -1 ) in steel within the core shroud and vessel wall as compared to only conventional, enriched UOX fuel in the core. The evaluation of radiation damage within the core shroud and vessel wall is a concern because of the potentially adverse affect to personnel and public safety, environment, and operating life of the reactor.The primary uniqueness of this paper is the computation of radiation damage (dpa-s -1 ) using NJOY99-processed cross sections for steel within the core shroud and vessel wall. Specifically, the unique radiation damage results are several orders of magnitude greater than results of previous works. In addition, the conclusion of this paper was that the addition of the maximum fraction of one-third MOX fuel to the LV1 BWR core did significantly increase the radiation damage in steel within the core shroud and vessel wall such that without mitigation of radiation damage by periodic thermal annealing or reduction in operating parameters such as neutron fluence, core temperature, and pressure, it posed a potentially adverse affect to the personnel and public safety, environment, and operating life of the reactor

  9. Atoms, molecules & elements

    Graybill, George

    2007-01-01

    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  10. Photonic Molecule Lasers Revisited

    Gagnon, Denis; Dumont, Joey; Déziel, Jean-Luc; Dubé, Louis J.

    2014-05-01

    Photonic molecules (PMs) formed by coupling two or more optical resonators are ideal candidates for the fabrication of integrated microlasers, photonic molecule lasers. Whereas most calculations on PM lasers have been based on cold-cavity (passive) modes, i.e. quasi-bound states, a recently formulated steady-state ab initio laser theory (SALT) offers the possibility to take into account the spectral properties of the underlying gain transition, its position and linewidth, as well as incorporating an arbitrary pump profile. We will combine two theoretical approaches to characterize the lasing properties of PM lasers: for two-dimensional systems, the generalized Lorenz-Mie theory will obtain the resonant modes of the coupled molecules in an active medium described by SALT. Not only is then the theoretical description more complete, the use of an active medium provides additional parameters to control, engineer and harness the lasing properties of PM lasers for ultra-low threshold and directional single-mode emission. We will extend our recent study and present new results for a number of promising geometries. The authors acknowledge financial support from NSERC (Canada) and the CERC in Photonic Innovations of Y. Messaddeq.

  11. Interstellar molecules and masers

    Nguyen-Q-Rieu; Guibert, J.

    1978-01-01

    The study of dense and dark clouds, in which hydrogen is mostly in molecular form, became possible since the discovery of interstellar molecules, emitting in the centimeter and millimeter wavelengths. The molecular lines are generally not in local thermal equilibrium (LTE). Their intensity can often be explained by invoking a population inversion mechanism. Maser emission lines due to OH, H 2 O and SiO molecules are among the most intense molecular lines. The H 2 CO molecule, detected in absorption in front of the cold cosmic background radiation of 2.7 K, illustrates the inverse phenomenon, the antimaser absorption. For a radio transition of frequency v, the inversion rate Δn (relative population difference between the upper and lower level) as well as the maser gain can be determined from the radio observations. In the case of the OH lines in the 2 PIsub(3/2), J=3/2 state, the inversion rates approximately 1 to 2% derived from the observations, are comparable with those obtained in the laboratory. The determination of the excitation mechanisms of the masers, through the statistical equilibrium and radiative transfer equations, implies the knowledge of collisional and radiative transition probabilities. A pumping model, which can satisfactorily explain the radio observations of some interstellar OH clouds, will be discussed [fr

  12. Fiber Optic Displacement Sensor for Measuring Cholesterol Concentration

    Moh. Budiyanto

    2017-11-01

    Full Text Available A simple design of a cholesterol concentration detection is proposed and demonstrated using a fiber optic displacement sensor based on an intensity modulation technique. The proposed sensor uses a bundled plastic optical fiber (POF as a probe in conjunction with a flat mirror as a target. It is obtained that the peak voltage reduces with increasing cholesterol concentration. The sensor is capable of measuring the cholesterol concentration ranging from 0 to 300 ppm in a distilled water with a measured sensitivity of 0.01 mV/ppm, a linearity of more than 99.62 % and a resolution of 3.9188 ppm. The proposed sensor also shows a high degree of stability and good repeatability. The simplicity of design, accuracy, flexible dynamic range, and the low cost of fabrication are favorable attributes of the sensor and beneficial for real- field applications. Fiber optic sensors

  13. Optimization of chemical displacement deposition of copper on porous silicon.

    Bandarenka, Hanna; Redko, Sergey; Nenzi, Paolo; Balucani, Marco; Bondarenko, Vitaly

    2012-11-01

    Copper (II) sulfate was used as a source of copper to achieve uniform distribution of Cu particles deposited on porous silicon. Layers of the porous silicon were formed by electrochemical anodization of Si wafers in a mixture of HF, C3H7OH and deionized water. The well-known chemical displacement technique was modified to grow the copper particles of specific sizes. SEM and XRD analysis revealed that the outer surface of the porous silicon was covered with copper particles of the crystal orientation inherited from the planes of porous silicon skeleton. The copper crystals were found to have the cubic face centering elementary cell. In addition, the traces of Cu2O cubic primitive crystalline phases were identified. The dimensions of Cu particles were determined by the Feret's analysis of the SEM images. The sizes of the particles varied widely from a few to hundreds of nanometers. A phenomenological model of copper deposition was proposed.

  14. Stability of Miscible Displacements Across Stratified Porous Media

    Shariati, Maryam; Yortsos, Yanis C.

    2000-09-11

    This report studied macro-scale heterogeneity effects. Reflecting on their importance, current simulation practices of flow and displacement in porous media were invariably based on heterogeneous permeability fields. Here, it was focused on a specific aspect of such problems, namely the stability of miscible displacements in stratified porous media, where the displacement is perpendicular to the direction of stratification.

  15. Peroneal tendon displacement accompanying intra-articular calcaneal fractures.

    Toussaint, Rull James; Lin, Darius; Ehrlichman, Lauren K; Ellington, J Kent; Strasser, Nicholas; Kwon, John Y

    2014-02-19

    Peroneal tendon displacement (subluxation or dislocation) accompanying an intra-articular calcaneal fracture is often undetected and under-treated. The goals of this study were to determine (1) the prevalence of peroneal tendon displacement accompanying intra-articular calcaneal fractures, (2) the association of tendon displacement with fracture classifications, (3) the association of tendon displacement with heel width, and (4) the rate of missed diagnosis of the tendon displacement on radiographs and computed tomography (CT) scans and the resulting treatment rate. A retrospective radiographic review of all calcaneal fractures presenting at three institutions from June 30, 2006, to June 30, 2011, was performed. CT imaging of 421 intra-articular calcaneal fractures involving the posterior facet was available for review. The prevalence of peroneal tendon displacement was noted and its associations with fracture classification and heel width were evaluated. Peroneal tendon displacement was identified in 118 (28.0%) of the 421 calcaneal fracture cases. The presence of tendon displacement was significantly associated with joint-depression fractures compared with tongue-type fractures (p displacement had been identified in the radiology reports. Although sixty-five (55.1%) of the fractures with tendon displacement had been treated with internal fixation, the tendon displacement was treated surgically in only seven (10.8%) of these cases. Analysis of CT images showed a 28% prevalence of peroneal tendon displacement accompanying intra-articular calcaneal fractures. Surgeons and radiologists are encouraged to consider this association.

  16. 5 CFR 330.706 - Notification of displaced employees.

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Notification of displaced employees. 330... RECRUITMENT, SELECTION, AND PLACEMENT (GENERAL) Interagency Career Transition Assistance Plan for Displaced Employees § 330.706 Notification of displaced employees. (a) In addition to meeting the requirements of...

  17. Water

    Van Wyk, Llewellyn V

    2010-08-01

    Full Text Available Water scarcity is without a doubt on of the greatest threats to the human species and has all the potential to destabilise world peace. Falling water tables are a new phenomenon. Up until the development of steam and electric motors, deep groudwater...

  18. Water

    Hertie School of Governance

    2010-01-01

    All human life depends on water and air. The sustainable management of both is a major challenge for today's public policy makers. This issue of Schlossplatz³ taps the streams and flows of the current debate on the right water governance.

  19. Displaced and non-displaced Colombian children's evaluations of moral transgressions, retaliation, and reconciliation

    Ardila-Rey, Alicia; Killen, Melanie; Brenick, Alaina

    2015-01-01

    In order to assess the effects of displacement and exposure to violence on children's moral reasoning, Colombian children exposed to minimal violence (non-displaced or low-risk) (N = 99) and to extreme violence (displaced or high-risk) (N = 94), evenly divided by gender, at 6-, 9-, and 12 - years of age, were interviewed regarding their evaluation of peer-oriented moral transgressions (hitting and not sharing toys). The vast majority of children evaluated moral transgressions as wrong. Group and age differences were revealed, however, regarding provocation and retaliation. Children who were exposed to violence, in contrast to those with minimum exposure, judged it more legitimate to inflict harm or deny resources when provoked and judged it more okay to retaliate for reasons of retribution. Surprisingly, and somewhat hopefully, all children viewed reconciliation as feasible. The results are informative regarding theories of morality, culture, and the effects of violence on children's social development. PMID:25722543

  20. Reply to Comment on 'Diffusion of water and sodium counter-ions in nanopores of β-lactoglobulin crystal: a molecular simulation study'

    Malek, Kourosh; Coppens, Marc-Olivier

    2008-01-01

    The analysis in Hu and Jiang's Comment to our paper cannot reveal long-time diffusion, and incorrectly led the authors to conclude that the diffusion in beta-lactoglobuline is anomalous. In this context, the limitations of applying a mean-square displacement analysis to short, heterogeneous pore channels are discussed. A more appropriate approach based on first-passage time analysis is illustrated by a detailed analysis of water motion in a natural membrane protein channel. The partitioning and the motion of water molecules between core and surface hydration layers is discussed. Finally, the calculation of the water density profile is commented upon. (reply)

  1. Borehole tool outrigger arm displacement control mechanism

    Lee, A.G.

    1985-01-01

    As the outrigger arms of a borehole logging tool are flexed inwardly and outwardly according to the diameter of the borehole opening through which they pass, the corresponding axial displacements of the ends of the arms are controlled to determine the axial positions of the arms relative to the tool. Specifically, as the arm ends move, they are caused to rotate by a cam mechanism. The stiffness of the arms causes the arm ends to rotate in unison, and the exact positions of the arms on the tool are then controlled by the differential movements of the arm ends in the cams

  2. Superconducting inductive displacement detection of a microcantilever

    Vinante, A.

    2014-07-01

    We demonstrate a superconducting inductive technique to measure the displacement of a micromechanical resonator. In our scheme, a type I superconducting microsphere is attached to the free end of a microcantilever and approached to the loop of a dc Superconducting Quantum Interference Device (SQUID) microsusceptometer. A local magnetic field as low as 100 μT, generated by a field coil concentric to the SQUID, enables detection of the cantilever thermomechanical noise at 4.2 K. The magnetomechanical coupling and the magnetic spring are in good agreement with image method calculations assuming pure Meissner effect. These measurements are relevant to recent proposals of quantum magnetomechanics experiments based on levitating superconducting microparticles.

  3. Traumatic displacement of stomach - a case report.

    Janardhanan, Joshima; Tarvadi, Pratik Vijay; Manipady, Shahnavaz; Shetty, Mahabalesh; Somashekar, C

    2014-01-01

    These days we have fast paced traffic on our roads to help us keep up with our fast paced life. But every boon has a down side and our high velocity traffic is no exception. Here is a case report of a blunt abdominal injury following a road traffic accident. Externally the deceased had only a few grazed abrasions on the forehead and right forearm. But on internal examination of abdomen, it was noticed that the left hemi-diaphragm was torn and the stomach and intestines were found displaced into the left thoracic cavity. Copyright © 2013 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  4. [Intra-articular injections of hyaluronic acid for anterior disc displacement of temporomandibular joint].

    Long, X

    2017-03-09

    Anterior disc displacement (ADD) of temporomandibular joint (TMJ) is regarded as one of the major findings in temporomandibular disorders (TMD). It is related to joint noise, pain, mandibular dysfunction, degenerative change and osteoarthritis. In the mean time, the pathological changes were found in synovial membrane and synovial fluid. Hyaluronic acid is a principal component of the synovial fluid which plays an important role in nutrition, lubrication, anti-inflammation and cartilage repair. The synthesis, molecule weight, and concentration of hyaluronic acid are decreased during TMD and cause TMJ degenerative changes. The clinical conditions, pathological changes, the mechanism of action for hyaluronic acid and the treatment of anterior disc displacement of TMJ are discussed in this article.

  5. Displacement of Drugs from Human Serum Albumin: From Molecular Interactions to Clinical Significance.

    Rimac, Hrvoje; Debeljak, Željko; Bojić, Mirza; Miller, Larisa

    2017-01-01

    Human serum albumin (HSA) is the most abundant protein in human serum. It has numerous functions, one of which is transport of small hydrophobic molecules, including drugs, toxins, nutrients, hormones and metabolites. HSA has the ability to interact with a wide variety of structurally different compounds. This promiscuous, nonspecific affinity can lead to sudden changes in concentrations caused by displacement, when two or more compounds compete for binding to the same molecular site. It is important to consider drug combinations and their binding to HSA when defining dosing regimens, as this can directly influence drug's free, active concentration in blood. In present paper we review drug interactions with potential for displacement from HSA, situations in which they are likely to occur and their clinical significance. We also offer guidelines in designing drugs with decreased binding to HSA. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  6. Conserved linear dynamics of single-molecule Brownian motion

    Serag, Maged F.

    2017-06-06

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  7. Conserved linear dynamics of single-molecule Brownian motion

    Serag, Maged F.; Habuchi, Satoshi

    2017-06-01

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  8. Conserved linear dynamics of single-molecule Brownian motion

    Serag, Maged F.; Habuchi, Satoshi

    2017-01-01

    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  9. Apparatus for controlling a nuclear reactor by vertical displacement of a unit absorbing neutrons

    Wiart, A.; Defaucheux, J.; Martin, J.; Pasqualini, G.

    1980-01-01

    Apparatus is described for controlling a nuclear reactor by vertical displacement of a unit absorbing neutrons, comprising, inside a sealed enclosure in communication with the interior of the reactor, a movable magnetic piece connected to a control shaft which is itself connected to the absorbent unit. This magnetic piece has at least two radial projections. The magnetic piece is displaced by an inductor with at least two pole shoes corresponding to the projections on the magnetic piece and allowing magnetic coupling between the inductor and the magnetic piece. The inductor and its displacement device are disposed outside the sealed enclosure. A control means allows the control shaft to be uncoupled from a member assuring its suspension so as to drop the absorbent unit in the event of emergency shutdown. The apparatus is particularly applicable to control rods of pressurized water nuclear reactors

  10. Gender-based violence in conflict and displacement: qualitative findings from displaced women in Colombia.

    Wirtz, Andrea L; Pham, Kiemanh; Glass, Nancy; Loochkartt, Saskia; Kidane, Teemar; Cuspoca, Decssy; Rubenstein, Leonard S; Singh, Sonal; Vu, Alexander

    2014-01-01

    Gender-based violence (GBV) is prevalent among, though not specific to, conflict affected populations and related to multifarious levels of vulnerability of conflict and displacement. Colombia has been marked with decades of conflict, with an estimated 5.2 million internally displaced persons (IDPs) and ongoing violence. We conducted qualitative research to understand the contexts of conflict, displacement and dynamics with GBV. This as part of a multi-phase, mixed method study, in collaboration with UNHCR, to develop a screening tool to confidentially identify cases of GBV for referral among IDP women who were survivors of GBV. Qualitative research was used to identify the range of GBV, perpetrators, contexts in conflict and displacement, barriers to reporting and service uptake, as well as to understand experiences of service providers. Thirty-five female IDPs, aged 18 years and older, who self-identified as survivors of GBV were enrolled for in-depth interviews in San Jose de Guaviare and Quibdo, Colombia in June 2012. Thirty-one service providers participated in six focus group discussions and four interviews across these sites. Survivors described a range of GBV across conflict and displacement settings. Armed actors in conflict settings perpetrated threats of violence and harm to family members, child recruitment, and, to a lesser degree, rape and forced abortion. Opportunistic violence, including abduction, rape, and few accounts of trafficking were more commonly reported to occur in the displacement setting, often perpetrated by unknown individuals. Intrafamilial violence, intimate partner violence, including physical and sexual violence and reproductive control were salient across settings and may be exacerbated by conflict and displacement. Barriers to reporting and services seeking were reported by survivors and providers alike. Findings highlight the need for early identification of GBV cases, with emphasis on confidential approaches and active

  11. Experimental and simulated displacement of oil in sand berea cores using aqueous solutions

    Ramirez, A.; Gonzalez, J.L.; Hernandez, F.; Hernandez, H.

    2009-01-01

    The development of a mathematical algorithm to simulate the displacement of a resident fluid using a displacing one in a saturated anisotropic porous media is shown in this work. The algorithm was included in the simulator developed by the present authors in previous works to represent the anisotropic distribution of the porous media properties and the fluid injection [Ramirez A et al. Mathematical simulation of oil reservoir properties. Chaos, solitons and Fractals 2008;38:778-88, Ramirez A et al. Simulation of uncompressible fluid flow through a porous media. Chaos, Solitons and Fractals 2009;39:1753-63] in a nested loop to analyze the participant nodes in the transport process and calculate the volumes of the resident and new fluids. The new routine developed takes in count the mobility of both fluids. Additionally experimental fluid displacement tests were done using heavy oil from Mexican reservoirs as a resident fluid in sand berea cores. The injection of new fluids in natural oil reservoirs is a part of the Enhanced oil recovery (EOR) methods used to improve the oil displacement and increase production after the primary stage of the oil recovery has been finished. Water is an available and economical resource to be used as a displacing fluid due to many of the producers (off-shores) of the oil industries are placed in the sea near the coast.

  12. Double displacement: An improved bioorthogonal reaction strategy for templated nucleic acid detection.

    Kleinbaum, Daniel J; Miller, Gregory P; Kool, Eric T

    2010-06-16

    Quenched autoligation probes have been employed previously in a target-templated nonenzymatic ligation strategy for detecting nucleic acids in cells by fluorescence. A common source of background signal in such probes is the undesired reaction with water and other cellular nucleophiles. Here, we describe a new class of self-ligating probes, double displacement (DD) probes, that rely on two displacement reactions to fully unquench a nearby fluorophore. Three potential double displacement architectures, all possessing two fluorescence quencher/leaving groups (dabsylate groups), were synthesized and evaluated for templated reaction with nucleophile (phosphorothioate) probes both in vitro and in intact bacterial cells. All three DD probe designs provided substantially better initial quenching than a single-Dabsyl control. In isothermal templated reactions in vitro, double displacement probes yielded considerably lower background signal than previous single displacement probes; investigation into the mechanism revealed that one dabsylate acts as a sacrificial leaving group, reacting nonspecifically with water, but yielding little signal because another quencher group remains. Templated reaction with the specific nucleophile probe is required to activate a signal. The double displacement probes provided a ca. 80-fold turn-on signal and yielded a 2-4-fold improvement in signal/background over single Dabsyl probes. The best-performing probe architecture was demonstrated in a two-color, FRET-based two-allele discrimination system in vitro and was shown to be capable of discriminating between two closely related species of bacteria differing by a single nucleotide at an rRNA target site.

  13. Water

    E. Sanmuga Priya

    2017-05-01

    Full Text Available Phytoremediation through aquatic macrophytes treatment system (AMATS for the removal of pollutants and contaminants from various natural sources is a well established environmental protection technique. Water hyacinth (Eichhornia crassipes, a worst invasive aquatic weed has been utilised for various research activities over the last few decades. The biosorption capacity of the water hyacinth in minimising various contaminants present in the industrial wastewater is well studied. The present review quotes the literatures related to the biosorption capacity of the water hyacinth in reducing the concentration of dyestuffs, heavy metals and minimising certain other physiochemical parameters like TSS (total suspended solids, TDS (total dissolved solids, COD (chemical oxygen demand and BOD (biological oxygen demand in textile wastewater. Sorption kinetics through various models, factors influencing the biosorption capacity, and role of physical and chemical modifications in the water hyacinth are also discussed.

  14. Transient digitizer with displacement current samplers

    McEwan, Thomas E.

    1996-01-01

    A low component count, high speed sample gate, and digitizer architecture using the sample gates is based on use of a signal transmission line, a strobe transmission line and a plurality of sample gates connected to the sample transmission line at a plurality of positions. The sample gates include a strobe pickoff structure near the strobe transmission line which generates a charge displacement current in response to propagation of the strobe signal on the strobe transmission line sufficient to trigger the sample gate. The sample gate comprises a two-diode sampling bridge and is connected to a meandered signal transmission line at one end and to a charge-holding cap at the other. The common cathodes are reverse biased. A voltage step is propagated down the strobe transmission line. As the step propagates past a capacitive pickoff, displacement current i=c(dv/dT), flows into the cathodes, driving the bridge into conduction and thereby charging the charge-holding capacitor to a value related to the signal. A charge amplifier converts the charge on the charge-holding capacitor to an output voltage. The sampler is mounted on a printed circuit board, and the sample transmission line and strobe transmission line comprise coplanar microstrips formed on a surface of the substrate. Also, the strobe pickoff structure may comprise a planar pad adjacent the strobe transmission line on the printed circuit board.

  15. Quark chemistry: charmonium molecules

    De Rujula, A.; Jaffe, R.L.

    1977-01-01

    The theoretical and experimental evidence for two quark-two antiquark hadrons is reviewed. Concentration is placed on predictions for S-wave ''charmonium molecules,'' built of a c anti c charmonium pair and a light quark-antiquark pair. Their spectrum and quantum numbers are predicted and an estimate of their decay couplings and their prediction in monochromatic pion decays from charmonium resonances produced in e + e - -annihilation is given. Some S-wave charmonium resonances should be detectable in these decays, but typical branching ratios are only at the 1% level. 19 references

  16. Ultra-cold molecule production

    Ramirez-Serrano, Jamie; Chandler, David W.; Strecker, Kevin; Rahn, Larry A.

    2005-01-01

    The production of Ultra-cold molecules is a goal of many laboratories through out the world. Here we are pursuing a unique technique that utilizes the kinematics of atomic and molecular collisions to achieve the goal of producing substantial numbers of sub Kelvin molecules confined in a trap. Here a trap is defined as an apparatus that spatially localizes, in a known location in the laboratory, a sample of molecules whose temperature is below one degree absolute Kelvin. Further, the storage time for the molecules must be sufficient to measure and possibly further cool the molecules. We utilize a technique unique to Sandia to form cold molecules from near mass degenerate collisions between atoms and molecules. This report describes the progress we have made using this novel technique and the further progress towards trapping molecules we have cooled

  17. Heavy metal displacement in chelate-irrigated soil during phytoremediation

    Madrid, F.; Liphadzi, M. S.; Kirkham, M. B.

    2003-03-01

    Heavy metals in wastewater sewage sludge (biosolids), applied to land, contaminate soils. Phytoremediation, the use of plants to clean up toxic heavy metals, might remove them. Chelating agents are added to soil to solubilize the metals for enhanced phytoextraction. Yet no studies follow the displacement and leaching of heavy metals in soil with and without roots following solubilization with chelates. The objective of this work was to determine the mobility of heavy metals in biosolids applied to the surface of soil columns (76 cm long; 17 cm diam.) with or without plants (barley; Hordeum vulgare L.). Three weeks after barley was planted, all columns were irrigated with the disodium salt of the chelating agent, EDTA (ethylenediamine tetraacetic acid) (0.5 g/kg soil). Drainage water, soil, and plants were analyzed for heavy metals (Cd, Cu, Fe, Mn, Ni, Pb, Zn). Total concentrations of the heavy metals in all columns at the end of the experiment generally were lower in the top 30 cm of soil with EDTA than without EDTA. The chelate increased concentrations of heavy metals in shoots. With or without plants, the EDTA mobilized Cd, Fe, Mn, Ni, Pb, and Zn, which leached to drainage water. Drainage water from columns without EDTA had concentrations of these heavy metals below detection limits. Only Cu did not leach in the presence of EDTA. Even though roots retarded the movement of Cd, Fe, Mn, Ni, Pb, and Zn through the EDTA-treated soil from 1 d (Cd) to 5 d (Fe), the drainage water from columns with EDTA had concentrations of Cd, Fe, Mn, and Pb that exceeded drinking water standards by 1.3, 500, 620, and 8.6 times, respectively. Because the chelate rendered Cd, Fe, Mn, Ni, Pb, and Zn mobile, it is suggested that the theory for leaching of soluble salts, put forward by Nielsen and associates in 1965, could be applied to control movement of the heavy metals for maximum uptake during chelate-assisted phytoremediation.

  18. Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.

    Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K

    2016-10-24

    DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Passing Current through Touching Molecules

    Schull, G.; Frederiksen, Thomas; Brandbyge, Mads

    2009-01-01

    The charge flow from a single C-60 molecule to another one has been probed. The conformation and electronic states of both molecules on the contacting electrodes have been characterized using a cryogenic scanning tunneling microscope. While the contact conductance of a single molecule between two...

  20. A pressure-induced displacive phase transition in Tris(ethylenediamine) Nickel(II) nitrate

    Cameron, C.A.; Allan, D.R.; Kamenev, K.V.; Moggach, S.A.; Murrie, M.; Parsons, S.

    2014-01-01

    [Ni(en)(3)] [NO3](2) undergoes a displacive phase transition from P6(3)22 at ambient pressure to a lower symmetry P6(1)22/P6(5)22 structure between 0.82 and 0.87 GPa, which is characterized by a tripling of the unit cell c-axis and the number of molecules per unit cell. The same transition has been previously observed at 108 K. The application of pressure leads to a general shortening of O H hydrogen bonding interactions in the structure, with the greatest contraction (24%) occurring diagonal...

  1. Effects of threshold displacement energy on defect production by displacement cascades in α, β and γ-LiAlO2

    Tsuchihira, H.; Oda, T.; Tanaka, S.

    2013-01-01

    Threshold displacement energy evaluation and a series of displacement cascade simulations in α, β, and γ-LiAlO 2 were performed using molecular dynamics. Threshold displacement energy evaluations indicated that higher absolute ionic charge values and larger densities both increase threshold displacement energy. The displacement cascade simulations suggest that the influence of different crystal structures on the number of interstitial atoms generated in a displacement cascade is explainable almost entirely by the difference of the threshold displacement energy

  2. Contact angle hysteresis and motion behaviors of a water nano-droplet on suspended graphene under temperature gradient

    Foroutan, Masumeh; Fatemi, S. Mahmood; Esmaeilian, Farshad; Fadaei Naeini, Vahid; Baniassadi, Majid

    2018-05-01

    In the present work, the effect of temperature gradient on the behavior of a water nano-droplet resting on a suspended graphene was studied based on a non-equilibrium molecular dynamics simulation. The acquired results indicate that the applied temperature gradient to the suspended graphene drives the water nano-droplet to the colder region. The droplet accelerates its motion toward the cold reservoir as the temperature gradient is increased. In addition to the translational motion of the nano-droplet, the vortical motion of the water molecules was also observed. Contact angle analysis was also utilized to describe the directional motion of the nano-droplet. The translational motion of the droplet leads to the estimation of contact angle hysteresis through advancing and receding contact angles while the rotational motion resulted in the advancing and receding fronts being switched with one another through the simulation. The average displacement vector of the water molecules shows that parts of the droplet seem to stagnate while other parts rotate around them. The reason behind this particular behavior was studied based on interaction energy contours between a water molecule and the suspended graphene. The obtained data indicate that the rotational motion is in agreement with the migration of the water molecules to low interaction energy regions in order to avoid high interaction energy areas.

  3. Solvation in supercritical water

    Cochran, H.D.; Cummings, P.T.; Karaborni, S.

    1991-01-01

    The aim of this work is to determine the solvation structure in supercritical water composed with that in ambient water and in simple supercritical solvents. Molecular dynamics studies have been undertaken of systems that model ionic sodium and chloride, atomic argon, and molecular methanol in supercritical aqueous solutions using the simple point charge model of Berendsen for water. Because of the strong interactions between water and ions, ionic solutes are strongly attractive in supercritical water, forming large clusters of water molecules around each ion. Methanol is found to be a weakly-attractive solute in supercritical water. The cluster of excess water molecules surrounding a dissolved ion or polar molecule in supercritical aqueous solutions is comparable to the solvent clusters surrounding attractive solutes in simple supercritical fluids. Likewise, the deficit of water molecules surrounding a dissolved argon atom in supercritical aqueous solutions is comparable to that surrounding repulsive solutes in simple supercritical fluids. The number of hydrogen bonds per water molecule in supercritical water was found to be about one third the number in ambient water. The number of hydrogen bonds per water molecule surrounding a central particle in supercritical water was only mildly affected by the identify of the central particle--atom, molecule, or ion. These results should be helpful in developing a qualitative understanding of important processes that occur in supercritical water. 29 refs., 6 figs

  4. War, forced displacement and growth in Laotian adults.

    Clarkin, Patrick F

    2012-01-01

    Evidence from several populations suggests that war negatively impacts civilian nutrition, physical growth and overall health. This effect is often enduring or permanent, particularly if experienced early in life. To assess whether the number of lifetime displacement experiences and being displaced in infancy were associated with adult height, sitting height, leg length and the sitting height ratio. Retrospective questionnaires on displacement and resettlement experiences and anthropometric data were collected from a sample of Laotian adult refugees (ethnic Hmong and Lao; n = 365). All were born in Laos or Thailand and had resettled in French Guiana or the US. Many had been displaced several times by military conflict in Laos. In bivariate analyses, being displaced in infancy and the number of lifetime displacement experiences one had were negatively associated with final adult height and leg length in both sexes. The association was stronger in females, particularly Hmong females. There was no significant association between total displacement experiences and the sitting height ratio. In multiple regression analyses, linear growth in males was negatively associated with being displaced in infancy; in females, the number of lifetime displacement experiences was a significant predictor. Forced displacement from war appears to have a lasting effect on final adult height, sitting height and leg length, although not necessarily on the sitting height ratio in this sample.

  5. Mirror displacement energies and neutron skins

    Duflo, J.; Zuker, A.P.

    2002-01-01

    A gross estimate of the neutron skin [0.80(5)(N-Z)/A fm] is extracted from experimental proton radii, represented by a four parameter fit, and observed mirror displacement energies (CDE). The calculation of the latter relies on an accurately derived Coulomb energy and smooth averages of the charge symmetry breaking potentials constrained to state of the art values. The only free parameter is the neutron skin itself. The Nolen Schiffer anomaly is reduced to small deviations (rms=127 keV) that exhibit a secular trend. It is argued that with state of the art shell model calculations the anomaly should disappear. Highly accurate fits to proton radii emerge as a fringe benefit

  6. Core polarization and Coulomb displacement energies

    Shlomo, S.; Love, W.G.

    1982-01-01

    The contributions of core polarization terms (other than the Auerbach-Kahana-Weneser (AKW) effect) to Coulomb displacement energies of mirror nuclei near A = 16 and A = 40 are examined within the particle-vibration coupling model. The parameters of the model are determined using updated data on the locations and strengths of multipole core excitations. In the absence of relevant data an energy-weighted sum rule (EWSR) is exploited. Taking into account multipole excitations up to L = 5 and subtracting the contributions which are due to short-range correlations, significant contributions (1-3%) to ΔEsub(c) are found. These corrections arise from particle coupling to low-lying collective states (long-range correlations). The implications of these results on the Coulomb energy problem are discussed. (Auth.)

  7. Searching for displaced Higgs boson decays

    Csáki, Csaba; Kuflik, Eric; Lombardo, Salvator; Slone, Oren

    2015-10-01

    We study a simplified model of the Standard Model (SM) Higgs boson decaying to a degenerate pair of scalars which travel a macroscopic distance before decaying to SM particles. This is the leading signal for many well-motivated solutions to the hierarchy problem that do not propose additional light colored particles. Bounds for displaced Higgs boson decays below 10 cm are found by recasting existing tracker searches from Run I. New tracker search strategies, sensitive to the characteristics of these models and similar decays, are proposed with sensitivities projected for Run II at √{s }=13 TeV . With 20 fb-1 of data, we find that Higgs branching ratios down to 2 ×1 0-4 can be probed for centimeter decay lengths.

  8. Violence Against Displaced Syrian Women in Lebanon.

    Usta, Jinan; Masterson, Amelia Reese; Farver, JoAnn M

    2016-10-01

    This study used focus group discussions to explore 29 Syrian women's experiences of being displaced refugees in Lebanon. Women reported intimate partner violence (IPV), harassment, and community violence. They experienced difficult living conditions characterized by crowding and lack of privacy, adult unemployment, and overall feelings of helplessness. Most frequently, they used negative coping strategies, including justification and acceptance of IPV and often physically harmed their own children due to heightened stress. Some sought support from other Syrian refugee women. Although the study did not address the root causes of IPV, the results shed light on women's experiences and indicate that training them in positive coping strategies and establishing support groups would help them face IPV that occurs in refugee settings.

  9. Displaced fracture through the anterior atlantal synchondrosis

    Thakar, Chrishan; Allibone, James; Harish, Srinivasan; Saifuddin, Asif

    2005-01-01

    In the acute setting, accurate radiological interpretation of paediatric cervical spine trauma can be difficult due to a combination of normal variants and presence of multiple synchondroses. We present a rare case of a fracture through the anterior atlantal synchondrosis in a paediatric spine. A five-year-old boy, who fell backwards onto the top of his head while swinging across on a monkey bar frame, presented with neck pain, cervical muscle spasm and decreased right lateral rotation and extension of his neck. Computed tomography showed a displaced diastatic fracture through right anterior atlantal synchondrosis. There are only 12 cases of paediatric C1 fractures reported in the world literature. The importance of considering this diagnosis in the appropriate clinical setting, and the normal variants in the paediatric atlas that can cause diagnostic dilemma to the interpreting radiologist, are discussed in this case report. (orig.)

  10. Displaced fracture through the anterior atlantal synchondrosis

    Thakar, Chrishan; Allibone, James [Royal National Orthopaedic Hospital NHS Trust, Department of Spinal Deformity, Stanmore, Middlesex (United Kingdom); Harish, Srinivasan [Royal National Orthopaedic Hospital NHS Trust, Department of Radiology, Stanmore, Middlesex (United Kingdom); Saifuddin, Asif [Royal National Orthopaedic Hospital NHS Trust, Department of Radiology, Stanmore, Middlesex (United Kingdom); University College, The Institute of Orthopaedics and Musculoskeletal Sciences, London (United Kingdom)

    2005-09-01

    In the acute setting, accurate radiological interpretation of paediatric cervical spine trauma can be difficult due to a combination of normal variants and presence of multiple synchondroses. We present a rare case of a fracture through the anterior atlantal synchondrosis in a paediatric spine. A five-year-old boy, who fell backwards onto the top of his head while swinging across on a monkey bar frame, presented with neck pain, cervical muscle spasm and decreased right lateral rotation and extension of his neck. Computed tomography showed a displaced diastatic fracture through right anterior atlantal synchondrosis. There are only 12 cases of paediatric C1 fractures reported in the world literature. The importance of considering this diagnosis in the appropriate clinical setting, and the normal variants in the paediatric atlas that can cause diagnostic dilemma to the interpreting radiologist, are discussed in this case report. (orig.)

  11. The REFANI-S study protocol: a non-randomised cluster controlled trial to assess the role of an unconditional cash transfer, a non-food item kit, and free piped water in reducing the risk of acute malnutrition among children aged 6-59 months living in camps for internally displaced persons in the Afgooye corridor, Somalia.

    Jelle, Mohamed; Grijalva-Eternod, Carlos S; Haghparast-Bidgoli, Hassan; King, Sarah; Cox, Cassy L; Skordis-Worrall, Jolene; Morrison, Joanna; Colbourn, Timothy; Fottrell, Edward; Seal, Andrew J

    2017-07-06

    The prevalence of acute malnutrition is often high in emergency-affected populations and is associated with elevated mortality risk and long-term health consequences. Increasingly, cash transfer programmes (CTP) are used instead of direct food aid as a nutritional intervention, but there is sparse evidence on their nutritional impact. We aim to understand whether CTP reduces acute malnutrition and its known risk factors. A non-randomised, cluster-controlled trial will assess the impact of an unconditional cash transfer of US$84 per month for 5 months, a single non-food items kit, and free piped water on the risk of acute malnutrition in children, aged 6-59 months. The study will take place in camps for internally displaced persons (IDP) in peri-urban Mogadishu, Somalia. A cluster will consist of one IDP camp and 10 camps will be allocated to receive the intervention based on vulnerability targeting criteria. The control camps will then be selected from the same geographical area. Needs assessment data indicates small differences in vulnerability between camps. In each trial arm, 120 households will be randomly sampled and two detailed household surveys will be implemented at baseline and 3 months after the initiation of the cash transfer. The survey questionnaire will cover risk factors for malnutrition including household expenditure, assets, food security, diet diversity, coping strategies, morbidity, WASH, and access to health care. A community surveillance system will collect monthly mid-upper arm circumference measurements from all children aged 6-59 months in the study clusters to assess the incidence of acute malnutrition over the duration of the intervention. Process evaluation data will be compiled from routine quantitative programme data and primary qualitative data collected using key informant interviews and focus group discussions. The UK Department for International Development will provide funding for this study. The European Civil Protection and

  12. The REFANI-S study protocol: a non-randomised cluster controlled trial to assess the role of an unconditional cash transfer, a non-food item kit, and free piped water in reducing the risk of acute malnutrition among children aged 6–59 months living in camps for internally displaced persons in the Afgooye corridor, Somalia

    Mohamed Jelle

    2017-07-01

    Full Text Available Abstract Background The prevalence of acute malnutrition is often high in emergency-affected populations and is associated with elevated mortality risk and long-term health consequences. Increasingly, cash transfer programmes (CTP are used instead of direct food aid as a nutritional intervention, but there is sparse evidence on their nutritional impact. We aim to understand whether CTP reduces acute malnutrition and its known risk factors. Methods/design A non-randomised, cluster-controlled trial will assess the impact of an unconditional cash transfer of US$84 per month for 5 months, a single non-food items kit, and free piped water on the risk of acute malnutrition in children, aged 6–59 months. The study will take place in camps for internally displaced persons (IDP in peri-urban Mogadishu, Somalia. A cluster will consist of one IDP camp and 10 camps will be allocated to receive the intervention based on vulnerability targeting criteria. The control camps will then be selected from the same geographical area. Needs assessment data indicates small differences in vulnerability between camps. In each trial arm, 120 households will be randomly sampled and two detailed household surveys will be implemented at baseline and 3 months after the initiation of the cash transfer. The survey questionnaire will cover risk factors for malnutrition including household expenditure, assets, food security, diet diversity, coping strategies, morbidity, WASH, and access to health care. A community surveillance system will collect monthly mid-upper arm circumference measurements from all children aged 6–59 months in the study clusters to assess the incidence of acute malnutrition over the duration of the intervention. Process evaluation data will be compiled from routine quantitative programme data and primary qualitative data collected using key informant interviews and focus group discussions. The UK Department for International Development will provide

  13. Connecting localized DNA strand displacement reactions

    Mullor Ruiz, Ismael; Arbona, Jean-Michel; Lad, Amitkumar; Mendoza, Oscar; Aimé, Jean-Pierre; Elezgaray, Juan

    2015-07-01

    Logic circuits based on DNA strand displacement reactions have been shown to be versatile enough to compute the square root of four-bit numbers. The implementation of these circuits as a set of bulk reactions faces difficulties which include leaky reactions and intrinsically slow, diffusion-limited reaction rates. In this paper, we consider simple examples of these circuits when they are attached to platforms (DNA origamis). As expected, constraining distances between DNA strands leads to faster reaction rates. However, it also induces side-effects that are not detectable in the solution-phase version of this circuitry. Appropriate design of the system, including protection and asymmetry between input and fuel strands, leads to a reproducible behaviour, at least one order of magnitude faster than the one observed under bulk conditions.Logic circuits based on DNA strand displacement reactions have been shown to be versatile enough to compute the square root of four-bit numbers. The implementation of these circuits as a set of bulk reactions faces difficulties which include leaky reactions and intrinsically slow, diffusion-limited reaction rates. In this paper, we consider simple examples of these circuits when they are attached to platforms (DNA origamis). As expected, constraining distances between DNA strands leads to faster reaction rates. However, it also induces side-effects that are not detectable in the solution-phase version of this circuitry. Appropriate design of the system, including protection and asymmetry between input and fuel strands, leads to a reproducible behaviour, at least one order of magnitude faster than the one observed under bulk conditions. Electronic supplementary information (ESI) available. See DOI: 10.1039/C5NR02434J

  14. Fundamental principles of rotary displacement meters

    Rosen, J. [Schlumberger Industries, Owenton, KY (United States)

    1995-12-01

    The gas meter exists to continually and accurately measure the volume of gas supplied over the complete flow range of the load. In effect the gas meter serves as the {open_quotes}cash register{close_quotes} of the gas industry; its accurate and dependable performance ensures fair dealings for both the supplier and the user. An investment both in and of itself, the gas meter should be chosen as a function of its usefullness both over the short term and the long term. Thus in addition to initial cost, one must take into account various associated factors, costs and benefits, including the following: Design Characteristics Application, suitability, Meter features and options, Operation constraints, Installation, Service and maintenance, Repair and replacement, Life expectancy, Compatibility with complimentary products, Correcting devices, Remote reading capabilities, Data generation and gathering, Upgradeabilty. This paper will look at one positive displacement meter, the Rotary meter, and address the fundamentals principals of the technology as well as looking at some of the benefits derived from its application. Rotary positive displacement meters were introduced at the end of last century. Used primarily for metering transmission sized loads, the meters` measuring capabilities have extended to cover nearly all areas of distribution with exception of domestic applications. Rotary meters are available in rated capacities from 800 cfh to 102,000 cfh and operating pressures from 175 PSIG to 1440 PSIG. The use of rotary meters on load ranges in the 800 to 10,000 cfh category has increased and is replacing the use of diaphragm meters because of the smaller relative size of rotaries, and improvements in rangeabilities in the last few years. Turbine meters are usually the meter of choice on loads over 16,000 cfh unless a meter with high rangeability is required because of varying load characteristics, in which case a large foot mounted rotary might still be selected.

  15. Lanthanide single molecule magnets

    Tang, Jinkui; Zhang, Peng [Chinese Academy of Sciences, Changchun (China). Changchun Inst. of Applied Chemistry

    2015-10-01

    This book begins by providing basic information on single-molecule magnets (SMMs), covering the magnetism of lanthanide, the characterization and relaxation dynamics of SMMs and advanced means of studying lanthanide SMMs. It then systematically introduces lanthanide SMMs ranging from mononuclear and dinuclear to polynuclear complexes, classifying them and highlighting those SMMs with high barrier and blocking temperatures - an approach that provides some very valuable indicators for the structural features needed to optimize the contribution of an Ising type spin to a molecular magnet. The final chapter presents some of the newest developments in the lanthanide SMM field, such as the design of multifunctional and stimuli-responsive magnetic materials as well as the anchoring and organization of the SMMs on surfaces. In addition, the crystal structure and magnetic data are clearly presented with a wealth of illustrations in each chapter, helping newcomers and experts alike to better grasp ongoing trends and explore new directions.

  16. Lanthanide single molecule magnets

    Tang, Jinkui

    2015-01-01

    This book begins by providing basic information on single-molecule magnets (SMMs), covering the magnetism of lanthanide, the characterization and relaxation dynamics of SMMs, and advanced means of studying lanthanide SMMs. It then systematically introduces lanthanide SMMs ranging from mononuclear and dinuclear to polynuclear complexes, classifying them and highlighting those SMMs with high barrier and blocking temperatures – an approach that provides some very valuable indicators for the structural features needed to optimize the contribution of an Ising type spin to a molecular magnet. The final chapter presents some of the newest developments in the lanthanide SMM field, such as the design of multifunctional and stimuli-responsive magnetic materials as well as the anchoring and organization of the SMMs on surfaces. In addition, the crystal structure and magnetic data are clearly presented with a wealth of illustrations in each chapter, helping newcomers and experts alike to better grasp ongoing trends and...

  17. Molecules in the Spotlight

    Cryan, James

    2010-01-26

    SLAC has just unveiled the world's first X-ray laser, the LCLS. This machine produces pulses of X-rays that are ten billion times brighter than those from conventional sources. One of the goals of this machine is to make movies of chemical reactions, including reactions necessary for life and reactions that might power new energy technologies. This public lecture will show the first results from the LCLS. As a first target, we have chosen nitrogen gas, the main component of the air we breathe. Using the unprecedented power of the LCLS X-rays as a blasting torch, we have created new forms of this molecule and with unique electronic arrangements. Please share with us the first insights from this new technology.

  18. Magnetic field modification of ultracold molecule-molecule collisions

    Tscherbul, T V; Suleimanov, Yu V; Aquilanti, V; Krems, R V

    2009-01-01

    We present an accurate quantum mechanical study of molecule-molecule collisions in the presence of a magnetic field. The work focuses on the analysis of elastic scattering and spin relaxation in collisions of O 2 ( 3 Σ g - ) molecules at cold (∼0.1 K) and ultracold (∼10 -6 K) temperatures. Our calculations show that magnetic spin relaxation in molecule-molecule collisions is extremely efficient except at magnetic fields below 1 mT. The rate constant for spin relaxation at T=0.1 K and a magnetic field of 0.1 T is found to be as large as 6.1x10 -11 cm -3 s -1 . The magnetic field dependence of elastic and inelastic scattering cross sections at ultracold temperatures is dominated by a manifold of Feshbach resonances with the density of ∼100 resonances per Tesla for collisions of molecules in the absolute ground state. This suggests that the scattering length of ultracold molecules in the absolute ground state can be effectively tuned in a very wide range of magnetic fields. Our calculations demonstrate that the number and properties of the magnetic Feshbach resonances are dramatically different for molecules in the absolute ground and excited spin states. The density of Feshbach resonances for molecule-molecule scattering in the low-field-seeking Zeeman state is reduced by a factor of 10.

  19. Variable reluctance displacement transducer temperature compensated to 6500F

    1975-01-01

    In pressurized water reactor tests, compact instruments for accurate measurement of small displacements in a 650 0 F environment are often required. In the case of blowdown tests such as the Loss of Fluid Test (LOFT) or Semiscale computer code development tests, not only is the initial environment water at 650 0 F and 2200 psi but it undergoes a severe transient due to depressurization. Since the LOFT and Semiscale tests are run just for the purpose of obtaining data during the depressurization, instruments used to obtain the data must not give false outputs induced by the change in environment. A LOFT rho v 2 probe and a Semiscale drag disk are described. Each utilizes a variable reluctance transducer (VRT) for indication of the drag-disk location and a torsion bar for drag-disk restoring force. The VRT, in addition to being thermally gain and null offset stable, is fabricated from materials known to be resistant to large nuclear radiation levels and has successfully passed a fast neutron radiation test of 2.7 x 10 17 nvt without failure

  20. The primary processes by impact of ionizing radiations with water

    Znamirovschi, V.; Mastan, I.; Cozar, O.

    1976-01-01

    The problem concerning primary processes in radiolysis of water is discussed. The results on the excitation and ionization of water molecule, dissociation of the parent-molecular ion of water and dissociation of excited molecule of water are presented. (author)