WorldWideScience

Sample records for directed human anti-caix

  1. Unique biological properties of catalytic domain directed human anti-CAIX antibodies discovered through phage-display technology.

    Directory of Open Access Journals (Sweden)

    Chen Xu

    2010-03-01

    Full Text Available Carbonic anhydrase IX (CAIX, gene G250/MN-encoded transmembrane protein is highly expressed in various human epithelial tumors such as renal clear cell carcinoma (RCC, but absent from the corresponding normal tissues. Besides the CA signal transduction activity, CAIX may serve as a biomarker in early stages of oncogenesis and also as a reliable marker of hypoxia, which is associated with tumor resistance to chemotherapy and radiotherapy. Although results from preclinical and clinical studies have shown CAIX as a promising target for detection and therapy for RCC, only a limited number of murine monoclonal antibodies (mAbs and one humanized mAb are available for clinical testing and development. In this study, paramagnetic proteoliposomes of CAIX (CAIX-PMPLs were constructed and used for anti-CAIX antibody selection from our 27 billion human single-chain antibody (scFv phage display libraries. A panel of thirteen human scFvs that specifically recognize CAIX expressed on cell surface was identified, epitope mapped primarily to the CA domain, and affinity-binding constants (KD determined. These human anti-CAIX mAbs are diverse in their functions including induction of surface CAIX internalization into endosomes and inhibition of the carbonic anhydrase activity, the latter being a unique feature that has not been previously reported for anti-CAIX antibodies. These human anti-CAIX antibodies are important reagents for development of new immunotherapies and diagnostic tools for RCC treatment as well as extending our knowledge on the basic structure-function relationships of the CAIX molecule.

  2. Human anti-CAIX antibodies mediate immune cell inhibition of renal cell carcinoma in vitro and in a humanized mouse model in vivo.

    Science.gov (United States)

    Chang, De-Kuan; Moniz, Raymond J; Xu, Zhongyao; Sun, Jiusong; Signoretti, Sabina; Zhu, Quan; Marasco, Wayne A

    2015-06-11

    Carbonic anhydrase (CA) IX is a surface-expressed protein that is upregulated by the hypoxia inducible factor (HIF) and represents a prototypic tumor-associated antigen that is overexpressed on renal cell carcinoma (RCC). Therapeutic approaches targeting CAIX have focused on the development of CAIX inhibitors and specific immunotherapies including monoclonal antibodies (mAbs). However, current in vivo mouse models used to characterize the anti-tumor properties of fully human anti-CAIX mAbs have significant limitations since the role of human effector cells in tumor cell killing in vivo is not directly evaluated. The role of human anti-CAIX mAbs on CAIX(+) RCC tumor cell killing by immunocytes or complement was tested in vitro by antibody-dependent cell-mediated cytotoxicity (ADCC), complement-dependent cytotoxicity (CDC) and antibody-dependent cellular phagocytosis (ADCP) as well as on CAIX(+) RCC cellular motility, wound healing, migration and proliferation. The in vivo therapeutic activity mediated by anti-CAIX mAbs was determined by using a novel orthotopic RCC xenograft humanized animal model and analyzed by histology and FACS staining. Our studies demonstrate the capacity of human anti-CAIX mAbs that inhibit CA enzymatic activity to result in immune-mediated killing of RCC, including nature killer (NK) cell-mediated ADCC, CDC, and macrophage-mediated ADCP. The killing activity correlated positively with the level of CAIX expression on RCC tumor cell lines. In addition, Fc engineering of anti-CAIX mAbs was shown to enhance the ADCC activity against RCC. We also demonstrate that these anti-CAIX mAbs inhibit migration of RCC cells in vitro. Finally, through the implementation of a novel orthotopic RCC model utilizing allogeneic human peripheral blood mononuclear cells in NOD/SCID/IL2Rγ(-/-) mice, we show that anti-CAIX mAbs are capable of mediating human immune response in vivo including tumor infiltration of NK cells and activation of T cells, resulting in

  3. Regression of established renal cell carcinoma in nude mice using lentivirus-transduced human T cells expressing a human anti-CAIX chimeric antigen receptor

    Directory of Open Access Journals (Sweden)

    Agnes Shuk-Yee Lo

    2014-01-01

    Full Text Available Carbonic anhydrase IX (CAIX is a tumor-associated antigen and marker of hypoxia that is overexpressed on > 90% of clear-cell type renal cell carcinoma (RCC but not on neighboring normal kidney tissue. Here, we report on the construction of two chimeric antigen receptors (CARs that utilize a carbonic anhydrase (CA domain mapped, human single chain antibody (scFv G36 as a targeting moiety but differ in their capacity to provide costimulatory signaling for optimal T cell proliferation and tumor cell killing. The resulting anti-CAIX CARs were expressed on human primary T cells via lentivirus transduction. CAR-transduced T cells (CART cells expressing second-generation G36-CD28-TCRζ exhibited more potent in vitro antitumor effects on CAIX+ RCC cells than first-generation G36-CD8-TCRζ including cytotoxicity, cytokine secretion, proliferation, and clonal expansion. Adoptive G36-CD28-TCRζ CART cell therapy combined with high-dose interleukin (IL-2 injection also lead to superior regression of established RCC in nude mice with evidence of tumor cell apoptosis and tissue necrosis. These results suggest that the fully human G36-CD28-TCRζ CARs should provide substantial improvements over first-generation mouse anti-CAIX CARs in clinical use through reduced human anti-mouse antibody responses against the targeting scFv and administration of lower doses of T cells during CART cell therapy of CAIX+ RCC.

  4. Direct dating of human fossils.

    Science.gov (United States)

    Grün, Rainer

    2006-01-01

    The methods that can be used for the direct dating of human remains comprise of radiocarbon, U-series, electron spin resonance (ESR), and amino acid racemization (AAR). This review gives an introduction to these methods in the context of dating human bones and teeth. Recent advances in ultrafiltration techniques have expanded the dating range of radiocarbon. It now seems feasible to reliably date bones up to 55,000 years. New developments in laser ablation mass spectrometry permit the in situ analysis of U-series isotopes, thus providing a rapid and virtually non-destructive dating method back to about 300,000 years. This is of particular importance when used in conjunction with non-destructive ESR analysis. New approaches in AAR analysis may lead to a renaissance of this method. The potential and present limitations of these direct dating techniques are discussed for sites relevant to the reconstruction of modern human evolution, including Florisbad, Border Cave, Tabun, Skhul, Qafzeh, Vindija, Banyoles, and Lake Mungo. (c) 2006 Wiley-Liss, Inc.

  5. Human-directed aggression in the cat.

    Science.gov (United States)

    Curtis, Terry Marie

    2008-09-01

    Feline aggression-between cats or directed at humans-is, after inappropriate elimination and urine-marking behaviors, the second most common reason cats are seen by behavioral specialists. For diagnosis and treatment it is important to determine the motivation for the aggression. The more common causes for human-directed aggression in cats include play, fear, petting intolerance, and redirected aggression. Other causes include pain and maternal behavior. Sexually motivated and status related aggression are much more rare. Treatment includes a combination of behavioral modification, environmental modification, and, in some cases, medication.

  6. Human-Robot Interaction Directed Research Project

    Science.gov (United States)

    Rochlis, Jennifer; Ezer, Neta; Sandor, Aniko

    2011-01-01

    Human-robot interaction (HRI) is about understanding and shaping the interactions between humans and robots (Goodrich & Schultz, 2007). It is important to evaluate how the design of interfaces and command modalities affect the human s ability to perform tasks accurately, efficiently, and effectively (Crandall, Goodrich, Olsen Jr., & Nielsen, 2005) It is also critical to evaluate the effects of human-robot interfaces and command modalities on operator mental workload (Sheridan, 1992) and situation awareness (Endsley, Bolt , & Jones, 2003). By understanding the effects of interface design on human performance, workload, and situation awareness, interfaces can be developed that support the human in performing tasks with minimal errors and with appropriate interaction time and effort. Thus, the results of research on human-robot interfaces have direct implications for design. Because the factors associated with interfaces and command modalities in HRI are too numerous to address in 3 years of research, the proposed research concentrates on three manageable areas applicable to National Aeronautics and Space Administration (NASA) robot systems. These topic areas emerged from the Fiscal Year (FY) 2011 work that included extensive literature reviews and observations of NASA systems. The three topic areas are: 1) video overlays, 2) camera views, and 3) command modalities. Each area is described in detail below, along with relevance to existing NASA human-robot systems. In addition to studies in these three topic areas, a workshop is proposed for FY12. The workshop will bring together experts in human-robot interaction and robotics to discuss the state of the practice as applicable to research in space robotics. Studies proposed in the area of video overlays consider two factors in the implementation of augmented reality (AR) for operator displays during teleoperation. The first of these factors is the type of navigational guidance provided by AR symbology. In the proposed

  7. [Advance directives, a tool to humanize care].

    Science.gov (United States)

    Olmari-Ebbing, M; Zumbach, C N; Forest, M I; Rapin, C H

    2000-07-01

    The relationship between the patient and a medical care giver is complex specially as it implies to the human, juridical and practical points of view. It depends on legal and deontological considerations, but also on professional habits. Today, we are confronted to a fundamental modification of this relationship. Professional guidelines exist, but are rarely applied and rarely taught in universities. However, patients are eager to move from a paternalistic relationship to a true partnership, more harmonious and more respectful of individual values ("value based medicine"). Advance directives give us an opportunity to improve our practices and to provide care consistent with the needs and wishes of each patient.

  8. Human movement is both diffusive and directed.

    Directory of Open Access Journals (Sweden)

    Mark Padgham

    Full Text Available Understanding the influence of the built environment on human movement requires quantifying spatial structure in a general sense. Because of the difficulty of this task, studies of movement dynamics often ignore spatial heterogeneity and treat movement through journey lengths or distances alone. This study analyses public bicycle data from central London to reveal that, although journey distances, directions, and frequencies of occurrence are spatially variable, their relative spatial patterns remain largely constant, suggesting the influence of a fixed spatial template. A method is presented to describe this underlying space in terms of the relative orientation of movements toward, away from, and around locations of geographical or cultural significance. This produces two fields: one of convergence and one of divergence, which are able to accurately reconstruct the observed spatial variations in movement. These two fields also reveal categorical distinctions between shorter journeys merely serving diffusion away from significant locations, and longer journeys intentionally serving transport between spatially distinct centres of collective importance. Collective patterns of human movement are thus revealed to arise from a combination of both diffusive and directed movement, with aggregate statistics such as mean travel distances primarily determined by relative numbers of these two kinds of journeys.

  9. Direct numerical simulation of human phonation

    Science.gov (United States)

    Bodony, Daniel; Saurabh, Shakti

    2017-11-01

    The generation and propagation of the human voice in three-dimensions is studied using direct numerical simulation. A full body domain is employed for the purpose of directly computing the sound in the region past the speaker's mouth. The air in the vocal tract is modeled as a compressible and viscous fluid interacting with the elastic vocal folds. The vocal fold tissue material properties are multi-layered, with varying stiffness, and a linear elastic transversely isotropic model is utilized and implemented in a quadratic finite element code. The fluid-solid domains are coupled through a boundary-fitted interface and utilize a Poisson equation-based mesh deformation method. A kinematic constraint based on a specified minimum gap between the vocal folds is applied to prevent collision during glottal closure. Both near VF flow dynamics and far-field acoustics have been studied. A comparison is drawn to current two-dimensional simulations as well as to data from the literature. Near field vocal fold dynamics and glottal flow results are studied and in good agreement with previous three-dimensional phonation studies. Far-field acoustic characteristics, when compared to their two-dimensional counterpart, are shown to be sensitive to the dimensionality. Supported by the National Science Foundation (CAREER Award Number 1150439).

  10. Human-Robot Interaction Directed Research Project

    Science.gov (United States)

    Sandor, Aniko; Cross, Ernest V., II; Chang, Mai Lee

    2014-01-01

    Human-robot interaction (HRI) is a discipline investigating the factors affecting the interactions between humans and robots. It is important to evaluate how the design of interfaces and command modalities affect the human's ability to perform tasks accurately, efficiently, and effectively when working with a robot. By understanding the effects of interface design on human performance, workload, and situation awareness, interfaces can be developed to appropriately support the human in performing tasks with minimal errors and with appropriate interaction time and effort. Thus, the results of research on human-robot interfaces have direct implications for the design of robotic systems. This DRP concentrates on three areas associated with interfaces and command modalities in HRI which are applicable to NASA robot systems: 1) Video Overlays, 2) Camera Views, and 3) Command Modalities. The first study focused on video overlays that investigated how Augmented Reality (AR) symbology can be added to the human-robot interface to improve teleoperation performance. Three types of AR symbology were explored in this study, command guidance (CG), situation guidance (SG), and both (SCG). CG symbology gives operators explicit instructions on what commands to input, whereas SG symbology gives operators implicit cues so that operators can infer the input commands. The combination of CG and SG provided operators with explicit and implicit cues allowing the operator to choose which symbology to utilize. The objective of the study was to understand how AR symbology affects the human operator's ability to align a robot arm to a target using a flight stick and the ability to allocate attention between the symbology and external views of the world. The study evaluated the effects type of symbology (CG and SG) has on operator tasks performance and attention allocation during teleoperation of a robot arm. The second study expanded on the first study by evaluating the effects of the type of

  11. Effects of flow gradients on directional radiation of human voice.

    Science.gov (United States)

    Pulkki, Ville; Lähivaara, Timo; Huhtakallio, Ilkka

    2018-02-01

    In voice communication in windy outdoor conditions, complex velocity gradients appear in the flow field around the source, the receiver, and also in the atmosphere. It is commonly known that voice emanates stronger towards the downstream direction when compared with the upstream direction. In literature, the atmospheric effects are used to explain the stronger emanation in the downstream direction. This work shows that the wind also has an effect to the directivity of voice also favouring the downstream direction. The effect is addressed by measurements and simulations. Laboratory measurements are conducted by using a large pendulum with a loudspeaker mimicking the human head, whereas practical measurements utilizing the human voice are realized by placing a subject through the roof window of a moving car. The measurements and a simulation indicate congruent results in the speech frequency range: When the source faces the downstream direction, stronger radiation coinciding with the wind direction is observed, and when it faces the upstream direction, radiation is not affected notably. The simulated flow gradients show a wake region in the downstream direction, and the simulated acoustic field in the flow show that the region causes a wave-guide effect focusing the sound in the direction.

  12. Direct evidence of milk consumption from ancient human dental calculus

    DEFF Research Database (Denmark)

    Warinner, C.; Hendy, J.; Speller, C.

    2014-01-01

    directly to individuals and their dairy livestock. Here we report the first direct evidence of milk consumption, the whey protein β-lactoglobulin (BLG), preserved in human dental calculus from the Bronze Age (ca. 3000 BCE) to the present day. Using protein tandem mass spectrometry, we demonstrate that BLG...... is a species-specific biomarker of dairy consumption, and we identify individuals consuming cattle, sheep, and goat milk products in the archaeological record. We then apply this method to human dental calculus from Greenland's medieval Norse colonies, and report a decline of this biomarker leading up...

  13. Evidence of directional and stabilizing selection in contemporary humans.

    Science.gov (United States)

    Sanjak, Jaleal S; Sidorenko, Julia; Robinson, Matthew R; Thornton, Kevin R; Visscher, Peter M

    2018-01-02

    Modern molecular genetic datasets, primarily collected to study the biology of human health and disease, can be used to directly measure the action of natural selection and reveal important features of contemporary human evolution. Here we leverage the UK Biobank data to test for the presence of linear and nonlinear natural selection in a contemporary population of the United Kingdom. We obtain phenotypic and genetic evidence consistent with the action of linear/directional selection. Phenotypic evidence suggests that stabilizing selection, which acts to reduce variance in the population without necessarily modifying the population mean, is widespread and relatively weak in comparison with estimates from other species.

  14. Structural behavior of human lumbar intervertebral disc under direct shear.

    Science.gov (United States)

    Schmidt, Hendrik; Häussler, Kim; Wilke, Hans-Joachim; Wolfram, Uwe

    2015-03-18

    The intervertebral disc (IVD) is a complex, flexible joint between adjacent vertebral bodies that provides load transmission while permitting movements of the spinal column. Finite element models can be used to help clarify why and how IVDs fail or degenerate. To do so, it is of importance to validate those models against controllable experiments. Due to missing experimental data, shear properties are not used thus far in validating finite element models. This study aimed to investigate the structural shear properties of human lumbar IVDs in posteroanterior (PA) and laterolateral (LL) loading directions. Fourteen lumbar IVDs (median age: 49 years) underwent direct shear in PA and LL loading directions. A custom-build shear device was used in combination with a materials testing machine to load the specimens until failure. Shear stiffness, ultimate shear force and displacement, and work to failure were determined. Each specimen was tested until complete or partial disruption. Median stiffness in PA direction was 490 N/mm and in LL direction 568 N/mm. Median ultimate shear force in the PA direction was 2,877 N and in the LL direction 3,199 N. Work to failure was 12 Nm in the PA and 9 Nm in the LL direction. This study was an experiment to subject IVDs to direct shear. The results could help us to understand the structure and function of IVDs with regard to mechanical spinal stability, and they can be used to validate finite element models of the IVD.

  15. Domestic dogs and puppies can use human voice direction referentially.

    Science.gov (United States)

    Rossano, Federico; Nitzschner, Marie; Tomasello, Michael

    2014-06-22

    Domestic dogs are particularly skilled at using human visual signals to locate hidden food. This is, to our knowledge, the first series of studies that investigates the ability of dogs to use only auditory communicative acts to locate hidden food. In a first study, from behind a barrier, a human expressed excitement towards a baited box on either the right or left side, while sitting closer to the unbaited box. Dogs were successful in following the human's voice direction and locating the food. In the two following control studies, we excluded the possibility that dogs could locate the box containing food just by relying on smell, and we showed that they would interpret a human's voice direction in a referential manner only when they could locate a possible referent (i.e. one of the boxes) in the environment. Finally, in a fourth study, we tested 8-14-week-old puppies in the main experimental test and found that those with a reasonable amount of human experience performed overall even better than the adult dogs. These results suggest that domestic dogs' skills in comprehending human communication are not based on visual cues alone, but are instead multi-modal and highly flexible. Moreover, the similarity between young and adult dogs' performances has important implications for the domestication hypothesis.

  16. Direct dating of Early Upper Palaeolithic human remains from Mladec.

    Science.gov (United States)

    Wild, Eva M; Teschler-Nicola, Maria; Kutschera, Walter; Steier, Peter; Trinkaus, Erik; Wanek, Wolfgang

    2005-05-19

    The human fossil assemblage from the Mladec Caves in Moravia (Czech Republic) has been considered to derive from a middle or later phase of the Central European Aurignacian period on the basis of archaeological remains (a few stone artefacts and organic items such as bone points, awls, perforated teeth), despite questions of association between the human fossils and the archaeological materials and concerning the chronological implications of the limited archaeological remains. The morphological variability in the human assemblage, the presence of apparently archaic features in some specimens, and the assumed early date of the remains have made this fossil assemblage pivotal in assessments of modern human emergence within Europe. We present here the first successful direct accelerator mass spectrometry radiocarbon dating of five representative human fossils from the site. We selected sample materials from teeth and from one bone for 14C dating. The four tooth samples yielded uncalibrated ages of approximately 31,000 14C years before present, and the bone sample (an ulna) provided an uncertain more-recent age. These data are sufficient to confirm that the Mladec human assemblage is the oldest cranial, dental and postcranial assemblage of early modern humans in Europe and is therefore central to discussions of modern human emergence in the northwestern Old World and the fate of the Neanderthals.

  17. Chimeric antigen receptor T cells secreting anti-PD-L1 antibodies more effectively regress renal cell carcinoma in a humanized mouse model.

    Science.gov (United States)

    Suarez, Eloah Rabello; Chang, De Kuan; Sun, Jiusong; Sui, Jianhua; Freeman, Gordon J; Signoretti, Sabina; Zhu, Quan; Marasco, Wayne A

    2016-06-07

    Advances in the treatment of metastatic clear cell renal cell carcinoma (ccRCC) have led to improved progression-free survival of many patients; however the therapies are toxic, rarely achieve durable long-term complete responses and are not curative. Herein we used a single bicistronic lentiviral vector to develop a new combination immunotherapy that consists of human anti-carbonic anhydrase IX (CAIX)-targeted chimeric antigen receptor (CAR) T cells engineered to secrete human anti-programmed death ligand 1 (PD-L1) antibodies at the tumor site. The local antibody delivery led to marked immune checkpoint blockade. Tumor growth diminished 5 times and tumor weight reduced 50-80% when compared with the anti-CAIX CAR T cells alone in a humanized mice model of ccRCC. The expression of PD-L1 and Ki67 in the tumors decreased and an increase in granzyme B levels was found in CAR T cells. The anti-PD-L1 IgG1 isotype, which is capable of mediating ADCC, was also able to recruit human NK cells to the tumor site in vivo. These armed second-generation CAR T cells empowered to secrete human anti-PD-L1 antibodies in the ccRCC milieu to combat T cell exhaustion is an innovation in this field that should provide renewed potential for CAR T cell immunotherapy of solid tumors where limited efficacy is currently seen.

  18. Human-directed social behaviour in dogs shows significant heritability.

    Science.gov (United States)

    Persson, M E; Roth, L S V; Johnsson, M; Wright, D; Jensen, P

    2015-04-01

    Through domestication and co-evolution with humans, dogs have developed abilities to attract human attention, e.g. in a manner of seeking assistance when faced with a problem solving task. The aims of this study were to investigate within breed variation in human-directed contact seeking in dogs and to estimate its genetic basis. To do this, 498 research beagles, bred and kept under standardized conditions, were tested in an unsolvable problem task. Contact seeking behaviours recorded included both eye contact and physical interactions. Behavioural data was summarized through a principal component analysis, resulting in four components: test interactions, social interactions, eye contact and physical contact. Females scored significantly higher on social interactions and physical contact and age had an effect on eye contact scores. Narrow sense heritabilities (h(2) ) of the two largest components were estimated at 0.32 and 0.23 but were not significant for the last two components. These results show that within the studied dog population, behavioural variation in human-directed social behaviours was sex dependent and that the utilization of eye contact seeking increased with age and experience. Hence, heritability estimates indicate a significant genetic contribution to the variation found in human-directed social interactions, suggesting that social skills in dogs have a genetic basis, but can also be shaped and enhanced through individual experiences. This research gives the opportunity to further investigate the genetics behind dogs' social skills, which could also play a significant part into research on human social disorders such as autism. © 2015 John Wiley & Sons Ltd and International Behavioural and Neural Genetics Society.

  19. Inflammatory aetiology of human myometrial activation tested using directed graphs.

    Directory of Open Access Journals (Sweden)

    2005-07-01

    Full Text Available THERE ARE THREE MAIN HYPOTHESES FOR THE ACTIVATION OF THE HUMAN UTERUS AT LABOUR: functional progesterone withdrawal, inflammatory stimulation, and oxytocin receptor activation. To test these alternatives we have taken information and data from the literature to develop causal pathway models for the activation of human myometrium. The data provided quantitative RT-PCR results on key genes from samples taken before and during labour. Principal component analysis showed that pre-labour samples form a homogenous group compared to those during labour. We therefore modelled the alternative causal pathways in non-labouring samples using directed graphs and statistically compared the likelihood of the different models using structural equations and D-separation approaches. Using the computer program LISREL, inflammatory activation as a primary event was highly consistent with the data (p = 0.925, progesterone withdrawal, as a primary event, is plausible (p = 0.499, yet comparatively unlikely, oxytocin receptor mediated initiation is less compatible with the data (p = 0.091. DGraph, a software program that creates directed graphs, produced similar results (p= 0.684, p= 0.280, and p = 0.04, respectively. This outcome supports an inflammatory aetiology for human labour. Our results demonstrate the value of directed graphs in determining the likelihood of causal relationships in biology in situations where experiments are not possible.

  20. Direct evidence of milk consumption from ancient human dental calculus.

    Science.gov (United States)

    Warinner, C; Hendy, J; Speller, C; Cappellini, E; Fischer, R; Trachsel, C; Arneborg, J; Lynnerup, N; Craig, O E; Swallow, D M; Fotakis, A; Christensen, R J; Olsen, J V; Liebert, A; Montalva, N; Fiddyment, S; Charlton, S; Mackie, M; Canci, A; Bouwman, A; Rühli, F; Gilbert, M T P; Collins, M J

    2014-11-27

    Milk is a major food of global economic importance, and its consumption is regarded as a classic example of gene-culture evolution. Humans have exploited animal milk as a food resource for at least 8500 years, but the origins, spread, and scale of dairying remain poorly understood. Indirect lines of evidence, such as lipid isotopic ratios of pottery residues, faunal mortality profiles, and lactase persistence allele frequencies, provide a partial picture of this process; however, in order to understand how, where, and when humans consumed milk products, it is necessary to link evidence of consumption directly to individuals and their dairy livestock. Here we report the first direct evidence of milk consumption, the whey protein β-lactoglobulin (BLG), preserved in human dental calculus from the Bronze Age (ca. 3000 BCE) to the present day. Using protein tandem mass spectrometry, we demonstrate that BLG is a species-specific biomarker of dairy consumption, and we identify individuals consuming cattle, sheep, and goat milk products in the archaeological record. We then apply this method to human dental calculus from Greenland's medieval Norse colonies, and report a decline of this biomarker leading up to the abandonment of the Norse Greenland colonies in the 15(th) century CE.

  1. Earliest directly-dated human skull-cups.

    Directory of Open Access Journals (Sweden)

    Silvia M Bello

    Full Text Available BACKGROUND: The use of human braincases as drinking cups and containers has extensive historic and ethnographic documentation, but archaeological examples are extremely rare. In the Upper Palaeolithic of western Europe, cut-marked and broken human bones are widespread in the Magdalenian (∼15 to 12,000 years BP and skull-cup preparation is an element of this tradition. PRINCIPAL FINDINGS: Here we describe the post-mortem processing of human heads at the Upper Palaeolithic site of Gough's Cave (Somerset, England and identify a range of modifications associated with the production of skull-cups. New analyses of human remains from Gough's Cave demonstrate the skilled post-mortem manipulation of human bodies. Results of the research suggest the processing of cadavers for the consumption of body tissues (bone marrow, accompanied by meticulous shaping of cranial vaults. The distribution of cut-marks and percussion features indicates that the skulls were scrupulously 'cleaned' of any soft tissues, and subsequently modified by controlled removal of the facial region and breakage of the cranial base along a sub-horizontal plane. The vaults were also 'retouched', possibly to make the broken edges more regular. This manipulation suggests the shaping of skulls to produce skull-cups. CONCLUSIONS: Three skull-cups have been identified amongst the human bones from Gough's Cave. New ultrafiltered radiocarbon determinations provide direct dates of about 14,700 cal BP, making these the oldest directly dated skull-cups and the only examples known from the British Isles.

  2. Directional and balancing selection in human beta-defensins

    Directory of Open Access Journals (Sweden)

    Armour John AL

    2008-04-01

    Full Text Available Abstract Background In primates, infection is an important force driving gene evolution, and this is reflected in the importance of infectious disease in human morbidity today. The beta-defensins are key components of the innate immune system, with antimicrobial and cell signalling roles, but also reproductive functions. Here we examine evolution of beta-defensins in catarrhine primates and variation within different human populations. Results We show that five beta-defensin genes that do not show copy number variation in humans show evidence of positive selection in catarrhine primates, and identify specific codons that have been under selective pressure. Direct haplotyping of DEFB127 in humans suggests long-term balancing selection: there are two highly diverged haplotype clades carrying different variants of a codon that, in primates, is positively selected. For DEFB132, we show that extensive diversity, including a four-state amino acid polymorphism (valine, isoleucine, alanine and threonine at position 93, is present in hunter-gatherer populations, both African and non-African, but not found in samples from agricultural populations. Conclusion Some, but not all, beta-defensin genes show positive selection in catarrhine primates. There is suggestive evidence of different selective pressures on these genes in humans, but the nature of the selective pressure remains unclear and is likely to differ between populations.

  3. Directional and balancing selection in human beta-defensins.

    Science.gov (United States)

    Hollox, Edward J; Armour, John A L

    2008-04-16

    In primates, infection is an important force driving gene evolution, and this is reflected in the importance of infectious disease in human morbidity today. The beta-defensins are key components of the innate immune system, with antimicrobial and cell signalling roles, but also reproductive functions. Here we examine evolution of beta-defensins in catarrhine primates and variation within different human populations. We show that five beta-defensin genes that do not show copy number variation in humans show evidence of positive selection in catarrhine primates, and identify specific codons that have been under selective pressure. Direct haplotyping of DEFB127 in humans suggests long-term balancing selection: there are two highly diverged haplotype clades carrying different variants of a codon that, in primates, is positively selected. For DEFB132, we show that extensive diversity, including a four-state amino acid polymorphism (valine, isoleucine, alanine and threonine at position 93), is present in hunter-gatherer populations, both African and non-African, but not found in samples from agricultural populations. Some, but not all, beta-defensin genes show positive selection in catarrhine primates. There is suggestive evidence of different selective pressures on these genes in humans, but the nature of the selective pressure remains unclear and is likely to differ between populations.

  4. Foreign Direct Investments and Human Capital Development in Subsaharan Africa

    Directory of Open Access Journals (Sweden)

    Luc NEMBOT NDEFFO

    2010-12-01

    Full Text Available The objective of the present study is to estimate the impact of foreign direct investments on human capital development in 32 Subsaharan African countries over the period 1980 – 2005. Human capital is captured by the percentage of children in full-time education in primary and secondary schools. Panel data regressions are used for the estimations. The results show a correlation not only between FDI and the percentage of children in full-time education in primary school but also between the FDI and the percentage of children in full-time education in secondary school. These results are not significant for that. This shows that FDI directed towards Sub-Saharan Africa still remain insufficient. That is why a lot of effort should be made in order to favour the attraction of FDI in this part of the continent. The other variables which have a positive and significant impact on the percentage of children in full-time education are: the domestic investment rate, public sector expenditures, life expectancy at birth and the growth rate of the gross domestic product per capita.

  5. Human platelet vasopressin receptor identification by direct ultraviolet photoaffinity labeling

    International Nuclear Information System (INIS)

    Thibonnier, M.

    1987-01-01

    Tritiated vasopressin ([ 3 H]AVP) was directly crosslinked to its human platelet receptor by using an ultraviolet irradiation procedure. After preincubation with [ 3 H]AVP, the hydrodynamic parameters of the hormone-receptor complexes solubilized with 3-[(3-cholamidopropyl)dimethylammonio]-1-propane sulfonate were derived from Sephacryl S-300 superfine gel filtration and from sucrose density gradient ultracentrifugation experiments. The following values were obtained: Stoke's radius = 5.48 +/- 0.1 nm, apparent sedimentation coefficient = 5.55 +/- 0.1 S, and calculated molecular weight = 132,000. On sodium dodecyl sulfate-8% polyacrylamide slab gel electrophoresis under reducing conditions, [ 3 H]AVP preferentially and specifically labeled a 125,000-dalton protein. The labeling of this protein was suppressed by addition of excess cold vasopressin, whereas angiotensin II did not inhibit incorporation of tritiated vasopressin in this protein. These results suggest that direct UV-photoaffinity labelling with [ 3 H]AVP is a suitable tool for the purification of the human platelet vasopressin receptor

  6. Directional asymmetries in human smooth pursuit eye movements.

    Science.gov (United States)

    Ke, Sally R; Lam, Jessica; Pai, Dinesh K; Spering, Miriam

    2013-06-27

    Humans make smooth pursuit eye movements to bring the image of a moving object onto the fovea. Although pursuit accuracy is critical to prevent motion blur, the eye often falls behind the target. Previous studies suggest that pursuit accuracy differs between motion directions. Here, we systematically assess asymmetries in smooth pursuit. In experiment 1, binocular eye movements were recorded while observers (n = 20) tracked a small spot of light moving along one of four cardinal or diagonal axes across a featureless background. We analyzed pursuit latency, acceleration, peak velocity, gain, and catch-up saccade latency, number, and amplitude. In experiment 2 (n = 22), we examined the effects of spatial location and constrained stimulus motion within the upper or lower visual field. Pursuit was significantly faster (higher acceleration, peak velocity, and gain) and smoother (fewer and later catch-up saccades) in response to downward versus upward motion in both the upper and the lower visual fields. Pursuit was also more accurate and smoother in response to horizontal versus vertical motion. CONCLUSIONS. Our study is the first to report a consistent up-down asymmetry in human adults, regardless of visual field. Our findings suggest that pursuit asymmetries are adaptive responses to the requirements of the visual context: preferred motion directions (horizontal and downward) are more critical to our survival than nonpreferred ones.

  7. Directed neuronal differentiation of human embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Noggle Scott A

    2003-10-01

    Full Text Available Abstract Background We have developed a culture system for the efficient and directed differentiation of human embryonic stem cells (HESCs to neural precursors and neurons. HESC were maintained by manual passaging and were differentiated to a morphologically distinct OCT-4+/SSEA-4- monolayer cell type prior to the derivation of embryoid bodies. Embryoid bodies were grown in suspension in serum free conditions, in the presence of 50% conditioned medium from the human hepatocarcinoma cell line HepG2 (MedII. Results A neural precursor population was observed within HESC derived serum free embryoid bodies cultured in MedII conditioned medium, around 7–10 days after derivation. The neural precursors were organized into rosettes comprised of a central cavity surrounded by ring of cells, 4 to 8 cells in width. The central cells within rosettes were proliferating, as indicated by the presence of condensed mitotic chromosomes and by phosphoHistone H3 immunostaining. When plated and maintained in adherent culture, the rosettes of neural precursors were surrounded by large interwoven networks of neurites. Immunostaining demonstrated the expression of nestin in rosettes and associated non-neuronal cell types, and a radial expression of Map-2 in rosettes. Differentiated neurons expressed the markers Map-2 and Neurofilament H, and a subpopulation of the neurons expressed tyrosine hydroxylase, a marker for dopaminergic neurons. Conclusion This novel directed differentiation approach led to the efficient derivation of neuronal cultures from HESCs, including the differentiation of tyrosine hydroxylase expressing neurons. HESC were morphologically differentiated to a monolayer OCT-4+ cell type, which was used to derive embryoid bodies directly into serum free conditions. Exposure to the MedII conditioned medium enhanced the derivation of neural precursors, the first example of the effect of this conditioned medium on HESC.

  8. Sleep-dependent directional coupling between human neocortex and hippocampus.

    Science.gov (United States)

    Wagner, Tobias; Axmacher, Nikolai; Lehnertz, Klaus; Elger, Christian E; Fell, Jürgen

    2010-02-01

    Complex interactions between neocortex and hippocampus are the neural basis of memory formation. Two-step theories of memory formation suggest that initial encoding of novel information depends on the induction of rapid plasticity within the hippocampus, and is followed by a second sleep-dependent step of memory consolidation. These theories predict information flow from the neocortex into the hippocampus during waking state and in the reverse direction during sleep. However, experimental evidence that interactions between hippocampus and neocortex have a predominant direction which reverses during sleep rely on cross-correlation analysis of data from animal experiments and yielded inconsistent results. Here, we investigated directional coupling in intracranial EEG data from human subjects using a phase-modeling approach which is well suited to reveal functional interdependencies in oscillatory data. In general, we observed that the anterior hippocampus predominantly drives nearby and remote brain regions. Surprisingly, however, the influence of neocortical regions on the hippocampus significantly increased during sleep as compared to waking state. These results question the standard model of hippocampal-neocortical interactions and suggest that sleep-dependent consolidation is accomplished by an active retrieval of hippocampal information by the neocortex. Copyright 2009 Elsevier Srl. All rights reserved.

  9. Mechanical impedance of the human body in vertical direction.

    Science.gov (United States)

    Holmlund, P; Lundström, R; Lindberg, L

    2000-08-01

    The mechanical impedance of the human body in sitting posture and vertical direction was measured during different experimental conditions, such as vibration level (0.5-1.4 m/s2), frequency (2-100 Hz), body weight (57-92 kg), relaxed and erect upper body posture. The outcome shows that impedance increases with frequency up to a peak at about 5 Hz after which it decreases in a complex manner which includes two additional peaks. The frequency at which the first and second impedance peak occurs decreases with higher vibration level. Erect, compared with relaxed body posture resulted in higher impedance magnitudes and with peaks located at somewhat higher frequencies. Heavy persons show higher impedance magnitudes and peaks at lower frequencies.

  10. Characterization of monoclonal antibodies directed against human thyroid stimulating hormone

    International Nuclear Information System (INIS)

    Soos, M.; Siddle, K.

    1982-01-01

    Monoclonal antibodies directed against human thyroid stimulating hormone (TSH) were obtained from hybrid myelomas, following fusion of mouse NSI myeloma cells with mouse spleen cells. Ten different antibodies were obtained from 4 separate fusions. Eight antibodies were of the IgG 1 subclass. Affinities of antibodies for TSH were in the range 2 x 10 8 -5 x 10 10 M -1 . Five of the antibodies were specific for TSH and did not react with LH, FSH or hCG. The remaining antibodies reacted with all these hormones and were assumed to recognise their common (α) subunit. The 5 specific antibodies fell into 3 subgroups recognising distinct antigenic determinants, whereas the 5 non-specific antibodies recognised a single determinant or closely related set of sites. It is concluded that these antibodies should be valuable reagents for use in sensitive and specific two-site immunoradiometric assays. (Auth.)

  11. Human genome sequencing with direct x-ray holographic imaging

    International Nuclear Information System (INIS)

    Rhodes, C.K.

    1993-01-01

    Direct holographic imaging of biological materials is widely applicable to the study of the structure, properties and action of genetic material. This particular application involves the sequencing of the human genome where prospective genomic imaging technology is composed of three subtechnologies, name an x-ray holographic camera, suitable chemistry and enzymology for the preparation of tagged DNA samples, and the illuminator in the form of an x-ray laser. We report appropriate x-ray camera, embodied by the instrument developed by MCR, is available and that suitable chemical and enzymatic procedures exist for the preparation of the necessary tagged DNA strands. Concerning the future development of the x-ray illuminator. We find that a practical small scale x-ray light source is indeed feasible. This outcome requires the use of unconventional physical processes in order to achieve the necessary power-compression in the amplifying medium. The understanding of these new physical mechanisms is developing rapidly. Importantly, although the x-ray source does not currently exist, the understanding of these new physical mechanisms is developing rapidly and the research has established the basic scaling laws that will determine the properties of the x-ray illuminator. When this x-ray source becomes available, an extremely rapid and cost effective instrument for 3-D imaging of biological materials can be applied to a wide range of biological structural assays, including the base-pair sequencing of the human genome and many questions regarding its higher levels of organization

  12. Direct Electrical Stimulation in the Human Brain Disrupts Melody Processing.

    Science.gov (United States)

    Garcea, Frank E; Chernoff, Benjamin L; Diamond, Bram; Lewis, Wesley; Sims, Maxwell H; Tomlinson, Samuel B; Teghipco, Alexander; Belkhir, Raouf; Gannon, Sarah B; Erickson, Steve; Smith, Susan O; Stone, Jonathan; Liu, Lynn; Tollefson, Trenton; Langfitt, John; Marvin, Elizabeth; Pilcher, Webster H; Mahon, Bradford Z

    2017-09-11

    Prior research using functional magnetic resonance imaging (fMRI) [1-4] and behavioral studies of patients with acquired or congenital amusia [5-8] suggest that the right posterior superior temporal gyrus (STG) in the human brain is specialized for aspects of music processing (for review, see [9-12]). Intracranial electrical brain stimulation in awake neurosurgery patients is a powerful means to determine the computations supported by specific brain regions and networks [13-21] because it provides reversible causal evidence with high spatial resolution (for review, see [22, 23]). Prior intracranial stimulation or cortical cooling studies have investigated musical abilities related to reading music scores [13, 14] and singing familiar songs [24, 25]. However, individuals with amusia (congenitally, or from a brain injury) have difficulty humming melodies but can be spared for singing familiar songs with familiar lyrics [26]. Here we report a detailed study of a musician with a low-grade tumor in the right temporal lobe. Functional MRI was used pre-operatively to localize music processing to the right STG, and the patient subsequently underwent awake intraoperative mapping using direct electrical stimulation during a melody repetition task. Stimulation of the right STG induced "music arrest" and errors in pitch but did not affect language processing. These findings provide causal evidence for the functional segregation of music and language processing in the human brain and confirm a specific role of the right STG in melody processing. VIDEO ABSTRACT. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Ultraviolet radiation directly induces pigment production by cultured human melanocytes

    International Nuclear Information System (INIS)

    Friedmann, P.S.; Gilchrest, B.A.

    1987-01-01

    In humans the major stimulus for cutaneous pigmentation is ultraviolet radiation (UVR). Little is known about the mechanism underlying this response, in part because of the complexity of interactions in whole epidermis. Using a recently developed culture system, human melanocytes were exposed daily to a physiologic range of UVR doses from a solar simulator. Responses were determined 24 hours after the last exposure. There was a dose-related increase in melanin content per cell and uptake of 14 C-DOPA, accompanied by growth inhibition. Cells from donors of different racial origin gave proportionately similar increases in melanin, although there were approximately tenfold differences in basal values. Light and electron microscopy revealed UVR-stimulated increases in dendricity as well as melanosome number and degree of melanization, analogous to the well-recognized melanocyte changes following sun exposure of intact skin. Similar responses were seen with Cloudman S91 melanoma cells, although this murine cell line required lower UVR dosages and fewer exposures for maximal stimulation. These data establish that UVR is capable of directly stimulating melanogenesis. Because cyclic AMP elevation has been associated in some settings with increased pigment production by cultured melanocytes, preliminary experiments were conducted to see if the effects of UVR were mediated by cAMP. Both alpha-MSH and isobutylmethylxanthine (IBMX), as positive controls, caused a fourfold increase in cAMP level in human melanocytes and/or S91 cells, but following a dose of UVR sufficient to stimulate pigment production there was no change in cAMP level up to 4 hours after exposure. Thus, it appears that the UVR-induced melanogenesis is mediated by cAMP-independent mechanisms

  14. Coupled motions direct electrons along human microsomal P450 Chains.

    Directory of Open Access Journals (Sweden)

    Christopher R Pudney

    2011-12-01

    Full Text Available Protein domain motion is often implicated in biological electron transfer, but the general significance of motion is not clear. Motion has been implicated in the transfer of electrons from human cytochrome P450 reductase (CPR to all microsomal cytochrome P450s (CYPs. Our hypothesis is that tight coupling of motion with enzyme chemistry can signal "ready and waiting" states for electron transfer from CPR to downstream CYPs and support vectorial electron transfer across complex redox chains. We developed a novel approach to study the time-dependence of dynamical change during catalysis that reports on the changing conformational states of CPR. FRET was linked to stopped-flow studies of electron transfer in CPR that contains donor-acceptor fluorophores on the enzyme surface. Open and closed states of CPR were correlated with key steps in the catalytic cycle which demonstrated how redox chemistry and NADPH binding drive successive opening and closing of the enzyme. Specifically, we provide evidence that reduction of the flavin moieties in CPR induces CPR opening, whereas ligand binding induces CPR closing. A dynamic reaction cycle was created in which CPR optimizes internal electron transfer between flavin cofactors by adopting closed states and signals "ready and waiting" conformations to partner CYP enzymes by adopting more open states. This complex, temporal control of enzyme motion is used to catalyze directional electron transfer from NADPH→FAD→FMN→heme, thereby facilitating all microsomal P450-catalysed reactions. Motions critical to the broader biological functions of CPR are tightly coupled to enzyme chemistry in the human NADPH-CPR-CYP redox chain. That redox chemistry alone is sufficient to drive functionally necessary, large-scale conformational change is remarkable. Rather than relying on stochastic conformational sampling, our study highlights a need for tight coupling of motion to enzyme chemistry to give vectorial electron

  15. Direct methods for measuring radionuclides in the human body

    International Nuclear Information System (INIS)

    1996-01-01

    Occupational exposure leading to intakes of internally incorporated radionuclides can occur as a result of various activities. This includes work associated with the different stages of the nuclear fuel cycle, the use of radioactive sources in medicine, scientific research, agriculture and industry, and occupations which involve exposure to enhanced levels of naturally occurring radionuclides. In 1987 the IAEA published a Safety Guide on basic principles for occupational radiation monitoring which set forth principles and objectives of a strategy for monitoring exposures of workers. Since drafting of the present Safety Practice commenced, the International Basic Safety Standards for Protection against Ionizing Radiation and for the Safety of Radiation Sources (BSS) have been issued. On the basis of the principles laid down in the BSS, the 1987 Safety Guide is also being revised, and recommendations on the assessment of the occupational intake of radioactive materials are to be added. The present Safety Practice, which deals with direct measurement of radionuclides in the human body, is the first to be published in this area. Refs, figs, tabs

  16. Functional corticostriatal connection topographies predict goal directed behaviour in humans

    NARCIS (Netherlands)

    Marquand, A.F.; Haak, K.V.; Beckmann, C.F.

    2017-01-01

    Anatomical tracing studies in non-human primates have suggested that corticostriatal connectivity is topographically organized: nearby locations in striatum are connected with nearby locations in cortex. The topographic organization of corticostriatal connectivity is thought to underpin many

  17. The human gut microbiome: current knowledge, challenges, and future directions.

    Science.gov (United States)

    Dave, Maneesh; Higgins, Peter D; Middha, Sumit; Rioux, Kevin P

    2012-10-01

    The Human Genome Project was completed a decade ago, leaving a legacy of process, tools, and infrastructure now being turned to the study of the microbes that reside in and on the human body as determinants of health and disease, and has been branded "The Human Microbiome Project." Of the various niches under investigation, the human gut houses the most complex and abundant microbial community and is an arena for important host-microbial interactions that have both local and systemic impact. Initial studies of the human microbiome have been largely descriptive, a testing ground for innovative molecular techniques and new hypotheses. Methods for studying the microbiome have quickly evolved from low-resolution surveys of microbial community structure to high-definition description of composition, function, and ecology. Next-generation sequencing technologies combined with advanced bioinformatics place us at the doorstep of revolutionary insight into the composition, capability, and activity of the human intestinal microbiome. Renewed efforts to cultivate previously "uncultivable" microbes will be important to the overall understanding of gut ecology. There remain numerous methodological challenges to the effective study and understanding of the gut microbiome, largely relating to study design, sample collection, and the number of predictor variables. Strategic collaboration of clinicians, microbiologists, molecular biologists, computational scientists, and bioinformaticians is the ideal paradigm for success in this field. Meaningful interpretation of the gut microbiome requires that host genetic and environmental influences be controlled or accounted for. Understanding the gut microbiome in healthy humans is a foundation for discovering its influence in various important gastrointestinal and nutritional diseases (eg, inflammatory bowel disease, diabetes, and obesity), and for rational translation to human health gains. Copyright © 2012 Mosby, Inc. All rights

  18. Consciousness in humans and non-human animals: recent advances and future directions.

    Science.gov (United States)

    Boly, Melanie; Seth, Anil K; Wilke, Melanie; Ingmundson, Paul; Baars, Bernard; Laureys, Steven; Edelman, David B; Tsuchiya, Naotsugu

    2013-10-31

    This joint article reflects the authors' personal views regarding noteworthy advances in the neuroscience of consciousness in the last 10 years, and suggests what we feel may be promising future directions. It is based on a small conference at the Samoset Resort in Rockport, Maine, USA, in July of 2012, organized by the Mind Science Foundation of San Antonio, Texas. Here, we summarize recent advances in our understanding of subjectivity in humans and other animals, including empirical, applied, technical, and conceptual insights. These include the evidence for the importance of fronto-parietal connectivity and of "top-down" processes, both of which enable information to travel across distant cortical areas effectively, as well as numerous dissociations between consciousness and cognitive functions, such as attention, in humans. In addition, we describe the development of mental imagery paradigms, which made it possible to identify covert awareness in non-responsive subjects. Non-human animal consciousness research has also witnessed substantial advances on the specific role of cortical areas and higher order thalamus for consciousness, thanks to important technological enhancements. In addition, much progress has been made in the understanding of non-vertebrate cognition relevant to possible conscious states. Finally, major advances have been made in theories of consciousness, and also in their comparison with the available evidence. Along with reviewing these findings, each author suggests future avenues for research in their field of investigation.

  19. Direct detection of a single photon by humans

    Science.gov (United States)

    Tinsley, Jonathan N.; Molodtsov, Maxim I.; Prevedel, Robert; Wartmann, David; Espigulé-Pons, Jofre; Lauwers, Mattias; Vaziri, Alipasha

    2016-01-01

    Despite investigations for over 70 years, the absolute limits of human vision have remained unclear. Rod cells respond to individual photons, yet whether a single-photon incident on the eye can be perceived by a human subject has remained a fundamental open question. Here we report that humans can detect a single-photon incident on the cornea with a probability significantly above chance. This was achieved by implementing a combination of a psychophysics procedure with a quantum light source that can generate single-photon states of light. We further discover that the probability of reporting a single photon is modulated by the presence of an earlier photon, suggesting a priming process that temporarily enhances the effective gain of the visual system on the timescale of seconds. PMID:27434854

  20. Direct action of endocrine disrupting chemicals on human sperm

    DEFF Research Database (Denmark)

    Schiffer, Christian; Müller, Astrid; Egeberg, Dorte L

    2014-01-01

    Synthetic endocrine disrupting chemicals (EDCs), omnipresent in food, household, and personal care products, have been implicated in adverse trends in human reproduction, including infertility and increasing demand for assisted reproduction. Here, we study the action of 96 ubiquitous EDCs on huma...

  1. Directional dominance on stature and cognition in diverse human populations

    NARCIS (Netherlands)

    Joshi, Peter K.; Esko, Tonu; Mattsson, Hannele; Eklund, Niina; Gandin, Ilaria; Nutile, Teresa; Jackson, Anne U.; Schurmann, Claudia; Smith, Albert V.; Zhang, Weihua; Okada, Yukinori; Stancakova, Alena; Faul, Jessica D.; Zhao, Wei; Bartz, Traci M.; Concas, Maria Pina; Franceschini, Nora; Enroth, Stefan; Vitart, Veronique; Trompet, Stella; Guo, Xiuqing; Chasman, Daniel I.; O'Connel, Jeffrey R.; Corre, Tanguy; Nongmaithem, Suraj S.; Chen, Yuning; Mangino, Massimo; Ruggiero, Daniela; Traglia, Michela; Farmaki, Aliki-Eleni; Kacprowski, Tim; Bjonnes, Andrew; van der Spek, Ashley; Wu, Ying; Giri, Anil K.; Yanek, Lisa R.; Wang, Lihua; Hofer, Edith; Rietveld, Cornelius A.; McLeod, Olga; Cornelis, Marilyn C.; Pattaro, Cristian; Verweij, Niek; Baumbach, Clemens; Abdellaoui, Abdel; Warren, Helen R.; Vuckovic, Dragana; Mei, Hao; Bouchard, Claude; Perry, John R. B.; Cappellani, Stefania; Mirza, Saira S.; Benton, Miles C.; Broeckel, Ulrich; Medland, Sarah E.; Lind, PenelopeA.; Malerba, Giovanni; Drong, Alexander; Yengo, Loic; Bielak, Lawrence F.; Zhi, Degui; van der Most, Peter J.; Shriner, Daniel; Maegi, Reedik; Hemani, Gibran; Karaderi, Tugce; Wang, Zhaoming; Liu, Tian; Demuth, Ilja; Zhao, Jing Hua; Meng, Weihua; Lataniotis, Lazaros; van der Laan, Sander W.; Bradfield, Jonathan P.; Wood, Andrew R.; Bonnefond, Amelie; Ahluwalia, Tarunveer S.; Hall, LeanneM.; Salvi, Erika; Yazar, Seyhan; Carstensen, Lisbeth; de Haan, Hugoline G.; Abney, Mark; Afzal, Uzma; Allison, Matthew A.; Amin, Najaf; Asselbergs, Folkert W.; Bakker, Stephan J. L.; Barr, R. Graham; Baumeister, Sebastian E.; Benjamin, Daniel J.; Bergmann, Sven; Boerwinkle, Eric; Bottinger, Erwin P.; Campbell, Archie; Chakravarti, Aravinda; Chan, Yingleong; Chanock, Stephen J.; Chen, Constance; Chen, Y. -D. Ida; Collins, Francis S.; Connell, John; Correa, Adolfo; Cupples, L. Adrienne; Smith, George Davey; Davies, Gail; Doerr, Marcus; Ehret, Georg; Ellis, Stephen B.; Feenstra, Bjarke; Feitosa, Mary F.; Ford, Ian; Fox, Caroline S.; Frayling, Timothy M.; Friedrich, Nele; Geller, Frank; Scotland, Generation; Gillham-Nasenya, Irina; Gottesman, Omri; Graff, Misa; Grodstein, Francine; Gu, Charles; Haley, Chris; Hammond, Christopher J.; Harris, Sarah E.; Harris, Tamara B.; Hastie, Nicholas D.; Heard-Costa, Nancy L.; Heikkila, Kauko; Hocking, Lynne J.; Homuth, Georg; Hottenga, Jouke-Jan; Huang, Jinyan; Huffman, Jennifer E.; Hysi, Pirro G.; Ikram, M. Arfan; Ingelsson, Erik; Joensuu, Anni; Johansson, Asa; Jousilahti, Pekka; Jukema, J. Wouter; Kahonen, Mika; Kamatani, Yoichiro; Kanoni, Stavroula; Kerr, Shona M.; Khan, Nazir M.; Koellinger, Philipp; Koistinen, Heikki A.; Kooner, Manraj K.; Kubo, Michiaki; Kuusisto, Johanna; Lahti, Jari; Launer, Lenore J.; Lea, Rodney A.; Lehne, Benjamin; Lehtimaki, Terho; Liewald, David C. M.; Lind, Lars; Loh, Marie; Lokki, Marja-Liisa; London, Stephanie J.; Loomis, Stephanie J.; Loukola, Anu; Lu, Yingchang; Lumley, Thomas; Lundqvist, Annamari; Mannisto, Satu; Marques-Vidal, Pedro; Masciullo, Corrado; Matchan, Angela; Mathias, Rasika A.; Matsuda, Koichi; Meigs, James B.; Meisinger, Christa; Meitinger, Thomas; Menni, Cristina; Mentch, Frank D.; Mihailov, Evelin; Milani, Lili; Montasser, May E.; Montgomery, GrantW.; Morrison, Alanna; Myers, Richard H.; Nadukuru, Rajiv; Navarro, Pau; Nelis, Mari; Nieminen, Markku S.; Nolte, Ilja M.; O'Connor, George T.; Ogunniyi, Adesola; Padmanabhan, Sandosh; Palmas, Walter R.; Pankow, James S.; Patarcic, Inga; Pavani, Francesca; Peyser, Patricia A.; Pietilainen, Kirsi; Poulter, Neil; Prokopenko, Inga; Ralhan, Sarju; Redmond, Paul; Rich, Stephen S.; Rissanen, Harri; Robino, Antonietta; Rose, Lynda M.; Rose, Richard; Sala, Cinzia; Salako, Babatunde; Salomaa, Veikko; Sarin, Antti-Pekka; Saxena, Richa; Schmidt, Helena; Scott, Laura J.; Scott, William R.; Sennblad, Bengt; Seshadri, Sudha; Sever, Peter; Shrestha, Smeeta; Smith, Blair H.; Smith, Jennifer A.; Soranzo, Nicole; Sotoodehnia, Nona; Southam, Lorraine; Stanton, Alice V.; Stathopoulou, Maria G.; Strauch, Konstantin; Strawbridge, Rona J.; Suderman, Matthew J.; Tandon, Nikhil; Tang, Sian-Tsun; Taylor, Kent D.; Tayo, Bamidele O.; Toeglhofer, Anna Maria; Tomaszewski, Maciej; Tsernikova, Natalia; Tuomilehto, Jaakko; Uitterlinden, Andre G.; Vaidya, Dhananjay; Vlieg, Astrid van Hylckama; van Setten, Jessica; Vasankari, Tuula; Vedantam, Sailaja; Vlachopoulou, Efthymia; Vozzi, Diego; Vuoksimaa, Eero; Waldenberger, Melanie; Ware, Erin B.; Wentworth-Shields, William; Whitfield, John B.; Wild, Sarah; Willemsen, Gonneke; Yajnik, Chittaranjan S.; Yao, Jie; Zaza, Gianluigi; Zhu, Xiaofeng; Salem, Rany M.; Melbye, Mads; Bisgaard, Hans; Samani, Nilesh J.; Cusi, Daniele; Mackey, David A.; Cooper, Richard S.; Froguel, Philippe; Pasterkamp, Gerard; Grant, Struan F. A.; Hakonarson, Hakon; Ferrucci, Luigi; Scott, Robert A.; Morris, Andrew D.; Palmer, Colin N. A.; Dedoussis, George; Deloukas, Panos; Bertram, Lars; Lindenberger, Ulman; Berndt, Sonja I.; Lindgren, Cecilia M.; Timpson, Nicholas J.; Toenjes, Anke; Munroe, Patricia B.; Sorensen, Thorkild I. A.; Rotimi, Charles N.; Arnett, Donna K.; Oldehinkel, Albertine J.; Kardia, Sharon L. R.; Balkau, Beverley; Gambaro, Giovanni; Morris, Andrew P.; Eriksson, Johan G.; Wright, Margie J.; Martin, Nicholas G.; Hunt, Steven C.; Starr, John M.; Deary, Ian J.; Griffiths, Lyn R.; Tiemeier, Henning; Pirastu, Nicola; Kaprio, Jaakko; Wareham, Nicholas J.; Perusse, Louis; Wilson, James G.; Girotto, Giorgia; Caulfield, Mark J.; Raitakari, Olli; Boomsma, Dorret I.; Gieger, Christian; van der Harst, Pim; Hicks, Andrew A.; Kraft, Peter; Sinisalo, Juha; Knekt, Paul; Johannesson, Magnus; Magnusson, Patrik K. E.; Hamsten, Anders; Schmidt, Reinhold; Borecki, Ingrid B.; Vartiainen, Erkki; Becker, Diane M.; Bharadwaj, Dwaipayan; Mohlke, Karen L.; Boehnke, Michael; van Duijn, Cornelia M.; Sanghera, Dharambir K.; Teumer, Alexander; Zeggini, Eleftheria; Metspalu, Andres; Gasparini, Paolo; Ulivi, Sheila; Ober, Carole; Toniolo, Daniela; Rudan, Igor; Porteous, David J.; Ciullo, Marina; Spector, Tim D.; Hayward, Caroline; Dupuis, Josee; Loos, Ruth J. F.; Wright, Alan F.; Chandak, Giriraj R.; Vollenweider, Peter; Shuldiner, Alan R.; Ridker, Paul M.; Rotter, Jerome I.; Sattar, Naveed; Gyllensten, Ulf; North, Kari E.; Pirastu, Mario; Psaty, Bruce M.; Weir, David R.; Laakso, Markku; Gudnason, Vilmundur; Takahashi, Atsushi; Chambers, John C.; Kooner, Jaspal S.; Strachan, David P.; Campbell, Harry; Hirschhorn, Joel N.; Perola, Markus; Polasek, Ozren; Wilson, James F.

    2015-01-01

    Homozygosity has long been associated with rare, often devastating, Mendelian disorders(1), and Darwin was one of the first to recognize that inbreeding reduces evolutionary fitness(2). However, the effect of the more distant parental relatedness that is common in modern human populations is less

  2. Direct human impacts on the peatland carbon sink

    Science.gov (United States)

    Jukka Laine; Kari Minkkinen; Carl Trettin

    2009-01-01

    Northern peatlands occupy over 3 million km2 globally and contain the largest carbon (C) pool (typically >100 kg C m-2) among terrestrial ecosystems. Agriculture, forestry, and peat harvesting are the principal human-induced activities that alter the peatland and hence the distribution and flux of carbon. As a prerequisite to those uses, the peatland is usually...

  3. Legon at 60: New Directions for the Humanities | Oduyoye | Legon ...

    African Journals Online (AJOL)

    Legon Journal of the Humanities. Journal Home · ABOUT THIS JOURNAL · Advanced Search · Current Issue · Archives · Journal Home > Vol 21 (2010) >. Log in or Register to get access to full text downloads. Username, Password, Remember me, or Register · Download this PDF file. The PDF file you selected should load ...

  4. Directional dominance on stature and cognition in diverse human populations

    NARCIS (Netherlands)

    P.K. Joshi (Peter); T. Esko (Tõnu); H. Mattsson (Hannele); N. Eklund (Niina); I. Gandin (Ilaria); T. Nutile; A.U. Jackson (Anne); C. Schurmann (Claudia); G.D. Smith; W. Zhang (Weihua); Y. Okada (Yukinori); A. Stancáková (Alena); J.D. Faul (Jessica D.); W. Zhao (Wei); T.M. Bartz (Traci M.); M.P. Concas (Maria Pina); N. Franceschini (Nora); S. Enroth (Stefan); V. Vitart (Veronique); S. Trompet (Stella); X. Guo (Xiuqing); D.I. Chasman (Daniel); J.R. O'Connel (Jeffrey R.); T. Corre (Tanguy); S.S. Nongmaithem (Suraj S.); Y. Chen (Yuning); M. Mangino (Massimo); D. Ruggiero; M. Traglia (Michela); A.-E. Farmaki (Aliki-Eleni); T. Kacprowski (Tim); A. Bjonnes (Andrew); A. van der Spek (Ashley); Y. Wu (Ying); A.K. Giri (Anil K.); L.R. Yanek (Lisa); L. Wang (Lihua); E. Hofer (Edith); C.A. Rietveld (Niels); O. McLeod (Olga); M. Cornelis (Marilyn); C. Pattaro (Cristian); N. Verweij (Niek); C. Baumbach (Clemens); A. Abdellaoui (Abdel); H. Warren (Helen); D. Vuckovic (Dragana); H. Mei (Hao); C. Bouchard (Claude); J.R.B. Perry (John); S. Cappellani (Stefania); S.S. Mirza (Saira); M.C. Benton (Miles C.); U. Broeckel (Ulrich); S.E. Medland (Sarah Elizabeth); P.A. Lind (Penelope); G. Malerba (Giovanni); A. Drong (Alexander); L. Yengo (Loic); L.F. Bielak (Lawrence F.); D. Zhi (Degui); P.J. van der Most (Peter); D. Shriner (Daniel); R. Mägi (Reedik); G. Hemani; T. Karaderi (Tugce); Z. Wang (Zhaoming); T. Liu (Tian); I. Demuth (Ilja); J.H. Zhao (Jing Hua); W. Meng (Weihua); L. Lataniotis (Lazaros); S.W. Van Der Laan (Sander W.); J.P. Bradfield (Jonathan); A.R. Wood (Andrew); A. Bonnefond (Amélie); T.S. Ahluwalia (Tarunveer Singh); L.M. Hall (Leanne M.); E. Salvi (Erika); S. Yazar (Seyhan); L. Carstensen (Lisbeth); H.G. De Haan (Hugoline G.); M. Abney (Mark); U. Afzal (Uzma); M.A. Allison (Matthew); N. Amin (Najaf); F.W. Asselbergs (Folkert W.); S.J.L. Bakker (Stephan); R.G. Barr (Graham); S.E. Baumeister (Sebastian); D.J. Benjamin (Daniel J.); S. Bergmann (Sven); E.A. Boerwinkle (Eric); E.P. Bottinger (Erwin P.); A. Campbell (Archie); A. Chakravarti (Aravinda); Y. Chan (Yingleong); S.J. Chanock (Stephen); C. Chen (Constance); Y.-D.I. Chen (Y.-D. Ida); F.S. Collins (Francis); J. Connell (John); A. Correa (Adolfo); L.A. Cupples (Adrienne); G.D. Smith; G. Davies (Gail); M. Dörr (Marcus); G.B. Ehret (Georg); S.B. Ellis (Stephen B.); B. Feenstra (Bjarke); M.F. Feitosa (Mary Furlan); I. Ford; C.S. Fox (Caroline); T.M. Frayling (Timothy); N. Friedrich (Nele); F. Geller (Frank); G. Scotland (Generation); I. Gillham-Nasenya (Irina); R.F. Gottesman (Rebecca); M.J. Graff (Maud J.L.); F. Grodstein (Francine); C. Gu (Charles); C. Haley (Chris); C.J. Hammond (Christopher); S.E. Harris (Sarah); T.B. Harris (Tamara); N. Hastie (Nick); N.L. Heard-Costa (Nancy); K. Heikkilä (Kauko); L.J. Hocking (Lynne); G. Homuth (Georg); J.J. Hottenga (Jouke Jan); J. Huang (Jian); J.E. Huffman (Jennifer); P.G. Hysi (Pirro); M.A. Ikram (Arfan); E. Ingelsson (Erik); A. Joensuu (Anni); A. Johansson (Åsa); P. Jousilahti (Pekka); J.W. Jukema (Jan Wouter); M. Kähönen (Mika); Y. Kamatani (Yoichiro); S. Kanoni (Stavroula); S.M. Kerr (Shona); N.M. Khan (Nazir M.); Ph.D. Koellinger (Philipp); H.A. Koistinen (Heikki A.); M.K. Kooner (Manraj K.); M. Kubo (Michiaki); J. Kuusisto (Johanna); J. Lahti (Jari); L.J. Launer (Lenore); R.A. Lea (Rodney A.); B. Lehne (Benjamin); T. Lehtimäki (Terho); D.C. Liewald (David C.); L. Lind (Lars); M. Loh (Marie); M.L. Lokki; S.J. London (Stephanie J.); S.J. Loomis (Stephanie J.); A. Loukola (Anu); Y. Lu (Yingchang); T. Lumley (Thomas); A. Lundqvist (Annamari); S. Männistö (Satu); P. Marques-Vidal (Pedro); C. Masciullo (Corrado); A. Matchan (Angela); J. Mathias (Jasmine); K. Matsuda (Koichi); J.B. Meigs (James); C. Meisinger (Christa); T. Meitinger (Thomas); C. Menni (Cristina); F.D. Mentch (Frank); E. Mihailov (Evelin); L. Milani (Lili); M.E. Montasser (May E.); G.W. Montgomery (Grant); A.C. Morrison (Alanna); R.H. Myers (Richard); R. Nadukuru (Rajiv); P. Navarro (Pau); M. Nalis (Mari); M.S. Nieminen (Markku S.); I.M. Nolte (Ilja M.); G.T. O'Connor (George); A. Ogunniyi (Adesola); S. Padmanabhan (Sandosh); W. Palmas (Walter); J.S. Pankow (James); I. Patarcic (Inga); F. Pavani (Francesca); P.A. Peyser (Patricia A.); K.H. Pietilainen (Kirsi Hannele); N.R. Poulter (Neil); I. Prokopenko (Inga); S. Ralhan (Sarju); P. Redmond (Paul); S.S. Rich (Stephen S.); H. Rissanen (Harri); A. Robino (Antonietta); L.M. Rose (Lynda M.); R.J. Rose (Richard J.); C. Sala (Cinzia); B. Salako (Babatunde); V. Salomaa (Veikko); A.-P. Sarin; R. Saxena (Richa); R. Schmidt (Reinhold); L.J. Scott (Laura); W.R. Scott (William R.); B. Sennblad (Bengt); S. Seshadri (Sudha); P. Sever (Peter); S. Shrestha (Smeeta); B.H. Smith (Blair); J.A. Smith (Jennifer A); N. Soranzo (Nicole); N. Sotoodehnia (Nona); L. Southam (Lorraine); A. Stanton (Alice); M.G. Stathopoulou (Maria G); K. Strauch (Konstantin); R.J. Strawbridge (Rona); M.J. Suderman (Matthew J.); N. Tandon (Nikhil); S.-T. Tang (Sian-Tsun); K.D. Taylor (Kent D.); B. Tayo (Bamidele); A.M. Töglhofer (Anna Maria); M. Tomaszewski (Maciej); N. Tsernikova (Natalia); J. Tuomilehto (Jaakko); A.G. Uitterlinden (André); D. Vaidya (Dhananjay); A. van Hylckama Vlieg (Astrid); J. van Setten (Jessica); T. Vasankari (Tuula); S. Vedantam (Sailaja); E. Vlachopoulou (Efthymia); D. Vozzi (Diego); E. Vuoksimaa (Eero); M. Waldenberger (Melanie); E.B. Ware (Erin B.); W. Wentworth-Shields (William); J. Whitfield (John); S. Wild (Sarah); G.A.H.M. Willemsen (Gonneke); C.S. Yajnik (Chittaranjan S.); J. Yao (Jie); G. Zaza (Gianluigi); X. Zhu (Xiaofeng); R.M. Salem (Rany); M. Melbye (Mads); H. Bisgaard (Hans); N.J. Samani (Nilesh); D. Cusi (Daniele); D.A. Mackey (David A.); R.S. Cooper (Richard S.); P. Froguel (Philippe); G. Pasterkamp (Gerard); S.F.A. Grant (Struan F.A.); H. Hakonarson (Hakon); L. Ferrucci (Luigi); R.A. Scott (Robert); A.D. Morris (Andrew); C.N.A. Palmer (Colin); G.V. Dedoussis (George V.); P. Deloukas (Panagiotis); L. Bertram (Lars); U. Lindenberger (Ulman); S.I. Berndt (Sonja); C.M. Lindgren (Cecilia); N.J. Timpson (Nicholas); A. Tönjes (Anke); P. Munroe (Patricia); T.I.A. Sørensen (Thorkild I.A.); C. Rotimi (Charles); D.K. Arnett (Donna); A.J. Oldehinkel (Albertine); S.L.R. Kardia (Sharon); B. Balkau (Beverley); G. Gambaro (Giovanni); A.P. Morris (Andrew); J.G. Eriksson (Johan G.); M.J. Wright (Margaret); N.G. Martin (Nicholas); S.C. Hunt (Steven); J.M. Starr (John); I.J. Deary (Ian J.); L.R. Griffiths (Lyn R.); H.W. Tiemeier (Henning); N. Pirastu (Nicola); J. Kaprio (Jaakko); N.J. Wareham (Nick); L. Perusse (Louis); J.G. Wilson (James); S. Girotto; M. Caulfield (Mark); O.T. Raitakari (Olli T.); D.I. Boomsma (Dorret); C. Gieger (Christian); P. van der Harst; A.A. Hicks (Andrew); P. Kraft (Peter); J. Sinisalo (Juha); P. Knekt; M. Johannesson (Magnus); P.K.E. Magnusson (Patrik K. E.); A. Hamsten (Anders); R. Schmidt (Reinhold); I.B. Borecki (Ingrid); E. Vartiainen (Erkki); D.M. Becker (Diane); D. Bharadwaj (Dwaipayan); K.L. Mohlke (Karen); M. Boehnke (Michael); C.M. van Duijn (Cornelia); D.K. Sanghera (Dharambir); A. Teumer (Alexander); E. Zeggini (Eleftheria); A. Metspalu (Andres); P. Gasparini (Paolo); S. Ulivi (Shelia); C. Ober (Carole); D. Toniolo (Daniela); I. Rudan (Igor); D.J. Porteous (David J.); M. Ciullo; T.D. Spector (Timothy); C. Hayward (Caroline); J. Dupuis (Josée); R.J.F. Loos (Ruth); A. Wright (Alan); G.R. Chandak (Giriraj); P. Vollenweider (Peter); A.R. Shuldiner (Alan); P.M. Ridker (Paul); J.I. Rotter (Jerome I.); N. Sattar (Naveed); U. Gyllensten (Ulf); K.E. North (Kari); M. Pirastu (Mario); B.M. Psaty (Bruce); D.R. Weir (David); M. Laakso (Markku); V. Gudnason (Vilmundur); A. Takahashi (Atsushi); J.C. Chambers (John C.); J.S. Kooner (Jaspal S.); D.P. Strachan (David P.); H. Campbell (Harry); J.N. Hirschhorn (Joel N.); M. Perola (Markus); O. Polasek (Ozren); J.F. Wilson (James)

    2015-01-01

    textabstractHomozygosity has long been associated with rare, often devastating, Mendelian disorders, and Darwin was one of the first to recognize that inbreeding reduces evolutionary fitness. However, the effect of the more distant parental relatedness that is common in modern human populations is

  5. Directed Differentiation of Human Pluripotent Stem Cells to Microglia

    Directory of Open Access Journals (Sweden)

    Panagiotis Douvaras

    2017-06-01

    Full Text Available Microglia, the immune cells of the brain, are crucial to proper development and maintenance of the CNS, and their involvement in numerous neurological disorders is increasingly being recognized. To improve our understanding of human microglial biology, we devised a chemically defined protocol to generate human microglia from pluripotent stem cells. Myeloid progenitors expressing CD14/CX3CR1 were generated within 30 days of differentiation from both embryonic and induced pluripotent stem cells (iPSCs. Further differentiation of the progenitors resulted in ramified microglia with highly motile processes, expressing typical microglial markers. Analyses of gene expression and cytokine release showed close similarities between iPSC-derived (iPSC-MG and human primary microglia as well as clear distinctions from macrophages. iPSC-MG were able to phagocytose and responded to ADP by producing intracellular Ca2+ transients, whereas macrophages lacked such response. The differentiation protocol was highly reproducible across several pluripotent stem cell lines.

  6. Direct Fusion Drive for a Human Mars Orbital Mission

    Energy Technology Data Exchange (ETDEWEB)

    Paluszek, Michael [Princeton Satellite Systems; Pajer, Gary [Princeton Satellite Systems; Razin, Yosef [Princeton Satellite Systems; Slonaker, James [Princeton Satellite Systems; Cohen, Samuel [PPPL; Feder, Russ [PPPL; Griffin, Kevin [Princeton University; Walsh, Matthew [Princeton University

    2014-08-01

    The Direct Fusion Drive (DFD) is a nuclear fusion engine that produces both thrust and electric power. It employs a field reversed configuration with an odd-parity rotating magnetic field heating system to heat the plasma to fusion temperatures. The engine uses deuterium and helium-3 as fuel and additional deuterium that is heated in the scrape-off layer for thrust augmentation. In this way variable exhaust velocity and thrust is obtained.

  7. Expression and site-directed mutagenesis of human dihydrofolate reductase

    Energy Technology Data Exchange (ETDEWEB)

    Prendergast, N.J.; Delcamp, T.J.; Smith, P.L.; Freisheim, J.H.

    1988-05-17

    A procaryotic high-level expression vector for human dihydrofolate reductase has been constructed and the protein characterized as a first step toward structure-function studies of this enzyme. A vector bearing the tac promoter, four synthetic oligodeoxynucleotides, and a restriction fragment from the dihydrofolate reductase cDNA were ligated in a manner which optimized the transcriptional and translational frequency of the enzyme mRNA. The reductase, comprising ca. 17% of the total soluble protein in the host bacteria, was purified to apparent homogeneity as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and characterized by amino acid composition, partial amino acid sequence, and steady-sate kinetic analysis. This expression vector has been used as a template for double-stranded plasmid DNA site-specific mutagenesis. Functional studies on a Cys-6 ..-->.. Ser-6 mutant enzyme support the contention that Cys-6 is obligatory for organomercurial activation of human dihydrofolate reductase. The Ser-6 mutant enzyme was not activated to any extent following a 24-h incubation with p-(hydroxymercuri)benzoate and nicotinamide adenine dinucleotide phosphate (reduced) (NADPH), whereas the k/sub cat/ for Cys-6 reductase increased 2-fold under identical conditions. The specific activities of the Cys-6 and Ser-6 enzymes were virtually identical as determined by methotrexate titration as were the K/sub m/ values for both dihydrofolate and NADPH. The Ser-6 mutant showed a decreased temperature stability and was more sensitive to inactivation by ..cap alpha..-chymotrypsin when compared to the wild-type enzyme. These results suggest that the Ser-6 mutant reductase is conformationally altered relative to the Cys-6 native enzyme.

  8. Expression and site-directed mutagenesis of human dihydrofolate reductase

    International Nuclear Information System (INIS)

    Prendergast, N.J.; Delcamp, T.J.; Smith, P.L.; Freisheim, J.H.

    1988-01-01

    A procaryotic high-level expression vector for human dihydrofolate reductase has been constructed and the protein characterized as a first step toward structure-function studies of this enzyme. A vector bearing the tac promoter, four synthetic oligodeoxynucleotides, and a restriction fragment from the dihydrofolate reductase cDNA were ligated in a manner which optimized the transcriptional and translational frequency of the enzyme mRNA. The reductase, comprising ca. 17% of the total soluble protein in the host bacteria, was purified to apparent homogeneity as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and characterized by amino acid composition, partial amino acid sequence, and steady-sate kinetic analysis. This expression vector has been used as a template for double-stranded plasmid DNA site-specific mutagenesis. Functional studies on a Cys-6 → Ser-6 mutant enzyme support the contention that Cys-6 is obligatory for organomercurial activation of human dihydrofolate reductase. The Ser-6 mutant enzyme was not activated to any extent following a 24-h incubation with p-(hydroxymercuri)benzoate and nicotinamide adenine dinucleotide phosphate (reduced) (NADPH), whereas the k/sub cat/ for Cys-6 reductase increased 2-fold under identical conditions. The specific activities of the Cys-6 and Ser-6 enzymes were virtually identical as determined by methotrexate titration as were the K/sub m/ values for both dihydrofolate and NADPH. The Ser-6 mutant showed a decreased temperature stability and was more sensitive to inactivation by α-chymotrypsin when compared to the wild-type enzyme. These results suggest that the Ser-6 mutant reductase is conformationally altered relative to the Cys-6 native enzyme

  9. 77 FR 14022 - Guidance for Industry: Testing for Salmonella Species in Human Foods and Direct-Human-Contact...

    Science.gov (United States)

    2012-03-08

    ...-contact animal foods, and the interpretation of test results, when the presence of Salmonella spp. in the... eggs) and direct-human-contact animal foods, and the interpretation of test results, when the presence... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2011-D-0091...

  10. Identification of proteins that may directly interact with human RPA.

    Science.gov (United States)

    Nakaya, Ryou; Takaya, Junichiro; Onuki, Takeshi; Moritani, Mariko; Nozaki, Naohito; Ishimi, Yukio

    2010-11-01

    RPA, which consisted of three subunits (RPA1, 2 and 3), plays essential roles in DNA transactions. At the DNA replication forks, RPA binds to single-stranded DNA region to stabilize the structure and to assemble other replication proteins. Interactions between RPA and several replication proteins have been reported but the analysis is not comprehensive. We systematically performed the qualitative analysis to identify RPA interaction partners to understand the protein-protein interaction at the replication forks. We expressed in insect cells the three subunits of human RPA, together with one replication protein, which is present at the forks under normal conditions and/or under the replication stress conditions, to examine the interaction. Among 30 proteins examined in total, it was found that at least 14 proteins interacted with RPA. RPA interacted with MCM3-7, MCM-BP and CDC45 proteins among the proteins that play roles in the initiation and the elongation of the DNA replication. RPA bound with TIPIN, CLASPIN and RAD17, which are involved in the DNA replication checkpoint functions. RPA also bound with cyclin-dependent kinases and an amino-terminal fragment of Rb protein that negatively regulates DNA replication. These results suggest that RPA interacts with the specific proteins among those that play roles in the regulation of the replication fork progression.

  11. Direct human DNA protection by Coriolus versicolor (Yunzhi) extract.

    Science.gov (United States)

    Szeto, Yim Tong; Lau, Po Chun; Kalle, Wouter; Pak, Sok Cheon

    2013-07-01

    Scientific evidence has shown Coriolus versicolor (L. ex Fr.) Quel (also known as Yunzhi) has the role of immunomodulator in therapeutic effect. The aim of this in vitro study was to investigate the antioxidative effect of Yunzhi and to explore the mechanisms behind its DNA protection. Commercial Yunzhi extract was dissolved in water and diluted in five concentrations (10(1)-10(5) μg/L) with appropriate buffers. Lymphocytes harvested from three healthy subjects were incubated with Yunzhi extract for 30 min. Cells were then subjected to 5 min oxidant challenge by 45 μM hydrogen peroxide. The standard alkaline comet (SAC) assay and lysed cell comet (LCC) assay were performed in parallel. DNA damage of each treatment was scored under a fluorescence microscope and compared with the cells without Yunzhi pretreatment. U-shaped dose-response was seen in both versions of the comet assay. Yunzhi at 10(4) μg/L demonstrated a genoprotective effect against oxidative damage in the SAC assay (25% decrease in comet score). In the LCC assay, a trend of protection in lymphocytes was observed but it did not reach statistical significance. A direct antioxidant effect of Yunzhi against oxidant challenge on the DNA of lymphocytes was evidenced. The active component in Yunzhi was likely to be membrane permeable.

  12. The Measure of Human Error: Direct and Indirect Performance Shaping Factors

    Energy Technology Data Exchange (ETDEWEB)

    Ronald L. Boring; Candice D. Griffith; Jeffrey C. Joe

    2007-08-01

    The goal of performance shaping factors (PSFs) is to provide measures to account for human performance. PSFs fall into two categories—direct and indirect measures of human performance. While some PSFs such as “time to complete a task” are directly measurable, other PSFs, such as “fitness for duty,” can only be measured indirectly through other measures and PSFs, such as through fatigue measures. This paper explores the role of direct and indirect measures in human reliability analysis (HRA) and the implications that measurement theory has on analyses and applications using PSFs. The paper concludes with suggestions for maximizing the reliability and validity of PSFs.

  13. Differential diagnosis and management of human-directed aggression in cats.

    Science.gov (United States)

    Frank, Diane; Dehasse, Joel

    2003-03-01

    Human-directed aggression in cats should be evaluated as a multifactorial problem. It results from the combined actions of heredity, environment, learning, human social requirements (or needs), client interactions, lack of understanding of normal feline behavior, unrealistic client expectations, and lack of meeting the cat's basic ethologic needs. Managing human-directed aggression in cats encompasses the use of environmental modification, therapies, and, when and if needed, regulatory drugs so as to increase learning capabilities and adaptation and decrease danger to the human victims.

  14. Risk factors for human-directed canine aggression in a referral level clinical population.

    Science.gov (United States)

    Lord, M; Casey, R A; Loftus, B A; Blackwell, E J

    2017-07-07

    Risk factors for human-directed aggression were investigated using retrospective analysis of data from a referral-level clinical behaviour population in the UK. A sample of 200 cases involving human-directed canine aggression and 200 control cases involving no instance of human-directed aggression were selected at random from a population of 746 cases. The final model suggested that clinical cases with human-directed aggression were significantly younger than those presenting with other undesired behaviours (P=0.008) and that male dogs were 1.4 times more likely to be aggressive towards human beings than female dogs (P=0.019). Dogs were 1.7 times more likely to be aggressive towards people if they had attended more than five puppy classes than if they had never attended puppy class (P=0.015) and that dogs were 2.8 times more likely to be aggressive towards human beings if there was another dog between 0 months and 24 months of age in the home (P=0.004). These factors only account for 7 per cent to 10 per cent of the variance between the human-directed aggression population and the control population, but factors such as attendance at puppy classes and numbers of dogs in the household suggest the need for longitudinal studies to investigate temporal relationships.

  15. 77 FR 71695 - Secondary Direct Food Additives Permitted in Food for Human Consumption; Sodium...

    Science.gov (United States)

    2012-12-04

    ... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration 21 CFR Part 173 [Docket No. FDA-2011-F-0853] Secondary Direct Food Additives Permitted in Food for Human Consumption; Sodium... dodecylbenzenesulfonate (CAS No. 25155-30-0) as an antimicrobial agent for use in wash water for fruits and vegetables...

  16. Associative theories of goal-directed behaviour: a case for animal-human translational models

    NARCIS (Netherlands)

    de Wit, S.; Dickinson, A.

    2009-01-01

    Associative accounts of goal-directed action, developed in the fields of human ideomotor action and that of animal learning, can capture cognitive belief-desire psychology of human decision-making. Whereas outcome-response accounts can account for the fact that the thought of a goal can call to mind

  17. 76 FR 41687 - Food Additives Permitted for Direct Addition to Food for Human Consumption; Hydroxypropyl Cellulose

    Science.gov (United States)

    2011-07-15

    ... Organization and the World Health Organization (FAO/WHO) Expert Committee for Food Additives (JECFA) has... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration 21 CFR Part 172 [Docket No. FDA-2010-F-0103] Food Additives Permitted for Direct Addition to Food for Human Consumption...

  18. Human projected area factors for detailed direct and diffuse solar radiation analysis

    DEFF Research Database (Denmark)

    Kubaha, K.; Fiala, D.; Toftum, Jørn

    2004-01-01

    Projected area factors for individual segments of the standing and sedentary human body were modelled for both direct and diffuse solar radiation using detailed 3D geometry and radiation models. The local projected area factors with respect to direct short-wave radiation are a function of the solar...

  19. Human-directed local autonomy for motion guidance and coordination in an intelligent manufacturing system

    Science.gov (United States)

    Alford, W. A.; Kawamura, Kazuhiko; Wilkes, Don M.

    1997-12-01

    This paper discusses the problem of integrating human intelligence and skills into an intelligent manufacturing system. Our center has jointed the Holonic Manufacturing Systems (HMS) Project, an international consortium dedicated to developing holonic systems technologies. One of our contributions to this effort is in Work Package 6: flexible human integration. This paper focuses on one activity, namely, human integration into motion guidance and coordination. Much research on intelligent systems focuses on creating totally autonomous agents. At the Center for Intelligent Systems (CIS), we design robots that interact directly with a human user. We focus on using the natural intelligence of the user to simplify the design of a robotic system. The problem is finding ways for the user to interact with the robot that are efficient and comfortable for the user. Manufacturing applications impose the additional constraint that the manufacturing process should not be disturbed; that is, frequent interacting with the user could degrade real-time performance. Our research in human-robot interaction is based on a concept called human directed local autonomy (HuDL). Under this paradigm, the intelligent agent selects and executes a behavior or skill, based upon directions from a human user. The user interacts with the robot via speech, gestures, or other media. Our control software is based on the intelligent machine architecture (IMA), an object-oriented architecture which facilitates cooperation and communication among intelligent agents. In this paper we describe our research testbed, a dual-arm humanoid robot and human user, and the use of this testbed for a human directed sorting task. We also discuss some proposed experiments for evaluating the integration of the human into the robot system. At the time of this writing, the experiments have not been completed.

  20. Direct 2-D reconstructions of conductivity and permittivity from EIT data on a human chest.

    Science.gov (United States)

    Herrera, Claudia N L; Vallejo, Miguel F M; Mueller, Jennifer L; Lima, Raul G

    2015-01-01

    A novel direct D-bar reconstruction algorithm is presented for reconstructing a complex conductivity distribution from 2-D EIT data. The method is applied to simulated data and archival human chest data. Permittivity reconstructions with the aforementioned method and conductivity reconstructions with the previously existing nonlinear D-bar method for real-valued conductivities depicting ventilation and perfusion in the human chest are presented. This constitutes the first fully nonlinear D-bar reconstructions of human chest data and the first D-bar permittivity reconstructions of experimental data. The results of the human chest data reconstructions are compared on a circular domain versus a chest-shaped domain.

  1. Direction of movement is encoded in the human primary motor cortex.

    Directory of Open Access Journals (Sweden)

    Carolien M Toxopeus

    Full Text Available The present study investigated how direction of hand movement, which is a well-described parameter in cerebral organization of motor control, is incorporated in the somatotopic representation of the manual effector system in the human primary motor cortex (M1. Using functional magnetic resonance imaging (fMRI and a manual step-tracking task we found that activation patterns related to movement in different directions were spatially disjoint within the representation area of the hand on M1. Foci of activation related to specific movement directions were segregated within the M1 hand area; activation related to direction 0° (right was located most laterally/superficially, whereas directions 180° (left and 270° (down elicited activation more medially within the hand area. Activation related to direction 90° was located between the other directions. Moreover, by investigating differences between activations related to movement along the horizontal (0°+180° and vertical (90°+270° axis, we found that activation related to the horizontal axis was located more anterolaterally/dorsally in M1 than for the vertical axis, supporting that activations related to individual movement directions are direction- and not muscle related. Our results of spatially segregated direction-related activations in M1 are in accordance with findings of recent fMRI studies on neural encoding of direction in human M1. Our results thus provide further evidence for a direct link between direction as an organizational principle in sensorimotor transformation and movement execution coded by effector representations in M1.

  2. Direct Lineage Reprogramming Reveals Disease-Specific Phenotypes of Motor Neurons from Human ALS Patients

    Directory of Open Access Journals (Sweden)

    Meng-Lu Liu

    2016-01-01

    Full Text Available Subtype-specific neurons obtained from adult humans will be critical to modeling neurodegenerative diseases, such as amyotrophic lateral sclerosis (ALS. Here, we show that adult human skin fibroblasts can be directly and efficiently converted into highly pure motor neurons without passing through an induced pluripotent stem cell stage. These adult human induced motor neurons (hiMNs exhibit the cytological and electrophysiological features of spinal motor neurons and form functional neuromuscular junctions (NMJs with skeletal muscles. Importantly, hiMNs converted from ALS patient fibroblasts show disease-specific degeneration manifested through poor survival, soma shrinkage, hypoactivity, and an inability to form NMJs. A chemical screen revealed that the degenerative features of ALS hiMNs can be remarkably rescued by the small molecule kenpaullone. Taken together, our results define a direct and efficient strategy to obtain disease-relevant neuronal subtypes from adult human patients and reveal their promising value in disease modeling and drug identification.

  3. Driving and driven architectures of directed small-world human brain functional networks.

    Directory of Open Access Journals (Sweden)

    Chaogan Yan

    Full Text Available Recently, increasing attention has been focused on the investigation of the human brain connectome that describes the patterns of structural and functional connectivity networks of the human brain. Many studies of the human connectome have demonstrated that the brain network follows a small-world topology with an intrinsically cohesive modular structure and includes several network hubs in the medial parietal regions. However, most of these studies have only focused on undirected connections between regions in which the directions of information flow are not taken into account. How the brain regions causally influence each other and how the directed network of human brain is topologically organized remain largely unknown. Here, we applied linear multivariate Granger causality analysis (GCA and graph theoretical approaches to a resting-state functional MRI dataset with a large cohort of young healthy participants (n = 86 to explore connectivity patterns of the population-based whole-brain functional directed network. This directed brain network exhibited prominent small-world properties, which obviously improved previous results of functional MRI studies showing weak small-world properties in the directed brain networks in terms of a kernel-based GCA and individual analysis. This brain network also showed significant modular structures associated with 5 well known subsystems: fronto-parietal, visual, paralimbic/limbic, subcortical and primary systems. Importantly, we identified several driving hubs predominantly located in the components of the attentional network (e.g., the inferior frontal gyrus, supplementary motor area, insula and fusiform gyrus and several driven hubs predominantly located in the components of the default mode network (e.g., the precuneus, posterior cingulate gyrus, medial prefrontal cortex and inferior parietal lobule. Further split-half analyses indicated that our results were highly reproducible between two

  4. Advancing Direct Corporate Accountability in International Human Rights Law: The Role of State-Owned Enterprises

    OpenAIRE

    Ma, Xili

    2017-01-01

    Resorting to the immensely State-centric international legal system to regulate corporate human rights abuses is often viewed as inadequate. Among many proposals aiming at filling the international regulatory gaps, imposing international human rights obligations directly on corporations is a bold one, which, due to profound doctrinal and practical challenges, has yet to be agreed upon or established. However, State-Owned Enterprises (SOEs), given its prima facie “State-Business nexus” that bl...

  5. Humans tend to walk in circles as directed by memorized visual locations at large distances

    OpenAIRE

    Consolo, Patricia; Holanda, Humberto C.; Fukusima, Sérgio S.

    2014-01-01

    Human veering while walking blindfolded or walking straight without any visual cues has been widely studied over the last 100 years, but the results are still controversial. The present study attempted to describe and understand the human ability to maintain the direction of a trajectory while walking without visual or audio cues with reference to a proposed mathematical model and using data collected by a global positioning system (GPS). Fifteen right-handed people of both genders, aged 18-3...

  6. The effect of oxytocin on human-directed social behaviour in dogs (Canis familiaris).

    Science.gov (United States)

    Kis, Anna; Ciobica, Alin; Topál, József

    2017-08-01

    The oxytocin system has recently received increasing attention due to its effect on complex human behaviours. In parallel to this, over the past couple of decades, the human-analogue social behaviour of dogs has been intensively studied. Combining these two lines of research (e.g. studying the relationship between dog social behaviour and the oxytocin system) is a promising new research area. The present paper reviews the existing literature on how oxytocin is related to different aspects of human-directed social behaviour in dogs. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Directional dominance on stature and cognition in diverse human populations

    DEFF Research Database (Denmark)

    Joshi, Peter K; Esko, Tonu; Mattsson, Hannele

    2015-01-01

    is predicted for traits under directional evolutionary selection, this study provides evidence that increased stature and cognitive function have been positively selected in human evolution, whereas many important risk factors for late-onset complex diseases may not have been....... confounding, directly contributes to phenotypic variance. Contrary to earlier reports in substantially smaller samples, no evidence was seen of an influence of genome-wide homozygosity on blood pressure and low density lipoprotein cholesterol, or ten other cardio-metabolic traits. Since directional dominance...

  8. Estimating the probability that the Taser directly causes human ventricular fibrillation.

    Science.gov (United States)

    Sun, H; Haemmerich, D; Rahko, P S; Webster, J G

    2010-04-01

    This paper describes the first methodology and results for estimating the order of probability for Tasers directly causing human ventricular fibrillation (VF). The probability of an X26 Taser causing human VF was estimated using: (1) current density near the human heart estimated by using 3D finite-element (FE) models; (2) prior data of the maximum dart-to-heart distances that caused VF in pigs; (3) minimum skin-to-heart distances measured in erect humans by echocardiography; and (4) dart landing distribution estimated from police reports. The estimated mean probability of human VF was 0.001 for data from a pig having a chest wall resected to the ribs and 0.000006 for data from a pig with no resection when inserting a blunt probe. The VF probability for a given dart location decreased with the dart-to-heart horizontal distance (radius) on the skin surface.

  9. The oldest anatomically modern humans from far southeast Europe: direct dating, culture and behavior.

    Directory of Open Access Journals (Sweden)

    Sandrine Prat

    Full Text Available BACKGROUND: Anatomically Modern Humans (AMHs are known to have spread across Europe during the period coinciding with the Middle to Upper Paleolithic transition. Whereas their dispersal into Western Europe is relatively well established, evidence of an early settlement of Eastern Europe by modern humans are comparatively scarce. METHODOLOGY/PRINCIPAL FINDING: Based on a multidisciplinary approach for the study of human and faunal remains, we describe here the oldest AMH remains from the extreme southeast Europe, in conjunction with their associated cultural and paleoecological background. We applied taxonomy, paleoecology, and taphonomy combined with geomorphology, stratigraphy, archeology and radiocarbon dating. More than 160 human bone remains have been discovered. They originate from a well documented Upper Paleolithic archeological layer (Gravettian cultural tradition from the site of Buran-Kaya III located in Crimea (Ukraine. The combination of non-metric dental traits and the morphology of the occipital bones allow us to attribute the human remains to Anatomically Modern Humans. A set of human and faunal remains from this layer has been radiocarbon dated by Accelerator Mass Spectrometry. The direct-dating results of human bone establish a secure presence of AMHs at 31,900+240/-220 BP in this region. They are the oldest direct evidence of the presence of AMHs in a well documented archeological context. Based on taphonomical observations (cut marks and distribution of skeletal elements, they represent the oldest Upper Paleolithic modern humans from Eastern Europe, showing post-mortem treatment of the dead as well. CONCLUSION/SIGNIFICANCE: These findings are essential for the debate on the spread of modern humans in Europe during the Upper Paleolithic, as well as their cultural behaviors.

  10. The oldest anatomically modern humans from far southeast Europe: direct dating, culture and behavior.

    Science.gov (United States)

    Prat, Sandrine; Péan, Stéphane C; Crépin, Laurent; Drucker, Dorothée G; Puaud, Simon J; Valladas, Hélène; Lázničková-Galetová, Martina; van der Plicht, Johannes; Yanevich, Alexander

    2011-01-01

    Anatomically Modern Humans (AMHs) are known to have spread across Europe during the period coinciding with the Middle to Upper Paleolithic transition. Whereas their dispersal into Western Europe is relatively well established, evidence of an early settlement of Eastern Europe by modern humans are comparatively scarce. Based on a multidisciplinary approach for the study of human and faunal remains, we describe here the oldest AMH remains from the extreme southeast Europe, in conjunction with their associated cultural and paleoecological background. We applied taxonomy, paleoecology, and taphonomy combined with geomorphology, stratigraphy, archeology and radiocarbon dating. More than 160 human bone remains have been discovered. They originate from a well documented Upper Paleolithic archeological layer (Gravettian cultural tradition) from the site of Buran-Kaya III located in Crimea (Ukraine). The combination of non-metric dental traits and the morphology of the occipital bones allow us to attribute the human remains to Anatomically Modern Humans. A set of human and faunal remains from this layer has been radiocarbon dated by Accelerator Mass Spectrometry. The direct-dating results of human bone establish a secure presence of AMHs at 31,900+240/-220 BP in this region. They are the oldest direct evidence of the presence of AMHs in a well documented archeological context. Based on taphonomical observations (cut marks and distribution of skeletal elements), they represent the oldest Upper Paleolithic modern humans from Eastern Europe, showing post-mortem treatment of the dead as well. These findings are essential for the debate on the spread of modern humans in Europe during the Upper Paleolithic, as well as their cultural behaviors.

  11. Outward Foreign Direct Investment and Human Capital Development: A Small Country Perspective

    Science.gov (United States)

    McDonnell, Anthony

    2008-01-01

    Purpose: The purpose of this paper is to examine the pattern of outward foreign direct investment (FDI) by Irish MNCs, and more specifically, to investigate their approach to human capital development and how these correspond to foreign MNCs in Ireland. In particular, it seeks to investigate training and development expenditure, adoption of…

  12. An online brain-machine interface using decoding of movement direction from the human electrocorticogram

    Science.gov (United States)

    Milekovic, Tomislav; Fischer, Jörg; Pistohl, Tobias; Ruescher, Johanna; Schulze-Bonhage, Andreas; Aertsen, Ad; Rickert, Jörn; Ball, Tonio; Mehring, Carsten

    2012-08-01

    A brain-machine interface (BMI) can be used to control movements of an artificial effector, e.g. movements of an arm prosthesis, by motor cortical signals that control the equivalent movements of the corresponding body part, e.g. arm movements. This approach has been successfully applied in monkeys and humans by accurately extracting parameters of movements from the spiking activity of multiple single neurons. We show that the same approach can be realized using brain activity measured directly from the surface of the human cortex using electrocorticography (ECoG). Five subjects, implanted with ECoG implants for the purpose of epilepsy assessment, took part in our study. Subjects used directionally dependent ECoG signals, recorded during active movements of a single arm, to control a computer cursor in one out of two directions. Significant BMI control was achieved in four out of five subjects with correct directional decoding in 69%-86% of the trials (75% on average). Our results demonstrate the feasibility of an online BMI using decoding of movement direction from human ECoG signals. Thus, to achieve such BMIs, ECoG signals might be used in conjunction with or as an alternative to intracortical neural signals.

  13. Flexible and multi-directional piezoelectric energy harvester for self-powered human motion sensor

    Science.gov (United States)

    Kim, Min-Ook; Pyo, Soonjae; Oh, Yongkeun; Kang, Yunsung; Cho, Kyung-Ho; Choi, Jungwook; Kim, Jongbaeg

    2018-03-01

    A flexible piezoelectric strain energy harvester that is responsive to multi-directional input forces produced by various human motions is proposed. The structure of the harvester, which includes a polydimethylsiloxane (PDMS) bump, facilitates the effective conversion of strain energy, produced by input forces applied in random directions, into electrical energy. The structural design of the PDMS bump and frame as well as the slits in the piezoelectric polyvinylidene fluoride (PVDF) film provide mechanical flexibility and enhance the strain induced in the PVDF film under input forces applied at various angles. The amount and direction of the strain induced in PVDF can be changed by the direction of the applied force; thus, the generated output power can be varied. The measured maximum output peak voltage is 1.75, 1.29, and 0.98 V when an input force of 4 N (2 Hz) is applied at angles of 0°, 45°, and 90°, and the corresponding maximum output power is 0.064, 0.026, and 0.02 μW, respectively. Moreover, the harvester stably generates output voltage over 1.4 × 104 cycles. Thus, the proposed harvester successfully identifies and converts strain energy produced by multi-directional input forces by various human motions into electrical energy. We demonstrate the potential utility of the proposed flexible energy harvester as a self-powered human motion sensor for wireless healthcare systems.

  14. Oxytocin receptor gene polymorphisms are associated with human directed social behavior in dogs (Canis familiaris).

    Science.gov (United States)

    Kis, Anna; Bence, Melinda; Lakatos, Gabriella; Pergel, Enikő; Turcsán, Borbála; Pluijmakers, Jolanda; Vas, Judit; Elek, Zsuzsanna; Brúder, Ildikó; Földi, Levente; Sasvári-Székely, Mária; Miklósi, Adám; Rónai, Zsolt; Kubinyi, Enikő

    2014-01-01

    The oxytocin system has a crucial role in human sociality; several results prove that polymorphisms of the oxytocin receptor gene are related to complex social behaviors in humans. Dogs' parallel evolution with humans and their adaptation to the human environment has made them a useful species to model human social interactions. Previous research indicates that dogs are eligible models for behavioral genetic research, as well. Based on these previous findings, our research investigated associations between human directed social behaviors and two newly described (-212AG, 19131AG) and one known (rs8679684) single nucleotide polymorphisms (SNPs) in the regulatory regions (5' and 3' UTR) of the oxytocin receptor gene in German Shepherd (N = 104) and Border Collie (N = 103) dogs. Dogs' behavior traits have been estimated in a newly developed test series consisting of five episodes: Greeting by a stranger, Separation from the owner, Problem solving, Threatening approach, Hiding of the owner. Buccal samples were collected and DNA was isolated using standard protocols. SNPs in the 3' and 5' UTR regions were analyzed by polymerase chain reaction based techniques followed by subsequent electrophoresis analysis. The gene-behavior association analysis suggests that oxytocin receptor gene polymorphisms have an impact in both breeds on (i) proximity seeking towards an unfamiliar person, as well as their owner, and on (ii) how friendly dogs behave towards strangers, although the mediating molecular regulatory mechanisms are yet unknown. Based on these results, we conclude that similarly to humans, the social behavior of dogs towards humans is influenced by the oxytocin system.

  15. Direct evidence for human reliance on rainforest resources in late Pleistocene Sri Lanka.

    Science.gov (United States)

    Roberts, Patrick; Perera, Nimal; Wedage, Oshan; Deraniyagala, Siran; Perera, Jude; Eregama, Saman; Gledhill, Andrew; Petraglia, Michael D; Lee-Thorp, Julia A

    2015-03-13

    Human occupation of tropical rainforest habitats is thought to be a mainly Holocene phenomenon. Although archaeological and paleoenvironmental data have hinted at pre-Holocene rainforest foraging, earlier human reliance on rainforest resources has not been shown directly. We applied stable carbon and oxygen isotope analysis to human and faunal tooth enamel from four late Pleistocene-to-Holocene archaeological sites in Sri Lanka. The results show that human foragers relied primarily on rainforest resources from at least ~20,000 years ago, with a distinct preference for semi-open rainforest and rain forest edges. Homo sapiens' relationship with the tropical rainforests of South Asia is therefore long-standing, a conclusion that indicates the time-depth of anthropogenic reliance and influence on these habitats. Copyright © 2015, American Association for the Advancement of Science.

  16. Direct induction of chondrogenic cells from human dermal fibroblast culture by defined factors.

    Directory of Open Access Journals (Sweden)

    Hidetatsu Outani

    Full Text Available The repair of large cartilage defects with hyaline cartilage continues to be a challenging clinical issue. We recently reported that the forced expression of two reprogramming factors (c-Myc and Klf4 and one chondrogenic factor (SOX9 can induce chondrogenic cells from mouse dermal fibroblast culture without going through a pluripotent state. We here generated induced chondrogenic (iChon cells from human dermal fibroblast (HDF culture with the same factors. We developed a chondrocyte-specific COL11A2 promoter/enhancer lentiviral reporter vector to select iChon cells. The human iChon cells expressed marker genes for chondrocytes but not fibroblasts, and were derived from non-chondrogenic COL11A2-negative cells. The human iChon cells formed cartilage but not tumors in nude mice. This approach could lead to the preparation of cartilage directly from skin in human, without going through pluripotent stem cells.

  17. Investigation of the direct effects of salmon calcitonin on human osteoarthritic chondrocytes

    Directory of Open Access Journals (Sweden)

    Pedersen Christian

    2010-04-01

    Full Text Available Abstract Background Calcitonin has been demonstrated to have chondroprotective effects under pre-clinical settings. It is debated whether this effect is mediated through subchondral-bone, directly on cartilage or both in combination. We investigated possible direct effects of salmon calcitonin on proteoglycans and collagen-type-II synthesis in osteoarthritic (OA cartilage. Methods Human OA cartilage explants were cultured with salmon calcitonin [100 pM-100 nM]. Direct effects of calcitonin on articular cartilage were evaluated by 1 measurement of proteoglycan synthesis by incorporation of radioactive labeled 35SO4 [5 μCi] 2 quantification of collagen-type-II formation by pro-peptides of collagen type II (PIINP ELISA, 3 QPCR expression of the calcitonin receptor in OA chondrocytes using four individual primer pairs, 4 activation of the cAMP signaling pathway by EIA and, 5 investigations of metabolic activity by AlamarBlue. Results QPCR analysis and subsequent sequencing confirmed expression of the calcitonin receptor in human chondrocytes. All doses of salmon calcitonin significantly elevated cAMP levels (P 35SO4 incorporation, with a 96% maximal induction at 10 nM (P Conclusion Calcitonin treatment increased proteoglycan and collagen synthesis in human OA cartilage. In addition to its well-established effect on subchondral bone, calcitonin may prove beneficial to the management of joint diseases through direct effects on chondrocytes.

  18. Movement-related theta rhythm in humans: coordinating self-directed hippocampal learning.

    Directory of Open Access Journals (Sweden)

    Raphael Kaplan

    Full Text Available The hippocampus is crucial for episodic or declarative memory and the theta rhythm has been implicated in mnemonic processing, but the functional contribution of theta to memory remains the subject of intense speculation. Recent evidence suggests that the hippocampus might function as a network hub for volitional learning. In contrast to human experiments, electrophysiological recordings in the hippocampus of behaving rodents are dominated by theta oscillations reflecting volitional movement, which has been linked to spatial exploration and encoding. This literature makes the surprising cross-species prediction that the human hippocampal theta rhythm supports memory by coordinating exploratory movements in the service of self-directed learning. We examined the links between theta, spatial exploration, and memory encoding by designing an interactive human spatial navigation paradigm combined with multimodal neuroimaging. We used both non-invasive whole-head Magnetoencephalography (MEG to look at theta oscillations and Functional Magnetic Resonance Imaging (fMRI to look at brain regions associated with volitional movement and learning. We found that theta power increases during the self-initiation of virtual movement, additionally correlating with subsequent memory performance and environmental familiarity. Performance-related hippocampal theta increases were observed during a static pre-navigation retrieval phase, where planning for subsequent navigation occurred. Furthermore, periods of the task showing movement-related theta increases showed decreased fMRI activity in the parahippocampus and increased activity in the hippocampus and other brain regions that strikingly overlap with the previously observed volitional learning network (the reverse pattern was seen for stationary periods. These fMRI changes also correlated with participant's performance. Our findings suggest that the human hippocampal theta rhythm supports memory by coordinating

  19. The physiological period length of the human circadian clock in vivo is directly proportional to period in human fibroblasts.

    Directory of Open Access Journals (Sweden)

    Lucia Pagani

    Full Text Available BACKGROUND: Diurnal behavior in humans is governed by the period length of a circadian clock in the suprachiasmatic nuclei of the brain hypothalamus. Nevertheless, the cell-intrinsic mechanism of this clock is present in most cells of the body. We have shown previously that for individuals of extreme chronotype ("larks" and "owls", clock properties measured in human fibroblasts correlated with extreme diurnal behavior. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we have measured circadian period in human primary fibroblasts taken from normal individuals and, for the first time, compared it directly with physiological period measured in vivo in the same subjects. Human physiological period length was estimated via the secretion pattern of the hormone melatonin in two different groups of sighted subjects and one group of totally blind subjects, each using different methods. Fibroblast period length was measured via cyclical expression of a lentivirally delivered circadian reporter. Within each group, a positive linear correlation was observed between circadian period length in physiology and in fibroblast gene expression. Interestingly, although blind individuals showed on average the same fibroblast clock properties as sighted ones, their physiological periods were significantly longer. CONCLUSIONS/SIGNIFICANCE: We conclude that the period of human circadian behaviour is mostly driven by cellular clock properties in normal individuals and can be approximated by measurement in peripheral cells such as fibroblasts. Based upon differences among sighted and blind subjects, we also speculate that period can be modified by prolonged unusual conditions such as the total light deprivation of blindness.

  20. Direct evidence that the VEGF-specific antibody bevacizumab has antivascular effects in human rectal cancer

    Science.gov (United States)

    Willett, Christopher G; Boucher, Yves; di Tomaso, Emmanuelle; Duda, Dan G; Munn, Lance L; Tong, Ricky T; Chung, Daniel C; Sahani, Dushyant V; Kalva, Sanjeeva P; Kozin, Sergey V; Mino, Mari; Cohen, Kenneth S; Scadden, David T; Hartford, Alan C; Fischman, Alan J; Clark, Jeffrey W; Ryan, David P; Zhu, Andrew X; Blaszkowsky, Lawrence S; Chen, Helen X; Shellito, Paul C; Lauwers, Gregory Y; Jain, Rakesh K

    2009-01-01

    The effects of vascular endothelial growth factor (VEGF) blockade on the vascular biology of human tumors are not known. Here we show here that a single infusion of the VEGF-specific antibody bevacizumab decreases tumor perfusion, vascular volume, microvascular density, interstitial fluid pressure and the number of viable, circulating endothelial and progenitor cells, and increases the fraction of vessels with pericyte coverage in rectal carcinoma patients. These data indicate that VEGF blockade has a direct and rapid antivascular effect in human tumors. PMID:14745444

  1. Direct electrical stimulation of human cortex evokes high gamma activity that predicts conscious somatosensory perception

    Science.gov (United States)

    Muller, Leah; Rolston, John D.; Fox, Neal P.; Knowlton, Robert; Rao, Vikram R.; Chang, Edward F.

    2018-04-01

    Objective. Direct electrical stimulation (DES) is a clinical gold standard for human brain mapping and readily evokes conscious percepts, yet the neurophysiological changes underlying these percepts are not well understood. Approach. To determine the neural correlates of DES, we stimulated the somatosensory cortex of ten human participants at frequency-amplitude combinations that both elicited and failed to elicit conscious percepts, meanwhile recording neural activity directly surrounding the stimulation site. We then compared the neural activity of perceived trials to that of non-perceived trials. Main results. We found that stimulation evokes distributed high gamma activity, which correlates with conscious perception better than stimulation parameters themselves. Significance. Our findings suggest that high gamma activity is a reliable biomarker for perception evoked by both natural and electrical stimuli.

  2. Loss of urban forest canopy and the related effects on soundscape and human directed attention

    Science.gov (United States)

    Laverne, Robert James Paul

    The specific questions addressed in this research are: Will the loss of trees in residential neighborhoods result in a change to the local soundscape? The investigation of this question leads to a related inquiry: Do the sounds of the environment in which a person is present affect their directed attention?. An invasive insect pest, the Emerald Ash Borer (Agrilus planipennis ), is killing millions of ash trees (genus Fraxinus) throughout North America. As the loss of tree canopy occurs, urban ecosystems change (including higher summer temperatures, more stormwater runoff, and poorer air quality) causing associated changes to human physical and mental health. Previous studies suggest that conditions in urban environments can result in chronic stress in humans and fatigue to directed attention, which is the ability to focus on tasks and to pay attention. Access to nature in cities can help refresh directed attention. The sights and sounds associated with parks, open spaces, and trees can serve as beneficial counterbalances to the irritating conditions associated with cities. This research examines changes to the quantity and quality of sounds in Arlington Heights, Illinois. A series of before-and-after sound recordings were gathered as trees died and were removed between 2013 and 2015. Comparison of recordings using the Raven sound analysis program revealed significant differences in some, but not all measures of sound attributes as tree canopy decreased. In general, more human-produced mechanical sounds (anthrophony) and fewer sounds associated with weather (geophony) were detected. Changes in sounds associated with animals (biophony) varied seasonally. Monitoring changes in the proportions of anthrophony, biophony and geophony can provide insight into changes in biodiversity, environmental health, and quality of life for humans. Before-tree-removal and after-tree-removal sound recordings served as the independent variable for randomly-assigned human volunteers as

  3. Rapid, Directed Differentiation of Retinal Pigment Epithelial Cells from Human Embryonic or Induced Pluripotent Stem Cells

    OpenAIRE

    Foltz, LP; Clegg, DO

    2017-01-01

    We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing a detailed and thorough protocol is to clearly demonstrate each step and to make this readily available to researchers in the field. This protocol results in a homogenous layer of RPE with minimal or no manual dissection needed. The method presented here has been shown to be effective for induced pluripotent stem cells (iPSC) and human embry...

  4. mTORC1 directly phosphorylates and regulates human MAF1.

    OpenAIRE

    Michels Annemieke A; Robitaille Aaron M; Buczynski-Ruchonnet Diane; Hodroj Wassim; Reina Jaime H; Hall Michael N; Hernandez Nouria

    2010-01-01

    mTORC1 is a central regulator of growth in response to nutrient availability, but few direct targets have been identified. RNA polymerase (pol) III produces a number of essential RNA molecules involved in protein synthesis, RNA maturation, and other processes. Its activity is highly regulated, and deregulation can lead to cell transformation. The human phosphoprotein MAF1 becomes dephosphorylated and represses pol III transcription after various stresses, but neither the significance of the p...

  5. Direct visualization of lipid domains in human skin stratum corneum's lipid membranes

    DEFF Research Database (Denmark)

    Plasencia, I; Norlen, Lars; Bagatolli, Luis

    2007-01-01

    scanning calorimetry, fluorescence spectroscopy, and two-photon excitation and laser scanning confocal fluorescence microscopy. Here we show that hydrated bilayers of human skin stratum corneum lipids express a giant sponge-like morphology with dimensions corresponding to the global three......-dimensional morphology of the stratum corneum extracellular space. These structures can be directly visualized using the aforementioned fluorescence microscopy techniques. At skin physiological temperatures (28 degrees C-32 degrees C), the phase state of these hydrated bilayers correspond microscopically (radial...

  6. Direct microcomputer controlled determination of zinc in human serum by flow injection atomic absorption spectrometry

    DEFF Research Database (Denmark)

    Simonsen, Kirsten Wiese; Nielsen, Bent; Jensen, Arne

    1986-01-01

    A procedure is described for the direct determination of zinc in human serum by fully automated, microcomputer controlled flow injection atomic absorption spectrometry (Fl-AAS). The Fl system is pumpless, using the negative pressure created by the nebuliser. It only consists of a three-way valve......, programmable from the microcomputer, to control the sample volume. No pre-treatment of the samples is necessary. The limit of detection is 0.14 mg l–1, and only small amounts of serum (

  7. Self-directed learning in gross human anatomy: assessment outcomes and student perceptions.

    Science.gov (United States)

    Smythe, Gayle; Hughes, Diane

    2008-01-01

    Speech pathology students enrolled in a lecture-based gross human anatomy program completed two out of nine topics in self-directed mode. Student performance in quizzes was compared for the two modes, and the students completed questionnaires on their perceptions of the self-directed mode of delivery. Students performed as well in the first self-directed topic as they did in lecture-based material, but performance declined significantly on the second self-directed topic. Correlations showed that students who performed well in lecture-based topics also performed well on self-directed topics. The major issues that arose in the student questionnaires were primarily related to the amount of content in the topics and the length of time required for completion. We conclude that there is a strong need for appropriate design of distance education materials to reflect student perceptions of length, content, and time investment, and more importantly that there is a need to ensure extensive communication and support of students studying in distance education/self-directed modes for the first time.

  8. Gamma irradiation does not induce detectable changes in DNA methylation directly following exposure of human cells.

    Directory of Open Access Journals (Sweden)

    Christoph Lahtz

    Full Text Available Environmental chemicals and radiation have often been implicated in producing alterations of the epigenome thus potentially contributing to cancer and other diseases. Ionizing radiation, released during accidents at nuclear power plants or after atomic bomb explosions, is a potentially serious health threat for the exposed human population. This type of high-energy radiation causes DNA damage including single- and double-strand breaks and induces chromosomal rearrangements and mutations, but it is not known if ionizing radiation directly induces changes in the epigenome of irradiated cells. We treated normal human fibroblasts and normal human bronchial epithelial cells with different doses of γ-radiation emitted from a cesium 137 ((137Cs radiation source. After a seven-day recovery period, we analyzed global DNA methylation patterns in the irradiated and control cells using the methylated-CpG island recovery assay (MIRA in combination with high-resolution microarrays. Bioinformatics analysis revealed only a small number of potential methylation changes with low fold-difference ratios in the irradiated cells. These minor methylation differences seen on the microarrays could not be verified by COBRA (combined bisulfite restriction analysis or bisulfite sequencing of selected target loci. Our study shows that acute γ-radiation treatment of two types of human cells had no appreciable direct effect on DNA cytosine methylation patterns in exposed cells.

  9. Direct Neural Conversion from Human Fibroblasts Using Self-Regulating and Nonintegrating Viral Vectors

    Directory of Open Access Journals (Sweden)

    Shong Lau

    2014-12-01

    Full Text Available Summary: Recent findings show that human fibroblasts can be directly programmed into functional neurons without passing via a proliferative stem cell intermediate. These findings open up the possibility of generating subtype-specific neurons of human origin for therapeutic use from fetal cell, from patients themselves, or from matched donors. In this study, we present an improved system for direct neural conversion of human fibroblasts. The neural reprogramming genes are regulated by the neuron-specific microRNA, miR-124, such that each cell turns off expression of the reprogramming genes once the cell has reached a stable neuronal fate. The regulated system can be combined with integrase-deficient vectors, providing a nonintegrative and self-regulated conversion system that rids problems associated with the integration of viral transgenes into the host genome. These modifications make the system suitable for clinical use and therefore represent a major step forward in the development of induced neurons for cell therapy. : Lau et al. now use miRNA targeting to build a self-regulating neural conversion system. Combined with nonintegrating vectors, this system can efficiently drive conversion of human fibroblasts into functional induced neurons (iNs suitable for clinical applications.

  10. New sensitive direct radioimmunoassay for human plasma renin and its clinical application

    International Nuclear Information System (INIS)

    Higaki, J.; Ogihara, T.; Imai, N.; Kumahara, Y.; Hontani, S.; Nishiura, M.; Ogawa, H.; Hirose, S.; Murakami, K.

    1984-01-01

    A new sensitive direct radioimmunoassay for human plasma renin has been developed. Renin was purified from Haas' preparation utilizing a pepstatin-C 6 -Sepharose affinity chromatography. Antiserum, prepared by immunizing rabbits with the purified renin, was used for the direct radioimmunoassay at a final dilution of 1:30,000. The antibody was specific for human renal and plasma renin, but did not cross-react with cathepsin D, trypsin, or renins of mouse, dog, and rat. Radioimmunoassay was performed by the double antibody technique using the delayed tracer addition method. In this method, a standard curve was obtained over a range from 0.2 to 8.0 ng/ml. The values from this assay correlated well with total renin activity measured as the generation rate of angiotensin I after trypsin activation, but correlated weakly with active renin activity. This finding disclosed that both active and inactive renin were detected by this method. In normal participants, plasma renin concentration determined by direct radioimmunoassay was increased by standing and furosemide injection. The plasma renin concentration determined by direct radioimmunoassay of patients with essential hypertension was not significantly different from values in normal controls. The values were higher in patients with renovascular hypertension, malignant hypertension and Bartter's syndrome, but lower in patients with primary aldosteronism than in normal controls. 20 references, 7 figures

  11. Assessing Impact Direction in 3-point Bending of Human Femora: Incomplete Butterfly Fractures and Fracture Surfaces,.

    Science.gov (United States)

    Isa, Mariyam I; Fenton, Todd W; Deland, Trevor; Haut, Roger C

    2018-01-01

    Current literature associates bending failure with butterfly fracture, in which fracture initiates transversely at the tensile surface of a bent bone and branches as it propagates toward the impact surface. The orientation of the resulting wedge fragment is often considered diagnostic of impact direction. However, experimental studies indicate bending does not always produce complete butterfly fractures or produces wedge fragments variably in tension or compression, precluding their use in interpreting directionality. This study reports results of experimental 3-point bending tests on thirteen unembalmed human femora. Complete fracture patterns varied following bending failure, but incomplete fractures and fracture surface characteristics were observed in all impacted specimens. A flat, billowy fracture surface was observed in tension, while jagged, angular peaks were observed in compression. Impact direction was accurately reconstructed using incomplete tension wedge butterfly fractures and tension and compression fracture surface criteria in all thirteen specimens. © 2017 American Academy of Forensic Sciences.

  12. The Degradation Interface of Magnesium Based Alloys in Direct Contact with Human Primary Osteoblast Cells.

    Directory of Open Access Journals (Sweden)

    Nezha Ahmad Agha

    Full Text Available Magnesium alloys have been identified as a new generation material of orthopaedic implants. In vitro setups mimicking physiological conditions are promising for material / degradation analysis prior to in vivo studies however the direct influence of cell on the degradation mechanism has never been investigated. For the first time, the direct, active, influence of human primary osteoblasts on magnesium-based materials (pure magnesium, Mg-2Ag and Mg-10Gd alloys is studied for up to 14 days. Several parameters such as composition of the degradation interface (directly beneath the cells are analysed with a scanning electron microscope equipped with energy dispersive X-ray and focused ion beam. Furthermore, influence of the materials on cell metabolism is examined via different parameters like active mineralisation process. The results are highlighting the influences of the selected alloying element on the initial cells metabolic activity.

  13. The Degradation Interface of Magnesium Based Alloys in Direct Contact with Human Primary Osteoblast Cells.

    Science.gov (United States)

    Ahmad Agha, Nezha; Willumeit-Römer, Regine; Laipple, Daniel; Luthringer, Bérengère; Feyerabend, Frank

    2016-01-01

    Magnesium alloys have been identified as a new generation material of orthopaedic implants. In vitro setups mimicking physiological conditions are promising for material / degradation analysis prior to in vivo studies however the direct influence of cell on the degradation mechanism has never been investigated. For the first time, the direct, active, influence of human primary osteoblasts on magnesium-based materials (pure magnesium, Mg-2Ag and Mg-10Gd alloys) is studied for up to 14 days. Several parameters such as composition of the degradation interface (directly beneath the cells) are analysed with a scanning electron microscope equipped with energy dispersive X-ray and focused ion beam. Furthermore, influence of the materials on cell metabolism is examined via different parameters like active mineralisation process. The results are highlighting the influences of the selected alloying element on the initial cells metabolic activity.

  14. Direct observation of glycogen synthesis in human muscle with 13C NMR

    International Nuclear Information System (INIS)

    Jue, T.; Rothman, D.L.; Shulman, G.I.; Tavitian, B.A.; DeFronzo, R.A.; Shulman, R.G.

    1989-01-01

    On the basis of previous indirect measurements, skeletal muscle has been implicated as the major site of glucose uptake and it has been suggested that muscle glycogen formation is the dominant pathway. However, direct measurements of the rates of glycogen synthesis have not been possible by previous techniques. The authors have developed 13 C NMR methods to measure directly the rate of human muscle glycogen formation from infused, isotopically labeled [1- 13 C]glucose. They show that under conditions of imposed hyperglycemia and hyperinsulinemia, a majority of the infused glucose was converted to muscle glycogen in a normal man. This directly shows that muscle is the major site of glucose disposal under these conditions, and provides quantitation of the glucose flux to muscle glycogen

  15. Oxytocin receptor gene polymorphisms are associated with human directed social behavior in dogs (Canis familiaris.

    Directory of Open Access Journals (Sweden)

    Anna Kis

    Full Text Available The oxytocin system has a crucial role in human sociality; several results prove that polymorphisms of the oxytocin receptor gene are related to complex social behaviors in humans. Dogs' parallel evolution with humans and their adaptation to the human environment has made them a useful species to model human social interactions. Previous research indicates that dogs are eligible models for behavioral genetic research, as well. Based on these previous findings, our research investigated associations between human directed social behaviors and two newly described (-212AG, 19131AG and one known (rs8679684 single nucleotide polymorphisms (SNPs in the regulatory regions (5' and 3' UTR of the oxytocin receptor gene in German Shepherd (N = 104 and Border Collie (N = 103 dogs. Dogs' behavior traits have been estimated in a newly developed test series consisting of five episodes: Greeting by a stranger, Separation from the owner, Problem solving, Threatening approach, Hiding of the owner. Buccal samples were collected and DNA was isolated using standard protocols. SNPs in the 3' and 5' UTR regions were analyzed by polymerase chain reaction based techniques followed by subsequent electrophoresis analysis. The gene-behavior association analysis suggests that oxytocin receptor gene polymorphisms have an impact in both breeds on (i proximity seeking towards an unfamiliar person, as well as their owner, and on (ii how friendly dogs behave towards strangers, although the mediating molecular regulatory mechanisms are yet unknown. Based on these results, we conclude that similarly to humans, the social behavior of dogs towards humans is influenced by the oxytocin system.

  16. mTORC1 directly phosphorylates and regulates human MAF1.

    Science.gov (United States)

    Michels, Annemieke A; Robitaille, Aaron M; Buczynski-Ruchonnet, Diane; Hodroj, Wassim; Reina, Jaime H; Hall, Michael N; Hernandez, Nouria

    2010-08-01

    mTORC1 is a central regulator of growth in response to nutrient availability, but few direct targets have been identified. RNA polymerase (pol) III produces a number of essential RNA molecules involved in protein synthesis, RNA maturation, and other processes. Its activity is highly regulated, and deregulation can lead to cell transformation. The human phosphoprotein MAF1 becomes dephosphorylated and represses pol III transcription after various stresses, but neither the significance of the phosphorylations nor the kinase involved is known. We find that human MAF1 is absolutely required for pol III repression in response to serum starvation or TORC1 inhibition by rapamycin or Torin1. The protein is phosphorylated mainly on residues S60, S68, and S75, and this inhibits its pol III repression function. The responsible kinase is mTORC1, which phosphorylates MAF1 directly. Our results describe molecular mechanisms by which mTORC1 controls human MAF1, a key repressor of RNA polymerase III transcription, and add a new branch to the signal transduction cascade immediately downstream of TORC1.

  17. mTORC1 Directly Phosphorylates and Regulates Human MAF1▿

    Science.gov (United States)

    Michels, Annemieke A.; Robitaille, Aaron M.; Buczynski-Ruchonnet, Diane; Hodroj, Wassim; Reina, Jaime H.; Hall, Michael N.; Hernandez, Nouria

    2010-01-01

    mTORC1 is a central regulator of growth in response to nutrient availability, but few direct targets have been identified. RNA polymerase (pol) III produces a number of essential RNA molecules involved in protein synthesis, RNA maturation, and other processes. Its activity is highly regulated, and deregulation can lead to cell transformation. The human phosphoprotein MAF1 becomes dephosphorylated and represses pol III transcription after various stresses, but neither the significance of the phosphorylations nor the kinase involved is known. We find that human MAF1 is absolutely required for pol III repression in response to serum starvation or TORC1 inhibition by rapamycin or Torin1. The protein is phosphorylated mainly on residues S60, S68, and S75, and this inhibits its pol III repression function. The responsible kinase is mTORC1, which phosphorylates MAF1 directly. Our results describe molecular mechanisms by which mTORC1 controls human MAF1, a key repressor of RNA polymerase III transcription, and add a new branch to the signal transduction cascade immediately downstream of TORC1. PMID:20516213

  18. Goats display audience-dependent human-directed gazing behaviour in a problem-solving task.

    Science.gov (United States)

    Nawroth, Christian; Brett, Jemma M; McElligott, Alan G

    2016-07-01

    Domestication is an important factor driving changes in animal cognition and behaviour. In particular, the capacity of dogs to communicate in a referential and intentional way with humans is considered a key outcome of how domestication as a companion animal shaped the canid brain. However, the lack of comparison with other domestic animals makes general conclusions about how domestication has affected these important cognitive features difficult. We investigated human-directed behaviour in an 'unsolvable problem' task in a domestic, but non-companion species: goats. During the test, goats experienced a forward-facing or an away-facing person. They gazed towards the forward-facing person earlier and for longer and showed more gaze alternations and a lower latency until the first gaze alternation when the person was forward-facing. Our results provide strong evidence for audience-dependent human-directed visual orienting behaviour in a species that was domesticated primarily for production, and show similarities with the referential and intentional communicative behaviour exhibited by domestic companion animals such as dogs and horses. This indicates that domestication has a much broader impact on heterospecific communication than previously believed. © 2016 The Author(s).

  19. Direct RNA-based detection of CTX-M β-lactamases in human blood samples.

    Science.gov (United States)

    Stein, Claudia; Makarewicz, Oliwia; Pfeifer, Yvonne; Brandt, Christian; Pletz, Mathias W

    2015-05-01

    Bloodstream infections with ESBL-producers are associated with increased mortality, which is due to delayed appropriate treatment resulting in clinical failure. Current routine diagnostics for detection of bloodstream infections consists of blood culture followed by species identification and susceptibility testing. In attempts to improve and accelerate diagnostic procedures, PCR-based methods have been developed. These methods focus on species identification covering only a limited number of ESBL coding genes. Therefore, they fail to cover the steadily further evolving genetic diversity of clinically relevant β-lactamases. We have recently designed a fast and novel RNA targeting method to detect and specify CTX-M alleles from bacterial cultures, based on an amplification-pyrosequencing approach. We further developed this assay towards a diagnostic tool for clinical use and evaluated its sensitivity and specificity when applied directly to human blood samples. An optimized protocol for mRNA isolation allows detection of specific CTX-M groups from as little as 100 CFU/mL blood via reverse transcription, amplification, and pyrosequencing directly from human EDTA blood samples as well as from pre-incubated human blood cultures with a turnaround time for test results of <7 h. Copyright © 2015 Elsevier GmbH. All rights reserved.

  20. Generation of Directly Converted Human Osteoblasts That Are Free of Exogenous Gene and Xenogenic Protein.

    Science.gov (United States)

    Yamamoto, Kenta; Sato, Yoshiki; Honjo, Kenichi; Ichioka, Hiroaki; Oseko, Fumishige; Sowa, Yoshihiro; Yamamoto, Toshiro; Kanamura, Narisato; Kishida, Tsunao; Mazda, Osam

    2016-11-01

    Generation of osteoblasts from human somatic cells may be applicable in an effective transplantation therapy against bone diseases. Recently we established a procedure to directly convert human fibroblasts into osteoblasts by transducing some transcription factor genes via retroviral vectors. However, retroviral vector-mediated transduction may potentially cause tumor formation from the infected cells, thus a non-viral gene transfection method may be more preferable for preparation of osteoblasts to be used for transplantation therapy. Here, we constructed a plasmid vector encoding Oct4, Osterix, and L-Myc that were an appropriate combination of transcription factors for this purpose. Osteoblast-like phenotypes including high alkaline phosphatase (ALP) activity, bone matrix production and osteoblast-specific gene expression were induced in normal human fibroblasts that were transfected with the plasmid followed by culturing in osteogenic medium. The plasmid-driven directly converted osteoblasts (p-dOBs) were obtained even in the absence of a xenogenic protein. The plasmid vector sequence had fallen out of the p-dOBs. The cells formed deposition of calcified bodies in situ after transplantation into mice. These results strongly suggest that p-dOBs can be put into practical use for a novel cell-based therapy against bone diseases. J. Cell. Biochem. 117: 2538-2545, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  1. The effect of atomoxetine on random and directed exploration in humans.

    Science.gov (United States)

    Warren, Christopher M; Wilson, Robert C; van der Wee, Nic J; Giltay, Eric J; van Noorden, Martijn S; Cohen, Jonathan D; Nieuwenhuis, Sander

    2017-01-01

    The adaptive regulation of the trade-off between pursuing a known reward (exploitation) and sampling lesser-known options in search of something better (exploration) is critical for optimal performance. Theory and recent empirical work suggest that humans use at least two strategies for solving this dilemma: a directed strategy in which choices are explicitly biased toward information seeking, and a random strategy in which decision noise leads to exploration by chance. Here we examined the hypothesis that random exploration is governed by the neuromodulatory locus coeruleus-norepinephrine system. We administered atomoxetine, a norepinephrine transporter blocker that increases extracellular levels of norepinephrine throughout the cortex, to 22 healthy human participants in a double-blind crossover design. We examined the effect of treatment on performance in a gambling task designed to produce distinct measures of directed exploration and random exploration. In line with our hypothesis we found an effect of atomoxetine on random, but not directed exploration. However, contrary to expectation, atomoxetine reduced rather than increased random exploration. We offer three potential explanations of our findings, involving the non-linear relationship between tonic NE and cognitive performance, the interaction of atomoxetine with other neuromodulators, and the possibility that atomoxetine affected phasic norepinephrine activity more so than tonic norepinephrine activity.

  2. Direct conversion of human fibroblasts into functional osteoblasts by defined factors.

    Science.gov (United States)

    Yamamoto, Kenta; Kishida, Tsunao; Sato, Yoshiki; Nishioka, Keisuke; Ejima, Akika; Fujiwara, Hiroyoshi; Kubo, Toshikazu; Yamamoto, Toshiro; Kanamura, Narisato; Mazda, Osam

    2015-05-12

    Osteoblasts produce calcified bone matrix and contribute to bone formation and remodeling. In this study, we established a procedure to directly convert human fibroblasts into osteoblasts by transducing some defined factors and culturing in osteogenic medium. Osteoblast-specific transcription factors, Runt-related transcription factor 2 (Runx2), and Osterix, in combination with Octamer-binding transcription factor 3/4 (Oct4) and L-Myc (RXOL) transduction, converted ∼ 80% of the fibroblasts into osteocalcin-producing cells. The directly converted osteoblasts (dOBs) induced by RXOL displayed a similar gene expression profile as normal human osteoblasts and contributed to bone repair after transplantation into immunodeficient mice at artificial bone defect lesions. The dOBs expressed endogenous Runx2 and Osterix, and did not require continuous expression of the exogenous genes to maintain their phenotype. Another combination, Oct4 plus L-Myc (OL), also induced fibroblasts to produce bone matrix, but the OL-transduced cells did not express Osterix and exhibited a more distant gene expression profile to osteoblasts compared with RXOL-transduced cells. These findings strongly suggest successful direct reprogramming of fibroblasts into functional osteoblasts by RXOL, a technology that may provide bone regeneration therapy against bone disorders.

  3. Planning Ahead: Object-Directed Sequential Actions Decoded from Human Frontoparietal and Occipitotemporal Networks

    Science.gov (United States)

    Gallivan, Jason P.; Johnsrude, Ingrid S.; Randall Flanagan, J.

    2016-01-01

    Object-manipulation tasks (e.g., drinking from a cup) typically involve sequencing together a series of distinct motor acts (e.g., reaching toward, grasping, lifting, and transporting the cup) in order to accomplish some overarching goal (e.g., quenching thirst). Although several studies in humans have investigated the neural mechanisms supporting the planning of visually guided movements directed toward objects (such as reaching or pointing), only a handful have examined how manipulatory sequences of actions—those that occur after an object has been grasped—are planned and represented in the brain. Here, using event-related functional MRI and pattern decoding methods, we investigated the neural basis of real-object manipulation using a delayed-movement task in which participants first prepared and then executed different object-directed action sequences that varied either in their complexity or final spatial goals. Consistent with previous reports of preparatory brain activity in non-human primates, we found that activity patterns in several frontoparietal areas reliably predicted entire action sequences in advance of movement. Notably, we found that similar sequence-related information could also be decoded from pre-movement signals in object- and body-selective occipitotemporal cortex (OTC). These findings suggest that both frontoparietal and occipitotemporal circuits are engaged in transforming object-related information into complex, goal-directed movements. PMID:25576538

  4. Human epithelial cells increase their rigidity with ageing in vitro: direct measurements

    International Nuclear Information System (INIS)

    Berdyyeva, Tamara K; Woodworth, Craig D; Sokolov, Igor

    2005-01-01

    The decrease in elasticity of epithelial tissues with ageing contributes to many human diseases. This change was previously attributed to increased crosslinking of extracellular matrix proteins. Here we show that individual human epithelial cells also become significantly more rigid during ageing in vitro. Using atomic force microscopy (AFM), we found that the Young's modulus of viable cells was consistently increased two- to four-fold in older versus younger cells. Direct visualization of the cytoskeleton using a novel method involving the AFM suggested that increased rigidity of ageing cells was due to a higher density of cytoskeletal fibres. Our results identify a unique mechanism that might contribute to the age-related loss of elasticity in epithelial tissues

  5. Efficient Generation of Human Embryonic Stem Cell-Derived Corneal Endothelial Cells by Directed Differentiation.

    Directory of Open Access Journals (Sweden)

    Kathryn L McCabe

    Full Text Available To generate human embryonic stem cell derived corneal endothelial cells (hESC-CECs for transplantation in patients with corneal endothelial dystrophies.Feeder-free hESC-CECs were generated by a directed differentiation protocol. hESC-CECs were characterized by morphology, expression of corneal endothelial markers, and microarray analysis of gene expression.hESC-CECs were nearly identical morphologically to primary human corneal endothelial cells, expressed Zona Occludens 1 (ZO-1 and Na+/K+ATPaseα1 (ATPA1 on the apical surface in monolayer culture, and produced the key proteins of Descemet's membrane, Collagen VIIIα1 and VIIIα2 (COL8A1 and 8A2. Quantitative PCR analysis revealed expression of all corneal endothelial pump transcripts. hESC-CECs were 96% similar to primary human adult CECs by microarray analysis.hESC-CECs are morphologically similar, express corneal endothelial cell markers and express a nearly identical complement of genes compared to human adult corneal endothelial cells. hESC-CECs may be a suitable alternative to donor-derived corneal endothelium.

  6. Anodal transcranial direct current stimulation reduces psychophysically measured surround suppression in the human visual cortex.

    Directory of Open Access Journals (Sweden)

    Daniel P Spiegel

    Full Text Available Transcranial direct current stimulation (tDCS is a safe, non-invasive technique for transiently modulating the balance of excitation and inhibition within the human brain. It has been reported that anodal tDCS can reduce both GABA mediated inhibition and GABA concentration within the human motor cortex. As GABA mediated inhibition is thought to be a key modulator of plasticity within the adult brain, these findings have broad implications for the future use of tDCS. It is important, therefore, to establish whether tDCS can exert similar effects within non-motor brain areas. The aim of this study was to assess whether anodal tDCS could reduce inhibitory interactions within the human visual cortex. Psychophysical measures of surround suppression were used as an index of inhibition within V1. Overlay suppression, which is thought to originate within the lateral geniculate nucleus (LGN, was also measured as a control. Anodal stimulation of the occipital poles significantly reduced psychophysical surround suppression, but had no effect on overlay suppression. This effect was specific to anodal stimulation as cathodal stimulation had no effect on either measure. These psychophysical results provide the first evidence for tDCS-induced reductions of intracortical inhibition within the human visual cortex.

  7. Direct radiocarbon dating and DNA analysis of the Darra-i-Kur (Afghanistan) human temporal bone.

    Science.gov (United States)

    Douka, Katerina; Slon, Viviane; Stringer, Chris; Potts, Richard; Hübner, Alexander; Meyer, Matthias; Spoor, Fred; Pääbo, Svante; Higham, Tom

    2017-06-01

    The temporal bone discovered in the 1960s from the Darra-i-Kur cave in Afghanistan is often cited as one of the very few Pleistocene human fossils from Central Asia. Here we report the first direct radiocarbon date for the specimen and the genetic analyses of DNA extracted and sequenced from two areas of the bone. The new radiocarbon determination places the find to ∼4500 cal BP (∼2500 BCE) contradicting an assumed Palaeolithic age of ∼30,000 years, as originally suggested. The DNA retrieved from the specimen originates from a male individual who carried mitochondrial DNA of the modern human type. The petrous part yielded more endogenous ancient DNA molecules than the squamous part of the same bone. Molecular dating of the Darra-i-Kur mitochondrial DNA sequence corroborates the radiocarbon date and suggests that the specimen is younger than previously thought. Taken together, the results consolidate the fact that the human bone is not associated with the Pleistocene-age deposits of Darra-i-Kur; instead it is intrusive, possibly re-deposited from upper levels dating to much later periods (Neolithic). Despite its Holocene age, the Darra-i-Kur specimen is, so far, the first and only ancient human from Afghanistan whose DNA has been sequenced. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. A Generalized Radiation Model for Human Mobility: Spatial Scale, Searching Direction and Trip Constraint.

    Directory of Open Access Journals (Sweden)

    Chaogui Kang

    Full Text Available We generalized the recently introduced "radiation model", as an analog to the generalization of the classic "gravity model", to consolidate its nature of universality for modeling diverse mobility systems. By imposing the appropriate scaling exponent λ, normalization factor κ and system constraints including searching direction and trip OD constraint, the generalized radiation model accurately captures real human movements in various scenarios and spatial scales, including two different countries and four different cities. Our analytical results also indicated that the generalized radiation model outperformed alternative mobility models in various empirical analyses.

  9. Quantitative assay for the measurement of immune responses directed against the human placenta

    Energy Technology Data Exchange (ETDEWEB)

    Davies, M; Sutcliffe, R G [Glasgow Univ. (UK)

    1982-02-12

    A quantitative in vitro immune assay based on the classical chromium release assay has been developed to detect immune responses directed against alien antigens expressed by the developing foetus and present on the maternal-facing surface of the human placenta. A plasma membrane fraction from the surface of the placenta was prepared and the vesicles thus formed were radiolabelled with /sup 51/Cr. The /sup 51/Cr-labelled vesicles, by various criteria, were found to be suitable for use as targets in a release assay. Further, by means of experimentally immunised animals, the target membranes were shown to be capable of detecting both cellular and humoral anti-placental activity.

  10. Fundamental and clinical study of direct immunoradiometric assay in human renin concentration

    International Nuclear Information System (INIS)

    Kurimoto, Fumihiko; Horiuchi, Junko; Sakurai, Hyoichiro; Suzuki, Hiromichi; Takita, Takashi; Saruta, Takao.

    1988-01-01

    'Renin RIA Pasteur' kit for directly measuring renin concentration in human plasma (PRC) was fundamentally and clinically evaluated. A standard curve for PRC was linear in the range of 10 - 640 pg/ml. Reproducibility, recovery, and stability were satisfactory. There was a significantly positive correlation between direct PRC and conventional plasma renin activity (PRA) and indirect PRC. PRC was directly measured in 119 healthy volunteers and 15 patients with primary aldosteronism (4), Cushing's syndrome (6), or non-functioning tumor (5). The basal PRC was 32.4 +- 18.8 pg/ml for men and 37.9 +- 22.6 pg/ml for women. PRC for primary aldosteronism was below detectable levels, and remained unchanged even after the administratin of ACTH. In the case of Cushing's syndrome, mean PRC and PRA were 19 pg/ml and 1.2 ng/ml/hr, and did not respond to ACTH. Although the administration of ATCH was significantly associated with a decreased PRC, there was only tendency toward the decreased PRA in the case of non-functioning tumors. The results indicate the usefulness of the present kit in terms of its ability to directly measure PRC without any complicated procedures. (Namekawa, K.)

  11. To ban or not to ban: direct-to-consumer advertising and human rights analysis

    Directory of Open Access Journals (Sweden)

    Alex Wellington

    2010-12-01

    Full Text Available The issues surrounding Direct-To-Consumer Advertising of pharmaceuticals are ripe for scrutiny through the lens of Human Rights analysis. Among the human rights most decisively engaged by DTCA is the right to autonomy in health-related decision making, which in turn incorporates right of access to health-related information. The latter incorporates, in part, right of access to reliable and beneficial information through the avenues of commercial speech among others. Another crucial human right is the right not to be harmed by unsafe consumer products through corporate malfeasance or negligence. The most commonly invoked policy options in the context of DTCA are either an outright ban or strengthening regulatory oversight in combination with voluntary guidelines. Banning Direct-To-Consumer Advertising risks being both over inclusive and under inclusive as a policy option. A wholesale ban risks being over inclusive in that it could deprive consumers of information about medications with a positive benefit-risk profile, ones that could enhance their quality of health and well being. Thus it risks being overly paternalistic. Banning DTCA, by itself, is under inclusive in that it is insufficient to address the ways that unadvertised drugs can pose significant risks to consumers. Other policy measures would be most optimal to deal with the very serious deficits in the processes by which prescription drugs undergo clinical trials, and garner regulatory approval prior to their promotion in the marketplace. A more finely tuned approach to regulatory oversight is endorsed, one involving a proactive and precautionary approach reliant upon prior approval. Such an approach could help to address the very serious concerns about potential infringements of the human right not to be harmed by unsafe consumer products through corporate malfeasance or negligence.

  12. Systems Analysis of Human Visuo-Myoelectric Control Facilitated by Anodal Transcranial Direct Current Stimulation in Healthy Humans

    Directory of Open Access Journals (Sweden)

    Vinh Kha

    2018-04-01

    Full Text Available Induction of neuroplasticity by transcranial direct current stimulation (tDCS applied to the primary motor cortex facilitates motor learning of the upper extremities in healthy humans. The impact of tDCS on lower limb functions has not been studied extensively so far. In this study, we applied a system identification approach to investigate the impact of anodal transcranial direct current stimulation of the leg area of the motor cortex via the human visuo-myoelectric controller. The visuo-myoelectric reaching task (VMT involves ballistic muscle contraction after a visual cue. We applied a black box approach using a linear ARX (Auto-regressive with eXogenous input model for a visuomotor myoelectric reaching task. We found that a 20th order finite impulse response (FIR model captured the TARGET (single input—CURSOR (single output dynamics during a VMT. The 20th order FIR model was investigated based on gain/phase margin analysis, which showed a significant (p < 0.01 effect of anodal tDCS on the gain margin of the VMT system. Also, response latency and the corticomuscular coherence (CMC time delay were affected (p < 0.05 by anodal tDCS when compared to sham tDCS. Furthermore, gray box simulation results from a Simplified Spinal-Like Controller (SSLC model demonstrated that the input-output function for motor evoked potentials (MEP played an essential role in increasing muscle activation levels and response time improvement post-tDCS when compared to pre-tDCS baseline performance. This computational approach can be used to simulate the behavior of the neuromuscular controller during VMT to elucidate the effects of adjuvant treatment with tDCS.

  13. Direct Differentiation of Human Pluripotent Stem Cells into Haploid Spermatogenic Cells

    Directory of Open Access Journals (Sweden)

    Charles A. Easley, IV

    2012-09-01

    Full Text Available Human embryonic stem cells (hESCs and induced pluripotent stem cells (hiPSCs have been shown to differentiate into primordial germ cells (PGCs but not into spermatogonia, haploid spermatocytes, or spermatids. Here, we show that hESCs and hiPSCs differentiate directly into advanced male germ cell lineages, including postmeiotic, spermatid-like cells, in vitro without genetic manipulation. Furthermore, our procedure mirrors spermatogenesis in vivo by differentiating PSCs into UTF1-, PLZF-, and CDH1-positive spermatogonia-like cells; HIWI- and HILI-positive spermatocyte-like cells; and haploid cells expressing acrosin, transition protein 1, and protamine 1 (proteins that are uniquely found in spermatids and/or sperm. These spermatids show uniparental genomic imprints similar to those of human sperm on two loci: H19 and IGF2. These results demonstrate that male PSCs have the ability to differentiate directly into advanced germ cell lineages and may represent a novel strategy for studying spermatogenesis in vitro.

  14. p21-Activated kinase (PAK regulates cytoskeletal reorganization and directional migration in human neutrophils.

    Directory of Open Access Journals (Sweden)

    Asako Itakura

    Full Text Available Neutrophils serve as a first line of defense in innate immunity owing in part to their ability to rapidly migrate towards chemotactic factors derived from invading pathogens. As a migratory function, neutrophil chemotaxis is regulated by the Rho family of small GTPases. However, the mechanisms by which Rho GTPases orchestrate cytoskeletal dynamics in migrating neutrophils remain ill-defined. In this study, we characterized the role of p21-activated kinase (PAK downstream of Rho GTPases in cytoskeletal remodeling and chemotactic processes of human neutrophils. We found that PAK activation occurred upon stimulation of neutrophils with f-Met-Leu-Phe (fMLP, and PAK accumulated at the actin-rich leading edge of stimulated neutrophils, suggesting a role for PAK in Rac-dependent actin remodeling. Treatment with the pharmacological PAK inhibitor, PF3758309, abrogated the integrity of RhoA-mediated actomyosin contractility and surface adhesion. Moreover, inhibition of PAK activity impaired neutrophil morphological polarization and directional migration under a gradient of fMLP, and was associated with dysregulated Ca(2+ signaling. These results suggest that PAK serves as an important effector of Rho-family GTPases in neutrophil cytoskeletal reorganization, and plays a key role in driving efficient directional migration of human neutrophils.

  15. Direct effects of fermented cow's milk product with Lactobacillus paracasei CBA L74 on human enterocytes.

    Science.gov (United States)

    Paparo, L; Aitoro, R; Nocerino, R; Fierro, C; Bruno, C; Canani, R Berni

    2018-01-29

    Cow's milk fermented with Lactobacillus paracasei CBA L74 (FM-CBAL74) exerts a preventive effect against infectious diseases in children. We evaluated if this effect is at least in part related to a direct modulation of non-immune and immune defence mechanisms in human enterocytes. Human enterocytes (Caco-2) were stimulated for 48 h with FM-CBAL74 at different concentrations. Cell growth was assessed by colorimetric assay; cell differentiation (assessed by lactase expression), tight junction proteins (zonula occludens1 and occludin), mucin 2, and toll-like receptor (TRL) pathways were analysed by real-time PCR; innate immunity peptide synthesis, beta-defensin-2 (HBD-2) and cathelicidin (LL-37) were evaluated by ELISA. Mucus layer thickness was analysed by histochemistry. FMCBA L74 stimulated cell growth and differentiation, tight junction proteins and mucin 2 expression, and mucus layer thickness in a dose-dependent fashion. A significant stimulation of HBD-2 and LL-37 synthesis, associated with a modulation of TLR pathway, was also observed. FM-CBAL74 regulates non-immune and immune defence mechanisms through a direct interaction with the enterocytes. These effects could be involved in the preventive action against infectious diseases demonstrated by this fermented product in children.

  16. Development and optimization of a direct plaque assay for human and avian metapneumoviruses

    Science.gov (United States)

    Zhang, Yu; Wei, Yongwei; Li, Junan; Li, Jianrong

    2012-01-01

    The genus Metapneumovirus within the subfamily Pneumovirinae and family Paramyxoviridae includes only two viruses, human metapneumovirus (hMPV) and avian metapneumovirus (aMPV), which cause respiratory disease in humans and birds, respectively. These two viruses grow poorly in cell culture and other quantitation methods, such as indirect immuno-staining and immuno-fluorescent assays, are expensive, time consuming, and do not allow for plaque purification of the virus. In order to enhance research efforts for studying these two viruses, a direct plaque assay for both hMPV and aMPV has been developed. By optimizing the chemical components of the agarose overlay, it was found that both hMPV with a trypsin-independent F cleavage site and aMPV formed clear and countable plaques in a number of mammalian cell lines (such as Vero-E6 and LLC-MK2 cells) after 5 days of incubation. The plaque forming assay has similar sensitivity and reliability as the currently used immunological methods for viral quantitation. The plaque assay is also a more simple, rapid, and economical method compared to immunological assays, and in addition allows for plaque purification of the viruses. The direct plaque assay will be a valuable method for the quantitation and evaluation of the biological properties of some metapneumoviruses. PMID:22684013

  17. Pharmacological modulation of cortical excitability shifts induced by transcranial direct current stimulation in humans.

    Science.gov (United States)

    Nitsche, M A; Fricke, K; Henschke, U; Schlitterlau, A; Liebetanz, D; Lang, N; Henning, S; Tergau, F; Paulus, W

    2003-11-15

    Transcranial direct current stimulation (tDCS) of the human motor cortex results in polarity-specific shifts of cortical excitability during and after stimulation. Anodal tDCS enhances and cathodal stimulation reduces excitability. Animal experiments have demonstrated that the effect of anodal tDCS is caused by neuronal depolarisation, while cathodal tDCS hyperpolarises cortical neurones. However, not much is known about the ion channels and receptors involved in these effects. Thus, the impact of the sodium channel blocker carbamazepine, the calcium channel blocker flunarizine and the NMDA receptor antagonist dextromethorphane on tDCS-elicited motor cortical excitability changes of healthy human subjects were tested. tDCS-protocols inducing excitability alterations (1) only during tDCS and (2) eliciting long-lasting after-effects were applied after drug administration. Carbamazepine selectively eliminated the excitability enhancement induced by anodal stimulation during and after tDCS. Flunarizine resulted in similar changes. Antagonising NMDA receptors did not alter current-generated excitability changes during a short stimulation, which elicits no after-effects, but prevented the induction of long-lasting after-effects independent of their direction. These results suggest that, like in other animals, cortical excitability shifts induced during tDCS in humans also depend on membrane polarisation, thus modulating the conductance of sodium and calcium channels. Moreover, they suggest that the after-effects may be NMDA receptor dependent. Since NMDA receptors are involved in neuroplastic changes, the results suggest a possible application of tDCS in the modulation or induction of these processes in a clinical setting. The selective elimination of tDCS-driven excitability enhancements by carbamazepine proposes a role for this drug in focussing the effects of cathodal tDCS, which may have important future clinical applications.

  18. Female-directed violence as a form of sexual coercion in humans (Homo sapiens).

    Science.gov (United States)

    Barbaro, Nicole; Shackelford, Todd K

    2016-11-01

    Male-perpetrated female-directed violence (FDV) may be associated with greater sexual access to a female. Accordingly, FDV is expected to be associated with greater copulation frequency. Research on nonhuman primates affirms this hypothesis, but no previous research has investigated this relationship in humans (Homo sapiens). The current research tests the hypothesis that FDV is associated with in-pair copulation frequency and, thus, may function as a form of sexual coercion. It was predicted that men who perpetrate FDV will secure more in-pair copulations than men who do not perpetrate violence (Prediction 1a), and that average monthly rates of FDV would positively correlate with in-pair copulation frequency (Prediction 1b). Male participants (n = 355) completed a survey, reporting limited demographic information (e.g., age, relationship length), in-pair copulation frequency, and history of physical violence perpetration. As predicted, violent men secured more in-pair copulations, on average, than nonviolent men, and monthly rates of violence positively correlated with in-pair copulation frequency. In humans, as in nonhuman primates, FDV by males may facilitate greater sexual access to a female. We discuss the implications of the current research for an evolutionary perspective on partner violence, and draw on research on nonhuman primates to highlight profitable avenues of research on FDV in humans. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  19. Detection of antibodies in human serum using trimellityl-erythrocytes: direct and indirect haemagglutination and haemolysis.

    Science.gov (United States)

    Turner, E S; Pruzansky, J J; Patterson, R; Zeiss, C R; Roberts, M

    1980-02-01

    Utilizing trimellityl-erythrocytes (TM-E), antibodies were detected in sera of seven workers with trimellitic anhydride (TMA) induced airway syndromes by direct haemagglutination, indirect haemagglutination with anti-human IgG, IgA or IgM or by haemolysis. Detectable levels of antibody were obtained with all three methods. The most sensitive technique was indirect haemagglutination using anti-IgG. When added as an inhibitor, TM-human serum albumin produced a 10- to 800-fold reduction in titres. TM-ovalbumin of similar epitope density was less inhibitory and sodium trimellitate the least inhibitory on a molar basis. All of the assays using haptenized human red cells were also capable of detecting anti-TM antibodies in Rhesus monkeys whose airways had been exposed to TMA. These assays are useful for detecting anti-TM antibodies and may also be adapted to demonstrate antibodies induced against other inhaled haptens in sera of environmentally exposed individuals or in animal models of such exposure.

  20. Decoding conjunctions of direction-of-motion and binocular disparity from human visual cortex.

    Science.gov (United States)

    Seymour, Kiley J; Clifford, Colin W G

    2012-05-01

    Motion and binocular disparity are two features in our environment that share a common correspondence problem. Decades of psychophysical research dedicated to understanding stereopsis suggest that these features interact early in human visual processing to disambiguate depth. Single-unit recordings in the monkey also provide evidence for the joint encoding of motion and disparity across much of the dorsal visual stream. Here, we used functional MRI and multivariate pattern analysis to examine where in the human brain conjunctions of motion and disparity are encoded. Subjects sequentially viewed two stimuli that could be distinguished only by their conjunctions of motion and disparity. Specifically, each stimulus contained the same feature information (leftward and rightward motion and crossed and uncrossed disparity) but differed exclusively in the way these features were paired. Our results revealed that a linear classifier could accurately decode which stimulus a subject was viewing based on voxel activation patterns throughout the dorsal visual areas and as early as V2. This decoding success was conditional on some voxels being individually sensitive to the unique conjunctions comprising each stimulus, thus a classifier could not rely on independent information about motion and binocular disparity to distinguish these conjunctions. This study expands on evidence that disparity and motion interact at many levels of human visual processing, particularly within the dorsal stream. It also lends support to the idea that stereopsis is subserved by early mechanisms also tuned to direction of motion.

  1. Pupil size directly modulates the feedforward response in human primary visual cortex independently of attention.

    Science.gov (United States)

    Bombeke, Klaas; Duthoo, Wout; Mueller, Sven C; Hopf, Jens-Max; Boehler, C Nico

    2016-02-15

    Controversy revolves around the question of whether psychological factors like attention and emotion can influence the initial feedforward response in primary visual cortex (V1). Although traditionally, the electrophysiological correlate of this response in humans (the C1 component) has been found to be unaltered by psychological influences, a number of recent studies have described attentional and emotional modulations. Yet, research into psychological effects on the feedforward V1 response has neglected possible direct contributions of concomitant pupil-size modulations, which are known to also occur under various conditions of attentional load and emotional state. Here we tested the hypothesis that such pupil-size differences themselves directly affect the feedforward V1 response. We report data from two complementary experiments, in which we used procedures that modulate pupil size without differences in attentional load or emotion while simultaneously recording pupil-size and EEG data. Our results confirm that pupil size indeed directly influences the feedforward V1 response, showing an inverse relationship between pupil size and early V1 activity. While it is unclear in how far this effect represents a functionally-relevant adaptation, it identifies pupil-size differences as an important modulating factor of the feedforward response of V1 and could hence represent a confounding variable in research investigating the neural influence of psychological factors on early visual processing. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Type 2 diabetes risk alleles demonstrate extreme directional differentiation among human populations, compared to other diseases.

    Directory of Open Access Journals (Sweden)

    Rong Chen

    Full Text Available Many disease-susceptible SNPs exhibit significant disparity in ancestral and derived allele frequencies across worldwide populations. While previous studies have examined population differentiation of alleles at specific SNPs, global ethnic patterns of ensembles of disease risk alleles across human diseases are unexamined. To examine these patterns, we manually curated ethnic disease association data from 5,065 papers on human genetic studies representing 1,495 diseases, recording the precise risk alleles and their measured population frequencies and estimated effect sizes. We systematically compared the population frequencies of cross-ethnic risk alleles for each disease across 1,397 individuals from 11 HapMap populations, 1,064 individuals from 53 HGDP populations, and 49 individuals with whole-genome sequences from 10 populations. Type 2 diabetes (T2D demonstrated extreme directional differentiation of risk allele frequencies across human populations, compared with null distributions of European-frequency matched control genomic alleles and risk alleles for other diseases. Most T2D risk alleles share a consistent pattern of decreasing frequencies along human migration into East Asia. Furthermore, we show that these patterns contribute to disparities in predicted genetic risk across 1,397 HapMap individuals, T2D genetic risk being consistently higher for individuals in the African populations and lower in the Asian populations, irrespective of the ethnicity considered in the initial discovery of risk alleles. We observed a similar pattern in the distribution of T2D Genetic Risk Scores, which are associated with an increased risk of developing diabetes in the Diabetes Prevention Program cohort, for the same individuals. This disparity may be attributable to the promotion of energy storage and usage appropriate to environments and inconsistent energy intake. Our results indicate that the differential frequencies of T2D risk alleles may

  3. Impedimetric immunosensor for human serum albumin detection on a direct aldehyde-functionalized silicon nitride surface

    Energy Technology Data Exchange (ETDEWEB)

    Caballero, David, E-mail: caballero@unistra.fr [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); University of Barcelona, Department of Electronics, C/ Marti i Franques 1, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain); Martinez, Elena [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain); Bausells, Joan [Centre Nacional de Microelectronica (CNM-IMB), CSIC, Campus UAB, 08193 Bellaterra (Spain); Errachid, Abdelhamid, E-mail: abdelhamid.errachid-el-salhi@univ-lyon1.fr [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); Universite Claude Bernard - Lyon 1, LSA - UMR 5180, 43 Bd du 11 novembre 1918, 69622 Villeurbanne Cedex (France); Samitier, Josep [Nanobioengineering group-IBEC, Barcelona Science Park, C/ Baldiri Reixach 10-12, 08028 Barcelona (Spain); University of Barcelona, Department of Electronics, C/ Marti i Franques 1, 08028 Barcelona (Spain); Centro de Investigacion Biomedica en Red en Bioingenieria, Biomateriales y Nanomedicina (CIBER-BBN), 50018 Zaragoza (Spain)

    2012-03-30

    Highlights: Black-Right-Pointing-Pointer An impedimetric label-free immunosensor was developed for the specific detection of human serum albumin proteins. Black-Right-Pointing-Pointer Anti-HSA antibodies were covalently immobilized on silicon nitride surfaces using a direct functionalization methodology. Black-Right-Pointing-Pointer Silicon nitride offers multiple advantages compared to other common materials. Black-Right-Pointing-Pointer The proposed sensor has high sensitivity and good selectivity for the detection of HSA proteins. - Abstract: In this work we report the fabrication and characterization of a label-free impedimetric immunosensor based on a silicon nitride (Si{sub 3}N{sub 4}) surface for the specific detection of human serum albumin (HSA) proteins. Silicon nitride provides several advantages compared with other materials commonly used, such as gold, and in particular in solid-state physics for electronic-based biosensors. However, few Si{sub 3}N{sub 4}-based biosensors have been developed; the lack of an efficient and direct protocol for the integration of biological elements with silicon-based substrates is still one of its the main drawbacks. Here, we use a direct functionalization method for the direct covalent binding of monoclonal anti-HSA antibodies on an aldehyde-functionalized Si-p/SiO{sub 2}/Si{sub 3}N{sub 4} structure. This methodology, in contrast with most of the protocols reported in literature, requires less chemical reagents, it is less time-consuming and it does not need any chemical activation. The detection capability of the immunosensor was tested by performing non-faradaic electrochemical impedance spectroscopy (EIS) measurements for the specific detection of HSA proteins. Protein concentrations within the linear range of 10{sup -13}-10{sup -7} M were detected, showing a sensitivity of 0.128 {Omega} {mu}M{sup -1} and a limit of detection of 10{sup -14} M. The specificity of the sensor was also addressed by studying the

  4. Impedimetric immunosensor for human serum albumin detection on a direct aldehyde-functionalized silicon nitride surface

    International Nuclear Information System (INIS)

    Caballero, David; Martinez, Elena; Bausells, Joan; Errachid, Abdelhamid; Samitier, Josep

    2012-01-01

    Highlights: ► An impedimetric label-free immunosensor was developed for the specific detection of human serum albumin proteins. ► Anti-HSA antibodies were covalently immobilized on silicon nitride surfaces using a direct functionalization methodology. ► Silicon nitride offers multiple advantages compared to other common materials. ► The proposed sensor has high sensitivity and good selectivity for the detection of HSA proteins. - Abstract: In this work we report the fabrication and characterization of a label-free impedimetric immunosensor based on a silicon nitride (Si 3 N 4 ) surface for the specific detection of human serum albumin (HSA) proteins. Silicon nitride provides several advantages compared with other materials commonly used, such as gold, and in particular in solid-state physics for electronic-based biosensors. However, few Si 3 N 4 -based biosensors have been developed; the lack of an efficient and direct protocol for the integration of biological elements with silicon-based substrates is still one of its the main drawbacks. Here, we use a direct functionalization method for the direct covalent binding of monoclonal anti-HSA antibodies on an aldehyde-functionalized Si-p/SiO 2 /Si 3 N 4 structure. This methodology, in contrast with most of the protocols reported in literature, requires less chemical reagents, it is less time-consuming and it does not need any chemical activation. The detection capability of the immunosensor was tested by performing non-faradaic electrochemical impedance spectroscopy (EIS) measurements for the specific detection of HSA proteins. Protein concentrations within the linear range of 10 −13 –10 −7 M were detected, showing a sensitivity of 0.128 Ω μM −1 and a limit of detection of 10 −14 M. The specificity of the sensor was also addressed by studying the interferences with a similar protein, bovine serum albumin. The results obtained show that the antibodies were efficiently immobilized and the proteins

  5. Direct visualization of HIV-enhancing endogenous amyloid fibrils in human semen

    Science.gov (United States)

    Usmani, Shariq M.; Zirafi, Onofrio; Müller, Janis; Sandi-Monroy, Nathallie; Yadav, Jay K.; Meier, Christoph; Weil, Tanja; Roan, Nadia R.; Greene, Warner C.; Walther, Paul; Nilsson, K. Peter R.; Hammarström, Per; Wetzel, Ronald; Pilcher, Christopher D.; Gagsteiger, Friedrich; Fändrich, Marcus; Kirchhoff, Frank; Münch, Jan

    2014-01-01

    Naturally occurring fragments of the abundant semen proteins prostatic acid phosphatase (PAP) and semenogelins form amyloid fibrils in vitro. These fibrils boost HIV infection and may play a key role in the spread of the AIDS pandemic. However, the presence of amyloid fibrils in semen remained to be demonstrated. Here, we use state of the art confocal and electron microscopy techniques for direct imaging of amyloid fibrils in human ejaculates. We detect amyloid aggregates in all semen samples and find that they partially consist of PAP fragments, interact with HIV particles and increase viral infectivity. Our results establish semen as a body fluid that naturally contains amyloid fibrils that are exploited by HIV to promote its sexual transmission. PMID:24691351

  6. The Ecology of Human-Machine Systems II: Mediating 'Direct Perception' in Complex Work Domains

    DEFF Research Database (Denmark)

    Vicente, Kim J.; Rasmussen, Jens

    1990-01-01

    Recently, a new class of artifacts has appeared in our environment: complex, high-technology work domains. An important characteristic of such systems is that their goal-relevant properties cannot be directly observed by the unaided eye. As a result, interface design is a ubiquitous problem in th...... in the design of these work environments. Nevertheless, the problem is one that has yet to be addressed in an adequate manner. An analogy to human perceptual mechanisms suggests that a smart instrument approach to interface design is needed to supplant the rote instrument (single......-sensor-single-indicator) approach that has dominated to this point. Ecological interface design (ED) is a theoretical framework in the smart instrument vein that postulates a set of general, prescriptive principles for design. The goal of E D is twofold: first, to reveal the affordances of the work domain through the interface...

  7. Neural Plasticity following Abacus Training in Humans: A Review and Future Directions

    Directory of Open Access Journals (Sweden)

    Yongxin Li

    2016-01-01

    Full Text Available The human brain has an enormous capacity to adapt to a broad variety of environmental demands. Previous studies in the field of abacus training have shown that this training can induce specific changes in the brain. However, the neural mechanism underlying these changes remains elusive. Here, we reviewed the behavioral and imaging findings of comparisons between abacus experts and average control subjects and focused on changes in activation patterns and changes in brain structure. Finally, we noted the limitations and the future directions of this field. We concluded that although current studies have provided us with information about the mechanisms of abacus training, more research on abacus training is needed to understand its neural impact.

  8. Direct Genesis of Functional Rodent and Human Schwann Cells from Skin Mesenchymal Precursors

    Directory of Open Access Journals (Sweden)

    Matthew P. Krause

    2014-07-01

    Full Text Available Recent reports of directed reprogramming have raised questions about the stability of cell lineages. Here, we have addressed this issue, focusing upon skin-derived precursors (SKPs, a dermally derived precursor cell. We show by lineage tracing that murine SKPs from dorsal skin originate from mesenchymal and not neural crest-derived cells. These mesenchymally derived SKPs can, without genetic manipulation, generate functional Schwann cells, a neural crest cell type, and are highly similar at the transcriptional level to Schwann cells isolated from the peripheral nerve. This is not a mouse-specific phenomenon, since human SKPs that are highly similar at the transcriptome level can be made from neural crest-derived facial and mesodermally derived foreskin dermis and the foreskin SKPs can make myelinating Schwann cells. Thus, nonneural crest-derived mesenchymal precursors can differentiate into bona fide peripheral glia in the absence of genetic manipulation, suggesting that developmentally defined lineage boundaries are more flexible than widely thought.

  9. Direct effects of FGF21 on glucose uptake in human skeletal muscle

    DEFF Research Database (Denmark)

    Mashili, Fredirick L; Austin, Reginald L; Deshmukh, Atul S

    2011-01-01

    21 were determined in normal glucose tolerant (n = 40) and type 2 diabetic (T2D; n = 40) subjects. We determined whether FGF21 has direct effects on glucose metabolism in cultured myotubes (n = 8) and extensor digitorum longus skeletal muscle. RESULTS: Serum FGF21 levels increased 20% in T2D versus...... normal glucose tolerant subjects (p muscle mRNA expression was unaltered. Fasting insulin, homeostatic model assessment of insulin resistance (HOMA-IR), waist circumference, and body mass index (BMI) significantly correlated with serum FGF21 levels in T2D (p ... and insulin-stimulated glucose uptake in human myotubes, coincident with increased glucose transporter 1 mRNA, and enhanced glucose transporter 1 abundance at the plasma membrane. In isolated extensor digitorum longus muscle, FGF21 potentiated insulin-stimulated glucose transport, without altering...

  10. Direct radioimmunoassay of proinsulin and insulin in human plasma by the chromatographic technique

    Energy Technology Data Exchange (ETDEWEB)

    Megahed, Y M; Abdel-Wahab, M F; El-Shawarbie, K; Sadek, S; Amer, M S [Atomic Energy Establishment, Cairo (Egypt). Radioisotope Department; Ain Shams Univ., Cairo (Egypt). Faculty of Medicine)

    1976-04-01

    Specific method for direct radioimmunoassay of IRP and IRI separately in human plasma has been described. The method is used for extraction of total insulin and separation of IRP from IRI by paper chromatography to be assayed separately. The separation of the two components is identified and confirmed by column chromatography, paper chromatography and ultraviolet spectral analysis in comparison with the standard compounds. 134 plasma samples of different cases were investigated for the determination of IRI, IRP and IRT. Out of these 39 were normals, 16 normal obes, 21 juvinil diabetes, 18 overt adult diabetes, 10 recent adult diabetes, 12 hypothyroidism and 18 bilharzial hepatosplenomegaly. They were used to evaluate the test levels in comparison with blood sugar concentration.

  11. 76 FR 51374 - Direct Discovery of HLA Associated Influenza Epitopes Isolated From Human Cells for Vaccine and...

    Science.gov (United States)

    2011-08-18

    ... direct-discovery technology for use in FDA laboratories. C. Eligibility Information The technology...] Direct Discovery of HLA Associated Influenza Epitopes Isolated From Human Cells for Vaccine and... technology to molecularly characterize peptide epitopes that are processed and presented on soluble HLA...

  12. Human perception of air movement. Impact of frequency and airflow direction on draught sensation

    Energy Technology Data Exchange (ETDEWEB)

    Genhong Zhou

    1999-08-01

    calculates the air velocity and temperature field above and below the skin surface under steady and non-steady conditions. The model predicts the impulses from thermal receptors of skin. The simulation results had a good agreement with the experimental results on subject`s sensation of draught. (au) 130 refs.; covertitle: Human perception of air movement: Impact of frequency and airflow direction on sensation of draught

  13. Flexibility to contingency changes distinguishes habitual and goal-directed strategies in humans.

    Science.gov (United States)

    Lee, Julie J; Keramati, Mehdi

    2017-09-01

    Decision-making in the real world presents the challenge of requiring flexible yet prompt behavior, a balance that has been characterized in terms of a trade-off between a slower, prospective goal-directed model-based (MB) strategy and a fast, retrospective habitual model-free (MF) strategy. Theory predicts that flexibility to changes in both reward values and transition contingencies can determine the relative influence of the two systems in reinforcement learning, but few studies have manipulated the latter. Therefore, we developed a novel two-level contingency change task in which transition contingencies between states change every few trials; MB and MF control predict different responses following these contingency changes, allowing their relative influence to be inferred. Additionally, we manipulated the rate of contingency changes in order to determine whether contingency change volatility would play a role in shifting subjects between a MB and MF strategy. We found that human subjects employed a hybrid MB/MF strategy on the task, corroborating the parallel contribution of MB and MF systems in reinforcement learning. Further, subjects did not remain at one level of MB/MF behaviour but rather displayed a shift towards more MB behavior over the first two blocks that was not attributable to the rate of contingency changes but rather to the extent of training. We demonstrate that flexibility to contingency changes can distinguish MB and MF strategies, with human subjects utilizing a hybrid strategy that shifts towards more MB behavior over blocks, consequently corresponding to a higher payoff.

  14. SMAD7 directly converts human embryonic stem cells to telencephalic fate by a default mechanism

    Science.gov (United States)

    Ozair, Mohammad Zeeshan; Noggle, Scott; Warmflash, Aryeh; Krzyspiak, Joanna Ela; Brivanlou, Ali H.

    2013-01-01

    Human embryonic stem cells (hESCs) provide a valuable window into the dissection of the molecular circuitry underlying the early formation of the human forebrain. However, dissection of signaling events in forebrain development using current protocols is complicated by non-neural contamination and fluctuation of extrinsic influences. Here we show that SMAD7, a cell-intrinsic inhibitor of TGFβ signaling, is sufficient to directly convert pluripotent hESCs to an anterior neural fate. Time-course gene expression revealed down-regulation of MAPK components, and combining MEK1/2 inhibition with SMAD7-mediated TGFβ inhibition promoted telencephalic conversion. FGF-MEK and TGFβ-SMAD signaling maintain hESCs by promoting pluripotency genes and repressing neural genes. Our findings suggest that in the absence of these cues, pluripotent cells simply revert to a program of neural conversion. Hence the “primed” state of hESCs requires inhibition of the “default” state of neural fate acquisition. This has parallels in amphibians, suggesting an evolutionarily conserved mechanism. PMID:23034881

  15. Nicorandil directly and cyclic GMP-dependently opens K+ channels in human bypass grafts

    Directory of Open Access Journals (Sweden)

    Marija Marinko

    2015-06-01

    Full Text Available As we previously demonstrated the role of different K+ channels in the action of nicorandil on human saphenous vein (HSV and human internal mammary artery (HIMA, this study aimed to analyse the contribution of the cGMP pathway in nicorandil-induced vasorelaxation and to determine the involvement of cGMP in the K+ channel-activating effect of nicorandil. An inhibitor of soluble guanylate cyclase (GC, ODQ, significantly inhibited nicorandil-induced relaxation, while ODQ plus glibenclamide, a selective ATP-sensitive K+ (KATP channel inhibitor, produced a further inhibition of both vessels. In HSV, ODQ in combination with 4-aminopyridine, a blocker of voltage-gated K+ (KV channels, did not modify the concentration-response to nicorandil compared with ODQ, whereas in HIMA, ODQ plus iberiotoxin, a selective blocker of large-conductance Ca2+-activated K+ (BKCa channels, produced greater inhibition than ODQ alone. We showed that the cGMP pathway plays a significant role in the vasorelaxant effect of nicorandil on HSV and HIMA. It seems that nicorandil directly opens KATP channels in both vessels and BKCa channels in HIMA, although it is possible that stimulation of GC contributes to KATP channels activation in HIMA. Contrary, the activation of KV channels in HSV is probably due to GC activation and increased levels of cGMP.

  16. A model of human nasal epithelial cells adapted for direct and repeated exposure to airborne pollutants.

    Science.gov (United States)

    Bardet, Gaëlle; Achard, Sophie; Loret, Thomas; Desauziers, Valérie; Momas, Isabelle; Seta, Nathalie

    2014-08-17

    Airway epithelium lining the nasal cavity plays a pivotal role in respiratory tract defense and protection mechanisms. Air pollution induces alterations linked to airway diseases such as asthma. Only very few in vitro studies to date have succeeded in reproducing physiological conditions relevant to cellular type and chronic atmospheric pollution exposure. We therefore, set up an in vitro model of human Airway Epithelial Cells of Nasal origin (hAECN) close to real human cell functionality, specifically adapted to study the biological effects of exposure to indoor gaseous pollution at the environmental level. hAECN were exposed under air-liquid interface, one, two, or three-times at 24 h intervals for 1 h, to air or formaldehyde (200 μg/m(3)), an indoor air gaseous pollutant. All experiments were ended at day 4, when both cellular viability and cytokine production were assessed. Optimal adherence and confluence of cells were obtained 96 h after cell seeding onto collagen IV-precoated insert. Direct and repeated exposure to formaldehyde did not produce any cellular damage or IL-6 production change, although weak lower IL-8 production was observed only after the third exposure. Our model is significantly better than previous ones due to cell type and the repeated exposure protocol. Copyright © 2014. Published by Elsevier Ireland Ltd.

  17. Crystallization and preliminary crystallographic studies of human septin 1 with site-directed mutations

    International Nuclear Information System (INIS)

    Hu, Hao; Yu, Wen-bo; Li, Shu-xing; Ding, Xiang-ming; Yu, Long; Bi, Ru-Chang

    2006-01-01

    The homogeneity of septin 1 has been improved by site-directed mutation of serine residues and only a small alteration in the secondary structure is observed to arise from the mutations. Crystals of the septin 1 mutant were grown and diffraction data were collected to 2.5 Å resolution. Septin 1 is a member of an evolutionarily conserved family of GTP-binding and filament-forming proteins named septins, which function in diverse processes including cytokinasis, vesicle trafficking, apoptosis, remodelling of the cytoskeleton, infection, neurodegeneration and neoplasia. Human septin 1 has been expressed and purified, but suffers from severe aggregation. Studies have shown that septin 1 with site-directed mutations of five serine residues (Ser19, Ser206, Ser307, Ser312 and Ser315) has a much lower degree of aggregation and better structural homogeneity and that the mutations cause only slight perturbations in the secondary structure of septin 1. This septin 1 mutant was crystallized and diffraction data were collected to 2.5 Å resolution. The space group is P422, with unit-cell parameters a = b = 106.028, c = 137.852 Å

  18. Crystallization and preliminary crystallographic studies of human septin 1 with site-directed mutations

    Energy Technology Data Exchange (ETDEWEB)

    Hu, Hao [Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Yu, Wen-bo [State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, Shanghai 200433 (China); Li, Shu-xing [Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China); Ding, Xiang-ming; Yu, Long [State Key Laboratory of Genetic Engineering, Institute of Genetics, School of Life Sciences, Fudan University, Shanghai 200433 (China); Bi, Ru-Chang [Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101 (China)

    2006-02-01

    The homogeneity of septin 1 has been improved by site-directed mutation of serine residues and only a small alteration in the secondary structure is observed to arise from the mutations. Crystals of the septin 1 mutant were grown and diffraction data were collected to 2.5 Å resolution. Septin 1 is a member of an evolutionarily conserved family of GTP-binding and filament-forming proteins named septins, which function in diverse processes including cytokinasis, vesicle trafficking, apoptosis, remodelling of the cytoskeleton, infection, neurodegeneration and neoplasia. Human septin 1 has been expressed and purified, but suffers from severe aggregation. Studies have shown that septin 1 with site-directed mutations of five serine residues (Ser19, Ser206, Ser307, Ser312 and Ser315) has a much lower degree of aggregation and better structural homogeneity and that the mutations cause only slight perturbations in the secondary structure of septin 1. This septin 1 mutant was crystallized and diffraction data were collected to 2.5 Å resolution. The space group is P422, with unit-cell parameters a = b = 106.028, c = 137.852 Å.

  19. Direct Monte Carlo dose calculation using polygon-surface computational human model

    International Nuclear Information System (INIS)

    Jeong, Jong Hwi; Kim, Chan Hyeong; Yeom, Yeon Su; Cho, Sungkoo; Chung, Min Suk; Cho, Kun-Woo

    2011-01-01

    In the present study, a voxel-type computational human model was converted to a polygon-surface model, after which it was imported directly to the Geant4 code without using a voxelization process, that is, without converting back to a voxel model. The original voxel model was also imported to the Geant4 code, in order to compare the calculated dose values and the computational speed. The average polygon size of the polygon-surface model was ∼0.5 cm 2 , whereas the voxel resolution of the voxel model was 1.981 × 1.981 × 2.0854 mm 3 . The results showed a good agreement between the calculated dose values of the two models. The polygon-surface model was, however, slower than the voxel model by a factor of 6–9 for the photon energies and irradiation geometries considered in the present study, which nonetheless is considered acceptable, considering that direct use of the polygon-surface model does not require a separate voxelization process. (author)

  20. Regenerating the human heart: direct reprogramming strategies and their current limitations.

    Science.gov (United States)

    Ghiroldi, Andrea; Piccoli, Marco; Ciconte, Giuseppe; Pappone, Carlo; Anastasia, Luigi

    2017-10-27

    Cardiovascular diseases are the leading cause of death in the Western world. Unfortunately, current therapies are often only palliative, consequently essentially making heart transplantation necessary for many patients. However, several novel therapeutic approaches in the past two decades have yielded quite encouraging results. The generation of induced pluripotent stem cells, through the forced expression of stem cell-specific transcription factors, has inspired the most promising strategies for heart regeneration by direct reprogramming of cardiac fibroblasts into functional cardiomyocytes. Initial attempts at this reprogramming were conducted using a similar approach to the one used with transcription factors, but during years, novel strategies have been tested, e.g., miRNAs, recombinant proteins and chemical molecules. Although preliminary results on animal models are promising, the low reprogramming efficiency, as well as the incomplete maturation of the cardiomyocytes, still represents important obstacles. This review covers direct transdifferentiation strategies that have been proposed and developed and illustrates the pros and cons of each approach. Indeed, as described in the manuscript, there are still many unanswered questions and drawbacks that require a better understanding of the basic signaling pathways and transcription factor networks before functional cells, suitable for cardiac regeneration and safe for the patients, can be generated and used for human therapies.

  1. Direct numerical simulation of particle laden flow in a human airway bifurcation model

    International Nuclear Information System (INIS)

    Stylianou, Fotos S.; Sznitman, Josué; Kassinos, Stavros C.

    2016-01-01

    Highlights: • An anatomically realistic model of a human airway bifurcation is constructed. • Direct numerical simulations are used to study laminar and turbulent airflow. • Aerosol deposition in the bifurcation is studied with lagrangian particle tracking. • Carinal vortices forming during steady expiration are reported for the first time. • Stokes number determines deposition differences between inspiration and expiration. - Abstract: During the delivery of inhaled medicines, and depending on the size distribution of the particles in the formulation, airway bifurcations are areas of preferential deposition. Previous studies of laminar flow through airway bifurcations point to an interplay of inertial and centrifugal forces that leads to rich flow phenomena and controls particle deposition patterns. However, recent computational studies have shown that the airflow in the upper human airways is turbulent during much of the respiratory cycle. The question of how the presence of turbulence modifies these effects remains open. In this study, we perform for the first time Direct Numerical Simulations (DNS) of fully developed turbulent flow through a single human airway bifurcation model, emulating steady prolonged inspiration and expiration. We use the rich information obtained from the DNS in order to identify key structures in the flow field and scrutinize their role in determining deposition patterns in the bifurcation. We find that the vortical structures present in the bifurcation during expiration differ from those identified during inspiration. While Dean vortices are present in both cases, a set of three dimensional “carinal vortices” are identified only during expiration. A set of laminar simulations in the same geometries, but at lower Reynolds numbers, allow us to identify key differences in aerosol deposition patterns between laminar and turbulent respiration. We also report deposition fractions for representative Stokes numbers for both

  2. Notes on Human Trials of Transcranial Direct Current Stimulation between 1960 and 1998

    Science.gov (United States)

    Esmaeilpour, Zeinab; Schestatsky, Pedro; Bikson, Marom; Brunoni, André R.; Pellegrinelli, Ada; Piovesan, Fernanda X.; Santos, Mariana M. S. A.; Menezes, Renata B.; Fregni, Felipe

    2017-01-01

    Background: Transcranial direct current stimulation (tDCS) is investigated to modulate neuronal function including cognitive neuroscience and neuropsychiatric therapies. While cases of human stimulation with rudimentary batteries date back more than 200 years, clinical trials with current controlled stimulation were published intermittently since the 1960s. The modern era of tDCS only started after 1998. Objectives: To review methods and outcomes of tDCS studies from old literature (between 1960 and 1998) with intention of providing new insight for ongoing tDCS trials and development of tDCS protocols especially for the purpose of treatment. Methods: Articles were identified through a search in PubMed and through the reference list from its selected articles. We included only non-invasive human studies that provided controlled direct current and were written in English, French, Spanish or Portuguese before the year of 1998, the date in which modern stimulation paradigms were implemented. Results: Fifteen articles met our criteria. The majority were small-randomized controlled clinical trials that enrolled a mean of approximately 26 subjects (Phase II studies). Most of the studies (around 83%) assessed the role of tDCS in the treatment of psychiatric conditions, in which the main outcomes were measured by means of behavioral scales and clinical observation, but the diagnostic precision and the quality of outcome monitoring, including adverse events, were deficient by modern standards. Compared to modern tDCS dose, the stimulation intensities used (0.1–1 mA) were lower, however as the electrodes were typically smaller (e.g., 1.26 cm2), the average electrode current density (0.2 mA/cm2) was approximately 4× higher. The number of sessions ranged from one to 120 (median 14). Notably, the stimulation session durations of several minutes to 11 h (median 4.5 h) could markedly exceed modern tDCS protocols. Twelve studies out of 15 showed positive results. Only mild side

  3. Direct measurement of human plasma corticotropin-releasing hormone by two-site immunoradiometric assay

    International Nuclear Information System (INIS)

    Linton, E.A.; McLean, C.; Nieuwenhuyzen Kruseman, A.C.; Tilders, F.J.; Van der Veen, E.A.; Lowry, P.J.

    1987-01-01

    A ''two-site'' immunoradiometric assay (IRMA) which allows the direct estimation of human CRH (hCRH) in plasma is described. Using this IRMA, basal levels of CRH in normal subjects ranged from 2-28 pg/mL [mean, 15 +/- 7 (+/- SD) pg/mL; n = 58]. Values in men and women were similar. Plasma CRH values within this range were also found in patients with Cushing's syndrome, Addison's disease, and Nelson's syndrome, with no correlation between plasma CRH and ACTH levels in these patients. Elevated plasma CRH levels were found in pregnant women near term [1462 +/- 752 (+/- SD) pg/mL; n = 55], and the dilution curve of this CRH-like immunoreactivity paralleled the IRMA standard curve. After its immunoadsorption from maternal plasma, this CRH-like material eluted on reverse phase high performance liquid chromatography with a retention time identical to that of synthetic CRH and had equipotent bioactivity with the synthetic peptide in the perfused anterior pituitary cell bioassay. Circulating CRH was not detected in Wistar rats, even after adrenalectomy and subsequent ether stress. Synthetic hCRH was degraded by fresh human plasma relatively slowly; 65% of added CRH remained after 1 h of incubation at 37 C. Degradation was inhibited by heat treatment (54 C; 1 h), cold treatment (4 C; 4 h), or freezing and thawing. Loss of synthetic rat CRH occurred more rapidly when fresh rat plasma was used; only 20% of added CRH remained under the same conditions. The inability to measure CRH in peripheral rat plasma may be due to the presence of active CRH-degrading enzymes which fragment the CRH molecule into forms not recognized by the CRH IRMA

  4. Direct Proof of Endo-Epicardial Asynchrony of the Atrial Wall During Atrial Fibrillation in Humans.

    Science.gov (United States)

    de Groot, Natasja; van der Does, Lisette; Yaksh, Ameeta; Lanters, Eva; Teuwen, Christophe; Knops, Paul; van de Woestijne, Pieter; Bekkers, Jos; Kik, Charles; Bogers, Ad; Allessie, Maurits

    2016-05-01

    The presence of focal fibrillation waves during atrial fibrillation (AF) can, besides ectopic activity, also be explained by asynchronous activation of the atrial endo- and epicardial layer and transmurally propagating fibrillation waves. To provide direct proof of endo-epicardial asynchrony, we performed simultaneous high-resolution mapping of the right atrial endo- and epicardial wall during AF in humans. Intraoperative mapping of the endo- and epicardial right atrial wall was performed during (induced) AF in 10 patients with AF (paroxysmal: n=3; persistent: n=4; and longstanding persistent: n=3) and 4 patients without a history of AF. A clamp made of 2 rectangular 8×16 electrode arrays (interelectrode distance 2 mm) was inserted into the incision in the right atrial appendage. Recordings of 10 seconds of AF were analyzed to determine the incidence of asynchronous endo-epicardial activation times (≥15 ms) of opposite electrodes. Asynchronous endo-epicardial activation ranged between 0.9 and 55.9% without preference for either side. Focal waves appeared equally frequent at endocardium and epicardium (11% versus 13%; ITALIC! P=0.18). Using strict criteria for breakthrough (presence of an opposite wave within 4 mm and ≤14 ms before the origin of the focal wave), the majority (65%) of all focal fibrillation waves could be attributed to endo-epicardial excitation. We provided the first evidence for asynchronous activation of the endo-epicardial wall during AF in humans. Endo-epicardial asynchrony may play a major role in the pathophysiology of AF and may offer an explanation why in some patients therapy fails. © 2016 American Heart Association, Inc.

  5. Direct measurement of the precursors of adrenocorticotropin in human plasma by two-site immunoradiometric assay

    International Nuclear Information System (INIS)

    Crosby, S.R.; Stewart, M.F.; Ratcliffe, J.G.; White, A.

    1988-01-01

    An immunoradiometric assay (IRMA) for the direct measurement of the precursors of ACTH in unextracted human plasma has been developed and evaluated clinically in normal subjects and patients with disorders of the hypothalamic-pituitary-adrenal axis. The IRMA is based on an iodinated monoclonal antibody to ACTH and a monoclonal antibody to gamma MSH coupled to Sephacryl S300. The assay detects only peptides containing both epitopes, i.e. POMC (31K) and pro-ACTH (22K). The reference standard was partially purified POMC from culture medium of human corticotroph adenoma cells. The detection limit (greater than +2.5SD of the 0 standard) was 2.0 pmol/L and the within-assay coefficient of variation was less than 10% between 29 and 2600 pmol/L. Plasma concentrations of ACTH precursor peptides in 11 normal subjects sampled at 0930 h ranged from 5-34 pmol/L. The concentrations in the patient groups studied were: 260-2300 pmol/L in 5 patients with the ectopic ACTH syndrome associated with small cell lung cancer, less than 2.0-104 pmol/L in 10 patients with pituitary-dependent Cushing's disease, 23 pmol/L in a patient with Nelson's syndrome, and 3.0-230 pmol/L in 5 patients with Addison's disease. We conclude that this IRMA offers a simple and reliable method for measuring ACTH precursors in unextracted plasma. The proportionately greater elevation of ACTH precursors compared to ACTH in patients with the ectopic ACTH syndrome associated with small cell lung cancer but not in pituitary-dependent Cushing's syndrome, suggests that this assay may be clinically useful

  6. Flexibility to contingency changes distinguishes habitual and goal-directed strategies in humans.

    Directory of Open Access Journals (Sweden)

    Julie J Lee

    2017-09-01

    Full Text Available Decision-making in the real world presents the challenge of requiring flexible yet prompt behavior, a balance that has been characterized in terms of a trade-off between a slower, prospective goal-directed model-based (MB strategy and a fast, retrospective habitual model-free (MF strategy. Theory predicts that flexibility to changes in both reward values and transition contingencies can determine the relative influence of the two systems in reinforcement learning, but few studies have manipulated the latter. Therefore, we developed a novel two-level contingency change task in which transition contingencies between states change every few trials; MB and MF control predict different responses following these contingency changes, allowing their relative influence to be inferred. Additionally, we manipulated the rate of contingency changes in order to determine whether contingency change volatility would play a role in shifting subjects between a MB and MF strategy. We found that human subjects employed a hybrid MB/MF strategy on the task, corroborating the parallel contribution of MB and MF systems in reinforcement learning. Further, subjects did not remain at one level of MB/MF behaviour but rather displayed a shift towards more MB behavior over the first two blocks that was not attributable to the rate of contingency changes but rather to the extent of training. We demonstrate that flexibility to contingency changes can distinguish MB and MF strategies, with human subjects utilizing a hybrid strategy that shifts towards more MB behavior over blocks, consequently corresponding to a higher payoff.

  7. Directed Selection of Recombinant Human Monoclonal Antibodies to Herpes Simplex Virus Glycoproteins from Phage Display Libraries

    Science.gov (United States)

    Sanna, Pietro Paolo; Williamson, R. Anthony; de Logu, Alessandro; Bloom, Floyd E.; Burton, Dennis R.

    1995-07-01

    Human monoclonal antibodies have considerable potential in the prophylaxis and treatment of viral disease. However, only a few such antibodies suitable for clinical use have been produced to date. We have previously shown that large panels of human recombinant monoclonal antibodies against a plethora of infectious agents, including herpes simplex virus types 1 and 2, can be established from phage display libraries. Here we demonstrate that facile cloning of recombinant Fab fragments against specific viral proteins in their native conformation can be accomplished by panning phage display libraries against viral glycoproteins "captured" from infected cell extracts by specific monoclonal antibodies immobilized on ELISA plates. We have tested this strategy by isolating six neutralizing recombinant antibodies specific for herpes simplex glycoprotein gD or gB, some of which are against conformationally sensitive epitopes. By using defined monoclonal antibodies for the antigen-capture step, this method can be used for the isolation of antibodies to specific regions and epitopes within the target viral protein. For instance, monoclonal antibodies to a nonneutralizing epitope can be used in the capture step to clone antibodies to neutralizing epitopes, or antibodies to a neutralizing epitope can be used to clone antibodies to a different neutralizing epitope. Furthermore, by using capturing antibodies to more immunodominant epitopes, one can direct the cloning to less immunogenic ones. This method should be of value in generating antibodies to be used both in the prophylaxis and treatment of viral infections and in the characterization of the mechanisms of antibody protective actions at the molecular level.

  8. Engineering the human pluripotent stem cell microenvironment to direct cell fate.

    Science.gov (United States)

    Hazeltine, Laurie B; Selekman, Joshua A; Palecek, Sean P

    2013-11-15

    Human pluripotent stem cells (hPSCs), including both embryonic stem cells and induced pluripotent stem cells, offer a potential cell source for research, drug screening, and regenerative medicine applications due to their unique ability to self-renew or differentiate to any somatic cell type. Before the full potential of hPSCs can be realized, robust protocols must be developed to direct their fate. Cell fate decisions are based on components of the surrounding microenvironment, including soluble factors, substrate or extracellular matrix, cell-cell interactions, mechanical forces, and 2D or 3D architecture. Depending on their spatio-temporal context, these components can signal hPSCs to either self-renew or differentiate to cell types of the ectoderm, mesoderm, or endoderm. Researchers working at the interface of engineering and biology have identified various factors which can affect hPSC fate, often based on lessons from embryonic development, and they have utilized this information to design in vitro niches which can reproducibly direct hPSC fate. This review highlights culture systems that have been engineered to promote self-renewal or differentiation of hPSCs, with a focus on studies that have elucidated the contributions of specific microenvironmental cues in the context of those culture systems. We propose the use of microsystem technologies for high-throughput screening of spatial-temporal presentation of cues, as this has been demonstrated to be a powerful approach for differentiating hPSCs to desired cell types. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Do GnRH analogues directly affect human endometrial epithelial cell gene expression?

    KAUST Repository

    Zhang, Xiaomei

    2010-03-04

    We examined whether Gonadotrophin-releasing hormone (GnRH) analogues [leuprolide acetate (LA) and ganirelix acetate (GA)] modulate gene expression in Ishikawa cells used as surrogate for human endometrial epithelial cells in vitro. The specific aims were: (i) to study the modulatory effect of GnRH analogues by RT-PCR [in the absence and presence of E2 and P4, and cyclic adenosine monophos-phate (cAMP)] on mRNA expression of genes modulated during the window of implantation in GnRH analogues/rFSH-treated assisted reproductive technology cycles including OPTINEURIN (OPTN), CHROMATIN MODIFYING PROTEIN (CHMP1A), PROSAPOSIN (PSAP), IGFBP-5 and SORTING NEXIN 7 (SNX7), and (ii) to analyze the 5\\'-flanking regions of such genes for the presence of putative steroid-response elements [estrogen-response elements (EREs) and P4-response element (PREs)]. Ishikawa cells were cytokeratin+/vimentin2 and expressed ERa,ERb, PR and GnRH-R proteins. At 6 and 24 h, neither LA nor GA alone had an effect on gene expression. GnRH analogues alone or following E2 and/or P4 co-incubation for 24 h also had no effect on gene expression, but P4 significantly increased expression of CHMP1A.E2 + P4 treatment for 4 days, alone or followed by GA, had no effect, but E2 + P4 treatment followed by LA significantly decreased IGFBP-5 expression. The addition of 8-Br cAMP did not modify gene expression, with the exception of IGFBP-5 that was significantly increased. The GnRH analogues did not modify intracellular cAMP levels. We identified conserved EREs for OPN, CHMP1A, SNX7 and PSAP and PREs for SNX7. We conclude that GnRH analogues appear not to have major direct effects on gene expression of human endo-metrial epithelial cells in vitro. © The Author 2010. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oxfordjournals.org.

  10. Effects of frontal transcranial direct current stimulation on emotional processing and mood in healthy humans

    Directory of Open Access Journals (Sweden)

    Michael A. Nitsche

    2012-06-01

    Full Text Available The prefrontal cortex is involved in mood and emotional processing. In patients suffering from depression, the left dorsolateral prefrontal cortex is hypoactive, while activity of the right dorsolateral prefrontal cortex is enhanced. Counterbalancing these pathological excitability alterations by repetitive transcranial magnetic stimulation (rTMS or transcranial direct current stimulation (tDCS improves mood in these patients. In healthy subjects, however, rTMS of the same areas has no major effect, and the effects of tDCS are mixed. We aimed to evaluate the effects of prefrontal tDCS on mood and mood-related cognitive processing in healthy humans. In a first study, we administered excitability-enhancing anodal, excitability-diminishing cathodal and placebo tDCS to the left dorsolateral prefrontal cortex, combined with antagonistic stimulation of the right frontopolar cortex, and tested acute mood changes by an adjective checklist. Subjective mood was not influenced by tDCS. Emotional face identification, however, which was explored in a second experiment, was subtly improved by a tDCS-driven excitability modulation of the prefrontal cortex, markedly by anodal tDCS of the left dorsolateral prefrontal cortex for positive emotional content. We conclude that tDCS of the prefrontal cortex improves mood processing in healthy subjects, but does not influence subjective mood state.

  11. No Effect of Cathodal Transcranial Direct Current Stimulation on Fear Memory in Healthy Human Subjects

    Directory of Open Access Journals (Sweden)

    Aditya Mungee

    2016-11-01

    Full Text Available Background: Studies have demonstrated that fear memories can be modified using non-invasive methods. Recently, we demonstrated that anodal transcranial direct current stimulation (tDCS of the right dorsolateral prefrontal cortex is capable of enhancing fear memories. Here, we examined the effects of cathodal tDCS of the right dorsolateral prefrontal cortex during fear reconsolidation in humans. Methods: Seventeen young, healthy subjects were randomly assigned to two groups, which underwent fear conditioning with mild electric stimuli paired with a visual stimulus. Twenty-four hours later, both groups were shown a reminder of the conditioned fearful stimulus. Shortly thereafter, they received either tDCS (right prefrontal—cathodal, left supraorbital—anodal for 20 min at 1 mA, or sham stimulation. A day later, fear responses of both groups were compared. Results: On Day 3, during fear response assessment, there were no significant differences between the tDCS and sham group (p > 0.05. Conclusion: We conclude that cathodal tDCS of the right dorsolateral prefrontal cortex (right prefrontal—cathodal, left supraorbital—anodal did not influence fear memories.

  12. Non-primary motor areas in the human frontal lobe are connected directly to hand muscles.

    Science.gov (United States)

    Teitti, S; Määttä, S; Säisänen, L; Könönen, M; Vanninen, R; Hannula, H; Mervaala, E; Karhu, J

    2008-04-15

    Structural studies in primates have shown that, in addition to the primary motor cortex (M1), premotor areas are a source of corticospinal tracts. The function of these putative corticospinal neuronal tracts in humans is still unclear. We found frontal non-primary motor areas (NPMAs), which react to targeted non-invasive magnetic pulses and activate peripheral muscles as fast as or even faster than those in M1. Hand muscle movements were observed in all our subjects about 20 ms after transcranial stimulation of the superior frontal gyrus (Brodmann areas 6 and 8). Stimulation of NPMA could activate both proximal and distal upper limb muscles with the same delay as a stimulation of the M1, indicating converging motor representations with direct functional connections to the hand. We suggest that these non-primary cortical motor representations provide additional capacity for the fast execution of movements. Such a capacity may play a role in motor learning and in recovery from motor deficits.

  13. The Human Nuclear Exosome Targeting Complex Is Loaded onto Newly Synthesized RNA to Direct Early Ribonucleolysis

    Directory of Open Access Journals (Sweden)

    Michal Lubas

    2015-01-01

    Full Text Available The RNA exosome complex constitutes the major nuclear eukaryotic 3′-5′ exonuclease. Outside of nucleoli, the human nucleoplasmic exosome is directed to some of its substrates by the nuclear exosome targeting (NEXT complex. How NEXT targets RNA has remained elusive. Using an in vivo crosslinking approach, we report global RNA binding sites of RBM7, a key component of NEXT. RBM7 associates broadly with RNA polymerase II-derived RNA, including pre-mRNA and short-lived exosome substrates such as promoter upstream transcripts (PROMPTs, enhancer RNAs (eRNAs, and 3′-extended products from snRNA and replication-dependent histone genes. Within pre-mRNA, RBM7 accumulates at the 3′ ends of introns, and pulse-labeling experiments demonstrate that RBM7/NEXT defines an early exosome-targeting pathway for 3′-extended snoRNAs derived from such introns. We propose that RBM7 is generally loaded onto newly synthesized RNA to accommodate exosome action in case of available unprotected RNA 3′ ends.

  14. Direct conversion of human amniotic cells into endothelial cells without transitioning through a pluripotent state

    Science.gov (United States)

    Ginsberg, Michael; Schachterle, William; Shido, Koji; Rafii, Shahin

    2016-01-01

    Endothelial cells (ECs) have essential roles in organ development and regeneration, and therefore they could be used for regenerative therapies. However, generation of abundant functional endothelium from pluripotent stem cells has been difficult because ECs generated by many existing strategies have limited proliferative potential and display vascular instability. The latter difficulty is of particular importance because cells that lose their identity over time could be unsuitable for therapeutic use. Here, we describe a 3-week platform for directly converting human mid-gestation lineage-committed amniotic fluid–derived cells (ACs) into a stable and expandable population of vascular ECs (rAC-VECs) without using pluripotency factors. By transient expression of the ETS transcription factor ETV2 for 2 weeks and constitutive expression the ETS transcription factors FLI1 and ERG1, concomitant with TGF-β inhibition for 3 weeks, epithelial and mesenchymal ACs are converted, with high efficiency, into functional rAC-VECs. These rAC-VECs maintain their vascular repertoire and morphology over numerous passages in vitro, and they form functional vessels when implanted in vivo. rAC-VECs can be detected in recipient mice months after implantation. Thus, rAC-VECs can be used to establish a cellular platform to uncover the molecular determinants of vascular development and heterogeneity and potentially represent ideal ECs for the treatment of regenerative disorders. PMID:26540589

  15. Clonogenic growth of human breast cancer cells co-cultured in direct contact with serum-activated fibroblasts

    International Nuclear Information System (INIS)

    Samoszuk, Michael; Tan, Jenny; Chorn, Guillaume

    2005-01-01

    Accumulating evidence suggests that fibroblasts play a pivotal role in promoting the growth of breast cancer cells. The objective of the present study was to characterize and validate an in vitro model of the interaction between small numbers of human breast cancer cells and human fibroblasts. We measured the clonogenic growth of small numbers of human breast cancer cells co-cultured in direct contact with serum-activated, normal human fibroblasts. Using DNA microarrays, we also characterized the gene expression profile of the serum-activated fibroblasts. In order to validate the in vivo relevance of our experiments, we then analyzed clinical samples of metastatic breast cancer for the presence of myofibroblasts expressing α-smooth muscle actin. Clonogenic growth of human breast cancer cells obtained directly from in situ and invasive tumors was dramatically and consistently enhanced when the tumor cells were co-cultured in direct contact with serum-activated fibroblasts. This effect was abolished when the cells were co-cultured in transwells separated by permeable inserts. The fibroblasts in our experimental model exhibited a gene expression signature characteristic of 'serum response' (i.e. myofibroblasts). Immunostaining of human samples of metastatic breast cancer tissue confirmed that myofibroblasts are in direct contact with breast cancer cells. Serum-activated fibroblasts promote the clonogenic growth of human breast cancer cells in vitro through a mechanism that involves direct physical contact between the cells. This model shares many important molecular and phenotypic similarities with the fibroblasts that are naturally found in breast cancers

  16. Pretargeting vs. direct targeting of human betalox5 islet cells subcutaneously implanted in mice using an anti-human islet cell antibody

    International Nuclear Information System (INIS)

    Liu Guozheng; Dou Shuping; Akalin, Ali; Rusckowski, Mary; Streeter, Philip R.; Shultz, Leonard D.; Greiner, Dale L.

    2012-01-01

    Introduction: We previously demonstrated MORF/cMORF pretargeting of human islets and betalox 5 cells (a human beta cell line) transplanted subcutaneously in mice with the anti-human islet antibody, HPi1. We now compare pretargeting with direct targeting in the beta cell transplant model to evaluate the degree to which target/non-target (T/NT) ratios may be improved by pretargeting. Methods: Specific binding of an anti-human islet antibody HPi1 to the beta cells transplanted subcutaneously in mice was examined against a negative control antibody. We then compared pretargeting by MORF-HPi1 plus 111 In-labeled cMORF to direct targeting by 111 In-labeled HPi1. Results: HPi1 binding to betalox5 human cells in the transplant was shown by immunofluorescence. Normal organ 111 In backgrounds by pretargeting were always lower, although target accumulations were similar. More importantly, the transplant to pancreas and liver ratios was, respectively, 26 and 10 by pretargeting as compared to 9 and 0.6 by direct targeting. Conclusions: Pretargeting greatly improves the T/NT ratios, and based on the estimated endocrine to exocrine ratio within a pancreas, pretargeting may be approaching the sensitivity required for successful imaging of human islets within this organ.

  17. Biomechanical energy harvesting from human motion: theory, state of the art, design guidelines, and future directions.

    Science.gov (United States)

    Riemer, Raziel; Shapiro, Amir

    2011-04-26

    Biomechanical energy harvesting from human motion presents a promising clean alternative to electrical power supplied by batteries for portable electronic devices and for computerized and motorized prosthetics. We present the theory of energy harvesting from the human body and describe the amount of energy that can be harvested from body heat and from motions of various parts of the body during walking, such as heel strike; ankle, knee, hip, shoulder, and elbow joint motion; and center of mass vertical motion. We evaluated major motions performed during walking and identified the amount of work the body expends and the portion of recoverable energy. During walking, there are phases of the motion at the joints where muscles act as brakes and energy is lost to the surroundings. During those phases of motion, the required braking force or torque can be replaced by an electrical generator, allowing energy to be harvested at the cost of only minimal additional effort. The amount of energy that can be harvested was estimated experimentally and from literature data. Recommendations for future directions are made on the basis of our results in combination with a review of state-of-the-art biomechanical energy harvesting devices and energy conversion methods. For a device that uses center of mass motion, the maximum amount of energy that can be harvested is approximately 1 W per kilogram of device weight. For a person weighing 80 kg and walking at approximately 4 km/h, the power generation from the heel strike is approximately 2 W. For a joint-mounted device based on generative braking, the joints generating the most power are the knees (34 W) and the ankles (20 W). Our theoretical calculations align well with current device performance data. Our results suggest that the most energy can be harvested from the lower limb joints, but to do so efficiently, an innovative and light-weight mechanical design is needed. We also compared the option of carrying batteries to the

  18. The Nature of Belief-Directed Exploratory Choice in Human Decision-Making

    Directory of Open Access Journals (Sweden)

    W. Bradley Knox

    2012-01-01

    Full Text Available In non-stationary environments, there is a conflict between exploiting currently favored options and gaining information by exploring lesser-known options that in the past have proven less rewarding. Optimal decision making in such tasks requires considering future states of the environment (i.e., planning and properly updating beliefs about the state of environment after observing outcomes associated with choices. Optimal belief-updating is reflective in that beliefs can change without directly observing environmental change. For example, after ten seconds elapse, one might correctly believe that a traffic light last observed to be red is now more likely to be green. To understand human decision-making when rewards associated with choice options change over time, we develop a variant of the classic bandit task that is both rich enough to encompass relevant phenomena and sufficiently tractable to allow for ideal actor analysis of sequential choice behavior. We evaluate whether people update beliefs about the state of environment in a reflexive (i.e., only in response to observed changes in reward structure or reflective manner. In contrast to purely "random" accounts of exploratory behavior, model-based analyses of the subjects’ choices and latencies indicate that people are reflective belief-updaters. However, unlike the Ideal Actor model, our analyses indicate that people's choice behavior does not reflect consideration of future environmental states. Thus, although people update beliefs in a reflective manner consistent with the ideal actor, they do not engage in optimal long-term planning, but instead myopically choose the option on every trial that is believed to have the highest immediate payoff.

  19. The Nature of Belief-Directed Exploratory Choice in Human Decision-Making

    Science.gov (United States)

    Knox, W. Bradley; Otto, A. Ross; Stone, Peter; Love, Bradley C.

    2011-01-01

    In non-stationary environments, there is a conflict between exploiting currently favored options and gaining information by exploring lesser-known options that in the past have proven less rewarding. Optimal decision-making in such tasks requires considering future states of the environment (i.e., planning) and properly updating beliefs about the state of the environment after observing outcomes associated with choices. Optimal belief-updating is reflective in that beliefs can change without directly observing environmental change. For example, after 10 s elapse, one might correctly believe that a traffic light last observed to be red is now more likely to be green. To understand human decision-making when rewards associated with choice options change over time, we develop a variant of the classic “bandit” task that is both rich enough to encompass relevant phenomena and sufficiently tractable to allow for ideal actor analysis of sequential choice behavior. We evaluate whether people update beliefs about the state of environment in a reflexive (i.e., only in response to observed changes in reward structure) or reflective manner. In contrast to purely “random” accounts of exploratory behavior, model-based analyses of the subjects’ choices and latencies indicate that people are reflective belief updaters. However, unlike the Ideal Actor model, our analyses indicate that people’s choice behavior does not reflect consideration of future environmental states. Thus, although people update beliefs in a reflective manner consistent with the Ideal Actor, they do not engage in optimal long-term planning, but instead myopically choose the option on every trial that is believed to have the highest immediate payoff. PMID:22319503

  20. Optical imaging of human cone photoreceptors directly following the capture of light.

    Directory of Open Access Journals (Sweden)

    Phillip Bedggood

    Full Text Available Capture of light in the photoreceptor outer segment initiates a cascade of chemical events that inhibit neurotransmitter release, ultimately resulting in vision. The massed response of the photoreceptor population can be measured non-invasively by electrical recordings, but responses from individual cells cannot be measured without dissecting the retina. Here we used optical imaging to observe individual human cones in the living eye as they underwent bleaching of photopigment and associated phototransduction. The retina was simultaneously stimulated and observed with high intensity visible light at 1 kHz, using adaptive optics. There was marked variability between individual cones in both photosensitivity and pigment optical density, challenging the conventional assumption that photoreceptors act as identical subunits (coefficient of variation in rate of photoisomerization = 23%. There was also a pronounced inverse correlation between these two parameters (p<10(-7; the temporal evolution of image statistics revealed this to be a dynamic relationship, with cone waveguiding efficiency beginning a dramatic increase within 3 ms of light onset. Beginning as early as 2 ms after light onset and including half of cells by ∼7 ms, cone intensity showed reversals characteristic of interference phenomena, with greater delays in reversal corresponding to cones with more photopigment (p<10(-3. The timing of these changes is argued to best correspond with either the cessation of dark current, or to related events such as changes in intracellular cGMP. Cone intensity also showed fluctuations of high frequency (332±25 Hz and low amplitude (3.0±0.85%. Other groups have shown similar fluctuations that were directly evoked by light; if this corresponds to the same phenomenon, we propose that the amplitude of fluctuation may be increased by the use of a bright flash followed by a brief pause, to allow recovery of cone circulating current.

  1. Direct solid-phase microextraction combined with gas and liquid chromatography for the determination of lidocaine in human urine

    NARCIS (Netherlands)

    Koster, E.H M; Hofman, N.S K; de Jong, G.J.

    Solid-phase microextraction (SPME) has been combined with gas chromatography (GC) and liquid chromatography (LC) for the determination of lidocaine in human urine. A polydimethylsiloxane (PDMS) coated fibre was directly immersed into buffered urine. Extraction conditions such as time, pH, ionic

  2. Key challenges in the combat of human trafficking : Evaluating the EU trafficking strategy and EU trafficking directive

    NARCIS (Netherlands)

    Bosma, Alice; Rijken, Conny

    2016-01-01

    The problem of trafficking in human beings (THB) is still omnipresent in Europe, despite the numerous preventive and retributive actions taken. This article evaluates the two most important EU-instruments to combat trafficking: the EU Directive and the EU Strategy. Based on secondary analysis of

  3. 21 CFR 184.1 - Substances added directly to human food affirmed as generally recognized as safe (GRAS).

    Science.gov (United States)

    2010-04-01

    ... of these limited conditions of use, which may include the category of food(s), the technical effect(s... within such limitation(s), including the category of food(s), the functional use(s) of the ingredient... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Substances added directly to human food affirmed as...

  4. The need and direction of a human factors research program for the nuclear power industry

    International Nuclear Information System (INIS)

    Blackman, H.S.; Meyer, O.R.; Nelson, W.R.

    1986-01-01

    It is axiomatic that the need for a human factors program in the nuclear power industry must be based upon an examination of the process of nuclear energy production and the role that the human plays in this process. It has been pointed out by others that a large number of incidents in technology based industries can be attributed to human error, thereby demonstrating the need to understand the human in interacting with complex processes. But an emphasis upon human ''error'' is a negative approach and can be non-productive, particularly when the ''correct'' human action has not been clearly defined prior to the incident. Some industries have expended great resources in a positive attempt to maximize the performance of the human in critical roles, e.g., the man-in-space program, the commercial airlines industry, deep-sea exploration. Central to this issue of human factors in nuclear power is the question of the role that the human plays in reducing the risk of the total system. If, as in other areas of application, the nuclear industry can make substantial improvements in the performance of humans, one needs to know how much risk is really reduced

  5. Nonmuscle myosin IIA and IIB differentially contribute to intrinsic and directed migration of human embryonic lung fibroblasts.

    Science.gov (United States)

    Kuragano, Masahiro; Murakami, Yota; Takahashi, Masayuki

    2018-03-25

    Nonmuscle myosin II (NMII) plays an essential role in directional cell migration. In this study, we investigated the roles of NMII isoforms (NMIIA and NMIIB) in the migration of human embryonic lung fibroblasts, which exhibit directionally persistent migration in an intrinsic manner. NMIIA-knockdown (KD) cells migrated unsteadily, but their direction of migration was approximately maintained. By contrast, NMIIB-KD cells occasionally reversed their direction of migration. Lamellipodium-like protrusions formed in the posterior region of NMIIB-KD cells prior to reversal of the migration direction. Moreover, NMIIB KD led to elongation of the posterior region in migrating cells, probably due to the lack of load-bearing stress fibers in this area. These results suggest that NMIIA plays a role in steering migration by maintaining stable protrusions in the anterior region, whereas NMIIB plays a role in maintenance of front-rear polarity by preventing aberrant protrusion formation in the posterior region. These distinct functions of NMIIA and NMIIB might promote intrinsic and directed migration of normal human fibroblasts. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Direct and indirect effects of retinoic acid on human Th2 cytokine and chemokine expression by human T lymphocytes

    Directory of Open Access Journals (Sweden)

    Deep-Dixit Vishwa

    2006-11-01

    Full Text Available Abstract Background Vitamin A (VA deficiency induces a type 1 cytokine response and exogenously provided retinoids can induce a type 2 cytokine response both in vitro and in vivo. The precise mechanism(s involved in this phenotypic switch are inconsistent and have been poorly characterized in humans. In an effort to determine if retinoids are capable of inducing Th2 cytokine responses in human T cell cultures, we stimulated human PBMCs with immobilized anti-CD3 mAb in the presence or absence of all-trans retinoic acid (ATRA or 9-cis-RA. Results Stimulation of human PBMCs and purified T cells with ATRA and 9-cis-RA increased mRNA and protein levels of IL-4, IL-5, and IL-13 and decreased levels of IFN-γ, IL-2, IL-12p70 and TNF-α upon activation with anti-CD3 and/or anti-CD28 mAbs. These effects were dose-dependent and evident as early as 12 hr post stimulation. Real time RT-PCR analysis revealed a dampened expression of the Th1-associated gene, T-bet, and a time-dependent increase in the mRNA for the Th2-associated genes, GATA-3, c-MAF and STAT6, upon treatment with ATRA. Besides Th1 and Th2 cytokines, a number of additional proinflammatory and regulatory cytokines including several chemokines were also differentially regulated by ATRA treatment. Conclusion These data provide strong evidence for multiple inductive roles for retinoids in the development of human type-2 cytokine responses.

  7. Monoclonal antibodies directed to human insulin-like growth factor I (IGF I)

    International Nuclear Information System (INIS)

    Laubli, U.K.; Baier, W.; Celio, M.R.; Binz, H.; Humbel, R.E.

    1982-01-01

    Mouse hybridomas secreting antibodies to human insulin-like growth factor I (IGF I) were produced by fusion of spleen cells of hyperimmunised mice with FO mouse-myeloma cells. Eight clones producing antibodies against human IGF I have been isolated, two of which have been characterised. One was used in a radioimmunoassay, the other for immunopurification of IGF. (Auth.)

  8. Subcortical structures in humans can be facilitated by transcranial direct current stimulation

    NARCIS (Netherlands)

    Nonnekes, Johan Hendrik; Arrogi, Anass; Munneke, Moniek; van Asseldonk, Edwin H.F.; Oude Nijhuis, Lars; Geurts, Alexander; Weerdesteyn, Vivian

    2014-01-01

    BACKGROUND: Transcranial direct current stimulation (tDCS) is a noninvasive brain stimulation technique that alters cortical excitability via application of a weak direct current. Interestingly, it was demonstrated in cats that tDCS can facilitate subcortical structures as well (Bolzonii et al., J

  9. Direct evaluation of radiation damage in human hematopoietic progenitor cells in vivo

    International Nuclear Information System (INIS)

    Kyoizumi, Seishi; McCune, J.M.; Namikawa, Reiko

    1994-01-01

    We have developed techniques by which normal functional elements of human bone marrow can be implanted into immunodeficient C.B-17 scid/scid (SCID) mice. Afterward, long-term multilineage human hematopoiesis is sustained in vivo. We evaluated the effect of irradiation on the function of human bone marrow with this in vivo model. After whole-body X irradiation of the engrafted animals, it was determined that the D 0 value of human committed progenitor cells within the human marrow was 1.00 ± 0.09 (SEM) Gy for granulocyte-macrophage colony-forming units (CFU-GM) and 0.74 ± 0.12 Gy for erythroidburst-forming units (BFU-E). The effects of irradiation on the hematopoietic elements were reduced when the radioprotective agent WR-2721 was administered prior to irradiation. After low-dose irradiation, recovery of human granulocyte colony-stimulating factor (G-CSF). This small animal model may prove amenable for the analysis of the risk of the exposure of humans to irradiation as well as for the development of new modalities for the prevention and treatment of radiation-induced hematopoietic damage. 41 refs., 5 figs., 1 tab

  10. Scientific Merit Review of Directed Research Tasks Within the NASA Human Research Program

    Science.gov (United States)

    Charles, John B.

    2010-01-01

    The Human Research Program is instrumental in developing and delivering research findings, health countermeasures, and human systems technologies for spacecraft. :HRP is subdivided into 6 research entities, or Elements. Each Element is charged with providing the Program with knowledge and capabilities to conduct research to address the human health and performance risks as well as advance the readiness levels of technology and countermeasures. Project: An Element may be further subdivided into Projects, which are defined as an integrated set of tasks undertaken to deliver a product or set of products

  11. Advance Directives of Will (Living Will: Ethical and Legal Implications Based on the Principle of Dignity of Human Person

    Directory of Open Access Journals (Sweden)

    Maria Aparecida Alkimim

    2016-12-01

    Full Text Available This paper, with methodology of philosophical, bibliographical and documentary research intends to apply the principle of dignity of human person to the vicissitudes around the advance directives of will, to the ethical aspects disciplined by the Code of Medical Ethics, as well as to what regards the legal aspects, involving the Federal Constitution, the Civil Code, the Code of Medical Ethics and the Resolution 1995/2012 (CFM. The principle of dignity of human person along with the consequent application in the principles of bioethics is considered in a personalistic perspective. This kind of approach is indicative of the interdisciplinarity of bioethics.

  12. Future human health research directions for the Canadian Northern Contaminants Program

    Science.gov (United States)

    Donaldson, Shawn G.; Curren, Meredith S.; Adlard, Bryan; Provost, Jonathan; Leech, Tara; Tikhonov, Constantine; Feeley, Mark; Tomlinson, Scott; Shearer, Russel

    2013-01-01

    Studies conducted in the mid-1980s and early 1990s demonstrated that persistent organic pollutants (POPs) and metals were reaching the Arctic ecosystem at unexpectedly high levels, many of which had no Arctic or Canadian sources. Epidemiological and toxicological studies in Canada and in other countries have found that these contaminants may pose a risk to human health. The objective of this paper is to provide the foundation for the discussion on future northern human health research under the Northern Contaminants Program (NCP) in Canada. This short discussion of human health priorities will help guide a path forward for future northern human health research in Canada to address on-going and new health concerns related to contaminants exposure in the Canadian Arctic. PMID:24282784

  13. Transcranial magnetic stimulation with a half-sine wave pulse elicits direction-specific effects in human motor cortex

    DEFF Research Database (Denmark)

    Jung, Nikolai H; Delvendahl, Igor; Pechmann, Astrid

    2012-01-01

    Transcranial magnetic stimulation (TMS) commonly uses so-called monophasic pulses where the initial rapidly changing current flow is followed by a critically dampened return current. It has been shown that a monophasic TMS pulse preferentially excites different cortical circuits in the human motor...... hand area (M1-HAND), if the induced tissue current has a posterior-to-anterior (PA) or anterior-to-posterior (AP) direction. Here we tested whether similar direction-specific effects could be elicited in M1-HAND using TMS pulses with a half-sine wave configuration....

  14. Molecular Cloning of Human Gene(s) Directing the Synthesis of Nervous System Cholinesterases

    Science.gov (United States)

    1987-09-01

    responsible for at least some of the symptoms observed in hyperthyroidism . The location of primary sequences of human ChE showing high homology to bovine...verteLrates both classes exist in the heart. Humans having non- functional BuChE in the serum show no known symptoms of illness (15) and exhibit normal...become a "physiological nuisance" in cases of hyperthyroidism (such as Graves’ ophthalmopathy). In this disorder, there exists an overproduction of the

  15. A novel method for direct measurement of complement convertases activity in human serum

    NARCIS (Netherlands)

    Blom, A.M.; Volokhina, E.B.; Fransson, V.; Stromberg, P.; Berghard, L.; Viktorelius, M.; Mollnes, T.E.; Lopez-Trascasa, M.; Heuvel, B. van den; Goodship, T.H.; Marchbank, K.J.; Okroj, M.

    2014-01-01

    Complement convertases are enzymatic complexes that play a central role in sustaining and amplification of the complement cascade. Impairment of complement function leads directly or indirectly to pathological conditions, including higher infection rate, kidney diseases, autoimmune- or

  16. Direct and crossed effects of somatosensory stimulation on neuronal excitability and motor performance in humans

    NARCIS (Netherlands)

    Veldman, M. P.; Maffiuletti, N. A.; Hallett, M.; Zijdewind, I.; Hortobagyi, T.

    2014-01-01

    This analytic review reports how prolonged periods of somatosensory electric stimulation (SES) with repetitive transcutaneous nerve stimulation can have 'direct' and 'crossed' effects on brain activation, corticospinal excitability, and motor performance. A review of 26 studies involving 315 healthy

  17. Antibody directed against human YKL-40 increases tumor volume in a human melanoma xenograft model in scid mice

    DEFF Research Database (Denmark)

    Salamon, Johannes; Hoffmann, Tatjana; Elies, Eva

    2014-01-01

    were treated with intraperitoneal injections of anti-YKL-40, isoptype control or PBS. Non-YKL-40 expressing human pancreatic carcinoma cell line PaCa 5061 served as additional control. MR imaging was used for evaluation of tumor growth. Two days after the first injections of anti-YKL-40, tumor volume...... had increased significantly compared with controls, whereas no effects were observed for control tumors from PaCa 5061 cells lacking YKL-40 expression. After 18 days, mean tumor size of the mice receiving repeated anti-YKL-40 injections was 1.82 g, >4 times higher than mean tumor size of the controls...

  18. Perspectives on How Human Simultaneous Multi-Modal Imaging Adds Directionality to Spread Models of Alzheimer’s Disease

    Directory of Open Access Journals (Sweden)

    Julia Neitzel

    2018-01-01

    Full Text Available Previous animal research suggests that the spread of pathological agents in Alzheimer’s disease (AD follows the direction of signaling pathways. Specifically, tau pathology has been suggested to propagate in an infection-like mode along axons, from transentorhinal cortices to medial temporal lobe cortices and consequently to other cortical regions, while amyloid-beta (Aβ pathology seems to spread in an activity-dependent manner among and from isocortical regions into limbic and then subcortical regions. These directed connectivity-based spread models, however, have not been tested directly in AD patients due to the lack of an in vivo method to identify directed connectivity in humans. Recently, a new method—metabolic connectivity mapping (MCM—has been developed and validated in healthy participants that uses simultaneous FDG-PET and resting-state fMRI data acquisition to identify directed intrinsic effective connectivity (EC. To this end, postsynaptic energy consumption (FDG-PET is used to identify regions with afferent input from other functionally connected brain regions (resting-state fMRI. Here, we discuss how this multi-modal imaging approach allows quantitative, whole-brain mapping of signaling direction in AD patients, thereby pointing out some of the advantages it offers compared to other EC methods (i.e., Granger causality, dynamic causal modeling, Bayesian networks. Most importantly, MCM provides the basis on which models of pathology spread, derived from animal studies, can be tested in AD patients. In particular, future work should investigate whether tau and Aβ in humans propagate along the trajectories of directed connectivity in order to advance our understanding of the neuropathological mechanisms causing disease progression.

  19. Direct Induction and Functional Maturation of Forebrain GABAergic Neurons from Human Pluripotent Stem Cells

    Directory of Open Access Journals (Sweden)

    Alfred Xuyang Sun

    2016-08-01

    Full Text Available Gamma-aminobutyric acid (GABA-releasing interneurons play an important modulatory role in the cortex and have been implicated in multiple neurological disorders. Patient-derived interneurons could provide a foundation for studying the pathogenesis of these diseases as well as for identifying potential therapeutic targets. Here, we identified a set of genetic factors that could robustly induce human pluripotent stem cells (hPSCs into GABAergic neurons (iGNs with high efficiency. We demonstrated that the human iGNs express neurochemical markers and exhibit mature electrophysiological properties within 6–8 weeks. Furthermore, in vitro, iGNs could form functional synapses with other iGNs or with human-induced glutamatergic neurons (iENs. Upon transplantation into immunodeficient mice, human iGNs underwent synaptic maturation and integration into host neural circuits. Taken together, our rapid and highly efficient single-step protocol to generate iGNs may be useful to both mechanistic and translational studies of human interneurons.

  20. Direct Electrical Stimulation of the Human Entorhinal Region and Hippocampus Impairs Memory.

    Science.gov (United States)

    Jacobs, Joshua; Miller, Jonathan; Lee, Sang Ah; Coffey, Tom; Watrous, Andrew J; Sperling, Michael R; Sharan, Ashwini; Worrell, Gregory; Berry, Brent; Lega, Bradley; Jobst, Barbara C; Davis, Kathryn; Gross, Robert E; Sheth, Sameer A; Ezzyat, Youssef; Das, Sandhitsu R; Stein, Joel; Gorniak, Richard; Kahana, Michael J; Rizzuto, Daniel S

    2016-12-07

    Deep brain stimulation (DBS) has shown promise for treating a range of brain disorders and neurological conditions. One recent study showed that DBS in the entorhinal region improved the accuracy of human spatial memory. Based on this line of work, we performed a series of experiments to more fully characterize the effects of DBS in the medial temporal lobe on human memory. Neurosurgical patients with implanted electrodes performed spatial and verbal-episodic memory tasks. During the encoding periods of both tasks, subjects received electrical stimulation at 50 Hz. In contrast to earlier work, electrical stimulation impaired memory performance significantly in both spatial and verbal tasks. Stimulation in both the entorhinal region and hippocampus caused decreased memory performance. These findings indicate that the entorhinal region and hippocampus are causally involved in human memory and suggest that refined methods are needed to use DBS in these regions to improve memory. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. A single theoretical framework for circular features processing in humans: orientation and direction of motion compared

    Directory of Open Access Journals (Sweden)

    Tzvetomir eTzvetanov

    2012-05-01

    Full Text Available Common computational principles underly processing of various visual features in the cortex. They are considered to create similar patterns of contextual modulations in behavioral studies for different features as orientation and direction of motion. Here, I studied the possibility that a single theoretical framework, implemented in different visual areas, of circular feature coding and processing could explain these similarities in observations. Stimuli were created that allowed direct comparison of the contextual effects on orientation and motion direction with two different psychophysical probes: changes in weak and strong signal perception. One unique simplified theoretical model of circular feature coding including only inhibitory interactions, and decoding through standard vector average, successfully predicted the similarities in the two domains, while different feature population characteristics explained well the differences in modulation on both experimental probes. These results demonstrate how a single computational principle underlies processing of various features across the cortices.

  2. Direct evidence of fiber type-dependent GLUT-4 expression in human skeletal muscle

    DEFF Research Database (Denmark)

    Gaster, M; Poulsen, P; Handberg, A

    2000-01-01

    GLUT-4 expression in individual fibers of human skeletal muscles in younger and older adults was studied. Furthermore, the dependency of insulin-stimulated glucose uptake on fiber type distribution was investigated. Fiber type distribution was determined in cryosections of muscle biopsies from 8...... of slow fibers in the young (r = -0.45, P > 0.25) or in the elderly (r = 0. 11, P > 0.75) subjects. In conclusion, in human skeletal muscle, GLUT-4 expression is fiber type dependent and decreases with age, particularly in fast muscle fibers....

  3. Phosphorylated STAT5 directly facilitates parvovirus B19 DNA replication in human erythroid progenitors through interaction with the MCM complex.

    Science.gov (United States)

    Ganaie, Safder S; Zou, Wei; Xu, Peng; Deng, Xuefeng; Kleiboeker, Steve; Qiu, Jianming

    2017-05-01

    Productive infection of human parvovirus B19 (B19V) exhibits high tropism for burst forming unit erythroid (BFU-E) and colony forming unit erythroid (CFU-E) progenitor cells in human bone marrow and fetal liver. This exclusive restriction of the virus replication to human erythroid progenitor cells is partly due to the intracellular factors that are essential for viral DNA replication, including erythropoietin signaling. Efficient B19V replication also requires hypoxic conditions, which upregulate the signal transducer and activator of transcription 5 (STAT5) pathway, and phosphorylated STAT5 is essential for virus replication. In this study, our results revealed direct involvement of STAT5 in B19V DNA replication. Consensus STAT5-binding elements were identified adjacent to the NS1-binding element within the minimal origins of viral DNA replication in the B19V genome. Phosphorylated STAT5 specifically interacted with viral DNA replication origins both in vivo and in vitro, and was actively recruited within the viral DNA replication centers. Notably, STAT5 interacted with minichromosome maintenance (MCM) complex, suggesting that STAT5 directly facilitates viral DNA replication by recruiting the helicase complex of the cellular DNA replication machinery to viral DNA replication centers. The FDA-approved drug pimozide dephosphorylates STAT5, and it inhibited B19V replication in ex vivo expanded human erythroid progenitors. Our results demonstrated that pimozide could be a promising antiviral drug for treatment of B19V-related diseases.

  4. Integrating Environmental and Human Health Databases in the Great Lakes Basin: Themes, Challenges and Future Directions

    Directory of Open Access Journals (Sweden)

    Kate L. Bassil

    2015-03-01

    Full Text Available Many government, academic and research institutions collect environmental data that are relevant to understanding the relationship between environmental exposures and human health. Integrating these data with health outcome data presents new challenges that are important to consider to improve our effective use of environmental health information. Our objective was to identify the common themes related to the integration of environmental and health data, and suggest ways to address the challenges and make progress toward more effective use of data already collected, to further our understanding of environmental health associations in the Great Lakes region. Environmental and human health databases were identified and reviewed using literature searches and a series of one-on-one and group expert consultations. Databases identified were predominantly environmental stressors databases, with fewer found for health outcomes and human exposure. Nine themes or factors that impact integration were identified: data availability, accessibility, harmonization, stakeholder collaboration, policy and strategic alignment, resource adequacy, environmental health indicators, and data exchange networks. The use and cost effectiveness of data currently collected could be improved by strategic changes to data collection and access systems to provide better opportunities to identify and study environmental exposures that may impact human health.

  5. Body temperature predicts the direction of internal desynchronization in humans isolated from time cues

    NARCIS (Netherlands)

    Daan, Serge; Honma, Sato; Honma, Ken-ichi

    2013-01-01

    This publication presents a new analysis of experiments that were carried out in human subjects in isolation from time cues, under supervision of Jurgen Aschoff and Rutger Wever at the Max Planck Institute for Behavioural Physiology (Erling-Andechs, Germany, 1964-1974). Mean rectal temperatures

  6. Brain Imaging of Human Sexual Response : Recent Developments and Future Directions

    NARCIS (Netherlands)

    Ruesink, Gerben B; Georgiadis, Janniko R

    2017-01-01

    Purpose of Review: The purpose of this study is to provide a comprehensive summary of the latest developments in the experimental brain study of human sexuality, focusing on brain connectivity during the sexual response. Recent Findings: Stable patterns of brain activation have been established for

  7. The Oldest Anatomically Modern Humans from Far Southeast Europe : Direct Dating, Culture and Behavior

    NARCIS (Netherlands)

    Prat, Sandrine; Pean, Stephane C.; Crepin, Laurent; Drucker, Dorothee G.; Puaud, Simon J.; Valladas, Helene; Laznickova-Galetova, Martina; van der Plicht, Johannes; Yanevich, Alexander

    2011-01-01

    Background: Anatomically Modern Humans (AMHs) are known to have spread across Europe during the period coinciding with the Middle to Upper Paleolithic transition. Whereas their dispersal into Western Europe is relatively well established, evidence of an early settlement of Eastern Europe by modern

  8. DIRECT FLOW-CYTOMETRY OF ANAEROBIC-BACTERIA IN HUMAN FECES

    NARCIS (Netherlands)

    VANDERWAAIJ, LA; MESANDER, G; LIMBURG, PC; VANDERWAAIJ, D

    1994-01-01

    We describe a flow cytometry method for analysis of noncultured anaerobic bacteria present in human fecal suspensions. Nonbacterial fecal compounds, bacterial fragments, and large aggregates could be discriminated from bacteria by staining with propidium iodide (PI) and setting a discriminator on PI

  9. Why directionality is an important light factor for human health to consider in lighting design?

    NARCIS (Netherlands)

    Khademagha, P.; Aries, M.B.C.; Rosemann, A.L.P.; van Loenen, E.J.

    2016-01-01

    Both image-forming and non-image-forming effects of radiation require proper attention in lighting design that aims at meeting human vision and health requirements. Intrinsically Photosensitive Retinal Ganglion Cells (ipRGCs) appear to play an essential role in stimulation of the non-image forming

  10. Subcortical structures in humans can be facilitated by transcranial direct current stimulation

    NARCIS (Netherlands)

    Nonnekes, J.H.; Arrogi, A.; Munneke, M.A.M.; Asseldonk, E.H. van; Nijhuis, L.B.; Geurts, A.C.H.; Weerdesteyn, V.G.M.

    2014-01-01

    Transcranial direct current stimulation (tDCS) is a noninvasive brain stimulation technique that alters cortical excitability. Interestingly, in recent animal studies facilitatory effects of tDCS have also been observed on subcortical structures. Here, we sought to provide evidence for the potential

  11. Subcortical Structures in Humans Can Be Facilitated by Transcranial Direct Current Stimulation

    NARCIS (Netherlands)

    Nonnekes, Johan Hendrik; Arrogi, A.; Munneke, M.A.M.; van Asseldonk, Edwin H.F.; Oude Nijhuis, L.B.; Geurts, A.C.; Weerdesteyn, V.

    2014-01-01

    Transcranial direct current stimulation (tDCS) is a noninvasive brain stimulation technique that alters cortical excitability. Interestingly, in recent animal studies facilitatory effects of tDCS have also been observed on subcortical structures. Here, we sought to provide evidence for the potential

  12. Simulating Transcranial Direct Current Stimulation With a Detailed Anisotropic Human Head Model

    NARCIS (Netherlands)

    Rampersad, S.; Janssen, A.J.E.M.; Lucka, F.; Aydin, U.; Lanfer, B.; Lew, S.; Wolters, C.H.; Stegeman, D.F.; Oostendorp, T.F.

    2014-01-01

    Transcranial direct current stimulation (tDCS) is a noninvasive brain stimulation technique able to induce long-lasting changes in cortical excitability that can benefit cognitive functioning and clinical treatment. In order to both better understand the mechanisms behind tDCS and possibly improve

  13. Simulating transcranial direct current stimulation with a detailed anisotropic human head model

    NARCIS (Netherlands)

    Rampersad, S.M.; Janssen, A.M.; Lucka, F.; Aydin, U.; Lanfer, B.; Lew, S.; Wolters, C.H.; Stegeman, D.F.; Oostendorp, T.F.

    2014-01-01

    Transcranial direct current stimulation (tDCS) is a noninvasive brain stimulation technique able to induce long-lasting changes in cortical excitability that can benefit cognitive functioning and clinical treatment. In order to both better understand the mechanisms behind tDCS and possibly improve

  14. Direct 3D cell-printing of human skin with functional transwell system.

    Science.gov (United States)

    Kim, Byoung Soo; Lee, Jung-Seob; Gao, Ge; Cho, Dong-Woo

    2017-06-06

    Three-dimensional (3D) cell-printing has been emerging as a promising technology with which to build up human skin models by enabling rapid and versatile design. Despite the technological advances, challenges remain in the development of fully functional models that recapitulate complexities in the native tissue. Moreover, although several approaches have been explored for the development of biomimetic human skin models, the present skin models based on multistep fabrication methods using polydimethylsiloxane chips and commercial transwell inserts could be tackled by leveraging 3D cell-printing technology. In this paper, we present a new 3D cell-printing strategy for engineering a 3D human skin model with a functional transwell system in a single-step process. A hybrid 3D cell-printing system was developed, allowing for the use of extrusion and inkjet modules at the same time. We began by revealing the significance of each module in engineering human skin models; by using the extrusion-dispensing module, we engineered a collagen-based construct with polycaprolactone (PCL) mesh that prevented the contraction of collagen during tissue maturation; the inkjet-based dispensing module was used to uniformly distribute keratinocytes. Taking these features together, we engineered a human skin model with a functional transwell system; the transwell system and fibroblast-populated dermis were consecutively fabricated by using the extrusion modules. Following this process, keratinocytes were uniformly distributed onto the engineered dermis by the inkjet module. Our transwell system indicates a supportive 3D construct composed of PCL, enabling the maturation of a skin model without the aid of commercial transwell inserts. This skin model revealed favorable biological characteristics that included a stabilized fibroblast-stretched dermis and stratified epidermis layers after 14 days. It was also observed that a 50 times reduction in cost was achieved and 10 times less medium was

  15. Possible links between extreme levels of space weather changes and human health state in middle latitudes: direct and indirect indicators

    Science.gov (United States)

    Safaraly-Oghlu Babayev, Elchin

    geomagnetic storms of the solar cycle 23 on the mentioned systems in middle-latitude location. In these studies, direct and indirect indicators of space weather influence are used: 1) Indirect indicators are essentially epidemiological data showing the temporal and spatial distribution of defined events or health disturbances involving considerable numbers of test subjects over several years. The indirect indicators used in this paper are: temporal distribution of emergency calls and hospital admissions (sudden cardiac deaths, acute myocardial infarction mortality and morbidity, so on), dynamics of traffic accidents, epidemics, etc.; 2) Direct indicators. They are physiological parameters, which can be objectively verified and which are acquired either in vivo, directly on the subject (heart rate and its variability, blood pressure, human brain's functional state, human psycho-emotional state, so on), or in vitro by laboratory diagnostics or tissue investigations. The potential co-factors, e.g. terrestrial (tropospheric) weather, seasons, demographic factor, working environment, etc., were also considered in the interpretation of the indicators. Spectral analyses have revealed certain chronobiological periodicities in the considered data. There are also provided results of daily medical-physiological experiments (acupunctural studies of conductivity of the biologically active points of human body in days with different geomagnetic activity levels) conducted in the Laboratory of Heliobiology, Baku, Azerbaijan, as a part of collaborative studies with Russian institutions such as IZMIRAN and Space Research Institute. They show on the latitudinal and longitudinal dependence of space weather influence. Our complex studies enabled to conclude that not only extremely high, but also very low levels of geomagnetic activity may have signifi- cant influence on human health state, especially, in the cardio-vascular health state and human brain's bioelectrical activity.

  16. Starch Catabolism by a Prominent Human Gut Symbiont Is Directed by the Recognition of Amylose Helices

    Energy Technology Data Exchange (ETDEWEB)

    Koropatkin, Nicole M.; Martens, Eric C.; Gordon, Jeffrey I.; Smith, Thomas J. (WU); (Danforth)

    2009-01-12

    The human gut microbiota performs functions that are not encoded in our Homo sapiens genome, including the processing of otherwise undigestible dietary polysaccharides. Defining the structures of proteins involved in the import and degradation of specific glycans by saccharolytic bacteria complements genomic analysis of the nutrient-processing capabilities of gut communities. Here, we describe the atomic structure of one such protein, SusD, required for starch binding and utilization by Bacteroides thetaiotaomicron, a prominent adaptive forager of glycans in the distal human gut microbiota. The binding pocket of this unique {alpha}-helical protein contains an arc of aromatic residues that complements the natural helical structure of starch and imposes this conformation on bound maltoheptaose. Furthermore, SusD binds cyclic oligosaccharides with higher affinity than linear forms. The structures of several SusD/oligosaccharide complexes reveal an inherent ligand recognition plasticity dominated by the three-dimensional conformation of the oligosaccharides rather than specific interactions with the composite sugars.

  17. Exploring the implications of social change for human development: perspectives, issues and future directions.

    Science.gov (United States)

    Chen, Xinyin

    2015-02-01

    Researchers have investigated the implications of social change for human development from different perspectives. The studies published in this special section were conducted within Greenfield's theoretical framework (2009). The findings concerning links between specific sociodemographic features (e.g., commercial activities, schooling) and individual cognition and social behaviour are particularly interesting because they tap the underlying forces that drive human development. To further understand the issues in these studies and in the field, a pluralist-constructive perspective is discussed, which emphasises the integration of diverse values and practices in both Western and non-Western societies and its effects on the development of sophisticated competencies in individual adaptation to the changing global community. In addition, several issues are highlighted and some suggestions are provided for future explorations in this field. © 2014 International Union of Psychological Science.

  18. Brain Imaging of Human Sexual Response: Recent Developments and Future Directions.

    Science.gov (United States)

    Ruesink, Gerben B; Georgiadis, Janniko R

    2017-01-01

    The purpose of this study is to provide a comprehensive summary of the latest developments in the experimental brain study of human sexuality, focusing on brain connectivity during the sexual response. Stable patterns of brain activation have been established for different phases of the sexual response, especially with regard to the wanting phase, and changes in these patterns can be linked to sexual response variations, including sexual dysfunctions. From this solid basis, connectivity studies of the human sexual response have begun to add a deeper understanding of the brain network function and structure involved. The study of "sexual" brain connectivity is still very young. Yet, by approaching the brain as a connected organ, the essence of brain function is captured much more accurately, increasing the likelihood of finding useful biomarkers and targets for intervention in sexual dysfunction.

  19. EVEN-SKIPPED HOMEOBOX 1 controls human ES cell differentiation by directly repressing GOOSECOID expression

    DEFF Research Database (Denmark)

    Kalisz, Mark; Winzi, Maria Karin; Bisgaard, Hanne Cathrine

    2012-01-01

    (EVX1) and GOOSECOID (GSC) regulate cell fate decisions in streak-like progenitors derived from human ES cells exposed to BMP4 and/or activin. We found that EVX1 repressed GSC expression and promoted formation of posterior streak-like progeny in response to BMP4, and conversely that GSC repressed EVX1...... expression and was required for development of anterior streak-like progeny in response to activin. Chromatin immunoprecipitation assays showed that EVX1 bound to the GSC 5'-flanking region in BMP4 treated human ES cells, and band shift assays identified two EVX1 binding sites in the GSC 5'-region......TGFß signaling patterns the primitive streak, yet little is known about transcriptional effectors that mediate the cell fate choices during streak-like development in mammalian embryos and in embryonic stem (ES) cells. Here we demonstrate that cross-antagonistic actions of EVEN-SKIPPED HOMEOBOX 1...

  20. Brain Imaging of Human Sexual Response: Recent Developments and Future Directions

    OpenAIRE

    Ruesink, Gerben B; Georgiadis, Janniko R

    2017-01-01

    Purpose of Review: The purpose of this study is to provide a comprehensive summary of the latest developments in the experimental brain study of human sexuality, focusing on brain connectivity during the sexual response. Recent Findings: Stable patterns of brain activation have been established for different phases of the sexual response, especially with regard to the wanting phase, and changes in these patterns can be linked to sexual response variations, including sexual dysfunctions. From ...

  1. Visual and tactile interfaces for bi-directional human robot communication

    Science.gov (United States)

    Barber, Daniel; Lackey, Stephanie; Reinerman-Jones, Lauren; Hudson, Irwin

    2013-05-01

    Seamless integration of unmanned and systems and Soldiers in the operational environment requires robust communication capabilities. Multi-Modal Communication (MMC) facilitates achieving this goal due to redundancy and levels of communication superior to single mode interaction using auditory, visual, and tactile modalities. Visual signaling using arm and hand gestures is a natural method of communication between people. Visual signals standardized within the U.S. Army Field Manual and in use by Soldiers provide a foundation for developing gestures for human to robot communication. Emerging technologies using Inertial Measurement Units (IMU) enable classification of arm and hand gestures for communication with a robot without the requirement of line-of-sight needed by computer vision techniques. These devices improve the robustness of interpreting gestures in noisy environments and are capable of classifying signals relevant to operational tasks. Closing the communication loop between Soldiers and robots necessitates them having the ability to return equivalent messages. Existing visual signals from robots to humans typically require highly anthropomorphic features not present on military vehicles. Tactile displays tap into an unused modality for robot to human communication. Typically used for hands-free navigation and cueing, existing tactile display technologies are used to deliver equivalent visual signals from the U.S. Army Field Manual. This paper describes ongoing research to collaboratively develop tactile communication methods with Soldiers, measure classification accuracy of visual signal interfaces, and provides an integration example including two robotic platforms.

  2. Theranostic properties of a survivin-directed molecular beacon in human melanoma cells.

    Directory of Open Access Journals (Sweden)

    Sara Carpi

    Full Text Available Survivin is an inhibitor of apoptosis overexpressed in different types of tumors and undetectable in most terminally differentiated normal tissues. In the current study, we sought to evaluate the in vitro theranostic properties of a molecular beacon-oligodeoxynucleotide (MB that targets survivin mRNA. We used laser scanning confocal microscopy to study MB delivery in living cells and real-time PCR and western blot to assess selective survivin-targeting in human malignant melanoma cells. We further assess the pro-apoptotic effect of MB by measuring internucleosomal DNA fragmentation, dissipation of mitochondrial membrane potential (MMP and changes in nuclear morphology. Transfection of MB into A375 and 501 Mel cells generated high signal intensity from the cytoplasm, while no signal was detected in the extracellular environment and in survivin-negative cells (i.e., human melanocytes and monocytes. MB time dependently decreased survivin mRNA and protein expression in melanoma cells with the maximum effect reached at 72 h. Treatment of melanoma cells with MB induced apoptosis by significant changes in MMP, accumulation of histone-complexed DNA fragments in the cytoplasm and nuclear condensation. MB also enhanced the pro-apoptotic effect of standard chemotherapeutic drugs tested at clinically relevant concentrations. The MB tested in the current study conjugates the ability of imaging with the pharmacological silencing activity against survivin mRNA in human melanoma cells and may represent an innovative approach for cancer diagnosis and treatment.

  3. Regional characterization of freshwater Use in LCA: modeling direct impacts on human health.

    Science.gov (United States)

    Boulay, Anne-Marie; Bulle, Cécile; Bayart, Jean-Baptiste; Deschênes, Louise; Margni, Manuele

    2011-10-15

    Life cycle assessment (LCA) is a methodology that quantifies potential environmental impacts for comparative purposes in a decision-making context. While potential environmental impacts from pollutant emissions into water are characterized in LCA, impacts from water unavailability are not yet fully quantified. Water use can make the resource unavailable to other users by displacement or quality degradation. A reduction in water availability to human users can potentially affect human health. If financial resources are available, there can be adaptations that may, in turn, shift the environmental burdens to other life cycle stages and impact categories. This paper proposes a model to evaluate these potential impacts in an LCA context. It considers the water that is withdrawn and released, its quality and scarcity in order to evaluate the loss of functionality associated with water uses. Regionalized results are presented for impacts on human health for two modeling approaches regarding affected users, including or not domestic uses, and expressed in disability-adjusted life years (DALY). A consumption and quality based scarcity indicator is also proposed as a midpoint. An illustrative example is presented for the production of corrugated board with different effluents, demonstrating the importance of considering quality, process effluents and the difference between the modeling approaches.

  4. Tryptophan Depletion Promotes Habitual over Goal-Directed Control of Appetitive Responding in Humans.

    Science.gov (United States)

    Worbe, Yulia; Savulich, George; de Wit, Sanne; Fernandez-Egea, Emilio; Robbins, Trevor W

    2015-02-05

    Optimal behavioral performance results from a balance between goal-directed and habitual systems of behavioral control, which are modulated by ascending monoaminergic projections. While the role of the dopaminergic system in behavioral control has been recently addressed, the extent to which changes in global serotonin neurotransmission could influence these 2 systems is still poorly understood. We employed the dietary acute tryptophan depletion procedure to reduce serotonin neurotransmission in 18 healthy volunteers and 18 matched controls. We used a 3-stage instrumental learning paradigm that includes an initial instrumental learning stage, a subsequent outcome-devaluation test, and a slip-of-action stage, which directly tests the balance between hypothetical goal-directed and habitual systems. We also employed a separate response inhibition control test to assess the behavioral specificity of the results. Acute tryptophan depletion produced a shift of behavioral performance towards habitual responding as indexed by performance on the slip-of-action test. Moreover, greater habitual responding in the acute tryptophan depletion group was predicted by a steeper decline in plasma tryptophan levels. In contrast, acute tryptophan depletion left intact the ability to use discriminative stimuli to guide instrumental choice as indexed by the instrumental learning stage and did not impair inhibitory response control. The major implication of this study is that serotonin modulates the balance between goal-directed and stimulus-response habitual systems of behavioral control. Our findings thus imply that diminished serotonin neurotransmission shifts behavioral control towards habitual responding. © The Author 2015. Published by Oxford University Press on behalf of CINP.

  5. A Preliminary Human Rights Analysis of the Working Group Report and Recommendations on Direct Provision

    OpenAIRE

    Thornton, Liam

    2015-01-01

    Overall, the Report contains a mix of significant recommendations on the protection process and processing of asylum claims. However, I argue, there are significant concerns with the recommendations that have emerged as regards direct provision accommodation and supports for asylum applicants. The focus of this working paper relates to categorising some of the recommendations contained in the McMahon Report and providing some initial analysis. This analysis is not an exhaustive exploration...

  6. A novel method for direct measurement of complement convertases activity in human serum.

    Science.gov (United States)

    Blom, A M; Volokhina, E B; Fransson, V; Strömberg, P; Berghard, L; Viktorelius, M; Mollnes, T E; López-Trascasa, M; van den Heuvel, L P; Goodship, T H; Marchbank, K J; Okroj, M

    2014-10-01

    Complement convertases are enzymatic complexes that play a central role in sustaining and amplification of the complement cascade. Impairment of complement function leads directly or indirectly to pathological conditions, including higher infection rate, kidney diseases, autoimmune- or neurodegenerative diseases and ischaemia-reperfusion injury. An assay for direct measurement of activity of the convertases in patient sera is not available. Existing assays testing convertase function are based on purified complement components and, thus, convertase formation occurs under non-physiological conditions. We designed a new assay, in which C5 blocking compounds enabled separation of the complement cascade into two phases: the first ending at the stage of C5 convertases and the second ending with membrane attack complex formation. The use of rabbit erythrocytes or antibody-sensitized sheep erythrocytes as the platforms for convertase formation enabled easy readout based on measurement of haemolysis. Thus, properties of patient sera could be studied directly regarding convertase activity and membrane attack complex formation. Another advantage of this assay was the possibility to screen for host factors such as C3 nephritic factor and other anti-complement autoantibodies, or gain-of-function mutations, which prolong the half-life of complement convertases. Herein, we present proof of concept, detailed description and validation of this novel assay. © 2014 British Society for Immunology.

  7. Ex-vivo expanded human NK cells express activating receptors that mediate cytotoxicity of allogeneic and autologous cancer cell lines by direct recognition and antibody directed cellular cytotoxicity

    Directory of Open Access Journals (Sweden)

    Campana Dario

    2010-10-01

    Full Text Available Abstract Background The possibility that autologous NK cells could serve as an effective treatment modality for solid tumors has long been considered. However, implementation is hampered by (i the small number of NK cells in peripheral blood, (ii the difficulties associated with large-scale production of GMP compliant cytolytic NK cells, (iii the need to activate the NK cells in order to induce NK cell mediated killing and (iv the constraints imposed by autologous inhibitory receptor-ligand interactions. To address these issues, we determined (i if large numbers of NK cells could be expanded from PBMC and GMP compliant cell fractions derived by elutriation, (ii their ability to kill allogeneic and autologous tumor targets by direct cytotoxitiy and by antibody-mediated cellular cytotoxicity and (iii defined NK cell specific receptor-ligand interactions that mediate tumor target cell killing. Methods Human NK cells were expanded during 14 days. Expansion efficiency, NK receptor repertoire before and after expansion, expression of NK specific ligands, cytolytic activity against allogeneic and autologous tumor targets, with and without the addition of chimeric EGFR monoclonal antibody, were investigated. Results Cell expansion shifted the NK cell receptor repertoire towards activation and resulted in cytotoxicity against various allogeneic tumor cell lines and autologous gastric cancer cells, while sparing normal PBMC. Blocking studies confirmed that autologous cytotoxicity is established through multiple activating receptor-ligand interactions. Importantly, expanded NK cells also mediated ADCC in an autologous and allogeneic setting by antibodies that are currently being used to treat patients with select solid tumors. Conclusion These data demonstrate that large numbers of cytolytic NK cells can be generated from PBMC and lymphocyte-enriched fractions obtained by GMP compliant counter current elutriation from PBMC, establishing the preclinical

  8. Efficient direct conversion of human fibroblasts into myogenic lineage induced by co-transduction with MYCL and MYOD1.

    Science.gov (United States)

    Wakao, Junko; Kishida, Tsunao; Fumino, Shigehisa; Kimura, Koseki; Yamamoto, Kenta; Kotani, Shin-Ichiro; Mizushima, Katsura; Naito, Yuji; Yoshikawa, Toshikazu; Tajiri, Tatsuro; Mazda, Osam

    2017-06-24

    The skeletal muscle consists of contractile myofibers and plays essential roles for maintenance of body posture, movement, and metabolic regulation. During the development and regeneration of the skeletal muscle tissue, the myoblasts fuse into multinucleated myotubes that subsequently form myofibers. Transplantation of myoblasts may make possible a novel regenerative therapy against defects or dysfunction of the skeletal muscle. It is reported that rodent fibroblasts are converted into myoblast-like cells and fuse to form syncytium after forced expression of exogenous myogenic differentiation 1 (MYOD1) that is a key transcription factor for myoblast differentiation. But human fibroblasts are less efficiently converted into myoblasts and rarely fused by MYOD1 alone. Here we found that transduction of v-myc avian myelocytomatosis viral oncogene lung carcinoma derived homolog (MYCL) gene in combination with MYOD1 gene induced myoblast-like phenotypes in human fibroblasts more strongly than MYOD1 gene alone. The rate of conversion was approximately 90%. The directly converted myoblasts (dMBs) underwent fusion in an ERK5 pathway-dependent manner. The dMBs also formed myofiber-like structure in vivo after an inoculation into mice at the subcutaneous tissue. The present results strongly suggest that the combination of MYCL plus MYOD1 may promote direct conversion of human fibroblasts into functional myoblasts that could potentially be used for regenerative therapy for muscle diseases and congenital muscle defects. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Activated human neonatal CD8+ T cells are subject to immunomodulation by direct TLR2 or TLR5 stimulation.

    LENUS (Irish Health Repository)

    McCarron, Mark

    2012-02-01

    In conditions of optimal priming, the neonate possesses competency to mount quantitatively adult-like responses. Vaccine formulations containing sufficiently potent adjuvants may overcome the neonate\\'s natural tendency for immunosuppression and provoke a similarly robust immune response. TLR expression on T cells represents the possibility of directly enhancing T cell immunity. We examined the ex vivo responsiveness of highly purified human cord blood-derived CD8(+) T cells to direct TLR ligation by a repertoire of TLR agonists. In concert with TCR stimulation, only Pam(3)Cys (palmitoyl-3-Cys-Ser-(Lys)(4)) and flagellin monomers significantly enhanced proliferation, CD25(+) expression, IL-2, IFN-gamma, TNF-alpha, and intracellular granzyme B expression. TLR2 and TLR5 mRNA was detected in the CD8(+) T cells. Blocking studies confirmed that the increase in IFN-gamma production was by the direct triggering of surface TLR2 or TLR5. The simultaneous exposure of CD8(+) T cells to both TLR agonists had an additive effect on IFN-gamma production. These data suggest that a combination of the two TLR ligands would be a potent T cell adjuvant. This may represent a new approach to TLR agonist-based adjuvant design for future human neonatal vaccination strategies requiring a CD8(+) component.

  10. Direct Conversion of Human Umbilical Cord Blood into Induced Neural Stem Cells with SOX2 and HMGA2.

    Science.gov (United States)

    Kim, Jae-Jun; Shin, Ji-Hee; Yu, Kyung-Rok; Lee, Byung-Chul; Kang, Insung; Lee, Jin Young; Kim, Da-Hyun; Seo, Yoojin; Kim, Hyung-Sik; Choi, Soon Won; Kang, Kyung-Sun

    2017-11-30

    Recent advances have shown the direct reprogramming of mouse and human fibroblasts into induced neural stem cells (iNSCs) without passing through an intermediate pluripotent state. Thus, direct reprogramming strategy possibly provides a safe and homogeneous cellular platform. However, the applications of iNSCs for regenerative medicine are limited by the restricted availability of cell sources. Human umbilical cord blood (hUCB) cells hold great potential in that immunotyped hUCB units can be immediately obtained from public banks. Moreover, hUCB samples do not require invasive procedures during collection or an extensive culture period prior to reprogramming. We recently reported that somatic cells can be directly converted into iNSCs with high efficiency and a short turnaround time. Here, we describe the detailed method for the generation of iNSCs derived from hUCB (hUCB iNSCs) using the lineage-specific transcription factors SOX2 and HMGA2. The protocol for deriving iNSC-like colonies takes 1∼2 weeks and establishment of homogenous hUCB iNSCs takes additional 2 weeks. Established hUCB iNSCs are clonally expandable and multipotent producing neurons and glia. Our study provides an accessible method for generating hUCB iNSCs, contributing development of in vitro neuropathological model systems.

  11. Directed differentiation of basal forebrain cholinergic neurons from human pluripotent stem cells.

    Science.gov (United States)

    Hu, Yao; Qu, Zhuang-Yin; Cao, Shi-Ying; Li, Qi; Ma, Lixiang; Krencik, Robert; Xu, Min; Liu, Yan

    2016-06-15

    Basal forebrain cholinergic neurons (BFCNs) play critical roles in learning, memory and cognition. Dysfunction or degeneration of BFCNs may connect to neuropathology, such as Alzheimer's disease, Down's syndrome and dementia. Generation of functional BFCNs may contribute to the studies of cell-based therapy and pathogenesis that is related to learning and memory deficits. Here we describe a detail method for robust generation of BFCNs from human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs). In this method, BFCN progenitors are patterned from hESC or hiPSC-derived primitive neuroepithelial cells, with the treatment of sonic hedgehog (SHH) or combination with its agonist Purmorphamine, and by co-culturing with human astrocytes. At day 20, ∼90% hPSC-derived progenitors expressed NKX2.1, which is a transcriptional marker for MGE. Moreover, around 40% of NKX2.1+ cells co-expressed OLIG2 and ∼15% of NKX2.1+ cells co-expressed ISLET1, which are ventral markers. At day 35, ∼40% neurons robustly express ChAT, most of which are co-labeled with NKX2.1, ISLET1 and FOXG1, indicating the basal forebrain-like identity. At day 45, these neurons express mature neuronal markers MAP2, Synapsin, and VAChT. In this method, undefined conditions including genetic modification or cell-sorting are avoided. As a choice, feeder free conditions are used to avoid ingredients of animal origin. Moreover, Purmorphamine can be substituted for SHH to induce ventral progenitors effectively and economically. We provide an efficient method to generate BFCNs from multiple hPSC lines, which offers the potential application for disease modeling and pharmacological studies. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. A direct pedestrian-structure interaction model to characterize the human induced vibrations on slender footbridges

    Directory of Open Access Journals (Sweden)

    Jiménez-Alonso, J. F.

    2014-12-01

    Full Text Available Although the scientific community had knowledge of the human induced vibration problems in structures since the end of the 19th century, it was not until the occurrence of the vibration phenomenon happened in the Millennium Bridge (London, 2000 that the importance of the problem revealed and a higher level of attention devoted. Despite the large advances achieved in the determination of the human-structure interaction force, one of the main deficiencies of the existing models is the exclusion of the effect of changes in the footbridge dynamic properties due to the presence of pedestrians. In this paper, the formulation of a human-structure interaction model, addresses these limitations, is carried out and its reliability is verified from previously published experimental results.Aunque la comunidad científica tenía conocimiento de los problemas vibratorios inducidos por peatones en estructuras desde finales del siglo xix, no fue hasta la ocurrencia de los eventos vibratorios acontecidos en la pasarela del Milenio (Londres, 2000, cuando la importancia del problema se puso de manifiesto y se le comenzó a dedicar un mayor nivel de atención. A pesar de los grandes avances alcanzados en la caracterización de la fuerza de interacción peatón-estructura una de las principales deficiencias de los modelos existentes es la exclusión del cambio en las propiedades dinámicas de la pasarela por la presencia de peatones. En este artículo, se presenta la formulación de un modelo de interacción peatón-estructura que intenta dar respuesta a dichas limitaciones, y su validación a partir de resultados experimentales previamente publicados por otros autores.

  13. Endocasts-the direct evidence and recent advances in the study of human brain evolution

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Brain evolution is one of the most important aspects of human evolution, usually studied through endocasts. Analysis of fossil hominid endocasts allows inferences on functional anatomy, physiology, and phylogeny. In this paper, we describe the general features of endocast studies and review some of the major topics in paleoneurology. These are: absolute and relative brain size evolution; brain shape variation; brain asymmetry and lateralization; middle meningeal vessels and venous sinuses; application of computed tomography and virtual imaging; the history of Chinese brain endocast studies. In particular, this review emphasizes endocast studies on Chinese hominin fossils.

  14. Directed cortical information flow during human object recognition: analyzing induced EEG gamma-band responses in brain's source space.

    Directory of Open Access Journals (Sweden)

    Gernot G Supp

    Full Text Available The increase of induced gamma-band responses (iGBRs; oscillations >30 Hz elicited by familiar (meaningful objects is well established in electroencephalogram (EEG research. This frequency-specific change at distinct locations is thought to indicate the dynamic formation of local neuronal assemblies during the activation of cortical object representations. As analytically power increase is just a property of a single location, phase-synchrony was introduced to investigate the formation of large-scale networks between spatially distant brain sites. However, classical phase-synchrony reveals symmetric, pair-wise correlations and is not suited to uncover the directionality of interactions. Here, we investigated the neural mechanism of visual object processing by means of directional coupling analysis going beyond recording sites, but rather assessing the directionality of oscillatory interactions between brain areas directly. This study is the first to identify the directionality of oscillatory brain interactions in source space during human object recognition and suggests that familiar, but not unfamiliar, objects engage widespread reciprocal information flow. Directionality of cortical information-flow was calculated based upon an established Granger-Causality coupling-measure (partial-directed coherence; PDC using autoregressive modeling. To enable comparison with previous coupling studies lacking directional information, phase-locking analysis was applied, using wavelet-based signal decompositions. Both, autoregressive modeling and wavelet analysis, revealed an augmentation of iGBRs during the presentation of familiar objects relative to unfamiliar controls, which was localized to inferior-temporal, superior-parietal and frontal brain areas by means of distributed source reconstruction. The multivariate analysis of PDC evaluated each possible direction of brain interaction and revealed widespread reciprocal information-transfer during familiar

  15. Direct Evidence of Intrinsic Blue Fluorescence from Oligomeric Interfaces of Human Serum Albumin.

    Science.gov (United States)

    Bhattacharya, Arpan; Bhowmik, Soumitra; Singh, Amit K; Kodgire, Prashant; Das, Apurba K; Mukherjee, Tushar Kanti

    2017-10-10

    The molecular origin behind the concentration-dependent intrinsic blue fluorescence of human serum albumin (HSA) is not known yet. This unusual blue fluorescence is believed to be a characteristic feature of amyloid-like fibrils of protein/peptide and originates due to the delocalization of peptide bond electrons through the extended hydrogen bond networks of cross-β-sheet structure. Herein, by combining the results of spectroscopy, size exclusion chromatography, native gel electrophoresis, and confocal microscopy, we have shown that the intrinsic blue fluorescence of HSA exclusively originates from oligomeric interfaces devoid of any amyloid-like fibrillar structure. Our study suggests that this low energy fluorescence band is not due to any particular residue/sequence, but rather it is a common feature of self-assembled peptide bonds. The present findings of intrinsic blue fluorescence from oligomeric interfaces pave the way for future applications of this unique visual phenomenon for early stage detection of various protein aggregation related human diseases.

  16. Directed Differentiation of Human-Induced Pluripotent Stem Cells to Mesenchymal Stem Cells.

    Science.gov (United States)

    Lian, Qizhou; Zhang, Yuelin; Liang, Xiaoting; Gao, Fei; Tse, Hung-Fat

    2016-01-01

    Multipotent stromal cells, also known as mesenchymal stem cells (MSCs), possess great potential to generate a wide range of cell types including endothelial cells, smooth muscle cells, bone, cartilage, and lipid cells. This protocol describes in detail how to perform highly efficient, lineage-specific differentiation of human-induced pluripotent stem cells (iPSCs) with an MSCs fate. The approach uses a clinically compliant protocol with chemically defined media, feeder-free conditions, and a CD105 positive and CD24 negative selection to achieve a single cell-based MSCs derivation from differentiating human pluripotent cells in approximately 20 days. Cells generated with this protocol express typical MSCs surface markers and undergo adipogenesis, osteogenesis, and chondrogenesis similar to adult bone marrow-derived MSCs (BM-MSCs). Nonetheless, compared with adult BM-MSCs, iPSC-MSCs display a higher proliferative capacity, up to 120 passages, without obvious loss of self-renewal potential and constitutively express MSCs surface antigens. MSCs generated with this protocol have numerous applications, including expansion to large scale cell numbers for tissue engineering and the development of cellular therapeutics. This approach has been used to rescue limb ischemia, allergic disorders, and cigarette smoke-induced lung damage and to model mesenchymal and vascular disorders of Hutchinson-Gilford progeria syndrome (HGPS).

  17. Direct detection and quantification of transition metal ions in human atherosclerotic plaques

    DEFF Research Database (Denmark)

    Stadler, Nadina; Lindner, Robyn A; Davies, Michael Jonathan

    2004-01-01

    OBJECTIVE: The involvement of transition metals in atherosclerosis is controversial. Some epidemiological studies have reported a relationship between iron (Fe) and cardiovascular disease, whereas others have not. Experimental studies have reported elevated levels of iron and copper (Cu) in disea......OBJECTIVE: The involvement of transition metals in atherosclerosis is controversial. Some epidemiological studies have reported a relationship between iron (Fe) and cardiovascular disease, whereas others have not. Experimental studies have reported elevated levels of iron and copper (Cu......) in diseased human arteries but have often used methods that release metal ions from proteins. METHODS AND RESULTS: In this study, we have used the minimally invasive technique of electron paramagnetic resonance (EPR) spectroscopy and inductively coupled plasma mass spectroscopy (ICPMS) to quantify iron...... and copper in ex vivo healthy human arteries and carotid lesions. The EPR spectra detected are characteristic of nonheme Fe(III) complexes. Statistically elevated levels of iron were detected in the intima of lesions compared with healthy controls (0.370 versus 0.022 nmol/mg tissue for EPR, 0.525 versus 0...

  18. Amperometric magnetoimmunoassay for the direct detection of tumor necrosis factor alpha biomarker in human serum

    Energy Technology Data Exchange (ETDEWEB)

    Eletxigerra, U. [Micro-NanoFabrication Unit, IK4-Tekniker, Eibar (Spain); CIC microGUNE, Arrasate-Mondragón (Spain); Martinez-Perdiguero, J. [CIC microGUNE, Arrasate-Mondragón (Spain); Merino, S. [Micro-NanoFabrication Unit, IK4-Tekniker, Eibar (Spain); CIC microGUNE, Arrasate-Mondragón (Spain); Villalonga, R.; Pingarrón, J.M. [Departamento de Química Analítica, Facultad de CC. Químicas, Universidad Complutense de Madrid, Madrid (Spain); Campuzano, S., E-mail: susanacr@quim.ucm.es [Departamento de Química Analítica, Facultad de CC. Químicas, Universidad Complutense de Madrid, Madrid (Spain)

    2014-08-01

    Highlights: • Electrochemical magnetoimmunosensor for tumor necrosis factor alpha (TNFα) biomarker. • Sensitive and selective detection of TNFα in undiluted serum. • LOD achieved lower than the cut-off value established for relevant illnesses. • Useful and affordable alternative to ELISAs for TNFα determination in serum. - Abstract: An amperometric immunoassay for the determination of tumor necrosis factor alpha (TNFα) protein biomarker in human serum based on the use of magnetic microbeads (MBs) and disposable screen-printed carbon electrodes (SPCEs) has been developed. The specifically modified microbeads were magnetically captured on the working electrode surface and the amperometric responses were measured at −0.20 V (vs. Ag pseudo-reference electrode), upon addition of hydroquinone (HQ) as electron transfer mediator and H{sub 2}O{sub 2} as the enzyme substrate. After a thorough optimization of the assay, extremely low limits of detection were achieved: 2.0 pg mL{sup −1} (36 fM) and 5.8 pg mL{sup −1} (105 fM) for standard solutions and spiked human serum, respectively. The simplicity, robustness and this clinically interesting LOD proved the developed TNFα immunoassay as a good contender for real clinical application.

  19. Amperometric magnetoimmunoassay for the direct detection of tumor necrosis factor alpha biomarker in human serum

    International Nuclear Information System (INIS)

    Eletxigerra, U.; Martinez-Perdiguero, J.; Merino, S.; Villalonga, R.; Pingarrón, J.M.; Campuzano, S.

    2014-01-01

    Highlights: • Electrochemical magnetoimmunosensor for tumor necrosis factor alpha (TNFα) biomarker. • Sensitive and selective detection of TNFα in undiluted serum. • LOD achieved lower than the cut-off value established for relevant illnesses. • Useful and affordable alternative to ELISAs for TNFα determination in serum. - Abstract: An amperometric immunoassay for the determination of tumor necrosis factor alpha (TNFα) protein biomarker in human serum based on the use of magnetic microbeads (MBs) and disposable screen-printed carbon electrodes (SPCEs) has been developed. The specifically modified microbeads were magnetically captured on the working electrode surface and the amperometric responses were measured at −0.20 V (vs. Ag pseudo-reference electrode), upon addition of hydroquinone (HQ) as electron transfer mediator and H 2 O 2 as the enzyme substrate. After a thorough optimization of the assay, extremely low limits of detection were achieved: 2.0 pg mL −1 (36 fM) and 5.8 pg mL −1 (105 fM) for standard solutions and spiked human serum, respectively. The simplicity, robustness and this clinically interesting LOD proved the developed TNFα immunoassay as a good contender for real clinical application

  20. Direct noninvasive observation of near infrared photobleaching of autofluorescence in human volar side fingertips in vivo

    Science.gov (United States)

    Deng, Bin; Wright, Colin; Lewis-Clark, Eric; Shaheen, G.; Geier, Roman; Chaiken, J.

    2010-02-01

    Human transdermal in vivo spectroscopic applications for tissue analysis involving near infrared (NIR) light often must contend with broadband NIR fluorescence that, depending on what kind of spectroscopy is being employed, can degrade signal to noise ratios and dynamic range. Such NIR fluorescence, i.e. "autofluorescence" is well known to originate in blood tissues and various other endogenous materials associated with the static tissues. Results of recent experiments on human volar side fingertips in vivo are beginning to provide a relative ordering of the contributions from various sources. Preliminary results involving the variation in the bleaching effect across different individuals suggest that for 830 nm excitation well over half of the total fluorescence comes from the static tissues and remainder originates with the blood tissues, i.e. the plasma and the hematocrit. Of the NIR fluorescence associated with the static tissue, over half originates with products of well-known post-enzymatic glycation reactions, i.e. Maillard chemistry, in the skin involving glucose and other carbohydrates and skin proteins like collagen and cytosol proteins.

  1. Direct Detection of Protein Biomarkers in Human Fluids Using Site-Specific Antibody Immobilization Strategies

    Directory of Open Access Journals (Sweden)

    Maria Soler

    2014-01-01

    Full Text Available Design of an optimal surface biofunctionalization still remains an important challenge for the application of biosensors in clinical practice and therapeutic follow-up. Optical biosensors offer real-time monitoring and highly sensitive label-free analysis, along with great potential to be transferred to portable devices. When applied in direct immunoassays, their analytical features depend strongly on the antibody immobilization strategy. A strategy for correct immobilization of antibodies based on the use of ProLinker™ has been evaluated and optimized in terms of sensitivity, selectivity, stability and reproducibility. Special effort has been focused on avoiding antibody manipulation, preventing nonspecific adsorption and obtaining a robust biosurface with regeneration capabilities. ProLinker™-based approach has demonstrated to fulfill those crucial requirements and, in combination with PEG-derivative compounds, has shown encouraging results for direct detection in biological fluids, such as pure urine or diluted serum. Furthermore, we have implemented the ProLinker™ strategy to a novel nanoplasmonic-based biosensor resulting in promising advantages for its application in clinical and biomedical diagnosis.

  2. Direct detection of protein biomarkers in human fluids using site-specific antibody immobilization strategies.

    Science.gov (United States)

    Soler, Maria; Estevez, M-Carmen; Alvarez, Mar; Otte, Marinus A; Sepulveda, Borja; Lechuga, Laura M

    2014-01-29

    Design of an optimal surface biofunctionalization still remains an important challenge for the application of biosensors in clinical practice and therapeutic follow-up. Optical biosensors offer real-time monitoring and highly sensitive label-free analysis, along with great potential to be transferred to portable devices. When applied in direct immunoassays, their analytical features depend strongly on the antibody immobilization strategy. A strategy for correct immobilization of antibodies based on the use of ProLinker™ has been evaluated and optimized in terms of sensitivity, selectivity, stability and reproducibility. Special effort has been focused on avoiding antibody manipulation, preventing nonspecific adsorption and obtaining a robust biosurface with regeneration capabilities. ProLinker™-based approach has demonstrated to fulfill those crucial requirements and, in combination with PEG-derivative compounds, has shown encouraging results for direct detection in biological fluids, such as pure urine or diluted serum. Furthermore, we have implemented the ProLinker™ strategy to a novel nanoplasmonic-based biosensor resulting in promising advantages for its application in clinical and biomedical diagnosis.

  3. Mapping the timecourse of goal-directed attention to location and colour in human vision.

    Science.gov (United States)

    Adams, Rachel C; Chambers, Christopher D

    2012-03-01

    Goal-directed attention prioritises perception of task-relevant stimuli according to location, features, or onset time. In this study we compared the behavioural timecourse of goal-directed selection to locations and colours by varying the stimulus-onset asynchrony (SOA) between cue and target in a strategic cueing paradigm. Participants reported the presence or absence of a target following prior information regarding its location or colour. Results revealed that preparatory selection by colour is more effective at enhancing perceptual sensitivity than selection by location, even though both types of cue provided equivalent overall information. More detailed analysis revealed that this advantage arose due a limitation of spatial attention in maintaining a sufficiently broad focus (>2°) for target detection across multiple stimuli. In contrast, when target stimuli fell within 2° of the spatial attention spotlight, the strategic advantages and speed of spatial and colour attention were equated. Our findings are consistent with the conclusion that, under spatially optimal conditions, prior spatial and colour information are equally proficient at guiding top-down selection. When spatial locations are ambiguous, however, colour-based selection is the more efficient mechanism. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Rapid and efficient CRISPR/Cas9 gene inactivation in human neurons during human pluripotent stem cell differentiation and direct reprogramming.

    Science.gov (United States)

    Rubio, Alicia; Luoni, Mirko; Giannelli, Serena G; Radice, Isabella; Iannielli, Angelo; Cancellieri, Cinzia; Di Berardino, Claudia; Regalia, Giulia; Lazzari, Giovanna; Menegon, Andrea; Taverna, Stefano; Broccoli, Vania

    2016-11-18

    The CRISPR/Cas9 system is a rapid and customizable tool for gene editing in mammalian cells. In particular, this approach has widely opened new opportunities for genetic studies in neurological disease. Human neurons can be differentiated in vitro from hPSC (human Pluripotent Stem Cells), hNPCs (human Neural Precursor Cells) or even directly reprogrammed from fibroblasts. Here, we described a new platform which enables, rapid and efficient CRISPR/Cas9-mediated genome targeting simultaneously with three different paradigms for in vitro generation of neurons. This system was employed to inactivate two genes associated with neurological disorder (TSC2 and KCNQ2) and achieved up to 85% efficiency of gene targeting in the differentiated cells. In particular, we devised a protocol that, combining the expression of the CRISPR components with neurogenic factors, generated functional human neurons highly enriched for the desired genome modification in only 5 weeks. This new approach is easy, fast and that does not require the generation of stable isogenic clones, practice that is time consuming and for some genes not feasible.

  5. MicroRNA-320a suppresses human colon cancer cell proliferation by directly targeting {beta}-catenin

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Jian-Yong [State Key Laboratory of Cancer Biology, Department of Biochemistry and Molecular Biology, Fourth Military Medical University, 710032 Xi' an (China); State Key Laboratory of Cancer Biology, Xijing Hospital of Digestive Diseases, Fourth Military Medical University, 710032 Xi' an (China); Huang, Yi [Department of Anesthesiology, Xijing Hospital, Fourth Military Medical University, 710032 Xi' an (China); Li, Ji-Peng [State Key Laboratory of Cancer Biology, Xijing Hospital of Digestive Diseases, Fourth Military Medical University, 710032 Xi' an (China); Zhang, Xiang; Wang, Lei [State Key Laboratory of Cancer Biology, Department of Biochemistry and Molecular Biology, Fourth Military Medical University, 710032 Xi' an (China); Meng, Yan-Ling [Department of Immunology, Fourth Military Medical University, 710032 Xi' an (China); Yan, Bo [State Key Laboratory of Cancer Biology, Department of Biochemistry and Molecular Biology, Fourth Military Medical University, 710032 Xi' an (China); Bian, Yong-Qian [State Key Laboratory of Cancer Biology, Xijing Hospital of Digestive Diseases, Fourth Military Medical University, 710032 Xi' an (China); Zhao, Jing [State Key Laboratory of Cancer Biology, Department of Biochemistry and Molecular Biology, Fourth Military Medical University, 710032 Xi' an (China); Wang, Wei-Zhong, E-mail: weichang@fmmu.edu.cn [State Key Laboratory of Cancer Biology, Xijing Hospital of Digestive Diseases, Fourth Military Medical University, 710032 Xi' an (China); and others

    2012-04-20

    Highlights: Black-Right-Pointing-Pointer miR-320a is downregulated in human colorectal carcinoma. Black-Right-Pointing-Pointer Overexpression of miR-320a inhibits colon cancer cell proliferation. Black-Right-Pointing-Pointer {beta}-Catenin is a direct target of miR-320a in colon cancer cells. Black-Right-Pointing-Pointer miR-320a expression inversely correlates with mRNA expression of {beta}-catenin's target genes in human colon carcinoma. -- Abstract: Recent profile studies of microRNA (miRNA) expression have documented a deregulation of miRNA (miR-320a) in human colorectal carcinoma. However, its expression pattern and underlying mechanisms in the development and progression of colorectal carcinoma has not been elucidated clearly. Here, we performed real-time PCR to examine the expression levels of miR-320a in colon cancer cell lines and tumor tissues. And then, we investigated its biological functions in colon cancer cells by a gain of functional strategy. Further more, by the combinational approaches of bioinformatics and experimental validation, we confirmed target associations of miR-320a in colorectal carcinoma. Our results showed that miR-320a was frequently downregulated in cancer cell lines and colon cancer tissues. And we demonstrated that miR-320a restoration inhibited colon cancer cell proliferation and {beta}-catenin, a functionally oncogenic molecule was a direct target gene of miR-320a. Finally, the data of real-time PCR showed the reciprocal relationship between miR-320a and {beta}-catenin's downstream genes in colon cancer tissues. These findings indicate that miR-320a suppresses the growth of colon cancer cells by directly targeting {beta}-catenin, suggesting its application in prognosis prediction and cancer treatment.

  6. MicroRNA-320a suppresses human colon cancer cell proliferation by directly targeting β-catenin

    International Nuclear Information System (INIS)

    Sun, Jian-Yong; Huang, Yi; Li, Ji-Peng; Zhang, Xiang; Wang, Lei; Meng, Yan-Ling; Yan, Bo; Bian, Yong-Qian; Zhao, Jing; Wang, Wei-Zhong

    2012-01-01

    Highlights: ► miR-320a is downregulated in human colorectal carcinoma. ► Overexpression of miR-320a inhibits colon cancer cell proliferation. ► β-Catenin is a direct target of miR-320a in colon cancer cells. ► miR-320a expression inversely correlates with mRNA expression of β-catenin’s target genes in human colon carcinoma. -- Abstract: Recent profile studies of microRNA (miRNA) expression have documented a deregulation of miRNA (miR-320a) in human colorectal carcinoma. However, its expression pattern and underlying mechanisms in the development and progression of colorectal carcinoma has not been elucidated clearly. Here, we performed real-time PCR to examine the expression levels of miR-320a in colon cancer cell lines and tumor tissues. And then, we investigated its biological functions in colon cancer cells by a gain of functional strategy. Further more, by the combinational approaches of bioinformatics and experimental validation, we confirmed target associations of miR-320a in colorectal carcinoma. Our results showed that miR-320a was frequently downregulated in cancer cell lines and colon cancer tissues. And we demonstrated that miR-320a restoration inhibited colon cancer cell proliferation and β-catenin, a functionally oncogenic molecule was a direct target gene of miR-320a. Finally, the data of real-time PCR showed the reciprocal relationship between miR-320a and β-catenin’s downstream genes in colon cancer tissues. These findings indicate that miR-320a suppresses the growth of colon cancer cells by directly targeting β-catenin, suggesting its application in prognosis prediction and cancer treatment.

  7. Multipotent Basal Stem Cells, Maintained in Localized Proximal Niches, Support Directed Long-Ranging Epithelial Flows in Human Prostates

    Directory of Open Access Journals (Sweden)

    Mohammad Moad

    2017-08-01

    Full Text Available Sporadic mitochondrial DNA mutations serve as clonal marks providing access to the identity and lineage potential of stem cells within human tissues. By combining quantitative clonal mapping with 3D reconstruction of adult human prostates, we show that multipotent basal stem cells, confined to discrete niches in juxta-urethral ducts, generate bipotent basal progenitors in directed epithelial migration streams. Basal progenitors are then dispersed throughout the entire glandular network, dividing and differentiating to replenish the loss of apoptotic luminal cells. Rare lineage-restricted luminal stem cells, and their progeny, are confined to proximal ducts and provide only minor contribution to epithelial homeostasis. In situ cell capture from clonal maps identified delta homolog 1 (DLK1 enrichment of basal stem cells, which was validated in functional spheroid assays. This study establishes significant insights into niche organization and function of prostate stem and progenitor cells, with implications for disease.

  8. Direct and label-free detection of the human growth hormone in urine by an ultrasensitive bimodal waveguide biosensor.

    Science.gov (United States)

    González-Guerrero, Ana Belén; Maldonado, Jesús; Dante, Stefania; Grajales, Daniel; Lechuga, Laura M

    2017-01-01

    A label-free interferometric transducer showing a theoretical detection limit for homogeneous sensing of 5 × 10 -8 RIU, being equivalent to a protein mass coverage resolution of 2.8 fg mm -2 , is used to develop a high sensitive biosensor for protein detection. The extreme sensitivity of this transducer combined with a selective bioreceptor layer enables the direct evaluation of the human growth hormone (hGH) in undiluted urine matrix in the 10 pg mL -1 range. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Twenty Years of Creativity Research in Human-Computer Interaction: Current State and Future Directions

    DEFF Research Database (Denmark)

    Frich Pedersen, Jonas; Biskjaer, Michael Mose; Dalsgaard, Peter

    2018-01-01

    Creativity has been a growing topic within the ACM community since the 1990s. However, no clear overview of this trend has been offered. We present a thorough survey of 998 creativity-related publications in the ACM Digital Library collected using keyword search to determine prevailing approaches......, topics, and characteristics of creativity-oriented Human-Computer Interaction (HCI) research. . A selected sample based on yearly citations yielded 221 publications, which were analyzed using constant comparison analysis. We found that HCI is almost exclusively responsible for creativity......-oriented publications; they focus on collaborative creativity rather than individual creativity; there is a general lack of definition of the term ‘creativity’; empirically based contributions are prevalent; and many publications focus on new tools, often developed by researchers. On this basis, we present three...

  10. Qualitative ergonomics/human factors research in health care: Current state and future directions.

    Science.gov (United States)

    Valdez, Rupa Sheth; McGuire, Kerry Margaret; Rivera, A Joy

    2017-07-01

    The objective of this systematic review was to understand the current state of Ergonomics/Human Factors (E/HF) qualitative research in health care and to draw implications for future efforts. This systematic review identified 98 qualitative research papers published between January 2005 and August 2015 in the seven journals endorsed by the International Ergonomics Association with an impact factor over 1.0. The majority of the studies were conducted in hospitals and outpatient clinics, were focused on the work of formal health care professionals, and were classified as cognitive or organizational ergonomics. Interviews, focus groups, and observations were the most prevalent forms of data collection. Triangulation and data archiving were the dominant approaches to ensuring rigor. Few studies employed a formal approach to qualitative inquiry. Significant opportunities remain to enhance the use of qualitative research to advance systems thinking within health care. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Human exposure to trace elements through the skin by direct contact with clothing: Risk assessment

    Energy Technology Data Exchange (ETDEWEB)

    Rovira, Joaquim [Laboratory of Toxicology and Environmental Health, School of Medicine, IISPV, Universitat Rovira i Virgili, Sant Llorenç 21, 43201 Reus, Catalonia (Spain); Environmental Engineering Laboratory, Departament d' Enginyeria Quimica, Universitat Rovira i Virgili, Av. Països Catalans 26, 43007 Tarragona, Catalonia (Spain); Nadal, Martí [Laboratory of Toxicology and Environmental Health, School of Medicine, IISPV, Universitat Rovira i Virgili, Sant Llorenç 21, 43201 Reus, Catalonia (Spain); Schuhmacher, Marta [Laboratory of Toxicology and Environmental Health, School of Medicine, IISPV, Universitat Rovira i Virgili, Sant Llorenç 21, 43201 Reus, Catalonia (Spain); Environmental Engineering Laboratory, Departament d' Enginyeria Quimica, Universitat Rovira i Virgili, Av. Països Catalans 26, 43007 Tarragona, Catalonia (Spain); Domingo, José L., E-mail: joseluis.domingo@urv.cat [Laboratory of Toxicology and Environmental Health, School of Medicine, IISPV, Universitat Rovira i Virgili, Sant Llorenç 21, 43201 Reus, Catalonia (Spain)

    2015-07-15

    Metals in textile products and clothing are used for many purposes, such as metal complex dyes, pigments, mordant, catalyst in synthetic fabrics manufacture, synergists of flame retardants, antimicrobials, or as water repellents and odour-preventive agents. When present in textile materials, heavy metals may mean a potential danger to human health. In the present study, the concentrations of a number of elements (Al, As, B, Ba, Be, Bi, Cd, Co, Cr, Cu, Fe, Hg, Mg, Mn, Mo, Ni, Pb, Sb, Sc, Se, Sm, Sn, Sr, Tl, V, and Zn) were determined in skin-contact clothes. Analysed clothes were made of different materials, colours, and brands. Interestingly, we found high levels of Cr in polyamide dark clothes (605 mg/kg), high Sb concentrations in polyester clothes (141 mg/kg), and great Cu levels in some green cotton fabrics (around 280 mg/kg). Dermal contact exposure and human health risks for adult males, adult females, and for <1-year-old children were assessed. Non-carcinogenic and carcinogenic risks were below safe (HQ<1) and acceptable (<10{sup −6}) limits, respectively, according to international standards. However, for Sb, non-carcinogenic risk was above 10% of the safety limit (HQ>0.1) for dermal contact with clothes. - Highlights: • We determined in skin-contact clothes the concentrations of a number of metals. • Dermal contact exposure and health risks for adults and for 1-year-old children were assessed. • Carcinogenic risks were considered as acceptable (<10{sup −6}). • For non-carcinogenic risks, only Sb exceeded a 10% of the HQ for dermal contact with clothes.

  12. Human exposure to trace elements through the skin by direct contact with clothing: Risk assessment

    International Nuclear Information System (INIS)

    Rovira, Joaquim; Nadal, Martí; Schuhmacher, Marta; Domingo, José L.

    2015-01-01

    Metals in textile products and clothing are used for many purposes, such as metal complex dyes, pigments, mordant, catalyst in synthetic fabrics manufacture, synergists of flame retardants, antimicrobials, or as water repellents and odour-preventive agents. When present in textile materials, heavy metals may mean a potential danger to human health. In the present study, the concentrations of a number of elements (Al, As, B, Ba, Be, Bi, Cd, Co, Cr, Cu, Fe, Hg, Mg, Mn, Mo, Ni, Pb, Sb, Sc, Se, Sm, Sn, Sr, Tl, V, and Zn) were determined in skin-contact clothes. Analysed clothes were made of different materials, colours, and brands. Interestingly, we found high levels of Cr in polyamide dark clothes (605 mg/kg), high Sb concentrations in polyester clothes (141 mg/kg), and great Cu levels in some green cotton fabrics (around 280 mg/kg). Dermal contact exposure and human health risks for adult males, adult females, and for <1-year-old children were assessed. Non-carcinogenic and carcinogenic risks were below safe (HQ<1) and acceptable (<10 −6 ) limits, respectively, according to international standards. However, for Sb, non-carcinogenic risk was above 10% of the safety limit (HQ>0.1) for dermal contact with clothes. - Highlights: • We determined in skin-contact clothes the concentrations of a number of metals. • Dermal contact exposure and health risks for adults and for 1-year-old children were assessed. • Carcinogenic risks were considered as acceptable (<10 −6 ). • For non-carcinogenic risks, only Sb exceeded a 10% of the HQ for dermal contact with clothes

  13. Goal-directed fluid therapy: stroke volume optimisation and cardiac dimensions in supine healthy humans

    DEFF Research Database (Denmark)

    Jans, O.; Tollund, C.; Bundgaard-Nielsen, M.

    2008-01-01

    BACKGROUND: Based on maximisation of cardiac stroke volume (SV), peri-operative individualised goal-directed fluid therapy improves patient outcome. It remains, however, unknown how fluid therapy by this strategy relates to filling of the heart during supine rest as reference for the anaesthetised...... by thoracic electrical admittance, central venous oxygenation and pressure, and arterial plasma atrial natriuretic peptide. Also, muscle and brain oxygenation were assessed by near infrared spectroscopy (n=7). RESULTS: The HUT reduced the mentioned indices of CBV, the end-diastolic dimensions of the heart...... therapy is that when a maximal SV is established for patients, cardiac pre-load is comparable to that of supine healthy subjects Udgivelsesdato: 2008/4...

  14. A Direct Aqueous Derivatization GSMS Method for Determining Benzoylecgonine Concentrations in Human Urine.

    Science.gov (United States)

    Chericoni, Silvio; Stefanelli, Fabio; Da Valle, Ylenia; Giusiani, Mario

    2015-09-01

    A sensitive and reliable method for extraction and quantification of benzoylecgonine (BZE) and cocaine (COC) in urine is presented. Propyl-chloroformate was used as derivatizing agent, and it was directly added to the urine sample: the propyl derivative and COC were then recovered by liquid-liquid extraction procedure. Gas chromatography-mass spectrometry was used to detect the analytes in selected ion monitoring mode. The method proved to be precise for BZE and COC both in term of intraday and interday analysis, with a coefficient of variation (CV)0.999 and >0.997, respectively) within the range investigated. The method, applied to thirty authentic samples, showed to be very simple, fast, and reliable, so it can be easily applied in routine analysis for the quantification of BZE and COC in urine samples. © 2015 American Academy of Forensic Sciences.

  15. Pathogen reduction requirements for direct potable reuse in Antarctica: evaluating human health risks in small communities.

    Science.gov (United States)

    Barker, S Fiona; Packer, Michael; Scales, Peter J; Gray, Stephen; Snape, Ian; Hamilton, Andrew J

    2013-09-01

    Small, remote communities often have limited access to energy and water. Direct potable reuse of treated wastewater has recently gained attention as a potential solution for water-stressed regions, but requires further evaluation specific to small communities. The required pathogen reduction needed for safe implementation of direct potable reuse of treated sewage is an important consideration but these are typically quantified for larger communities and cities. A quantitative microbial risk assessment (QMRA) was conducted, using norovirus, giardia and Campylobacter as reference pathogens, to determine the level of treatment required to meet the tolerable annual disease burden of 10(-6) DALYs per person per year, using Davis Station in Antarctica as an example of a small remote community. Two scenarios were compared: published municipal sewage pathogen loads and estimated pathogen loads during a gastroenteritis outbreak. For the municipal sewage scenario, estimated required log10 reductions were 6.9, 8.0 and 7.4 for norovirus, giardia and Campylobacter respectively, while for the outbreak scenario the values were 12.1, 10.4 and 12.3 (95th percentiles). Pathogen concentrations are higher under outbreak conditions as a function of the relatively greater degree of contact between community members in a small population, compared with interactions in a large city, resulting in a higher proportion of the population being at risk of infection and illness. While the estimates of outbreak conditions may overestimate sewage concentration to some degree, the results suggest that additional treatment barriers would be required to achieve regulatory compliance for safe drinking water in small communities. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. A comparison and update of direct kinematic-kinetic models of leg stiffness in human running.

    Science.gov (United States)

    Liew, Bernard X W; Morris, Susan; Masters, Ashleigh; Netto, Kevin

    2017-11-07

    Direct kinematic-kinetic modelling currently represents the "Gold-standard" in leg stiffness quantification during three-dimensional (3D) motion capture experiments. However, the medial-lateral components of ground reaction force and leg length have been neglected in current leg stiffness formulations. It is unknown if accounting for all 3D would alter healthy biologic estimates of leg stiffness, compared to present direct modelling methods. This study compared running leg stiffness derived from a new method (multiplanar method) which includes all three Cartesian axes, against current methods which either only include the vertical axis (line method) or only the plane of progression (uniplanar method). Twenty healthy female runners performed shod overground running at 5.0 m/s. Three-dimensional motion capture and synchronised in-ground force plates were used to track the change in length of the leg vector (hip joint centre to centre of pressure) and resultant projected ground reaction force. Leg stiffness was expressed as dimensionless units, as a percentage of an individual's bodyweight divided by standing leg length (BW/LL). Leg stiffness using the line method was larger than the uniplanar method by 15.6%BW/LL (P method by 24.2%BW/LL (P stiffness from the uniplanar method was larger than the multiplanar method by 8.5%BW/LL (6.5 kN/m) (P stiffness estimate with the multiplanar method. Given that limb movements typically occur in 3D, the new multiplanar method provides the most complete accounting of all force and length components in leg stiffness calculation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. A recombinant dromedary antibody fragment (VHH or nanobody) directed against human Duffy antigen receptor for chemokines.

    Science.gov (United States)

    Smolarek, Dorota; Hattab, Claude; Hassanzadeh-Ghassabeh, Gholamreza; Cochet, Sylvie; Gutiérrez, Carlos; de Brevern, Alexandre G; Udomsangpetch, Rachanee; Picot, Julien; Grodecka, Magdalena; Wasniowska, Kazimiera; Muyldermans, Serge; Colin, Yves; Le Van Kim, Caroline; Czerwinski, Marcin; Bertrand, Olivier

    2010-10-01

    Fy blood group antigens are carried by the Duffy antigen receptor for chemokines (DARC), a red cells receptor for Plasmodium vivax broadly implicated in human health and diseases. Recombinant VHHs, or nanobodies, the smallest intact antigen binding fragment derivative from the heavy chain-only antibodies present in camelids, were prepared from a dromedary immunized against DARC N-terminal extracellular domain and selected for DARC binding. A described VHH, CA52, does recognize native DARC on cells. It inhibits P. vivax invasion of erythrocytes and displaces interleukin-8 bound to DARC. The targeted epitope overlaps the well-defined DARC Fy6 epitope. K (D) of CA52-DARC equilibrium is sub-nanomolar, hence ideal to develop diagnostic or therapeutic compounds. Immunocapture by immobilized CA52 yielded highly purified DARC from engineered K562 cells. This first report on a VHH with specificity for a red blood cell protein exemplifies VHHs' potentialities to target, to purify, and to modulate the function of cellular markers.

  18. Small-Molecule-Directed Hepatocyte-Like Cell Differentiation of Human Pluripotent Stem Cells.

    Science.gov (United States)

    Mathapati, Santosh; Siller, Richard; Impellizzeri, Agata A R; Lycke, Max; Vegheim, Karianne; Almaas, Runar; Sullivan, Gareth J

    2016-08-17

    Hepatocyte-like cells (HLCs) generated in vitro from human pluripotent stem cells (hPSCs) provide an invaluable resource for basic research, regenerative medicine, drug screening, toxicology, and modeling of liver disease and development. This unit describes a small-molecule-driven protocol for in vitro differentiation of hPSCs into HLCs without the use of growth factors. hPSCs are coaxed through a developmentally relevant route via the primitive streak to definitive endoderm (DE) using the small molecule CHIR99021 (a Wnt agonist), replacing the conventional growth factors Wnt3A and activin A. The small-molecule-derived DE is then differentiated to hepatoblast-like cells in the presence of dimethyl sulfoxide. The resulting hepatoblasts are then differentiated to HLCs with N-hexanoic-Tyr, Ile-6 aminohexanoic amide (Dihexa, a hepatocyte growth factor agonist) and dexamethasone. The protocol provides an efficient and reproducible procedure for differentiation of hPSCs into HLCs utilizing small molecules. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

  19. Genetic Modification of the Lung Directed Toward Treatment of Human Disease.

    Science.gov (United States)

    Sondhi, Dolan; Stiles, Katie M; De, Bishnu P; Crystal, Ronald G

    2017-01-01

    Genetic modification therapy is a promising therapeutic strategy for many diseases of the lung intractable to other treatments. Lung gene therapy has been the subject of numerous preclinical animal experiments and human clinical trials, for targets including genetic diseases such as cystic fibrosis and α1-antitrypsin deficiency, complex disorders such as asthma, allergy, and lung cancer, infections such as respiratory syncytial virus (RSV) and Pseudomonas, as well as pulmonary arterial hypertension, transplant rejection, and lung injury. A variety of viral and non-viral vectors have been employed to overcome the many physical barriers to gene transfer imposed by lung anatomy and natural defenses. Beyond the treatment of lung diseases, the lung has the potential to be used as a metabolic factory for generating proteins for delivery to the circulation for treatment of systemic diseases. Although much has been learned through a myriad of experiments about the development of genetic modification of the lung, more work is still needed to improve the delivery vehicles and to overcome challenges such as entry barriers, persistent expression, specific cell targeting, and circumventing host anti-vector responses.

  20. Direct measurements of relaxation times of phosphorus metabolites in the human myocardium

    International Nuclear Information System (INIS)

    Schindler, R.; Krahe, T.; Neubauer, S.; Hillenbrand, H.; Entzeroth, C.; Horn, M.; Lackner, K.; Ertl, G.

    1992-01-01

    The T 1 relaxation times of the phosphorus metabolites in human heart muscle measurable by 31 P-MR spectra were determined in 12 individuals using a 1.5 Tesla system. Several spectra were recorded consecutively with a pulse repetition time of 1.6s to 24 s. The T 1 times of creatine phosphate (CP), of γ-, α-, β-adenosintriphosphate (ATP), 2,3-diphosphoglycerate (2,3-DPG) together with anorganic phosphate) and phosphodiester (PDE) showed mean measurements of 6.1±0.5, 5.4±0.5, 5.0±0.5, 5.8±1.0, 7.6±1.0, and 5.0±1.0s (M±SE). The accuracy of the ISIS technique was tested with a special phantom. T 1 times were also measured in standard solutions (20mM CP, 10mM ATP); CP was 8.7±0.2s and γ-ATP was 9.9±0.7s. Corrections for partially saturated 31 P-MR spectra - at least for CP/ATP ratios - are relatively small. (orig.) [de

  1. The direct cytotoxic effects of medicaments used in endodontic regeneration on human dental pulp cells.

    Science.gov (United States)

    Labban, Nawaf; Yassen, Ghaeth H; Windsor, L Jack; Platt, Jeffrey A

    2014-12-01

    The purpose of this in vitro study was to evaluate the effects of intracanal medicaments commonly used in endodontic regeneration on the survival of human dental pulp cells (DPCs). DPCs were cultured and exposed to either no medicament treatment or low concentrations (0.3-5 mg ml(-1) ) of calcium hydroxide [Ca(OH)2 ], triple antibiotic paste (TAP), or double antibiotic paste (DAP) for 3 days. After that, toxicity to the DPCs was determined by lactate dehydrogenase activity assays (LDH) and cell proliferation was measured by colorimetric assays (WST-1). Two-way anova followed by Fisher's protected least significant differences was used for statistical analyses (α = 0.05). The group-by-concentration interactions were significant for the LDH and WST-1 assays (P medicaments tested in this study were not cytotoxic in cultured cells. However, these concentrations are much lower than the concentrations that have been advocated in endodontic regeneration. Furthermore, the negative effects of TAP on DPCs were detected at lower concentrations by using the WST-1 assays than by measuring the LDH release. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Direct estimation of human trabecular bone stiffness using cone beam computed tomography.

    Science.gov (United States)

    Klintström, Eva; Klintström, Benjamin; Pahr, Dieter; Brismar, Torkel B; Smedby, Örjan; Moreno, Rodrigo

    2018-04-10

    The aim of this study was to evaluate the possibility of estimating the biomechanical properties of trabecular bone through finite element simulations by using dental cone beam computed tomography data. Fourteen human radius specimens were scanned in 3 cone beam computed tomography devices: 3-D Accuitomo 80 (J. Morita MFG., Kyoto, Japan), NewTom 5 G (QR Verona, Verona, Italy), and Verity (Planmed, Helsinki, Finland). The imaging data were segmented by using 2 different methods. Stiffness (Young modulus), shear moduli, and the size and shape of the stiffness tensor were studied. Corresponding evaluations by using micro-CT were regarded as the reference standard. The 3-D Accuitomo 80 (J. Morita MFG., Kyoto, Japan) showed good performance in estimating stiffness and shear moduli but was sensitive to the choice of segmentation method. NewTom 5 G (QR Verona, Verona, Italy) and Verity (Planmed, Helsinki, Finland) yielded good correlations, but they were not as strong as Accuitomo 80 (J. Morita MFG., Kyoto, Japan). The cone beam computed tomography devices overestimated both stiffness and shear compared with the micro-CT estimations. Finite element-based calculations of biomechanics from cone beam computed tomography data are feasible, with strong correlations for the Accuitomo 80 scanner (J. Morita MFG., Kyoto, Japan) combined with an appropriate segmentation method. Such measurements might be useful for predicting implant survival by in vivo estimations of bone properties. Copyright © 2018 Elsevier Inc. All rights reserved.

  3. MicroRNA-198 inhibited tumorous behaviors of human osteosarcoma through directly targeting ROCK1

    International Nuclear Information System (INIS)

    Zhang, Shilian; Zhao, Yuehua; Wang, Lijie

    2016-01-01

    Osteosarcoma is an aggressive primary sarcoma of bone and occurs mainly in adolescents and young adults. The prognosis of OS remains poor, and most of them will die due to local relapse or metastases. The discovery of microRNAs provides a new possibility for the early diagnosis and treatment of OS. Thus, the aim of this study was to explore the expression and functions of microRNA-198 (miR-198) in osteosarcoma. The expression levels of miR-198 were determined by qRT-PCR in osteosarcoma tissues and cell lines. Cell proliferation assays, migration and invasion assays were adopted to investigate the effects of miR-198 on tumorous behaviors of osteosarcoma cells. The results showed that miR-198 expression levels were lower in osteosarcoma tissues and cell lines. In addition, low miR-198 expression levels were correlated with TNM stage and distant metastasis. After miR-198 mimics transfection, cell proliferation, migration and invasion were significantly suppressed in the osteosarcoma cells. Furthermore, ROCK1 was identified as a novel direct target of miR-198 in osteosarcoma. These findings suggested that miR-198 may act not only as a novel prognostic marker, but also as a potential target for molecular therapy of osteosarcoma.

  4. A modified direct insulin lodination for insulin radioreceptor assay in human erythrocytes

    Energy Technology Data Exchange (ETDEWEB)

    Elnabrawie, F S; Megahed, Y M; Fahim, F A; Ahmed, A M [Middle Eastern Regional radioisotope center for Arab Countries biochemistry dept. Faculty of science Ain Shams university, cairo, (Egypt)

    1995-10-01

    A substitution of iodine in to the inulin molecule will easily lead to a decreased hormonal activity. Nevertheless it cannot be concluded without further investigation that one or several of the tyrosyl groups are directly involve in the degree of iodination and the loss activity has been demonstrated by many workers, (Frenkel-Conrat 1950, and de Zoeten and van Strik, 1961). On the basis of the Frenkel-Conrat experiments, lee 1957 suggested that a mono-substitution of iodine in two tyrosyl groups is possible without loss of biological activity. In general, iodination is easy to perform as usually carried out at room temperature at PH of 7.5 in a phosphate buffer medium (Megahed et al., 1976, 1979). Reaction between antigen and antibody in radioimmunoassay (RIA), immunoradiometric assay (IRMA) and radioreceptor assay (RRA), is detected by radiation emitted from a radioisotope incorporated into the antigen or antibody molecule. Ideally the radiolabelled molecule has an immunoreactivity identical to the natural molecule and this behaves in the same way as in the assay procedure. Oxidation of 125 I-iodide gives rise to the 125 I-iodination which in a mildly alkaline PH (7.5) reacts with the phenolic benzene ring of tyrosine and tyrosyl residues by a process of electrophilic attack.

  5. MicroRNA-198 inhibited tumorous behaviors of human osteosarcoma through directly targeting ROCK1

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Shilian, E-mail: shilian_zhang@126.com; Zhao, Yuehua; Wang, Lijie

    2016-04-08

    Osteosarcoma is an aggressive primary sarcoma of bone and occurs mainly in adolescents and young adults. The prognosis of OS remains poor, and most of them will die due to local relapse or metastases. The discovery of microRNAs provides a new possibility for the early diagnosis and treatment of OS. Thus, the aim of this study was to explore the expression and functions of microRNA-198 (miR-198) in osteosarcoma. The expression levels of miR-198 were determined by qRT-PCR in osteosarcoma tissues and cell lines. Cell proliferation assays, migration and invasion assays were adopted to investigate the effects of miR-198 on tumorous behaviors of osteosarcoma cells. The results showed that miR-198 expression levels were lower in osteosarcoma tissues and cell lines. In addition, low miR-198 expression levels were correlated with TNM stage and distant metastasis. After miR-198 mimics transfection, cell proliferation, migration and invasion were significantly suppressed in the osteosarcoma cells. Furthermore, ROCK1 was identified as a novel direct target of miR-198 in osteosarcoma. These findings suggested that miR-198 may act not only as a novel prognostic marker, but also as a potential target for molecular therapy of osteosarcoma.

  6. Mapping face categorization in the human ventral occipitotemporal cortex with direct neural intracranial recordings.

    Science.gov (United States)

    Rossion, Bruno; Jacques, Corentin; Jonas, Jacques

    2018-02-26

    The neural basis of face categorization has been widely investigated with functional magnetic resonance imaging (fMRI), identifying a set of face-selective local regions in the ventral occipitotemporal cortex (VOTC). However, indirect recording of neural activity with fMRI is associated with large fluctuations of signal across regions, often underestimating face-selective responses in the anterior VOTC. While direct recording of neural activity with subdural grids of electrodes (electrocorticography, ECoG) or depth electrodes (stereotactic electroencephalography, SEEG) offers a unique opportunity to fill this gap in knowledge, these studies rather reveal widely distributed face-selective responses. Moreover, intracranial recordings are complicated by interindividual variability in neuroanatomy, ambiguity in definition, and quantification of responses of interest, as well as limited access to sulci with ECoG. Here, we propose to combine SEEG in large samples of individuals with fast periodic visual stimulation to objectively define, quantify, and characterize face categorization across the whole VOTC. This approach reconciles the wide distribution of neural face categorization responses with their (right) hemispheric and regional specialization, and reveals several face-selective regions in anterior VOTC sulci. We outline the challenges of this research program to understand the neural basis of face categorization and high-level visual recognition in general. © 2018 New York Academy of Sciences.

  7. A modified direct insulin lodination for insulin radioreceptor assay in human erythrocytes

    International Nuclear Information System (INIS)

    Elnabrawie, F.S.; Megahed, Y.M.; Fahim, F.A.; Ahmed, A.M.

    1995-01-01

    A substitution of iodine in to the inulin molecule will easily lead to a decreased hormonal activity. Nevertheless it cannot be concluded without further investigation that one or several of the tyrosyl groups are directly involve in the degree of iodination and the loss activity has been demonstrated by many workers, (Frenkel-Conrat 1950, and de Zoeten and van Strik, 1961). On the basis of the Frenkel-Conrat experiments, lee 1957 suggested that a mono-substitution of iodine in two tyrosyl groups is possible without loss of biological activity. In general, iodination is easy to perform as usually carried out at room temperature at PH of 7.5 in a phosphate buffer medium (Megahed et al., 1976, 1979). Reaction between antigen and antibody in radioimmunoassay (RIA), immunoradiometric assay (IRMA) and radioreceptor assay (RRA), is detected by radiation emitted from a radioisotope incorporated into the antigen or antibody molecule. Ideally the radiolabelled molecule has an immunoreactivity identical to the natural molecule and this behaves in the same way as in the assay procedure. Oxidation of 125 I-iodide gives rise to the 125 I-iodination which in a mildly alkaline PH (7.5) reacts with the phenolic benzene ring of tyrosine and tyrosyl residues by a process of electrophilic attack

  8. Direct Ex Vivo Analysis of Activated, Fas-sensitive Autoreactive T Cells in Human Autoimmune Disease

    Science.gov (United States)

    Bieganowska, Katarzyna D.; Ausubel, Lara J.; Modabber, Yalda; Slovik, Elissa; Messersmith, Wells; Hafler, David A.

    1997-01-01

    The frequency of clonally expanded and persistent T cells recognizing the immunodominant autoantigenic peptide of myelin basic protein (MBP)p85-99 was directly measured ex vivo in subjects with typical relapsing remitting multiple sclerosis (MS). T cells expressing mRNA transcripts encoding T cell receptor (TCR)-α and -β chains found in T cell clones previously isolated from these subjects recognizing the MBPp85-99 epitope were examined. In contrast to frequencies of 1 in 105–106 as measured by limiting dilution analysis, estimates of the T cell frequencies expressing MBPp85-99–associated TCR chain transcripts were as high as 1 in 300. These high frequencies were confirmed by performing PCR on single T cells isolated by flow cytometry. MBPp85-99 TCR transcripts were present in IL-2 receptor α–positive T cells which were induced to undergo Fas-mediated cell death upon antigen stimulation. These data demonstrate that at least a subpopulation of patients with MS can have a very high frequency of activated autoreactive T cells. PMID:9151896

  9. Effects of Transcranial Direct Current Stimulation (tDCS) on Human Memory.

    Energy Technology Data Exchange (ETDEWEB)

    Matzen, Laura E.; Trumbo, Michael Christopher Stefan

    2014-10-01

    Training a person in a new knowledge base or skill set is extremely time consuming and costly, particularly in highly specialized domains such as the military and the intelligence community. Recent research in cognitive neuroscience has suggested that a technique called transcranial direct current stimulation (tDCS) has the potential to revolutionize training by enabling learners to acquire new skills faster, more efficiently, and more robustly (Bullard et al., 2011). In this project, we tested the effects of tDCS on two types of memory performance that are critical for learning new skills: associative memory and working memory. Associative memory is memory for the relationship between two items or events. It forms the foundation of all episodic memories, so enhancing associative memory could provide substantial benefits to the speed and robustness of learning new information. We tested the effects of tDCS on associative memory, using a real-world associative memory task: remembering the links between faces and names. Working memory refers to the amount of information that can be held in mind and processed at one time, and it forms the basis for all higher-level cognitive processing. We investigated the degree of transfer between various working memory tasks (the N-back task as a measure of verbal working memory, the rotation-span task as a measure of visuospatial working memory, and Raven's progressive matrices as a measure of fluid intelligence) in order to determine if tDCS-induced facilitation of performance is task-specific or general.

  10. Direct measurement of first-pass ileal clearance of a bile acid in humans

    International Nuclear Information System (INIS)

    Galatola, G.; Jazrawi, R.P.; Bridges, C.; Joseph, A.E.; Northfield, T.C.

    1991-01-01

    The purpose of this study was to develop and validate a method of directly measuring ileal bile acid absorption efficiency during a single enterohepatic cycle (first-pass ileal clearance). This has become feasible for the first time because of the availability of the synthetic gamma-labeled bile acid 75Selena-homocholic acid-taurine (75SeHCAT). Together with the corresponding natural bile acid cholic acid-taurine (labeled with 14C), SeHCAT was infused distal to an occluding balloon situated beyond the ampulla of Vater in six healthy subjects. Completion of a single enterohepatic cycle was assessed by obtaining a plateau for 75SeHCAT activity proximal to the occluding balloon, which prevented further cycles. Unabsorbed 75SeHCAT was collected after total gut washout, which was administered distal to the occluding balloon. 75SeHCAT activity in the rectal effluent measured by gamma counter was compared with that of absorbed 75SeHCAT level measured by gamma camera and was used to calculate first-pass ileal clearance. This was very efficient (mean value, 96%) and showed very little variation in the six subjects studied (range, 95%-97%). A parallel time-activity course in hepatic bile for 14C and 75Se during a single enterohepatic cycle, together with a ratio of unity for 14C/75Se in samples obtained at different time intervals, suggests that 75SeHCAT is handled by the ileum like the natural bile acid cholic acid-taurine. Extrapolation of 75SeHCAT first-pass ileal clearance to that of the natural bile acid therefore seems justifiable. In a subsidiary experiment, ileal absorption efficiency per day for 75SeHCAT was also measured by scanning the gallbladder area on 5 successive days after the measurement of first-pass ileal clearance. In contrast with absorption efficiency per cycle, absorption efficiency per day varied widely (49%-86%)

  11. Decoding face information in time, frequency and space from direct intracranial recordings of the human brain.

    Directory of Open Access Journals (Sweden)

    Naotsugu Tsuchiya

    Full Text Available Faces are processed by a neural system with distributed anatomical components, but the roles of these components remain unclear. A dominant theory of face perception postulates independent representations of invariant aspects of faces (e.g., identity in ventral temporal cortex including the fusiform gyrus, and changeable aspects of faces (e.g., emotion in lateral temporal cortex including the superior temporal sulcus. Here we recorded neuronal activity directly from the cortical surface in 9 neurosurgical subjects undergoing epilepsy monitoring while they viewed static and dynamic facial expressions. Applying novel decoding analyses to the power spectrogram of electrocorticograms (ECoG from over 100 contacts in ventral and lateral temporal cortex, we found better representation of both invariant and changeable aspects of faces in ventral than lateral temporal cortex. Critical information for discriminating faces from geometric patterns was carried by power modulations between 50 to 150 Hz. For both static and dynamic face stimuli, we obtained a higher decoding performance in ventral than lateral temporal cortex. For discriminating fearful from happy expressions, critical information was carried by power modulation between 60-150 Hz and below 30 Hz, and again better decoded in ventral than lateral temporal cortex. Task-relevant attention improved decoding accuracy more than 10% across a wide frequency range in ventral but not at all in lateral temporal cortex. Spatial searchlight decoding showed that decoding performance was highest around the middle fusiform gyrus. Finally, we found that the right hemisphere, in general, showed superior decoding to the left hemisphere. Taken together, our results challenge the dominant model for independent face representation of invariant and changeable aspects: information about both face attributes was better decoded from a single region in the middle fusiform gyrus.

  12. First Human Experience with Directly Image-able Iodinated Embolization Microbeads

    Energy Technology Data Exchange (ETDEWEB)

    Levy, Elliot B., E-mail: levyeb@cc.nih.gov; Krishnasamy, Venkatesh P. [National Institutes of Health, Center for Interventional Oncology (United States); Lewis, Andrew L.; Willis, Sean; Macfarlane, Chelsea [Biocompatibles, UK Ltd, A BTG International Group Company (United Kingdom); Anderson, Victoria [National Institutes of Health, Center for Interventional Oncology (United States); Bom, Imramsjah MJ van der [Clinical Science IGT Systems North & Latin America, Philips, Philips, Image Guided Interventions (United States); Radaelli, Alessandro [Image-Guided Therapy Systems, Philips, Philips, Image Guided Interventions (Netherlands); Dreher, Matthew R. [Biocompatibles, UK Ltd, A BTG International Group Company (United Kingdom); Sharma, Karun V. [Children’s National Medical Center (United States); Negussie, Ayele; Mikhail, Andrew S. [National Institutes of Health, Center for Interventional Oncology (United States); Geschwind, Jean-Francois H. [Department of Radiology and Biomedical Imaging (United States); Wood, Bradford J. [National Institutes of Health, Center for Interventional Oncology (United States)

    2016-08-15

    PurposeTo describe first clinical experience with a directly image-able, inherently radio-opaque microspherical embolic agent for transarterial embolization of liver tumors.MethodologyLC Bead LUMI™ is a new product based upon sulfonate-modified polyvinyl alcohol hydrogel microbeads with covalently bound iodine (~260 mg I/ml). 70–150 μ LC Bead LUMI™ iodinated microbeads were injected selectively via a 2.8 Fr microcatheter to near complete flow stasis into hepatic arteries in three patients with hepatocellular carcinoma, carcinoid, or neuroendocrine tumor. A custom imaging platform tuned for LC LUMI™ microbead conspicuity using a cone beam CT (CBCT)/angiographic C-arm system (Allura Clarity FD20, Philips) was used along with CBCT embolization treatment planning software (EmboGuide, Philips).ResultsLC Bead LUMI™ image-able microbeads were easily delivered and monitored during the procedure using fluoroscopy, single-shot radiography (SSD), digital subtraction angiography (DSA), dual-phase enhanced and unenhanced CBCT, and unenhanced conventional CT obtained 48 h after the procedure. Intra-procedural imaging demonstrated tumor at risk for potential under-treatment, defined as paucity of image-able microbeads within a portion of the tumor which was confirmed at 48 h CT imaging. Fusion of pre- and post-embolization CBCT identified vessels without beads that corresponded to enhancing tumor tissue in the same location on follow-up imaging (48 h post).ConclusionLC Bead LUMI™ image-able microbeads provide real-time feedback and geographic localization of treatment in real time during treatment. The distribution and density of image-able beads within a tumor need further evaluation as an additional endpoint for embolization.

  13. The attribution of navigational- and goal-directed agency in dogs (Canis familiaris) and human toddlers (Homo sapiens).

    Science.gov (United States)

    Tauzin, Tibor; Csík, Andor; Lovas, Kata; Gergely, György; Topál, József

    2017-02-01

    Both human infants and nonhuman primates can recognize unfamiliar entities as instrumental agents ascribing to them goals and efficiency of goal-pursuit. This competence relies on movement cues indicating distal sensitivity to the environment and choice of efficient goal-approach. Although dogs' evolved sensitivity to social cues allow them to recognize humans as communicative agents, it remains unclear whether they have also evolved a basic concept of instrumental agency. We used a preferential object-choice procedure to test whether adult pet dogs and human toddlers can identify unfamiliar entities as agents based on different types of movement cues that specify different levels of agency. In the navigational agency condition, dogs preferentially chose an object that modified its pathway to avoid collision with obstacles over another object showing no evidence of distal sensitivity (regularly bumping into obstacles). However, in the goal-efficiency condition where neither object collided with obstacles as it navigated toward a distal target, but only 1 of them exhibited efficient goal-approach as well, toddlers, but not dogs, showed a preference toward the efficient goal-directed agent. These findings indicate that dogs possess a limited concept of environmentally sensitive navigational agency that they attribute to self-propelled entities capable of modifying their movement to avoid colliding with obstacles. Toddlers, in contrast, demonstrated clear sensitivity to cues of efficient variability of goal-approach as the basis for differentiating, attributing, and showing preference for goal-directed instrumental agency. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  14. Direct contact with endoderm-like cells efficiently induces cardiac progenitors from mouse and human pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Hideki Uosaki

    Full Text Available RATIONALE: Pluripotent stem cell-derived cardiac progenitor cells (CPCs have emerged as a powerful tool to study cardiogenesis in vitro and a potential cell source for cardiac regenerative medicine. However, available methods to induce CPCs are not efficient or require high-cost cytokines with extensive optimization due to cell line variations. OBJECTIVE: Based on our in-vivo observation that early endodermal cells maintain contact with nascent pre-cardiac mesoderm, we hypothesized that direct physical contact with endoderm promotes induction of CPCs from pluripotent cells. METHOD AND RESULT: To test the hypothesis, we cocultured mouse embryonic stem (ES cells with the endodermal cell line End2 by co-aggregation or End2-conditioned medium. Co-aggregation resulted in strong induction of Flk1(+ PDGFRa(+ CPCs in a dose-dependent manner, but the conditioned medium did not, indicating that direct contact is necessary for this process. To determine if direct contact with End2 cells also promotes the induction of committed cardiac progenitors, we utilized several mouse ES and induced pluripotent (iPS cell lines expressing fluorescent proteins under regulation of the CPC lineage markers Nkx2.5 or Isl1. In agreement with earlier data, co-aggregation with End2 cells potently induces both Nkx2.5(+ and Isl1(+ CPCs, leading to a sheet of beating cardiomyocytes. Furthermore, co-aggregation with End2 cells greatly promotes the induction of KDR(+ PDGFRa(+ CPCs from human ES cells. CONCLUSIONS: Our co-aggregation method provides an efficient, simple and cost-effective way to induce CPCs from mouse and human pluripotent cells.

  15. Molecular signatures of hemagglutinin stem-directed heterosubtypic human neutralizing antibodies against influenza A viruses.

    Directory of Open Access Journals (Sweden)

    Yuval Avnir

    2014-05-01

    Full Text Available Recent studies have shown high usage of the IGHV1-69 germline immunoglobulin gene for influenza hemagglutinin stem-directed broadly-neutralizing antibodies (HV1-69-sBnAbs. Here we show that a major structural solution for these HV1-69-sBnAbs is achieved through a critical triad comprising two CDR-H2 loop anchor residues (a hydrophobic residue at position 53 (Ile or Met and Phe54, and CDR-H3-Tyr at positions 98±1; together with distinctive V-segment CDR amino acid substitutions that occur in positions sparse in AID/polymerase-η recognition motifs. A semi-synthetic IGHV1-69 phage-display library screen designed to investigate AID/polη restrictions resulted in the isolation of HV1-69-sBnAbs that featured a distinctive Ile52Ser mutation in the CDR-H2 loop, a universal CDR-H3 Tyr at position 98 or 99, and required as little as two additional substitutions for heterosubtypic neutralizing activity. The functional importance of the Ile52Ser mutation was confirmed by mutagenesis and by BCR studies. Structural modeling suggests that substitution of a small amino acid at position 52 (or 52a facilitates the insertion of CDR-H2 Phe54 and CDR-H3-Tyr into adjacent pockets on the stem. These results support the concept that activation and expansion of a defined subset of IGHV1-69-encoded B cells to produce potent HV1-69-sBnAbs does not necessarily require a heavily diversified V-segment acquired through recycling/reentry into the germinal center; rather, the incorporation of distinctive amino acid substitutions by Phase 2 long-patch error-prone repair of AID-induced mutations or by random non-AID SHM events may be sufficient. We propose that these routes of B cell maturation should be further investigated and exploited as a pathway for HV1-69-sBnAb elicitation by vaccination.

  16. Nanoscale definition of substrate materials to direct human adult stem cells towards tissue specific populations.

    Science.gov (United States)

    Curran, Judith M; Chen, Rui; Stokes, Robert; Irvine, Eleanor; Graham, Duncan; Gubbins, Earl; Delaney, Deany; Amro, Nabil; Sanedrin, Raymond; Jamil, Haris; Hunt, John A

    2010-03-01

    The development of homogenously nano-patterned chemically modified surfaces that can be used to initiate a cellular response, particularly stem cell differentiation, in a highly controlled manner without the need for exogenous biological factors has never been reported, due to that fact that precisely defined and reproducible systems have not been available that can be used to study cell/material interactions and unlock the potential of a material driven cell response. Until now material driven stem cell (furthermore any cell) responses have been variable due to the limitations in definition and reproducibility of the underlying substrate and the lack of true homogeneity of modifications that can dictate a cellular response at a sub-micron level that can effectively control initial cell interactions of all cells that contact the surface. Here we report the successful design and use of homogenously molecularly nanopatterned surfaces to control initial stem cell adhesion and hence function. The highly specified nano-patterned arrays were compared directly to silane modified bulk coated substrates that have previously been proven to initiate mesenchymal stem cell (MSC) differentiation in a heterogenous manner, the aim of this study was to prove the efficiency of these previously observed cell responses could be enhanced by the incorporation of nano-patterns. Nano-patterned surfaces were prepared by Dip Pen Nanolithography (DPN) to produce arrays of 70 nm sized dots separated by defined spacings of 140, 280 and 1000 nm with terminal functionalities of carboxyl, amino, methyl and hydroxyl and used to control cell growth. These nanopatterned surfaces exhibited unprecedented control of initial cell interactions and will change the capabilities for stem cell definition in vitro and then cell based medical therapies. In addition to highlighting the ability of the materials to control stem cell functionality on an unprecedented scale this research also introduces the

  17. Direct Reprogramming of Adult Human Somatic Stem Cells Into Functional Neurons Using Sox2, Ascl1, and Neurog2

    Directory of Open Access Journals (Sweden)

    Jessica Alves de Medeiros Araújo

    2018-06-01

    Full Text Available Reprogramming of somatic cells into induced pluripotent stem cells (iPS or directly into cells from a different lineage, including neurons, has revolutionized research in regenerative medicine in recent years. Mesenchymal stem cells are good candidates for lineage reprogramming and autologous transplantation, since they can be easily isolated from accessible sources in adult humans, such as bone marrow and dental tissues. Here, we demonstrate that expression of the transcription factors (TFs SRY (sex determining region Y-box 2 (Sox2, Mammalian achaete-scute homolog 1 (Ascl1, or Neurogenin 2 (Neurog2 is sufficient for reprogramming human umbilical cord mesenchymal stem cells (hUCMSC into induced neurons (iNs. Furthermore, the combination of Sox2/Ascl1 or Sox2/Neurog2 is sufficient to reprogram up to 50% of transfected hUCMSCs into iNs showing electrical properties of mature neurons and establishing synaptic contacts with co-culture primary neurons. Finally, we show evidence supporting the notion that different combinations of TFs (Sox2/Ascl1 and Sox2/Neurog2 may induce multiple and overlapping neuronal phenotypes in lineage-reprogrammed iNs, suggesting that neuronal fate is determined by a combination of signals involving the TFs used for reprogramming but also the internal state of the converted cell. Altogether, the data presented here contribute to the advancement of techniques aiming at obtaining specific neuronal phenotypes from lineage-converted human somatic cells to treat neurological disorders.

  18. Perspective use of direct human blood as an energy source in air-breathing hybrid microfluidic fuel cells

    Science.gov (United States)

    Dector, A.; Escalona-Villalpando, R. A.; Dector, D.; Vallejo-Becerra, V.; Chávez-Ramírez, A. U.; Arriaga, L. G.; Ledesma-García, J.

    2015-08-01

    This work presents a flexible and light air-breathing hybrid microfluidic fuel cell (HμFC) operated under biological conditions. A mixture of glucose oxidase, glutaraldehyde, multi-walled carbon nanotubes and vulcan carbon (GOx/VC-MWCNT-GA) was used as the bioanode. Meanwhile, integrating an air-exposed electrode (Pt/C) as the cathode enabled direct oxygen delivery from air. The microfluidic fuel cell performance was evaluated using glucose obtained from three different sources as the fuel: 5 mM glucose in phosphate buffer, human serum and human blood. For the last fuel, an open circuit voltage and maximum power density of 0.52 V and 0.20 mW cm-2 (at 0.38 V) were obtained respectively; meanwhile the maximum current density was 1.1 mA cm-2. Furthermore, the stability of the device was measured in terms of recovery after several polarization curves, showing excellent results. Although this air-breathing HμFC requires technological improvements before being tested in a biomedical device, it represents the best performance to date for a microfluidic fuel cell using human blood as glucose source.

  19. Directly Converted Human Fibroblasts Mature to Neurons and Show Long-Term Survival in Adult Rodent Hippocampus

    Directory of Open Access Journals (Sweden)

    Natalia Avaliani

    2017-01-01

    Full Text Available Direct conversion of human somatic cells to induced neurons (iNs, using lineage-specific transcription factors has opened new opportunities for cell therapy in a number of neurological diseases, including epilepsy. In most severe cases of epilepsy, seizures often originate in the hippocampus, where populations of inhibitory interneurons degenerate. Thus, iNs could be of potential use to replace these lost interneurons. It is not known, however, if iNs survive and maintain functional neuronal properties for prolonged time periods in in vivo. We transplanted human fibroblast-derived iNs into the adult rat hippocampus and observed a progressive morphological differentiation, with more developed dendritic arborisation at six months as compared to one month. This was accompanied by mature electrophysiological properties and fast high amplitude action potentials at six months after transplantation. This proof-of-principle study suggests that human iNs can be developed as a candidate source for cell replacement therapy in temporal lobe epilepsy.

  20. Cytocompatibility and early inflammatory response of human endothelial cells in direct culture with Mg-Zn-Sr alloys

    Science.gov (United States)

    Cipriano, Aaron F.; Sallee, Amy; Tayoba, Myla; Cortez Alcaraz, Mayra C.; Lin, Alan; Guan, Ren-Guo; Zhao, Zhan-Yong; Liu, Huinan

    2018-01-01

    Crystalline Mg-Zinc (Zn)-Strontium (Sr) ternary alloys consist of elements naturally present in the human body and provide attractive mechanical and biodegradable properties for a variety of biomedical applications. The first objective of this study was to investigate the degradation and cytocompatibility of four Mg-4Zn-xSr alloys (x = 0.15, 0.5, 1.0, 1.5 wt%; designated as ZSr41A, B, C, and D respectively) in the direct culture with human umbilical vein endothelial cells (HUVEC) in vitro. The second objective was to investigate, for the first time, the early-stage inflammatory response in cultured HUVECs as indicated by the induction of vascular cellular adhesion molecule-1 (VCAM-1). The results showed that the 24-h in vitro degradation of the ZSr41 alloys containing a β-phase with a Zn/Sr at% ratio ~1.5 was significantly faster than the ZSr41 alloys with Zn/Sr at% ~1. Additionally, the adhesion density of HUVECs in the direct culture but not in direct contact with the ZSr41 alloys for up to 24 h was not adversely affected by the degradation of the alloys. Importantly, neither culture media supplemented with up to 27.6 mM Mg2+ ions nor media intentionally adjusted up to alkaline pH 9 induced any detectable adverse effects on HUVEC responses. In contrast, the significantly higher, yet non-cytotoxic, Zn2+ ion concentration from the degradation of ZSr41D alloy was likely the cause for the initially higher VCAM-1 expression on cultured HUVECs. Lastly, analysis of the HUVEC-ZSr41 interface showed near-complete absence of cell adhesion directly on the sample surface, most likely caused by either a high local alkalinity, change in surface topography, and/or surface composition. The direct culture method used in this study was proposed as a valuable tool for studying the design aspects of Zn-containing Mg-based biomaterials in vitro, in order to engineer solutions to address current shortcomings of Mg alloys for vascular device applications. PMID:27746360

  1. Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA.

    Science.gov (United States)

    Warren, Luigi; Manos, Philip D; Ahfeldt, Tim; Loh, Yuin-Han; Li, Hu; Lau, Frank; Ebina, Wataru; Mandal, Pankaj K; Smith, Zachary D; Meissner, Alexander; Daley, George Q; Brack, Andrew S; Collins, James J; Cowan, Chad; Schlaeger, Thorsten M; Rossi, Derrick J

    2010-11-05

    Clinical application of induced pluripotent stem cells (iPSCs) is limited by the low efficiency of iPSC derivation and the fact that most protocols modify the genome to effect cellular reprogramming. Moreover, safe and effective means of directing the fate of patient-specific iPSCs toward clinically useful cell types are lacking. Here we describe a simple, nonintegrating strategy for reprogramming cell fate based on administration of synthetic mRNA modified to overcome innate antiviral responses. We show that this approach can reprogram multiple human cell types to pluripotency with efficiencies that greatly surpass established protocols. We further show that the same technology can be used to efficiently direct the differentiation of RNA-induced pluripotent stem cells (RiPSCs) into terminally differentiated myogenic cells. This technology represents a safe, efficient strategy for somatic cell reprogramming and directing cell fate that has broad applicability for basic research, disease modeling, and regenerative medicine. Copyright © 2010 Elsevier Inc. All rights reserved.

  2. Direct labelling of the human P2X7 receptor and identification of positive and negative cooperativity of binding.

    Science.gov (United States)

    Michel, A D; Chambers, L J; Clay, W C; Condreay, J P; Walter, D S; Chessell, I P

    2007-05-01

    The P2X(7) receptor exhibits complex pharmacological properties. In this study, binding of a [(3)H]-labelled P2X(7) receptor antagonist to human P2X(7) receptors has been examined to further understand ligand interactions with this receptor. The P2X(7) receptor antagonist, N-[2-({2-[(2-hydroxyethyl)amino]ethyl}amino)-5-quinolinyl]-2-tricyclo[3.3.1.1(3,7)]dec-1-ylacetamide (compound-17), was radiolabelled with tritium and binding studies were performed using membranes prepared from U-2 OS or HEK293 cells expressing human recombinant P2X(7) receptors. Binding of [(3)H]-compound-17 was higher in membranes prepared from cells expressing P2X(7) receptors than from control cells and was inhibited by ATP suggesting labelled sites represented human P2X(7) receptors. Binding was reversible, saturable and modulated by P2X(7) receptor ligands (Brilliant Blue G, KN62, ATP, decavanadate). Furthermore, ATP potency was reduced in the presence of divalent cations or NaCl. Radioligand binding exhibited both positive and negative cooperativity. Positive cooperativity was evident from bell shaped Scatchard plots, reduction in radioligand dissociation rate by unlabelled compound-17 and enhancement of radioligand binding by KN62 and unlabelled compound-17. ATP and decavanadate inhibited binding in a negative cooperative manner as they enhanced radioligand dissociation. These data demonstrate that human P2X(7) receptors can be directly labelled and provide novel insights into receptor function. The positive cooperativity observed suggests that binding of compound-17 to one subunit in the P2X(7) receptor complex enhances subsequent binding to other P2X(7) subunits in the same complex. The negative cooperative effects of ATP suggest that ATP and compound-17 bind at separate, interacting, sites on the P2X(7) receptor.

  3. Hepatic glycogen in humans. I. Direct formation after oral and intravenous glucose or after a 24-h fast

    International Nuclear Information System (INIS)

    Radziuk, J.

    1989-01-01

    The formation of hepatic glycogen by the direct pathway is assessed in humans after a 12-h fast and oral loading (100 g) or intravenous infusion (90 g) and after a 24-h fast and the same oral glucose load. The methodology used is based on the double tracer method. [3- 3 H]glucose is infused at a constant rate for the determination of the metabolic clearance of glucose. [1- 14 C]glucose is administered with the glucose load. One hour after absorption or the intravenous glucose infusion is terminated, a glucagon infusion is initiated to mobilize the glycogen labeled with [1- 14 C]glucose and formed during the absorptive period. At this time a third tracer, [6- 3 H]glucose, is administered to measure glucose clearance. It was found that after the 12-h fast and oral glucose loading 7.2 +/- 1.1 g of hepatic glycogen appears to be formed directly from glucose compared with 8.4 +/- 1.0 g after the same load and a 24-h fast and 8.5 +/- 0.4 g after a 12-h fast and an equivalent intravenous glucose infusion. When the amount of label ([ 14 C]glucose) mobilized that was not corrected for metabolic recycling was calculated, the data suggested that the amount of glycogen formed by gluconeogenic pathways was probably at least equal to that formed by direct uptake. It was also approximately 60% greater after a 24-h fast. It can be concluded that the amount of hepatic glycogen formed directly from glucose during glucose loading is not significantly altered by the route of entry or the extension of the fasting period to 24 h. The data suggest, however, that gluconeogenetic formation of glycogen increases with fasting

  4. Quantification of Endogenous Cholesterol in Human Serum on Paper Using Direct Analysis in Real Time Mass Spectrometry.

    Science.gov (United States)

    Hsieh, Hua-Yi; Li, Li-Hua; Hsu, Ren-Yu; Kao, Wei-Fong; Huang, Ying-Chen; Hsu, Cheng-Chih

    2017-06-06

    Blood testing for endogenous small metabolites to determine physiological and biochemical states is routine for laboratory analysis. Here we demonstrate that by combining the commercial direct analysis in real time (DART) ion source with an ion trap mass spectrometer, native cholesterol in its free alcohol form is readily detected from a few hundred nanoliters of human serum loaded onto chromatography paper. Deuterium-labeled cholesterol was used as the internal standard to obtain the absolute quantity of the endogenous cholesterol. The amount of the cholesterol measured by this paper-loaded DART mass spectrometry (pDART-MS) is statistically comparable with that obtained by using commercially available fluorometric-enzymatic assay and liquid chromatography/mass spectrometry. Furthermore, sera from 21 participants at three different time points in an ultramarathon were collected to obtain their cholesterol levels. The test requires only very minimal sample preparation, and the concentrations of cholesterol in each sample were acquired within a minute.

  5. Replicative Intermediates of Human Papillomavirus Type 11 in Laryngeal Papillomas: Site of Replication Initiation and Direction of Replication

    Science.gov (United States)

    Auborn, K. J.; Little, R. D.; Platt, T. H. K.; Vaccariello, M. A.; Schildkraut, C. L.

    1994-07-01

    We have examined the structures of replication intermediates from the human papillomavirus type 11 genome in DNA extracted from papilloma lesions (laryngeal papillomas). The sites of replication initiation and termination utilized in vivo were mapped by using neutral/neutral and neutral/alkaline two-dimensional agarose gel electrophoresis methods. Initiation of replication was detected in or very close to the upstream regulatory region (URR; the noncoding, regulatory sequences upstream of the open reading frames in the papillomavirus genome). We also show that replication forks proceed bidirectionally from the origin and converge 180circ opposite the URR. These results demonstrate the feasibility of analysis of replication of viral genomes directly from infected tissue.

  6. Direct assessment of hepatic mitochondrial oxidative and anaplerotic fluxes in humans using dynamic 13C magnetic resonance spectroscopy

    DEFF Research Database (Denmark)

    Befroy, Douglas E; Perry, Rachel J; Jain, Nimit

    2014-01-01

    that rates of mitochondrial oxidation and anaplerosis in human liver can be directly determined noninvasively. Using this approach, we found the mean rates of hepatic tricarboxylic acid (TCA) cycle flux (VTCA) and anaplerotic flux (VANA) to be 0.43 ± 0.04 μmol g(-1) min(-1) and 0.60 ± 0.11 μmol g(-1) min(-1......), respectively, in twelve healthy, lean individuals. We also found the VANA/VTCA ratio to be 1.39 ± 0.22, which is severalfold lower than recently published estimates using an indirect approach. This method will be useful for understanding the pathogenesis of nonalcoholic fatty liver disease and type 2 diabetes...

  7. Direct astatination of a tumour-binding protein, human epidermal growth factor, using nido-carborane as a prosthetic group

    International Nuclear Information System (INIS)

    Sjoestroem, A.; Carlsson, J.; Lundqvist, H.; Koziorowski, J.

    2003-01-01

    A method for direct astatine labeling of proteins has been investigated. Binding sites for astatine were created by coupling of a nido-carborane derivative to a protein, the human epidermal growth factor (hEGF), using two different conjugation methods - by glutaraldehyde cross-linking or by introduction of sulfohydryl groups by Traut's reagent with subsequent linking of ANC-1 with m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester. The conjugates were astatinated using the Chloramine-T method in high yield. The best labeling was obtained by the glutaraldehyde conjugate with an average yield of 68 ± 9%. In vitro stability tests indicated that the glutaraldehyde conjugated label was as stable as hEGF labeled with astatobenzoate. (author)

  8. Direct quantification of creatinine in human urine by using isotope dilution extractive electrospray ionization tandem mass spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Li Xue [Institute of Environmental Pollution and Health, School of Environmental and Chemical Engineering, Shanghai University, Shanghai 200444 (China); Jiangxi Key Laboratory for Mass Spectrometry and Instrumentation, Applied Chemistry Department, East China Institute of Technology, Nanchang 330013 (China); Fang Xiaowei [Jiangxi Key Laboratory for Mass Spectrometry and Instrumentation, Applied Chemistry Department, East China Institute of Technology, Nanchang 330013 (China); Yu Zhiqiang; Sheng Guoying [Guangdong Key Laboratory of Environmental Protection and Resource Utilization, State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, Guangzhou 510640 (China); Wu Minghong [Shanghai Applied Radiation Institute, School of Environmental and Chemical Engineering, Shanghai University, Shanghai 200444 (China); Fu Jiamo [Institute of Environmental Pollution and Health, School of Environmental and Chemical Engineering, Shanghai University, Shanghai 200444 (China); Guangdong Key Laboratory of Environmental Protection and Resource Utilization, State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, Guangzhou 510640 (China); Chen Huanwen, E-mail: chw8868@gmail.com [Jiangxi Key Laboratory for Mass Spectrometry and Instrumentation, Applied Chemistry Department, East China Institute of Technology, Nanchang 330013 (China)

    2012-10-20

    Highlights: Black-Right-Pointing-Pointer High throughput analysis of urinary creatinine is achieved by using ID-EESI-MS/MS. Black-Right-Pointing-Pointer Urine sample is directly analyzed and no sample pre-treatment is required. Black-Right-Pointing-Pointer Accurate quantification is accomplished with isotope dilution technique. - Abstract: Urinary creatinine (CRE) is an important biomarker of renal function. Fast and accurate quantification of CRE in human urine is required by clinical research. By using isotope dilution extractive electrospray ionization tandem mass spectrometry (EESI-MS/MS) a high throughput method for direct and accurate quantification of urinary CRE was developed in this study. Under optimized conditions, the method detection limit was lower than 50 {mu}g L{sup -1}. Over the concentration range investigated (0.05-10 mg L{sup -1}), the calibration curve was obtained with satisfactory linearity (R{sup 2} = 0.9861), and the relative standard deviation (RSD) values for CRE and isotope-labeled CRE (CRE-d3) were 7.1-11.8% (n = 6) and 4.1-11.3% (n = 6), respectively. The isotope dilution EESI-MS/MS method was validated by analyzing six human urine samples, and the results were comparable with the conventional spectrophotometric method (based on the Jaffe reaction). Recoveries for individual urine samples were 85-111% and less than 0.3 min was taken for each measurement, indicating that the present isotope dilution EESI-MS/MS method is a promising strategy for the fast and accurate quantification of urinary CRE in clinical laboratories.

  9. Direct quantification of creatinine in human urine by using isotope dilution extractive electrospray ionization tandem mass spectrometry

    International Nuclear Information System (INIS)

    Li Xue; Fang Xiaowei; Yu Zhiqiang; Sheng Guoying; Wu Minghong; Fu Jiamo; Chen Huanwen

    2012-01-01

    Highlights: ► High throughput analysis of urinary creatinine is achieved by using ID-EESI–MS/MS. ► Urine sample is directly analyzed and no sample pre-treatment is required. ► Accurate quantification is accomplished with isotope dilution technique. - Abstract: Urinary creatinine (CRE) is an important biomarker of renal function. Fast and accurate quantification of CRE in human urine is required by clinical research. By using isotope dilution extractive electrospray ionization tandem mass spectrometry (EESI–MS/MS) a high throughput method for direct and accurate quantification of urinary CRE was developed in this study. Under optimized conditions, the method detection limit was lower than 50 μg L −1 . Over the concentration range investigated (0.05–10 mg L −1 ), the calibration curve was obtained with satisfactory linearity (R 2 = 0.9861), and the relative standard deviation (RSD) values for CRE and isotope-labeled CRE (CRE-d3) were 7.1–11.8% (n = 6) and 4.1–11.3% (n = 6), respectively. The isotope dilution EESI–MS/MS method was validated by analyzing six human urine samples, and the results were comparable with the conventional spectrophotometric method (based on the Jaffe reaction). Recoveries for individual urine samples were 85–111% and less than 0.3 min was taken for each measurement, indicating that the present isotope dilution EESI–MS/MS method is a promising strategy for the fast and accurate quantification of urinary CRE in clinical laboratories.

  10. Introducing graph theory to track for neuroplastic alterations in the resting human brain: a transcranial direct current stimulation study.

    Science.gov (United States)

    Polanía, Rafael; Paulus, Walter; Antal, Andrea; Nitsche, Michael A

    2011-02-01

    Transcranial direct current stimulation (tDCS) is a non-invasive brain stimulation technique that alters cortical excitability and activity in a polarity-dependent way. Stimulation for a few minutes has been shown to induce plastic alterations of cortical excitability and to improve cognitive performance. These effects might be related to stimulation-induced alterations of functional cortical network connectivity. We aimed to investigate the impact of tDCS on cortical network function by functional connectivity and graph theoretical analysis of the BOLD fMRI spontaneous activity. fMRI resting-state datasets were acquired immediately before and after 10-min bipolar tDCS during rest, with the anode placed over the left primary motor cortex (M1) and the cathode over the contralateral frontopolar cortex. For each dataset, grey matter voxel-based synchronization matrices were calculated and thresholded to construct undirected graphs. Nodal connectivity degree and minimum path length maps were calculated and compared before and after tDCS. Nodal minimum path lengths significantly increased in the left somatomotor (SM1) cortex after anodal tDCS, which means that the number of direct functional connections from the left SM1 to topologically distant grey matter voxels significantly decreased. In contrast, functional coupling between premotor and superior parietal areas with the left SM1 significantly increased. Additionally, the nodal connectivity degree in the left posterior cingulate cortex (PCC) area as well as in the right dorsolateral prefrontal cortex (right DLPFC) significantly increased. In summary, we provide initial support that tDCS-induced neuroplastic alterations might be related to functional connectivity changes in the human brain. Additionally, we propose our approach as a powerful method to track for neuroplastic changes in the human brain. Copyright © 2010 Elsevier Inc. All rights reserved.

  11. Direct trans-activation of the human cyclin D2 gene by the oncogene product Tax of human T-cell leukemia virus type I.

    Science.gov (United States)

    Huang, Y; Ohtani, K; Iwanaga, R; Matsumura, Y; Nakamura, M

    2001-03-01

    Cyclins are one of the pivotal determinants regulating cell cycle progression. We previously reported that the trans-activator Tax of human T-cell leukemia virus type I (HTLV-I) induces endogenous cyclin D2 expression along with cell cycle progression in a resting human T-cell line, Kit 225, suggesting a role of cyclin D2 in Tax-mediated cell cycle progression. The cyclin D2 gene has a typical E2F binding element, raising the possibility that induction of cyclin D2 expression is a consequence of cell cycle progression. In this study, we examined the role and molecular mechanism of induction of the endogenous human cyclin D2 gene by Tax. Introduction of p19(INK4d), a cyclin dependent kinase (CDK) inhibitor of the INK4 family specific for D-type CDK, inhibited Tax-mediated activation of E2F, indicating requirement of D-type CDK in Tax-mediated activation of E2F. Previously indicated E2F binding element and two NF-kappaB-like binding elements in the 1.6 kbp cyclin D2 promoter fragment had little, if any, effect on responsiveness to Tax. We found that trans-activation of the cyclin D2 promoter by Tax was mainly mediated by a newly identified NF-kappaB-like element with auxiliary contribution of a CRE-like element residing in sequences downstream of -444 which were by themselves sufficient for trans-activation by Tax. These results indicate that Tax directly trans-activates the cyclin D2 gene, resulting in growth promotion and perhaps leukemogenesis through activation of D-type CDK.

  12. Direct effect of plasma permeability factors from patients with idiopatic FSGS on nephrin and podocin expression in human podocytes.

    Science.gov (United States)

    Doublier, Sophie; Musante, Luca; Lupia, Enrico; Candiano, Giovanni; Spatola, Tiziana; Caridi, Gianluca; Zennaro, Cristina; Carraro, Michele; Ghiggeri, Gian Marco; Camussi, Giovanni

    2005-07-01

    The presence of circulating plasma factors (PF) altering renal permeability to proteins has been previously described in patients with focal segmental glomerulosclerosis (FSGS). Since these patients show reduced nephrin and podocin expression at renal biopsy, we evaluated the effect of serum and PF from patients with FSGS on nephrin and podocin expression in human podocytes. We studied 7 sera from patients with steroid-resistant FSGS, 3 from patients with nephrotic syndrome caused by non-immune disease, and 6 from healthy subjects. PF was prepared from plasmapheresis eluates of 2 patients with post-transplant recurrence of FSGS. Purification procedure was based on protein A Sepharose chromatography and differential precipitation in ammonium sulphate. Nephrin and podocin expression was semi-quantitatively evaluated by immunofluorescence. We found that serum and PF from FSGS patients rapidly induced redistribution and loss of nephrin in podocytes. This effect was associated with cytoskeleton redistribution and inhibited by cytochalasin B and sodium azide. On the contrary, podocin expression was unchanged after incubation with serum and PF from FSGS patients for short periods, but markedly reduced at 24 h. Our results demonstrate that serum and PF from FSGS patients may directly affect nephrin and podocin in human podocytes, thus providing new insights into the mechanisms causing proteinuria in FSGS.

  13. Direct-injection HPLC method of measuring micafungin in human plasma using a novel hydrophobic/hydrophilic hybrid ODS column.

    Science.gov (United States)

    Uranishi, Hiroaki; Nakamura, Mitsuhiro; Nakamura, Hiroki; Ikeda, Yukari; Otsuka, Mayuko; Kato, Zenichiro; Tsuchiya, Teruo

    2011-04-15

    A direct-injection HPLC-based method has been developed for determining amounts of micafungin in human plasma using a novel hydrophobic/hydrophilic hybrid ODS column. The method is easy to perform and requires only 10 μL of a filtered plasma sample. The chromatographic separations were carried out with a gradient mode. The fluorescence detection wavelengths of excitation and emission were set at 273 nm and 464 nm, respectively. Retention times for micafungin and IS were 22.4 and 23.7 min, respectively. Micafungin and FR195743 (IS) peaks were completely separated with little tailing, and no interference was observed. The calibration curve of micafungin showed good linearity in the range of 0.5-20.0 μg/mL (r(2)=1.00). The intra-day accuracy ranged from -4.5 to 5.3%. The inter-day accuracy ranged from -9.8 to 1.5%. The precisions were less than 10%. This method is useful for the determination of micafungin in human plasma. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. Gene expression profiling identifies HOXB4 as a direct downstream target of GATA-2 in human CD34+ hematopoietic cells.

    Directory of Open Access Journals (Sweden)

    Tohru Fujiwara

    Full Text Available Aplastic anemia is characterized by a reduced hematopoietic stem cell number. Although GATA-2 expression was reported to be decreased in CD34-positive cells in aplastic anemia, many questions remain regarding the intrinsic characteristics of hematopoietic stem cells in this disease. In this study, we identified HOXB4 as a downstream target of GATA-2 based on expression profiling with human cord blood-derived CD34-positive cells infected with control or GATA-2 lentiviral shRNA. To confirm the functional link between GATA-2 and HOXB4, we conducted GATA-2 gain-of-function and loss-of-function experiments, and HOXB4 promoter analysis, including luciferase assay, in vitro DNA binding analysis and quantitative ChIP analysis, using K562 and CD34-positive cells. The analyses suggested that GATA-2 directly regulates HOXB4 expression through the GATA sequence in the promoter region. Furthermore, we assessed GATA-2 and HOXB4 expression in CD34-positive cells from patients with aplastic anemia (n = 10 and idiopathic thrombocytopenic purpura (n = 13, and demonstrated that the expression levels of HOXB4 and GATA-2 were correlated in these populations (r = 0.6573, p<0.01. Our results suggested that GATA-2 directly regulates HOXB4 expression in hematopoietic stem cells, which may play an important role in the development and/or progression of aplastic anemia.

  15. Ultrasound-guided direct delivery of 3-bromopyruvate blocks tumor progression in an orthotopic mouse model of human pancreatic cancer.

    Science.gov (United States)

    Ota, Shinichi; Geschwind, Jean-Francois H; Buijs, Manon; Wijlemans, Joost W; Kwak, Byung Kook; Ganapathy-Kanniappan, Shanmugasundaram

    2013-06-01

    Studies in animal models of cancer have demonstrated that targeting tumor metabolism can be an effective anticancer strategy. Previously, we showed that inhibition of glucose metabolism by the pyruvate analog, 3-bromopyruvate (3-BrPA), induces anticancer effects both in vitro and in vivo. We have also documented that intratumoral delivery of 3-BrPA affects tumor growth in a subcutaneous tumor model of human liver cancer. However, the efficacy of such an approach in a clinically relevant orthotopic tumor model has not been reported. Here, we investigated the feasibility of ultrasound (US) image-guided delivery of 3-BrPA in an orthotopic mouse model of human pancreatic cancer and evaluated its therapeutic efficacy. In vitro, treatment of Panc-1 cells with 3-BrPA resulted in a dose-dependent decrease in cell viability. The loss of viability correlated with a dose-dependent decrease in the intracellular ATP level and lactate production confirming that disruption of energy metabolism underlies these 3-BrPA-mediated effects. In vivo, US-guided delivery of 3-BrPA was feasible and effective as demonstrated by a marked decrease in tumor size on imaging. Further, the antitumor effect was confirmed by (1) a decrease in the proliferative potential by Ki-67 immunohistochemical staining and (2) the induction of apoptosis by terminal deoxynucleotidyl transferase-mediated deoxyuridine 5-triphospate nick end labeling staining. We therefore demonstrate the technical feasibility of US-guided intratumoral injection of 3-BrPA in a mouse model of human pancreatic cancer as well as its therapeutic efficacy. Our data suggest that this new therapeutic approach consisting of a direct intratumoral injection of antiglycolytic agents may represent an exciting opportunity to treat patients with pancreas cancer.

  16. Direct interaction between caffeic acid phenethyl ester and human neutrophil elastase inhibits the growth and migration of PANC-1 cells.

    Science.gov (United States)

    Duan, Jianhui; Xiaokaiti, Yilixiati; Fan, Shengjun; Pan, Yan; Li, Xin; Li, Xuejun

    2017-05-01

    Pancreatic ductal adenocarcinoma (PDAC) is one of the most lethal malignant tumors of the digestive system, but the mechanisms of its development and progression are unclear. Inflammation is thought to be fundamental to pancreatic cancer development and caffeic acid phenethyl ester (CAPE) is an active component of honey bee resin or propolis with anti-inflammatory and anticancer activities. We investigated the inhibitory effects of CAPE on cell growth and migration induced by human neutrophil elastase (HNE) and report that HNE induced cancer cell migration at low doses and growth at higher doses. In contrast, lower CAPE doses inhibited migration and higher doses of CAPE inhibited the growth induced by HNE. HNE activity was significantly inhibited by CAPE (7.5-120 µM). Using quantitative real-time PCR and western blotting, we observed that CAPE (18-60 µM) did not affect transcription and translation of α1-antitrypsin (α1-AT), an endogenous HNE inhibitor. However, in an in silico drug target docking model, we found that CAPE directly bound to the binding pocket of HNE (25.66 kcal/mol) according to CDOCKER, and the residue of the catalytic site stabilized the interaction between CAPE and HNE as evidenced by molecular dynamic simulation. Response unit (RU) values of surface plasmon resonance (SPR) significantly increased with incremental CAPE doses (7.5-120 µM), indicating that CAPE could directly bind to HNE in a concentration-dependent manner. Thus, CAPE is an effective inhibitor of HNE via direct interaction whereby it inhibits the migration and growth of PANC-1 cells in a dose-dependent manner.

  17. Matching the optical properties of direct esthetic dental restorative materials to those of human enamel and dentin

    Science.gov (United States)

    Ragain, James Carlton, Jr.

    One of the goals of the restorative dentist is to restore the appearance of the natural dentition. Clinical matching of teeth and restorative materials are seldom accurate and shade selection techniques are subjective. The first specific aim of this research was to characterize the optical absorption and scattering that occurs within enamel, dentin, and composite resin and compomer restorative materials and to relate those phenomena to translucency and color. The second aim was to evaluate small color differences among composite restorative materials which would be detectable by humans. The last aim was to lay the foundation for developing an improved model of specifying layers of dental restorative materials in order to match the translucency and color to those of human enamel. The Kubelka-Munk theory was validated for enamel, dentin, and the restorative materials. These tissues and materials were then characterized in terms of their color parameters. Tooth cores were also characterized in terms of color space parameters. Human subjects were evaluated for their abilities to discriminate small color differences in the dental composite resin materials. The following conclusions were derived from this study: (1) Kubelka-Munk theory accurately predicts the diffuse reflectance spectra of enamel, dentin, and the direct esthetic dental restorative materials studied. (2) Scattering and absorption coefficients of the dental tissues and esthetic restorative materials can be directly calculated from diffuse reflectance measurements of a uniformly thick slab of tissue/material using black and white backings and the appropriate refractive index. (3) For tooth cores, there is a positive correlation between L* and b* and a negative correlation between L* and a*. (4) The range of translucency parameters for the restorative materials studied does not match those of enamel and dentin. (5) None of the shades of the dental composite resin restorative materials studied fit into the

  18. Restricted access carbon nanotubes for direct extraction of cadmium from human serum samples followed by atomic absorption spectrometry analysis.

    Science.gov (United States)

    Barbosa, Adriano F; Barbosa, Valéria M P; Bettini, Jefferson; Luccas, Pedro O; Figueiredo, Eduardo C

    2015-01-01

    In this paper, we propose a new sorbent that is able to extract metal ions directly from untreated biological fluids, simultaneously excluding all proteins from these samples. The sorbent was obtained through the modification of carbon nanotubes (CNTs) with an external bovine serum albumin (BSA) layer, resulting in restricted access carbon nanotubes (RACNTs). The BSA layer was fixed through the interconnection between the amine groups of the BSA using glutaraldehyde as cross-linker. When a protein sample is percolated through a cartridge containing RACNTs and the sample pH is higher than the isoelectric point of the proteins, both proteins from the sample and the BSA layer are negatively ionized. Thus, an electrostatic repulsion prevents the interaction between the proteins from the sample on the RACNTs surface. At the same time, metal ions are adsorbed in the CNTs (core) after their passage through the chains of proteins. The Cd(2+) ion was selected for a proof-of-principle case to test the suitability of the RACNTs due to its toxicological relevance. RACNTs were able to extract Cd(2+) and exclude almost 100% of the proteins from the human serum samples in an online solid-phase extraction system coupled with thermospray flame furnace atomic absorption spectrometry. The limits of detection and quantification were 0.24 and 0.80 μg L(-1), respectively. The sampling frequency was 8.6h(-1), and the intra- and inter-day precisions at the 0.80, 15.0, and 30.0 μg L(-1) Cd(2+) levels were all lower than 10.1% (RSD). The recoveries obtained for human blood serum samples fortified with Cd(2+) ranged from 85.0% to 112.0%. The method was successfully applied to analyze Cd(2+) directly from six human blood serum samples without any pretreatment, and the observed concentrations ranged from

  19. Direct in vivo characterization of delta 5 desaturase activity in humans by deuterium labeling: Effect of insulin

    International Nuclear Information System (INIS)

    el Boustani, S.; Causse, J.E.; Descomps, B.; Monnier, L.; Mendy, F.; Crastes de Paulet, A.

    1989-01-01

    The conversion of dihomogamma linolenic acid (DHLA) into arachidonic acid (AA) was compared in normal subjects and diabetic patients before and after treatment with insulin. The kinetics of the incorporation of deuterium-labeled DHLA and its conversion product, deuterium-labeled AA, was determined in plasma triglycerides, plasma phospholipids, and platelet lipids of subjects after ingestion of 2 g of the labeled precursor. Analysis was performed by gas liquid chromatography-mass spectrometry using multiple ion detection. In normal subjects, the deuterium-labeled DHLA concentration rose to 24 to 69 mg/L in plasma triglycerides four to nine hours after ingestion and to 20 to 34 mg/L in plasma phospholipids about four hours later. Deuterium-labeled AA appeared at 12 hours, rose to 2.4 to 3.8 mg/L between 48 and 72 hours in plasma phospholipids, but remained at the limit of detection in plasma triglycerides and was undetectable in platelet lipids. In diabetic patients both before and after insulin treatment, the deuterium-labeled DHLA concentration in plasma triglycerides and in plasma phospholipids followed the same pattern as in normal subjects. However, the deuterium-labeled arachidonic acid concentration was below 1 mg/L in plasma phospholipids before insulin. After insulin treatment the patients recovered normal DHLA metabolism because deuterium-labeled AA rose in phospholipids to a mean value of 3.5 mg/L, which is in the same range as that observed in normal subjects (3.2 mg/L). The present data provide direct evidence for the conversion of DHLA into AA in humans. The effect of insulin and the data from the literature of animal studies suggest insulin dependence of delta 5 desaturase in humans

  20. Evidence of transcranial direct current stimulation-generated electric fields at subthalamic level in human brain in vivo.

    Science.gov (United States)

    Chhatbar, Pratik Y; Kautz, Steven A; Takacs, Istvan; Rowland, Nathan C; Revuelta, Gonzalo J; George, Mark S; Bikson, Marom; Feng, Wuwei

    2018-03-13

    Transcranial direct current stimulation (tDCS) is a promising brain modulation technique for several disease conditions. With this technique, some portion of the current penetrates through the scalp to the cortex and modulates cortical excitability, but a recent human cadaver study questions the amount. This insufficient intracerebral penetration of currents may partially explain the inconsistent and mixed results in tDCS studies to date. Experimental validation of a transcranial alternating current stimulation-generated electric field (EF) in vivo has been performed on the cortical (using electrocorticography, ECoG, electrodes), subcortical (using stereo electroencephalography, SEEG, electrodes) and deeper thalamic/subthalamic levels (using DBS electrodes). However, tDCS-generated EF measurements have never been attempted. We aimed to demonstrate that tDCS generates biologically relevant EF as deep as the subthalamic level in vivo. Patients with movement disorders who have implanted deep brain stimulation (DBS) electrodes serve as a natural experimental model for thalamic/subthalamic recordings of tDCS-generated EF. We measured voltage changes from DBS electrodes and body resistance from tDCS electrodes in three subjects while applying direct current to the scalp at 2 mA and 4 mA over two tDCS montages. Voltage changes at the level of deep nuclei changed proportionally with the level of applied current and varied with different tDCS montages. Our findings suggest that scalp-applied tDCS generates biologically relevant EF. Incorporation of these experimental results may improve finite element analysis (FEA)-based models. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. Direct determination of lead in human urine and serum samples by electrothermal atomic absorption spectrometry and permanent modifiers

    International Nuclear Information System (INIS)

    Andrada, Daniel; Pinto, Frederico G.; Magalhaes, Cristina Goncalves; Nunes, Berta R.; Silva, Jose Bento Borba da; Franco, Milton B.

    2006-01-01

    The object of the present study was the development of alternative methods for the direct determination of lead in undigested samples of human urine and serum by electrothermal atomic absorption spectrometry (ETAAS). Thus, some substances have been investigated to act as chemical modifiers. Volumes of 20 μL of diluted samples, 1 + 1, v/v for urine and 1 + 4, v/v for serum, with HNO 3 1% v/v and 0.02% v/v of cetyl trimethyl ammonium chloride (CTAC) were prepared directly in the autosampler cups and placed into the graphite furnace. For modifiers in solutions 10 μL were used. Pyrolysis and atomization temperature curves were used in all optimizations in the matrixes diluted as exposed. For urine with permanent iridium (500 μg), the best pyrolysis and atomization temperatures were 900 and 1600 deg C, respectively, with a characteristic mass of 12 pg (recommended of 10 pg), with symmetrical absorption pulses and corrected background. Spiked urine samples presented recoveries between 86 and 112% for Ir permanent. The analysis results of certified urine samples are in agreement with certified values (95% of confidence) for two levels of the metal. For serum, good results were obtained with the mixture of Zr+Rh or Ir+Rh as permanent modifiers, with characteristic masses of 9.8 and 8.1 pg, respectively. Recoveries from spiked serum samples varied between 98.6 and 100.1% (Ir+Rh) and between 93.9 and 105.2% (Zr+Rh). In both recovery studies, the relative standard deviation (n=3) was lower than 7%. Calibration for both samples were made with aqueous calibration curves and presented r 2 higher than 0.99. The limits of detection were 0.7 μg L -1 for serum samples, with Zr+Rh permanent, and 1.0 μg L -1 for urine with iridium permanent. (author)

  2. Effect of increasing diffusion gradient direction number on diffusion tensor imaging fiber tracking in the human brain

    International Nuclear Information System (INIS)

    Yao, Xu Fang; Liang, Bie Bei; Xia, Tian; Huang, Qin Ming; Zhuang, Song Lin; Yu, Tong Gang

    2015-01-01

    To assess the effects of varying the number of diffusion gradient directions (NDGDs) on diffusion tensor fiber tracking (FT) in human brain white matter using tract characteristics. Twelve normal volunteers underwent diffusion tensor imaging (DTI) scanning with NDGDs of 6, 11, 15, 21, and 31 orientations. Three fiber tract groups, including the splenium of the corpus callosum (CC), the entire CC, and the full brain tract, were reconstructed by deterministic DTI-FT. Tract architecture was first qualitatively evaluated by visual observation. Six quantitative tract characteristics, including the number of fibers (NF), average length (AL), fractional anisotropy (FA), relative anisotropy (RA), mean diffusivity (MD), and volume ratio (VR) were measured for the splenium of the CC at the tract branch level, for the entire CC at tract level, and for the full brain tract at the whole brain level. Visual results and those of NF, AL, FA, RA, MD, and VR were compared among the five different NDGDs. The DTI-FT with NDGD of 11, 15, 21, and 31 orientations gave better tracking results compared with NDGD of 6 after the visual evaluation. NF, FA, RA, MD, and VR values with NDGD of six were significantly greater (smallest p = 0.001 to largest p = 0.042) than those with four other NDGDs (11, 15, 21, or 31 orientations), whereas AL measured with NDGD of six was significantly smaller (smallest p = 0.001 to largest p = 0.041) than with four other NDGDs (11, 15, 21, or 31 orientations). No significant differences were observed in the results among the four NDGD groups of 11, 15, 21, and 31 directions (smallest p = 0.059 to largest p = 1.000). The main fiber tracts were detected with NDGD of six orientations; however, the use of larger NDGD (> or = 11 orientations) could provide improved tract characteristics at the expense of longer scanning time.

  3. Effect of increasing diffusion gradient direction number on diffusion tensor imaging fiber tracking in the human brain

    Energy Technology Data Exchange (ETDEWEB)

    Yao, Xu Fang; Liang, Bie Bei; Xia, Tian; Huang, Qin Ming; Zhuang, Song Lin [School of Optical-Electrical and Computer Engineering, Shanghai Medical Instrument College, University of Shanghai for Science and Technology, Shanghai (China); Yu, Tong Gang [Dept. of Radiology, Huashan Hospital, Fudan University, Shanghai (China)

    2015-04-15

    To assess the effects of varying the number of diffusion gradient directions (NDGDs) on diffusion tensor fiber tracking (FT) in human brain white matter using tract characteristics. Twelve normal volunteers underwent diffusion tensor imaging (DTI) scanning with NDGDs of 6, 11, 15, 21, and 31 orientations. Three fiber tract groups, including the splenium of the corpus callosum (CC), the entire CC, and the full brain tract, were reconstructed by deterministic DTI-FT. Tract architecture was first qualitatively evaluated by visual observation. Six quantitative tract characteristics, including the number of fibers (NF), average length (AL), fractional anisotropy (FA), relative anisotropy (RA), mean diffusivity (MD), and volume ratio (VR) were measured for the splenium of the CC at the tract branch level, for the entire CC at tract level, and for the full brain tract at the whole brain level. Visual results and those of NF, AL, FA, RA, MD, and VR were compared among the five different NDGDs. The DTI-FT with NDGD of 11, 15, 21, and 31 orientations gave better tracking results compared with NDGD of 6 after the visual evaluation. NF, FA, RA, MD, and VR values with NDGD of six were significantly greater (smallest p = 0.001 to largest p = 0.042) than those with four other NDGDs (11, 15, 21, or 31 orientations), whereas AL measured with NDGD of six was significantly smaller (smallest p = 0.001 to largest p = 0.041) than with four other NDGDs (11, 15, 21, or 31 orientations). No significant differences were observed in the results among the four NDGD groups of 11, 15, 21, and 31 directions (smallest p = 0.059 to largest p = 1.000). The main fiber tracts were detected with NDGD of six orientations; however, the use of larger NDGD (> or = 11 orientations) could provide improved tract characteristics at the expense of longer scanning time.

  4. Direct fluorescence in situ hybridization on human metaphase chromosomes using quantum dot-platinum labeled DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Gyoyeon [Chemical Kinomics Research Center, Future Convergence Research Division, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon (Korea, Republic of); Lee, Hansol [Chemical Kinomics Research Center, Future Convergence Research Division, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Lee, Jiyeon, E-mail: jylee@kist.re.kr [Chemical Kinomics Research Center, Future Convergence Research Division, Korea Institute of Science and Technology, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 136-791 (Korea, Republic of); Biological Chemistry, Korea University of Science and Technology, 217, Gajeong-ro, Yuseong-gu, Deajeon (Korea, Republic of)

    2015-11-13

    The telomere shortening in chromosomes implies the senescence, apoptosis, or oncogenic transformation of cells. Since detecting telomeres in aging and diseases like cancer, is important, the direct detection of telomeres has been a very useful biomarker. We propose a telomere detection method using a newly synthesized quantum dot (QD) based probe with oligonucleotide conjugation and direct fluorescence in situ hybridization (FISH). QD-oligonucleotides were prepared with metal coordination bonding based on platinum-guanine binding reported in our previous work. The QD-oligonucleotide conjugation method has an advantage where any sequence containing guanine at the end can be easily bound to the starting QD-Pt conjugate. A synthesized telomeric oligonucleotide was bound to the QD-Pt conjugate successfully and this probe hybridized specifically on the telomere of fabricated MV-4-11 and MOLT-4 chromosomes. Additionally, the QD-telomeric oligonucleotide probe successfully detected the telomeres on the CGH metaphase slide. Due to the excellent photostability and high quantum yield of QDs, the QD-oligonucleotide probe has high fluorescence intensity when compared to the organic dye-oligonucleotide probe. Our QD-oligonucleotide probe, conjugation method of this QD probe, and hybridization protocol with the chromosomes can be a useful tool for chromosome painting and FISH. - Highlights: • We prepared a probe linked between QD and telomeric oligonucleotide with platinum-guanine bonding. • Telomeres were detected by our new telomere probes successfully in three different human metaphase chromosomes. • QDPt-DNA probe has high fluorescence intensity in comparison with organic dye-DNA probe.

  5. Direct determination of lead in human urine and serum samples by electrothermal atomic absorption spectrometry and permanent modifiers

    Directory of Open Access Journals (Sweden)

    Andrada Daniel

    2006-01-01

    Full Text Available The object of the present study was the development of alternative methods for the direct determination of lead in undigested samples of human urine and serum by electrothermal atomic absorption spectrometry (ET AAS. Thus, some substances have been investigated to act as chemical modifiers. Volumes of 20 µL of diluted samples, 1 + 1, v/v for urine and 1 + 4, v/v for serum, with HNO3 1% v/v and 0.02% v/v of cetil trimethyl ammonium chloride (CTAC were prepared directly in the autosampler cups and placed into the graphite furnace. For modifiers in solutions 10 µL were used. Pyrolysis and atomization temperature curves were used in all optimizations in the matrixes diluted as exposed. For urine with permanent iridium (500 µg, the best pyrolysis and atomization temperatures were 900 and 1600 ºC, respectively, with a characteristic mass of 12 pg (recommended of 10 pg, with symmetrical absorption pulses and corrected background. Spiked urine samples presented recoveries between 86 and 112% for Ir permanent. The analysis results of certified urine samples are in agreement with certified values (95% of confidence for two levels of the metal. For serum, good results were obtained with the mixture of Zr+Rh or Ir+Rh as permanent modifiers, with characteristic masses of 9.8 and 8.1 pg, respectively. Recoveries from spiked serum samples varied between 98.6 and 100.1% (Ir+Rh and between 93.9 and 105.2% (Zr+Rh. In both recovery studies, the relative standard deviation (n=3 was lower than 7%. Calibration for both samples were made with aqueous calibration curves and presented r² higher than 0.99. The limits of detection were 0.7 µg L-1 for serum samples, with Zr+Rh permanent, and 1.0 µg L-1 for urine with iridium permanent.

  6. Vitrification of human pronuclear oocytes by direct plunging into cooling agent: Non sterile liquid nitrogen vs. sterile liquid air.

    Science.gov (United States)

    Isachenko, Vladimir; Todorov, Plamen; Seisenbayeva, Akerke; Toishibekov, Yerzhan; Isachenko, Evgenia; Rahimi, Gohar; Mallmann, Peter; Foth, Dolores; Merzenich, Markus

    2018-02-01

    In fact, a full sterilization of commercially-produced liquid nitrogen contaminated with different pathogens is not possible. The aim of this study was to compare the viability of human pronuclear oocytes subjected to cooling by direct submerging of open carrier in liquid nitrogen versus submerging in clean liquid air (aseptic system). One- and three-pronuclei stage embryos (n = 444) were cryopreserved by direct plunging into liquid nitrogen (vitrified) in ethylene glycol (15%), dimethylsulphoxide (15%) and 0.2M sucrose. Oocytes were exposed in 20, 33, 50 and 100% vitrification solution for 2, 1 and 1 min, and 30-50 s, respectively at room temperature. Then first part of oocytes (n = 225) were directly plunged into liquid nitrogen, and second part of oocytes (n = 219) into liquid air. Oocytes were thawed rapidly at a speed of 20,000 °C/min and then subsequently were placed into a graded series of sucrose solutions (0.5, 0.25, 0.12 and 0.06M) at 2.5 min intervals and cultured in vitro for 3 days. In both groups, the rate of high-quality embryos (Grade 6A: 6 blastomeres, no fragmentation; Grade 8A: 8 blastomeres, no fragmentation; Grade 8A compacting: 8 blastomeres, beginning of compacting) was noted. The rates of high-quality embryos developed from one-pronuclear oocytes vitrified by cooling in liquid nitrogen and liquid air were: 39.4% ± 0.6 and 38.7% ± 0.8, respectively (P > 0.1). These rates for three-pronuclear oocytes were: 45.8 ± 0.8% and 52.0 ± 0.7%, respectively (P liquid air (aseptic system) is a good alternative for using of not sterile liquid nitrogen. Copyright © 2017. Published by Elsevier Inc.

  7. MicroRNAs let-7b/i suppress human glioma cell invasion and migration by targeting IKBKE directly

    International Nuclear Information System (INIS)

    Tian, Yuan; Hao, Shaobo; Ye, Minhua; Zhang, Anling; Nan, Yang; Wang, Guangxiu; Jia, Zhifan; Yu, Kai; Guo, Lianmei; Pu, Peiyu; Huang, Qiang; Zhong, Yue

    2015-01-01

    We demonstrated that IKBKE is overexpressed in human gliomas and that the downregulation of IKBKE markedly inhibits the proliferative and invasive abilities of glioma cells, which is consistent with the results reported by several different research groups. Therefore, IKBKE represents a promising therapeutic target for the treatment of glioma. In the present study, we verified that the microRNAs let-7b and let-7i target IKBKE through luciferase assays and found that let-7b/i mimics can knock down IKBKE and upregulate E-cadherin through western blot analysis. Moreover, the expression levels of let-7b/i were significantly lower in glioma cell lines than that in normal brain tissues, as determined by quantitative real-time PCR. Furthermore, let-7b/i inhibit the invasion and migration of glioma cells, as determined through wound healing and Transwell assays. The above-mentioned data suggest that let-7b/i inhibit the invasive ability of glioma cells by directly downregulating IKBKE and indirectly upregulating E-cadherin. - Highlights: • Let-7b and let-7i are downregulated in glioma cell lines. • IKBKE is a target gene of let-7b/i. • Let-7b/i inhibit the invasion and migration of glioma cells. • Let-7b/i upregulate E-cadherin by downregulating IKBKE

  8. Direct quantitative comparison of molecular responses in photodamaged human skin to fractionated and fully ablative carbon dioxide laser resurfacing.

    Science.gov (United States)

    Orringer, Jeffrey S; Sachs, Dana L; Shao, Yuan; Hammerberg, Craig; Cui, Yilei; Voorhees, John J; Fisher, Gary J

    2012-10-01

    Fractionated ablative laser resurfacing has become a widely used treatment modality. Its clinical results are often found to approach those of traditional fully ablative laser resurfacing. To directly compare the molecular changes that result from fractionated and fully ablative carbon dioxide (CO(2)) laser resurfacing in photodamaged human skin. Photodamaged skin of 34 adult volunteers was focally treated at distinct sites with a fully ablative CO(2) laser and a fractionated CO(2) laser. Serial skin samples were obtained at baseline and several time points after treatment. Real-time reverse transcriptase polymerase chain reaction technology and immunohistochemistry were used to quantify molecular responses to each type of laser treatment. Fully ablative and fractionated CO(2) laser resurfacing induced significant dermal remodeling and collagen induction. After a single treatment, fractionated ablative laser resurfacing resulted in collagen induction that was approximately 40% to 50% as pronounced as that induced by fully ablative laser resurfacing. The fundamental cutaneous responses that result from fully ablative and fractionated carbon dioxide laser resurfacing are similar but differ in magnitude and duration, with the fully ablative procedure inducing relatively greater changes including more pronounced collagen induction. However, the molecular data reported here provide substantial support for fractionated ablative resurfacing as an effective treatment modality for improving skin texture. © 2012 by the American Society for Dermatologic Surgery, Inc. Published by Wiley Periodicals, Inc.

  9. Effects of direct-to-consumer advertising and clinical guidelines on appropriate use of human papillomavirus DNA tests.

    Science.gov (United States)

    Price, Rebecca Anhang; Frank, Richard G; Cleary, Paul D; Goldie, Sue J

    2011-02-01

    Both clinical guidelines and direct-to-consumer (DTC) advertising influence the use of new health care technologies, but little is known about their relative effects. The introduction of a cervical cancer screening test in 2000 offered a unique opportunity to assess the 2 strategies. To evaluate the effects of clinical guidelines and a targeted DTC advertising campaign on overall and appropriate use of human papillomavirus (HPV) DNA tests. Quasi-experimental study using difference-in-differences analysis. Data were MarketScan private insurance claims for 500,000 women aged 21 to 64 enrolled at least 12 consecutive months from January 2001 through December 2005. Both clinical guidelines and DTC advertising were associated with increases in overall HPV DNA test use. DTC advertising was associated with a statistically significant increase in HPV DNA test use in 2 groups of DTC cities (+5.57%, P advertising was associated with comparable increases in the probability of appropriate and inappropriate use of the HPV DNA test in primary screening. Clinical guideline releases from the American College of Obstetricians and Gynecologists, and by a cosponsored panel, were associated with greater increases in HPV DNA tests for appropriate primary screening than for inappropriate primary screening (β = 0.3347, P advertising was associated with increased overall use of a cervical cancer screening test, whereas clinical guidelines were differentially associated with increased appropriate use. These findings suggest distinct influences of consumer marketing and professional guidelines on the use of health care products and services.

  10. Direct binding of retromer to human papillomavirus type 16 minor capsid protein L2 mediates endosome exit during viral infection.

    Directory of Open Access Journals (Sweden)

    Andreea Popa

    2015-02-01

    Full Text Available Trafficking of human papillomaviruses to the Golgi apparatus during virus entry requires retromer, an endosomal coat protein complex that mediates the vesicular transport of cellular transmembrane proteins from the endosome to the Golgi apparatus or the plasma membrane. Here we show that the HPV16 L2 minor capsid protein is a retromer cargo, even though L2 is not a transmembrane protein. We show that direct binding of retromer to a conserved sequence in the carboxy-terminus of L2 is required for exit of L2 from the early endosome and delivery to the trans-Golgi network during virus entry. This binding site is different from known retromer binding motifs and can be replaced by a sorting signal from a cellular retromer cargo. Thus, HPV16 is an unconventional particulate retromer cargo, and retromer binding initiates retrograde transport of viral components from the endosome to the trans-Golgi network during virus entry. We propose that the carboxy-terminal segment of L2 protein protrudes through the endosomal membrane and is accessed by retromer in the cytoplasm.

  11. Direct visualization of anatomic subfields within the superior aspect of the human lateral thalamus by MRI at 7T.

    Science.gov (United States)

    Kanowski, M; Voges, J; Buentjen, L; Stadler, J; Heinze, H-J; Tempelmann, C

    2014-09-01

    The morphology of the human thalamus shows high interindividual variability. Therefore, direct visualization of landmarks within the thalamus is essential for an improved definition of electrode positions for deep brain stimulation. The aim of this study was to provide anatomic detail in the thalamus by using inversion recovery TSE imaging at 7T. The MR imaging protocol was optimized on 1 healthy subject to segment thalamic nuclei from one another. Final images, acquired with 0.5(2)-mm2 in-plane resolution and 3-mm section thickness, were compared with stereotactic brain atlases to assign visualized details to known anatomy. The robustness of the visualization of thalamic nuclei was assessed with 4 healthy subjects at lower image resolution. Thalamic subfields were successfully delineated in the dorsal aspect of the lateral thalamus. T1-weighting was essential. MR images had an appearance very similar to that of myelin-stained sections seen in brain atlases. Visualized intrathalamic structures were, among others, the lamella medialis, the external medullary lamina, the reticulatum thalami, the nucleus centre médian, the boundary between the nuclei dorso-oralis internus and externus, and the boundary between the nuclei dorso-oralis internus and zentrolateralis intermedius internus. Inversion recovery-prepared TSE imaging at 7T has a high potential to reveal fine anatomic detail in the thalamus, which may be helpful in enhancing the planning of stereotactic neurosurgery in the future. © 2014 by American Journal of Neuroradiology.

  12. MicroRNAs let-7b/i suppress human glioma cell invasion and migration by targeting IKBKE directly

    Energy Technology Data Exchange (ETDEWEB)

    Tian, Yuan; Hao, Shaobo [Department of Neurosurgery, Tianjin Medical University General Hospital, Tianjin 300052 (China); Laboratory of Neuro-Oncology, Tianjin Neurological Institute, Tianjin 300052 (China); Key Laboratory of Neurotrauma, Variation and Regeneration, Ministry of Education and Tianjin Municipal Government (China); Ye, Minhua [Department of Neurosurgery, Second Affiliated Hospital of Nanchang University, Nanchang, Jiangxi Province 330006 (China); Zhang, Anling [Laboratory of Neuro-Oncology, Tianjin Neurological Institute, Tianjin 300052 (China); Key Laboratory of Neurotrauma, Variation and Regeneration, Ministry of Education and Tianjin Municipal Government (China); Nan, Yang [Department of Neurosurgery, Tianjin Medical University General Hospital, Tianjin 300052 (China); Wang, Guangxiu; Jia, Zhifan [Laboratory of Neuro-Oncology, Tianjin Neurological Institute, Tianjin 300052 (China); Key Laboratory of Neurotrauma, Variation and Regeneration, Ministry of Education and Tianjin Municipal Government (China); Yu, Kai; Guo, Lianmei [Department of Neurosurgery, Tianjin Medical University General Hospital, Tianjin 300052 (China); Pu, Peiyu [Laboratory of Neuro-Oncology, Tianjin Neurological Institute, Tianjin 300052 (China); Key Laboratory of Neurotrauma, Variation and Regeneration, Ministry of Education and Tianjin Municipal Government (China); Huang, Qiang, E-mail: huangqiang209@163.com [Department of Neurosurgery, Tianjin Medical University General Hospital, Tianjin 300052 (China); Zhong, Yue, E-mail: zhongyue2457@sina.com [Department of Neurosurgery, Tianjin Medical University General Hospital, Tianjin 300052 (China)

    2015-03-06

    We demonstrated that IKBKE is overexpressed in human gliomas and that the downregulation of IKBKE markedly inhibits the proliferative and invasive abilities of glioma cells, which is consistent with the results reported by several different research groups. Therefore, IKBKE represents a promising therapeutic target for the treatment of glioma. In the present study, we verified that the microRNAs let-7b and let-7i target IKBKE through luciferase assays and found that let-7b/i mimics can knock down IKBKE and upregulate E-cadherin through western blot analysis. Moreover, the expression levels of let-7b/i were significantly lower in glioma cell lines than that in normal brain tissues, as determined by quantitative real-time PCR. Furthermore, let-7b/i inhibit the invasion and migration of glioma cells, as determined through wound healing and Transwell assays. The above-mentioned data suggest that let-7b/i inhibit the invasive ability of glioma cells by directly downregulating IKBKE and indirectly upregulating E-cadherin. - Highlights: • Let-7b and let-7i are downregulated in glioma cell lines. • IKBKE is a target gene of let-7b/i. • Let-7b/i inhibit the invasion and migration of glioma cells. • Let-7b/i upregulate E-cadherin by downregulating IKBKE.

  13. Direct Conversion of Human Fibroblasts into Schwann Cells that Facilitate Regeneration of Injured Peripheral Nerve In Vivo.

    Science.gov (United States)

    Sowa, Yoshihiro; Kishida, Tsunao; Tomita, Koichi; Yamamoto, Kenta; Numajiri, Toshiaki; Mazda, Osam

    2017-04-01

    Schwann cells (SCs) play pivotal roles in the maintenance and regeneration of the peripheral nervous system. Although transplantation of SCs enhances repair of experimentally damaged peripheral and central nerve tissues, it is difficult to prepare a sufficient number of functional SCs for transplantation therapy without causing adverse events for the donor. Here, we generated functional SCs by somatic cell reprogramming procedures and demonstrated their capability to promote peripheral nerve regeneration. Normal human fibroblasts were phenotypically converted into SCs by transducing SOX10 and Krox20 genes followed by culturing for 10 days resulting in approximately 43% directly converted Schwann cells (dSCs). The dSCs expressed SC-specific proteins, secreted neurotrophic factors, and induced neuronal cells to extend neurites. The dSCs also displayed myelin-forming capability both in vitro and in vivo. Moreover, transplantation of the dSCs into the transected sciatic nerve in mice resulted in significantly accelerated regeneration of the nerve and in improved motor function at a level comparable to that with transplantation of the SCs obtained from a peripheral nerve. The dSCs induced by our procedure may be applicable for novel regeneration therapy for not only peripheral nerve injury but also for central nerve damage and for neurodegenerative disorders related to SC dysfunction. Stem Cells Translational Medicine 2017;6:1207-1216. © 2017 The Authors Stem Cells Translational Medicine published by Wiley Periodicals, Inc. on behalf of AlphaMed Press.

  14. Characterization of Human Cytomegalovirus Genome Diversity in Immunocompromised Hosts by Whole-Genome Sequencing Directly From Clinical Specimens.

    Science.gov (United States)

    Hage, Elias; Wilkie, Gavin S; Linnenweber-Held, Silvia; Dhingra, Akshay; Suárez, Nicolás M; Schmidt, Julius J; Kay-Fedorov, Penelope C; Mischak-Weissinger, Eva; Heim, Albert; Schwarz, Anke; Schulz, Thomas F; Davison, Andrew J; Ganzenmueller, Tina

    2017-06-01

    Advances in next-generation sequencing (NGS) technologies allow comprehensive studies of genetic diversity over the entire genome of human cytomegalovirus (HCMV), a significant pathogen for immunocompromised individuals. Next-generation sequencing was performed on target enriched sequence libraries prepared directly from a variety of clinical specimens (blood, urine, breast milk, respiratory samples, biopsies, and vitreous humor) obtained longitudinally or from different anatomical compartments from 20 HCMV-infected patients (renal transplant recipients, stem cell transplant recipients, and congenitally infected children). De novo-assembled HCMV genome sequences were obtained for 57 of 68 sequenced samples. Analysis of longitudinal or compartmental HCMV diversity revealed various patterns: no major differences were detected among longitudinal, intraindividual blood samples from 9 of 15 patients and in most of the patients with compartmental samples, whereas a switch of the major HCMV population was observed in 6 individuals with sequential blood samples and upon compartmental analysis of 1 patient with HCMV retinitis. Variant analysis revealed additional aspects of minor virus population dynamics and antiviral-resistance mutations. In immunosuppressed patients, HCMV can remain relatively stable or undergo drastic genomic changes that are suggestive of the emergence of minor resident strains or de novo infection. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  15. Direct and indirect reputation formation in nonhuman great apes (Pan paniscus, Pan troglodytes, Gorilla gorilla, Pongo pygmaeus) and human children (Homo sapiens).

    Science.gov (United States)

    Herrmann, Esther; Keupp, Stefanie; Hare, Brian; Vaish, Amrisha; Tomasello, Michael

    2013-02-01

    Humans make decisions about when and with whom to cooperate based on their reputations. People either learn about others by direct interaction or by observing third-party interactions or gossip. An important question is whether other animal species, especially our closest living relatives, the nonhuman great apes, also form reputations of others. In Study 1, chimpanzees, bonobos, orangutans, and 2.5-year-old human children experienced a nice experimenter who tried to give food/toys to the subject and a mean experimenter who interrupted the food/toy giving. In studies 2 and 3, nonhuman great apes and human children could only passively observe a similar interaction, in which a nice experimenter and a mean experimenter interacted with a third party. Orangutans and 2.5-year-old human children preferred to approach the nice experimenter rather than the mean one after having directly experienced their respective behaviors. Orangutans, chimpanzees, and 2.5-year-old human children also took into account experimenter actions toward third parties in forming reputations. These studies show that the human ability to form direct and indirect reputation judgment is already present in young children and shared with at least some of the other great apes. PsycINFO Database Record (c) 2013 APA, all rights reserved

  16. Partially non-linear stimulation intensity-dependent effects of direct current stimulation on motor cortex excitability in humans.

    Science.gov (United States)

    Batsikadze, G; Moliadze, V; Paulus, W; Kuo, M-F; Nitsche, M A

    2013-04-01

    Transcranial direct current stimulation (tDCS) of the human motor cortex at an intensity of 1 mA with an electrode size of 35 cm(2) has been shown to induce shifts of cortical excitability during and after stimulation. These shifts are polarity-specific with cathodal tDCS resulting in a decrease and anodal stimulation in an increase of cortical excitability. In clinical and cognitive studies, stronger stimulation intensities are used frequently, but their physiological effects on cortical excitability have not yet been explored. Therefore, here we aimed to explore the effects of 2 mA tDCS on cortical excitability. We applied 2 mA anodal or cathodal tDCS for 20 min on the left primary motor cortex of 14 healthy subjects. Cathodal tDCS at 1 mA and sham tDCS for 20 min was administered as control session in nine and eight healthy subjects, respectively. Motor cortical excitability was monitored by transcranial magnetic stimulation (TMS)-elicited motor-evoked potentials (MEPs) from the right first dorsal interosseous muscle. Global corticospinal excitability was explored via single TMS pulse-elicited MEP amplitudes, and motor thresholds. Intracortical effects of stimulation were obtained by cortical silent period (CSP), short latency intracortical inhibition (SICI) and facilitation (ICF), and I wave facilitation. The above-mentioned protocols were recorded both before and immediately after tDCS in randomized order. Additionally, single-pulse MEPs, motor thresholds, SICI and ICF were recorded every 30 min up to 2 h after stimulation end, evening of the same day, next morning, next noon and next evening. Anodal as well as cathodal tDCS at 2 mA resulted in a significant increase of MEP amplitudes, whereas 1 mA cathodal tDCS decreased corticospinal excitability. A significant shift of SICI and ICF towards excitability enhancement after both 2 mA cathodal and anodal tDCS was observed. At 1 mA, cathodal tDCS reduced single-pulse TMS-elicited MEP amplitudes and shifted SICI

  17. Pharmacological modulation of the short-lasting effects of antagonistic direct current-stimulation over the human motor cortex

    Directory of Open Access Journals (Sweden)

    Leila eChaieb

    2012-07-01

    Full Text Available Combined administration of transcranial direct current stimulation (tDCS with either pergolide (PGL or D-cycloserine (D-CYC can prolong the excitability-diminishing effects of cathodal, or the excitability enhancing effect of anodal stimulation for up to 24hrs poststimulation. However, it remains unclear whether the potentiation of the observed aftereffects is dominated by the polarity and duration of the stimulation, or the dual application of combined stimulation and drug administration. The present study looks at whether the aftereffects of oral administration of PGL (a D1/D2 agonist or D-CYC (a partial NMDA receptor agonist, in conjunction with the short duration antagonistic application of tDCS (either 5 min cathodal followed immediately by 5 min anodal or vice versa, that alone only induces short lasting aftereffects, can modulate cortical excitability in healthy human subjects, as revealed by a single-pulse MEP (motor-evoked-potential paradigm. Results indicate that the antagonistic application of DC currents induces short-term neuroplastic aftereffects that are dependent upon the polarity of the second application of short-duration tDCS. The application of D-cycloserine resulted in a reversal of this trend and so consequently a marked inhibition of cortical excitability with the cathodal-anodal stimulation order was observed. The administration of pergolide showed no significant aftereffects in either case. These results emphasise that the aftereffects of tDCS are dependent upon the stimulation orientation, and mirror the findings of other studies reporting the neuroplasticity inducing aftereffects of tDCS, and their prolongation when combined with the administration of CNS active drugs.

  18. Quantitative Profiling of Major Neutral Lipid Classes in Human Meibum by Direct Infusion Electrospray Ionization Mass Spectrometry

    Science.gov (United States)

    Chen, Jianzhong; Green, Kari B.; Nichols, Kelly K.

    2013-01-01

    Purpose. The purpose of this investigation was to better understand lipid composition in human meibum. Methods. Intact lipids in meibum samples were detected by direct infusion electrospray ionization mass spectrometry (ESI-MS) analysis in positive detection mode using sodium iodide (NaI) as an additive. The peak intensities of all major types of lipid species, that is, wax esters (WEs), cholesteryl esters (CEs), and diesters (DEs) were corrected for peak overlapping and isotopic distribution; an additional ionization efficiency correction was performed for WEs and CEs, which was simplified by the observation that the corresponding ionization efficiency was primarily dependent on the specific lipid class and saturation degree of the lipids while independent of the carbon chain length. A set of WE and CE standards was spiked in meibum samples for ionization efficiency determination and absolute quantitation. Results. The absolute amount (μmol/mg) for each of 51 WEs and 31 CEs in meibum samples was determined. The summed masses for 51 WEs and 31 CEs accounted for 48 ± 4% and 40 ± 2%, respectively, of the total meibum lipids. The mass percentages of saturated and unsaturated species were determined to be 75 ± 2% and 25 ± 1% for CEs and 14 ± 1% and 86 ± 1% for WEs. The profiles for two types of DEs were also obtained, which include 42 α,ω Type II DEs, and 21 ω Type I-St DEs. Conclusions. Major neutral lipid classes in meibum samples were quantitatively profiled by ESI-MS analysis with NaI additive. PMID:23847307

  19. The morphologic changes in the wall of the human urinary tracts after direct electro pulse exposure: the in vitro research

    Directory of Open Access Journals (Sweden)

    A.V. Gudkov

    2013-02-01

    Full Text Available The aim – study of the morphological changes in the wall of the human urinary tracts, developing after direct electro pulse exposure (DEPE. Materials and methods – The fragments of the surgical material obtained after the pelvis (n=25, ureter (n=33 and urinary bladder (n=20 open operations, were used in the research. DEPE was carried out by single (from 1 to 20 nanosecond pulses with the power of 0.8 J (joule and 1.0 J made by the electro pulse “Urolit-105M” lithotriptor probe on the fragments’ mucous tunic placed in the Petri dishes with 0.9% NaCl solution. The fragments were fixed in the formalin and after the processing, and pouring with paraffin, the tissue slices were prepared. Results – The kidney pelvis wall, where changes like epithelium desquamation, the basal membrane disorganization, paretic capillary expansion did not go beyond sub mucous layer even after exposure by 10 pulses with the power 1.0 J each, aimed at one point, proved to be the most resistant to DEPE. In the fragments of ureter and urinary bladder the same changes were detected after exposure by 5 pulses with the power of 1.0 J each, whereas after exposure by 10 pulses with the power 1.0 J each the changes occurred which were restricted by the muscular layer. Conclusion – The DEPEon the mucous tunic of the isolated urinary tracts fragments by the means of 10 pulses with the power of 1.0 J each looks safe, causes morphologic changes, restricted by the muscular layer and does not lead to the wall perforation.

  20. Vaccination directed against the human endogenous retrovirus-K envelope protein inhibits tumor growth in a murine model system.

    Science.gov (United States)

    Kraus, Benjamin; Fischer, Katrin; Büchner, Sarah M; Wels, Winfried S; Löwer, Roswitha; Sliva, Katja; Schnierle, Barbara S

    2013-01-01

    Human endogenous retrovirus (HERV) genomes are chromosomally integrated in all cells of an individual. They are normally transcriptionally silenced and transmitted only vertically. Enhanced expression of HERV-K accompanied by the emergence of anti-HERV-K-directed immune responses has been observed in tumor patients and HIV-infected individuals. As HERV-K is usually not expressed and immunological tolerance development is unlikely, it is an appropriate target for the development of immunotherapies. We generated a recombinant vaccinia virus (MVA-HKenv) expressing the HERV-K envelope glycoprotein (ENV), based on the modified vaccinia virus Ankara (MVA), and established an animal model to test its vaccination efficacy. Murine renal carcinoma cells (Renca) were genetically altered to express E. coli beta-galactosidase (RLZ cells) or the HERV-K ENV gene (RLZ-HKenv cells). Intravenous injection of RLZ-HKenv cells into syngenic BALB/c mice led to the formation of pulmonary metastases, which were detectable by X-gal staining. A single vaccination of tumor-bearing mice with MVA-HKenv drastically reduced the number of pulmonary RLZ-HKenv tumor nodules compared to vaccination with wild-type MVA. Prophylactic vaccination of mice with MVA-HKenv precluded the formation of RLZ-HKenv tumor nodules, whereas wild-type MVA-vaccinated animals succumbed to metastasis. Protection from tumor formation correlated with enhanced HERV-K ENV-specific killing activity of splenocytes. These data demonstrate for the first time that HERV-K ENV is a useful target for vaccine development and might offer new treatment opportunities for diverse types of cancer.

  1. Effects of Direct-to-Consumer Advertising and Clinical Guidelines on Appropriate Use of Human Papillomavirus DNA Tests

    Science.gov (United States)

    2011-01-01

    Background Both clinical guidelines and direct-to-consumer (DTC) advertising influence use of new health care technologies, but little is known about their relative effects. The introduction of a cervical cancer screening test in 2000 offered a unique opportunity to assess the two strategies. Objective To evaluate the effects of clinical guidelines and a targeted DTC advertising campaign on overall and appropriate use of human papillomavirus (HPV) DNA tests. Research Design Quasi-experimental study using difference-in-differences analysis. Data were MarketScan private insurance claims for 500,000 women ages 21 to 64 enrolled at least 12 consecutive months from January 2001 through December 2005. Results Both clinical guidelines and DTC advertising were associated with increases in overall HPV DNA test use. DTC advertising was associated with a statistically significant increase in HPV DNA test use in two groups of DTC cities (+5.57 percent, padvertising was associated with comparable increases in the probability of appropriate and inappropriate use of the HPV DNA test in primary screening. Clinical guideline releases from the American College of Obstetricians and Gynecologists, and by a co-sponsored panel, were associated with greater increases in HPV DNA tests for appropriate primary screening than for inappropriate primary screening (β=0.3347, padvertising was associated with increased overall use of a cervical cancer screening test, while clinical guidelines were differentially associated with increased appropriate use. These findings suggest distinct influences of consumer marketing and professional guidelines on the use of health care products and services. PMID:21150798

  2. Social Injustice, Human Rights-Based Education and Citizens' Direct Action to Promote Social Transformation in the Philippines

    Science.gov (United States)

    Ty, Reynaldo

    2011-01-01

    This article opens with a proposed framework for human rights education (HRE), which synthesizes ideas drawn from Zinn's people's history, Sen's theory of justice and Freire's critical pedagogy. A review of the literature on HRE and human rights-based learning suggests three existent interrelated models of HRE. Drawing on human rights-based…

  3. Fatty acid profiling of raw human plasma and whole blood using direct thermal desorption combined with gas chromatography–mass spectrometry

    NARCIS (Netherlands)

    Akoto, L.; Vreuls, R.J.J.; Irth, H.; Pel, R.; Stellaard, F.

    2008-01-01

    Gas chromatography (GC) has in recent times become an important tool for the fatty acid profiling of human blood and plasma. An at-line procedure used in the fatty acid profiling of whole/intact aquatic micro-organisms without any sample preparation was adapted for this work. A direct thermal

  4. Fatty acid profiling of raw human plasma and whole blood using direct thermal desorption combined with gas chromatography-mass spectrometry.

    NARCIS (Netherlands)

    Akoto, L.; Vreuls, J.J.; Irth, H.; Pel, R.; Stellaard, F.

    2008-01-01

    Gas chromatography (GC) has in recent times become an important tool for the fatty acid profiling of human blood and plasma. An at-line procedure used in the fatty acid profiling of whole/intact aquatic micro-organisms without any sample preparation was adapted for this work. A direct thermal

  5. Fatty acid profiling of raw human plasma and whole blood using direct thermal desorption combined with gas chromatography-mass spectrometry

    NARCIS (Netherlands)

    Akoto, Lawrence; Vreuls, Rene J. J.; Irth, Hubertus; Pel, Roel; Stellaard, Frans

    2008-01-01

    Gas chromatography (GC) has in recent times become an important tool for the fatty acid profiling of human blood and plasma. An at-line procedure used in the fatty acid profiling of whole/intact aquatic micro-organisms without any sample preparation was adapted for this work. A direct thermal

  6. Judicial activism, the Biotech Directive and its institutional implications – Is the Court acting as a legislator or a court when defining the ‘human embryo’?

    DEFF Research Database (Denmark)

    Faeh, Andrea Beata

    2015-01-01

    The Court of Justice of the European Union (Court) delivered a preliminary ruling in 2011 in the case of Oliver Brüstle v Greenpeace on the interpretation of Article 6(2) of the Biotech Directive and thereby established an autonomous concept of the term ‘human embryo’. The Brüstle decision raises...

  7. Human Capital Formation and Foreign Direct Investment in Developing Countries. OECD Development Centre Working Paper No. 211 (Formerly Technical Paper No. 211)

    Science.gov (United States)

    Miyamoto, Koji

    2003-01-01

    This paper synthesises the existing literature on human capital formation and foreign direct investment (FDI) in developing countries. The aim is to take a bird's eye view of the complex linkages between the activities of multinational enterprises (MNEs) and policies of host developing countries. In doing so, general trends, best practices and…

  8. Different Mode of Afferents Determines the Frequency Range of High Frequency Activities in the Human Brain: Direct Electrocorticographic Comparison between Peripheral Nerve and Direct Cortical Stimulation.

    Directory of Open Access Journals (Sweden)

    Katsuya Kobayashi

    Full Text Available Physiological high frequency activities (HFA are related to various brain functions. Factors, however, regulating its frequency have not been well elucidated in humans. To validate the hypothesis that different propagation modes (thalamo-cortical vs. cortico-coritcal projections, or different terminal layers (layer IV vs. layer II/III affect its frequency, we, in the primary somatosensory cortex (SI, compared HFAs induced by median nerve stimulation with those induced by electrical stimulation of the cortex connecting to SI. We employed 6 patients who underwent chronic subdural electrode implantation for presurgical evaluation. We evaluated the HFA power values in reference to the baseline overriding N20 (earliest cortical response and N80 (late response of somatosensory evoked potentials (HFA(SEP(N20 and HFA(SEP(N80 and compared those overriding N1 and N2 (first and second responses of cortico-cortical evoked potentials (HFA(CCEP(N1 and HFA(CCEP(N2. HFA(SEP(N20 showed the power peak in the frequency above 200 Hz, while HFA(CCEP(N1 had its power peak in the frequency below 200 Hz. Different propagation modes and/or different terminal layers seemed to determine HFA frequency. Since HFA(CCEP(N1 and HFA induced during various brain functions share a similar broadband profile of the power spectrum, cortico-coritcal horizontal propagation seems to represent common mode of neural transmission for processing these functions.

  9. Social communication with virtual agents: The effects of body and gaze direction on attention and emotional responding in human observers.

    Science.gov (United States)

    Marschner, Linda; Pannasch, Sebastian; Schulz, Johannes; Graupner, Sven-Thomas

    2015-08-01

    In social communication, the gaze direction of other persons provides important information to perceive and interpret their emotional response. Previous research investigated the influence of gaze by manipulating mutual eye contact. Therefore, gaze and body direction have been changed as a whole, resulting in only congruent gaze and body directions (averted or directed) of another person. Here, we aimed to disentangle these effects by using short animated sequences of virtual agents posing with either direct or averted body or gaze. Attention allocation by means of eye movements, facial muscle response, and emotional experience to agents of different gender and facial expressions were investigated. Eye movement data revealed longer fixation durations, i.e., a stronger allocation of attention, when gaze and body direction were not congruent with each other or when both were directed towards the observer. This suggests that direct interaction as well as incongruous signals increase the demands of attentional resources in the observer. For the facial muscle response, only the reaction of muscle zygomaticus major revealed an effect of body direction, expressed by stronger activity in response to happy expressions for direct compared to averted gaze when the virtual character's body was directed towards the observer. Finally, body direction also influenced the emotional experience ratings towards happy expressions. While earlier findings suggested that mutual eye contact is the main source for increased emotional responding and attentional allocation, the present results indicate that direction of the virtual agent's body and head also plays a minor but significant role. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Direct comparison of flow-FISH and qPCR as diagnostic tests for telomere length measurement in humans.

    Directory of Open Access Journals (Sweden)

    Fernanda Gutierrez-Rodrigues

    Full Text Available Telomere length measurement is an essential test for the diagnosis of telomeropathies, which are caused by excessive telomere erosion. Commonly used methods are terminal restriction fragment (TRF analysis by Southern blot, fluorescence in situ hybridization coupled with flow cytometry (flow-FISH, and quantitative PCR (qPCR. Although these methods have been used in the clinic, they have not been comprehensively compared. Here, we directly compared the performance of flow-FISH and qPCR to measure leukocytes' telomere length of healthy individuals and patients evaluated for telomeropathies, using TRF as standard. TRF and flow-FISH showed good agreement and correlation in the analysis of healthy subjects (R(2 = 0.60; p<0.0001 and patients (R(2 = 0.51; p<0.0001. In contrast, the comparison between TRF and qPCR yielded modest correlation for the analysis of samples of healthy individuals (R(2 = 0.35; p<0.0001 and low correlation for patients (R(2 = 0.20; p = 0.001; Bland-Altman analysis showed poor agreement between the two methods for both patients and controls. Quantitative PCR and flow-FISH modestly correlated in the analysis of healthy individuals (R(2 = 0.33; p<0.0001 and did not correlate in the comparison of patients' samples (R(2 = 0.1, p = 0.08. Intra-assay coefficient of variation (CV was similar for flow-FISH (10.8 ± 7.1% and qPCR (9.5 ± 7.4%; p = 0.35, but the inter-assay CV was lower for flow-FISH (9.6 ± 7.6% vs. 16 ± 19.5%; p = 0.02. Bland-Altman analysis indicated that flow-FISH was more precise and reproducible than qPCR. Flow-FISH and qPCR were sensitive (both 100% and specific (93% and 89%, respectively to distinguish very short telomeres. However, qPCR sensitivity (40% and specificity (63% to detect telomeres below the tenth percentile were lower compared to flow-FISH (80% sensitivity and 85% specificity. In the clinical setting, flow-FISH was more accurate, reproducible, sensitive, and specific in the measurement of human

  11. Pseudogene of dihydrolipoyl succinyltransferase (E2k) found by PCR amplification and direct sequencing of rodent-human cell hybrid DNAs

    Energy Technology Data Exchange (ETDEWEB)

    Cai, X.; Ali, G.; Blass, J.P. [Cornell Univ. Medical College, White Plains, NY (United States); Szabo, P. [Cornell Univ. Medical College, New York, NY (United States); Tanzi, R.E. [Massachusetts General Hospital, Boston, MA (United States)

    1994-07-01

    Previous studies have indicated that the cDNA for the E2k component of the human {alpha}-ketoglutarate dehydrogenase complex (KGDHC) hybridized not only to a major locus on chromosome 14q24.3 in a region associated with familial Alzheimer`s disease and with Joseph-Machado disease, but also to another locus on chromosome 1p31. The authors now report that PCR of genomic DNA and direct sequencing indicated that the chromosome 1 locus is an intronless pseudogene. PCR of genomic DNA amplified E2k fragments from mouse-human cell hybrids containing human chromosome 1 DNA but not from hybrids containing human chromosome 14 DNA. The resulting amplicons were of comparable sizes to those when the cDNA was used to template. The direct sequencing of these amplicons confirmed the lack of introns and indicated a frame shift, which led to the presence of four termination codons early in the coding region. PCR followed by direct sequencing of the amplicons appears to be a convenient method for identifying intronless pseudogenes.

  12. A comparison of human immunodeficiency virus, hepatitis C virus, hepatitis B virus, and human T-lymphotropic virus marker rates for directed versus volunteer blood donations to the American Red Cross during 2005 to 2010.

    Science.gov (United States)

    Dorsey, Kerri A; Moritz, Erin D; Steele, Whitney R; Eder, Anne F; Stramer, Susan L

    2013-06-01

    At most US blood centers, patients may still opt to choose specific donors to give blood for their anticipated transfusion needs. However, there is little evidence of improved safety with directed donation when compared to volunteer donation. The percentage of directed donations made to the American Red Cross (ARC) from 1995 to 2010 was determined. Infectious disease marker rates for human immunodeficiency virus (HIV), hepatitis C virus (HCV), hepatitis B virus (HBV), and human T-lymphotropic virus (HTLV) were calculated for volunteer and directed donations made from 2005 to 2010. Odds ratios (ORs) were calculated to compare marker-positive rates of directed donations to volunteer donations. The percentage of donations from directed donors declined from 1.6% in 1995 to 0.12% in 2010. From 2005 to 2010, the ARC collected 38,894,782 volunteer and 69,869 directed donations. Rates of HIV, HCV, HBV, and HTLV for volunteer donations were 2.9, 32.2, 12.4, and 2.5 per 100,000 donations, respectively; for directed, the rates were 7.2, 93.0, 40.1, and 18.6 per 100,000. After demographics and first-time or repeat status were adjusted for, corresponding ORs of viral marker positivity in directed versus volunteer donations were not significant for HIV, HBV, or HTLV and significant for HCV (OR, 0.7; 95% confidence interval, 0.50-0.90). Directed donations have declined by 92% at the ARC since 1995, but have higher viral marker rates than volunteer donations. The difference can be explained in part by the effects of first-time or repeat status of the donors. Patients considering directed donation should be appropriately counseled about the potential risks. © 2012 American Association of Blood Banks.

  13. Directed Differentiation of Human Embryonic Stem Cells into Prostate Organoids In Vitro and its Perturbation by Low-Dose Bisphenol A Exposure.

    Directory of Open Access Journals (Sweden)

    Esther L Calderon-Gierszal

    Full Text Available Studies using rodent and adult human prostate stem-progenitor cell models suggest that developmental exposure to the endocrine disruptor Bisphenol-A (BPA can predispose to prostate carcinogenesis with aging. Unknown at present is whether the embryonic human prostate is equally susceptible to BPA during its natural developmental window. To address this unmet need, we herein report the construction of a pioneer in vitro human prostate developmental model to study the effects of BPA. The directed differentiation of human embryonic stem cells (hESC into prostatic organoids in a spatial system was accomplished with precise temporal control of growth factors and steroids. Activin-induced definitive endoderm was driven to prostate specification by combined exposure to WNT10B and FGF10. Matrigel culture for 20-30 days in medium containing R-Spondin-1, Noggin, EGF, retinoic acid and testosterone was sufficient for mature prostate organoid development. Immunofluorescence and gene expression analysis confirmed that organoids exhibited cytodifferentiation and functional properties of the human prostate. Exposure to 1 nM or 10 nM BPA throughout differentiation culture disturbed early morphogenesis in a dose-dependent manner with 1 nM BPA increasing and 10 nM BPA reducing the number of branched structures formed. While differentiation of branched structures to mature organoids seemed largely unaffected by BPA exposure, the stem-like cell population increased, appearing as focal stem cell nests that have not properly entered lineage commitment rather than the rare isolated stem cells found in normally differentiated structures. These findings provide the first direct evidence that low-dose BPA exposure targets hESC and perturbs morphogenesis as the embryonic cells differentiate towards human prostate organoids, suggesting that the developing human prostate may be susceptible to disruption by in utero BPA exposures.

  14. MiR-206 functions as a tumor suppressor and directly targets K-Ras in human oral squamous cell carcinoma [Retraction

    Directory of Open Access Journals (Sweden)

    Lin FO

    2016-10-01

    Full Text Available The Editor-in-Chief and Publisher of OncoTargets and Therapy have been alerted to unacceptable levels of duplication with another published paper: Zhang D, Ni Z, Xu X, and Xiao J. MiR-32 Functions as a Tumor Suppressor and Directly Targets EZH2 in Human Oral Squamous Cell Carcinoma. Medical Science Monitor. 20:2527–2535, 2014.Accordingly, we retract Lin FO, Yao LJ, Xiao J, Liu DF, and Ni ZY. MiR-206 functions as a tumor suppressor and directly targets K-Ras in human oral squamous cell carcinoma. OncoTargets and Therapy. 2014;7:1583–1591.This Retraction relates to 

  15. Direct comparison of radiation dosimetry of six PET tracers using human whole-body imaging and murine biodistribution studies

    International Nuclear Information System (INIS)

    Sakata, Muneyuki; Oda, Keiichi; Toyohara, Jun; Ishii, Kenji; Nariai, Tadashi; Ishiwata, Kiichi

    2013-01-01

    We investigated the whole-body biodistributions and radiation dosimetry of five 11 C-labeled and one 18 F-labeled radiotracers in human subjects, and compared the results to those obtained from murine biodistribution studies. The radiotracers investigated were 11 C-SA4503, 11 C-MPDX, 11 C-TMSX, 11 C-CHIBA-1001, 11 C-4DST, and 18 F-FBPA. Dynamic whole-body positron emission tomography (PET) was performed in three human subjects after a single bolus injection of each radiotracer. Emission scans were collected in two-dimensional mode in five bed positions. Regions of interest were placed over organs identified in reconstructed PET images. The OLINDA program was used to estimate radiation doses from the number of disintegrations of these source organs. These results were compared with the predicted human radiation doses on the basis of biodistribution data obtained from mice by dissection. The ratios of estimated effective doses from the human-derived data to those from the mouse-derived data ranged from 0.86 to 1.88. The critical organs that received the highest absorbed doses in the human- and mouse-derived studies differed for two of the six radiotracers. The differences between the human- and mouse-derived dosimetry involved not only the species differences, including faster systemic circulation of mice and differences in the metabolism, but also measurement methodologies. Although the mouse-derived effective doses were roughly comparable to the human-derived doses in most cases, considerable differences were found for critical organ dose estimates and pharmacokinetics in certain cases. Whole-body imaging for investigation of radiation dosimetry is desirable for the initial clinical evaluation of new PET probes prior to their application in subsequent clinical investigations. (author)

  16. Current direction-dependent modulation of human hand motor function by intermittent theta burst stimulation (iTBS).

    Science.gov (United States)

    Shirota, Yuichiro; Dhaka, Suman; Paulus, Walter; Sommer, Martin

    2017-05-22

    Transcranial magnetic stimulation (TMS) with different current directions can activate different sets of neurons. Current direction can also affect the results of repetitive TMS. To test the influence of uni-directional intermittent theta burst stimulation (iTBS) using different current directions, namely posteroanterior (PA) and anteroposterior (AP), on motor behaviour. In a cross-over design, PA- and AP-iTBS was applied over the left primary motor cortex in 19 healthy, right-handed volunteers. Performance of a finger-tapping task was recorded before and 0, 10, 20, and 30min after the iTBS. The task was conducted with the right and left hands separately at each time point. As a control, AP-iTBS with reduced intensity was applied to 14 participants in a separate session (AP weak condition). The finger-tapping count with the left hand was decreased after PA-iTBS. Neither AP- nor AP weak -iTBS altered the performance. Current direction had a significant impact on the after-effects of iTBS. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Cell Adhesion Minimization by a Novel Mesh Culture Method Mechanically Directs Trophoblast Differentiation and Self-Assembly Organization of Human Pluripotent Stem Cells.

    Science.gov (United States)

    Okeyo, Kennedy Omondi; Kurosawa, Osamu; Yamazaki, Satoshi; Oana, Hidehiro; Kotera, Hidetoshi; Nakauchi, Hiromitsu; Washizu, Masao

    2015-10-01

    Mechanical methods for inducing differentiation and directing lineage specification will be instrumental in the application of pluripotent stem cells. Here, we demonstrate that minimization of cell-substrate adhesion can initiate and direct the differentiation of human pluripotent stem cells (hiPSCs) into cyst-forming trophoblast lineage cells (TLCs) without stimulation with cytokines or small molecules. To precisely control cell-substrate adhesion area, we developed a novel culture method where cells are cultured on microstructured mesh sheets suspended in a culture medium such that cells on mesh are completely out of contact with the culture dish. We used microfabricated mesh sheets that consisted of open meshes (100∼200 μm in pitch) with narrow mesh strands (3-5 μm in width) to provide support for initial cell attachment and growth. We demonstrate that minimization of cell adhesion area achieved by this culture method can trigger a sequence of morphogenetic transformations that begin with individual hiPSCs attached on the mesh strands proliferating to form cell sheets by self-assembly organization and ultimately differentiating after 10-15 days of mesh culture to generate spherical cysts that secreted human chorionic gonadotropin (hCG) hormone and expressed caudal-related homeobox 2 factor (CDX2), a specific marker of trophoblast lineage. Thus, this study demonstrates a simple and direct mechanical approach to induce trophoblast differentiation and generate cysts for application in the study of early human embryogenesis and drug development and screening.

  18. Mapping directionality specific volume changes using tensor based morphometry: an application to the study of gyrogenesis and lateralization of the human fetal brain.

    Science.gov (United States)

    Rajagopalan, Vidya; Scott, Julia; Habas, Piotr A; Kim, Kio; Rousseau, Francois; Glenn, Orit A; Barkovich, A James; Studholme, Colin

    2012-11-01

    Tensor based morphometry (TBM) is a powerful approach to analyze local structural changes in brain anatomy. However, conventional scalar TBM methods do not completely capture all direction specific volume changes required to model complex changes such as those during brain growth. In this paper, we describe novel TBM descriptors for studying direction-specific changes in a subject population which can be used in conjunction with scalar TBM to analyze local patterns in directionality of volume change during brain development. We also extend the methodology to provide a new approach to mapping directional asymmetry in deformation tensors associated with the emergence of structural asymmetry in the developing brain. We illustrate the use of these methods by studying developmental patterns in the human fetal brain, in vivo. Results show that fetal brain development exhibits a distinct spatial pattern of anisotropic growth. The most significant changes in the directionality of growth occur in the cortical plate at major sulci. Our analysis also detected directional growth asymmetry in the peri-Sylvian region and the medial frontal lobe of the fetal brain. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Direct assessment of cumulative aryl hydrocarbon receptor agonist activity in sera from experimentally exposed mice and environmentally exposed humans

    DEFF Research Database (Denmark)

    Schlezinger, Jennifer J; Bernard, Pamela L; Haas, Amelia

    2010-01-01

    (PCB)-exposed Faroe Islanders using an AhR-driven reporter cell line. To validate relationships between serum AhR agonist levels and biological outcomes, AhR agonist activity in mouse sera correlated with toxic end points. AhR agonist activity in unmanipulated ("neat") human sera was compared......, was associated with the frequency of recent pilot whale dinners, but did not correlate with levels of PCBs quantified by GC/MS. Surprisingly, significant "baseline" AhR activity was found in commercial human sera. CONCLUSIONS: An AhR reporter assay revealed cumulative levels of AhR activation potential in neat...

  20. Activation of protein kinase A and exchange protein directly activated by cAMP promotes adipocyte differentiation of human mesenchymal stem cells

    DEFF Research Database (Denmark)

    Jia, Bingbing; Madsen, Lise; Petersen, Rasmus Koefoed

    2012-01-01

    ) and exchange protein directly activated by cAMP (Epac) in adipocyte conversion of human mesenchymal stem cells derived from adipose tissue (hMADS). We show that cAMP signaling involving the simultaneous activation of both PKA- and Epac-dependent signaling is critical for this process even in the presence......Human mesenchymal stem cells are primary multipotent cells capable of differentiating into several cell types including adipocytes when cultured under defined in vitro conditions. In the present study we investigated the role of cAMP signaling and its downstream effectors, protein kinase A (PKA...... results emphasize the need for cAMP signaling in concert with treatment with a PPARγ or PPARδ agonist to secure efficient adipocyte differentiation of human hMADS mesenchymal stem cells....

  1. Utility of the Hebb–Williams Maze Paradigm for Translational Research in Fragile X Syndrome: A Direct Comparison of Mice and Humans

    Science.gov (United States)

    Boutet, Isabelle; Collin, Charles A.; MacLeod, Lindsey S.; Messier, Claude; Holahan, Matthew R.; Berry-Kravis, Elizabeth; Gandhi, Reno M.; Kogan, Cary S.

    2018-01-01

    To generate meaningful information, translational research must employ paradigms that allow extrapolation from animal models to humans. However, few studies have evaluated translational paradigms on the basis of defined validation criteria. We outline three criteria for validating translational paradigms. We then evaluate the Hebb–Williams maze paradigm (Hebb and Williams, 1946; Rabinovitch and Rosvold, 1951) on the basis of these criteria using Fragile X syndrome (FXS) as model disease. We focused on this paradigm because it allows direct comparison of humans and animals on tasks that are behaviorally equivalent (criterion #1) and because it measures spatial information processing, a cognitive domain for which FXS individuals and mice show impairments as compared to controls (criterion #2). We directly compared the performance of affected humans and mice across different experimental conditions and measures of behavior to identify which conditions produce comparable patterns of results in both species. Species differences were negligible for Mazes 2, 4, and 5 irrespective of the presence of visual cues, suggesting that these mazes could be used to measure spatial learning in both species. With regards to performance on the first trial, which reflects visuo-spatial problem solving, Mazes 5 and 9 without visual cues produced the most consistent results. We conclude that the Hebb–Williams mazes paradigm has the potential to be utilized in translational research to measure comparable cognitive functions in FXS humans and animals (criterion #3). PMID:29643767

  2. Utility of the Hebb-Williams Maze Paradigm for Translational Research in Fragile X Syndrome: A Direct Comparison of Mice and Humans.

    Science.gov (United States)

    Boutet, Isabelle; Collin, Charles A; MacLeod, Lindsey S; Messier, Claude; Holahan, Matthew R; Berry-Kravis, Elizabeth; Gandhi, Reno M; Kogan, Cary S

    2018-01-01

    To generate meaningful information, translational research must employ paradigms that allow extrapolation from animal models to humans. However, few studies have evaluated translational paradigms on the basis of defined validation criteria. We outline three criteria for validating translational paradigms. We then evaluate the Hebb-Williams maze paradigm (Hebb and Williams, 1946; Rabinovitch and Rosvold, 1951) on the basis of these criteria using Fragile X syndrome (FXS) as model disease. We focused on this paradigm because it allows direct comparison of humans and animals on tasks that are behaviorally equivalent (criterion #1) and because it measures spatial information processing, a cognitive domain for which FXS individuals and mice show impairments as compared to controls (criterion #2). We directly compared the performance of affected humans and mice across different experimental conditions and measures of behavior to identify which conditions produce comparable patterns of results in both species. Species differences were negligible for Mazes 2, 4, and 5 irrespective of the presence of visual cues, suggesting that these mazes could be used to measure spatial learning in both species. With regards to performance on the first trial, which reflects visuo-spatial problem solving, Mazes 5 and 9 without visual cues produced the most consistent results. We conclude that the Hebb-Williams mazes paradigm has the potential to be utilized in translational research to measure comparable cognitive functions in FXS humans and animals (criterion #3).

  3. Molecular Biological Studies on the Biogenesis of Human Cholinesterases in vivo and as Directed by Cloned Cholinesterase DNA Sequences

    Science.gov (United States)

    1990-10-24

    species, was constructed using " lineup " and "profile." Sequences included human BCHE, Torpedo ACHE, Droscphila esterase-6 and rat lysophospholipase...in embryonic development. Prog. Histochem. Cytochem. 7: 1-52 (1975). 38 Layer, P.G.; Alber, R.; Rathjen, F.G. Sequential activation of

  4. 78 FR 73434 - Food Additives Permitted for Direct Addition to Food for Human Consumption; Acacia (Gum Arabic)

    Science.gov (United States)

    2013-12-06

    ...-contamination in the food production process, FDA investigations concluded that no peanut protein was present... . (c) The ingredient is used in food in accordance with good manufacturing practices under the... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration 21 CFR Part 172 [Docket No...

  5. Improved efficacy of soluble human receptor activator of nuclear factor kappa B (RANK) fusion protein by site-directed mutagenesis.

    Science.gov (United States)

    Son, Young Jun; Han, Jihye; Lee, Jae Yeon; Kim, HaHyung; Chun, Taehoon

    2015-06-01

    Soluble human receptor activator of nuclear factor kappa B fusion immunoglobulin (hRANK-Ig) has been considered as one of the therapeutic agents to treat osteoporosis or diseases associated with bone destruction by blocking the interaction between RANK and the receptor activator of nuclear factor kappa B ligand (RANKL). However, no scientific record showing critical amino acid residues within the structural interface between the human RANKL and RANK complex is yet available. In this study, we produced several mutants of hRANK-Ig by replacement of amino acid residue(s) and tested whether the mutants had increased binding affinity to human RANKL. Based on the results from flow cytometry and surface plasmon resonance analyses, the replacement of E(125) with D(125), or E(125) and C(127) with D(125) and F(127) within loop 3 of cysteine-rich domain 3 of hRANK-Ig increases binding affinity to human RANKL over the wild-type hRANK-Ig. This result may provide the first example of improvement in the efficacy of hRANK-Ig by protein engineering and may give additional information to understand a more defined structural interface between hRANK and RANKL.

  6. On the controversy over non-human culture: the reasons for disagreement and possible directions toward consensus.

    Science.gov (United States)

    Pagnotta, Murillo

    2014-11-01

    In recent decades, animal behaviorists have been using the term culture in relation to non-human animals, starting a controversy with social scientists that is still far from cooling down. I investigated the meanings of the term culture as used by social and cultural anthropologists, and also its recent use by ethologists, in order to better understand this controversy and identify possible paths that might lead to a consensus. I argue that disagreements in the level of theories involve definitions of culture and theories of behavioral development, while disagreements in the level of worldviews include the acceptance or rejection of the idea of a radical distinction between humans and other animals. Reaching a synthetic approach to (human and non-human) animal behavior depends on constructing a consensus in both levels. It is also necessary to discuss how to include symbolic communication in a comparative perspective. I conclude that this might lead to the abandonment or reconstruction of the related dichotomies of nature-culture, innate-acquired and gene-environment. This article is part of a Special Issue entitled: Neotropical Behaviour. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. The direct agglutination test as an alternative method for the diagnosis of canine and human visceral leishmaniasis

    NARCIS (Netherlands)

    Terán-Angel, Guillermo; Schallig, Henk; Zerpa, Olga; Rodríguez, Vestalia; Ulrich, Marian; Cabrera, Maira

    2007-01-01

    Visceral leishmaniasis is the most severe clinical form of leishmaniasis and is often fatal without proper treatment. Therefore, early and accurate diagnosis is important, but often difficult in endemic areas. The aim was to evaluate a direct agglutination test as a potential visceral leishmaniasis

  8. Effects of alternating and direct electrical current application on the odontoblastic layer in human teeth : an in vitro study

    NARCIS (Netherlands)

    Alwas-Danowska, HM; Huysmans, MCDNJM; Verdonschot, EH

    Aim The aim of this study was to investigate the influence of a low intensity alternating current on the odontoblasts and odontoblast layer and compare this with the effects of a direct current. Methodology Teeth extracted for orthodontic were immersed in physiological saline stabilized with thymol

  9. Assessing Anthropogenic Impacts on Tunas, Sharks and Billfishes with Direct Observations of Human Fishers on the High Seas

    Science.gov (United States)

    Block, B.; Ferretti, F.; White, T.; De Leo, G.; Hazen, E. L.; Bograd, S. J.

    2016-12-01

    Anthropogenic impacts on marine predators have been examined within exclusive economic zones, but few data sets have enabled assessing human fishing impacts on the high seas. By combining large electronic tagging databases archiving mobile predator movements (e.g. Tagging of Pacific Pelagics, TAG A Giant, Animal Telemetry Network) with the global fishing catch and fishing effort data, from satellite tracks of vessels on the high seas (AIS), a better understanding of human use and exploitation at a global scale can be obtained. This capacity to combine the movements of mobile ocean predators (tunas, sharks, billfishes) with analyses of their human predator's behaviors, via examination of the global fishing fleet activities is unprecedented due to the new access researchers are garnering to these big satellite derived AIS databases. Global Fishing Watch is one example of such a data provider, that now makes accessible, the AIS data from the global community of maritime vessels, and has developed along with researchers new algorithms that delineate distinct types of fishing vessel behaviors (longline, purse seiner) and effort. When combined with satellite tagging data of mobile apex predators, oceanographic preferences, records of fishing fleets catches, targeted species and economic drivers of fisheries, new quantitative insights can be gained about the catch reporting of fleets, and the pelagic species targeted at a global scale. Research communities can now also examine how humans behave on the high seas, and potentially improve how fish stocks, such as tunas, billfishes, and sharks are exploited. The capacity to gather information on diverse human fishing fleets and behaviors remotely, should provide a wealth of new tools that can potentially be applied toward the resource management efforts surrounding these global fishing fleets. This type of information is essential for prioritizing regions of conservation concern for megaufauna swimming in our oceans.

  10. 'Goats that stare at men'--revisited: do dwarf goats alter their behaviour in response to eye visibility and head direction of a human?

    Science.gov (United States)

    Nawroth, Christian; von Borell, Eberhard; Langbein, Jan

    2016-05-01

    Being able to recognise when one is being observed by someone else is thought to be adaptive during cooperative or competitive events. In particular for prey species, this ability should be of use in the context of predation. A previous study reported that goats (Capra aegagrus hircus) alter their behaviour according to the body and head orientation of a human experimenter. During a food anticipation task, an experimenter remained in a particular posture for 30 s before delivering a reward, and the goats' active anticipation and standing alert behaviour were analysed. To further evaluate the specific mechanisms at work, we here present two additional test conditions. In particular, we investigated the effects of the eye visibility and head orientation of a human experimenter on the behaviour of the goats (N = 7). We found that the level of the subjects' active anticipatory behaviour was highest in the conditions where the experimenter was directing his head and body towards the goat ('Control' and 'Eyes closed' conditions), but the anticipatory behaviour was significantly decreased when the body ('Head only') or the head and body of the experimenter were directed away from the subject ('Back' condition). For standing alert, we found no significant differences between the three conditions in which the experimenter was directing his head towards the subject ('Control', 'Eyes closed' and 'Head only'). This lack of differences in the expression of standing alert suggests that goats evaluate the direction of a human's head as an important cue in their anticipatory behaviour. However, goats did not respond to the visibility of the experimenter's eyes alone.

  11. Bulk derivatization and direct injection of human cerebrospinal fluid for trace-level quantification of endogenous estrogens using trap-and-elute liquid chromatography with tandem mass spectrometry.

    Science.gov (United States)

    Fan, Hui; Papouskova, Barbora; Lemr, Karel; Wigginton, Jane G; Schug, Kevin A

    2014-08-01

    Although there are existing methods for determining estrogen in human bodily fluids including blood plasma and serum, very little information is available regarding estrogen levels in human cerebrospinal fluid (CSF), which is critical to assess in studies of neuroprotective functions and diffusion of neuroprotective estrogens across the blood-brain barrier. To address this problem, a liquid chromatography with tandem mass spectrometry method for the simultaneous quantification of four endogenous estrogens (estrone, 17α-estradiol, 17β-estradiol, and estriol) in human CSF was developed. An aliquot (300 μL) of human CSF was bulk derivatized using dansyl chloride in the sample and 10 μL was directly injected onto a restricted-access media trap column for protein removal. No off-line sample extraction or cleanup was needed. The limits of detection of estrone, 17α-estradiol, 17β-estradiol, and estriol were 17, 28, 13, and 30 pg/mL, respectively, which is in the parts-per-trillion regime. The method was then applied to human CSF collected from ischemic trauma patients. Endogenous estrogens were detected and quantified, demonstrating the effectiveness of this method. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Direct conversion of human pluripotent stem cells into cranial motor neurons using a piggyBac vector

    Directory of Open Access Journals (Sweden)

    Riccardo De Santis

    2018-05-01

    Full Text Available Human pluripotent stem cells (PSCs are widely used for in vitro disease modeling. One of the challenges in the field is represented by the ability of converting human PSCs into specific disease-relevant cell types. The nervous system is composed of a wide variety of neuronal types with selective vulnerability in neurodegenerative diseases. This is particularly relevant for motor neuron diseases, in which different motor neurons populations show a different susceptibility to degeneration. Here we developed a fast and efficient method to convert human induced Pluripotent Stem Cells into cranial motor neurons of the branchiomotor and visceral motor subtype. These populations represent the motor neuron subgroup that is primarily affected by a severe form of amyotrophic lateral sclerosis with bulbar onset and worst prognosis. This goal was achieved by stable integration of an inducible vector, based on the piggyBac transposon, allowing controlled activation of Ngn2, Isl1 and Phox2a (NIP. The NIP module effectively produced electrophysiologically active cranial motor neurons. Our method can be easily extended to PSCs carrying disease-associated mutations, thus providing a useful tool to shed light on the cellular and molecular bases of selective motor neuron vulnerability in pathological conditions. Keywords: Spinal motor neuron, Cranial motor neuron, Induced pluripotent stem cells, Amyotrophic lateral sclerosis, Phox2a, piggyBac

  13. Direct PCR amplification of DNA from human bloodstains, saliva, and touch samples collected with microFLOQ® swabs.

    Science.gov (United States)

    Ambers, Angie; Wiley, Rachel; Novroski, Nicole; Budowle, Bruce

    2018-01-01

    Previous studies have shown that nylon flocked swabs outperform traditional fiber swabs in DNA recovery due to their innovative design and lack of internal absorbent core to entrap cellular materials. The microFLOQ ® Direct swab, a miniaturized version of the 4N6 FLOQSwab ® , has a small swab head that is treated with a lysing agent which allows for direct amplification and DNA profiling from sample collection to final result in less than two hours. Additionally, the microFLOQ ® system subsamples only a minute portion of a stain and preserves the vast majority of the sample for subsequent testing or re-analysis, if desired. The efficacy of direct amplification of DNA from dilute bloodstains, saliva stains, and touch samples was evaluated using microFLOQ ® Direct swabs and the GlobalFiler™ Express system. Comparisons were made to traditional methods to assess the robustness of this alternate workflow. Controlled studies with 1:19 and 1:99 dilutions of bloodstains and saliva stains consistently yielded higher STR peak heights than standard methods with 1ng input DNA from the same samples. Touch samples from common items yielded single source and mixed profiles that were consistent with primary users of the objects. With this novel methodology/workflow, no sample loss occurs and therefore more template DNA is available during amplification. This approach may have important implications for analysis of low quantity and/or degraded samples that plague forensic casework. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  14. Direct dating of Tantavel man by non-destructive gamma-ray spectrometry of fossil human skull Arago XXI

    International Nuclear Information System (INIS)

    Yokoyama, Yuji; Nguyen, Huu-Van

    1981-01-01

    A new method to date prehistoric samples is proposed. Non-destructive gamma-ray spectrometry with semi-conductor detector was used in the direct determination of the activities of 238 U, 234 U, 231 Pa, 230 Th and 228 Th. An age of (400sub(-96)sup(+infinite))x10 3 years was obtained from the 230 Th/ 238 U ratio of 0.975+-0.030 [fr

  15. Janus-kinase-2 relates directly to portal hypertension and to complications in rodent and human cirrhosis.

    Science.gov (United States)

    Klein, Sabine; Rick, Johanna; Lehmann, Jennifer; Schierwagen, Robert; Schierwagen, Irela Gretchen; Verbeke, Len; Hittatiya, Kanishka; Uschner, Frank Erhard; Manekeller, Steffen; Strassburg, Christian P; Wagner, Kay-Uwe; Sayeski, Peter P; Wolf, Dominik; Laleman, Wim; Sauerbruch, Tilman; Trebicka, Jonel

    2017-01-01

    Angiotensin II (AngII) activates via angiotensin-II-type-I receptor (AT1R) Janus-kinase-2 (JAK2)/Arhgef1 pathway and subsequently RHOA/Rho-kinase (ROCK), which induces experimental and probably human liver fibrosis. This study investigated the relationship of JAK2 to experimental and human portal hypertension. The mRNA and protein levels of JAK2/ARHGEF1 signalling components were analysed in 49 human liver samples and correlated with clinical parameters of portal hypertension in these patients. Correspondingly, liver fibrosis (bile duct ligation (BDL), carbon tetrachloride (CCl 4 )) was induced in floxed-Jak2 knock-out mice with SM22-promotor (SM22 Cre+ -Jak2 f/f ). Transcription and contraction of primary myofibroblasts from healthy and fibrotic mice and rats were analysed. In two different cirrhosis models (BDL, CCl 4 ) in rats, the acute haemodynamic effect of the JAK2 inhibitor AG490 was assessed using microsphere technique and isolated liver perfusion experiments. Hepatic transcription of JAK2/ARHGEF1 pathway components was upregulated in liver cirrhosis dependent on aetiology, severity and complications of human liver cirrhosis (Model for End-stage Liver disease (MELD) score, Child score as well as ascites, high-risk varices, spontaneous bacterial peritonitis). SM22 Cre+ - Jak2 f/f mice lacking Jak2 developed less fibrosis and lower portal pressure (PP) than SM22 Cre- -Jak2 f/f upon fibrosis induction. Myofibroblasts from SM22 Cre+ -Jak2 f/f mice expressed less collagen and profibrotic markers upon activation. AG490 relaxed activated hepatic stellate cells in vitro. In cirrhotic rats, AG490 decreased hepatic vascular resistance and consequently the PP in vivo and in situ. Hepatic JAK2/ARHGEF1/ROCK expression is associated with portal hypertension and decompensation in human cirrhosis. The deletion of Jak2 in myofibroblasts attenuated experimental fibrosis and acute inhibition of JAK2 decreased PP. Thus, JAK2 inhibitors, already in clinical use for other

  16. The use of total human bone marrow fraction in a direct three-dimensional expansion approach for bone tissue engineering applications: focus on angiogenesis and osteogenesis.

    Science.gov (United States)

    Guerrero, Julien; Oliveira, Hugo; Catros, Sylvain; Siadous, Robin; Derkaoui, Sidi-Mohammed; Bareille, Reine; Letourneur, Didier; Amédée, Joëlle

    2015-03-01

    Current approaches in bone tissue engineering have shown limited success, mostly owing to insufficient vascularization of the construct. A common approach consists of co-culture of endothelial cells and osteoblastic cells. This strategy uses cells from different sources and differentiation states, thus increasing the complexity upstream of a clinical application. The source of reparative cells is paramount for the success of bone tissue engineering applications. In this context, stem cells obtained from human bone marrow hold much promise. Here, we analyzed the potential of human whole bone marrow cells directly expanded in a three-dimensional (3D) polymer matrix and focused on the further characterization of this heterogeneous population and on their ability to promote angiogenesis and osteogenesis, both in vitro and in vivo, in a subcutaneous model. Cellular aggregates were formed within 24 h and over the 12-day culture period expressed endothelial and bone-specific markers and a specific junctional protein. Ectopic implantation of the tissue-engineered constructs revealed osteoid tissue and vessel formation both at the periphery and within the implant. This work sheds light on the potential clinical use of human whole bone marrow for bone regeneration strategies, focusing on a simplified approach to develop a direct 3D culture without two-dimensional isolation or expansion.

  17. In-vivo Imaging of Magnetic Fields Induced by Transcranial Direct Current Stimulation (tDCS) in Human Brain using MRI

    Science.gov (United States)

    Jog, Mayank V.; Smith, Robert X.; Jann, Kay; Dunn, Walter; Lafon, Belen; Truong, Dennis; Wu, Allan; Parra, Lucas; Bikson, Marom; Wang, Danny J. J.

    2016-10-01

    Transcranial direct current stimulation (tDCS) is an emerging non-invasive neuromodulation technique that applies mA currents at the scalp to modulate cortical excitability. Here, we present a novel magnetic resonance imaging (MRI) technique, which detects magnetic fields induced by tDCS currents. This technique is based on Ampere’s law and exploits the linear relationship between direct current and induced magnetic fields. Following validation on a phantom with a known path of electric current and induced magnetic field, the proposed MRI technique was applied to a human limb (to demonstrate in-vivo feasibility using simple biological tissue) and human heads (to demonstrate feasibility in standard tDCS applications). The results show that the proposed technique detects tDCS induced magnetic fields as small as a nanotesla at millimeter spatial resolution. Through measurements of magnetic fields linearly proportional to the applied tDCS current, our approach opens a new avenue for direct in-vivo visualization of tDCS target engagement.

  18. Direct activation of human and mouse Oct4 genes using engineered TALE and Cas9 transcription factors.

    Science.gov (United States)

    Hu, Jiabiao; Lei, Yong; Wong, Wing-Ki; Liu, Senquan; Lee, Kai-Chuen; He, Xiangjun; You, Wenxing; Zhou, Rui; Guo, Jun-Tao; Chen, Xiongfong; Peng, Xianlu; Sun, Hao; Huang, He; Zhao, Hui; Feng, Bo

    2014-04-01

    The newly developed transcription activator-like effector protein (TALE) and clustered regularly interspaced short palindromic repeats/Cas9 transcription factors (TF) offered a powerful and precise approach for modulating gene expression. In this article, we systematically investigated the potential of these new tools in activating the stringently silenced pluripotency gene Oct4 (Pou5f1) in mouse and human somatic cells. First, with a number of TALEs and sgRNAs targeting various regions in the mouse and human Oct4 promoters, we found that the most efficient TALE-VP64s bound around -120 to -80 bp, while highly effective sgRNAs targeted from -147 to -89-bp upstream of the transcription start sites to induce high activity of luciferase reporters. In addition, we observed significant transcriptional synergy when multiple TFs were applied simultaneously. Although individual TFs exhibited marginal activity to up-regulate endogenous gene expression, optimized combinations of TALE-VP64s could enhance endogenous Oct4 transcription up to 30-fold in mouse NIH3T3 cells and 20-fold in human HEK293T cells. More importantly, the enhancement of OCT4 transcription ultimately generated OCT4 proteins. Furthermore, examination of different epigenetic modifiers showed that histone acetyltransferase p300 could enhance both TALE-VP64 and sgRNA/dCas9-VP64 induced transcription of endogenous OCT4. Taken together, our study suggested that engineered TALE-TF and dCas9-TF are useful tools for modulating gene expression in mammalian cells.

  19. Recombinant human interleukin 2 directly provides signals for the proliferation and functional maturation of murine B lymphocytes

    OpenAIRE

    Moll, Heidrun; Emmrich, F.; Simon, Markus M.

    2009-01-01

    In this study the effect of recombinant human interleukin 2 (rec.hIL-2) on the proliferation and maturation of B lymphocytes was investigated. It was found that the presence of rec.hIL 2 results in proliferation of mitogen (LPS)-activated B cell blasts. In addition, it is shown that highly enriched murine B cells can be induced by rec.hIL-2 to proliferate and to develop into antibody-secreting cells (PFC) in the presence of antigen (SRBC). When tested for its effect on B cell preparations enr...

  20. Human antibody responses to Schistosoma mansoni: does antigen directed, isotype restriction result in the production of blocking antibodies?

    Directory of Open Access Journals (Sweden)

    David W. Dunne

    1987-01-01

    Full Text Available After treatment young Kenyan schoolchildren are highly susceptible to reinfection with Schistosoma mansoni. Older children and adults are resistant to reinfection. There is no evidence that this age related resistance is due to a slow development of protective immunological mechanisms, rather, it appears that young children are susceptible because of the presence of blocking antibodies which decline with age, thus allowing the expression of protective responses. Correlations between antibody responses to different stages of the parasite life-cycle suggest that, in young children, antigen directed, isotype restriction of the response against cross-reactive polysaccharide egg antigens results in an ineffectual, or even blocking antibody response to the schistosomulum.

  1. Slow-oscillatory transcranial direct current stimulation can induce bidirectional shifts in motor cortical excitability in awake humans

    DEFF Research Database (Denmark)

    Groppa, S; Bergmann, T O; Siems, C

    2010-01-01

    Constant transcranial direct stimulation (c-tDCS) of the primary motor hand area (M1(HAND)) can induce bidirectional shifts in motor cortical excitability depending on the polarity of tDCS. Recently, anodal slow oscillation stimulation at a frequency of 0.75 Hz has been shown to augment intrinsic...... slow oscillations during sleep and theta oscillations during wakefulness. To embed this new type of stimulation into the existing tDCS literature, we aimed to characterize the after effects of slowly oscillating stimulation (so-tDCS) on M1(HAND) excitability and to compare them to those of c-tDCS. Here...

  2. Highly efficient reprogramming to pluripotency and directed differentiation of human cells using synthetic modified mRNA

    OpenAIRE

    Warren, Luigi; Manos, Philip D.; Ahfeldt, Tim; Loh, Yuin-Han; Li, Hu; Lau, Frank; Ebina, Wataru; Mandal, Pankaj; Smith, Zachary D.; Meissner, Alexander; Daley, George Q.; Brack, Andrew S.; Collins, James J.; Cowan, Chad; Schlaeger, Thorsten M.

    2010-01-01

    Clinical application of induced pluripotent stem (iPS) cells is limited by the low efficiency of iPS derivation and the fact that most protocols modify the genome to effect cellular reprogramming. Moreover, safe and effective means of directing the fate of patient-specific iPS cells towards clinically useful cell types are lacking. Here we describe a simple, non-integrating strategy for reprogramming cell fate based on administration of synthetic mRNA modified to overcome innate anti-viral re...

  3. FROM LABOUR ECONOMICS TO HUMAN RESOURCE MANAGEMENT: THE DEVELOPMENT OF SCIENCE AND DIRECTIONS OF TRAINING OF SPECIALISTS ON LABOR

    Directory of Open Access Journals (Sweden)

    Yuriy G. Odegov

    2016-01-01

    Full Text Available The article deals with the stages of becoming and de-velopment the subject ща labor economy, the problem of training in the eld of labor relations associated with the formation of market relations in Russia, and as consequence, the allocation of separate independent direction of learning for higher education personnel management, the demand for it has been steadily in-creasing. The authors proved the inevitability oriented of learning specialists on the micro- and macrolevel and have offer to create new chairs

  4. Examination of the protective roles of helmet/faceshield and directionality for human head under blast waves.

    Science.gov (United States)

    Sarvghad-Moghaddam, Hesam; Jazi, Mehdi Salimi; Rezaei, Asghar; Karami, Ghodrat; Ziejewski, Mariusz

    2015-01-01

    A parametric study was conducted to delineate the efficacy of personal protective equipment (PPE), such as ballistic faceshields and advanced combat helmets, in the case of a blast. The propagations of blast waves and their interactions with an unprotected head, a helmeted one, and a fully protected finite element head model (FEHM) were modeled. The biomechanical parameters of the brain were recorded when the FEHM was exposed to shockwaves from the front, back, top, and bottom. The directional dependent tissue response of the brain and the variable efficiency of PPE with respect to the blast orientation were two major results of this study.

  5. Potent neutralization of VEGF biological activities with a fully human antibody Fab fragment directed against VEGF receptor 2

    International Nuclear Information System (INIS)

    Miao, H.-Q.; Hu, Kun; Jimenez, Xenia; Navarro, Elizabeth; Zhang, Haifan; Lu Dan; Ludwig, Dale L.; Balderes, Paul; Zhu Zhenping

    2006-01-01

    Compelling evidence suggest that vascular endothelial growth factor (VEGF) and its receptors, especially receptor 2 (VEGFR2, or kinase insert domain-containing receptor, KDR), play a critical role in angiogenesis under both physiological and pathological conditions, including cancer and angiogenic retinopathies such as age-related macular degeneration (AMD). To this end, inhibition of angiogenesis with antagonists to either VEGF or KDR has yielded significant therapeutic efficacy both in preclinical studies in animal models and in clinical trials in patients with cancer and AMD. We previously reported the identification of a high affinity, fully human anti-KDR antibody fragment, 1121B Fab, through a highly stringent affinity maturation process with a Fab originally isolated from a naive human antibody phage display library. In this study, we demonstrate that 1121B Fab is able to strongly block KDR/VEGF interaction, resulting in potent inhibition of an array of biological activities of VEGF, including activation of the receptor and its signaling pathway, intracellular calcium mobilization, and migration and proliferation of endothelial cells. Taken together, our data lend strong support to the further development of 1121B Fab fragment as an anti-angiogenesis agent in both cancer and angiogenic retinopathies

  6. High-Throughput LC-MS/MS Method for Direct Quantification of Glucuronidated, Sulfated and Free Enterolactone in Human Plasma

    DEFF Research Database (Denmark)

    Nørskov, Natalja; Kyrø, Cecilie; Olsen, Anja

    2016-01-01

    Sulfation and glucuronidation constitute a major pathway in humans and may play an important role in biological activity of metabolites including the enterolignan, enterolactone. Because the aromatic structure of enterolactone has similarities to steroid metabolites, it was hypothesized that ente......Sulfation and glucuronidation constitute a major pathway in humans and may play an important role in biological activity of metabolites including the enterolignan, enterolactone. Because the aromatic structure of enterolactone has similarities to steroid metabolites, it was hypothesized......−MS/MS and a fluoroimmunoassay; however, most of these methods measure the total concentration of enterolactone, without any specification of its conjugation pattern. Here for the first time we present a high-throughput LC−MS/MS method to quantify enterolactone in its intact form as glucuronide, sulfate, and free enterolactone....... The method has shown good accuracy and precision at low concentration and very high sensitivity, with LLOQ for enterolactone sulfate at 16 pM, enterolactone glucuronide at 26 pM, and free enterolactone at 86 pM. The short run time of 2.6 min combined with simple sample clean up and high sensitivity make...

  7. Directly observed reversible shape changes and hemoglobin stratification during centrifugation of human and Amphiuma red blood cells.

    Science.gov (United States)

    Hoffman, Joseph F; Inoué, Shinya

    2006-02-21

    This paper describes changes that occur in human and Amphiuma red blood cells observed during centrifugation with a special microscope. Dilute suspensions of cells were layered, in a centrifuge chamber, above an osmotically matched dense solution, containing Nycodenz, Ficoll, or Percoll (Pharmacia) that formed a density gradient that allowed the cells to slowly settle to an equilibrium position. Biconcave human red blood cells moved downward at low forces with minimum wobble. The cells oriented vertically when the force field was increased and Hb sedimented as the lower part of each cell became bulged and assumed a "bag-like" shape. The upper centripetal portion of the cell became thinner and remained biconcave. These changes occurred rapidly and were completely reversible upon lowering the centrifugal force. Bag-shaped cells, upon touching red cells in rouleau, immediately reverted to biconcave disks as they flipped onto a stack. Amphiuma red cells displayed a different type of reversible stratification and deformation at high force fields. Here the cells became stretched, with the nucleus now moving centrifugally, the Hb moving centripetally, and the bottom of the cells becoming thinner and clear. Nevertheless, the distribution of the marginal bands at the cells' rim was unchanged. We conclude that centrifugation, per se, while changing a red cell's shape and the distribution of its intracellular constituents, does so in a completely reversible manner. Centrifugation of red cells harboring altered or missing structural elements could provide information on shape determinants that are still unexplained.

  8. Comparison of multiple assays for detecting human antibodies directed against antigens on normal and malignant tissue culture cells

    International Nuclear Information System (INIS)

    Rosenberg, S.A.; Schwarz, S.; Anding, H.; Hyatt, C.; Williams, G.M.; Johns Hopkins Univ., Baltimore, Md.

    1977-01-01

    Four separate assays of human antibody reactivity to four separate normal and malignant human tissue culture cells lines from two patients have been evaluated using a single highly-reactive allogeneic serum. The visual end-point cytolysis assay and the chromium-51 release assay were equally sensitive in measuring complement mediated antibody cytotoxicity and both were far more sensitive than a trypan blue dye exclusion assay. The assay of antibody reactivity by hemadsorption technique was about 10 times more sensitive than any of the cytotoxicity assays. This latter assay measures only IgG antibody however. These assays showed that cell lines from different patients may differ greatly in 'reactivity' to an allogeneic serum and emphasized the importance of utilizing tumor and normal cells from the same patient when using tissue culture cells to search for tumor specific reactivity. These observations emphasize the importance of utilizing multiple assays against paired normal and malignant cells from the same patient to be certain of the specificity and magnitude of the measured antibody

  9. Modeling the phenotype of spinal muscular atrophy by the direct conversion of human fibroblasts to motor neurons.

    Science.gov (United States)

    Zhang, Qi-Jie; Li, Jin-Jing; Lin, Xiang; Lu, Ying-Qian; Guo, Xin-Xin; Dong, En-Lin; Zhao, Miao; He, Jin; Wang, Ning; Chen, Wan-Jin

    2017-02-14

    Spinal muscular atrophy (SMA) is a lethal autosomal recessive neurological disease characterized by selective degeneration of motor neurons in the spinal cord. In recent years, the development of cellular reprogramming technology has provided an alternative and effective method for obtaining patient-specific neurons in vitro. In the present study, we applied this technology to the field of SMA to acquire patient-specific induced motor neurons that were directly converted from fibroblasts via the forced expression of 8 defined transcription factors. The infected fibroblasts began to grow in a dipolar manner, and the nuclei gradually enlarged. Typical Tuj1-positive neurons were generated at day 23. After day 35, induced neurons with multiple neurites were observed, and these neurons also expressed the hallmarks of Tuj1, HB9, ISL1 and CHAT. The conversion efficiencies were approximately 5.8% and 5.5% in the SMA and control groups, respectively. Additionally, the SMA-induced neurons exhibited a significantly reduced neurite outgrowth rate compared with the control neurons. After day 60, the SMA-induced neurons also exhibited a liability of neuronal degeneration and remarkable fracturing of the neurites was observed. By directly reprogramming fibroblasts, we established a feeder-free conversion system to acquire SMA patient-specific induced motor neurons that partially modeled the phenotype of SMA in vitro.

  10. Role of the HSPA9/HSC20 chaperone pair in promoting directional human iron-sulfur cluster exchange involving monothiol glutaredoxin 5.

    Science.gov (United States)

    Olive, Joshua A; Cowan, J A

    2018-07-01

    Iron‑sulfur clusters are essential cofactors found across all domains of life. Their assembly and transfer are accomplished by highly conserved protein complexes and partners. In eukaryotes a [2Fe-2S] cluster is first assembled in the mitochondria on the iron‑sulfur cluster scaffold protein ISCU in tandem with iron, sulfide, and electron donors. Current models suggest that a chaperone pair interacts with a cluster-bound ISCU to facilitate cluster transfer to a monothiol glutaredoxin. In humans this protein is glutaredoxin 5 (GLRX5) and the cluster can then be exchanged with a variety of target apo proteins. By use of circular dichroism spectroscopy, the kinetics of cluster exchange reactivity has been evaluated for human GLRX5 with a variety of cluster donor and acceptor partners, and the role of chaperones determined for several of these. In contrast to the prokaryotic model, where heat-shock type chaperone proteins HscA and HscB are required for successful and efficient transfer of a [2Fe-2S] cluster from the ISCU scaffold to a monothiol glutaredoxin. However, in the human system the chaperone homologs, HSPA9 and HSC20, are not necessary for human ISCU to promote cluster transfer to GLRX5, and appear to promote the reverse transfer. Cluster exchange with the human iron‑sulfur cluster carrier protein NFU1 and ferredoxins (FDX's), and the role of chaperones, has also been evaluated, demonstrating in certain cases control over the directionality of cluster transfer. In contrast to other prokaryotic and eukaryotic organisms, NFU1 is identified as a more likely physiological donor of [2Fe-2S] cluster to human GLRX5 than ISCU. Copyright © 2018 Elsevier Inc. All rights reserved.

  11. Scanning electron microscopy (SEM) and X-ray dispersive spectrometry evaluation of direct laser metal sintering surface and human bone interface: a case series.

    Science.gov (United States)

    Mangano, Carlo; Piattelli, Adriano; Raspanti, Mario; Mangano, Francesco; Cassoni, Alessandra; Iezzi, Giovanna; Shibli, Jamil Awad

    2011-01-01

    Recent studies have shown that direct laser metal sintering (DLMS) produces structures with complex geometry and consequently that allow better osteoconductive properties. The aim of this patient report was to evaluate the early bone response to DLMS implant surface retrieved from human jaws. Four experimental DLMS implants were inserted in the posterior mandible of four patients during conventional dental implant surgery. After 8 weeks, the micro-implants and the surrounding tissue were removed and prepared for scanning electron microscopy (SEM) and histomorphometric analysis to evaluate the bone-implant interface. The SEM and EDX evaluations showed a newly formed tissue composed of calcium and phosphorus. The bone-to-implant contact presented a mean of 60.5 ± 11.6%. Within the limits of this patient report, data suggest that the DLMS surfaces presented a close contact with the human bone after a healing period of 8 weeks.

  12. Cytokine-free directed differentiation of human pluripotent stem cells efficiently produces hemogenic endothelium with lymphoid potential.

    Science.gov (United States)

    Galat, Yekaterina; Dambaeva, Svetlana; Elcheva, Irina; Khanolkar, Aaruni; Beaman, Kenneth; Iannaccone, Philip M; Galat, Vasiliy

    2017-03-17

    The robust generation of human hematopoietic progenitor cells from induced or embryonic pluripotent stem cells would be beneficial for multiple areas of research, including mechanistic studies of hematopoiesis, the development of cellular therapies for autoimmune diseases, induced transplant tolerance, anticancer immunotherapies, disease modeling, and drug/toxicity screening. Over the past years, significant progress has been made in identifying effective protocols for hematopoietic differentiation from pluripotent stem cells and understanding stages of mesodermal, endothelial, and hematopoietic specification. Thus, it has been shown that variations in cytokine and inhibitory molecule treatments in the first few days of hematopoietic differentiation define primitive versus definitive potential of produced hematopoietic progenitor cells. The majority of current feeder-free, defined systems for hematopoietic induction from pluripotent stem cells include prolonged incubations with various cytokines that make the differentiation process complex and time consuming. We established that the application of Wnt agonist CHIR99021 efficiently promotes differentiation of human pluripotent stem cells in the absence of any hematopoietic cytokines to the stage of hemogenic endothelium capable of definitive hematopoiesis. The hemogenic endothelium differentiation was accomplished in an adherent, serum-free culture system by applying CHIR99021. Hemogenic endothelium progenitor cells were isolated on day 5 of differentiation and evaluated for their endothelial, myeloid, and lymphoid potential. Monolayer induction based on GSK3 inhibition, described here, yielded a large number of CD31 + CD34 + hemogenic endothelium cells. When isolated and propagated in adherent conditions, these progenitors gave rise to mature endothelium. When further cocultured with OP9 mouse stromal cells, these progenitors gave rise to various cells of myeloid lineages as well as natural killer lymphoid, T

  13. Direct effects of locally administered lipopolysaccharide on glucose, lipid, and protein metabolism in the placebo-controlled, bilaterally infused human leg

    DEFF Research Database (Denmark)

    Buhl, Mads; Bosnjak, Ermina; Vendelbo, Mikkel H.

    2013-01-01

    Context: Accumulating evidence suggests that chronic exposure to lipopolysaccharide (LPS, endotoxin) maycreate a constant low-grade inflammation, leading to insulin resistance and diabetes. All previous human studies assessing the metabolic actions of LPS have used systemic administration, making...... palmitate isotopic dilution, although primary ANOVA tests did not reveal significant dilution. Leg blood flows, phenylalanine, lactate kinetics, cytokines, and intramyocellular insulin signaling were not affected by LPS. LPS thus directly inhibits insulin-stimulated glucose uptake and increases palmitate...... and stress hormone release may lead to overt glucose intolerance and diabetes....

  14. An exploratory study of adolescent female reactions to direct-to-consumer advertising: the case of the Human Papillomavirus (HPV) Vaccine.

    Science.gov (United States)

    Leader, Amy E; Cashman, Rebecca; Voytek, Chelsea D; Baker, Jillian L; Brawner, Bridgette M; Frank, Ian

    2011-10-01

    When the human papillomavirus (HPV) vaccine was approved in 2006, an extensive direct-to-consumer (DTC) advertising campaign raised awareness and promoted vaccination. This study explores adolescents' exposure to and understanding of the messages in these advertisements. Sixty-seven African American females participated in a focus group about DTC advertising for the HPV vaccine. Virtually all adolescents had seen an HPV vaccine DTC advertisement, but most did not understand the health information contained in it. If DTC advertising is to be an effective source of health information for adolescents in the future, it must take into account the unique features of an adolescent audience.

  15. Assessing Brain–Muscle Connectivity in Human Locomotion through Mobile Brain/Body Imaging: Opportunities, Pitfalls, and Future Directions

    Directory of Open Access Journals (Sweden)

    Federico Gennaro

    2018-02-01

    Full Text Available Assessment of the cortical role during bipedalism has been a methodological challenge. While surface electroencephalography (EEG is capable of non-invasively measuring cortical activity during human locomotion, it is associated with movement artifacts obscuring cerebral sources of activity. Recently, statistical methods based on blind source separation revealed potential for resolving this issue, by segregating non-cerebral/artifactual from cerebral sources of activity. This step marked a new opportunity for the investigation of the brains’ role while moving and was tagged mobile brain/body imaging (MoBI. This methodology involves simultaneous mobile recording of brain activity with several other body behavioral variables (e.g., muscle activity and kinematics, through wireless recording wearable devices/sensors. Notably, several MoBI studies using EEG–EMG approaches recently showed that the brain is functionally connected to the muscles and active throughout the whole gait cycle and, thus, rejecting the long-lasting idea of a solely spinal-driven bipedalism. However, MoBI and brain/muscle connectivity assessments during human locomotion are still in their fledgling state of investigation. Mobile brain/body imaging approaches hint toward promising opportunities; however, there are some remaining pitfalls that need to be resolved before considering their routine clinical use. This article discusses several of these pitfalls and proposes research to address them. Examples relate to the validity, reliability, and reproducibility of this method in ecologically valid scenarios and in different populations. Furthermore, whether brain/muscle connectivity within the MoBI framework represents a potential biomarker in neuromuscular syndromes where gait disturbances are evident (e.g., age-related sarcopenia remains to be determined.

  16. Direct exposure of guinea pig CNS to human luteinizing hormone increases cerebrospinal fluid and cerebral beta amyloid levels.

    Science.gov (United States)

    Wahjoepramono, Eka J; Wijaya, Linda K; Taddei, Kevin; Bates, Kristyn A; Howard, Matthew; Martins, Georgia; deRuyck, Karl; Matthews, Paul M; Verdile, Giuseppe; Martins, Ralph N

    2011-01-01

    Luteinizing hormone (LH) has been shown to alter the metabolism of beta amyloid (Aβ), a key protein in Alzheimer's disease (AD) pathogenesis. While LH and components required for LH receptor signalling are present in the brain, their role in the CNS remains unclear. In vitro, LH has been shown to facilitate neurosteroid production and alter Aβ metabolism. However, whether LH can directly modulate cerebral Aβ levels in vivo has not previously been studied. In this study, we investigated the effect of chronic administration of LH to the guinea pig CNS on cerebral Aβ levels. Gonadectomised male animals were administered, via cortical placement, either placebo or LH slow-release pellets. At 14 and 28 days after treatment, animals were sacrificed. Brain, plasma and CSF were collected and Aβ levels measured via ELISA. Levels of the Aβ precursor protein (APP) and the neurosteroidogenic enzyme cytochrome P450 side-chain cleavage enzyme (P450scc) were also assayed. An increase in CSF Aβ40 levels was observed 28 days following treatment. These CSF data also reflected changes in Aβ40 levels observed in brain homogenates. No change was observed in plasma Aβ40 levels but APP and its C-terminal fragments (APP-CTF) were significantly increased in response to LH exposure. Protein expression of P450scc was increased after 28 days of LH exposure, suggesting activation of the LH receptor. These data indicate that direct exposure of guinea pig CNS to LH results in altered brain Aβ levels, perhaps due to altered APP expression/metabolism. Copyright © 2011 S. Karger AG, Basel.

  17. The Processed Amino-Terminal Fragment of Human TLR7 Acts as a Chaperone To Direct Human TLR7 into Endosomes

    Science.gov (United States)

    Shepherd, Dawn; Booth, Sarah; Waithe, Dominic; Reis e Sousa, Caetano

    2015-01-01

    TLR7 mediates innate immune responses to viral RNA in endocytic compartments. Mouse and human (h)TLR7 undergo proteolytic cleavage, resulting in the generation of a C-terminal fragment that accumulates in endosomes and associates with the signaling adaptor MyD88 upon receptor triggering by TLR7 agonists. Although mouse TLR7 is cleaved in endosomes by acidic proteases, hTLR7 processing can occur at neutral pH throughout the secretory pathway through the activity of furin-like proprotein convertases. However, the mechanisms by which cleaved hTLR7 reaches the endosomal compartment remain unclear. In this study, we demonstrate that, after hTLR7 proteolytic processing, the liberated amino (N)-terminal fragment remains bound to the C terminus through disulfide bonds and provides key trafficking information that ensures correct delivery of the complex to endosomal compartments. In the absence of the N-terminal fragment, the C-terminal fragment is redirected to the cell surface, where it is functionally inactive. Our data reveal a novel role for the N terminus of hTLR7 as a molecular chaperone that provides processed hTLR7 with the correct targeting instructions to reach the endosomal compartment, hence ensuring its biological activity and preventing inadvertent cell surface responses to self-RNA. PMID:25917086

  18. Neural patterning of human induced pluripotent stem cells in 3-D cultures for studying biomolecule-directed differential cellular responses.

    Science.gov (United States)

    Yan, Yuanwei; Bejoy, Julie; Xia, Junfei; Guan, Jingjiao; Zhou, Yi; Li, Yan

    2016-09-15

    Appropriate neural patterning of human induced pluripotent stem cells (hiPSCs) is critical to generate specific neural cells/tissues and even mini-brains that are physiologically relevant to model neurological diseases. However, the capacity of signaling factors that regulate 3-D neural tissue patterning in vitro and differential responses of the resulting neural populations to various biomolecules have not yet been fully understood. By tuning neural patterning of hiPSCs with small molecules targeting sonic hedgehog (SHH) signaling, this study generated different 3-D neuronal cultures that were mainly comprised of either cortical glutamatergic neurons or motor neurons. Abundant glutamatergic neurons were observed following the treatment with an antagonist of SHH signaling, cyclopamine, while Islet-1 and HB9-expressing motor neurons were enriched by an SHH agonist, purmorphamine. In neurons derived with different neural patterning factors, whole-cell patch clamp recordings showed similar voltage-gated Na(+)/K(+) currents, depolarization-evoked action potentials and spontaneous excitatory post-synaptic currents. Moreover, these different neuronal populations exhibited differential responses to three classes of biomolecules, including (1) matrix metalloproteinase inhibitors that affect extracellular matrix remodeling; (2) N-methyl-d-aspartate that induces general neurotoxicity; and (3) amyloid β (1-42) oligomers that cause neuronal subtype-specific neurotoxicity. This study should advance our understanding of hiPSC self-organization and neural tissue development and provide a transformative approach to establish 3-D models for neurological disease modeling and drug discovery. Appropriate neural patterning of human induced pluripotent stem cells (hiPSCs) is critical to generate specific neural cells, tissues and even mini-brains that are physiologically relevant to model neurological diseases. However, the capability of sonic hedgehog-related small molecules to tune

  19. Direct Reprogramming of Human Bone Marrow Stromal Cells into Functional Renal Cells Using Cell-free Extracts

    Directory of Open Access Journals (Sweden)

    Evangelia Papadimou

    2015-04-01

    Full Text Available The application of cell-based therapies in regenerative medicine is gaining recognition. Here, we show that human bone marrow stromal cells (BMSCs, also known as bone-marrow-derived mesenchymal cells, can be reprogrammed into renal proximal tubular-like epithelial cells using cell-free extracts. Streptolysin-O-permeabilized BMSCs exposed to HK2-cell extracts underwent morphological changes—formation of “domes” and tubule-like structures—and acquired epithelial functional properties such as transepithelial-resistance, albumin-binding, and uptake and specific markers E-cadherin and aquaporin-1. Transmission electron microscopy revealed the presence of brush border microvilli and tight intercellular contacts. RNA sequencing showed tubular epithelial transcript abundance and revealed the upregulation of components of the EGFR pathway. Reprogrammed BMSCs integrated into self-forming kidney tissue and formed tubular structures. Reprogrammed BMSCs infused in immunodeficient mice with cisplatin-induced acute kidney injury engrafted into proximal tubuli, reduced renal injury and improved function. Thus, reprogrammed BMSCs are a promising cell resource for future cell therapy.

  20. Evaluation of E-Cigarette Liquid Vapor and Mainstream Cigarette Smoke after Direct Exposure of Primary Human Bronchial Epithelial Cells

    Directory of Open Access Journals (Sweden)

    Stefanie Scheffler

    2015-04-01

    Full Text Available E-cigarettes are emerging products, often described as “reduced-risk” nicotine products or alternatives to combustible cigarettes. Many smokers switch to e-cigarettes to quit or significantly reduce smoking. However, no regulations for e-cigarettes are currently into force, so that the quality and safety of e-liquids is not necessarily guaranteed. We exposed primary human bronchial epithelial cells of two different donors to vapor of e-cigarette liquid with or without nicotine, vapor of the carrier substances propylene glycol and glycerol as well as to mainstream smoke of K3R4F research cigarettes. The exposure was done in a CULTEX® RFS compact  module, allowing the exposure of the cells at the air-liquid interface. 24 h post-exposure, cell viability and oxidative stress levels in the cells were analyzed. We found toxicological effects of e-cigarette vapor and the pure carrier substances, whereas the nicotine concentration did not have an effect on the cell viability. The viability of mainstream smoke cigarette exposed cells was 4.5–8 times lower and the oxidative stress levels 4.5–5 times higher than those of e-cigarette vapor exposed cells, depending on the donor. Our experimental setup delivered reproducible data and thus provides the opportunity for routine testing of e-cigarette liquids to ensure safety and quality for the user.

  1. Evaluation of E-cigarette liquid vapor and mainstream cigarette smoke after direct exposure of primary human bronchial epithelial cells.

    Science.gov (United States)

    Scheffler, Stefanie; Dieken, Hauke; Krischenowski, Olaf; Förster, Christine; Branscheid, Detlev; Aufderheide, Michaela

    2015-04-08

    E-cigarettes are emerging products, often described as "reduced-risk" nicotine products or alternatives to combustible cigarettes. Many smokers switch to e-cigarettes to quit or significantly reduce smoking. However, no regulations for e-cigarettes are currently into force, so that the quality and safety of e-liquids is not necessarily guaranteed. We exposed primary human bronchial epithelial cells of two different donors to vapor of e-cigarette liquid with or without nicotine, vapor of the carrier substances propylene glycol and glycerol as well as to mainstream smoke of K3R4F research cigarettes. The exposure was done in a CULTEX® RFS compact  module, allowing the exposure of the cells at the air-liquid interface. 24 h post-exposure, cell viability and oxidative stress levels in the cells were analyzed. We found toxicological effects of e-cigarette vapor and the pure carrier substances, whereas the nicotine concentration did not have an effect on the cell viability. The viability of mainstream smoke cigarette exposed cells was 4.5-8 times lower and the oxidative stress levels 4.5-5 times higher than those of e-cigarette vapor exposed cells, depending on the donor. Our experimental setup delivered reproducible data and thus provides the opportunity for routine testing of e-cigarette liquids to ensure safety and quality for the user.

  2. Electrochemical approach for acute myocardial infarction diagnosis based on direct antibodies-free analysis of human blood plasma.

    Science.gov (United States)

    Suprun, Elena V; Saveliev, Anatoly A; Evtugyn, Gennady A; Lisitsa, Alexander V; Bulko, Tatiana V; Shumyantseva, Victoria V; Archakov, Alexander I

    2012-03-15

    A novel direct antibodies-free electrochemical approach for acute myocardial infarction (AMI) diagnosis has been developed. For this purpose, a combination of the electrochemical assay of plasma samples with chemometrics was proposed. Screen printed carbon electrodes modified with didodecyldimethylammonium bromide were used for plasma charactrerization by cyclic (CV) and square wave voltammetry and square wave (SWV) voltammetry. It was shown that the cathodic peak in voltammograms at about -250 mV vs. Ag/AgCl can be associated with AMI. In parallel tests, cardiac myoglobin and troponin I, the AMI biomarkers, were determined in each sample by RAMP immunoassay. The applicability of the electrochemical testing for AMI diagnostics was confirmed by statistical methods: generalized linear model (GLM), linear discriminant analysis (LDA) and quadratic discriminant analysis (QDA), artificial neural net (multi-layer perception, MLP), and support vector machine (SVM), all of which were created to obtain the "True-False" distribution prediction where "True" and "False" are, respectively, positive and negative decision about an illness event. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Rapid determination of piracetam in human plasma and cerebrospinal fluid by micellar electrokinetic chromatography with sample direct injection.

    Science.gov (United States)

    Yeh, Hsin-Hua; Yang, Yuan-Han; Ko, Ju-Yun; Chen, Su-Hwei

    2006-07-07

    A simple micellar electrokinetic chromatography (MEKC) method with UV detection at 200 nm for analysis of piracetam in plasma and in cerebrospinal fluid (CSF) by direct injection without any sample pretreatment is described. The separation of piracetam from biological matrix was performed at 25 degrees C using a background electrolyte consisting of Tris buffer with sodium dodecyl sulfate (SDS) as the electrolyte solution. Several parameters affecting the separation of the drug from biological matrix were studied, including the pH and concentrations of the Tris buffer and SDS. Under optimal MEKC condition, good separation with high efficiency and short analyses time is achieved. Using imidazole as an internal standard (IS), the linear ranges of the method for the determination of piracetam in plasma and in CSF were all between 5 and 500 microg/mL; the detection limit of the drug in plasma and in CSF (signal-to-noise ratio=3; injection 0.5 psi, 5s) was 1.0 microg/mL. The applicability of the proposed method for determination of piracetam in plasma and CSF collected after intravenous administration of 3g piracetam every 6h and oral administration 1.2g every 6h in encephalopathy patients with aphasia was demonstrated.

  4. Energy Expenditure Evaluation in Humans and Non-Human Primates by SenseWear Armband. Validation of Energy Expenditure Evaluation by SenseWear Armband by Direct Comparison with Indirect Calorimetry

    Science.gov (United States)

    Casiraghi, Francesca; Chavez, Alberto O.; Davalli, Alberto M.; Naegelin, Terry; Comuzzie, Anthony G.; Frost, Patricia; Musi, Nicolas; Folli, Franco

    2013-01-01

    Introduction The purpose of this study was to compare and validate the use of SenseWear Armband (SWA) placed on the arm (SWA ARM) and on the back (SWA BACK) in healthy humans during resting and a cycle-ergometer exercise and to evaluate the SWA to estimate Resting Energy Expenditure (REE) and Total Energy Expenditure (TEE) in healthy baboons. Methods We studied 26 (15F/11M) human subjects wearing SWA in two different anatomical sites (arm and back) during resting and a cycle-ergometer test and directly compared these results with indirect calorimetry evaluation (IC), performed at the same time. We then inserted the SWA in a metabolic jacket for baboons and evaluated the TEE and REE in free living condition for 6 days in 21 (8F/13M) non-human primates. Results In humans we found a good correlation between SWA place on the ARM and on the BACK with IC during the resting experiment (1.1±0.3 SWAs, 1±0.2 IC kcal/min) and a slight underestimation in the SWAs data compared with IC during the cycle-ergometer exercise (5±1.9 SWA ARM, 4.5±1.5 SWA BACK and 5.4±2.1 IC kcal/min). In the non-human primate (baboons) experiment SWA estimated a TEE of 0.54±0.009 kcal/min during free living and a REE of 0.82±0.06 kcal/min. Conclusion SWA, an extremely simple and inexpensive apparatus, provides quite accurate measurements of energy expenditure in humans and in baboons. Energy expenditure data obtained with SWA are highly correlated with the data obtained with “gold standard”, IC, in humans. PMID:24069218

  5. Energy expenditure evaluation in humans and non-human primates by SenseWear Armband. Validation of energy expenditure evaluation by SenseWear Armband by direct comparison with indirect calorimetry.

    Science.gov (United States)

    Casiraghi, Francesca; Lertwattanarak, Raweewan; Luzi, Livio; Chavez, Alberto O; Davalli, Alberto M; Naegelin, Terry; Comuzzie, Anthony G; Frost, Patricia; Musi, Nicolas; Folli, Franco

    2013-01-01

    The purpose of this study was to compare and validate the use of SenseWear Armband (SWA) placed on the arm (SWA ARM) and on the back (SWA BACK) in healthy humans during resting and a cycle-ergometer exercise and to evaluate the SWA to estimate Resting Energy Expenditure (REE) and Total Energy Expenditure (TEE) in healthy baboons. We studied 26 (15F/11M) human subjects wearing SWA in two different anatomical sites (arm and back) during resting and a cycle-ergometer test and directly compared these results with indirect calorimetry evaluation (IC), performed at the same time. We then inserted the SWA in a metabolic jacket for baboons and evaluated the TEE and REE in free living condition for 6 days in 21 (8F/13M) non-human primates. In humans we found a good correlation between SWA place on the ARM and on the BACK with IC during the resting experiment (1.1±0.3 SWAs, 1±0.2 IC kcal/min) and a slight underestimation in the SWAs data compared with IC during the cycle-ergometer exercise (5±1.9 SWA ARM, 4.5±1.5 SWA BACK and 5.4±2.1 IC kcal/min). In the non-human primate (baboons) experiment SWA estimated a TEE of 0.54±0.009 kcal/min during free living and a REE of 0.82±0.06 kcal/min. SWA, an extremely simple and inexpensive apparatus, provides quite accurate measurements of energy expenditure in humans and in baboons. Energy expenditure data obtained with SWA are highly correlated with the data obtained with "gold standard", IC, in humans.

  6. Direct U-series analysis of the Lezetxiki humerus reveals a Middle Pleistocene age for human remains in the Basque Country (northern Iberia).

    Science.gov (United States)

    de-la-Rúa, Concepción; Altuna, Jesús; Hervella, Monserrat; Kinsley, Leslie; Grün, Rainer

    2016-04-01

    In 1964, a human humerus was found in a sedimentary deposit in Lezetxiki Cave (Basque Country, northern Iberia). The first studies on the stratigraphy, associated mammal faunal remains and lithic implements placed the deposits containing the humerus into the Riss glacial stage. Direct chronometric evidence has so far been missing, and the previous chronostratigraphic framework and faunal dating gave inconsistent results. Here we report laser ablation U-series analyses on the humerus yielding a minimum age of 164 ± 9 ka, corresponding to MIS 6. This is the only direct dating analysis of the Lezetxiki humerus and confirms a Middle Pleistocene age for this hominin fossil. Morphometric analyses suggest that the Lezetxiki humerus has close affinities to other Middle Pleistocene archaic hominins, such as those from La Sima de los Huesos at Atapuerca. This emphasizes the significance of the Lezetxiki fossil within the populations that predate the Neanderthals in south-western Europe. It is thus an important key fossil for the understanding of human evolution in Europe during the Middle Pleistocene, a time period when a great morphological diversity is observed but whose phylogenetic meaning is not yet fully understood. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Chondroprotective effects of a proanthocyanidin rich Amazonian genonutrient reflects direct inhibition of matrix metalloproteinases and upregulation of IGF-1 production by human chondrocytes

    Directory of Open Access Journals (Sweden)

    Gupta Kalpana

    2007-08-01

    Full Text Available Abstract Background The Amazonian medicinal plant Sangre de grado (Croton palanostigma has traditional applications for the treatment of wound healing and inflammation. We sought to characterize two extracts (progrado and zangrado in terms of safety and oligomeric proanthocyanidin chain length. Additionally progrado was evaluated for antioxidant activity and possible chondroprotective actions. Methods Acute oral safety and toxicity was tested in rats according under OECD protocol number 420. The profile of proanthocyanidin oligomers was determined by HPLC and progrado's antioxidant activity quantified by the ORAC, NORAC and HORAC assays. Human cartilage explants, obtained from surgical specimens, were used to assess chondroproteciton with activity related to direct inhibitory effects on human matrix metalloproteinase (MMP, gelatinolytic activity using synovial fluid and chondrocytes activated with IL-1β (10 ng/ml. Additionally, progrado (2–10 μg/ml was tested for its ability to maintain optimal IGF-1 transcription and translation in cartilage explants and cultured chondrocytes. Results Both progrado and zangrado at doses up to 2000 mg/kg (po displayed no evidence of toxicity. Oligomeric proanthocyanidin content was high for both progrado (158 mg/kg and zangrado (124 mg/kg, with zangrado almost entirely composed of short oligomers ( Conclusion Progrado has a promising safety profile, significant chondroprotective and antioxidant actions, directly inhibits MMP activity and promotes the production of the cartilage repair factor, IGF-1. This suggests that progrado may offer therapeutic benefits in joint health, wound healing and inflammation.

  8. Simultaneous determination of glucose, triglycerides, urea, cholesterol, albumin and total protein in human plasma by Fourier transform infrared spectroscopy: direct clinical biochemistry without reagents.

    Science.gov (United States)

    Jessen, Torben E; Höskuldsson, Agnar T; Bjerrum, Poul J; Verder, Henrik; Sørensen, Lars; Bratholm, Palle S; Christensen, Bo; Jensen, Lene S; Jensen, Maria A B

    2014-09-01

    Direct measurement of chemical constituents in complex biologic matrices without the use of analyte specific reagents could be a step forward toward the simplification of clinical biochemistry. Problems related to reagents such as production errors, improper handling, and lot-to-lot variations would be eliminated as well as errors occurring during assay execution. We describe and validate a reagent free method for direct measurement of six analytes in human plasma based on Fourier-transform infrared spectroscopy (FTIR). Blood plasma is analyzed without any sample preparation. FTIR spectrum of the raw plasma is recorded in a sampling cuvette specially designed for measurement of aqueous solutions. For each analyte, a mathematical calibration process is performed by a stepwise selection of wavelengths giving the optimal least-squares correlation between the measured FTIR signal and the analyte concentration measured by conventional clinical reference methods. The developed calibration algorithms are subsequently evaluated for their capability to predict the concentration of the six analytes in blinded patient samples. The correlation between the six FTIR methods and corresponding reference methods were 0.87albumin and total protein in human plasma. Copyright © 2014 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  9. Selective toxicity of persian gulf sea cucumber holothuria parva on human chronic lymphocytic leukemia b lymphocytes by direct mitochondrial targeting.

    Science.gov (United States)

    Salimi, Ahmad; Motallebi, Abbasali; Ayatollahi, Maryam; Seydi, Enayatollah; Mohseni, Ali Reza; Nazemi, Melika; Pourahmad, Jalal

    2017-04-01

    Natural products isolated from marine environment are well known for their pharmacodynamic potential in diversity of disease treatments such as cancer or inflammatory conditions. Sea cucumbers are one of the marine animals of the phylum Echinoderm. Many studies have shown that the sea cucumber contains antioxidants and anti-cancer compounds. Chronic lymphocytic leukemia (CLL) is a disease characterized by the relentless accumulation of CD5 + B lymphocytes. CLL is the most common leukemia in adults, about 25-30% of all leukemias. In this study B lymphocytes and their mitochondria (cancerous and non-cancerous) were obtained from peripheral blood of human subjects and B lymphocyte cytotoxicity assay, and caspase 3 activation along with mitochondrial upstream events of apoptosis signaling including reactive oxygen species (ROS) production, collapse of mitochondrial membrane potential (MMP) and mitochondrial swelling were determined following the addition of Holothuria parva extract to both cancerous and non-cancerous B lymphocytes and their mitochondria. Our in vitro finding showed that mitochondrial ROS formation, MMP collapse, and mitochondrial swelling and cytochrome c release were significantly (P < 0.05) increased after addition of different concentrations of H. parva only in cancerous BUT NOT normal non-cancerous mitochondria. Consistently, different concentrations of H. parva significantly (P < 0.05) increased cytotoxicity and caspase 3 activation only in cancerous BUT NOT normal non-cancerous B lymphocytes. These results showed that H. parva methanolic extract has a selective mitochondria mediated apoptotic effect on chronic lymphocytic leukemia B lymphocytes hence may be promising in the future anticancer drug development for treatment of CLL. © 2016 Wiley Periodicals, Inc. Environ Toxicol 32: 1158-1169, 2017. © 2016 Wiley Periodicals, Inc.

  10. Probing neural mechanisms underlying auditory stream segregation in humans by transcranial direct current stimulation (tDCS).

    Science.gov (United States)

    Deike, Susann; Deliano, Matthias; Brechmann, André

    2016-10-01

    One hypothesis concerning the neural underpinnings of auditory streaming states that frequency tuning of tonotopically organized neurons in primary auditory fields in combination with physiological forward suppression is necessary for the separation of representations of high-frequency A and low-frequency B tones. The extent of spatial overlap between the tonotopic activations of A and B tones is thought to underlie the perceptual organization of streaming sequences into one coherent or two separate streams. The present study attempts to interfere with these mechanisms by transcranial direct current stimulation (tDCS) and to probe behavioral outcomes reflecting the perception of ABAB streaming sequences. We hypothesized that tDCS by modulating cortical excitability causes a change in the separateness of the representations of A and B tones, which leads to a change in the proportions of one-stream and two-stream percepts. To test this, 22 subjects were presented with ambiguous ABAB sequences of three different frequency separations (∆F) and had to decide on their current percept after receiving sham, anodal, or cathodal tDCS over the left auditory cortex. We could confirm our hypothesis at the most ambiguous ∆F condition of 6 semitones. For anodal compared with sham and cathodal stimulation, we found a significant decrease in the proportion of two-stream perception and an increase in the proportion of one-stream perception. The results demonstrate the feasibility of using tDCS to probe mechanisms underlying auditory streaming through the use of various behavioral measures. Moreover, this approach allows one to probe the functions of auditory regions and their interactions with other processing stages. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Perceptual learning of motion direction discrimination with suppressed and unsuppressed MT in humans: an fMRI study.

    Directory of Open Access Journals (Sweden)

    Benjamin Thompson

    Full Text Available The middle temporal area of the extrastriate visual cortex (area MT is integral to motion perception and is thought to play a key role in the perceptual learning of motion tasks. We have previously found, however, that perceptual learning of a motion discrimination task is possible even when the training stimulus contains locally balanced, motion opponent signals that putatively suppress the response of MT. Assuming at least partial suppression of MT, possible explanations for this learning are that 1 training made MT more responsive by reducing motion opponency, 2 MT remained suppressed and alternative visual areas such as V1 enabled learning and/or 3 suppression of MT increased with training, possibly to reduce noise. Here we used fMRI to test these possibilities. We first confirmed that the motion opponent stimulus did indeed suppress the BOLD response within hMT+ compared to an almost identical stimulus without locally balanced motion signals. We then trained participants on motion opponent or non-opponent stimuli. Training with the motion opponent stimulus reduced the BOLD response within hMT+ and greater reductions in BOLD response were correlated with greater amounts of learning. The opposite relationship between BOLD and behaviour was found at V1 for the group trained on the motion-opponent stimulus and at both V1 and hMT+ for the group trained on the non-opponent motion stimulus. As the average response of many cells within MT to motion opponent stimuli is the same as their response to non-directional flickering noise, the reduced activation of hMT+ after training may reflect noise reduction.

  12. Direct induction of hepatocyte-like cells from immortalized human bone marrow mesenchymal stem cells by overexpression of HNF4α

    International Nuclear Information System (INIS)

    Hu, Xiaojun; Xie, Peiyi; Li, Weiqiang; Li, Zhengran; Shan, Hong

    2016-01-01

    Hepatocytes from human bone marrow-derived mesenchymal stem cells (hBM-MSCs) are expected to be a useful source for cell transplantation. However, relatively low efficiency and repeatability of hepatic differentiation of human BM-MSCs remains an obstacle for clinical translation. Hepatocyte nuclear factor 4 alpha (HNF4α), a critical transcription factor, plays an essential role in the entire process of liver development. In this study, immortalized hBM-MSCs, UE7T-13 cells were transduced with a lentiviral vector containing HNF4α. The typical fibroblast-like morphology of the MSCs changed, and polygonal, epithelioid cells grew out after HNF4α transduction. In hepatocyte culture medium, HNF4α-transduced MSCs (E7-hHNF4α cells) strongly expressed the albumin (ALB), CYP2B6, alpha-1 antitrypsin (AAT), and FOXA2 mRNA and exhibited morphology markedly similar to that of mature hepatocytes. The E7-hHNF4α cells showed hepatic functions such as Indocyanine green (ICG) uptake and release, glycogen storage, urea production and ALB secretion. Approximately 28% of E7-hHNF4α cells expressed both ALB and AAT. Furthermore, these E7-hHNF4α cells via superior mesenteric vein (SMV) injection expressed human ALB in mouse chronic injured liver. In conclusion, this study represents a novel strategy by directly inducing hepatocyte-like cells from MSCs. - Highlights: • We overexpressed HNF4α in immortalized BM-MSCs by lentiviral transduction. • HNF4α-transduced MSCs transdifferentiated into hepatocytes with mature hepatic metabolic functions. • Our study represents a novel strategy by direct induction of hepatocyte-like cells from MSCs.

  13. ChIP-on-chip analysis identifies IL-22 as direct target gene of ectopically expressed FOXP3 transcription factor in human T cells

    Directory of Open Access Journals (Sweden)

    Jeron Andreas

    2012-12-01

    Full Text Available Abstract Background The transcription factor (TF forkhead box P3 (FOXP3 is constitutively expressed at high levels in naturally occurring CD4+CD25+ regulatory T cells (nTregs. It is not only the most accepted marker for that cell population but is also considered lineage determinative. Chromatin immunoprecipitation (ChIP of TFs in combination with genomic tiling microarray analysis (ChIP-on-chip has been shown to be an appropriate tool for identifying FOXP3 transcription factor binding sites (TFBSs on a genome-wide scale. In combination with microarray expression analysis, the ChIP-on-chip technique allows identification of direct FOXP3 target genes. Results ChIP-on-chip analysis of the human FOXP3 expressed in resting and PMA/ionomycin–stimulated Jurkat T cells revealed several thousand putative FOXP3 binding sites and demonstrated the importance of intronic regions for FOXP3 binding. The analysis of expression data showed that the stimulation-dependent down-regulation of IL-22 was correlated with direct FOXP3 binding in the IL-22 promoter region. This association was confirmed by real-time PCR analysis of ChIP-DNA. The corresponding ChIP-region also contained a matching FOXP3 consensus sequence. Conclusions Knowledge of the general distribution patterns of FOXP3 TFBSs in the human genome under resting and activated conditions will contribute to a better understanding of this TF and its influence on direct target genes, as well as its importance for the phenotype and function of Tregs. Moreover, FOXP3-dependent repression of Th17-related IL-22 may be relevant to an understanding of the phenomenon of Treg/Th17 cell plasticity.

  14. Handling a crisis via a combination of human initiative and godly direction: Insights from the Book of Ruth

    Directory of Open Access Journals (Sweden)

    Robin Gallaher Branch

    2012-12-01

    Full Text Available The biblical text introduces Ruth, a Moabite woman, at a time of personal crisis. She faces destitution. Life has handed her multiple blows, amongst them widowhood and childlessness. Her single asset? Naomi, a cranky, elderly but endearing mother-in-law. Naomi, an Israelite and also widowed, is now quite determined to go home to Bethlehem. Ruth joins Naomi’s journey, but for Ruth it is a pilgrimage, for it is at this time that she switches allegiance from the gods of Moab to the God of Israel. As an immigrant facing change on every level – a new culture, a new religion, no friends and no job – Ruth nonetheless triumphs. Within only a couple of months, not only does she marry a prominent and prosperous bachelor, Boaz, but also wins the hearts of her mother-in-law’s friends, the women of Bethlehem. This analysis of her successful pilgrimage offers contemporary guidelines for facing dramatic changes. Using literary method, this article examines one of the Bible’s accounts of how a personal crisis is resolved via a combination of God’s providence and human initiative and courage. Die hantering van ’n krisis deur ’n kombinasie van menslike inisiatief en goddelike bestuur: Insigte uit die boek Rut. Die bybelse teks stel die leser voor aan Rut, ’n Moabitiese vrou, tydens ‘n persoonlike krisis in haar lewe. Sy is ’n weduwee, kinderloos en staar dus armoede in die gesig. Haar enigste pluspunt is Naomi, haar bejaarde, ietwat verbitterde dog innemende skoonmoeder. Naomi, ’n Israeliet en ook ’n weduwee, is vasbeslote om na haar huis in Betlehem terug te keer. Rut vergesel haar en dit word vir Rut ’n pelgrimstog na die God van Israel, weg van die afgode van Moab af. As immigrant wat ’n vreemde kultuur en godsdiens, ’n toekoms sonder vriende en werkloosheid moet verwerk, seëvier Rut uiteindelik. Sy trou binne ‘n paar maande met Boas, ’n prominente en welvarende vrygesel en wen ook die harte van haar skoonmoeder se

  15. Going skin deep: A direct comparison of penetration potential of lipid-based nanovesicles on the isolated perfused human skin flap model.

    Science.gov (United States)

    Ternullo, Selenia; de Weerd, Louis; Holsæter, Ann Mari; Flaten, Gøril Eide; Škalko-Basnet, Nataša

    2017-12-01

    Phospholipid-based nanocarriers are attractive drug carriers for improved local skin therapy. In the present study, the recently developed isolated perfused human skin flap (IPHSF) model was used to directly compare the skin penetration enhancing potential of the three commonly used nanocarriers, namely conventional liposomes (CLs), deformable liposomes (DLs) and solid lipid nanoparticles (SLNs). Two fluorescent markers, calcein (hydrophilic) or rhodamine (lipophilic), were incorporated individually in the three nanosystems. The nanocarrier size ranged between 200 and 300nm; the surface charge and entrapment efficiency for both markers were dependent on the lipid composition and the employed surfactant. Both carrier-associated markers could not penetrate the full thickness human skin, confirming their suitability for dermal drug delivery. CLs exhibited higher retention of both markers on the skin surface compared to DLs and SLNs, indicating a depo formation. DLs and SLNs enabled the deeper penetration of the two markers into the skin layers. In vitro and ex vivo skin penetration studies performed on the cellophane membrane and full thickness pig/human skin, respectively, confirmed the findings. In conclusion, efficient dermal drug delivery can be achieved by optimization of a lipid nanocarrier on the suitable skin-mimicking model to assure system's accumulation in the targeted skin layer. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Fully human IgG and IgM antibodies directed against the carcinoembryonic antigen (CEA Gold 4 epitope and designed for radioimmunotherapy (RIT of colorectal cancers

    Directory of Open Access Journals (Sweden)

    Pugnière Martine

    2004-10-01

    Full Text Available Abstract Background Human monoclonal antibodies (MAbs are needed for colon cancer radioimmunotherapy (RIT to allow for repeated injections. Carcinoembryonic antigen (CEA being the reference antigen for immunotargeting of these tumors, we developed human anti-CEA MAbs. Methods XenoMouse®-G2 animals were immunized with CEA. Among all the antibodies produced, two of them, VG-IgG2κ and VG-IgM, were selected for characterization in vitro in comparison with the human-mouse chimeric anti-CEA MAb X4 using flow cytometry, surface plasmon resonance, and binding to radiolabeled soluble CEA and in vivo in human colon carcinoma LS174T bearing nude mice. Results Flow cytometry analysis demonstrated binding of MAbs on CEA-expressing cells without any binding on NCA-expressing human granulocytes. In a competitive binding assay using five reference MAbs, directed against the five Gold CEA epitopes, VG-IgG2κ and VG-IgM were shown to be directed against the Gold 4 epitope. The affinities of purified VG-IgG2κ and VG-IgM were determined to be 0.19 ± 0.06 × 108 M-1 and 1.30 ± 0.06 × 108 M-1, respectively, as compared with 0.61 ± 0.05 × 108 M-1 for the reference MAb X4. In a soluble phase assay, the binding capacities of VG-IgG2κ and VG-IgM to soluble CEA were clearly lower than that of the control chimeric MAb X4. A human MAb concentration of about 10-7 M was needed to precipitate approximatively 1 ng 125I-rhCEA as compared with 10-9 M for MAb X4, suggesting a preferential binding of the human MAbs to solid phase CEA. In vivo, 24 h post-injection, 125I-VG-IgG2κ demonstrated a high tumor uptake (25.4 ± 7.3%ID/g, close to that of 131I-X4 (21.7 ± 7.2%ID/g. At 72 h post-injection, 125I-VG-IgG2κ was still concentrated in the tumor (28.4 ± 11.0%ID/g whereas the tumor concentration of 131I-X4 was significantly reduced (12.5 ± 4.8%ID/g. At no time after injection was there any accumulation of the radiolabeled MAbs in normal tissues. A pertinent analysis of

  17. Two-Dimensional Capillary Electrophoresis with On-Line Sample Preparation and Cyclodextrin Separation Environment for Direct Determination of Serotonin in Human Urine.

    Science.gov (United States)

    Piešťanský, Juraj; Maráková, Katarína; Mikuš, Peter

    2017-10-07

    An advanced two-dimensional capillary electrophoresis method, based on on-line combination of capillary isotachophoresis and capillary zone electrophoresis with cyclodextrin additive in background electrolyte, was developed for effective determination of serotonin in human urine. Hydrodynamically closed separation system and large bore capillaries (300-800 µm) were chosen for the possibility to enhance the sample load capacity, and, by that, to decrease limit of detection. Isotachophoresis served for the sample preseparation, defined elimination of sample matrix constituents (sample clean up), and preconcentration of the analyte. Cyclodextrin separation environment enhanced separation selectivity of capillary zone electrophoresis. In this way, serotonin could be successfully separated from the rest of the sample matrix constituents migrating in capillary zone electrophoresis step so that human urine could be directly (i.e., without any external sample preparation) injected into the analyzer. The proposed method was successfully validated, showing favorable parameters of sensitivity (limit of detection for serotonin was 2.32 ng·mL -1 ), linearity (regression coefficient higher than 0.99), precision (repeatability of the migration time and peak area were in the range of 0.02-1.17% and 5.25-7.88%, respectively), and recovery (ranging in the interval of 90.0-93.6%). The developed method was applied for the assay of the human urine samples obtained from healthy volunteers. The determined concentrations of serotonin in such samples were in the range of 12.4-491.2 ng·mL -1 that was in good agreement with literature data. This advanced method represents a highly effective, reliable, and low-cost alternative for the routine determination of serotonin as a biomarker in human urine.

  18. Pandemic H1N1 influenza A directly induces a robust and acute inflammatory gene signature in primary human bronchial epithelial cells downstream of membrane fusion

    Energy Technology Data Exchange (ETDEWEB)

    Paquette, Stéphane G. [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Institute of Medical Science, Faculty of Medicine, University of Toronto, Toronto, Ontario (Canada); Banner, David [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Chi, Le Thi Bao [Department of Microbiology, Hue University of Medicine and Pharmacy, Thua Thien Hue (Viet Nam); Carlo Urbani Centre, Hue University of Medicine and Pharmacy, Thua Thien Hue (Viet Nam); Leon, Alberto J. [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); International Institute of Infection and Immunity, Shantou University Medical College, Shantou, Guangdong (China); Xu, Luoling; Ran, Longsi [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Huang, Stephen S.H. [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); Department of Immunology, Faculty of Medicine, University of Toronto, Toronto, Ontario (Canada); Farooqui, Amber [Division of Experimental Therapeutics, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario (Canada); International Institute of Infection and Immunity, Shantou University Medical College, Shantou, Guangdong (China); and others

    2014-01-05

    Pandemic H1N1 influenza A (H1N1pdm) elicits stronger pulmonary inflammation than previously circulating seasonal H1N1 influenza A (sH1N1), yet mechanisms of inflammatory activation in respiratory epithelial cells during H1N1pdm infection are unclear. We investigated host responses to H1N1pdm/sH1N1 infection and virus entry mechanisms in primary human bronchial epithelial cells in vitro. H1N1pdm infection rapidly initiated a robust inflammatory gene signature (3 h post-infection) not elicited by sH1N1 infection. Protein secretion inhibition had no effect on gene induction. Infection with membrane fusion deficient H1N1pdm failed to induce robust inflammatory gene expression which was rescued with restoration of fusion ability, suggesting H1N1pdm directly triggered the inflammatory signature downstream of membrane fusion. Investigation of intra-virion components revealed H1N1pdm viral RNA (vRNA) triggered a stronger inflammatory phenotype than sH1N1 vRNA. Thus, our study is first to report H1N1pdm induces greater inflammatory gene expression than sH1N1 in vitro due to direct virus–epithelial cell interaction. - Highlights: • We investigated H1N1pdm/sH1N1 infection in primary epithelial cells. • H1N1pdm directly initiated a robust inflammatory gene signature, sH1N1 did not. • H1N1pdm viral RNA triggered a stronger response than sH1N1. • H1N1pdm induces greater response due to direct virus–cell interaction. • These results have potential to impact vaccine and therapeutic development.

  19. Pandemic H1N1 influenza A directly induces a robust and acute inflammatory gene signature in primary human bronchial epithelial cells downstream of membrane fusion

    International Nuclear Information System (INIS)

    Paquette, Stéphane G.; Banner, David; Chi, Le Thi Bao; Leon, Alberto J.; Xu, Luoling; Ran, Longsi; Huang, Stephen S.H.; Farooqui, Amber

    2014-01-01

    Pandemic H1N1 influenza A (H1N1pdm) elicits stronger pulmonary inflammation than previously circulating seasonal H1N1 influenza A (sH1N1), yet mechanisms of inflammatory activation in respiratory epithelial cells during H1N1pdm infection are unclear. We investigated host responses to H1N1pdm/sH1N1 infection and virus entry mechanisms in primary human bronchial epithelial cells in vitro. H1N1pdm infection rapidly initiated a robust inflammatory gene signature (3 h post-infection) not elicited by sH1N1 infection. Protein secretion inhibition had no effect on gene induction. Infection with membrane fusion deficient H1N1pdm failed to induce robust inflammatory gene expression which was rescued with restoration of fusion ability, suggesting H1N1pdm directly triggered the inflammatory signature downstream of membrane fusion. Investigation of intra-virion components revealed H1N1pdm viral RNA (vRNA) triggered a stronger inflammatory phenotype than sH1N1 vRNA. Thus, our study is first to report H1N1pdm induces greater inflammatory gene expression than sH1N1 in vitro due to direct virus–epithelial cell interaction. - Highlights: • We investigated H1N1pdm/sH1N1 infection in primary epithelial cells. • H1N1pdm directly initiated a robust inflammatory gene signature, sH1N1 did not. • H1N1pdm viral RNA triggered a stronger response than sH1N1. • H1N1pdm induces greater response due to direct virus–cell interaction. • These results have potential to impact vaccine and therapeutic development

  20. Beyond the Debye length in high ionic strength solution: direct protein detection with field-effect transistors (FETs) in human serum.

    Science.gov (United States)

    Chu, Chia-Ho; Sarangadharan, Indu; Regmi, Abiral; Chen, Yen-Wen; Hsu, Chen-Pin; Chang, Wen-Hsin; Lee, Geng-Yen; Chyi, Jen-Inn; Chen, Chih-Chen; Shiesh, Shu-Chu; Lee, Gwo-Bin; Wang, Yu-Lin

    2017-07-12

    In this study, a new type of field-effect transistor (FET)-based biosensor is demonstrated to be able to overcome the problem of severe charge-screening effect caused by high ionic strength in solution and detect proteins in physiological environment. Antibody or aptamer-immobilized AlGaN/GaN high electron mobility transistors (HEMTs) are used to directly detect proteins, including HIV-1 RT, CEA, NT-proBNP and CRP, in 1X PBS (with 1%BSA) or human sera. The samples do not need any dilution or washing process to reduce the ionic strength. The sensor shows high sensitivity and the detection takes only 5 minutes. The designs of the sensor, the methodology of the measurement, and the working mechanism of the sensor are discussed and investigated. A theoretical model is proposed based on the finding of the experiments. This sensor is promising for point-of-care, home healthcare, and mobile diagnostic device.

  1. Different (direct and indirect) mechanisms for the induction of DNA-protein crosslinks in human cells by far- and near-ultraviolet radiations (290 and 405 nm)

    International Nuclear Information System (INIS)

    Peak, M.J.; Peak, J.G.; Jones, C.A.

    1985-01-01

    Apparent DNA-protein crosslinking induced by monochromatic 290 and 405 nm radiations was measured in cultured human P3 teratocarcinoma cells with DNA alkaline elution techniques. The rates of the induction of crosslinks by 290 nm radiation were the same when the cells were irradiated either aerobically or anaerobically or when the cells were in an H 2 O or D 2 O aqueous environment. With 405 nm radiation, anaerobic irradiation reduced the induction of the crosslinks (dose modifying factor is about 0.2), and about twice as many crosslinks were observed when the cells were irradiated in an environment of D 2 O rather than H 2 O. The results are consistent with the hypothesis that far-UV radiation induces DNA-protein crosslinks by a direct mechanism, whereas near-UV radiation induces crosslinks via indirect photodynamic photosensitizations in which unidentified cellular endogenous photosensitizers and reactive species of oxygen are used. (author)

  2. MicroRNA-195 inhibits the proliferation of human glioma cells by directly targeting cyclin D1 and cyclin E1.

    Directory of Open Access Journals (Sweden)

    Wang Hui

    Full Text Available Glioma proliferation is a multistep process during which a sequence of genetic and epigenetic alterations randomly occur to affect the genes controlling cell proliferation, cell death and genetic stability. microRNAs are emerging as important epigenetic modulators of multiple target genes, leading to abnormal cellular signaling involving cellular proliferation in cancers.In the present study, we found that expression of miR-195 was markedly downregulated in glioma cell lines and human primary glioma tissues, compared to normal human astrocytes and matched non-tumor associated tissues. Upregulation of miR-195 dramatically reduced the proliferation of glioma cells. Flow cytometry analysis showed that ectopic expression of miR-195 significantly decreased the percentage of S phase cells and increased the percentage of G1/G0 phase cells. Overexpression of miR-195 dramatically reduced the anchorage-independent growth ability of glioma cells. Furthermore, overexpression of miR-195 downregulated the levels of phosphorylated retinoblastoma (pRb and proliferating cell nuclear antigen (PCNA in glioma cells. Conversely, inhibition of miR-195 promoted cell proliferation, increased the percentage of S phase cells, reduced the percentage of G1/G0 phase cells, enhanced anchorage-independent growth ability, upregulated the phosphorylation of pRb and PCNA in glioma cells. Moreover, we show that miR-195 inhibited glioma cell proliferation by downregulating expression of cyclin D1 and cyclin E1, via directly targeting the 3'-untranslated regions (3'-UTR of cyclin D1 and cyclin E1 mRNA. Taken together, our results suggest that miR-195 plays an important role to inhibit the proliferation of glioma cells, and present a novel mechanism for direct miRNA-mediated suppression of cyclin D1 and cyclin E1 in glioma.

  3. Δ⁹-tetrahydrocannabinol (Δ⁹-THC) exerts a direct neuroprotective effect in a human cell culture model of Parkinson's disease.

    Science.gov (United States)

    Carroll, C B; Zeissler, M-L; Hanemann, C O; Zajicek, J P

    2012-10-01

    Δ⁹-tetrahydrocannabinol (Δ⁹-THC) is neuroprotective in models of Parkinson's disease (PD). Although CB1 receptors are increased within the basal ganglia of PD patients and animal models, current evidence suggests a role for CB1 receptor-independent mechanisms. Here, we utilized a human neuronal cell culture PD model to further investigate the protective properties of Δ⁹-THC. Differentiated SH-SY5Y neuroblastoma cells were exposed to PD-relevant toxins: 1-methyl-4-phenylpyridinium (MPP+), lactacystin and paraquat. Changes in CB1 receptor level were determined by quantitative polymerase chain reaction and Western blotting. Cannabinoids and modulatory compounds were co-administered with toxins for 48 h and the effects on cell death, viability, apoptosis and oxidative stress assessed. We found CB1 receptor up-regulation in response to MPP+, lactacystin and paraquat and a protective effect of Δ⁹-THC against all three toxins. This neuroprotective effect was not reproduced by the CB1 receptor agonist WIN55,212-2 or blocked by the CB1 antagonist AM251. Furthermore, the antioxidants α-tocopherol and butylhydroxytoluene as well as the antioxidant cannabinoids, nabilone and cannabidiol were unable to elicit the same neuroprotection as Δ⁹-THC. However, the peroxisome proliferator-activated receptor-gamma (PPARγ) antagonist T0070907 dose-dependently blocked the neuroprotective, antioxidant and anti-apoptotic effects of Δ⁹-THC, while the PPARγ agonist pioglitazone resulted in protection from MPP+-induced neurotoxicity. Furthermore, Δ⁹-THC increased PPARγ expression in MPP+-treated SH-SY5Y cells, another indicator of PPARγ activation. We have demonstrated up-regulation of the CB1 receptor in direct response to neuronal injury in a human PD cell culture model, and a direct neuronal protective effect of Δ⁹-THC that may be mediated through PPARγ activation. © 2011 The Authors. Neuropathology and Applied Neurobiology © 2011 British Neuropathological

  4. Order no 000003/ME/P/DRH from January 21,2014 provides for the organization and attributions of the Human ResourcesDirection of Ministry of Energy and Oil

    International Nuclear Information System (INIS)

    Foumakoye, Gado

    2014-01-01

    This order provides fore the organzation and attributions of the human resouces Direction. So the Direction includs two Divisions: Administrative Division and Personal Division. Administrative Division assures administrative sevice and social service and the personal Division take care of persanal service ,improvement and formation [fr

  5. Differentiation and sarcomere formation in skeletal myocytes directly prepared from human induced pluripotent stem cells using a sphere-based culture.

    Science.gov (United States)

    Jiwlawat, Saowanee; Lynch, Eileen; Glaser, Jennifer; Smit-Oistad, Ivy; Jeffrey, Jeremy; Van Dyke, Jonathan M; Suzuki, Masatoshi

    Human induced-pluripotent stem cells (iPSCs) are a promising resource for propagation of myogenic progenitors. Our group recently reported a unique protocol for the derivation of myogenic progenitors directly (without genetic modification) from human pluripotent cells using free-floating spherical culture. Here we expand our previous efforts and attempt to determine how differentiation duration, culture surface coatings, and nutrient supplements in the medium influence progenitor differentiation and formation of skeletal myotubes containing sarcomeric structures. A long differentiation period (over 6 weeks) promoted the differentiation of iPSC-derived myogenic progenitors and subsequent myotube formation. These iPSC-derived myotubes contained representative sarcomeric structures, consisting of organized myosin and actin filaments, and could spontaneously contract. We also found that a bioengineering approach using three-dimensional (3D) artificial muscle constructs could facilitate the formation of elongated myotubes. Lastly, we determined how culture surface coating matrices and different supplements would influence terminal differentiation. While both Matrigel and laminin coatings showed comparable effects on muscle differentiation, B27 serum-free supplement in the differentiation medium significantly enhanced myogenesis compared to horse serum. Our findings support the possibility to create an in vitro model of contractile sarcomeric myofibrils for disease modeling and drug screening to study neuromuscular diseases. Copyright © 2017 International Society of Differentiation. Published by Elsevier B.V. All rights reserved.

  6. Structural insights into the interaction of human IgG1 with FcγRI: no direct role of glycans in binding

    Energy Technology Data Exchange (ETDEWEB)

    Oganesyan, Vaheh, E-mail: oganesyanv@medimmune.com; Mazor, Yariv; Yang, Chunning; Cook, Kimberly E.; Woods, Robert M. [MedImmune LLC, 1 MedImmune Way, Gaithersburg, MD 20878 (United States); Ferguson, Andrew [AstraZeneca Pharmaceuticals, 35 Gatehouse Drive, Mailstop E3, Waltham, MA 02451 (United States); Bowen, Michael A.; Martin, Tom; Zhu, Jie; Wu, Herren; Dall’Acqua, William F., E-mail: oganesyanv@medimmune.com [MedImmune LLC, 1 MedImmune Way, Gaithersburg, MD 20878 (United States)

    2015-10-31

    In an effort to identify the critical structural features responsible for the high-affinity interaction of IgG1 Fc with FcγRI, the structure of the corresponding complex was solved at a resolution of 2.4 Å. The three-dimensional structure of a human IgG1 Fc fragment bound to wild-type human FcγRI is reported. The structure of the corresponding complex was solved at a resolution of 2.4 Å using molecular replacement; this is the highest resolution achieved for an unmutated FcγRI molecule. This study highlights the critical structural and functional role played by the second extracellular subdomain of FcγRI. It also explains the long-known major energetic contribution of the Fc ‘LLGG’ motif at positions 234–237, and particularly of Leu235, via a ‘lock-and-key’ mechanism. Finally, a previously held belief is corrected and a differing view is offered on the recently proposed direct role of Fc carbohydrates in the corresponding interaction. Structural evidence is provided that such glycan-related effects are strictly indirect.

  7. Force direction patterns promote whole body stability even in hip-flexed walking, but not upper body stability in human upright walking

    Science.gov (United States)

    Müller, Roy; Rode, Christian; Aminiaghdam, Soran; Vielemeyer, Johanna; Blickhan, Reinhard

    2017-11-01

    Directing the ground reaction forces to a focal point above the centre of mass of the whole body promotes whole body stability in human and animal gaits similar to a physical pendulum. Here we show that this is the case in human hip-flexed walking as well. For all upper body orientations (upright, 25°, 50°, maximum), the focal point was well above the centre of mass of the whole body, suggesting its general relevance for walking. Deviations of the forces' lines of action from the focal point increased with upper body inclination from 25 to 43 mm root mean square deviation (RMSD). With respect to the upper body in upright gait, the resulting force also passed near a focal point (17 mm RMSD between the net forces' lines of action and focal point), but this point was 18 cm below its centre of mass. While this behaviour mimics an unstable inverted pendulum, it leads to resulting torques of alternating sign in accordance with periodic upper body motion and probably provides for low metabolic cost of upright gait by keeping hip torques small. Stabilization of the upper body is a consequence of other mechanisms, e.g. hip reflexes or muscle preflexes.

  8. trans-11 18:1 Vaccenic Acid (TVA Has a Direct Anti-Carcinogenic Effect on MCF-7 Human Mammary Adenocarcinoma Cells

    Directory of Open Access Journals (Sweden)

    Ji-Na Lim

    2014-02-01

    Full Text Available Trans vaccenic acid (TVA; trans-11 18:1 is a positional and geometric isomer of oleic acid and it is the predominant trans isomer found in ruminant fats. TVA can be converted into cis-9, trans-11 conjugated linoleic acid (c9, t11-CLA, a CLA isomer that has many beneficial effects, by stearoyl CoA desaturase 1 (SCD1 in the mammary gland. The health benefits associated with CLA are well documented, but it is unclear whether trans fatty acids (TFAs from ruminant products have healthy effects. Therefore, the effects of TVA on the proliferation of MCF-7 human breast adenocarcinoma cells and MCF-10A human breast epithelial cells were investigated in the present study. Results showed that TVA inhibited the proliferation of MCF-7 cells but not MCF-10A cells by down-regulating the expression of Bcl-2 as well as procaspase-9. In addition, the suppressive effect of TVA was confirmed in SCD1-depleted MCF-7 cells. Our results suggested that TVA exerts a direct anti-carcinogenic effect on MCF-7 cells. These findings provided a better understanding of the research on the anti-carcinogenic effects of TVA and this may facilitate the manufacture of TVA/c9, t11-CLA fortified ruminant products.

  9. Dietary Phenolic Compounds Interfere with the Fate of Hydrogen Peroxide in Human Adipose Tissue but Do Not Directly Inhibit Primary Amine Oxidase Activity

    Directory of Open Access Journals (Sweden)

    Christian Carpéné

    2016-01-01

    Full Text Available Resveratrol has been reported to inhibit monoamine oxidases (MAO. Many substrates or inhibitors of neuronal MAO interact also with other amine oxidases (AO in peripheral organs, such as semicarbazide-sensitive AO (SSAO, known as primary amine oxidase, absent in neurones, but abundant in adipocytes. We asked whether phenolic compounds (resveratrol, pterostilbene, quercetin, and caffeic acid behave as MAO and SSAO inhibitors. AO activity was determined in human adipose tissue. Computational docking and glucose uptake assays were performed in 3D models of human AO proteins and in adipocytes, respectively. Phenolic compounds fully inhibited the fluorescent detection of H2O2 generated during MAO and SSAO activation by tyramine and benzylamine. They also quenched H2O2-induced fluorescence in absence of biological material and were unable to abolish the oxidation of radiolabelled tyramine and benzylamine. Thus, phenolic compounds hampered H2O2 detection but did not block AO activity. Only resveratrol and quercetin partially impaired MAO-dependent [14C]-tyramine oxidation and behaved as MAO inhibitors. Phenolic compounds counteracted the H2O2-dependent benzylamine-stimulated glucose transport. This indicates that various phenolic compounds block downstream effects of H2O2 produced by biogenic or exogenous amine oxidation without directly inhibiting AO. Phenolic compounds remain of interest regarding their capacity to limit oxidative stress rather than inhibiting AO.

  10. Impact of methods used to express levels of circulating fatty acids on the degree and direction of associations with blood lipids in humans.

    Science.gov (United States)

    Sergeant, Susan; Ruczinski, Ingo; Ivester, Priscilla; Lee, Tammy C; Morgan, Timothy M; Nicklas, Barbara J; Mathias, Rasika A; Chilton, Floyd H

    2016-01-28

    Numerous studies have examined relationships between disease biomarkers (such as blood lipids) and levels of circulating or cellular fatty acids. In such association studies, fatty acids have typically been expressed as the percentage of a particular fatty acid relative to the total fatty acids in a sample. Using two human cohorts, this study examined relationships between blood lipids (TAG, and LDL, HDL or total cholesterol) and circulating fatty acids expressed either as a percentage of total or as concentration in serum. The direction of the correlation between stearic acid, linoleic acid, dihomo-γ-linolenic acid, arachidonic acid and DHA and circulating TAG reversed when fatty acids were expressed as concentrations v. a percentage of total. Similar reversals were observed for these fatty acids when examining their associations with the ratio of total cholesterol:HDL-cholesterol. This reversal pattern was replicated in serum samples from both human cohorts. The correlations between blood lipids and fatty acids expressed as a percentage of total could be mathematically modelled from the concentration data. These data reveal that the different methods of expressing fatty acids lead to dissimilar correlations between blood lipids and certain fatty acids. This study raises important questions about how such reversals in association patterns impact the interpretation of numerous association studies evaluating fatty acids and their relationships with disease biomarkers or risk.

  11. Noninvasive brain stimulation with transcranial magnetic or direct current stimulation (TMS/tDCS)-From insights into human memory to therapy of its dysfunction.

    Science.gov (United States)

    Sparing, Roland; Mottaghy, Felix M

    2008-04-01

    Noninvasive stimulation of the brain by means of transcranial magnetic stimulation (TMS) or transcranial direct current stimulation (tDCS) has driven important discoveries in the field of human memory functions. Stand-alone or in combination with other brain mapping techniques noninvasive brain stimulation can assess issues such as location and timing of brain activity, connectivity and plasticity of neural circuits and functional relevance of a circumscribed brain area to a given cognitive task. In this emerging field, major advances in technology have been made in a relatively short period. New stimulation protocols and, especially, the progress in the application of tDCS have made it possible to obtain longer and much clearer inhibitory or facilitatory effects even after the stimulation has ceased. In this introductory review, we outline the basic principles, discuss technical limitations and describe how noninvasive brain stimulation can be used to study human memory functions in vivo. Though improvement of cognitive functions through noninvasive brain stimulation is promising, it still remains an exciting challenge to extend the use of TMS and tDCS from research tools in neuroscience to the treatment of neurological and psychiatric patients.

  12. Direct determination of uranium in human urine by Icp-SFMS; Determinacion directa de uranio en orina humana por ICP-SFMS

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez M, H. [ININ, Departamento de Quimica, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico); Yllera de Ll, A., E-mail: hector.hernandez520@gmail.com [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, Departamento de Medio Ambiente, Av. Complutense 22, 28040 Madrid (Spain)

    2013-10-15

    The success of the measurement and the evaluation of the internal exposure are highly dependent of the effective capacities for the radiation measurement in biological samples (mainly urine and the feces). Usually, during the samples bioassay of human urine, a pre-concentration and purification of the radionuclides is carried out previously to the quantitative analysis. These stages, as the analysis time are the main source of uncertainty in the measurement process. In the uranium case, this is not necessary when are used mass spectrometry techniques, in particular, Mass Spectrometry of Magnetic Sector with Inductively Coupled Plasma (Icp-SFMS). This work presents the results obtained for the uranium analysis in samples of human urine during the participation in the inter-comparison exercises of the Association pour la Promotion de Controle de Qualite des Analyses de Biologie Medicale en Radiotoxicologie (PROCORAD) in the period 2010 and 2011. The analyses were realized directly in the diluted urine samples (dilution factor 1:20) in 5% of HNO{sub 3}. The obtained results, were normalized to the total urine sample (V = 0.5 L), these values coincide with the waited reference values of uranium in the urine sample. Additionally, were calculated the detection limits of {sup 235}U= 0.049 x 10{sup -3} μg L{sup -1} and {sup 238}U= 7.37 x 10{sup -3} μg L{sup -1}. (author)

  13. Direct extraction of lead (II) from untreated human blood serum using restricted access carbon nanotubes and its determination by atomic absorption spectrometry.

    Science.gov (United States)

    Barbosa, Valéria Maria Pereira; Barbosa, Adriano Francisco; Bettini, Jefferson; Luccas, Pedro Orival; Figueiredo, Eduardo Costa

    2016-01-15

    Oxidized carbon nanotubes were covered with layers of bovine serum albumin to result in so-called restricted-access carbon nanotubes (RACNTs). This material can extract Pb(2+) ions directly from untreated human blood serum while excluding all the serum proteins. The RACNTs have a protein exclusion capacity of almost 100% and a maximum Pb(2+) adsorption capacity of 34.5mg g(-1). High resolution transmission electron microscopy, scanning transmission electron microscopy and energy dispersive spectroscopy were used to confirm the BSA layer and Pb(2+) adsorption sites. A mini-column filled with RACNTs was used in an on-line solid phase extraction system coupled to a thermospray flame furnace atomic absorption spectrometry. At optimized experimental conditions, the method has a detection limit as low as 2.1µg L(-1), an enrichment factor of 5.5, and inter- and intra-day precisions (expressed as relative standard deviation) of <8.1%. Recoveries of the Pb(2+) spiked samples ranged from 89.4% to 107.3% for the extraction from untreated human blood serum. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Direct and indirect mechanisms for the induction of apparent DNA-protein crosslinks by far- and near-ultraviolet radiations in human cells in culture

    International Nuclear Information System (INIS)

    Peak, M.J.; Peak, J.G.; Jones, C.A.

    1985-01-01

    DNA from human epithelioid P/sub 3/ cells in culture was studied by alkaline elution techniques after the cells were irradiated by monochromatic 254, 290, 313, 334, 365, 405, 434, and 545 nm ultraviolet light. An action spectrum (aerobic irradiation) for the relative efficiency of induction of apparent DNA-protein covalent bonds (crosslinks) showed a maximum at about 254 nm, with a secondary peak of activity at 405 nm. No changes in the crosslink production by 290 nm radiation were observed when the cells were irradiated under anoxic conditions or in an environment of D/sub 2/O. Under anoxic conditions, the induction of crosslinks was reduced by 80% at 405 nm, and, in the presence of D/sub 2/O, it was doubled. These findings constitute evidence that far- and near-UV radiations induce crosslinks by direct (absorption of photons directly by DNA) and indirect (photosensitizations involving nonDNA cellular sensitizers and reactive species of oxygen) mechanisms respectively

  15. Fundamental Evaluation of Adaptation and Human Capabilities in a Condition Using a System to Give a User an Artificial Oculomotor Function to Control Directions of Both Eyes Independently

    Directory of Open Access Journals (Sweden)

    Fumio Mizuno

    2011-10-01

    Full Text Available To investigate flexible adaptation of visual system, we developed a system to provide a user an artificial oculomotor function to control directions of both eyes. The system named “Virtual Chameleon” consists of two CCD cameras independently controlled and a head-mounted display. The user can control each tracking directions of two cameras with sensors set to both hands so that the user can get independent arbitrary view fields for both eyes. We performed fundamental experiments to evaluate capability to evaluate adaptation to use of Virtual Chameleon and effects on the user's capabilities. Eleven healthy volunteers with normal and corrected-to-normal vision participated in the experiments. The experiments were tests to find out each position of targets put in both side of a subject. In the experiments, a condition using Virtual Chameleon and a condition without it was adopted. We obtained accuracy rates and time intervals to find out target positions as experimental results. The experiments showed all of volunteers became able to actively control independent visual axes and correctly understood two different views by using Virtual Chameleon, even though two independent view fields yielded binocular rivalry to volunteers and binocular rivalry reduced human capabilities compared to cases without Virtual Chameleon.

  16. Coactivator-associated arginine methyltransferase 1 enhances transcriptional activity of the human T-cell lymphotropic virus type 1 long terminal repeat through direct interaction with Tax.

    Science.gov (United States)

    Jeong, Soo-Jin; Lu, Hanxin; Cho, Won-Kyung; Park, Hyeon Ung; Pise-Masison, Cynthia; Brady, John N

    2006-10-01

    In this study, we demonstrate that the coactivator-associated arginine methyltransferase 1 (CARM1), which methylates histone H3 and other proteins such as p300/CBP, is positively involved in the regulation of Tax transactivation. First, transfection studies demonstrated that overexpression of CARM1 wild-type protein resulted in increased Tax transactivation of the human T-cell lymphotropic virus type 1 (HTLV-1) long terminal repeat (LTR). In contrast, transfection of a catalytically inactive CARM1 methyltransferase mutant did not enhance Tax transactivation. CARM1 facilitated Tax transactivation of the CREB-dependent cellular GEM promoter. A direct physical interaction between HTLV-1 Tax and CARM1 was demonstrated using in vitro glutathione S-transferase-Tax binding assays, in vivo coimmunoprecipitation, and confocal microscopy experiments. Finally, chromatin immunoprecipitation analysis of the activated HTLV-1 LTR promoter showed the association of CARM1 and methylated histone H3 with the template DNA. In vitro, Tax facilitates the binding of CARM1 to the transcription complex. Together, our data provide evidence that CARM1 enhances Tax transactivation of the HTLV-1 LTR through a direct interaction between CARM1 and Tax and this binding promotes methylation of histone H3 (R2, R17, and R26).

  17. Identification of Top-ranked Proteins within a Directional Protein Interaction Network using the PageRank Algorithm: Applications in Humans and Plants.

    Science.gov (United States)

    Li, Xiu-Qing; Xing, Tim; Du, Donglei

    2016-01-01

    Somatic mutation of signal transduction genes or key nodes of the cellular protein network can cause severe diseases in humans but can sometimes genetically improve plants, likely because growth is determinate in animals but indeterminate in plants. This article reviews protein networks; human protein ranking; the mitogen-activated protein kinase (MAPK) and insulin (phospho- inositide 3kinase [PI3K]/phosphatase and tensin homolog [PTEN]/protein kinase B [AKT]) signaling pathways; human diseases caused by somatic mutations to the PI3K/PTEN/ AKT pathway; use of the MAPK pathway in plant molecular breeding; and protein domain evolution. Casitas B-lineage lymphoma (CBL), PTEN, MAPK1 and PIK3CA are among PIK3CA the top-ranked proteins in directional rankings. Eight proteins (ACVR1, CDC42, RAC1, RAF1, RHOA, TGFBR1, TRAF2, and TRAF6) are ranked in the top 50 key players in both signal emission and signal reception and in interaction with many other proteins. Top-ranked proteins likely have major impacts on the network function. Such proteins are targets for drug discovery, because their mutations are implicated in various cancers and overgrowth syndromes. Appropriately managing food intake may help reduce the growth of tumors or malformation of tissues. The role of the protein kinase C/ fatty acid synthase pathway in fat deposition in PTEN/PI3K patients should be investigated. Both the MAPK and insulin signaling pathways exist in plants, and MAPK pathway engineering can improve plant tolerance to biotic and abiotic stresses such as salinity.

  18. Bioprinting of human pluripotent stem cells and their directed differentiation into hepatocyte-like cells for the generation of mini-livers in 3D.

    Science.gov (United States)

    Faulkner-Jones, Alan; Fyfe, Catherine; Cornelissen, Dirk-Jan; Gardner, John; King, Jason; Courtney, Aidan; Shu, Wenmiao

    2015-10-21

    We report the first investigation into the bioprinting of human induced pluripotent stem cells (hiPSCs), their response to a valve-based printing process as well as their post-printing differentiation into hepatocyte-like cells (HLCs). HLCs differentiated from both hiPSCs and human embryonic stem cells (hESCs) sources were bioprinted and examined for the presence of hepatic markers to further validate the compatibility of the valve-based bioprinting process with fragile cell transfer. Examined cells were positive for nuclear factor 4 alpha and were demonstrated to secrete albumin and have morphology that was also found to be similar to that of hepatocytes. Both hESC and hiPSC lines were tested for post-printing viability and pluripotency and were found to have negligible difference in terms of viability and pluripotency between the printed and non-printed cells. hESC-derived HLCs were 3D printed using alginate hydrogel matrix and tested for viability and albumin secretion during the remaining differentiation and were found to be hepatic in nature. 3D printed with 40-layer of HLC-containing alginate structures reached peak albumin secretion at day 21 of the differentiation protocol. This work demonstrates that the valve-based printing process is gentle enough to print human pluripotent stem cells (hPSCs) (both hESCs and hiPSCs) while either maintaining their pluripotency or directing their differentiation into specific lineages. The ability to bioprint hPSCs will pave the way for producing organs or tissues on demand from patient specific cells which could be used for animal-free drug development and personalized medicine.

  19. Direct anti-inflammatory effects of granulocyte colony-stimulating factor (G-CSF) on activation and functional properties of human T cell subpopulations in vitro.

    Science.gov (United States)

    Malashchenko, Vladimir Vladimirovich; Meniailo, Maxsim Evgenievich; Shmarov, Viacheslav Anatolievich; Gazatova, Natalia Dinislamovna; Melashchenko, Olga Borisovna; Goncharov, Andrei Gennadievich; Seledtsova, Galina Victorovna; Seledtsov, Victor Ivanovich

    2018-03-01

    We investigated the direct effects of human granulocyte colony-stimulating factor (G-CSF) on functionality of human T-cell subsets. CD3 + T-lymphocytes were isolated from blood of healthy donors by positive magnetic separation. T cell activation with particles conjugated with antibodies (Abs) to human CD3, CD28 and CD2 molecules increased the proportion of cells expressing G-CSF receptor (G-CSFR, CD114) in all T cell subpopulations studied (CD45RA + /CD197 + naive T cells, CD45RA - /CD197 + central memory T cells, CD45RA - /CD197 - effector memory T cells and CD45RA + /CD197 - terminally differentiated effector T cells). Upon T-cell activation in vitro, G-CSF (10.0 ng/ml) significantly and specifically enhanced the proportion of CD114 + T cells in central memory CD4 + T cell compartment. A dilution series of G-CSF (range, 0.1-10.0 ng/ml) was tested, with no effect on the expression of CD25 (interleukin-2 receptor α-chain) on activated T cells. Meanwhile, G-CSF treatment enhanced the proportion of CD38 + T cells in CD4 + naïve T cell, effector memory T cell and terminally differentiated effector T cell subsets, as well as in CD4 - central memory T cells and terminally differentiated effector T cells. G-CSF did not affect IL-2 production by T cells; relatively low concentrations of G-CSF down-regulated INF-γ production, while high concentrations of this cytokine up-regulated IL-4 production in activated T cells. The data obtained suggests that G-CSF could play a significant role both in preventing the development of excessive and potentially damaging inflammatory reactivity, and in constraining the expansion of potentially cytodestructive T cells. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Bioprinting of human pluripotent stem cells and their directed differentiation into hepatocyte-like cells for the generation of mini-livers in 3D

    International Nuclear Information System (INIS)

    Faulkner-Jones, Alan; Cornelissen, Dirk-Jan; Shu, Wenmiao; Fyfe, Catherine; Gardner, John; King, Jason; Courtney, Aidan

    2015-01-01

    We report the first investigation into the bioprinting of human induced pluripotent stem cells (hiPSCs), their response to a valve-based printing process as well as their post-printing differentiation into hepatocyte-like cells (HLCs). HLCs differentiated from both hiPSCs and human embryonic stem cells (hESCs) sources were bioprinted and examined for the presence of hepatic markers to further validate the compatibility of the valve-based bioprinting process with fragile cell transfer. Examined cells were positive for nuclear factor 4 alpha and were demonstrated to secrete albumin and have morphology that was also found to be similar to that of hepatocytes. Both hESC and hiPSC lines were tested for post-printing viability and pluripotency and were found to have negligible difference in terms of viability and pluripotency between the printed and non-printed cells. hESC-derived HLCs were 3D printed using alginate hydrogel matrix and tested for viability and albumin secretion during the remaining differentiation and were found to be hepatic in nature. 3D printed with 40-layer of HLC-containing alginate structures reached peak albumin secretion at day 21 of the differentiation protocol. This work demonstrates that the valve-based printing process is gentle enough to print human pluripotent stem cells (hPSCs) (both hESCs and hiPSCs) while either maintaining their pluripotency or directing their differentiation into specific lineages. The ability to bioprint hPSCs will pave the way for producing organs or tissues on demand from patient specific cells which could be used for animal-free drug development and personalized medicine. (paper)

  1. How to Direct the Edges of the Connectomes: Dynamics of the Consensus Connectomes and the Development of the Connections in the Human Brain.

    Science.gov (United States)

    Kerepesi, Csaba; Szalkai, Balázs; Varga, Bálint; Grolmusz, Vince

    2016-01-01

    The human braingraph or the connectome is the object of an intensive research today. The advantage of the graph-approach to brain science is that the rich structures, algorithms and definitions of graph theory can be applied to the anatomical networks of the connections of the human brain. In these graphs, the vertices correspond to the small (1-1.5 cm2) areas of the gray matter, and two vertices are connected by an edge, if a diffusion-MRI based workflow finds fibers of axons, running between those small gray matter areas in the white matter of the brain. One main question of the field today is discovering the directions of the connections between the small gray matter areas. In a previous work we have reported the construction of the Budapest Reference Connectome Server http://connectome.pitgroup.org from the data recorded in the Human Connectome Project of the NIH. The server generates the consensus braingraph of 96 subjects in Version 2, and of 418 subjects in Version 3, according to selectable parameters. After the Budapest Reference Connectome Server had been published, we recognized a surprising and unforeseen property of the server. The server can generate the braingraph of connections that are present in at least k graphs out of the 418, for any value of k = 1, 2, …, 418. When the value of k is changed from k = 418 through 1 by moving a slider at the webserver from right to left, certainly more and more edges appear in the consensus graph. The astonishing observation is that the appearance of the new edges is not random: it is similar to a growing shrub. We refer to this phenomenon as the Consensus Connectome Dynamics. We hypothesize that this movement of the slider in the webserver may copy the development of the connections in the human brain in the following sense: the connections that are present in all subjects are the oldest ones, and those that are present only in a decreasing fraction of the subjects are gradually the newer connections in the

  2. How to Direct the Edges of the Connectomes: Dynamics of the Consensus Connectomes and the Development of the Connections in the Human Brain.

    Directory of Open Access Journals (Sweden)

    Csaba Kerepesi

    Full Text Available The human braingraph or the connectome is the object of an intensive research today. The advantage of the graph-approach to brain science is that the rich structures, algorithms and definitions of graph theory can be applied to the anatomical networks of the connections of the human brain. In these graphs, the vertices correspond to the small (1-1.5 cm2 areas of the gray matter, and two vertices are connected by an edge, if a diffusion-MRI based workflow finds fibers of axons, running between those small gray matter areas in the white matter of the brain. One main question of the field today is discovering the directions of the connections between the small gray matter areas. In a previous work we have reported the construction of the Budapest Reference Connectome Server http://connectome.pitgroup.org from the data recorded in the Human Connectome Project of the NIH. The server generates the consensus braingraph of 96 subjects in Version 2, and of 418 subjects in Version 3, according to selectable parameters. After the Budapest Reference Connectome Server had been published, we recognized a surprising and unforeseen property of the server. The server can generate the braingraph of connections that are present in at least k graphs out of the 418, for any value of k = 1, 2, …, 418. When the value of k is changed from k = 418 through 1 by moving a slider at the webserver from right to left, certainly more and more edges appear in the consensus graph. The astonishing observation is that the appearance of the new edges is not random: it is similar to a growing shrub. We refer to this phenomenon as the Consensus Connectome Dynamics. We hypothesize that this movement of the slider in the webserver may copy the development of the connections in the human brain in the following sense: the connections that are present in all subjects are the oldest ones, and those that are present only in a decreasing fraction of the subjects are gradually the newer

  3. Effects of cytochalasin congeners, microtubule-directed agents, and doxorubicin alone or in combination against human ovarian carcinoma cell lines in vitro

    International Nuclear Information System (INIS)

    Trendowski, Matthew; Christen, Timothy D.; Acquafondata, Christopher; Fondy, Thomas P.

    2015-01-01

    Although the actin cytoskeleton is vital for carcinogenesis and subsequent pathology, no microfilament-directed agent has been approved for cancer chemotherapy. One of the most studied classes of microfilament-directed agents has been the cytochalasins, mycotoxins known to disrupt the formation of actin polymers. In the present study, we sought to determine the effects of cytochalasin congeners toward human drug sensitive and multidrug resistant cell lines. SKOV3 human ovarian carcinoma and several multidrug resistant derivatives were tested for sensitivity against a panel of nine cytochalasin congeners, as well as three clinically approved chemotherapeutic agents (doxorubicin, paclitaxel, and vinblastine). In addition, verapamil, a calcium ion channel blocker known to reverse P-glycoprotein (P-gp) mediated drug resistance, was used in combination with multiple cytochalasin congeners to determine whether drug sensitivity could be increased. While multidrug resistant SKVLB1 had increased drug tolerance (was more resistant) to most cytochalasin congeners in comparison to drug sensitive SKOV3, the level of resistance was 10 to 1000-fold less for the cytochalasins than for any of the clinically approved agents. While cytochalasins did not appear to alter the expression of ATP binding cassette (ABC) transporters, several cytochalasins appeared to inhibit the activity of ABC transporter-mediated efflux of rhodamine 123 (Rh123), suggesting that these congeners do have affinity for drug efflux pumps. Cytochalasins also appeared to significantly decrease the F/G-actin ratio in both drug sensitive and drug resistant cells, indicative of marked microfilament inhibition. The cytotoxicity of most cytochalasin congeners could be increased with the addition of verapamil, and the drug sensitivity of resistant SKVLB1 to the clinically approved antineoplastic agents could be increased with the addition of cytochalasins. As assessed by isobolographic analysis and Chou

  4. A direct thrombin inhibitor suppresses protein C activation and factor Va degradation in human plasma: Possible mechanisms of paradoxical enhancement of thrombin generation.

    Science.gov (United States)

    Kamisato, Chikako; Furugohri, Taketoshi; Morishima, Yoshiyuki

    2016-05-01

    We have demonstrated that antithrombin (AT)-independent thrombin inhibitors paradoxically increase thrombin generation (TG) in human plasma in a thrombomodulin (TM)- and protein C (PC)-dependent manner. We determined the effects of AT-independent thrombin inhibitors on the negative-feedback system, activation of PC and production and degradation of factor Va (FVa), as possible mechanisms underlying the paradoxical enhancement of TG. TG in human plasma containing 10nM TM was assayed by means of the calibrated automated thrombography. As an index of PC activation, plasma concentration of activated PC-PC inhibitor complex (aPC-PCI) was measured. The amounts of FVa heavy chain and its degradation product (FVa(307-506)) were examined by western blotting. AT-independent thrombin inhibitors, melagatran and dabigatran (both at 25-600nM) and 3-30μg/ml active site-blocked thrombin (IIai), increased peak levels of TG. Melagatran, dabigatran and IIai significantly decreased plasma concentration of aPC-PCI complex at 25nM or more, 75nM or more, and 10 and 30μg/ml, respectively. Melagatran (300nM) significantly increased FVa and decreased FVa(307-506). In contrast, a direct factor Xa inhibitor edoxaban preferentially inhibited thrombin generation (≥25nM), and higher concentrations were required to inhibit PC activation (≥150nM) and FVa degradation (300nM). The present study suggests that the inhibitions of protein C activation and subsequent degradation of FVa and increase in FVa by antithrombin-independent thrombin inhibitors may contribute to the paradoxical TG enhancement, and edoxaban may inhibit PC activation and FVa degradation as a result of TG suppression. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Sorptive thin film microextraction followed by direct solid state spectrofluorimetry: A simple, rapid and sensitive method for determination of carvedilol in human plasma.

    Science.gov (United States)

    Karimi, Shima; Talebpour, Zahra; Adib, Noushin

    2016-06-14

    A poly acrylate-ethylene glycol (PA-EG) thin film is introduced for the first time as a novel polar sorbent for sorptive extraction method coupled directly to solid-state spectrofluorimetry without the necessity of a desorption step. The structure, polarity, fluorescence property and extraction performance of the developed thin film were investigated systematically. Carvedilol was used as the model analyte to evaluate the proposed method. The entire procedure involved one-step extraction of carvedilol from plasma using PA-EG thin film sorptive phase without protein precipitation. Extraction variables were studied in order to establish the best experimental conditions. Optimum extraction conditions were the followings: stirring speed of 1000 rpm, pH of 6.8, extraction temperature of 60 °C, and extraction time of 60 min. Under optimal conditions, extraction of carvedilol was carried out in spiked human plasma; and the linear range of calibration curve was 15-300 ng mL(-1) with regression coefficient of 0.998. Limit of detection (LOD) for the method was 4.5 ng mL(-1). The intra- and inter-day accuracy and precision of the proposed method were evaluated in plasma sample spiked with three concentration levels of carvedilol; yielding a recovery of 91-112% and relative standard deviation of less than 8%, respectively. The established procedure was successfully applied for quantification of carvedilol in plasma sample of a volunteer patient. The developed PA-EG thin film sorptive phase followed by solid-state spectrofluorimetric method provides a simple, rapid and sensitive approach for the analysis of carvedilol in human plasma. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Directional secretory response of double stranded RNA-induced thymic stromal lymphopoetin (TSLP) and CCL11/eotaxin-1 in human asthmatic airways.

    Science.gov (United States)

    Nino, Gustavo; Huseni, Shehlanoor; Perez, Geovanny F; Pancham, Krishna; Mubeen, Humaira; Abbasi, Aleeza; Wang, Justin; Eng, Stephen; Colberg-Poley, Anamaris M; Pillai, Dinesh K; Rose, Mary C

    2014-01-01

    Thymic stromal lymphoproetin (TSLP) is a cytokine secreted by the airway epithelium in response to respiratory viruses and it is known to promote allergic Th2 responses in asthma. This study investigated whether virally-induced secretion of TSLP is directional in nature (apical vs. basolateral) and/or if there are TSLP-mediated effects occurring at both sides of the bronchial epithelial barrier in the asthmatic state. Primary human bronchial epithelial cells (HBEC) from control (n = 3) and asthmatic (n = 3) donors were differentiated into polarized respiratory tract epithelium under air-liquid interface (ALI) conditions and treated apically with dsRNA (viral surrogate) or TSLP. Sub-epithelial effects of TSLP were examined in human airway smooth muscle cells (HASMC) from normal (n = 3) and asthmatic (n = 3) donors. Clinical experiments examined nasal airway secretions obtained from asthmatic children during naturally occurring rhinovirus-induced exacerbations (n = 20) vs. non-asthmatic uninfected controls (n = 20). Protein levels of TSLP, CCL11/eotaxin-1, CCL17/TARC, CCL22/MDC, TNF-α and CXCL8 were determined with a multiplex magnetic bead assay. Our data demonstrate that: 1) Asthmatic HBEC exhibit an exaggerated apical, but not basal, secretion of TSLP after dsRNA exposure; 2) TSLP exposure induces unidirectional (apical) secretion of CCL11/eotaxin-1 in asthmatic HBEC and enhanced CCL11/eotaxin-1 secretion in asthmatic HASMC; 3) Rhinovirus-induced asthma exacerbations in children are associated with in vivo airway secretion of TSLP and CCL11/eotaxin-1. There are virally-induced TSLP-driven secretory immune responses at both sides of the bronchial epithelial barrier characterized by enhanced CCL11/eotaxin-1 secretion in asthmatic airways. These results suggest a new model of TSLP-mediated eosinophilic responses in the asthmatic airway during viral-induced exacerbations.

  7. Directional secretory response of double stranded RNA-induced thymic stromal lymphopoetin (TSLP and CCL11/eotaxin-1 in human asthmatic airways.

    Directory of Open Access Journals (Sweden)

    Gustavo Nino

    Full Text Available Thymic stromal lymphoproetin (TSLP is a cytokine secreted by the airway epithelium in response to respiratory viruses and it is known to promote allergic Th2 responses in asthma. This study investigated whether virally-induced secretion of TSLP is directional in nature (apical vs. basolateral and/or if there are TSLP-mediated effects occurring at both sides of the bronchial epithelial barrier in the asthmatic state.Primary human bronchial epithelial cells (HBEC from control (n = 3 and asthmatic (n = 3 donors were differentiated into polarized respiratory tract epithelium under air-liquid interface (ALI conditions and treated apically with dsRNA (viral surrogate or TSLP. Sub-epithelial effects of TSLP were examined in human airway smooth muscle cells (HASMC from normal (n = 3 and asthmatic (n = 3 donors. Clinical experiments examined nasal airway secretions obtained from asthmatic children during naturally occurring rhinovirus-induced exacerbations (n = 20 vs. non-asthmatic uninfected controls (n = 20. Protein levels of TSLP, CCL11/eotaxin-1, CCL17/TARC, CCL22/MDC, TNF-α and CXCL8 were determined with a multiplex magnetic bead assay.Our data demonstrate that: 1 Asthmatic HBEC exhibit an exaggerated apical, but not basal, secretion of TSLP after dsRNA exposure; 2 TSLP exposure induces unidirectional (apical secretion of CCL11/eotaxin-1 in asthmatic HBEC and enhanced CCL11/eotaxin-1 secretion in asthmatic HASMC; 3 Rhinovirus-induced asthma exacerbations in children are associated with in vivo airway secretion of TSLP and CCL11/eotaxin-1.There are virally-induced TSLP-driven secretory immune responses at both sides of the bronchial epithelial barrier characterized by enhanced CCL11/eotaxin-1 secretion in asthmatic airways. These results suggest a new model of TSLP-mediated eosinophilic responses in the asthmatic airway during viral-induced exacerbations.

  8. Recombinant Human Respiratory Syncytial Virus (RSV) Monoclonal Antibody Fab is Effective Therapeutically when Introduced Directly into the Lungs of RSV-Infected Mice

    Science.gov (United States)

    Crowe, James E., Jr.; Murphy, Brian R.; Chanock, Robert M.; Williamson, R. Anthony; Barbas, Carlos F., III; Burton, Dennis R.

    1994-02-01

    Previously, recombinant human respiratory syncytial virus (RSV) monoclonal antibody Fabs were generated by antigen selection from random combinatorial libraries displayed at the tip of filamentous phage. Two such Fabs, which exhibited high binding affinity for RSV F glycoprotein (a major protective antigen), were evaluated for therapeutic efficacy in infected mice just before or at the time of peak virus replication in the lungs. Fab 19, which neutralized RSV infectivity with high efficiency in tissue culture, was effective therapeutically when delivered directly into the lungs by intranasal instillation under anesthesia. In contrast, RSV Fab 126, which failed to neutralize virus in cell culture, did not exhibit a therapeutic effect under these conditions. The amount of Fab 19 required to effect a 5000- to 12,000-fold reduction in titer of RSV in the lungs within 24 hr was rather small. In four separate experiments, a single instillation of 12.9-50 μg of RSV Fab 19 was sufficient to achieve such a reduction in pulmonary virus in a 25g mouse. The use of Fabs instead of the whole immunoglobulin molecules from which they are derived reduced the protein content of a therapeutic dose. This is important because the protein load that can be delivered effectively into the lungs is limited. The therapeutic effect of a single treatment with Fab 19 was not sustained, so that a rebound in pulmonary virus titer occurred on the 2nd day after treatment. This rebound in pulmonary RSV titer could be prevented by treating infected mice with a single dose of Fab 19 daily for 3 days. These observations suggest that human monoclonal Fabs grown in Escherichia coli may prove useful in the treatment of serious RSV disease as well as diseases caused by other viruses where replication in vivo is limited primarily to the lumenal lining of the respiratory tract.

  9. CDK2 and mTOR are direct molecular targets of isoangustone A in the suppression of human prostate cancer cell growth

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eunjung; Son, Joe Eun; Byun, Sanguine; Lee, Seung Joon; Kim, Yeong A [WCU Biomodulation Major, Department of Agricultural Biotechnology and Center for Food and Bioconvergence, Seoul National University, Seoul 151-921 (Korea, Republic of); Liu, Kangdong [The Hormel Institute, University of Minnesota, 801 16th Avenue NE, Austin, MN 55912 (United States); Kim, Jiyoung [WCU Biomodulation Major, Department of Agricultural Biotechnology and Center for Food and Bioconvergence, Seoul National University, Seoul 151-921 (Korea, Republic of); Lim, Soon Sung; Park, Jung Han Yoon [Department of Food Science and Nutrition, College of Natural Science, Hallym University, Chuncheon, 200-702 (Korea, Republic of); Dong, Zigang [The Hormel Institute, University of Minnesota, 801 16th Avenue NE, Austin, MN 55912 (United States); Lee, Ki Won, E-mail: kiwon@snu.ac.kr [WCU Biomodulation Major, Department of Agricultural Biotechnology and Center for Food and Bioconvergence, Seoul National University, Seoul 151-921 (Korea, Republic of); Advanced Institutes of Convergence Technology, Seoul National University, Suwon 443-270 (Korea, Republic of); Lee, Hyong Joo, E-mail: leehyjo@snu.ac.kr [WCU Biomodulation Major, Department of Agricultural Biotechnology and Center for Food and Bioconvergence, Seoul National University, Seoul 151-921 (Korea, Republic of); Advanced Institutes of Convergence Technology, Seoul National University, Suwon 443-270 (Korea, Republic of)

    2013-10-01

    Licorice extract which is used as a natural sweetener has been shown to possess inhibitory effects against prostate cancer, but the mechanisms responsible are poorly understood. Here, we report a compound, isoangustone A (IAA) in licorice that potently suppresses the growth of aggressive prostate cancer and sought to clarify its mechanism of action. We analyzed its inhibitory effects on the growth of PTEN-deleted human prostate cancer cells, in vitro and in vivo. Administration of IAA significantly attenuated the growth of prostate cancer cell cultures and xenograft tumors. These effects were found to be attributable to inhibition of the G1/S phase cell cycle transition and the accumulation of p27{sup kip1}. The elevated p27{sup kip1} expression levels were concurrent with the decrease of its phosphorylation at threonine 187 through suppression of CDK2 kinase activity and the reduced phosphorylation of Akt at Serine 473 by diminishing the kinase activity of the mammalian target of rapamycin (mTOR). Further analysis using recombinant proteins and immunoprecipitated cell lysates determined that IAA exerts suppressive effects against CDK2 and mTOR kinase activity by direct binding with both proteins. These findings suggested that the licorice compound IAA is a potent molecular inhibitor of CDK2 and mTOR, with strong implications for the treatment of prostate cancer. Thus, licorice-derived extracts with high IAA content warrant further clinical investigation for nutritional sources for prostate cancer patients. - Highlights: • Isoangustone A suppresses growth of PC3 and LNCaP prostate cancer cells. • Administration of isoangustone A inhibits tumor growth in mice. • Treatment of isoangustone A induces cell cycle arrest and accumulation of p27{sup kip1}. • Isoangustone A inhibits CDK2 and mTOR activity. • Isoangustone A directly binds with CDK2 and mTOR complex in prostate cancer cells.

  10. Investigation of scale effects and directionality dependence on friction and adhesion of human hair using AFM and macroscale friction test apparatus

    International Nuclear Information System (INIS)

    LaTorre, Carmen; Bhushan, Bharat

    2006-01-01

    Macroscale testing of human hair tribological properties has been widely used to aid in the development of better shampoos and conditioners. Recently, literature has focused on using the atomic force microscope (AFM) to study surface roughness, coefficient of friction, adhesive force, and wear (tribological properties) on the nanoscale in order to increase understanding about how shampoos and conditioners interact with the hair cuticle. Since there are both similarities and differences when comparing the tribological trends at both scales, it is thus recognized that scale effects are an important aspect of studying the tribology of hair. However, no microscale tribological data for hair exists in literature. This is unfortunate because many interactions between hair-skin, hair-comb, and hair-hair contact takes place at microasperities ranging from a few μm to hundreds of μm. Thus, to bridge the gap between the macro- and nanoscale data, as well as to gain a full understanding of the mechanisms behind the trends, it is now worthwhile to look at hair tribology on the microscale. Presented in this paper are coefficient of friction and adhesive force data on various scales for virgin and chemically damaged hair, both with and without conditioner treatment. Macroscale coefficient of friction was determined using a traditional friction test apparatus. Microscale and nanoscale tribological characterization was performed with AFM tips of various radii. The nano-, micro-, and macroscale trends are compared and the mechanisms behind the scale effects are discussed. Since the coefficient of friction changes drastically (on any scale) depending on whether the direction of motion is along or against the cuticle scales, the directionality dependence and responsible mechanisms are discussed

  11. Human XPC-hHR23B interacts with XPA-RPA in the recognition of triplex-directed psoralen DNA interstrand crosslinks

    DEFF Research Database (Denmark)

    Thoma, Brian S; Wakasugi, Mitsuo; Christensen, Jesper

    2005-01-01

    (NER), XPA-RPA, recognizes DNA ICLs. We now report the use of triplex technology to direct a site-specific psoralen ICL to a target DNA substrate to determine whether the human global genome NER damage recognition complex, XPC-hHR23B, recognizes this lesion. Our results demonstrate that XPC-hHR23B...... recognizes psoralen ICLs, which have a structure fundamentally different from other lesions that XPC-hHR23B is known to bind, with high affinity and specificity. XPC-hHR23B and XPA-RPA protein complexes were also observed to bind psoralen ICLs simultaneously, demonstrating not only that psoralen ICLs...... are recognized by XPC-hHR23B alone, but also that XPA-RPA may interact cooperatively with XPC-hHR23B on damaged DNA, forming a multimeric complex. Since XPC-hHR23B and XPA-RPA participate in the recognition and verification of DNA damage, these results support the hypothesis that interplay between components...

  12. Rapid, High-Throughput, and Direct Molecular Beacon Delivery to Human Cancer Cells Using a Nanowire-Incorporated and Pneumatic Pressure-Driven Microdevice.

    Science.gov (United States)

    Kim, Kyung Hoon; Kim, Jung; Choi, Jong Seob; Bae, Sunwoong; Kwon, Donguk; Park, Inkyu; Kim, Do Hyun; Seo, Tae Seok

    2015-12-01

    Tracking and monitoring the intracellular behavior of mRNA is of paramount importance for understanding real-time gene expression in cell biology. To detect specific mRNA sequences, molecular beacons (MBs) have been widely employed as sensing probes. Although numerous strategies for MB delivery into the target cells have been reported, many issues such as the cytotoxicity of the carriers, dependence on the random probability of MB transfer, and critical cellular damage still need to be overcome. Herein, we have developed a nanowire-incorporated and pneumatic pressure-driven microdevice for rapid, high-throughput, and direct MB delivery to human breast cancer MCF-7 cells to monitor survivin mRNA expression. The proposed microdevice is composed of three layers: a pump-associated glass manifold layer, a monolithic polydimethylsiloxane (PDMS) membrane, and a ZnO nanowire-patterned microchannel layer. The MB is immobilized on the ZnO nanowires by disulfide bonding, and the glass manifold and PDMS membrane serve as a microvalve, so that the cellular attachment and detachment on the MB-coated nanowire array can be manipulated. The combination of the nanowire-mediated MB delivery and the microvalve function enable the transfer of MB into the cells in a controllable way with high cell viability and to detect survivin mRNA expression quantitatively after docetaxel treatment. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Direct radiofluorination of dopamine: 18F-labeled 6-fluorodopamine for imaging cardiac sympathetic innervation in humans using positron emission tomography

    International Nuclear Information System (INIS)

    Chirakal, Raman; Coates, Geoff; Firnau, Guenter; Schrobilgen, Gary J.; Nahmias, Claude

    1996-01-01

    Fluorine-18 labeled fluorodopamine (FDA) was synthesized by the direct fluorination with [ 18 F]F 2 [produced by the nuclear reaction 18 O(p,n) 18 F] of dopamine in anhydrous hydrogen fluoride containing b boron trifluoride at -65 deg. C. Reverse-phase high-performance liquid chromatography (HPLC) was used to separate [ 18 F]6-FDA from the reaction mixture containing 18 F-labeled 2- and 5-FDA. The radio-chemical yield of [ 18 F]6-FDA, with respect to [ 18 F]F 2 , was 10 ± 2% at the end of the 120-min synthesis from EOB1. The specific activity of [ 18 F]6-FDA at the end of synthesis, 10 ± 1.5 Ci/mmol, is sufficiently high that the amount of 6-FDA associated with the infusion of a dose of 5 mCi of [ 18 F]6-FDA over 3 min into a 50-kg human (0.5-0.7 μg/kg/min) is considerably lower than therapeutic doses (2-10 μg/kg/min) of dopamine

  14. Development of freeze-dried kit for direct 99mTc -labeling of nimotuzumab to diagnose human EGFR positive tumors

    International Nuclear Information System (INIS)

    Toledo, Darien; Figueiras, Jenneby; Rojas, Gertrudis; León, Kalet; Gongora Bravo, Magdiel; Miguel Martínez, Antonio; Michel Alonso, Luis; Hernández, Ignacio; León, Mariela; Leyva, René; Hernández, Gerardo Ramses

    2016-01-01

    Epidermal growth factor receptor (EGFR), a 170 kDa transmembrane tyrosine kinase receptor which specifically binds epidermal growth factor (EGF) and transforming growth factor-a (TGFa) that are crucial in signaling cell proliferation, differentiation, and survival1. Overexpression of EGFR has been observed in breast cancer2, colorectal cancer, ovarian cancer, squamous cell lung carcinoma3 head and neck cancer4 and bladder cancer. Molecular imaging using radiopharmaceuticals directed towards EGFR could characterize the receptor status of tumors and thereby predict response to anti-EGFR agents for the treatment of cancer. Nimotuzumab is a humanized anti-EGFR monoclonal antibody5 designed to reduce immunogenicity and rate of clearance from the body6. Radiolabelled formulations of nimotuzumab would have applications for non-invasive imaging in order to characterize EGFR-positive tumors and thus to select patient populations that could benefit from therapy7, 8. The studies described in this work were designed to develop and evaluate the in vitro and in vivo the properties of a radiolabeled freeze dried kit of nimotuzumab and to determine its potential for radio immunodiagnostic applications. (author)

  15. Emergence of a Stage-Dependent Human Liver Disease Signature with Directed Differentiation of Alpha-1 Antitrypsin-Deficient iPS Cells

    Directory of Open Access Journals (Sweden)

    Andrew A. Wilson

    2015-05-01

    Full Text Available Induced pluripotent stem cells (iPSCs provide an inexhaustible source of cells for modeling disease and testing drugs. Here we develop a bioinformatic approach to detect differences between the genomic programs of iPSCs derived from diseased versus normal human cohorts as they emerge during in vitro directed differentiation. Using iPSCs generated from a cohort carrying mutations (PiZZ in the gene responsible for alpha-1 antitrypsin (AAT deficiency, we find that the global transcriptomes of PiZZ iPSCs diverge from normal controls upon differentiation to hepatic cells. Expression of 135 genes distinguishes PiZZ iPSC-hepatic cells, providing potential clues to liver disease pathogenesis. The disease-specific cells display intracellular accumulation of mutant AAT protein, resulting in increased autophagic flux. Furthermore, we detect beneficial responses to the drug carbamazepine, which further augments autophagic flux, but adverse responses to known hepatotoxic drugs. Our findings support the utility of iPSCs as tools for drug development or prediction of toxicity.

  16. MicroRNA-200c modulates the expression of MUC4 and MUC16 by directly targeting their coding sequences in human pancreatic cancer.

    Directory of Open Access Journals (Sweden)

    Prakash Radhakrishnan

    Full Text Available Transmembrane mucins, MUC4 and MUC16 are associated with tumor progression and metastatic potential in human pancreatic adenocarcinoma. We discovered that miR-200c interacts with specific sequences within the coding sequence of MUC4 and MUC16 mRNAs, and evaluated the regulatory nature of this association. Pancreatic cancer cell lines S2.028 and T3M-4 transfected with miR-200c showed a 4.18 and 8.50 fold down regulation of MUC4 mRNA, and 4.68 and 4.82 fold down regulation of MUC16 mRNA compared to mock-transfected cells, respectively. A significant reduction of glycoprotein expression was also observed. These results indicate that miR-200c overexpression regulates MUC4 and MUC16 mucins in pancreatic cancer cells by directly targeting the mRNA coding sequence of each, resulting in reduced levels of MUC4 and MUC16 mRNA and protein. These data suggest that, in addition to regulating proteins that modulate EMT, miR-200c influences expression of cell surface mucins in pancreatic cancer.

  17. Vaccination directed against the human endogenous retrovirus-K (HERV-K) gag protein slows HERV-K gag expressing cell growth in a murine model system.

    Science.gov (United States)

    Kraus, Benjamin; Fischer, Katrin; Sliva, Katja; Schnierle, Barbara S

    2014-03-26

    Human endogenous retroviruses (HERVs) are remnants of ancestral infections and chromosomally integrated in all cells of an individual, are transmitted only vertically and are defective in viral replication. However enhanced expression of HERV-K accompanied by the emergence of anti-HERV-K-directed immune responses has been observed inter-alia in HIV-infected individuals and tumor patients. Therefore HERV-K might serve as a tumor-specific antigen or even as a constant target for the development of an HIV vaccine. To verify our hypothesis, we tested the immunogenicity of HERV-K Gag by using a recombinant vaccinia virus (MVA-HKcon) expressing the HERV-K Gag protein and established an animal model to test its vaccination efficacy. Murine renal carcinoma cells (Renca) were genetically altered to express E. coli beta-galactosidase (RLZ cells) and the HERV-K Gag protein (RLZ-HKGag cells). Subcutaneous application of RLZ-HKGag cells into syngenic BALB/c mice resulted in the formation of local tumors in MVA vaccinated mice. MVA-HKcon vaccination reduced the tumor growth. Furthermore, intravenous injection of RLZ-HKGag cells led to the formation of pulmonary metastases. Vaccination of tumor-bearing mice with MVA-HKcon drastically reduced the number of pulmonary RLZ-HKGag tumor nodules compared to vaccination with wild-type MVA. The data demonstrate that HERV-K Gag is a useful target for vaccine development and might offer new treatment opportunities for cancer patients.

  18. A Novel Protocol for Directed Differentiation of C9orf72-Associated Human Induced Pluripotent Stem Cells Into Contractile Skeletal Myotubes.

    Science.gov (United States)

    Swartz, Elliot W; Baek, Jaeyun; Pribadi, Mochtar; Wojta, Kevin J; Almeida, Sandra; Karydas, Anna; Gao, Fen-Biao; Miller, Bruce L; Coppola, Giovanni

    2016-11-01

    : Induced pluripotent stem cells (iPSCs) offer an unlimited resource of cells to be used for the study of underlying molecular biology of disease, therapeutic drug screening, and transplant-based regenerative medicine. However, methods for the directed differentiation of skeletal muscle for these purposes remain scarce and incomplete. Here, we present a novel, small molecule-based protocol for the generation of multinucleated skeletal myotubes using eight independent iPSC lines. Through combinatorial inhibition of phosphoinositide 3-kinase (PI3K) and glycogen synthase kinase 3β (GSK3β) with addition of bone morphogenic protein 4 (BMP4) and fibroblast growth factor 2 (FGF2), we report up to 64% conversion of iPSCs into the myogenic program by day 36 as indicated by MYOG + cell populations. These cells began to exhibit spontaneous contractions as early as 34 days in vitro in the presence of a serum-free medium formulation. We used this protocol to obtain iPSC-derived muscle cells from frontotemporal dementia (FTD) patients harboring C9orf72 hexanucleotide repeat expansions (rGGGGCC), sporadic FTD, and unaffected controls. iPSCs derived from rGGGGCC carriers contained RNA foci but did not vary in differentiation efficiency when compared to unaffected controls nor display mislocalized TDP-43 after as many as 120 days in vitro. This study presents a rapid, efficient, and transgene-free method for generating multinucleated skeletal myotubes from iPSCs and a resource for further modeling the role of skeletal muscle in amyotrophic lateral sclerosis and other motor neuron diseases. Protocols to produce skeletal myotubes for disease modeling or therapy are scarce and incomplete. The present study efficiently generates functional skeletal myotubes from human induced pluripotent stem cells using a small molecule-based approach. Using this strategy, terminal myogenic induction of up to 64% in 36 days and spontaneously contractile myotubes within 34 days were achieved

  19. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  20. Subcortical surgical anatomy of the lateral frontal region: human white matter dissection and correlations with functional insights provided by intraoperative direct brain stimulation: laboratory investigation.

    Science.gov (United States)

    De Benedictis, Alessandro; Sarubbo, Silvio; Duffau, Hugues

    2012-12-01

    Recent neuroimaging and surgical results support the crucial role of white matter in mediating motor and higher-level processing within the frontal lobe, while suggesting the limited compensatory capacity after damage to subcortical structures. Consequently, an accurate knowledge of the anatomofunctional organization of the pathways running within this region is mandatory for planning safe and effective surgical approaches to different diseases. The aim of this dissection study was to improve the neurosurgeon's awareness of the subcortical anatomofunctional architecture for a lateral approach to the frontal region, to optimize both resection and postoperative outcome. Ten human hemispheres (5 left, 5 right) were dissected according to the Klingler technique. Proceeding lateromedially, the main association and projection tracts as well as the deeper basal structures were identified. The authors describe the anatomy and the relationships among the exposed structures in both a systematic and topographical surgical perspective. Structural results were also correlated to the functional responses obtained during resections of infiltrative frontal tumors guided by direct cortico-subcortical electrostimulation with patients in the awake condition. The eloquent boundaries crucial for a safe frontal lobectomy or an extensive lesionectomy are as follows: 1) the motor cortex; 2) the pyramidal tract and premotor fibers in the posterior and posteromedial part of the surgical field; 3) the inferior frontooccipital fascicle and the superior longitudinal fascicle posterolaterally; and 4) underneath the inferior frontal gyrus, the head of the caudate nucleus, and the tip of the frontal horn of the lateral ventricle in the depth. Optimization of results following brain surgery, especially within the frontal lobe, requires a perfect knowledge of functional anatomy, not only at the cortical level but also with regard to subcortical white matter connectivity.

  1. Rabbit IgG directed to a synthetic C-terminal peptide of the major grass pollen allergen Lol p I inhibits human basophil histamine release induced by natural Lol p I

    NARCIS (Netherlands)

    van Ree, R.; Aalberse, R. C.

    1995-01-01

    The potential role of allergen-specific IgG antibodies as 'blocking' antibodies in allergen-induced human basophil histamine release was investigated. This was studied in a model with the major grass pollen allergen Lol p I and polyclonal rabbit antisera directed against this allergen and against a

  2. Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

    Science.gov (United States)

    Lenzmeier, B A; Giebler, H A; Nyborg, J K

    1998-02-01

    Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

  3. MicroRNA-532 and microRNA-3064 inhibit cell proliferation and invasion by acting as direct regulators of human telomerase reverse transcriptase in ovarian cancer.

    Directory of Open Access Journals (Sweden)

    Lin Bai

    Full Text Available Human telomerase reverse transcriptase (hTERT plays a crucial role in ovarian cancer (OC progression. However, the mechanisms underlying hTERT upregulation in OC, and the specific microRNAs (miRNAs involved in the regulation of hTERT in OC cells, remains unclear. We performed a bioinformatics search to identify potential miRNAs that bind to the 3'-untranslated region (3'-UTR region of the hTERT mRNA. We examined the expression levels of miR-532/miR-3064 in OC tissues and normal ovarian tissues, and analyzed the correlation between miRNA expression and OC patient outcomes. The impacts of miR-532/miR-3064 on hTERT expression were evaluated by western blot analysis and hTERT 3'-UTR reporter assays. We investigated the effects of miR-532/miR-3064 on proliferation and invasion in OC cells. We found that miR-532 and miR-3064 are down-regulated in OC specimens. We observed a significant association between reduced miR-532/miR-3064 expression and poorer survival of patients with OC. We confirmed that in OC cells, these two miRNAs downregulate hTERT levels by directly targeting its 3'-UTR region, and inhibited proliferation, EMT and invasion of OC cells. In addition, the overexpression of the hTERT cDNA lacking the 3'-UTR partially restored miR-532/miR-3064-inhibited OC cell proliferation and invasion. The silencing of hTERT by siRNA oligonucleotides abolished these malignant features, and phenocopied the effects of miR-532/miR-3064 overexpression. Furthermore, overexpression of miR-532/miR-3064 inhibits the growth of OC cells in vivo. Our findings demonstrate a miR-532/miR-3064-mediated mechanism responsible for hTERT upregulation in OC cells, and reveal a possibility of targeting miR-532/miR-3064 for future treatment of OC.

  4. Determination of human-use pharmaceuticals in filtered water by direct aqueous injection: high-performance liquid chromatography/tandem mass spectrometry

    Science.gov (United States)

    Furlong, Edward T.; Noriega, Mary C.; Kanagy, Christopher J.; Kanagy, Leslie K.; Coffey, Laura J.; Burkhardt, Mark R.

    2014-01-01

    This report describes a method for the determination of 110 human-use pharmaceuticals using a 100-microliter aliquot of a filtered water sample directly injected into a high-performance liquid chromatograph coupled to a triple-quadrupole tandem mass spectrometer using an electrospray ionization source operated in the positive ion mode. The pharmaceuticals were separated by using a reversed-phase gradient of formic acid/ammonium formate-modified water and methanol. Multiple reaction monitoring of two fragmentations of the protonated molecular ion of each pharmaceutical to two unique product ions was used to identify each pharmaceutical qualitatively. The primary multiple reaction monitoring precursor-product ion transition was quantified for each pharmaceutical relative to the primary multiple reaction monitoring precursor-product transition of one of 19 isotope-dilution standard pharmaceuticals or the pesticide atrazine, using an exact stable isotope analogue where possible. Each isotope-dilution standard was selected, when possible, for its chemical similarity to the unlabeled pharmaceutical of interest, and added to the sample after filtration but prior to analysis. Method performance for each pharmaceutical was determined for reagent water, groundwater, treated drinking water, surface water, treated wastewater effluent, and wastewater influent sample matrixes that this method will likely be applied to. Each matrix was evaluated in order of increasing complexity to demonstrate (1) the sensitivity of the method in different water matrixes and (2) the effect of sample matrix, particularly matrix enhancement or suppression of the precursor ion signal, on the quantitative determination of pharmaceutical concentrations. Recovery of water samples spiked (fortified) with the suite of pharmaceuticals determined by this method typically was greater than 90 percent in reagent water, groundwater, drinking water, and surface water. Correction for ambient environmental

  5. Design Guidelines and Criteria for User/Operator Transactions with Battlefield Automated Systems. Volume III-A. Human Factors Analyses of User/ Operator Transactions with TACFIRE - The Tactical Fire Direction System

    Science.gov (United States)

    1981-02-01

    7. Reseaarch Product 81-26 - DESIGN GUIDELINES AND CRITERIA FOR USER/ I;. I’OPERATOR TRANSACTIONS WITH BATTLEFIELD AUTOMIATED SYSTEMS I’ /HVtAN...FACTORS XWLYSES :’F K~R/ OPERATOR TRANSACTIONS WTHT TACFIRE - THE TACTICAL FIRE DiRECTION SY2T3EM A HUMAN FACTORS TECHNICAL AREA L~h~h K L-J 1’ U~~i~ ll...Battlefield Auto- Inter : Oct 1979-Feb 1981 mated Systems Volume III-A: Human Factors 4t C/ Analyses of User/Operator Transactions with 6. PERFORMING

  6. New Approaches towards the Elucidation of Epidermal-Dermal Separation in Sulfur Mustard-Exposed Human Skin and Directions for Therapy

    National Research Council Canada - National Science Library

    Mol, Marijke

    2005-01-01

    .... Results of experiments with a human skin ex vivo model show that apoptosis and metalloprotease activity are key elements in HD-induced skin pathogenesis, and that intervention in these two processes...

  7. Efficient in vivo gene transfer to xenotransplanted human skin by lentivirus-mediated, but not by AAV-directed, gene delivery

    DEFF Research Database (Denmark)

    Jakobsen, Maria Vad; Askou, Anne Louise; Dokkedahl, Karin Stenderup

    skin graft, and firefly luciferase expression was observed primarily in neighboring tissue beneath or surrounding the graft. In contrast, gene delivery by intradermally injected lentiviral vectors was efficient and led to extensive and persistent firefly luciferase expression within the human skin...... graft only. The study demonstrates limited capacity of single-stranded AAV vectors of six commonly used serotypes for gene delivery to human skin in vivo....

  8. Introducing directly induced microglia-like (iMG cells from fresh human monocytes: A novel translational research tool for psychiatric disorders.

    Directory of Open Access Journals (Sweden)

    Masahiro eOhgidani

    2015-05-01

    Full Text Available Microglia, glial cells with immunological functions, have been implicated in various neurological diseases and psychiatric disorders in rodent studies, and human postmortem and PET studies. However, the deeper molecular implications of living human microglia have not been clarified.Here, we introduce a novel translational research approach focusing on human microglia. We have recently developed a new technique for creating induced microglia-like (iMG cells from human peripheral blood. Two cytokines, GM-CSF and IL-34, converted human monocytes into the iMG cells within 14 days, which show various microglial characterizations; expressing markers, forming a ramified morphology, and phagocytic activity with various cytokine releases. We have already confirmed the applicability of this technique by analyzing iMG cells from a patient of Nasu-Hakola disease (Ohgidani et al., Sci Rep 2014. We herein show possible applications of the iMG cells in translational research.We believe that this iMG technique will open the door to explore various unknown dynamic aspects of human microglia in psychiatric disorders. This also opens new routes for psychopharmacological approach such as drug efficacy screening and personalized medicine.

  9. Direct Democracy

    DEFF Research Database (Denmark)

    Beramendi, Virginia; Ellis, Andrew; Kaufman, Bruno

    While many books on direct democracy have a regional or national approach, or simply focus on one of the many mechanisms associated with direct democracy, this Handbook delves into a global comparison of direct democracy mechanisms, including referendums, citizens' initiatives, agenda initiatives...... learned. In addition, the uniquely comprehensive world survey outlines direct democracy provisions in 214 countries and territories and indicates which, if any, of these provisions are used by each country or territory at both the national and sub-national levels. Furthermore, the world survey includes...

  10. Directing 101.

    Science.gov (United States)

    Pintoff, Ernest

    Providing an introduction to anyone considering directing as a field of study or career, this book takes a broad look at the process of directing and encourages students and professionals alike to look outside of the movie industry for inspiration. Chapters in the book discuss selecting and acquiring material; budgeting and financing; casting and…

  11. LPS, but not Angiotensin ll, lnduces Direct Pro-lnflammatory Effects in Cultured Mouse Arteries and Human Endothelial and Vascular Smooth Muscle Cells

    DEFF Research Database (Denmark)

    Outzen, Emilie M; Zaki, Marina; Mehryar, Rahila

    2017-01-01

    resistance-sized arteries (MRA) supported by experiments in cultured human primary endothelial and vascular smooth muscle cells. Results showed that 24-hr organ culture of mouse MRA with 10 nM Ang II had, unlike 100 ng/mL LPS, no effects on IL-6 or MCP-1 secretion, VCAM1 mRNA expression or endothelial......]-Ang II had no concentration- or time-dependent effects on IL-6 and MCP-1 secretion in human umbilical vein endothelial cells (HUVEC) and human aortic smooth muscle cells (HASMC). AGTR1 or AGTR2 mRNA expression were undetectable in HUVEC, whereas HASMC expressed only AGTR1 mRNA. In summary, contrary...... rights reserved....

  12. Human eosinophils are direct targets to nanoparticles: Zinc oxide nanoparticles (ZnO) delay apoptosis and increase the production of the pro-inflammatory cytokines IL-1β and IL-8.

    Science.gov (United States)

    Silva, Luis Rafael; Girard, Denis

    2016-09-30

    Zinc oxide NPs (ZnO) have been recently proposed as novel candidates for the treatment of allergic inflammatory diseases. Paradoxically, recent data suggested that ZnO could cause eosinophilic airway inflammation in rodents. Despite the above observations, there are currently no studies reporting direct interaction between a given NP and human eosinophils themselves. In this study, freshly isolated human eosinophils were incubated with ZnO and several cellular functions were studied. We found that ZnO delay human eosinophil apoptosis, partially by inhibiting caspases and by preventing caspase-4 and Bcl-xL degradation. ZnO do not induce production of reactive oxygen species but increase de novo protein synthesis. In addition, ZnO were found to increase the production of the proinflammatory IL-1β and IL-8 cytokines. Using a pharmacological approach, we demonstrated that inhibition of caspase-1 reversed the ability of ZnO to induce IL-1β and IL-8 production, whereas inhibition of caspase-4 only reversed that of IL-8. Our results indicate the necessity of conducting studies to determine the potential of using NP as nanotherapies, particularly in diseases in which eosinophils may be involved. We conclude that, indeed, human eosinophils represent potential new direct targets to NPs, ZnO in the present case. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  13. Direct quantification of human cytomegalovirus immediate-early and late mRNA levels in blood of lung transplant recipients by competitive nucleic acid sequence-based amplification

    NARCIS (Netherlands)

    Greijer, AE; Verschuuren, EAM; Harmsen, MC; Dekkers, CAJ; Adriaanse, HMA; The, TH; Middeldorp, JM

    The dynamics of active human cytomegalovirus (HCMV) infection was monitored by competitive nucleic acid sequence-based amplification (NASBA) assays for quantification of IE1 (UL123) and pp67 (UL65) mRNA expression levels In the blood of patients after lung transplantation. RNA was isolated from 339

  14. Immortalization of normal human mammary epithelial cells in two steps by direct targeting of senescence barriers does not require gross genomic alterations

    Czech Academy of Sciences Publication Activity Database

    Garbe, J.C.; Vrba, Lukáš; Sputova, K.; Fuchs, L.; Novák, Petr; Brothman, A.R.; Jackson, M.; Chin, K.; LaBarge, M.A.; Watts, G.; Futscher, B. W.; Stampfer, M.R.

    2014-01-01

    Roč. 13, č. 21 (2014), s. 3423-3435 ISSN 1538-4101 Institutional support: RVO:60077344 Keywords : genomic instability * human mammary epithelial cells * telomerase Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Cell biology Impact factor: 4.565, year: 2014

  15. Gulf of Mexico and Caribbean Community Sustainability Study Focuses on Tying the Science of Ecosystem Services and Human Health Directly to Community Decision Making

    Science.gov (United States)

    The Community-based Sustainability Research Program in EPA’s Office of Research and Development is studying how the availability of ecosystem goods and services (EGS) is impacted by community decision making and how this relationship alters human wellbeing. We also seek ‘common g...

  16. High prevalence of Human Parechovirus (HPeV) genotypes in the Amsterdam region and the identification of specific HPeV variants by direct genotyping of stool samples

    NARCIS (Netherlands)

    Benschop, K.; Thomas, X.; Serpenti, C.; Molenkamp, R.; Wolthers, K.

    2008-01-01

    Human Parechoviruses (HPeV) are widespread pathogens belonging to the Picornavirus family. Six genotypes are known which have predominantly been isolated from children. Data on prevalence of HPeV genotypes are generally based on cell culture, which may underestimate the prevalence of certain HPeV

  17. Direct analysis of formate in human plasma, serum and whole blood by in-line coupling of microdialysis to capillary electrophoresis for rapid diagnosis of methanol poisoning

    OpenAIRE

    Kubáň, P. (Pavel); Boček, P. (Petr)

    2013-01-01

    A microdialytic device was in-line coupled to capillary electrophoresis for direct injection of blood samples. Its performance was demonstrated on rapid analysis of formic acid in various blood samples including serum samples of a patient diagnosed with acute methanol poisoning.

  18. Direct effects of TNF-α on local fuel metabolism and cytokine levels in the placebo controlled bilaterally infused human leg

    DEFF Research Database (Denmark)

    Bach, Ermina; Nielsen, Bent Roni Ranghøj; Vendelbo, Mikkel

    2013-01-01

    . Insulin and protein signaling in muscle biopsies was not affected by TNF-α. TNF-α directly increased net muscle protein loss, which may contribute to cachexia and general protein loss during severe illness. The finding of increased insulin sensitivity, which could relate to IL-6, is of major clinical...

  19. Use of FTA elute card impregnated with cervicovaginal sample directly into the amplification reaction increases the detection of human papillomavirus DNA.

    Science.gov (United States)

    Santos, Carla R; Franciscatto, Laura G; Barcellos, Regina B; Almeida, Sabrina E M; Rossetti, Maria Lucia R

    2012-01-01

    This study aimed to evaluate the use of the FTA elute card(TM) impregnated with cervicovaginal sample directly in the PCR amplification for detection of HPV-DNA. The results were compared to a reference technique. This method was more efficient than the protocol indicated by the manufacturer, identifying 91.7% against 54.2% of the positive samples.

  20. Use of FTA elute card impregnated with cervicovaginal sample directly into the amplification reaction increases the detection of human papillomavirus DNA

    OpenAIRE

    Santos, Carla R.; Franciscatto, Laura G.; Barcellos, Regina B.; Almeida, Sabrina E. M; Rossetti, Maria Lucia R.

    2012-01-01

    This study aimed to evaluate the use of the FTA elute cardTM impregnated with cervicovaginal sample directly in the PCR amplification for detection of HPV-DNA. The results were compared to a reference technique. This method was more efficient than the protocol indicated by the manufacturer, identifying 91.7% against 54.2% of the positive samples.

  1. Use of FTA elute card impregnated with cervicovaginal sample directly into the amplification reaction increases the detection of human papillomavirus DNA

    Directory of Open Access Journals (Sweden)

    Carla R. Santos

    2012-03-01

    Full Text Available This study aimed to evaluate the use of the FTA elute cardTM impregnated with cervicovaginal sample directly in the PCR amplification for detection of HPV-DNA. The results were compared to a reference technique. This method was more efficient than the protocol indicated by the manufacturer, identifying 91.7% against 54.2% of the positive samples.

  2. Direct analysis of δ2H and δ18O in natural and enriched human urine using laser-based, Off-Axis Integrated Cavity Output Spectroscopy

    Science.gov (United States)

    Berman, Elena S.F.; Fortsona, Susan L.; Snaith, Steven P.; Gupta, Manish; Baer, Douglas S.; Chery, Isabelle; Blanc, Stephane; Melanson, Edward L.; Thomson, Peter J; Speakman, John R.

    2012-01-01

    The stable isotopes of hydrogen (δ2H) and oxygen (δ18O) in human urine are measured during studies of total energy expenditure by the doubly labeled water method, measurement of total body water, and measurement of insulin resistance by glucose disposal among other applications. An ultrasensitive laser absorption spectrometer based on off-axis integrated cavity output spectroscopy was demonstrated for simple and inexpensive measurement of stable isotopes in natural isotopic abundance and isotopically enriched human urine. Preparation of urine for analysis was simple and rapid (approx. 25 samples per hour), requiring no decolorizing or distillation steps. Analysis schemes were demonstrated to address sample-to-sample memory while still allowing analysis of 45 natural or 30 enriched urine samples per day. The instrument was linear over a wide range of water isotopes (δ2H = −454 to +1702 ‰ and δ18O= −58.3 to +265 ‰). Measurements of human urine were precise to better than 0.65 ‰ 1σ for δ2H and 0.09 ‰ 1σ for δ18O for natural urines, 1.1 ‰ 1σ for δ2H and 0.13 ‰ 1σ for δ18O for low enriched urines, and 1.0 ‰ 1σ for δ2H and 0.08 ‰ 1σ for δ18O for high enriched urines. Furthermore, the accuracy of the isotope measurements of human urines was verified to better than ±0.81 ‰ in δ2H and ±0.13 ‰ in δ18O (average deviation) against three independent IRMS laboratories. The ability to immediately and inexpensively measure the stable isotopes of water in human urine is expected to increase the number and variety of experiments which can be undertaken. PMID:23075099

  3. The direct, not V1-mediated, functional influence between the thalamus and middle temporal complex in the human brain is modulated by the speed of visual motion.

    Science.gov (United States)

    Gaglianese, A; Costagli, M; Ueno, K; Ricciardi, E; Bernardi, G; Pietrini, P; Cheng, K

    2015-01-22

    The main visual pathway that conveys motion information to the middle temporal complex (hMT+) originates from the primary visual cortex (V1), which, in turn, receives spatial and temporal features of the perceived stimuli from the lateral geniculate nucleus (LGN). In addition, visual motion information reaches hMT+ directly from the thalamus, bypassing the V1, through a direct pathway. We aimed at elucidating whether this direct route between LGN and hMT+ represents a 'fast lane' reserved to high-speed motion, as proposed previously, or it is merely involved in processing motion information irrespective of speeds. We evaluated functional magnetic resonance imaging (fMRI) responses elicited by moving visual stimuli and applied connectivity analyses to investigate the effect of motion speed on the causal influence between LGN and hMT+, independent of V1, using the Conditional Granger Causality (CGC) in the presence of slow and fast visual stimuli. Our results showed that at least part of the visual motion information from LGN reaches hMT+, bypassing V1, in response to both slow and fast motion speeds of the perceived stimuli. We also investigated whether motion speeds have different effects on the connections between LGN and functional subdivisions within hMT+: direct connections between LGN and MT-proper carry mainly slow motion information, while connections between LGN and MST carry mainly fast motion information. The existence of a parallel pathway that connects the LGN directly to hMT+ in response to both slow and fast speeds may explain why MT and MST can still respond in the presence of V1 lesions. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

  4. Directing Creativity

    DEFF Research Database (Denmark)

    Darsø, Lotte; Ibbotson, Piers

    2008-01-01

    In this article we argue that leaders facing complex challenges can learn from the arts, specifically that leaders can learn by examining how theatre directors direct creativity through creative constraints. We suggest that perceiving creativity as a boundary phenomenon is helpful for directing it....... Like leaders, who are caught in paradoxical situations where they have to manage production and logistics simultaneously with making space for creativity and innovation, theatre directors need to find the delicate balance between on one hand renewal of perceptions, acting and interaction...... and on the other hand getting ready for the opening night. We conclude that the art of directing creativity is linked to developing competencies of conscious presence, attention and vigilance, whereas the craft of directing creativity concerns communication, framing and choice....

  5. Direct Heat

    Energy Technology Data Exchange (ETDEWEB)

    Lienau, P J

    1990-01-01

    Potential resources and applications of earth heat in the form of geothermal energy are large. United States direct uses amount to 2,100 MWt thermal and worldwide 8,850 MWt above a reference temperature of 35 degrees Celsius. Space and district heating are the major direct uses of geothermal energy. Equipment employed in direct use projects is of standard manufacture and includes downhole and circulation pumps, transmission and distribution pipelines, heat exchangers and convectors, heat pumps and chillers. Direct uses of earth heat discussed are space and district heating, greenhouse heating and fish farming, process and industrial applications. The economic feasibility of direct use projects is governed by site specific factors such as location of user and resource, resource quality, system load factor and load density, as well as financing. Examples are presented of district heating in Klamath Falls, and Elko. Further developments of direct uses of geothermal energy will depend on matching user needs to the resource, and improving load factors and load density.

  6. Immunoglobulin variable region sequences of two human monoclonal antibodies directed to an onco-developmental carbohydrate antigen, lactotetraosylceramide (LcOse4Cer).

    Science.gov (United States)

    Yago, K; Zenita, K; Ohwaki, I; Harada, R; Nozawa, S; Tsukazaki, K; Iwamori, M; Endo, N; Yasuda, N; Okuma, M

    1993-11-01

    A human monoclonal antibody, 11-50, was generated and was shown to recognize an onco-developmental carbohydrate antigen, LcOse4Cer. The isotype of this antibody was IgM, lambda, similar to the previously known human anti-LcOse4 antibodies, such as IgMWOO and HMST-1. We raised a murine anti-idiotypic antibody G3 (IgG1, kappa) against 11-50, and tested its reactivity towards the affinity purified human polyclonal anti-LcOse4 antibodies prepared from pooled human sera using a Gal beta 1-->3GlcNAc beta-immobilized column. The results indicated that at least a part of the human polyclonal anti-LcOse4 antibodies shared the G3 idiotype with 11-50. We further analyzed the sequence of variable regions of the two anti-LcOse4 antibodies, 11-50 and HMST-1. Sequence analysis of the heavy chain variable regions indicated that the VH regions of these two antibodies were highly homologous to each other (93.5% at the nucleic acid level), and these antibodies utilized the germline genes VH1.9III and hv3005f3 as the VH segments, which are closely related germline genes of the VHIII family. It was noted that these germline VH genes are frequently utilized in fetal B cells. The JH region of both antibodies was encoded by the JH4 gene. For the light chain, the V lambda segments of the two antibodies were 96.3% homologous to each other at the nucleic acid level. The V lambda segments of both antibodies showed the highest homology to the rearranged V lambda gene called V lambda II.DS among reported V lambda genes, while the exact germline V lambda genes encoding the two antibodies were not yet registered in available sequence databanks. The amino acid sequences of the J lambda segments of both antibodies were identical. These results indicate that the two human antibodies recognizing the onco-developmental carbohydrate antigen Lc4 are encoded by the same or very homologous germline genes.

  7. Antibody fragments directed against different portions of the human neural cell adhesion molecule L1 act as inhibitors or activators of L1 function.

    Directory of Open Access Journals (Sweden)

    Yan Wang

    Full Text Available The neural cell adhesion molecule L1 plays important roles in neuronal migration and survival, neuritogenesis and synaptogenesis. L1 has also been found in tumors of different origins, with levels of L1 expression correlating positively with the metastatic potential of tumors. To select antibodies targeting the varied functions of L1, we screened the Tomlinson library of recombinant human antibody fragments to identify antibodies binding to recombinant human L1 protein comprising the entire extracellular domain of human L1. We obtained four L1 binding single-chain variable fragment antibodies (scFvs, named I4, I6, I13, and I27 and showed by enzyme-linked immunosorbent assay (ELISA that scFvs I4 and I6 have high affinity to the immunoglobulin-like (Ig domains 1-4 of L1, while scFvs I13 and I27 bind strongly to the fibronectin type III homologous (Fn domains 1-3 of L1. Application of scFvs I4 and I6 to human SK-N-SH neuroblastoma cells reduced proliferation and transmigration of these cells. Treatment of SK-N-SH cells with scFvs I13 and I27 enhanced cell proliferation and migration, neurite outgrowth, and protected against the toxic effects of H(2O(2 by increasing the ratio of Bcl-2/Bax. In addition, scFvs I4 and I6 inhibited and scFvs I13 and I27 promoted phosphorylation of src and Erk. Our findings indicate that scFvs reacting with the immunoglobulin-like domains 1-4 inhibit L1 functions, whereas scFvs interacting with the fibronectin type III domains 1-3 trigger L1 functions of cultured neuroblastoma cells.

  8. Development of Transgenic Cloned Pig Models of Skin Inflammation by DNA Transposon-Directed Ectopic Expression of Human β1 and α2 Integrin

    Science.gov (United States)

    Staunstrup, Nicklas Heine; Madsen, Johannes; Primo, Maria Nascimento; Li, Juan; Liu, Ying; Kragh, Peter M.; Li, Rong; Schmidt, Mette; Purup, Stig; Dagnæs-Hansen, Frederik; Svensson, Lars; Petersen, Thomas K.; Callesen, Henrik; Bolund, Lars; Mikkelsen, Jacob Giehm

    2012-01-01

    Integrins constitute a superfamily of transmembrane signaling receptors that play pivotal roles in cutaneous homeostasis by modulating cell growth and differentiation as well as inflammatory responses in the skin. Subrabasal expression of integrins α2 and/or β1 entails hyperproliferation and aberrant differentiation of keratinocytes and leads to dermal and epidermal influx of activated T-cells. The anatomical and physiological similarities between porcine and human skin make the pig a suitable model for human skin diseases. In efforts to generate a porcine model of cutaneous inflammation, we employed the Sleeping Beauty DNA transposon system for production of transgenic cloned Göttingen minipigs expressing human β1 or α2 integrin under the control of a promoter specific for subrabasal keratinocytes. Using pools of transgenic donor fibroblasts, cloning by somatic cell nuclear transfer was utilized to produce reconstructed embryos that were subsequently transferred to surrogate sows. The resulting pigs were all transgenic and harbored from one to six transgene integrants. Molecular analyses on skin biopsies and cultured keratinocytes showed ectopic expression of the human integrins and localization within the keratinocyte plasma membrane. Markers of perturbed skin homeostasis, including activation of the MAPK pathway, increased expression of the pro-inflammatory cytokine IL-1α, and enhanced expression of the transcription factor c-Fos, were identified in keratinocytes from β1 and α2 integrin-transgenic minipigs, suggesting the induction of a chronic inflammatory phenotype in the skin. Notably, cellular dysregulation obtained by overexpression of either β1 or α2 integrin occurred through different cellular signaling pathways. Our findings mark the creation of the first cloned pig models with molecular markers of skin inflammation. Despite the absence of an overt psoriatic phenotype, these animals may possess increased susceptibility to severe skin damage

  9. Directed polymers versus directed percolation

    Science.gov (United States)

    Halpin-Healy, Timothy

    1998-10-01

    Universality plays a central role within the rubric of modern statistical mechanics, wherein an insightful continuum formulation rises above irrelevant microscopic details, capturing essential scaling behaviors. Nevertheless, occasions do arise where the lattice or another discrete aspect can constitute a formidable legacy. Directed polymers in random media, along with its close sibling, directed percolation, provide an intriguing case in point. Indeed, the deep blood relation between these two models may have sabotaged past efforts to fully characterize the Kardar-Parisi-Zhang universality class, to which the directed polymer belongs.

  10. Antibody-directed lentiviral gene transduction for live-cell monitoring and selection of human iPS and hES cells.

    Directory of Open Access Journals (Sweden)

    Dai-tze Wu

    Full Text Available The identification of stem cells within a mixed population of cells is a major hurdle for stem cell biology--in particular, in the identification of induced pluripotent stem (iPS cells during the reprogramming process. Based on the selective expression of stem cell surface markers, a method to specifically infect stem cells through antibody-conjugated lentiviral particles has been developed that can deliver both visual markers for live-cell imaging as well as selectable markers to enrich for iPS cells. Antibodies recognizing SSEA4 and CD24 mediated the selective infection of the iPS cells over the parental human fibroblasts, allowing for rapid expansion of these cells by puromycin selection. Adaptation of the vector allows for the selective marking of human embryonic stem (hES cells for their removal from a population of differentiated cells. This method has the benefit that it not only identifies stem cells, but that specific genes, including positive and negative selection markers, regulatory genes or miRNA can be delivered to the targeted stem cells. The ability to specifically target gene delivery to human pluripotent stem cells has broad applications in tissue engineering and stem cell therapies.

  11. A novel dendritic cell-based direct ex vivo assay for detection and enumeration of circulating antigen-specific human T cells.

    Science.gov (United States)

    Carrio, Roberto; Zhang, Ge; Drake, Donald R; Schanen, Brian C

    2018-05-07

    Although a variety of assays have been used to examine T cell responses in vitro, standardized ex vivo detection of antigen-specific CD4 + T cells from human circulatory PBMCs remains constrained by low-dimensional characterization outputs and the need for polyclonal, mitogen-induced expansion methods to generate detectable response signals. To overcome these limitations, we developed a novel methodology utilizing antigen-pulsed autologous human dendritic target cells in a rapid and sensitive assay to accurately enumerate antigen-specific CD4 + T cell precursor frequency by multiparametric flow cytometry. With this approach, we demonstrate the ability to reproducibly quantitate poly-functional T cell responses following both primary and recall antigenic stimulation. Furthermore, this approach enables more comprehensive phenotypic profiling of circulating antigen-specific CD4 + T cells, providing valuable insights into the pre-existing polarization of antigen-specific T cells in humans. Combined, this approach permits sensitive and detailed ex vivo detection of antigen-specific CD4 + T cells delivering an important tool for advancing vaccine, immune-oncology and other therapeutic studies.

  12. 'Goats that stare at men': dwarf goats alter their behaviour in response to human head orientation, but do not spontaneously use head direction as a cue in a food-related context.

    Science.gov (United States)

    Nawroth, Christian; von Borell, Eberhard; Langbein, Jan

    2015-01-01

    Recently, comparative research on the mechanisms and species-specific adaptive values of attributing attentive states and using communicative cues has gained increased interest, particularly in non-human primates, birds, and dogs. Here, we investigate these phenomena in a farm animal species, the dwarf goat (Capra aegagrus hircus). In the first experiment, we investigated the effects of different human head and body orientations, as well as human experimenter presence/absence, on the behaviour of goats in a food-anticipating paradigm. Over a 30-s interval, the experimenter engaged in one of four different postures or behaviours (head and body towards the subject-'Control', head to the side, head and body away from the subject, or leaving the room) before delivering a reward. We found that the level of subjects' active anticipatory behaviour was highest in the control condition and decreased with a decreasing level of attention paid to the subject by the experimenter. Additionally, goats 'stared' (i.e. stood alert) at the experimental set-up for significantly more time when the experimenter was present but paid less attention to the subject ('Head' and 'Back' condition) than in the 'Control' and 'Out' conditions. In a second experiment, the experimenter provided different human-given cues that indicated the location of a hidden food reward in a two-way object choice task. Goats were able to use both 'Touch' and 'Point' cues to infer the correct location of the reward but did not perform above the level expected by chance in the 'Head only' condition. We conclude that goats are able to differentiate among different body postures of a human, including head orientation; however, despite their success at using multiple physical human cues, they fail to spontaneously use human head direction as a cue in a food-related context.

  13. Rapid, Automated, and Specific Immunoassay to Directly Measure Matrix Metalloproteinase-9–Tissue Inhibitor of Metalloproteinase-1 Interactions in Human Plasma Using AlphaLISA Technology: A New Alternative to Classical ELISA

    Directory of Open Access Journals (Sweden)

    Helena Pulido-Olmo

    2017-07-01

    Full Text Available The protocol describes a novel, rapid, and no-wash one-step immunoassay for highly sensitive and direct detection of the complexes between matrix metalloproteinases (MMPs and their tissue inhibitor of metalloproteinases (TIMPs based on AlphaLISA® technology. We describe two procedures: (i one approach is used to analyze MMP-9–TIMP-1 interactions using recombinant human MMP-9 with its corresponding recombinant human TIMP-1 inhibitor and (ii the second approach is used to analyze native or endogenous MMP-9–TIMP-1 protein interactions in samples of human plasma. Evaluating native MMP-9–TIMP-1 complexes using this approach avoids the use of indirect calculations of the MMP-9/TIMP-1 ratio for which independent MMP-9 and TIMP-1 quantifications by two conventional ELISAs are needed. The MMP-9–TIMP-1 AlphaLISA® assay is quick, highly simplified, and cost-effective and can be completed in less than 3 h. Moreover, the assay has great potential for use in basic and preclinical research as it allows direct determination of native MMP-9–TIMP-1 complexes in circulating blood as biofluid.

  14. Direct Head-To-Head Comparison of Cationic Liposome-Mediated Gene Delivery to Mesenchymal Stem/Stromal Cells of Different Human Sources: A Comprehensive Study

    Science.gov (United States)

    Boura, Joana S.; dos Santos, Francisco; Gimble, Jeffrey M.; Cardoso, Carla M.P.; Madeira, Catarina; Cabral, Joaquim M.S.

    2013-01-01

    Abstract Nonviral gene delivery to human mesenchymal stem/stromal cells (MSC) can be considered a very promising strategy to improve their intrinsic features, amplifying the therapeutic potential of these cells for clinical applications. In this work, we performed a comprehensive comparison of liposome-mediated gene transfer efficiencies to MSC derived from different human sources—bone marrow (BM MSC), adipose tissue-derived cells (ASC), and umbilical cord matrix (UCM MSC). The results obtained using a green fluorescent protein (GFP)-encoding plasmid indicated that MSC isolated from BM and UCM are more amenable to genetic modification when compared to ASC as they exhibited superior levels of viable, GFP+ cells 48 hr post-transfection, 58±7.1% and 54±3.8%, respectively, versus 33±4.7%. For all cell sources, high cell recoveries (≈50%) and viabilities (>85%) were achieved, and the transgene expression was maintained for 10 days. Levels of plasmid DNA uptake, as well as kinetics of transgene expression and cellular division, were also determined. Importantly, modified cells were found to retain their characteristic immunophenotypic profile and multilineage differentiation capacity. By using the lipofection protocol optimized herein, we were able to maximize transfection efficiencies to human MSC (maximum of 74% total GFP+ cells) and show that lipofection is a promising transfection strategy for MSC genetic modification, especially when a transient expression of a therapeutic gene is required. Importantly, we also clearly demonstrated that intrinsic features of MSC from different sources should be taken into consideration when developing and optimizing strategies for MSC engineering with a therapeutic gene. PMID:23360350

  15. Synthesis, purification, and characterization of an Arg152 → Glu site-directed mutant of recombinant human blood clotting factor VII

    International Nuclear Information System (INIS)

    Wildgoose, P.; Kisiel, W.; Berkner, K.L.

    1990-01-01

    Coagulation factor VII circulates in blood as a single-chain zymogen of a serine protease and is converted to its activated two-chain form, factor VIIa, by cleavage of an internal peptide bond located at Arg 152 -Ile 153 . Previous studies using serine protease active-site inhibitors suggest that zymogen factor VII may possess sufficient proteolytic activity to initiate the extrinsic pathway of blood coagulation. In order to assess the putative intrinsic proteolytic activity of single-chain factor VII, the authors have constructed a site-specific mutant of recombinant human factor VII in which arginine-152 has been replaced with a glutamic acid residue. Mutant factor VII was purified in a single step from culture supernatants of baby hamster kidney cells transfected with a plasmid containing the sequence for Arg 152 → Glu factor VII using a calcium-dependent, murine anti-factor VII monoclonal antibody column. The clotting activity of mutant factor VII was completely inhibited following incubation with dansyl-Glu-Gly-Arg chloromethyl ketone, suggesting that the apparent clotting activity of mutant factor VII was due to a contaminating serine protease. Immunoblots of mutant factor VII with human factor IXa revealed no cleavage, whereas incubation of mutant factor VII with human factor Xa resulted in cleavage of mutant factor VII and the formation of a lower molecular weight degradation product migrating at M r ∼40 000. The results are consistent with the proposal that zymogen factor VII possesses no intrinsic proteolytic activity toward factor X or factor IX

  16. Synthesis, purification, and characterization of an Arg sub 152 yields Glu site-directed mutant of recombinant human blood clotting factor VII

    Energy Technology Data Exchange (ETDEWEB)

    Wildgoose, P.; Kisiel, W. (Univ. of New Mexico, Albuquerque (USA)); Berkner, K.L. (ZymoGenetics, Inc., Seattle, WA (USA))

    1990-04-03

    Coagulation factor VII circulates in blood as a single-chain zymogen of a serine protease and is converted to its activated two-chain form, factor VIIa, by cleavage of an internal peptide bond located at Arg{sub 152}-Ile{sub 153}. Previous studies using serine protease active-site inhibitors suggest that zymogen factor VII may possess sufficient proteolytic activity to initiate the extrinsic pathway of blood coagulation. In order to assess the putative intrinsic proteolytic activity of single-chain factor VII, the authors have constructed a site-specific mutant of recombinant human factor VII in which arginine-152 has been replaced with a glutamic acid residue. Mutant factor VII was purified in a single step from culture supernatants of baby hamster kidney cells transfected with a plasmid containing the sequence for Arg{sub 152} {yields} Glu factor VII using a calcium-dependent, murine anti-factor VII monoclonal antibody column. The clotting activity of mutant factor VII was completely inhibited following incubation with dansyl-Glu-Gly-Arg chloromethyl ketone, suggesting that the apparent clotting activity of mutant factor VII was due to a contaminating serine protease. Immunoblots of mutant factor VII with human factor IXa revealed no cleavage, whereas incubation of mutant factor VII with human factor Xa resulted in cleavage of mutant factor VII and the formation of a lower molecular weight degradation product migrating at M{sup r}{approx}40 000. The results are consistent with the proposal that zymogen factor VII possesses no intrinsic proteolytic activity toward factor X or factor IX.

  17. Direct Measurements of Human Colon Crypt Stem Cell Niche Genetic Fidelity: The Role of Chance in Non-Darwinian Mutation Selection

    Directory of Open Access Journals (Sweden)

    Haeyoun eKang

    2013-10-01

    Full Text Available Perfect human stem cell genetic fidelity would prevent aging and cancer. However, perfection would be difficult to achieve, and aging is universal and cancers common. A hypothesis is that because mutations are inevitable over a human lifetime, downstream mechanisms have evolved to manage the deleterious effects of beneficial and lethal mutations. In the colon, a crypt stem cell architecture reduces the number of mitotic cells at risk for mutation accumulation, and multiple niche stem cells ensure that a lethal mutation within any single stem cell does not lead to crypt death. In addition, the architecture of the colon crypt stem cell niche may harness probability or chance to randomly discard many beneficial mutations that might lead to cancer. An analysis of somatic chromosome copy number alterations (CNAs reveals a lack of perfect fidelity in individual normal human crypts, with age-related increases and higher frequencies in ulcerative colitis, a proliferative, inflammatory disease. The age-related increase in somatic CNAs appears consistent with relatively normal replication error and cell division rates. Surprisingly, and similar to point mutations in cancer genomes, the types of crypt mutations were more consistent with random fixation rather than selection. In theory, a simple non-Darwinian way to nullify selection is to reduce the size of the reproducing population. Fates are more determined by chance rather than selection in very small populations, and therefore selection may be minimized within small crypt niches. The desired effect is that many beneficial mutations that might lead to cancer are randomly lost by drift rather than fixed by selection. The subdivision of the colon into multiple very small stem cell niches may trade Darwinian evolution for non-Darwinian somatic cell evolution, capitulating to aging but reducing cancer risks.

  18. Direct Human Papillomavirus E6 Whole-Cell Enzyme-Linked Immunosorbent Assay for Objective Measurement of E6 Oncoproteins in Cytology Samples

    OpenAIRE

    Yang, Yi-Shan; Smith-McCune, Karen; Darragh, Teresa M.; Lai, Yvonne; Lin, Ju-Hwa; Chang, Ting-Chang; Guo, Hsiao-Yun; Kesler, Tiea; Carter, Alicia; Castle, Philip E.; Cheng, Shuling

    2012-01-01

    A novel, whole-cell enzyme-linked immunosorbent assay (ELISA) based on a non-type-specific anti-human papillomavirus (HPV) E6 antibody was tested on 182 residual cytological specimens. For samples with a designation of more severe than cervical intraepithelial neoplasia grade 3 (CIN3+), 83% tested positive for E6; in a subset with paired testing for E6 ELISA and HPV DNA, 72% tested E6 positive and 92% tested high-risk (HR)-HPV DNA positive (P = 0.2). Among the women with a less than CIN3 diag...

  19. Joint EEG/fMRI state space model for the detection of directed interactions in human brains—a simulation study

    International Nuclear Information System (INIS)

    Lenz, Michael; Linke, Yannick; Timmer, Jens; Schelter, Björn; Musso, Mariachristina; Weiller, Cornelius; Tüscher, Oliver

    2011-01-01

    An often addressed challenge in neuroscience research is the assignment of different tasks to specific brain regions. In many cases several brain regions are activated during a single task. Therefore, one is also interested in the temporal evolution of brain activity to infer causal relations between activated brain regions. These causal relations may be described by a directed, task specific network which consists of activated brain regions as vertices and directed edges. The edges describe the causal relations. Inference of the task specific brain network from measurements like electroencephalography (EEG) or functional magnetic resonance imaging (fMRI) is challenging, due to the low spatial resolution of the former and the low temporal resolution of the latter. Here, we present a simulation study investigating a possible combined analysis of simultaneously measured EEG and fMRI data to address the challenge specified above. A nonlinear state space model is used to distinguish between the underlying brain states and the (simulated) EEG/fMRI measurements. We make use of a modified unscented Kalman filter and a corresponding unscented smoother for the estimation of the underlying neural activity. Model parameters are estimated using an expectation-maximization algorithm, which exploits the partial linearity of our model. Inference of the brain network structure is then achieved using directed partial correlation, a measure for Granger causality. The results indicate that the convolution effect of the fMRI forward model imposes a big challenge for the parameter estimation and reduces the influence of the fMRI in combined EEG–fMRI models. It remains to be investigated whether other models or similar combinations of other modalities such as, e.g., EEG and magnetoencephalography can increase the profit of the promising idea of combining various modalities

  20. Direct marketing

    Directory of Open Access Journals (Sweden)

    Čičić Muris

    2002-01-01

    Full Text Available Direct Marketing (DM is usually treated as unworthy activity, with actions at the edge of legality and activities minded cheating. Despite obvious problems regarding ethics and privacy threat, DM with its size, importance and role in a concept of integrated marketing communication deserves respect and sufficient analysis and review

  1. Simultaneous and Direct Determination of Vancomycin and Cephalexin in Human Plasma by Using HPLC-DAD Coupled with Second-Order Calibration Algorithms

    Directory of Open Access Journals (Sweden)

    Le-Qian Hu

    2012-01-01

    Full Text Available A simple, rapid, and sensitive method for the simultaneous determination of vancomycin and cephalexin in human plasma was developed by using HPLC-DAD with second-order calibration algorithms. Instead of a completely chromatographic separation, mathematical separation was performed by using two trilinear decomposition algorithms, that is, PARAFAC-alternative least squares (PARAFAC-ALSs and self-weight-alternative-trilinear-decomposition- (SWATLD- coupled high-performance liquid chromatography with DAD detection. The average recoveries attained from PARAFAC-ALS and SWATLD with the factor number of 4 (N=4 were 101±5% and 102±4% for vancomycin, and 96±3% and 97±3% for cephalexininde in real human samples, respectively. The statistical comparison between PARAFAC-ALS and SWATLD is demonstrated to be similar. The results indicated that the combination of HPLC-DAD detection with second-order calibration algorithms is a powerful tool to quantify the analytes of interest from overlapped chromatographic profiles for complex analysis of drugs in plasma.

  2. Pharmacological and functional characterisation of the wild-type and site-directed mutants of the human H1 histamine receptor stably expressed in CHO cells.

    Science.gov (United States)

    Moguilevsky, N; Varsalona, F; Guillaume, J P; Noyer, M; Gillard, M; Daliers, J; Henichart, J P; Bollen, A

    1995-01-01

    A cDNA clone for the human histamine H1 receptor was isolated from a lung cDNA library and stably expressed in CHO cells. The recombinant receptor protein present in the cell membranes, displayed the functional and binding characteristics of histamine H1 receptors. Mutation of Ser155 to Ala in the fourth transmembrane domain did not significantly change the affinity of the receptor for histamine and H1 antagonists. However, mutation of the fifth transmembrane Asn198 to Ala resulted in a dramatic decrease of the affinity for histamine binding, and for the histamine-induced polyphosphoinositides breakdown, whereas the affinity towards antagonists was not significantly modified. In addition, mutation of another fifth transmembrane amino acid, Thr194 to Ala also diminished, but to a lesser extent, the affinity for histamine. These data led us to propose a molecular model for histamine interaction with the human H1 receptor. In this model, the amide moiety of Asn198 and the hydroxyl group of Thr194 are involved in hydrogen bonding with the nitrogen atoms of the imidazole ring of histamine. Moreover, mutation of Thr194 to Ala demonstrated that this residue is responsible for the discrimination between enantiomers of cetirizine.

  3. Double silencing of relevant genes suggests the existence of the direct link between DNA replication/repair and central carbon metabolism in human fibroblasts.

    Science.gov (United States)

    Wieczorek, Aneta; Fornalewicz, Karolina; Mocarski, Łukasz; Łyżeń, Robert; Węgrzyn, Grzegorz

    2018-04-15

    Genetic evidence for a link between DNA replication and glycolysis has been demonstrated a decade ago in Bacillus subtilis, where temperature-sensitive mutations in genes coding for replication proteins could be suppressed by mutations in genes of glycolytic enzymes. Then, a strong influence of dysfunctions of particular enzymes from the central carbon metabolism (CCM) on DNA replication and repair in Escherichia coli was reported. Therefore, we asked if such a link occurs only in bacteria or it is a more general phenomenon. Here, we demonstrate that effects of silencing (provoked by siRNA) of expression of genes coding for proteins involved in DNA replication and repair (primase, DNA polymerase ι, ligase IV, and topoisomerase IIIβ) on these processes (less efficient entry into the S phase of the cell cycle and decreased level of DNA synthesis) could be suppressed by silencing of specific genes of enzymes from CMM. Silencing of other pairs of replication/repair and CMM genes resulted in enhancement of the negative effects of lower expression levels of replication/repair genes. We suggest that these results may be proposed as a genetic evidence for the link between DNA replication/repair and CMM in human cells, indicating that it is a common biological phenomenon, occurring from bacteria to humans. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. A milk protein gene promoter directs the expression of human tissue plasminogen activator cDNA to the mammary gland in transgenic mice

    International Nuclear Information System (INIS)

    Pittius, C.W.; Hennighausen, L.; Lee, E.; Westphal, H.; Nicols, E.; Vitale, J.; Gordon, K.

    1988-01-01

    Whey acidic protein (WAP) is a major whey protein in mouse milk. Its gene is expressed in the lactating mammary gland and is inducible by steroid and peptide hormones. A series of transgenic mice containing a hybrid gene in which human tissue plasminogen activator (tPA) cDNA is under the control of the murine WAP gene promoter had previously been generated. In this study, 21 tissues from lactating and virgin transgenic female mice containing the WAP-tPA hybrid gene were screened for the distribution of murine WAP and human tPA transcripts. Like the endogenous WAP RNA, WAP-tPA RNA was expressed predominantly in mammary gland tissue and appeared to be inducible by lactation. Whereas WAP transcripts were not detected in 22 tissues of virgin mice, low levels of WAP-tPA RNA, which were not modulated during lactation, were found in tongue, kidney, and sublingual gland. These studies demonstrate that the WAP gene promoter can target the expression of a transgene to the mammary gland and that this expression is inducible during lactation

  5. In vitro and in vivo assessment of direct effects of simulated solar and galactic cosmic radiation on human hematopoietic stem/progenitor cells.

    Science.gov (United States)

    Rodman, C; Almeida-Porada, G; George, S K; Moon, J; Soker, S; Pardee, T; Beaty, M; Guida, P; Sajuthi, S P; Langefeld, C D; Walker, S J; Wilson, P F; Porada, C D

    2017-06-01

    Future deep space missions to Mars and near-Earth asteroids will expose astronauts to chronic solar energetic particles (SEP) and galactic cosmic ray (GCR) radiation, and likely one or more solar particle events (SPEs). Given the inherent radiosensitivity of hematopoietic cells and short latency period of leukemias, space radiation-induced hematopoietic damage poses a particular threat to astronauts on extended missions. We show that exposing human hematopoietic stem/progenitor cells (HSC) to extended mission-relevant doses of accelerated high-energy protons and iron ions leads to the following: (1) introduces mutations that are frequently located within genes involved in hematopoiesis and are distinct from those induced by γ-radiation; (2) markedly reduces in vitro colony formation; (3) markedly alters engraftment and lineage commitment in vivo; and (4) leads to the development, in vivo, of what appears to be T-ALL. Sequential exposure to protons and iron ions (as typically occurs in deep space) proved far more deleterious to HSC genome integrity and function than either particle species alone. Our results represent a critical step for more accurately estimating risks to the human hematopoietic system from space radiation, identifying and better defining molecular mechanisms by which space radiation impairs hematopoiesis and induces leukemogenesis, as well as for developing appropriately targeted countermeasures.

  6. Distinct kinetics of human DNA ligases I, IIIalpha, IIIbeta, and IV reveal direct DNA sensing ability and differential physiological functions in DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xi; Ballin, Jeff D.; Della-Maria, Julie; Tsai, Miaw-Sheue; White, Elizabeth J.; Tomkinson, Alan E.; Wilson, Gerald M.

    2009-05-11

    The three human LIG genes encode polypeptides that catalyze phosphodiester bond formation during DNA replication, recombination and repair. While numerous studies have identified protein partners of the human DNA ligases (hLigs), there has been little characterization of the catalytic properties of these enzymes. In this study, we developed and optimized a fluorescence-based DNA ligation assay to characterize the activities of purified hLigs. Although hLigI joins DNA nicks, it has no detectable activity on linear duplex DNA substrates with short, cohesive single-strand ends. By contrast, hLigIII{beta} and the hLigIII{alpha}/XRCC1 and hLigIV/XRCC4 complexes are active on both nicked and linear duplex DNA substrates. Surprisingly, hLigIV/XRCC4, which is a key component of the major non-homologous end joining (NHEJ) pathway, is significantly less active than hLigIII on a linear duplex DNA substrate. Notably, hLigIV/XRCC4 molecules only catalyze a single ligation event in the absence or presence of ATP. The failure to catalyze subsequent ligation events reflects a defect in the enzyme-adenylation step of the next ligation reaction and suggests that, unless there is an in vivo mechanism to reactivate DNA ligase IV/XRCC4 following phosphodiester bond formation, the cellular NHEJ capacity will be determined by the number of adenylated DNA ligaseIV/XRCC4 molecules.

  7. UVB irradiation does not directly induce detectable changes of DNA methylation in human keratinocytes [v1; ref status: indexed, http://f1000r.es/np

    Directory of Open Access Journals (Sweden)

    Christoph Lahtz

    2013-02-01

    Full Text Available Unprotected exposure to UVB radiation from the sun and the resulting DNA damage are thought to be responsible for physiological changes in the skin and for a variety of skin cancers, including basal cell and squamous cell carcinoma and malignant melanoma. Although the mutagenic effects of UVB have been well documented and studied mechanistically, there is only limited information as to whether UV light may also be responsible for inducing epigenetic changes in the genome of exposed cells. DNA methylation is a stable epigenetic modification involved in gene control. To study the effects of UVB radiation on DNA methylation, we repeatedly exposed normal human keratinocytes to a UVB light source. After a recovery period, we analyzed global DNA methylation patterns in the irradiated and control cells using the methylated-CpG island recovery assay (MIRA method in combination with high-resolution microarrays. Bioinformatics analysis revealed only a limited number of possible differences between UVB-exposed and control cells. However, these minor apparent changes could not be independently confirmed by bisulfite sequencing-based approaches. This study reveals that UVB irradiation of keratinocytes has no recognizable global effect on DNA methylation patterns and suggests that changes in DNA methylation, as observed in skin cancers, are not immediate consequences of human exposure to solar UVB irradiation.

  8. Direct determination of Cd and Pb in human urine by GFAAS with deuterium-lamp background correction using different chemical modifiers

    International Nuclear Information System (INIS)

    Husakova, L.; Baoinova, M.; Sramkova, J.; Cernohorsky, T.

    2007-01-01

    Several authors have contributed to the elaboration of methodology for direct determination of Cd and Pb in urine by graphite furnace atomic absorption spectrometry (GFAAS). In the proposed approaches, Zeeman background correction systems were predominantly used, without paying much attention to the selection of an appropriate chemical modifier. However, systematic studies on eleven recommended and less commonly used modifiers have resulted in optimization of atomization conditions, so that accurate analysis also with the use of D 2 -lamp background correction became possible. This was confirmed by comparative measurements using both background correction systems. For determination of Cd in urine, NH 4 F has been selected resulting in the lowest limit of detection (LOD): 0.07 μg L -1 . NH 4 F promotes efficient atomization at low temperatures and suppresses chloride interference effect. Pd + Sr (nitrate) has been selected as the most adequate modifier for determination of Pb. Its presence raised the maximum tolerable pyrolysis temperature up to 1200 o C, which resulted in the maximum reduction of the background signal and the lowest LOD of 1.5 mg L -1