Directory of Open Access Journals (Sweden)
L.G. Mamonova
2007-01-01
Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.
DEFF Research Database (Denmark)
Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens
2011-01-01
Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...
Antinociceptive effect of purine nucleotides.
Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R
1996-10-01
The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.
The arabidopsis cyclic nucleotide interactome
Donaldson, Lara Elizabeth
2016-05-11
Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.
2012-01-01
Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756
Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J
2012-02-03
Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.
Kondo, Jiro; Westhof, Eric
2011-10-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.
The arabidopsis cyclic nucleotide interactome
Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A
2016-01-01
Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions
Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.
Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B
2017-09-01
In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.
Cyclic nucleotides and radioresistnace
International Nuclear Information System (INIS)
Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.
1982-01-01
The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru
Nucleotide sequence preservation of human mitochondrial DNA
International Nuclear Information System (INIS)
Monnat, R.J. Jr.; Loeb, L.A.
1985-01-01
Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms
Palindromic nucleotide analysis in human T cell receptor rearrangements.
Directory of Open Access Journals (Sweden)
Santosh K Srivastava
Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.
Supplementary Material for: The arabidopsis cyclic nucleotide interactome
Donaldson, Lara; Meier, Stuart; Gehring, Christoph A
2016-01-01
Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.
Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase
International Nuclear Information System (INIS)
Aalto, T.K.; Raivio, K.O.
1990-01-01
Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage
Main: Nucleotide Analysis [KOME
Lifescience Database Archive (English)
Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...
Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi
2010-11-19
Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.
Bacterial nucleotide-based second messengers.
Pesavento, Christina; Hengge, Regine
2009-04-01
In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.
Enzymatic Incorporation of Modified Purine Nucleotides in DNA.
Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet
2017-12-14
A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Identification of cyclic nucleotide gated channels using regular expressions
Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.
2013-01-01
Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin
Nucleotide Metabolism and its Control in Lactic Acid Bacteria
DEFF Research Database (Denmark)
Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal
2005-01-01
Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....
Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...
African Journals Online (AJOL)
PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...
Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.
E, Chao; Duan, Baogen; Yu, Jin
2017-04-20
Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.
Single Nucleotide Polymorphism
DEFF Research Database (Denmark)
Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg
2014-01-01
Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....
Condensing the information in DNA with double-headed nucleotides
DEFF Research Database (Denmark)
Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte
2017-01-01
A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...
Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping
Hendershot, Jenna M.; O'Brien, Patrick J.
2014-01-01
Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304
Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity
Directory of Open Access Journals (Sweden)
Tobias Fromme
2018-02-01
Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase
DNA Nucleotides Detection via capacitance properties of Graphene
Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash
2016-05-01
In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.
Directory of Open Access Journals (Sweden)
Desirée Villahermosa
2017-05-01
Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.
In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...
African Journals Online (AJOL)
Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.
Statistical properties and fractals of nucleotide clusters in DNA sequences
International Nuclear Information System (INIS)
Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting
2004-01-01
Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
Detection of DNA nucleotides on pretreated boron doped diamond electrodes
Energy Technology Data Exchange (ETDEWEB)
Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica
2011-07-01
The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway
International Nuclear Information System (INIS)
Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori
1977-01-01
In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-01-01
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...
Electrical detection and quantification of single and mixed DNA nucleotides in suspension
Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah
2016-09-01
High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.
The possible role of human milk nucleotides as sleep inducers.
Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen
2009-02-01
Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P inducing the 'hypnotic' action of breast-milk at night in the infant.
The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment
Energy Technology Data Exchange (ETDEWEB)
Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)
2014-02-26
For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.
Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.
Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O
1987-06-01
The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.
Nucleotide excision repair in yeast
Eijk, Patrick van
2012-01-01
Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The
The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition
Štambuk, Nikola
The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.
Nucleotide diversity and phylogenetic relationships among ...
Indian Academy of Sciences (India)
2017-03-03
Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.
Free amino acids and 5'-nucleotides in Finnish forest mushrooms.
Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo
2018-05-01
Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Vetter, I.R.; Reinstein, J.; Roesch, P.
1990-01-01
One- and two-dimensional nuclear magnetic resonance (NMR) studies, in particular substrate-protein nuclear Overhauser effect (NOESY) measurements, as well as nucleotide and P 1 ,P 5 -bis-(5'-adenosyl) pentaphosphate (AP 5 A) titrations and studies of the temperature-dependent unfolding of the tertiary structure of Escherichia coli adenylate kinase (AK EC ) were performed. These experiments and comparison with the same type of experiments performed with the porcine enzyme led them to the following conclusions: (1) at pH 8 and concentrations of approximately 2.5-3 mM, AK EC is partially unfolded at 318 K; (2) ATP·Mg 2+ binds to the ATP site with a dissociation constant of approximately 40 μM under the assumption that ATP binds to one nucleotide site only; (3) AP 5 A·Mg 2+ binds to both nucleotide sites and thus simulates the active complex; (4) the ATP·Mg 2+ adenine in the AK EC ·AP 5 A·Mg 2+ complex is located close to His 134 and Phe 19 ; (5) the AK EC G-loop with bound ATP·Mg 2+ is structurally highly homologous to the loop region in the oncogene product p21 with bound GTP·Mg 2+
Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.
Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela
2013-07-01
Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.
Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap
DEFF Research Database (Denmark)
Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey
2011-01-01
A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...
Directory of Open Access Journals (Sweden)
Simon Reed
2012-09-01
Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.
Nucleotide excision repair in the test tube.
N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)
1995-01-01
textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.
The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.
Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L
1989-04-01
The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.
Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.
Le Gall, O; Candresse, T; Brault, V; Dunez, J
1989-10-11
The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.
Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens.
Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric
2017-12-01
Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.
Directory of Open Access Journals (Sweden)
Arehart Eric
2009-03-01
Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in
Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays
Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse
2013-11-01
Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.
Vacuum ultraviolet photoionization of carbohydrates and nucleotides
Energy Technology Data Exchange (ETDEWEB)
Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)
2014-01-28
Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.
Vacuum ultraviolet photoionization of carbohydrates and nucleotides
International Nuclear Information System (INIS)
Shin, Joong-Won; Bernstein, Elliot R.
2014-01-01
Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results
Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.
Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A
2016-01-01
A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.
The International Nucleotide Sequence Database Collaboration.
Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu
2011-01-01
Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.
Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.
2016-01-01
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946
Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J
2016-01-15
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Subnanomole detection and quantitation of high specific activity 32P-nucleotides
International Nuclear Information System (INIS)
Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.
1991-01-01
Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution
De novo synthesis of adenine nucleotides in different skeletal muscle fiber types
International Nuclear Information System (INIS)
Tullson, P.C.; John-Alder, H.B.; Hood, D.A.; Terjung, R.L.
1988-01-01
Management of adenine nucleotide catabolism differs among skeletal muscle fiber types. This study evaluated whether there are corresponding differences in the rates of de novo synthesis of adenine nucleotide among fiber type sections of skeletal muscle using an isolated perfused rat hindquarter preparation. Label incorporation into adenine nucleotides from the [1-14C]glycine precursor was determined and used to calculate synthesis rates based on the intracellular glycine specific radioactivity. Results show that intracellular glycine is closely related to the direct precursor pool. Rates of de novo synthesis were highest in fast-twitch red muscle (57.0 +/- 4.0, 58.2 +/- 4.4 nmol.h-1.g-1; deep red gastrocnemius and vastus lateralis), relatively high in slow-twitch red muscle (47.0 +/- 3.1; soleus), and low in fast-twitch white muscle (26.1 +/- 2.0 and 21.6 +/- 2.3; superficial white gastrocnemius and vastus lateralis). Rates for four mixed muscles were intermediate, ranging between 32.3 and 37.3. Specific de novo synthesis rates exhibited a strong correlation (r = 0.986) with muscle section citrate synthase activity. Turnover rates (de novo synthesis rate/adenine nucleotide pool size) were highest in high oxidative muscle (0.82-1.06%/h), lowest in low oxidative muscle (0.30-0.35%/h), and intermediate in mixed muscle (0.44-0.55%/h). Our results demonstrate that differences in adenine nucleotide management among fiber types extends to the process of de novo adenine nucleotide synthesis
A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.
Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.
1996-01-01
A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having
Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.
Dunn, Joshua G; Weissman, Jonathan S
2016-11-22
Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily
Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.
Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel
2015-09-01
An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.
Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis
Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.
2015-01-01
An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680
DEFF Research Database (Denmark)
Odgaard, Elvin V. P.; Prætorius, Helle; Leipziger, Jens Georg
2009-01-01
is stimulated remain elusive. Here, we investigate the phenomenon of nucleotide secretion in intact, perfused mouse medullary thick ascending limb (mTAL) and cortical collecting duct (CCD). The nucleotide secretion was monitored by a biosensor adapted to register nucleotides in the tubular outflow...
The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.
Woolfitt, A R; Kellett, G L; Hoggett, J G
1988-01-29
The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC 2.7.1.1) from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.
Nucleotide sequence of tomato ringspot virus RNA-2.
Rott, M E; Tremaine, J H; Rochon, D M
1991-07-01
The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.
Optimization time synthesis of nucleotide labelled [γ-32P]-ATP
International Nuclear Information System (INIS)
Rahman, Wira Y; Sarmini, Endang; Herlina; Lubis, Hotman; Triyanto; Hambali
2013-01-01
Adenosine triphosphate-labelled with γ- 32 P([γ- 32 p]-ATP) has been widely used in the biotechnology research, usually as a tracer to study aspects of physiological and pathological processes. In order to support biotechnology research in Indonesia, a process for production of [γ- 32 P]-ATP with enzymatic reaction was used as precursors DL-glyceraldehydde 3-phosphate, Adenosine Diphosphate (ADP) and H 3 32 PO 4 , and enzyme glyceraldehid 3-phosphate dehydrogenase, 3-phosphoglyceryc phosphokinase and lactate dehydrogenase. Optimization of incubation time labeled nucleotide synthesis process is performed to find the optimum conditions, in terms of the most advantageous time in the synthesis process. With the success of the synthesis and optimization is done incubation time of synthesis labeled nucleotide, the result suggested can be used for producing [γ- 32 P] -ATP to support the provision of radiolabeled nucleotide for biotechnology research in Indonesia. (author)
WEB-server for search of a periodicity in amino acid and nucleotide sequences
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
A single nucleotide polymorphism (SNP) assay for population ...
African Journals Online (AJOL)
A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...
Scambio, a novel guanine nucleotide exchange factor for Rho
Directory of Open Access Journals (Sweden)
Groffen John
2004-04-01
Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.
Purine nucleotide synthesis from exogenous adenine and guanine in rodent small intestine
International Nuclear Information System (INIS)
Gross, C.J.; Karlberg, P.K.; Savaiano, D.A.
1986-01-01
14 C-Adenine and 14 C-guanine uptake was studied in isolated guinea pig enterocytes. Cells were incubated in Hank's buffer and separated from the medium by centrifugation through silicone oil into 1M PCA. Uptake was temperature and concentration dependent. Both compounds were incorporated into nucleotides as measured by HPLC and HVE. Adenine was more extensively incorporated into nucleotides than was guanine. Adenine nucleotides accounted for about 70% of the intracellular label after 30 min with a majority being ADP and ATP (medium concentration = 10 μM). Guanine nucleotides accounted for only 30% of the intracellular label after 30 min. Labeled intracellular free adenine or guanine were not detected. Significantly more guanine vs. adenine was converted to uric acid. After 30 min, 11.5 +/- 3.9% (n=3) and 83.0 +/- 8.4% (n=4) of the label was present as uric acid in the medium when adenine and guanine, respectively, were the substrate. After 1 min, 34.8 +/- 3.4% (n=4) of the label in the medium was present as uric acid when guanine was the substrate. Decreasing the concentration of adenine resulted in an increase in the percent of uric acid in the medium. 14 C-adenine (75 nmol) was injected into 1 gm segments of rat jejunum. After 5 min., segments were quickly flushed and the tissue homogenized in 1M PCA. Only uric acid was present after 5 min (n=6). In contrast, in animals fasted 3 to 5 days, less conversion to uric acid was observed in the intestinal content (50-80% of the same dose was still present as adenine after 5 min) and nucleotide formation was observed in the tissue. The results indicate that uric acid and nucleotide synthesis from exogenous adenine and guanine are concentration dependent and affected by nutritional state
Directory of Open Access Journals (Sweden)
Elaine C Thomas
Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.
Study on the change of cyclic nucleotide in mice with yang vacuity disease
International Nuclear Information System (INIS)
Zhu Xinhua; Shen Ling; Wang Shuguang
2002-01-01
To study the relation between Yang Vacuity disease happening, development and cyclic nucleotide response, and prove curative effects of some assisting Yang drug, the plasma cAMP, cGMP and cAMP/cGMP levels were detected by radioimmunoassay in the Yang Vacuity group and curing group. Results: showed: (1) Yang Vacuity group: the symptoms were clear, death rate was high, the plasma cAMP and cAMP/cGMP increased obviously, it suggests that cyclic nucleotide was imbalance. (2) Curing group: the symptoms of Yang Vacuity disease were improved obviously, death rate dropped, cAMP declined, cGMP increased, while cAMP/cGMP reached the normal level, it showed that cyclic nucleotide of the body had altered greatly. (3) It is a reference target for Yang Vacuity. (4) Assisting yang drug (Sini Decoction) had a close relation with correcting imbalance of cyclic nucleotide
Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism
International Nuclear Information System (INIS)
Welin, Martin; Nordlund, Paer
2010-01-01
Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.
Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.
Black, W C; Gorrochotegui-Escalante, N; Duteau, N M
2006-03-01
Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.
Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.
Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis
2014-09-12
The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*
Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis
2014-01-01
The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514
Energy Technology Data Exchange (ETDEWEB)
Trapido-Rosenthal, H G; Carr, W E; Gleeson, R A
1987-10-01
The olfactory organ of the spiny lobster, Panulirus argus, is composed of chemosensory sensilla containing the dendrites of primary chemosensory neurons. Receptors on these dendrites are activated by the nucleotides AMP, ADP, and ATP but not by the nucleoside adenosine. It is shown here that the lobster chemosensory sensilla contain enzymes that dephosphorylate excitatory nucleotides and an uptake system that internalizes the nonexcitatory dephosphorylated product adenosine. The uptake of (/sup 3/H)-adenosine is saturable with increasing concentration, linear with time for up to 3 h, sodium dependent, insensitive to moderate pH changes and has a Km of 7.1 microM and a Vmax of 5.2 fmol/sensillum/min (573 fmol/micrograms of protein/min). Double-label experiments show that sensilla dephosphorylate nucleotides extracellularly; /sup 3/H from adenine-labeled AMP or ATP is internalized, whereas 32P from phosphate-labeled nucleotides is not. The dephosphorylation of AMP is very rapid; /sup 3/H from AMP is internalized at the same rate as /sup 3/H from adenosine. Sensillar 5'-ectonucleotidase activity is inhibited by ADP and the ADP analog alpha, beta-methylene ADP. Collectively, these results indicate that the enzymes and the uptake system whereby chemosensory sensilla of the lobster inactivate excitatory nucleotides and clear adenosine from extracellular spaces are very similar to those present in the internal tissues of vertebrates, where nucleotides have many neuroactive effects.
DEFF Research Database (Denmark)
Leonardsen, L; DeClue, J E; Lybaek, H
1996-01-01
The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....
Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.
Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro
2015-11-01
The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress
DEFF Research Database (Denmark)
Golan, O; Issan, Y; Isak, A
2011-01-01
assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...
Schechinger, Linda Sue
I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators
Directory of Open Access Journals (Sweden)
Henky Manoppo
2010-06-01
Full Text Available The objective of this research was to evaluate the nonspecific immune response and resistance of Litopenaeus vannamei fed with nucleotide, β–glucan, and protagen diets. Shrimp juveniles with an average weight of 5.39±0.56 g were reared in glass aquaria at a density of 15 shrimps/aquarium. Shrimps were fed three times a day for four weeks at a feeding rate of 3%/bw/day. Treatment diets consisted of A: basal diet (without immunostimulant, B: β–glucan, C: protagen, and D: nucleotide, each with three replicates. At the end of feeding period, the shrimps were intramuscularly injected with Vibrio harveyi 0.1 x 106 cfu.shrimp-1. Total haemocyte count (THC of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p=0.01, but not different compared to shrimp fed with protagen-diet. PO activity also increased significantly in shrimp fed with nucleotide-diet (p=0.02. β–glucan diet could also increase THC and PO activity, but compared to the control, the increase was not significantly different. Overall, PO activity of shrimp fed with nucleotide, β–glucan, and protagen diets was high (>0.35. Oral administration of nucleotide, β–glucan, and protagen for four consecutive weeks significantly increased resistance of shrimp to disease (<0.01 where the highest resistance rate was observed on shrimp fed with nucleotide-diet. Growth of shrimp fed with nucleotide-diet was significantly different compared to that of control shrimp (p<0.01, as well as to β–glucan, and protagen-treated shrimp. As a conclusion, supplementation of nucleotide into shrimp pellet enhanced nonspecific immune response and growth performance better than β-glucan, and protagen.
Lehninger, Albert L.; Vercesi, Anibal; Bababunmi, Enitan A.
1978-01-01
Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca2+ and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca2+ is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as β-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca2+. Successive cycles of Ca2+ release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca2+-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca2+, mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport. Images PMID:25436
Nucleotide excision repair II: From yeast to mammals
J.H.J. Hoeijmakers (Jan)
1993-01-01
textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this
Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression
Directory of Open Access Journals (Sweden)
Charikleia Papadopoulou
2015-12-01
Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.
Directory of Open Access Journals (Sweden)
Michael E. Østergaard
2017-06-01
Full Text Available Antisense oligonucleotides (ASOs have the potential to discriminate between subtle RNA mismatches such as SNPs. Certain mismatches, however, allow ASOs to bind at physiological conditions and result in RNA cleavage mediated by RNase H. We showed that replacing DNA nucleotides in the gap region of an ASO with other chemical modification can improve allele selectivity. Herein, we systematically substitute every position in the gap region of an ASO targeting huntingtin gene (HTT with fluorinated nucleotides. Potency is determined in cell culture against mutant HTT (mtHTT and wild-type HTT (wtHTT mRNA and RNase H cleavage intensities, and patterns are investigated. This study profiled five different fluorinated nucleotides and showed them to have predictable, site-specific effects on RNase H cleavage, and the cleavage patterns were rationalized from a published X-ray structure of human RNase H1. The results herein can be used as a guide for future projects where ASO discrimination of SNPs is important.
Preparation of protected nucleotides usable in oligonucleotide synthesis
International Nuclear Information System (INIS)
Debiard, Jean-Pascal
1983-01-01
After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr
Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode
Energy Technology Data Exchange (ETDEWEB)
Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: gustgarb@yahoo.com.br [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica
2013-12-01
Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)
Scopesi, F; Verkeste, C M; Paola, D; Gazzolo, D; Pronzato, M A; Bruschettini, P L; Marinari, U M
1999-03-01
The present study was designed to test if dietary intake of nucleotides increases erythrocyte 2,3-diphosphoglycerate (2,3-DPG) in neonatal rats. To this end, rat pups were fed a nucleotide-supplemented formula (S, n = 14) from d 9 until d 16 after birth. The results were compared with those obtained from a group of breast-fed pups (C, n = 14) and a group of pups artificially fed with nucleotide-free formula (NS, n = 14). Neonatal weight, 2,3-DPG concentration, hematocrit (Hct) and hemoglobin concentration (Hb) were determined before the experiment (d 9) and after 7 d of treatment (d 16). In all groups, 2,3-DPG concentration was greater at d 16 than d 9, and the increase was greater in the S group than in the NS group. Alterations in neonatal weight, Hct and Hb concentration did not differ among the groups. On d 16 the 2, 3-DPG/Hb ratio, reflecting the affinity of hemoglobin for oxygen, was significantly higher in the C and S groups than in the NS group. We conclude that in neonatal rats, dietary nucleotides increase erythrocyte 2,3-DPG concentration. Studies need to be conducted in humans to assess the effect of this increase on both neonatal peripheral hemodynamics and metabolism in this species.
Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G
2017-07-25
We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected
Histone displacement during nucleotide excision repair
DEFF Research Database (Denmark)
Dinant, C.; Bartek, J.; Bekker-Jensen, S.
2012-01-01
Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....
Computational identification of candidate nucleotide cyclases in higher plants
Wong, Aloysius Tze; Gehring, Christoph A
2013-01-01
In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs
Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene
Directory of Open Access Journals (Sweden)
Yang Ming
2012-07-01
Full Text Available Abstract Background MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD within this gene in Chinese indigenous breeds and Western commercial breeds. Results A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb in Western commercial breeds. The significant positive Tajima’D, and Fu and Li’s D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Conclusions Chinese and Western breeds have
Guanine nucleotide regulation of α1-adrenergic receptors of muscle and kidney eptihelial cells
International Nuclear Information System (INIS)
Terman, B.I.; Hughes, R.J.; Slivka, S.R.; Insel, P.A.
1986-01-01
The authors have examined the effect of guanine nucleotides on the interaction of adrenergic agents with α 1 -adrenergic receptors of two cell lines, the Madin-Darby Canine Kidney (MDCK) and BC3H-1 muscle cells. While gaunylylimidodiphosphoate (Gpp(NH)p) had no effect on the affinity or the total number of [ -3 H]prazosin binding sites in membranes prepared from these cells, the nucleotide decreased the apparent affinity of the agonist epinephrine in competing for [ 3 H]prazosin binding sites in both cell types. The EC 50 of Gpp(NH)p was ∼100 μM, and a maximal effect was seen at 500 μM. In contrast, 100 μM Gpp(NH)p yielding maximal shifts in binding of epinephrine to β-adrenergic receptors in BC3H-1 cell membranes. Guanine nucleotides were significantly more effective than adenine nucleotides in shifting agonist affinity for the α 1 -receptor and Mg ++ was required to observe a maximal effect. α 1 -receptor agonists activated phosphatidylinositol (PI) hydrolysis in both cell types, but have no direct effect on membrane adenylate cyclase activity. In intact BC3H-1 cells, α 1 -agonists inhibited β-adrenergic cAMP production, an effect which appears in preliminary studies not to result from enhanced phosphodieterase activity. These results show that agonist binding to α 1 -adrenergic receptors in mammalian kidney and muscle cells is regulated by guanine nucleotides. This regulation and inturn transmembrane signalling (PI hydrolysis) by these receptors appear to involve a guanine nucleotide binding (G) protein, which may be different than G/sub s/ and G/sub i/
Classifying Coding DNA with Nucleotide Statistics
Directory of Open Access Journals (Sweden)
Nicolas Carels
2009-10-01
Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.
Kondo, Jiro; Westhof, Eric
2011-01-01
Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431
Mitochondrial DNA analysis reveals a low nucleotide diversity of ...
African Journals Online (AJOL)
STORAGESEVER
2009-06-17
Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.
Statistical properties of nucleotides in human chromosomes 21 and 22
International Nuclear Information System (INIS)
Zhang Linxi; Sun Tingting
2005-01-01
In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence
Directory of Open Access Journals (Sweden)
Barry J Grant
2009-03-01
Full Text Available Ras mediates signaling pathways controlling cell proliferation and development by cycling between GTP- and GDP-bound active and inactive conformational states. Understanding the complete reaction path of this conformational change and its intermediary structures is critical to understanding Ras signaling. We characterize nucleotide-dependent conformational transition using multiple-barrier-crossing accelerated molecular dynamics (aMD simulations. These transitions, achieved for the first time for wild-type Ras, are impossible to observe with classical molecular dynamics (cMD simulations due to the large energetic barrier between end states. Mapping the reaction path onto a conformer plot describing the distribution of the crystallographic structures enabled identification of highly populated intermediate structures. These structures have unique switch orientations (residues 25-40 and 57-75 intermediate between GTP and GDP states, or distinct loop3 (46-49, loop7 (105-110, and alpha5 C-terminus (159-166 conformations distal from the nucleotide-binding site. In addition, these barrier-crossing trajectories predict novel nucleotide-dependent correlated motions, including correlations of alpha2 (residues 66-74 with alpha3-loop7 (93-110, loop2 (26-37 with loop10 (145-151, and loop3 (46-49 with alpha5 (152-167. The interconversion between newly identified Ras conformations revealed by this study advances our mechanistic understanding of Ras function. In addition, the pattern of correlated motions provides new evidence for a dynamic linkage between the nucleotide-binding site and the membrane interacting C-terminus critical for the signaling function of Ras. Furthermore, normal mode analysis indicates that the dominant collective motion that occurs during nucleotide-dependent conformational exchange, and captured in aMD (but absent in cMD simulations, is a low-frequency motion intrinsic to the structure.
Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.
Directory of Open Access Journals (Sweden)
Kouki Yonezawa
Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.
Building the library of RNA 3D nucleotide conformations using the clustering approach
Directory of Open Access Journals (Sweden)
Zok Tomasz
2015-09-01
Full Text Available An increasing number of known RNA 3D structures contributes to the recognition of various RNA families and identification of their features. These tasks are based on an analysis of RNA conformations conducted at different levels of detail. On the other hand, the knowledge of native nucleotide conformations is crucial for structure prediction and understanding of RNA folding. However, this knowledge is stored in structural databases in a rather distributed form. Therefore, only automated methods for sampling the space of RNA structures can reveal plausible conformational representatives useful for further analysis. Here, we present a machine learning-based approach to inspect the dataset of RNA three-dimensional structures and to create a library of nucleotide conformers. A median neural gas algorithm is applied to cluster nucleotide structures upon their trigonometric description. The clustering procedure is two-stage: (i backbone- and (ii ribose-driven. We show the resulting library that contains RNA nucleotide representatives over the entire data, and we evaluate its quality by computing normal distribution measures and average RMSD between data points as well as the prototype within each cluster.
Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A; Aye, Yimon
2014-11-24
Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typically trigger α-dimerization. Currently, both knowledge of and tools to interrogate the oligomeric assembly pathway of RNR in any species in real time are lacking. We therefore developed a fluorimetric assay that reliably reports on oligomeric state changes of α with high sensitivity. The oligomerization-directed fluorescence quenching of hRNR-α, covalently labeled with two fluorophores, allows for direct readout of hRNR dimeric and hexameric states. We applied the newly developed platform to reveal the timescales of α self-assembly, driven by the feedback regulator dATP. This information is currently unavailable, despite the pharmaceutical relevance of hRNR oligomeric regulation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Enhanced NMR signal detection of imino protons in RNA molecules containing 3' dangling nucleotides
International Nuclear Information System (INIS)
Amborski, Andrew N.; Johnson, Philip E.
2008-01-01
We present a method for improving the quality of nuclear magnetic resonance (NMR) spectra involving exchangeable protons near the base of the stem of RNA hairpin molecules. NMR spectra of five different RNA hairpins were compared. These hairpins consisted of a native RNA structure and four molecules each having different unpaired, or dangling, nucleotides at the 3' end. NMR experiments were acquired in water for each construct and the quality of the imino proton spectral regions were examined. The imino resonances near the base of the stem of the wild type RNA structure were not observed due to breathing motions. However, a significant increase in spectral quality for molecules with dangling 3' adenosine or guanosine nucleotides was observed, with imino protons detected in these constructs that were not observed in the wild type construct. A modest improvement in spectral quality was seen for the construct with a 3' unpaired uridine, whereas no significant improvement was observed for a 3' unpaired cytidine. This improvement in NMR spectral quality mirrors the increased thermodynamic stability observed for 3' unpaired nucleotides which is dependant on the stacking interactions of these nucleotides against the base of the stem. The use of a dangling 3' adenosine nucleotide represents an easy method to significantly improve the quality of NMR spectra of RNA molecules
Directory of Open Access Journals (Sweden)
Abhasnee Sobhonslidsuk
2017-01-01
Full Text Available Aims. Proximal renal tubular dysfunction (PRTD is an infrequent complication after nucleotide analogue therapy. We evaluated the outcomes of PRTD and nephrotoxicity after nucleotide analogue withdrawal in chronic hepatitis B (CHB. Methods. A longitudinal follow-up study was performed in patients with PRTD after nucleotide analogue discontinuation. Serum and urine were collected at baseline and every 3 months for one year. The fractional excretion of phosphate (PO4, uric acid (UA, and potassium and tubular maximal reabsorption rate of PO4 to glomerular filtration rate (TmPO4/GFR were calculated. Renal losses were defined based on the criteria of substance losses. Subclinical PRTD and overt PRTD were diagnosed when 2 and ≥3 criteria were identified. Results. Eight subclinical and eight overt PRTD patients were enrolled. After nucleotide analogue withdrawal, there were overall improvements in GFR, serum PO4, and UA. Renal loss of PO4, UA, protein, and β2-microglobulin reduced over time. At one year, complete reversal of PRTD was seen in 13 patients (81.2%. Improvements in PRTD were seen in all but one patient. Conclusion. One year after nucleotide analogue withdrawal, PRTD was resolved in most patients. Changes in TmPO4/GFR, urinary protein, and β2-microglobulin indicate that urinary biomarkers may represent an early sign of PRTD recovery.
International Nuclear Information System (INIS)
Boulias, C.; Moscarello, M.A.
1989-01-01
Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides
Nucleotide Manipulatives to Illustrate the Central Dogma
Sonja B. Yung; Todd P. Primm
2015-01-01
The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.
Pyrrolidine nucleotide analogs with a tunable conformation
Czech Academy of Sciences Publication Activity Database
Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek
2014-01-01
Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205
Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.
Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J
1989-10-11
The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.
Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián
2014-06-01
The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.
Directory of Open Access Journals (Sweden)
Andy Hesketh
2017-07-01
Full Text Available We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP, cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.
The nucleotide sequences of two leghemoglobin genes from soybean
DEFF Research Database (Denmark)
Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O
1982-01-01
We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...
Nucleotide Manipulatives to Illustrate the Central Dogma
Directory of Open Access Journals (Sweden)
Sonja B. Yung
2015-08-01
Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.
Directory of Open Access Journals (Sweden)
Sagot Isabelle
2005-05-01
Full Text Available Abstract Background Guanylic nucleotides are both macromolecules constituents and crucial regulators for a variety of cellular processes. Therefore, their intracellular concentration must be strictly controlled. Consistently both yeast and mammalian cells tightly correlate the transcription of genes encoding enzymes critical for guanylic nucleotides biosynthesis with the proliferation state of the cell population. Results To gain insight into the molecular relationships connecting intracellular guanylic nucleotide levels and cellular proliferation, we have studied the consequences of guanylic nucleotide limitation on Saccharomyces cerevisiae cell cycle progression. We first utilized mycophenolic acid, an immunosuppressive drug that specifically inhibits inosine monophosphate dehydrogenase, the enzyme catalyzing the first committed step in de novo GMP biosynthesis. To approach this system physiologically, we next developed yeast mutants for which the intracellular guanylic nucleotide pools can be modulated through changes of growth conditions. In both the pharmacological and genetic approaches, we found that guanylic nucleotide limitation generated a mother-daughter separation defect, characterized by cells with two unseparated daughters. We then showed that this separation defect resulted from cell wall perturbations but not from impaired cytokinesis. Importantly, cells with similar separation defects were found in a wild type untreated yeast population entering quiescence upon nutrient limitation. Conclusion Our results demonstrate that guanylic nucleotide limitation slows budding yeast cell cycle progression, with a severe pause in telophase. At the cellular level, guanylic nucleotide limitation causes the emergence of cells with two unseparated daughters. By fluorescence and electron microscopy, we demonstrate that this phenotype arises from defects in cell wall partition between mother and daughter cells. Because cells with two unseparated
International Nuclear Information System (INIS)
Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.
1987-01-01
Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced 125 I-[Tyr 1 ]somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate [Gpp(NH)p]>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg 2+ . When pancreatic acini were treated with 1 μg/ml pertussis toxin for 4 h, subsequent 125 I-[Tyr 1 ]somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor
Nucleotide excision repair I: from E.coli to yeast.
J.H.J. Hoeijmakers (Jan)
1993-01-01
textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide
Development of a single nucleotide polymorphism (SNP) marker for ...
African Journals Online (AJOL)
The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...
Effects of Dietary Nucleotides on Growth Rate and Disease ...
African Journals Online (AJOL)
Nucleotides are low molecular weight biological compounds, which are ... nutrition and disease aspects of crustaceans (Overton and Bland 1981 .... additives on growth and disease resistance. Effects of ... metabolically active cells during stressful conditions ... in humans supplemented with Uracyl, which resulted in optimal ...
cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs
Energy Technology Data Exchange (ETDEWEB)
Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K
1983-01-01
Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.
Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo
2017-09-01
There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.
Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q
2010-11-01
Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.
DEFF Research Database (Denmark)
Sonne, Jacob; Kandt, C.; Peters, Günther H.j.
2007-01-01
The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B12 importer BtuCD using perturbed elastic network calculations and biased molecular...
Identification of cyclic nucleotide gated channels using regular expressions
Zelman, Alice K.
2013-09-03
Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.
Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R
2016-06-01
As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...
African Journals Online (AJOL)
The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...
DEFF Research Database (Denmark)
Brazauskas, Gintaras; Pašakinskienė, Izolda; Asp, Torben
2010-01-01
Knowledge on nucleotide diversity and linkage disequilibrium (LD) patterns is prerequisite for association analyses. However, little is known about the nucleotide diversity in the evolutionary important ryegrass shoot morphology genes. Five candidate genes, LpIAA1, LpRUB1, LpBRI1, LpSHOOT1 and Lp...
Subpicosecond Dynamics in Nucleotides Measured by Spontaneous Raman Spectroscopy
Terpstra, P.A.; Terpstra, P.A.; Otto, Cornelis; Greve, Jan
1997-01-01
The band widths in Raman spectra are sensitive to dynamics active on a time scale from 0.1 to 10 ps. The band widths of nucleotide vibrations and their dependence on temperature, concentration, and structure are reported. From the experimental band widths and second moments, it is derived that the
M. Suska; E. Skotnicka; W. Dudzińska; W. Orowicz; M. Brzezinska
2006-01-01
The aim of this study was to examine the relationships between the concentrations of adenylate nucleotides (ATP, ADP, AMP), total nucleotide pool (TAN), adenylate energy charge (AEC) and 2,3-biphosphoglycerate (2,3-BPG) in the erythrocytes of young horses in the period of their rapid growth and development. The studies were conducted on 10 young Wielkopolska breed stallions for two years; Group A: 1-month-old, Group B: 3-month-old, Group C: 6-month-old, Group D: 1-year-old, and Group E: 2-yea...
[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].
Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I
1985-11-01
The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.
De novo synthesis of purine nucleotides in different fiber types of rat skeletal muscle
International Nuclear Information System (INIS)
Tullson, P.C.; John-Alder, H.; Hood, D.A.; Terjung, R.L.
1986-01-01
The contribution of de novo purine nucleotide synthesis to nucleotide metabolism in skeletal muscles is not known. The authors have determined rates of de novo synthesis in soleus (slow-twitch red), red gastrocnemius (fast-twitch red), and white gastrocnemius (fast-twitch white) using the perfused rat hindquarter. 14 C glycine incorporation into ATP was linear after 1 and 2 hours of perfusion with 0.2 mM added glycine. The intracellular (I) and extracellular (E) specific activity of 14 C glycine was determined by HPLC of phenylisothiocyanate derivatives of neutralized PCA extracts. The rates of de novo synthesis when expressed relative to muscle ATP content show slow and fast-twitch red muscles to be similar and about twice as great as fast-twitch white muscles. This could represent a greater turnover of the adenine nucleotide pool in more oxidative red muscle types
Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana
2016-05-01
Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final
International Nuclear Information System (INIS)
Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.
2006-01-01
Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)
International Nuclear Information System (INIS)
Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.
1988-01-01
The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity [ 3 H]fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity [ 3 H]fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils
Four new single nucleotide polymorphisms (SNPs) of toll-like ...
African Journals Online (AJOL)
In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...
Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...
OrthoANI: An improved algorithm and software for calculating average nucleotide identity.
Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik
2016-02-01
Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.
Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.
Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru
2017-04-18
Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.
Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)
Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.
We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database
Involvement of cyclic nucleotides in locust flight muscle metabolism
Worm, R.A.A.
1980-01-01
1. Flight had no significant effect on the levels of c-AMP of c-GMP in the flight muscles of Locusta migratoria. 2. Injections of 0.01 or 0.1 corpus cardiacum equivalents into the abdominal cavity did not elicit any effect on cyclic nucleotide levels either. 3. Injection of A23187 resulted in
Effects of Dietary Nucleotides on Growth Rate and Disease ...
African Journals Online (AJOL)
Effects of dietary nucleotides on growth and disease resistance of crustaceans were evaluated using axenic Artemia culture tests. Higher Artemia growth in xenic culture (15.6 ± 2.9 mm) than in axenic culture (9.2 ± 1.9 mm) reaffirmed the need to eliminate microbial populations known to influence growth and disease ...
Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis
Directory of Open Access Journals (Sweden)
Suravajhala P
2017-06-01
Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS
Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB
Directory of Open Access Journals (Sweden)
Joon-Ho Lee
2014-09-01
Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.
Complete nucleotide sequences of avian metapneumovirus subtype B genome.
Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro
2010-12-01
Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.
Junctional transfer in cultured vascular endothelium: II. Dye and nucleotide transfer
International Nuclear Information System (INIS)
Larson, D.M.; Sheridan, J.D.
1985-01-01
Vascular endothelial cultures, derived from large vessels, retain many of the characteristics of their in vivo counterparts. However, the observed reduction in size and complexity of intercellular gap and tight junctions in these cultured cells suggests that important functions, thought to be mediated by these structures, may be altered in vitro. In continuing studies on intercellular communication in vessel wall cells, the authors have quantitated the extent of junctional transfer of small molecular tracers (the fluorescent dye Lucifer Yellow CH and tritiated uridine nucleotides) in confluent cultures of calf aortic (BAEC) and umbilical vein (BVEC) endothelium. Both BAEC and BVEC show extensive (and quantitatively equivalent) dye and nucleotide transfer. As an analogue of intimal endothelium, the authors have also tested dye transfer in freshly isolated sheets of endothelium. Transfer in BAEC and BVEC sheets was more rapid, extensive and homogeneous than in the cultured cells, implying a reduction in molecular coupling as endothelium adapts to culture conditions. In addition, they have documented heterocellular nucleotide transfer between cultured endothelium and vascular smooth muscle cells, of particular interest considering the prevalence of ''myo-endothelial'' junctions in vivo. These data yield further information on junctional transfer in cultured vascular endothelium and have broad implications for the functional integration of the vessel wall in the physiology and pathophysiology of the vasculature
Energy Technology Data Exchange (ETDEWEB)
Gomez, D.; Azcarate, Sabino [Dpto. de Micro y Nanotecnologias, Fundacion Tekniker, Av. Otaola 20, 20600 Eibar (Spain); Fernandez, Jose A.; Astigarraga, Egoitz [Dpto. de Quimica Fisica, Universidad del Pais Vasco, Campus de Lejona, Lejona (Spain); Marcaide, Arrate [Dpto. de Procesos de Fabricacion, Fundacion Tekniker, Av. Otaola 20, 20600 Eibar (Spain)
2007-07-01
In present work, porous silicon surfaces (PSS) have been developed for time of flight mass spectrometric experiments (TOF-MS) in the monitoring of nucleotides, commonly found as metabolites in the cell. The mass range of the studied molecules ({proportional_to} 400 amu) is common to several important messengers and other metabolites. Different porosified surfaces have been developed by means of electrochemical etching and different degree of porosity and pore size achieved as function of silicon dopant concentration, silicon resistivity, current density and the presence or absence of illumination along the process. As main conclusion, it can be said that an interesting commercial nucleotide (Cyclic adenosine monophosphate, c-AMP) has been detected on low concentrations ({proportional_to}hundreds of femtomols) for some of the fabricated porous surfaces. Taking into account that these concentrations are similar to the ones found in real samples, this result opens the possibility to the fabrication of DIOS (Desorption Ionization On Silicon) chips for the detection of nucleotides in biological fluids. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)
2′-O-methyl nucleotide modified DNA substrates influence the ...
Indian Academy of Sciences (India)
2014-07-18
Jul 18, 2014 ... 1. Introduction. Due to the development of novel nucleotide derivatives, ..... which is located in a spiral ring made of 152-157 bases before α6. ..... 8 126–. 130. Majlessi M, Nelson NC and Becker MM 1998 Advantages of 2'-O-.
SUMO and ubiquitin-dependent XPC exchange drives nucleotide excision repair
DEFF Research Database (Denmark)
Van Cuijk, Loes; Van Belle, Gijsbert J.; Turkyilmaz, Yasemin
2015-01-01
XPC recognizes UV-induced DNA lesions and initiates their removal by nucleotide excision repair (NER). Damage recognition in NER is tightly controlled by ubiquitin and SUMO modifications. Recent studies have shown that the SUMO-targeted ubiquitin ligase RNF111 promotes K63-linked ubiquitylation o...
Single nucleotide polymorphisms in the 5'-flanking region of the ...
African Journals Online (AJOL)
Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...
Kinetic mechanism and nucleotide specificity of NADH peroxidase
International Nuclear Information System (INIS)
Stoll, V.S.; Blanchard, J.S.
1988-01-01
NADH peroxidase is a flavoprotein isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide-dependent reduction of hydrogen peroxide to water. Initial velocity, product, and dead-end inhibition studies have been performed at pH 7.5 and support a ping-pong kinetic mechanism. In the absence of hydrogen peroxide, both transhydrogenation between NADH and thioNAD, and isotope exchange between [ 14 C]NADH and NAD, have been demonstrated, although in both these experiments, the maximal velocity of nucleotide exchange was less than 1.5% the maximal velocity of the peroxidatic reaction. We propose that NADH binds tightly to both oxidized and two-electron reduced enzyme. NADH oxidation proceeds stereospecifically with the transfer of the 4S hydrogen to enzyme, and then, via exchange, to water. No primary tritium kinetic isotope effect was observed, and no statistically significant primary deuterium kinetic isotope effects on V/K were determined, although primary deuterium kinetic isotope effects on V were observed in the presence and absence of sodium acetate. NADH peroxidase thus shares with other flavoprotein reductases striking kinetic, spectroscopic, and stereochemical similarities. On this basis, we propose a chemical mechanism for the peroxide cleaving reaction catalyzed by NADH peroxidase which involves the obligate formation of a flavinperoxide, and peroxo bond cleavage by nucleophilic attack by enzymatic dithiols
Modification of synthesis nucleotides [γ-32P] ATP
International Nuclear Information System (INIS)
Wira Y Rahman; Endang Sarmini; Herlina; Triyanto; Hambali; Abdul Mutalib; Santi Nurbaiti
2013-01-01
In molecular biology, radionuclides in the form of radiolabeled compounds have been widely used as deoxyribonucleic acid (DNA) / ribonucleic acid (RNA) tracer in order to explore a wide range of physiological and pathological processes. One of such compounds is [γ- 32 P]-adenosine triphosphate {[γ- 32 P]-ATP} [γ- 32 P]-ATP which has been widely used in the biotechnology research. In order to support the biotechnology research in Indonesia in this project, [γ- 32 P]- ATP had been synthesized by enzymatic reactions with modifying the method of synthesis using the precursor DL-glyceraldehyde 3-phosphate, nucleotides Adenosine Diphosphate (ADP) and H 3 32 PO 4 and enzymes glyceraldehyde 3-phosphate dehydrogenase, 3-phosphoroglyceric phosphokinase and lactate dehydrogenase. The purification of the synthesized [γ- 32 P]-ATP, by using DEAE Sephadex column chromatography. The synthesis and purification process that had been performed were able in producing of [γ- 32 P]-ATP with radioactivity of 1,175 mCi and radiochemical purity of 99,49%.. Having successfully prepared the [γ- 32 P]-ATP and application, in the near future the Radioisotopes and Radiopharmaceuticals Centre is expected to be able in providing the above-mentioned radiolabeled nucleotide for biotechnology research in Indonesia. (author)
Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C
International Nuclear Information System (INIS)
Edenbrandt, C.M.; Murphy, S.
1990-01-01
Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation
Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes
Energy Technology Data Exchange (ETDEWEB)
Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.; Mulrooney, Scott B.; Hausinger, Robert P.; Maroney, Michael J.
2016-12-21
Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donor ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.
Sueldo, D.J.; Shimels, M.Z.; Spiridon, L.N.; Caldararu, O.; Petrescu, A.J.; Joosten, M.H.A.J.; Tameling, W.I.L.
2015-01-01
•Plant nucleotide-binding, leucine-rich repeat (NB-LRR) proteins confer immunity to pathogens possessing the corresponding avirulence proteins. Activation of NB-LRR proteins is often associated with induction of the hypersensitive response (HR), a form of programmed cell death. •NRC1 (NB-LRR
Pu, Fang; Ren, Jinsong; Qu, Xiaogang
2018-02-21
The incorporation of biomolecules into nanomaterials generates functional nanosystems with novel and advanced properties, presenting great potential for applications in various fields. Nucleobases, nucleosides and nucleotides, as building blocks of nucleic acids and biological coenzymes, constitute necessary components of the foundation of life. In recent years, as versatile biomolecules for the construction or regulation of functional nanomaterials, they have stimulated interest in researchers, due to their unique properties such as structural diversity, multiplex binding sites, self-assembly ability, stability, biocompatibility, and chirality. In this review, strategies for the synthesis of nanomaterials and the regulation of their morphologies and functions using nucleobases, nucleosides, and nucleotides as building blocks, templates or modulators are summarized alongside selected applications. The diverse applications range from sensing, bioimaging, and drug delivery to mimicking light-harvesting antenna, the construction of logic gates, and beyond. Furthermore, some perspectives and challenges in this emerging field are proposed. This review is directed toward the broader scientific community interested in biomolecule-based functional nanomaterials.
Scopesi, Fabio; Canini, Silvana; Arioni, Cesare; Mazzella, Massimo; Gazzolo, Diego; Lantieri, Pasquale B; Bonacci, Wanda; Serra, Giovanni
2006-06-01
Recently we demonstrated an increased 2,3-diphosphoglycerate (2,3-DPG) erythrocyte concentration in rat pups subjected to nucleotide-enriched artificial feeding. The present study was carried out to test the hypothesis that a possible increase in 2,3-DPG concentration can also be obtained in human neonates who are fed nucleotide-enriched formula. Preterm neonates born or referred to the neonatal intensive care unit of the G. Gaslini Hospital, Genoa University, with a gestational age >30 weeks and <37 weeks were enrolled in our randomized trial. Recruitment took place within 48-72 hours from birth. Only newborns of mothers deciding not to breast-feed were eligible to be randomized for the supplemented group (FN) or non-supplemented group (RF). Breast-fed newborns were considered the control group (C). The study window (for supplementation and blood samples) was restricted to the first two weeks following birth (from the 2nd (t1) to the 16th (t2) day of life). At the end of our study, only 21 neonates were eligible for statistical analysis. The stimulating action of dietary nucleotides on 2,3-DPG concentration failed to be demonstrated; increases in 2,3-DPG concentration that were observed in newborns fed with nucleotide supplemented formula (FN) were comparable to those observed in newborns fed with regular formula (RF) and breast-fed newborns. The EC recommendation for the amount of nucleotides allowed in formula milk does not seem to be high enough to have positive effects on 2,3-DPG synthesis. Whether this possible 'pharmacological' effect can be achieved by a higher intake of ingested nucleotides and/or a change in the proportions of single nucleotides contained in milk formulas remain interesting end points to be elucidated.
Pyridine nucleotides in regulation of cell death and survival by redox and non-redox reactions.
Novak Kujundžić, Renata; Žarković, Neven; Gall Trošelj, Koraljka
2014-01-01
Changes of the level and ratios of pyridine nucleotides determine metabolism- dependent cellular redox status and the activity of poly(ADP-ribose) polymerases (PARPs) and sirtuins, thereby influencing several processes closely related to cell survival and death. Pyridine nucleotides participate in numerous metabolic reactions whereby their net cellular level remains constant, but the ratios of NAD+/NADP+ and NADH/NADPH oscillate according to metabolic changes in response to diverse stress signals. In non-redox reactions, NAD+ is degraded and quickly, afterward, resynthesized in the NAD+ salvage pathway, unless overwhelming activation of PARP-1 consumes NAD+ to the point of no return, when the cell can no longer generate enough ATP to accommodate NAD+ resynthesis. The activity of PARP-1 is mandatory for the onset of cytoprotective autophagy on sublethal stress signals. It has become increasingly clear that redox status, largely influenced by the metabolism-dependent composition of the pyridine nucleotides pool, plays an important role in the synthesis of pro-apoptotic and anti-apoptotic sphingolipids. Awareness of the involvement of the prosurvival sphingolipid, sphingosine-1-phosphate, in transition from inflammation to malignant transformation has recently emerged. Here, the participation of pyridine nucleotides in redox and non-redox reactions, sphingolipid metabolism, and their role in cell fate decisions is reviewed.
Analysis of single nucleotide polymorphisms in case-control studies.
Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer
2011-01-01
Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.
Pulmonary preservation studies: effects on endothelial function and pulmonary adenine nucleotides.
Paik, Hyo Chae; Hoffmann, Steven C; Egan, Thomas M
2003-02-27
Lung transplantation is an effective therapy plagued by a high incidence of early graft dysfunction, in part because of reperfusion injury. The optimal preservation solution for lung transplantation is unknown. We performed experiments using an isolated perfused rat lung model to test the effect of lung preservation with three solutions commonly used in clinical practice. Lungs were retrieved from Sprague-Dawley rats and flushed with one of three solutions: modified Euro-Collins (MEC), University of Wisconsin (UW), or low potassium dextran and glucose (LPDG), then stored cold for varying periods before reperfusion with Earle's balanced salt solution using the isolated perfused rat lung model. Outcome measures were capillary filtration coefficient (Kfc), wet-to-dry weight ratio, and lung tissue levels of adenine nucleotides and cyclic AMP. All lungs functioned well after 4 hr of storage. By 6 hr, UW-flushed lungs had a lower Kfc than LPDG-flushed lungs. After 8 hr of storage, only UW-flushed lungs had a measurable Kfc. Adenine nucleotide levels were higher in UW-flushed lungs after prolonged storage. Cyclic AMP levels correlated with Kfc in all groups. Early changes in endothelial permeability seemed to be better attenuated in lungs flushed with UW compared with LPDG or MEC; this was associated with higher amounts of adenine nucleotides. MEC-flushed lungs failed earlier than LPDG-flushed or UW-flushed lungs. The content of the solution may be more important for lung preservation than whether the ionic composition is intracellular or extracellular.
Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai
2010-01-01
DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705
Detection of new single nucleotide polymorphisms by means of real ...
Indian Academy of Sciences (India)
Unknown
amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...
Non-nucleotide Agonists Triggering P2X7 Receptor Activation and Pore Formation
Directory of Open Access Journals (Sweden)
Francesco Di Virgilio
2018-02-01
Full Text Available The P2X7 receptor (P2X7R is a ligand-gated plasma membrane ion channel belonging to the P2X receptor subfamily activated by extracellular nucleotides. General consensus holds that the physiological (and maybe the only agonist is ATP. However, scattered evidence generated over the last several years suggests that ATP might not be the only agonist, especially at inflammatory sites. Solid data show that NAD+ covalently modifies the P2X7R of mouse T lymphocytes, thus lowering the ATP threshold for activation. Other structurally unrelated agents have been reported to activate the P2X7R via a poorly understood mechanism of action: (a the antibiotic polymyxin B, possibly a positive allosteric P2X7R modulator, (b the bactericidal peptide LL-37, (c the amyloidogenic β peptide, and (d serum amyloid A. Some agents, such as Alu-RNA, have been suggested to activate the P2X7R acting on the intracellular N- or C-terminal domains. Mode of P2X7R activation by these non-nucleotide ligands is as yet unknown; however, these observations raise the intriguing question of how these different non-nucleotide ligands may co-operate with ATP at inflammatory or tumor sites. New information obtained from the cloning and characterization of the P2X7R from exotic mammalian species (e.g., giant panda and data from recent patch-clamp studies are strongly accelerating our understanding of P2X7R mode of operation, and may provide hints to the mechanism of activation of P2X7R by non-nucleotide ligands.
Yegutkin, Gennady G; Guerrero-Toro, Cindy; Kilinc, Erkan; Koroleva, Kseniya; Ishchenko, Yevheniia; Abushik, Polina; Giniatullina, Raisa; Fayuk, Dmitriy; Giniatullin, Rashid
2016-09-01
Extracellular ATP is suspected to contribute to migraine pain but regulatory mechanisms controlling pro-nociceptive purinergic mechanisms in the meninges remain unknown. We studied the peculiarities of metabolic and signaling pathways of ATP and its downstream metabolites in rat meninges and in cultured trigeminal cells exposed to the migraine mediator calcitonin gene-related peptide (CGRP). Under resting conditions, meningeal ATP and ADP remained at low nanomolar levels, whereas extracellular AMP and adenosine concentrations were one-two orders higher. CGRP increased ATP and ADP levels in meninges and trigeminal cultures and reduced adenosine concentration in trigeminal cells. Degradation rates for exogenous nucleotides remained similar in control and CGRP-treated meninges, indicating that CGRP triggers nucleotide release without affecting nucleotide-inactivating pathways. Lead nitrate-based enzyme histochemistry of whole mount meninges revealed the presence of high ATPase, ADPase, and AMPase activities, primarily localized in the medial meningeal artery. ATP and ADP induced large intracellular Ca(2+) transients both in neurons and in glial cells whereas AMP and adenosine were ineffective. In trigeminal glia, ATP partially operated via P2X7 receptors. ATP, but not other nucleotides, activated nociceptive spikes in meningeal trigeminal nerve fibers providing a rationale for high degradation rate of pro-nociceptive ATP. Pro-nociceptive effect of ATP in meningeal nerves was reproduced by α,β-meATP operating via P2X3 receptors. Collectively, extracellular ATP, which level is controlled by CGRP, can persistently activate trigeminal nerves in meninges which considered as the origin site of migraine headache. These data are consistent with the purinergic hypothesis of migraine pain and suggest new targets against trigeminal pain.
Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy
Directory of Open Access Journals (Sweden)
Stylianos Michalakis
2018-03-01
Full Text Available The first step in vision is the absorption of photons by the photopigments in cone and rod photoreceptors. After initial amplification within the phototransduction cascade the signal is translated into an electrical signal by the action of cyclic nucleotide-gated (CNG channels. CNG channels are ligand-gated ion channels that are activated by the binding of cyclic guanosine monophosphate (cGMP or cyclic adenosine monophosphate (cAMP. Retinal CNG channels transduce changes in intracellular concentrations of cGMP into changes of the membrane potential and the Ca2+ concentration. Structurally, the CNG channels belong to the superfamily of pore-loop cation channels and share a common gross structure with hyperpolarization-activated cyclic nucleotide-gated (HCN channels and voltage-gated potassium channels (KCN. In this review, we provide an overview on the molecular properties of CNG channels and describe their physiological role in the phototransduction pathways. We also discuss insights into the pathophysiological role of CNG channel proteins that have emerged from the analysis of CNG channel-deficient animal models and human CNG channelopathies. Finally, we summarize recent gene therapy activities and provide an outlook for future clinical application.
Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling
Gehring, Christoph A; Turek, Ilona S.
2017-01-01
The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.
Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling
Gehring, Christoph A.
2017-10-04
The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.
Heinle, H; Tober, C; Zhang, D; Jäggi, R; Kuebler, W M
2010-01-01
Vertigo of various and often unknown aetiologies has been associated with and attributed to impaired microvascular perfusion in the inner ear or the vertebrobasilar system. Vertigoheel is a low-dose combination preparation of proven value in the symptomatic treatment of vertigo. In the present study we tested the hypothesis that Vertigoheel's anti-vertiginous properties may in part be due to a vasodilatory effect exerted via stimulation of the adenylate and/or guanylate cyclase pathways. Thus, the influence of Vertigoheel or its single constituents on synthesis and degradation of cyclic nucleotides was measured. Furthermore, vessel myography was used to observe the effect of Vertigoheel on the vasoreactivity of rat carotid arteries. Vertigoheel and one of its constituents, Anamirta cocculus, stimulated adenylate cyclase activity, while another constituent, Conium maculatum, inhibited phosphodiesterase 5, suggesting that the individual constituents of Vertigoheel contribute differentially to a synergistic stimulation of cyclic nucleotide signalling pathways. In rat carotid artery rings, Vertigoheel counteracted phenylephrine-induced tonic vasoconstriction. The present data demonstrate a vasorelaxant effect of Vertigoheel that goes along with a synergistic stimulation of cyclic nucleotide pathways and may provide a mechanistic basis for the documented anti-vertiginous effects of this combination preparation.
Eltzschig, Holger K; Thompson, Linda F; Karhausen, Jorn; Cotta, Richard J; Ibla, Juan C; Robson, Simon C; Colgan, Sean P
2004-12-15
Hypoxia is a well-documented inflammatory stimulus and results in tissue polymorphonuclear leukocyte (PMN) accumulation. Likewise, increased tissue adenosine levels are commonly associated with hypoxia, and given the anti-inflammatory properties of adenosine, we hypothesized that adenosine production via adenine nucleotide metabolism at the vascular surface triggers an endogenous anti-inflammatory response during hypoxia. Initial in vitro studies indicated that endogenously generated adenosine, through activation of PMN adenosine A(2A) and A(2B) receptors, functions as an antiadhesive signal for PMN binding to microvascular endothelia. Intravascular nucleotides released by inflammatory cells undergo phosphohydrolysis via hypoxia-induced CD39 ectoapyrase (CD39 converts adenosine triphosphate/adenosine diphosphate [ATP/ADP] to adenosine monophosphate [AMP]) and CD73 ecto-5'-nucleotidase (CD73 converts AMP to adenosine). Extensions of our in vitro findings using cd39- and cd73-null animals revealed that extracellular adenosine produced through adenine nucleotide metabolism during hypoxia is a potent anti-inflammatory signal for PMNs in vivo. These findings identify CD39 and CD73 as critical control points for endogenous adenosine generation and implicate this pathway as an innate mechanism to attenuate excessive tissue PMN accumulation.
International Nuclear Information System (INIS)
Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.
2003-01-01
Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification
Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels
Zelman, Alice K.; Dawe, Adam; Gehring, Christoph A; Berkowitz, Gerald A.
2012-01-01
, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a
Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.
2015-11-01
Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.
Directory of Open Access Journals (Sweden)
Shui-Lian He
Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang
2015-01-01
Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
DEFF Research Database (Denmark)
Hedeland, Rikke L; Hvidt, Kristian; Nersting, Jacob
2010-01-01
To explore the DNA incorporation of 6-thioguanine nucleotide levels (DNA-6TGN) during 6-mercaptopurine (6MP) therapy of childhood acute lymphoblastic leukaemia (ALL) and non-Hodgkin lymphoma (NHL) and its relation to erythrocyte levels of their metabolites: 6-thioguanine-nucleotides (E-6TGN...
Association between nucleotide mutation of eNOS gene and serum ...
African Journals Online (AJOL)
Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...
International Nuclear Information System (INIS)
Rybin, V.O.
1986-01-01
In the presence of guanine nucleotides and rhodopsin-containing membranes from bovine retinal rod outer segments transducin stimulates light-sensitive cyclic nucleotide phosphodiesterase 5.5- to 7-fold. The activation constant (K/sub act/) for GTP and Gpp(NH)p is equal to 0.25 μM, while that for GDP and GDPβS is 14 and 110 μM, respectively. GDP free of admixtures of other nucleotides does not activate phosphodiesterase at concentrations up to 1 mM, but is bound to transducin and inhibits the Gpp(NH)p-dependent activation of phosphodiesterase. The nature of the interaction of transducin with depolarized rhodopsin also depends on the type of guanine nucleotide bound: in the presence of GDP rhodopsin-containing membranes bind 70-100% of the transducin, whereas in the presence of Gpp(NH)p only 13% of the protein is bound. The data obtained indicate that GDP and GTP convert transducin to two different functional states: the transducin-GTP complex is bound to phosphodiesterase and activates it, while the transducin-GDP complex is bound primarily to rhodopsin
International Nuclear Information System (INIS)
Lee, Hee Yoon; Lee, Ki Ho; Hah, Jung Hwan; Moon, Deuk Kyu; Lee, Chong Kyo
2010-01-01
We have designed and synthesized functionalized dihydrofurylphosphonates that are constrained analogs of 1-alkenyl-phosphonate derivatives of purine/pyrimidine nucleotides as they bear phosphonyl groups at the 3-position and bases at the methyl group of the 5-position of the furan ring. This newly designed dihydrofurylphosphonate analogs of nucleotide showed antiviral activity. Through the current synthetic strategy, structural diversification can be easily attainable for structure activity relationship study and for the better antiviral compounds. Phosphonate esters play an important role in studying the biological system as a hydrolytically stable replacement of phosphate groups and as prodrugs of phosphonates. In continuation of our study on the chemistry of 1-alkenylphosphonates, we were interested in designing and developing versatile synthetic routes to conformationally constrained structures of al-kenylphosphonate nucleotide analogs
Horizontal gene transfer and nucleotide compositional anomaly in large DNA viruses
Directory of Open Access Journals (Sweden)
Ogata Hiroyuki
2007-12-01
Full Text Available Abstract Background DNA viruses have a wide range of genome sizes (5 kb up to 1.2 Mb, compared to 0.16 Mb to 1.5 Mb for obligate parasitic bacteria that do not correlate with their virulence or the taxonomic distribution of their hosts. The reasons for such large variation are unclear. According to the traditional view of viruses as gifted "gene pickpockets", large viral genome sizes could originate from numerous gene acquisitions from their hosts. We investigated this hypothesis by studying 67 large DNA viruses with genome sizes larger than 150 kb, including the recently characterized giant mimivirus. Given that horizontally transferred DNA often have anomalous nucleotide compositions differing from the rest of the genome, we conducted a detailed analysis of the inter- and intra-genome compositional properties of these viruses. We then interpreted their compositional heterogeneity in terms of possible causes, including strand asymmetry, gene function/expression, and horizontal transfer. Results We first show that the global nucleotide composition and nucleotide word usage of viral genomes are species-specific and distinct from those of their hosts. Next, we identified compositionally anomalous (cA genes in viral genomes, using a method based on Bayesian inference. The proportion of cA genes is highly variable across viruses and does not exhibit a significant correlation with genome size. The vast majority of the cA genes were of unknown function, lacking homologs in the databases. For genes with known homologs, we found a substantial enrichment of cA genes in specific functional classes for some of the viruses. No significant association was found between cA genes and compositional strand asymmetry. A possible exogenous origin for a small fraction of the cA genes could be confirmed by phylogenetic reconstruction. Conclusion At odds with the traditional dogma, our results argue against frequent genetic transfers to large DNA viruses from their
Grinding up Wheat: a Massive Loss of Nucleotide Diversity Since Domestication
DEFF Research Database (Denmark)
Haudry, Anabelle; Cenci, Alberto; Ravel, Catherine
2007-01-01
Several demographic and selective events occurred during the domestication of wheat from the allotetraploid wild emmer (Triticum turgidum ssp. dicoccoides). Cultivated wheat has since been affected by other historical events. We analyzed nucleotide diversity at 21 loci in a sample of 101 individu...
Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology
DEFF Research Database (Denmark)
Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr
2017-01-01
Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...
A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.
Zeng, Lingwen; Xiao, Zhuo
2017-01-01
A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.
Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae
International Nuclear Information System (INIS)
Madura, K.; Prakash, S.
1986-01-01
The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes
Iser, Isabele C; Bracco, Paula A; Gonçalves, Carlos E I; Zanin, Rafael F; Nardi, Nance B; Lenz, Guido; Battastini, Ana Maria O; Wink, Márcia R
2014-10-01
Mesenchymal stem cells (MSCs) have shown a great potential for cell-based therapy and many different therapeutic purposes. Despite the recent advances in the knowledge of MSCs biology, their biochemical and molecular properties are still poorly defined. Ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) and ecto-5'-nucleotidase (eNT/CD73) are widely expressed enzymes that hydrolyze extracellular nucleotides, generating an important cellular signaling cascade. Currently, studies have evidenced the relationship between the purinergic system and the development, maintenance, and differentiation of stem cells. The objective of this study is to identify the NTPDases and eNT/CD73 and compare the levels of nucleotide hydrolysis on MSCs isolated from different murine tissues (bone marrow, lung, vena cava, kidney, pancreas, spleen, skin, and adipose tissue). MSCs from all tissues investigated expressed the ectoenzymes at different levels. In MSCs from pancreas and adipose tissue, the hydrolysis of triphosphonucleosides was significantly higher when compared to the other cells. The diphosphonucleosides were hydrolyzed at a higher rate by MSC from pancreas when compared to MSC from other tissues. The differential nucleotide hydrolysis activity and enzyme expression in these cells suggests that MSCs play different roles in regulating the purinergic system in these tissues. Overall MSCs are an attractive adult-derived cell population for therapies, however, the fact that ecto-nucleotide metabolism can affect the microenvironment, modulating important events, such as immune response, makes the assessment of this metabolism an important part of the characterization of MSCs to be applied therapeutically. © 2014 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Teruel, J.A.; Inesi, G.
1988-01-01
The roles of the phosphorylation (phosphorylated enzyme intermediate) and nucleotide binding domains in calcium transport were studied by comparing acetyl phosphate and ATP as substrates for the Ca 2+ -ATPase of sarcoplasmic reticulum vesicles. The authors found that the maximal level of phosphoenzyme obtained with either substrate is approximately 4 nmol/mg of protein, corresponding to the stoichiometry of catalytic sites in their preparation. The initial burst of phosphoenzyme formation observed in the transient state, following addition of either substrate, is accompanied by internalization of 2 mol of calcium per mole of phosphoenzyme. The internalized calcium is then translocated with a sequential pattern, independent of the substrate used. Following a rate-limiting step, the phosphoenzyme undergoes hydrolytic cleavage and proceeds to the steady-state activity which is soon back inhibited by the rise of Ca 2+ concentration in the lumen of the vesicles. When the back inhibition is released by the addition of oxalate, substrate utilization and calcium transport occur with a ratio of 1:2, independent of the substrate and its concentration. When the nucleotide binding site is derivatized with FITP, the enzyme can still utilize acetyl phosphate (but not ATP) for calcium transport. These observations demonstrate that the basic coupling mechanism of catalysis and calcium transport involves the phosphorylation and calcium binding domains, and not the nucleotide binding domain. On the other hand, occupancy of the FITC-sensitive nucleotide site is involved in kinetic regulation not only with respect to utilization of substrate for the phosphoryl transfer reaction but also for subsequent steps related to calcium translocation and phosphoenzyme turnover
Adsorption of nucleotides onto ferromagnesian phyllosilicates: Significance for the origin of life
Pedreira-Segade, Ulysse; Feuillie, Cécile; Pelletier, Manuel; Michot, Laurent J.; Daniel, Isabelle
2016-03-01
The concentration of prebiotic organic building blocks may have promoted the formation of biopolymers in the environment of the early Earth. We therefore studied the adsorption of RNA monomers AMP, GMP, CMP, and UMP, and DNA monomers dGMP, dCMP, and TMP, on minerals that were abundant in the early Earth environment as the result of aqueous or hydrothermal alteration of the primitive oceanic crust. We focused our study on swelling clays, i.e. nontronite and montmorillonite, and non-swelling phyllosilicates, i.e. pyrophyllite, chlorite, lizardite and chrysotile suspended in an aqueous saline solution analog to seawater. In this reference study, adsorption experiments were carried out under standard conditions of pressure and temperature and controlled pH. Under such conditions, this work is also relevant to the preservation of nucleic acids in Fe-Mg-rich terrestrial and Martian soils. We compared the adsorption of the different monomers on individual minerals, as well as the adsorption of single monomers on the whole suite of minerals. We found that DNA monomers adsorb much more strongly than RNA monomers, and that any monomer containing the G nucleobase adsorbed more strongly than one containing the C nucleobase. At high surface loadings (greater than about 1 mM monomer in aqueous solution) we also found a dramatic increase in the slope of adsorption isotherm on the swelling clays, leading to large increases in the amounts adsorbed. Data were processed in order to understand the adsorption mechanism of nucleotides onto mineral surfaces. We infer that all nucleotides behave as homologous molecules in regard to their adsorption onto the studied mineral surfaces. At low to moderate surface loadings, their adsorption is best explained by a single mechanism common to the suite of minerals of the present study. At pH 7, adsorption certainly proceeds by ligand exchange between the phosphate group and the hydroxyls of the broken edges of phyllosilicates leading to the
Role of Metal Oxides in Chemical Evolution: Interaction of Ribose Nucleotides with Alumina
Arora, Avnish Kumar; Kamaluddin
2009-03-01
Interaction of ribonucleotides—namely, 5‧-AMP, 5‧-GMP, 5‧-CMP, and 5‧-UMP—with acidic, neutral, and basic alumina has been studied. Purine nucleotides showed higher adsorption on alumina in comparison with pyrimidine nucleotides under acidic conditions. Adsorption data obtained followed Langmuir adsorption isotherm, and Xm and KL values were calculated. On the basis of infrared spectral studies of ribonucleotides, alumina, and ribonucleotide-alumina adducts, we propose that the nitrogen base and phosphate moiety of the ribonucleotides interact with the positive charge surface of alumina. Results of the present study may indicate the importance of alumina in concentrating organic molecules from dilute aqueous solutions in primeval seas in the course of chemical evolution on Earth.
Selective fluorescence quenching of 2,3-diazabicyclo[2.2.2]oct-2-ene by nucleotides.
Marquez, Cesar; Pischel, Uwe; Nau, Werner M
2003-10-16
[reaction: see text] The fluorescence quenching of 2,3-diazabicyclo[2.2.2]oct-2-ene (DBO) by nucleotides has been studied. The quenching mechanism was analyzed on the basis of deuterium isotope effects, tendencies for exciplex formation, and the quenching efficiency in the presence of a molecular container (cucurbit[7]uril). Exciplex-induced quenching appears to prevail for adenosine, cytidine, and uridine, while hydrogen abstraction becomes competitive for thymidine and guanosine. Compared to other fluorescent probes, DBO responds very selectively to the type of nucleotide.
E Skotnicka; I Baranowska-Bosiacka; W Dudzińska; M Suska; R Nowak; K Krupecki; AJ Hłyńczak
2008-01-01
In this study we tried to obtain a complete overview of purine nucleotide metabolism in erythrocytes before and during an incremental, intermittent exhaustive exercise bout protocol for sportsmen (high-performance rowers) and untrained, healthy, active volunteers. Erythrocyte levels of the main nucleotides (ATP, ADP, AMP, GTP, GDP, GMP, IMP, NAD and NADP ), nucleosides (Ado, Guo, Ino) and the base Hyp were measured using the HPLC method. The parameters that can be deducted from their concent...
Ethanol-induced activation of adenine nucleotide turnover. Evidence for a role of acetate
International Nuclear Information System (INIS)
Puig, J.G.; Fox, I.H.
1984-01-01
Consumption of alcohol causes hyperuricemia by decreasing urate excretion and increasing its production. Our previous studies indicate that ethanol administration increases uric acid production by increasing ATP degradation to uric acid precursors. To test the hypothesis that ethanol-induced increased urate production results from acetate metabolism and enhanced adenosine triphosphate turnover, we gave intravenous sodium acetate, sodium chloride and ethanol (0.1 mmol/kg per min for 1 h) to five normal subjects. Acetate plasma levels increased from 0.04 +/- 0.01 mM (mean +/- SE) to peak values of 0.35 +/- 0.07 mM and to 0.08 +/- 0.01 mM during acetate and ethanol infusions, respectively. Urinary oxypurines increased to 223 +/- 13% and 316 +/- 44% of the base-line values during acetate and ethanol infusions, respectively. Urinary radioactivity from the adenine nucleotide pool labeled with [8-14C] adenine increased to 171 +/- 27% and to 128 +/- 8% of the base-line values after acetate and ethanol infusions. These data indicate that both ethanol and acetate increase purine nucleotide degradation by enhancing the turnover of the adenine nucleotide pool. They support the hypothesis that acetate metabolism contributes to the increased production of urate associated with ethanol intake
On the biased nucleotide composition of the human coronavirus RNA genome
Berkhout, Ben; van Hemert, Formijn
2015-01-01
We investigated the nucleotide composition of the RNA genome of the six human coronaviruses. Some general coronavirus characteristics were apparent (e.g. high U, low C count), but we also detected species-specific signatures. Most strikingly, the high U and low C proportions are quite variable and
Lack of nucleotide variability in a beetle pest with extreme inbreeding.
Andreev, D; Breilid, H; Kirkendall, L; Brun, L O; ffrench-Constant, R H
1998-05-01
The coffee berry borer beetle Hypothenemus hampei (Ferrari) (Curculionidae: Scolytinae) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an unusual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occurring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation in nuclear and mitochondrial genomes of this beetle worldwide. Here we show that two nuclear loci (Resistance to dieldrin and ITS2) are completely invariant, whereas some variability is maintained at a mitochondrial locus (COI), probably corresponding to a higher mutation rate in the mitochondrial genome. Phylogenetic analysis of the mitochondrial data shows only two clades of beetle haplotypes outside of Kenya, the proposed origin of the species. These data confirm that inbreeding greatly reduces nucleotide variation and suggest the recent global spread of only two inbreeding lines of this bark beetle.
Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe
2015-05-30
Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.
Fukui, H; Taniguchi , S; Ueta, Y; Yoshida, A; Ohtahara, A; Hisatome, I; Shigemasa, C
2001-05-01
Myopathy frequently develops in patients with hyperthyroidism, but its precise mechanism is not clearly understood. In this study we focused on the purine nucleotide cycle, which contributes to ATP balance in skeletal muscles. To investigate purine metabolism in muscles, we measured metabolites related to the purine nucleotide cycle using the semiischemic forearm test. We examined the following four groups: patients with untreated thyrotoxic Graves' disease (untreated group), patients with Graves' disease treated with methimazole (treated group), patients in remission (remission group), and healthy volunteers (control group). To trace the glycolytic process, we measured glycolytic metabolites (lactate and pyruvate) as well as purine metabolites (ammonia and hypoxanthine). In the untreated group, the levels of lactate, pyruvate, and ammonia released were remarkably higher than those in the control group. Hypoxanthine release also increased in the untreated group, but the difference among the patient groups was not statistically significant. The accelerated purine catabolism did not improve after 3 months of treatment with methimazole, but it was completely normalized in the remission group. This indicated that long-term maintenance of thyroid function was necessary for purine catabolism to recover. We presume that an unbalanced ATP supply or conversion of muscle fiber type may account for the acceleration of the purine nucleotide cycle under thyrotoxicosis. Such acceleration of the purine nucleotide cycle is thought to be in part a protective mechanism against a rapid collapse of the ATP energy balance in exercising muscles of patients with hyperthyroidism.
Rosenberg, Mark F; Kamis, Alhaji Bukar; Callaghan, Richard; Higgins, Christopher F; Ford, Robert C
2003-03-07
P-glycoprotein is an ATP-binding cassette transporter that is associated with multidrug resistance and the failure of chemotherapy in human patients. We have previously shown, based on two-dimensional projection maps, that P-glycoprotein undergoes conformational changes upon binding of nucleotide to the intracellular nucleotide binding domains. Here we present the three-dimensional structures of P-glycoprotein in the presence and absence of nucleotide, at a resolution limit of approximately 2 nm, determined by electron crystallography of negatively stained crystals. The data reveal a major reorganization of the transmembrane domains throughout the entire depth of the membrane upon binding of nucleotide. In the absence of nucleotide, the two transmembrane domains form a single barrel 5-6 nm in diameter and about 5 nm deep with a central pore that is open to the extracellular surface and spans much of the membrane depth. Upon binding nucleotide, the transmembrane domains reorganize into three compact domains that are each 2-3 nm in diameter and 5-6 nm deep. This reorganization opens the central pore along its length in a manner that could allow access of hydrophobic drugs (transport substrates) directly from the lipid bilayer to the central pore of the transporter.
Mitochondria as determinant of nucleotide pools and chromosomal stability
DEFF Research Database (Denmark)
Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna
2007-01-01
Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....
International Nuclear Information System (INIS)
Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.
1998-01-01
To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)
Nucleotide diversity analysis of three major bacterial blight resistance genes in rice.
Directory of Open Access Journals (Sweden)
Waikhom Bimolata
Full Text Available Nucleotide sequence polymorphisms among R gene alleles influence the process of co-evolutionary interaction between host and pathogen by shaping the response of host plants towards invading pathogens. Here, we present the DNA sequence polymorphisms and diversities present among natural alleles of three rice bacterial blight resistance genes, Xa21, Xa26 and xa5. The diversity was examined across different wild relatives and cultivars of Oryza species. Functional significance of selected alleles was evaluated through semi-quantitative reverse transcription polymerase chain reaction and real time PCR. The greatest nucleotide diversity and singleton variable sites (SVS were present in Xa26 (π = 0.01958; SVS = 182 followed by xa5 and Xa21 alleles. The highest frequency of single nucleotide polymorphisms were observed in Xa21 alleles and least in xa5. Transition bias was observed in all the genes and 'G' to 'A' transitions were more favored than other form of transitions. Neutrality tests failed to show the presence of selection at these loci, though negative Tajima's D values indicate the presence of a rare form of polymorphisms. At the interspecies level, O. nivara exhibited more diversity than O. sativa. We have also identified two nearly identical resistant alleles of xa5 and two sequentially identical alleles of Xa21. The alleles of xa5 showed basal levels of expression while Xa21 alleles were functionally not expressed.
Lifescience Database Archive (English)
Full Text Available and nucleotide oligomerisation domain inthe regulation of health and disease. Pu...bmedID 17535871 Title Critical role of toll-like receptors and nucleotide oligomerisation domain inthe regulation of health...17535871 Critical role of toll-like receptors and nucleotide oligomerisation domain inthe regulation of heal...th and disease. Mitchell JA, Paul-Clark MJ, Clarke GW, McMaster SK, Cartwright N. J
A single nucleotide change affects fur-dependent regulation of sodB in H. pylori.
Directory of Open Access Journals (Sweden)
Beth M Carpenter
Full Text Available Helicobacter pylori is a significant human pathogen that has adapted to survive the many stresses found within the gastric environment. Superoxide Dismutase (SodB is an important factor that helps H. pylori combat oxidative stress. sodB was previously shown to be repressed by the Ferric Uptake Regulator (Fur in the absence of iron (apo-Fur regulation [1]. Herein, we show that apo regulation is not fully conserved among all strains of H. pylori. apo-Fur dependent changes in sodB expression are not observed under iron deplete conditions in H. pylori strains G27, HPAG1, or J99. However, Fur regulation of pfr and amiE occurs as expected. Comparative analysis of the Fur coding sequence between G27 and 26695 revealed a single amino acid difference, which was not responsible for the altered sodB regulation. Comparison of the sodB promoters from G27 and 26695 also revealed a single nucleotide difference within the predicted Fur binding site. Alteration of this nucleotide in G27 to that of 26695 restored apo-Fur dependent sodB regulation, indicating that a single base difference is at least partially responsible for the difference in sodB regulation observed among these H. pylori strains. Fur binding studies revealed that alteration of this single nucleotide in G27 increased the affinity of Fur for the sodB promoter. Additionally, the single base change in G27 enabled the sodB promoter to bind to apo-Fur with affinities similar to the 26695 sodB promoter. Taken together these data indicate that this nucleotide residue is important for direct apo-Fur binding to the sodB promoter.
Bennett, Gillian C; Boarder, Michael R
2000-01-01
Evidence has previously been presented that P1 receptors for adenosine, and P2 receptors for nucleotides such as ATP, regulate stimulus-evoked release of biogenic amines from nerve terminals in the brain. Here we investigated whether adenosine and nucleotides exert presynaptic control over depolarisation-elicited glutamate release.Slices of rat brain cortex were perfused and stimulated with pulses of 46 mM K+ in the presence of the glutamate uptake inhibitor L-trans-pyrrolidine-2,4-dicarboxyl...
Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.
Directory of Open Access Journals (Sweden)
Enying Zhang
Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.
A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.
Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I
2016-01-01
We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.
Nucleotide Excision DNA Repair is Associated with Age-Related Vascular Dysfunction
Durik, Matej; Kavousi, Maryam; van der Pluijm, Ingrid; Isaacs, Aaron; Cheng, Caroline; Verdonk, Koen; Loot, Annemarieke E.; Oeseburg, Hisko; Musterd-Bhaggoe, Usha; Leijten, Frank; van Veghel, Richard; de Vries, Rene; Rudez, Goran; Brandt, Renata; Ridwan, Yanto R.; van Deel, Elza D.; de Boer, Martine; Tempel, Dennie; Fleming, Ingrid; Mitchell, Gary F.; Verwoert, Germaine C.; Tarasov, Kirill V.; Uitterlinden, Andre G.; Hofman, Albert; Duckers, Henricus J.; van Duijn, Cornelia M.; Oostra, Ben A.; Witteman, Jacqueline C.M.; Duncker, Dirk J.; Danser, A.H. Jan; Hoeijmakers, Jan H.; Roks, Anton J.M.
2012-01-01
Background Vascular dysfunction in atherosclerosis and diabetes, as observed in the aging population of developed societies, is associated with vascular DNA damage and cell senescence. We hypothesized that cumulative DNA damage during aging contributes to vascular dysfunction. Methods and Results In mice with genomic instability due to the defective nucleotide excision repair genes ERCC1 and XPD (Ercc1d/− and XpdTTD mice), we explored age-dependent vascular function as compared to wild-type mice. Ercc1d/− mice showed increased vascular cell senescence, accelerated development of vasodilator dysfunction, increased vascular stiffness and elevated blood pressure at very young age. The vasodilator dysfunction was due to decreased endothelial eNOS levels as well as impaired smooth muscle cell function, which involved phosphodiesterase (PDE) activity. Similar to Ercc1d/− mice, age-related endothelium-dependent vasodilator dysfunction in XpdTTD animals was increased. To investigate the implications for human vascular disease, we explored associations between single nucleotide polymorphisms (SNPs) of selected nucleotide excision repair genes and arterial stiffness within the AortaGen Consortium, and found a significant association of a SNP (rs2029298) in the putative promoter region of DDB2 gene with carotid-femoral pulse wave velocity. Conclusions Mice with genomic instability recapitulate age-dependent vascular dysfunction as observed in animal models and in humans, but with an accelerated progression, as compared to wild type mice. In addition, we found associations between variations in human DNA repair genes and markers for vascular stiffness which is associated with aging. Our study supports the concept that genomic instability contributes importantly to the development of cardiovascular disease. PMID:22705887
Cyclic nucleotide specific phosphodiesterases of Leishmania major
Directory of Open Access Journals (Sweden)
Linder Markus
2006-03-01
Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range
Unraveling the cellular context of cyclic nucleotide signaling proteins by chemical proteomics
Corradini, E.
2015-01-01
Understanding the molecular mechanisms which regulate signal transduction is fundamental to the development of therapeutic molecules for the treatment of several diseases. In particular, signaling proteins, such as cyclic nucleotide dependent enzymes are the orchestrators of many tissue functions.
Tomaszewski, M; Buchowicz, J
1971-08-01
The effect of ethanol on the activity of acid phosphatase from wheat germ was studied, by using ribonucleoside monophosphates as the enzyme substrates. The nucleotides were effectively degraded to the corresponding nucleosides in the presence of ethanol at all concentrations tested, including a 96% (v/v) solution. However, the nucleotide dephosphorylation was accompanied by the liberation of orthophosphate only when the concentration of ethanol in the assay mixture did not exceed 15%. No inorganic phosphate was liberated when ethanol was present at higher concentrations. Instead, monoethyl phosphate was formed in quantities expected for orthophosphate. The results are explained in terms of phosphatase-catalysed alcoholysis.
Directory of Open Access Journals (Sweden)
Lefranc Marie-Paule
2008-10-01
Full Text Available Abstract Background Nucleotides are trimmed from the ends of variable (V, diversity (D and joining (J genes during immunoglobulin (IG and T cell receptor (TR rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT® sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output". However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." Results A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA and TR gamma (TRG V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT®, the international ImMunoGeneTics information system®, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. Conclusion By
Bleakley, Kevin; Lefranc, Marie-Paule; Biau, Gérard
2008-10-02
Nucleotides are trimmed from the ends of variable (V), diversity (D) and joining (J) genes during immunoglobulin (IG) and T cell receptor (TR) rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides) of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output"). However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA) and TR gamma (TRG) V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT, the international ImMunoGeneTics information system, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. By using trimming of rearranged TR genes as a benchmark, we
Directory of Open Access Journals (Sweden)
Chai Ann Ng
Full Text Available Kv11.1 potassium channels are important for regulation of the normal rhythm of the heartbeat. Reduced activity of Kv11.1 channels causes long QT syndrome type 2, a disorder that increases the risk of cardiac arrhythmias and sudden cardiac arrest. Kv11.1 channels are members of the KCNH subfamily of voltage-gated K(+ channels. However, they also share many similarities with the cyclic nucleotide gated ion channel family, including having a cyclic nucleotide-binding homology (cNBH domain. Kv11.1 channels, however, are not directly regulated by cyclic nucleotides. Recently, crystal structures of the cNBH domain from mEAG and zELK channels, both members of the KCNH family of voltage-gated potassium channels, revealed that a C-terminal β9-strand in the cNBH domain occupied the putative cyclic nucleotide-binding site thereby precluding binding of cyclic nucleotides. Here we show that mutations to residues in the β9-strand affect the stability of the open state relative to the closed state of Kv11.1 channels. We also show that disrupting the structure of the β9-strand reduces the stability of the inactivated state relative to the open state. Clinical mutations located in this β9-strand result in reduced trafficking efficiency, which suggests that binding of the C-terminal β9-strand to the putative cyclic nucleotide-binding pocket is also important for assembly and trafficking of Kv11.1 channels.
Tools and drugs for uracil nucleotide-activated P2Y receptors.
Rafehi, Muhammad; Müller, Christa E
2018-04-13
P2Y receptors (P2YRs) are a family of G protein-coupled receptors activated by extracellular nucleotides. Physiological P2YR agonists include purine and pyrimidine nucleoside di- and triphosphates, such as ATP, ADP, UTP, UDP, nucleotide sugars, and dinucleotides. Eight subtypes exist, P2Y 1 , P2Y 2 , P2Y 4 , P2Y 6 , P2Y 11 , P2Y 12 , P2Y 13 , and P2Y 14 , which represent current or potential future drug targets. Here we provide a comprehensive overview of ligands for the subgroup of the P2YR family that is activated by uracil nucleotides: P2Y 2 (UTP, also ATP and dinucleotides), P2Y 4 (UTP), P2Y 6 (UDP), and P2Y 14 (UDP, UDP-glucose, UDP-galactose). The physiological agonists are metabolically unstable due to their fast hydrolysis by ectonucleotidases. A number of agonists with increased potency, subtype-selectivity and/or enzymatic stability have been developed in recent years. Useful P2Y 2 R agonists include MRS2698 (6-01, highly selective) and PSB-1114 (6-05, increased metabolic stability). A potent and selective P2Y 2 R antagonist is AR-C118925 (10-01). For studies of the P2Y 4 R, MRS4062 (3-15) may be used as a selective agonist, while PSB-16133 (10-06) represents a selective antagonist. Several potent P2Y 6 R agonists have been developed including 5-methoxyuridine 5'-O-((R p )α-boranodiphosphate) (6-12), PSB-0474 (3-11), and MRS2693 (3-26). The isocyanate MRS2578 (10-08) is used as a selective P2Y 6 R antagonist, although its reactivity and low water-solubility are limiting. With MRS2905 (6-08), a potent and metabolically stable P2Y 14 R agonist is available, while PPTN (10-14) represents a potent and selective P2Y 14 R antagonist. The radioligand [ 3 H]UDP can be used to label P2Y 14 Rs. In addition, several fluorescent probes have been developed. Uracil nucleotide-activated P2YRs show great potential as drug targets, especially in inflammation, cancer, cardiovascular and neurodegenerative diseases. Copyright © 2018. Published by Elsevier Inc.
Directory of Open Access Journals (Sweden)
Peter M Jones
Full Text Available ABC transporters are integral membrane pumps that are responsible for the import or export of a diverse range of molecules across cell membranes. ABC transporters have been implicated in many phenomena of medical importance, including cystic fibrosis and multidrug resistance in humans. The molecular architecture of ABC transporters comprises two transmembrane domains and two ATP-binding cassettes, or nucleotide-binding domains (NBDs, which are highly conserved and contain motifs that are crucial to ATP binding and hydrolysis. Despite the improved clarity of recent structural, biophysical, and biochemical data, the seemingly simple process of ATP binding and hydrolysis remains controversial, with a major unresolved issue being whether the NBD protomers separate during the catalytic cycle. Here chemical cross-linking data is presented for the bacterial ABC multidrug resistance (MDR transporter LmrA. These indicate that in the absence of nucleotide or substrate, the NBDs come into contact to a significant extent, even at 4°C, where ATPase activity is abrogated. The data are clearly not in accord with an inward-closed conformation akin to that observed in a crystal structure of V. cholerae MsbA. Rather, they suggest a head-to-tail configuration 'sandwich' dimer similar to that observed in crystal structures of nucleotide-bound ABC NBDs. We argue the data are more readily reconciled with the notion that the NBDs are in proximity while undergoing intra-domain motions, than with an NBD 'Switch' mechanism in which the NBD monomers separate in between ATP hydrolysis cycles.
Factor 11 single-nucleotide variants in women with heavy menstrual bleeding
Wiewel-Verschueren, Sophie; Mulder, Andre B.; Meijer, Karina; Mulder, Rene
2017-01-01
In a previous study it was shown that lower factor XI (FXI) levels in women with heavy menstrual bleeding (HMB). Our aim was to determine the single-nucleotide variants (SNVs) in the F11 gene in women with HMB. In addition, an extensive literature search was performed to determine the clinical
Nucleotide variation in ATHK1 region of Arabidopsis thaliana and its ...
African Journals Online (AJOL)
The ATHK1 gene in Arabidopsis encodes a putative histidine kinase that is transcriptionally upregulated in response to changes in external osmolarity. In this work, we investigated the nucleotide variability of the ATHK1 gene in a sample of 32 core Arabidopsis accessions originating from different ecoclimatic regions and ...
International Nuclear Information System (INIS)
Marques-Carvalho, Maria João; Morais-Cabral, João Henrique
2012-01-01
The crystallization conditions and preliminary crystal characterization of the cytoplasmic cyclic nucleotide-binding homology domain from the mouse EAG potassium channel are reported. The members of the family of voltage-gated KCNH potassium channels play important roles in cardiac and neuronal repolarization, tumour proliferation and hormone secretion. These channels have a C-terminal cytoplasmic domain which is homologous to cyclic nucleotide-binding domains (CNB-homology domains), but it has been demonstrated that channel function is not affected by cyclic nucleotides and that the domain does not bind nucleotides in vitro. Here, the crystallization and preliminary crystallographic analysis of a CNB-homology domain from a member of the KCNH family, the mouse EAG channel, is reported. X-ray diffraction data were collected to 2.2 Å resolution and the crystal belonged to the hexagonal space group P3 1 21
Synthesis and degradation of cyclic nucleotides in brain after a high dose of ionizing radiation
International Nuclear Information System (INIS)
Hunt, W.A.; Dalton, T.K.
1981-01-01
Previous data from our laboratory have indicated that a high dose of ionizing radiation can deplete the cyclic nucleotides guanosine 3',5'-cyclic monophosphate (cGMP) and adenosine 3',5'-cyclic monophosphate (cAMP) on several areas of the rat brain. cGMP is more sensitive to radiation than cAMP and does not recover for at least 24 h after irradiation. The response of cAMP is transient and recovery occurs within 4 h. The purpose of the present paper is to determine whether alternations in the activity of the synthetic and degradative enzymes that regulate cyclic nucleotide levels could account for the observed effects. Guanylate and adenylate cyclase and cGMP and cAMP phosphodiesterase activities were determined 10 min after irradiation with 10,000 rad of high-energy electrons. No alteration was detected under these experimental conditions. The data suggest that the reduction in cyclic nucleotides is not a direct effect on their metabolic enzymes and is probably secondary to some as yet-undefined action of radiation on the brain
Directory of Open Access Journals (Sweden)
Cheng-Chong Chou
2004-11-01
Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.
DEFF Research Database (Denmark)
Hansen, Thomas van Overeem; Jønson, Lars; Albrechtsen, Anders
2010-01-01
Germ-line mutations in the tumour suppressor proteins BRCA1 and BRCA2 predispose to breast and ovarian cancer. We have recently identified a Greenlandic Inuit BRCA1 nucleotide 234T>G/c.115T>G (p.Cys39Gly) founder mutation, which at that time was the only disease-causing BRCA1/BRCA2 mutation...... identified in this population. Here, we describe the identification of a novel disease-causing BRCA1 nucleotide 4803delCC/c.4684delCC mutation in a Greenlandic Inuit with ovarian cancer. The mutation introduces a frameshift and a premature stop at codon 1572. We have also identified a BRCA1 nucleotide 249T......>A/c.130T>A (p.Cys44Ser) mutation in another Greenlandic individual with ovarian cancer. This patient share a 1-2 Mb genomic fragment, containing the BRCA1 gene, with four Danish families harbouring the same mutation, suggesting that the 249T>A/c.130T>A (p.Cys44Ser) mutation originates from a Danish...
The first 3':5'-cyclic nucleotide-amino acid complex: L-His-cIMP.
Slepokura, Katarzyna
2012-08-01
In the crystal structure of the L-His-cIMP complex, i.e. L-histidinium inosine 3':5'-cyclic phosphate [systematic name: 5-(2-amino-2-carboxyethyl)-1H-imidazol-3-ium 7-hydroxy-2-oxo-6-(6-oxo-6,9-dihydro-1H-purin-9-yl)-4a,6,7,7a-tetrahydro-4H-1,3,5,2λ(5)-furo[3,2-d][1,3,2λ(5)]dioxaphosphinin-2-olate], C(6)H(10)N(3)O(2)(+)·C(10)H(10)N(4)O(7)P(-), the Hoogsteen edge of the hypoxanthine (Hyp) base of cIMP and the Hyp face are engaged in specific amino acid-nucleotide (His···cIMP) recognition, i.e. by abutting edge-to-edge and by π-π stacking, respectively. The Watson-Crick edge of Hyp and the cIMP phosphate group play a role in nonspecific His···cIMP contacts. The interactions between the cIMP anions (anti/C3'-endo/trans-gauche/chair conformers) are realized mainly between riboses and phosphate groups. The results for this L-His-cIMP complex, compared with those for the previously reported solvated L-His-IMP crystal structure, indicate a different nature of amino acid-nucleotide recognition and interactions upon the 3':5'-cyclization of the nucleotide phosphate group.
Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes
Directory of Open Access Journals (Sweden)
McGuire Patrick E
2010-12-01
Full Text Available Abstract Background A genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into their respective genomes. The same requirements complicate the development and deployment of single nucleotide polymorphism (SNP markers in polyploid species. We report here a strategy that satisfies these requirements and deploy it in the sequencing of genes in cultivated hexaploid wheat (Triticum aestivum, genomes AABBDD and wild tetraploid wheat (Triticum turgidum ssp. dicoccoides, genomes AABB from the putative site of wheat domestication in Turkey. Data are used to assess the distribution of diversity among and within wheat genomes and to develop a panel of SNP markers for polyploid wheat. Results Nucleotide diversity was estimated in 2114 wheat genes and was similar between the A and B genomes and reduced in the D genome. Within a genome, diversity was diminished on some chromosomes. Low diversity was always accompanied by an excess of rare alleles. A total of 5,471 SNPs was discovered in 1791 wheat genes. Totals of 1,271, 1,218, and 2,203 SNPs were discovered in 488, 463, and 641 genes of wheat putative diploid ancestors, T. urartu, Aegilops speltoides, and Ae. tauschii, respectively. A public database containing genome-specific primers, SNPs, and other information was constructed. A total of 987 genes with nucleotide diversity estimated in one or more of the wheat genomes was placed on an Ae. tauschii genetic map, and the map was superimposed on wheat deletion-bin maps. The agreement between the maps was assessed. Conclusions In a young polyploid, exemplified by T. aestivum, ancestral species are the primary source of genetic diversity. Low effective recombination due to self-pollination and a genetic mechanism precluding homoeologous chromosome pairing during polyploid meiosis can lead to the loss of diversity from large
Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito
2017-12-01
The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Ian R Kelsall
Full Text Available The many proteins that function in the Fanconi anaemia (FA monoubiquitylation pathway initiate replicative DNA crosslink repair. However, it is not clear whether individual FA genes participate in DNA repair pathways other than homologous recombination and translesion bypass. Here we show that avian DT40 cell knockouts of two integral FA genes--UBE2T and FANCM are unexpectedly sensitive to UV-induced DNA damage. Comprehensive genetic dissection experiments indicate that both of these FA genes collaborate to promote nucleotide excision repair rather than translesion bypass to protect cells form UV genotoxicity. Furthermore, UBE2T deficiency impacts on the efficient removal of the UV-induced photolesion cyclobutane pyrimidine dimer. Therefore, this work reveals that the FA pathway shares two components with nucleotide excision repair, intimating not only crosstalk between the two major repair pathways, but also potentially identifying a UBE2T-mediated ubiquitin-signalling response pathway that contributes to nucleotide excision repair.
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...
African Journals Online (AJOL)
Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...
Slow spontaneous [Ca2+]i oscillations reflect nucleotide release from renal epithelia
DEFF Research Database (Denmark)
Geyti, Christine Stride; Odgaard, Elvin V. P.; Overgaard, Morten Thaarup
2008-01-01
Renal epithelia can be provoked mechanically to release nucleotides, which subsequently increases the intracellular Ca(2+) concentration [Ca(2+)](i) through activation of purinergic (P2) receptors. Cultured cells often show spontaneous [Ca(2+)](i) oscillations, a feature suggested to involve nucl...
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
International Nuclear Information System (INIS)
Lo, A.; Yang, H.L.
1990-01-01
This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described
Regulation of nucleotide excision repair through ubiquitination
Institute of Scientific and Technical Information of China (English)
Jia Li; Audesh Bhat; Wei Xiao
2011-01-01
Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.
Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V
2015-03-04
Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.
Directory of Open Access Journals (Sweden)
Tautz Diethard
2002-03-01
Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.
Iron from haemoglobin and haemin modulates nucleotide hydrolysis in Trichomonas vaginalis.
Vieira, Patrícia de Brum; Silva, Nícolas Luiz Feijó; Kist, Luiza Wilges; Oliveira, Giovanna Medeiros Tavares de; Bogo, Maurício Reis; Carli, Geraldo Atillio de; Macedo, Alexandre José; Tasca, Tiana
2015-04-01
Extracellular ATP may act as a danger signalling molecule, inducing inflammation and immune responses in infection sites. The ectonucleotidases NTPDase and ecto-5'-nucleotidase are enzymes that modulate extracellular nucleotide levels; these enzymes have been previously characterised in Trichomonas vaginalis. Iron plays an important role in the complex trichomonal pathogenesis. Herein, the effects of iron on growth, nucleotide hydrolysis and NTPDase gene expression in T. vaginalis isolates from female and male patients were evaluated. Iron from different sources sustained T. vaginalis growth. Importantly, iron from haemoglobin (HB) and haemin (HM) enhanced NTPDase activity in isolates from female patients and conversely reduced the enzyme activity in isolates from male patients. Iron treatments could not alter the NTPDase transcript levels in T. vaginalis. Furthermore, our results reveal a distinct ATP, ADP and AMP hydrolysis profile between isolates from female and male patients influenced by iron from HB and HM. Our data indicate the participation of NTPDase and ecto-5'-nucleotidase in the establishment of trichomonas infection through ATP degradation and adenosine production influenced by iron.
Iron from haemoglobin and haemin modulates nucleotide hydrolysis in Trichomonas vaginalis
Directory of Open Access Journals (Sweden)
Patrícia de Brum Vieira
2015-04-01
Full Text Available Extracellular ATP may act as a danger signalling molecule, inducing inflammation and immune responses in infection sites. The ectonucleotidases NTPDase and ecto-5’-nucleotidase are enzymes that modulate extracellular nucleotide levels; these enzymes have been previously characterised in Trichomonas vaginalis. Iron plays an important role in the complex trichomonal pathogenesis. Herein, the effects of iron on growth, nucleotide hydrolysis and NTPDase gene expression in T. vaginalis isolates from female and male patients were evaluated. Iron from different sources sustained T. vaginalis growth. Importantly, iron from haemoglobin (HB and haemin (HM enhanced NTPDase activity in isolates from female patients and conversely reduced the enzyme activity in isolates from male patients. Iron treatments could not alter the NTPDase transcript levels in T. vaginalis. Furthermore, our results reveal a distinct ATP, ADP and AMP hydrolysis profile between isolates from female and male patients influenced by iron from HB and HM. Our data indicate the participation of NTPDase and ecto-5’-nucleotidase in the establishment of trichomonas infection through ATP degradation and adenosine production influenced by iron.
Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms
Drago, Francesca; Karpasitou, Katerina; Poli, Francesca
2009-01-01
We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...
Chen, Sherry Xi; Seelig, Georg
2016-04-20
Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.
Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J
2011-12-01
Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.
Brand, R C; Klootwijk, J; Planta, R J; Maden, B E
1978-01-01
The biosynthesis of a hypermodified nucleotide, similar to or identical with 3-(3-amino-3-carboxypropyl)-1-methylpseudouridine monophosphate, present in Saccharomyces carlsbergensis 17S and HeLa-cell 18S rRNA, was investigated with respect to the sequence of reactions required for synthesis and their timing in ribosome maturation. In both yeast and HeLa cells methylation precedes attachment of the 3-amino-3-carboxypropyl group. In yeast the methylated precursor nucleotide was tentatively characterized as 1-methylpseudouridine. This precursor nucleotide was demonstrated in both 37S and most of the cytoplasmic 18S pre-rRNA (rRNA precursor) molecules. The synthesis of the hypermodified nucleotide is completed just before the final cleavage of 18S pre-rRNA to give 17S rRNA, so that the final addition of the 3-amino-3-carboxypropyl group is a cytoplasmic event. Comparable experiments with HeLa cells indicated that formation of 1-methylpseudouridine occurs at the level of 45S RNA and addition of the 3-amino-3-carboxypropyl group occurs in the cytoplasm on newly synthesized 18S RNA.
Calcium-dependent, cyclic nucleotide-independent steroidogenesis in the bovine placenta.
Shemesh, M; Hansel, W; Strauss, J F
1984-01-01
Dispersed bovine placental cells (fetal cotyledon and maternal caruncle) were shown to synthesize progesterone. To determine if their steroidogenic activity could be modulated by a cyclic nucleotide-mediated process, we added luteinizing hormone, 8-bromoadenosine 3',5'-monophosphate, 8-bromoguanosine 3',5'-monophosphate, adenosine, or cholera toxin to dispersed cells from placentomes of 100-283 days gestational age and examined progesterone synthesis during 3-to 16-hr incubation periods. Net ...
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
Energy Technology Data Exchange (ETDEWEB)
Lo, A.; Yang, H.L.
1990-02-13
This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.
Heinz, Eva; Hacker, Christian; Dean, Paul; Mifsud, John; Goldberg, Alina V.; Williams, Tom A.; Nakjang, Sirintra; Gregory, Alison; Hirt, Robert P.; Lucocq, John M.; Kunji, Edmund R. S.; Embley, T. Martin
2014-01-01
Microsporidia are obligate intracellular parasites of most animal groups including humans, but despite their significant economic and medical importance there are major gaps in our understanding of how they exploit infected host cells. We have investigated the evolution, cellular locations and substrate specificities of a family of nucleotide transport (NTT) proteins from Trachipleistophora hominis, a microsporidian isolated from an HIV/AIDS patient. Transport proteins are critical to microsporidian success because they compensate for the dramatic loss of metabolic pathways that is a hallmark of the group. Our data demonstrate that the use of plasma membrane-located nucleotide transport proteins (NTT) is a key strategy adopted by microsporidians to exploit host cells. Acquisition of an ancestral transporter gene at the base of the microsporidian radiation was followed by lineage-specific events of gene duplication, which in the case of T. hominis has generated four paralogous NTT transporters. All four T. hominis NTT proteins are located predominantly to the plasma membrane of replicating intracellular cells where they can mediate transport at the host-parasite interface. In contrast to published data for Encephalitozoon cuniculi, we found no evidence for the location for any of the T. hominis NTT transporters to its minimal mitochondria (mitosomes), consistent with lineage-specific differences in transporter and mitosome evolution. All of the T. hominis NTTs transported radiolabelled purine nucleotides (ATP, ADP, GTP and GDP) when expressed in Escherichia coli, but did not transport radiolabelled pyrimidine nucleotides. Genome analysis suggests that imported purine nucleotides could be used by T. hominis to make all of the critical purine-based building-blocks for DNA and RNA biosynthesis during parasite intracellular replication, as well as providing essential energy for parasite cellular metabolism and protein synthesis. PMID:25474405
Directory of Open Access Journals (Sweden)
Alain Stepanian
Full Text Available Preeclampsia is a frequent medical complication during pregnancy. Corin, a serine protease which activates pro-atrial natriuretic peptide, has recently been shown to be involved in the pathophysiology of preeclampsia. The aim of this study was to search for CORIN gene variations and their association to preeclampsia in Caucasian and African women. Our study population was composed of 571 pregnant women (295 with preeclampsia and 276 normotensive controls matched for maternal and gestational age, and ethnic origin. The 22 exons of the CORIN gene were sequenced in a discovery sample (n = 260, where 31 single nucleotide polymorphisms were identified. In a replication sample (n = 311, 4 single nucleotide polymorphisms were tested. Two minor alleles (C for rs2271036 and G for rs2271037 were significantly associated to preeclampsia. Adjusted odds ratios [95% confidence interval] were 2.5 [1.2-3.8] (p = 0.007 and 2.3 [1.5-3.5] (p = 1.3 × 10(-4, respectively. These associations were ethnic-specific, as only found in the Caucasian of subjects (odds ratio = 3.5 [1.8-6.6], p = 1.1 × 10(-4; odds ratio = 3.1 [1.7-5.8], p = 2.1 × 10(-4, for each single nucleotide polymorphism, respectively. The two single nucleotide polymorphisms are in almost perfect linkage disequilibrium (r(2 = 0.93. No specific association was found with severe preeclampsia, early-onset preeclampsia nor fetal growth retardation. In conclusion, this is the first report of a highly significant association between these two single nucleotide polymorphisms in CORIN gene and preeclampsia. Our findings further support the probability of a critical role of corin in preeclamspia pathophysiology at the uteroplacental interface.
Directory of Open Access Journals (Sweden)
Eva Heinz
2014-12-01
Full Text Available Microsporidia are obligate intracellular parasites of most animal groups including humans, but despite their significant economic and medical importance there are major gaps in our understanding of how they exploit infected host cells. We have investigated the evolution, cellular locations and substrate specificities of a family of nucleotide transport (NTT proteins from Trachipleistophora hominis, a microsporidian isolated from an HIV/AIDS patient. Transport proteins are critical to microsporidian success because they compensate for the dramatic loss of metabolic pathways that is a hallmark of the group. Our data demonstrate that the use of plasma membrane-located nucleotide transport proteins (NTT is a key strategy adopted by microsporidians to exploit host cells. Acquisition of an ancestral transporter gene at the base of the microsporidian radiation was followed by lineage-specific events of gene duplication, which in the case of T. hominis has generated four paralogous NTT transporters. All four T. hominis NTT proteins are located predominantly to the plasma membrane of replicating intracellular cells where they can mediate transport at the host-parasite interface. In contrast to published data for Encephalitozoon cuniculi, we found no evidence for the location for any of the T. hominis NTT transporters to its minimal mitochondria (mitosomes, consistent with lineage-specific differences in transporter and mitosome evolution. All of the T. hominis NTTs transported radiolabelled purine nucleotides (ATP, ADP, GTP and GDP when expressed in Escherichia coli, but did not transport radiolabelled pyrimidine nucleotides. Genome analysis suggests that imported purine nucleotides could be used by T. hominis to make all of the critical purine-based building-blocks for DNA and RNA biosynthesis during parasite intracellular replication, as well as providing essential energy for parasite cellular metabolism and protein synthesis.
Energy Technology Data Exchange (ETDEWEB)
Kumar, Amit; Park, HaJeung; Fang, Pengfei; Parkesh, Raman; Guo, Min; Nettles, Kendall W.; Disney, Matthew D. (Scripps)
2012-03-27
RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[{und UU}GGGC(C{und U}G){sub 3}GUCC]{sub 2}, refined to 2.20 and 1.52 {angstrom} resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 x 1 nucleotide UU internal loops can display an ensemble of pairing conformations. In the 2.20 {angstrom} structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 x 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 x 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 {angstrom} structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 x 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 x 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.
DEFF Research Database (Denmark)
Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas
2013-01-01
The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...
Nucleotide composition of the Zika virus RNA genome and its codon usage
van Hemert, Formijn; Berkhout, Ben
2016-01-01
RNA viruses have genomes with a distinct nucleotide composition and codon usage. We present the global characteristics of the RNA genome of Zika virus (ZIKV), an emerging pathogen within the Flavivirus genus. ZIKV was first isolated in 1947 in Uganda, caused a widespread epidemic in South and
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
Synthesis of Benzene and Pyridine 2-C-Methyl-C-ribonucleosides and -nucleotides
Czech Academy of Sciences Publication Activity Database
Tokarenko, Anna; Poštová Slavětínská, Lenka; Klepetářová, Blanka; Hocek, Michal
2015-01-01
Roč. 2015, č. 36 (2015), s. 7962-7983 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * glycosides * antiviral agents * cross - coupling Subject RIV: CC - Organic Chemistry Impact factor: 3.068, year: 2015
Effects of luminal flow and nucleotides on [Ca(2+)](i) in rabbit cortical collecting duct.
Woda, Craig B; Leite, Maurilo; Rohatgi, Rajeev; Satlin, Lisa M
2002-09-01
Nucleotide binding to purinergic P2 receptors contributes to the regulation of a variety of physiological functions in renal epithelial cells. Whereas P2 receptors have been functionally identified at the basolateral membrane of the cortical collecting duct (CCD), a final regulatory site of urinary Na(+), K(+), and acid-base excretion, controversy exists as to whether apical purinoceptors exist in this segment. Nor has the distribution of receptor subtypes present on the unique cell populations that constitute Ca(2+) the CCD been established. To examine this, we measured nucleotide-induced changes in intracellular Ca(2+) concentration ([Ca(2+)](i)) in fura 2-loaded rabbit CCDs microperfused in vitro. Resting [Ca(2+)](i) did not differ between principal and intercalated cells, averaging approximately 120 nM. An acute increase in tubular fluid flow rate, associated with a 20% increase in tubular diameter, led to increases in [Ca(2+)](i) in both cell types. Luminal perfusion of 100 microM UTP or ATP-gamma-S, in the absence of change in flow rate, caused a rapid and transient approximately fourfold increase in [Ca(2+)](i) in both cell types (P < 0.05). Luminal suramin, a nonspecific P2 receptor antagonist, blocked the nucleotide- but not flow-induced [Ca(2+)](i) transients. Luminal perfusion with a P2X (alpha,beta-methylene-ATP), P2X(7) (benzoyl-benzoyl-ATP), P2Y(1) (2-methylthio-ATP), or P2Y(4)/P2Y(6) (UDP) receptor agonist had no effect on [Ca(2+)](i). The nucleotide-induced [Ca(2+)](i) transients were inhibited by the inositol-1,4,5-triphosphate receptor blocker 2-aminoethoxydiphenyl borate, thapsigargin, which depletes internal Ca(2+) stores, luminal perfusion with a Ca(2+)-free perfusate, or the L-type Ca(2+) channel blocker nifedipine. These results suggest that luminal nucleotides activate apical P2Y(2) receptors in the CCD via pathways that require both internal Ca(2+) mobilization and extracellular Ca(2+) entry. The flow-induced rise in [Ca(2+)](i) is
Yersinia Virulence Depends on Mimicry of Host Rho-Family Nucleotide Dissociation Inhibitors
Energy Technology Data Exchange (ETDEWEB)
Prehna,G.; Ivanov, M.; Blisha, J.; Stebbins, C.
2006-01-01
Yersinia spp. cause gastroenteritis and the plague, representing historically devastating pathogens that are currently an important biodefense and antibiotic resistance concern. A critical virulence determinant is the Yersinia protein kinase A, or YpkA, a multidomain protein that disrupts the eukaryotic actin cytoskeleton. Here we solve the crystal structure of a YpkA-Rac1 complex and find that YpkA possesses a Rac1 binding domain that mimics host guanidine nucleotide dissociation inhibitors (GDIs) of the Rho GTPases. YpkA inhibits nucleotide exchange in Rac1 and RhoA, and mutations that disrupt the YpkA-GTPase interface abolish this activity in vitro and impair in vivo YpkA-induced cytoskeletal disruption. In cell culture experiments, the kinase and the GDI domains of YpkA act synergistically to promote cytoskeletal disruption, and a Y. pseudotuberculosis mutant lacking YpkA GDI activity shows attenuated virulence in a mouse infection assay. We conclude that virulence in Yersinia depends strongly upon mimicry of host GDI proteins by YpkA.
Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira
2013-07-01
Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men
Directory of Open Access Journals (Sweden)
Ahamad Salamian
2008-01-01
Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.
Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3
DEFF Research Database (Denmark)
Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik
2003-01-01
The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...
Steenbergh, P.H.; Sussenbach, J.S.
The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the
Energy Technology Data Exchange (ETDEWEB)
Schäferling, Michael, E-mail: Michael.schaeferling@utu.fi; Lang, Thomas; Schnettelker, Annette
2014-10-15
The formation of ground state charge-transfer complexes between pyranine (8-hydroxypyrene-1,3,6-trisulfonic acid) and viologen (paraquat) derivatives is utilized for the design of novel fluoroionophores for the determination of phosphate species, particularly of nucleotides. The strong quenching of the pyranine fluorescence by viologen-type charge transfer acceptors can be countermanded if these are functionalized with triethylammonium groups that serve as recognition elements for phosphate anions. We report on the fluorogenic responses of these water-soluble molecular probes in presence of different phosphates. Absorbance measurements give additional information on the charge transfer complex formation and the interaction with nucleotides. The experimental data show that these aggregates form attractive, simple and versatile fluorescence turn-on probes for nucleoside triphosphates. The reversibility of the fluorescence response is demonstrated by means of an enzymatic model assay using ATPase for the decomposition of adenosine triphosphate. - Highlights: • Pyranine/viologen charge-transfer complexes as molecular probe for ATP recognition. • Fluorescence turn on mechanism. • Selective compared to other nucleotides and phosphate anions. • Fast and reversible response applicable to monitor enzymatic reactions.
Nucleotide compositional asymmetry between the leading and lagging strands of eubacterial genomes
Qu, Hongzhu
2010-12-01
Nucleotide compositional asymmetry (NCA) between leading and lagging strands (LeS and LaS) is dynamic and diverse among eubacterial genomes due to different mutation and selection forces. A thorough investigation is needed in order to study the relationship between nucleotide composition dynamics and gene distribution biases. Based on a collection of 364 eubacterial genomes that were grouped according to a DnaE-based scheme (DnaE1-DnaE1, DnaE2-DnaE1, and DnaE3-PolC), we investigated NCA and nucleotide composition gradients at three codon positions and found that there was universal G-enrichment on LeS among all groups. This was due to a strong selection for G-heading (codon position1 or cp1) codons and mutation pressure that led to more G-ending (cp3) codons. Moreover, a slight T-enrichment of LeS due to the mutation of cytosine deamination at cp3 was universal among DnaE1-DnaE1 and DnaE2-DnaE1 genomes, but was not clearly seen among DnaE3-PolC genomes, in which A-enrichment of LeS was proposed to be the effect of selections unique to polC and a mutation bias toward A-richness at cp1 that may be a result of transcription-coupled DNA repair mechanisms. Furthermore, strand-biased gene distribution enhances the purine-richness of LeS for DnaE3-PolC genomes and T-richness of LeS for DnaE1-DnaE1 and DnaE2-dnaE1 genomes. © 2010 Institut Pasteur.
Nucleotide compositional asymmetry between the leading and lagging strands of eubacterial genomes
Qu, Hongzhu; Wu, Hao; Zhang, Tongwu; Zhang, Zhang; Hu, Songnian; Yu, Jun
2010-01-01
Nucleotide compositional asymmetry (NCA) between leading and lagging strands (LeS and LaS) is dynamic and diverse among eubacterial genomes due to different mutation and selection forces. A thorough investigation is needed in order to study the relationship between nucleotide composition dynamics and gene distribution biases. Based on a collection of 364 eubacterial genomes that were grouped according to a DnaE-based scheme (DnaE1-DnaE1, DnaE2-DnaE1, and DnaE3-PolC), we investigated NCA and nucleotide composition gradients at three codon positions and found that there was universal G-enrichment on LeS among all groups. This was due to a strong selection for G-heading (codon position1 or cp1) codons and mutation pressure that led to more G-ending (cp3) codons. Moreover, a slight T-enrichment of LeS due to the mutation of cytosine deamination at cp3 was universal among DnaE1-DnaE1 and DnaE2-DnaE1 genomes, but was not clearly seen among DnaE3-PolC genomes, in which A-enrichment of LeS was proposed to be the effect of selections unique to polC and a mutation bias toward A-richness at cp1 that may be a result of transcription-coupled DNA repair mechanisms. Furthermore, strand-biased gene distribution enhances the purine-richness of LeS for DnaE3-PolC genomes and T-richness of LeS for DnaE1-DnaE1 and DnaE2-dnaE1 genomes. © 2010 Institut Pasteur.
Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li
2009-03-01
The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.
DEFF Research Database (Denmark)
Jendresen, Christian Bille; Martinussen, Jan; Kilstrup, Mogens
2012-01-01
Purine nucleotides are either synthesized de novo from 5-phosphoribosyl-1-pyrophosphate (PRPP) or salvaged from the environment. In Lactococcus lactis, transcription of the de novo synthesis operons, purCSQLF and purDEK, has genetically been shown to be activated by the PurR protein when bound to......-related functions. Of special interest is the presence of PurBox motifs in rrn promoters, suggesting a novel connection between nucleotide availability and the translational machinery....
Du, Shuhui; Wang, Zhaoshan; Ingvarsson, Pär K; Wang, Dongsheng; Wang, Junhui; Wu, Zhiqiang; Tembrock, Luke R; Zhang, Jianguo
2015-10-01
Historical tectonism and climate oscillations can isolate and contract the geographical distributions of many plant species, and they are even known to trigger species divergence and ultimately speciation. Here, we estimated the nucleotide variation and speciation in three closely related Populus species, Populus tremuloides, P. tremula and P. davidiana, distributed in North America and Eurasia. We analysed the sequence variation in six single-copy nuclear loci and three chloroplast (cpDNA) fragments in 497 individuals sampled from 33 populations of these three species across their geographic distributions. These three Populus species harboured relatively high levels of nucleotide diversity and showed high levels of nucleotide differentiation. Phylogenetic analysis revealed that P. tremuloides diverged earlier than the other two species. The cpDNA haplotype network result clearly illustrated the dispersal route from North America to eastern Asia and then into Europe. Molecular dating results confirmed that the divergence of these three species coincided with the sundering of the Bering land bridge in the late Miocene and a rapid uplift of the Qinghai-Tibetan Plateau around the Miocene/Pliocene boundary. Vicariance-driven successful allopatric speciation resulting from historical tectonism and climate oscillations most likely played roles in the formation of the disjunct distributions and divergence of these three Populus species. © 2015 John Wiley & Sons Ltd.
NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS
Directory of Open Access Journals (Sweden)
Lakshya Veer Singh
2013-06-01
Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.
Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma
Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E
2017-01-01
Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.
DEFF Research Database (Denmark)
Kristensen, Kim Vejlegaard; Paul, Sibasish; Kosbar, Tamer
2017-01-01
Incorporation in a 2'→5' direction of a phosphorodiamidite 2'-amino-LNA-T nucleotide as the morpholino phosphoramidate and N,N-dimethylamino phosphorodiamidate monomers into six oligonucleotides is reported. Thermal denaturation studies showed that the novel 2'-amino-LNA-based morpholino monomers...
Directory of Open Access Journals (Sweden)
Zienolddiny S
2011-12-01
Full Text Available Shanbeh Zienolddiny, Vidar SkaugSection for Toxicology and Biological Work Environment, National Institute of Occupational Health, Oslo, NorwayAbstract: Lung cancer is a major public health problem throughout the world. Among the most frequent cancer types (prostate, breast, colorectal, stomach, lung, lung cancer is the leading cause of cancer-related deaths worldwide. Among the two major subtypes of small cell lung cancer and nonsmall cell lung cancer (NSCLC, 85% of tumors belong to the NSCLC histological types. Small cell lung cancer is associated with the shortest survival time. Although tobacco smoking has been recognized as the major risk factor for lung cancer, there is a great interindividual and interethnic difference in risk of developing lung cancer given exposure to similar environmental and lifestyle factors. This may indicate that in addition to chemical and environmental factors, genetic variations in the genome may contribute to risk modification. A common type of genetic variation in the genome, known as single nucleotide polymorphism, has been found to be associated with susceptibility to lung cancer. Interestingly, many of these polymorphisms are found in the genes that regulate major pathways of carcinogen metabolism (cytochrome P450 genes, detoxification (glutathione S-transferases, adduct removal (DNA repair genes, cell growth/apoptosis (TP53/MDM2, the immune system (cytokines/chemokines, and membrane receptors (nicotinic acetylcholine and dopaminergic receptors. Some of these polymorphisms have been shown to alter the level of mRNA, and protein structure and function. In addition to being susceptibility markers, several of these polymorphisms are emerging to be important for response to chemotherapy/radiotherapy and survival of patients. Therefore, it is hypothesized that single nucleotide polymorphisms will be valuable genetic markers in individual-based prognosis and therapy in future. Here we will review some of the most
YgdE is the 2'-O-ribose methyltransferase RlmM specific for nucleotide C2498 in bacterial 23S rRNA
DEFF Research Database (Denmark)
Purta, Elzbieta; O'Connor, Michelle; Bujnicki, Janusz M
2009-01-01
The rRNAs of Escherichia coli contain four 2'-O-methylated nucleotides. Similar to other bacterial species and in contrast with Archaea and Eukaryota, the E. coli rRNA modifications are catalysed by specific methyltransferases that find their nucleotide targets without being guided by small...... complementary RNAs. We show here that the ygdE gene encodes the methyltransferase that catalyses 2'-O-methylation at nucleotide C2498 in the peptidyl transferase loop of E. coli 23S rRNA. Analyses of rRNAs using MALDI mass spectrometry showed that inactivation of the ygdE gene leads to loss of methylation...... at nucleotide C2498. The loss of ygdE function causes a slight reduction in bacterial fitness. Methylation at C2498 was restored by complementing the knock-out strain with a recombinant copy of ygdE. The recombinant YgdE methyltransferase modifies C2498 in naked 23S rRNA, but not in assembled 50S subunits...
Hendershot, Jenna M.; Wolfe, Abigail E.; O'Brien, Patrick J.
2011-01-01
Human alkyladenine DNA glycosylase (AAG) locates and excises a wide variety of structurally diverse alkylated and oxidized purine lesions from DNA to initiate the base excision repair pathway. Recognition of a base lesion requires flipping of the damaged nucleotide into a relatively open active site pocket between two conserved tyrosine residues, Y127 and Y159. We have mutated each of these amino acids to tryptophan and measured the kinetic effects on the nucleotide flipping and base excision steps. The Y127W and Y159W mutant proteins have robust glycosylase activity toward DNA containing 1,N6-ethenoadenine (εA), within 4-fold of that of the wildtype enzyme, raising the possibility that tryptophan fluorescence could be used to probe the DNA binding and nucleotide flipping steps. Stopped-flow fluorescence was used to compare the time-dependent changes in tryptophan fluorescence and εA fluorescence. For both mutants, the tryptophan fluorescence exhibited two-step binding with essentially identical rate constants as were observed for the εA fluorescence changes. These results provide evidence that AAG forms an initial recognition complex in which the active site pocket is perturbed and the stacking of the damaged base is disrupted. Upon complete nucleotide flipping, there is further quenching of the tryptophan fluorescence with coincident quenching of the εA fluorescence. Although these mutations do not have large effects on the rate constant for excision of εA, there are dramatic effects on the rate constants for nucleotide flipping that result in 40 to 100-fold decreases in the flipping equilibrium relative to wildtype. Most of this effect is due to an increased rate of unflipping, but surprisingly the Y159W mutation causes a 5-fold increase in the rate constant for flipping. The large effect on the equilibrium for nucleotide flipping explains the greater deleterious effects that these mutations have on the glycosylase activity toward base lesions that are in
Purine 3':5'-cyclic nucleotides with the nucleobase in a syn orientation: cAMP, cGMP and cIMP.
Řlepokura, Katarzyna Anna
2016-06-01
Purine 3':5'-cyclic nucleotides are very well known for their role as the secondary messengers in hormone action and cellular signal transduction. Nonetheless, their solid-state conformational details still require investigation. Five crystals containing purine 3':5'-cyclic nucleotides have been obtained and structurally characterized, namely adenosine 3':5'-cyclic phosphate dihydrate, C10H12N5O6P·2H2O or cAMP·2H2O, (I), adenosine 3':5'-cyclic phosphate 0.3-hydrate, C10H12N5O6P·0.3H2O or cAMP·0.3H2O, (II), guanosine 3':5'-cyclic phosphate pentahydrate, C10H12N5O7P·5H2O or cGMP·5H2O, (III), sodium guanosine 3':5'-cyclic phosphate tetrahydrate, Na(+)·C10H11N5O7P(-)·4H2O or Na(cGMP)·4H2O, (IV), and sodium inosine 3':5'-cyclic phosphate tetrahydrate, Na(+)·C10H10N4O7P(-)·4H2O or Na(cIMP)·4H2O, (V). Most of the cyclic nucleotide zwitterions/anions [two from four cAMP present in total in (I) and (II), cGMP in (III), cGMP(-) in (IV) and cIMP(-) in (V)] are syn conformers about the N-glycosidic bond, and this nucleobase arrangement is accompanied by Crib-H...Npur hydrogen bonds (rib = ribose and pur = purine). The base orientation is tuned by the ribose pucker. An analysis of data obtained from the Cambridge Structural Database made in the context of syn-anti conformational preferences has revealed that among the syn conformers of various purine nucleotides, cyclic nucleotides and dinucleotides predominate significantly. The interactions stabilizing the syn conformation have been indicated. The inter-nucleotide contacts in (I)-(V) have been systematized in terms of the chemical groups involved. All five structures display three-dimensional hydrogen-bonded networks.
Czech Academy of Sciences Publication Activity Database
Vaněk, Václav; Buděšínský, Miloš; Rinnová, Markéta; Rosenberg, Ivan
2009-01-01
Roč. 65, č. 4 (2009), s. 862-876 ISSN 0040-4020 R&D Projects: GA ČR GA203/05/0827; GA MŠk(CZ) LC06077; GA MŠk LC512; GA MŠk(CZ) LC06061 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleotide analogues * phosphonates * prolinol derivatives * N- alkylation Subject RIV: CC - Organic Chemistry Impact factor: 3.219, year: 2009
Vyas, Rajan; Zahurancik, Walter J.; Suo, Zucai
2014-01-01
DNA polymerases are known to select against L-nucleotides, the enantiomers of natural D-nucleotides. However, the structural basis for D-stereoselectivity of a DNA polymerase has not been established, although two L-nucleoside analogs, lamivudine and emtricitabine, have been widely used as anti-HIV and anti-hepatitis B drugs. Here, we report ternary crystal structures of human DNA polymerase λ in complex with DNA and L-deoxycytidine 5′-triphosphate, or its analogs (the triphosphates of lamivu...
Varik, Vallo; Oliveira, Sofia Raquel Alves; Hauryliuk, Vasili; Tenson, Tanel
2017-09-08
Here we describe an HPLC-based method to quantify bacterial housekeeping nucleotides and the signaling messengers ppGpp and pppGpp. We have replicated and tested several previously reported HPLC-based approaches and assembled a method that can process 50 samples in three days, thus making kinetically resolved experiments feasible. The method combines cell harvesting by rapid filtration, followed by acid extraction, freeze-drying with chromatographic separation. We use a combination of C18 IPRP-HPLC (GMP unresolved and co-migrating with IMP; GDP and GTP; AMP, ADP and ATP; CTP; UTP) and SAX-HPLC in isocratic mode (ppGpp and pppGpp) with UV detection. The approach is applicable to bacteria without the requirement of metabolic labelling with 32P-labelled radioactive precursors. We applied our method to quantify nucleotide pools in Escherichia coli BW25113 K12-strain both throughout the growth curve and during acute stringent response induced by mupirocin. While ppGpp and pppGpp levels vary drastically (40- and ≥8-fold, respectively) these changes are decoupled from the quotients of the housekeeping pool and guanosine and adenosine housekeeping nucleotides: NTP/NDP/NMP ratio remains stable at 6/1/0.3 during both normal batch culture growth and upon acute amino acid starvation.
Directory of Open Access Journals (Sweden)
Erena A. Edae
2013-07-01
Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.
Directory of Open Access Journals (Sweden)
Voelter-Mahlknecht Susanne
2012-10-01
Full Text Available Abstract Background Vibration-induced white finger disease (VWF, also known as hand-arm vibration syndrome, is a secondary form of Raynaud’s disease, affecting the blood vessels and nerves. So far, little is known about the pathogenesisof the disease. VWF is associated with an episodic reduction in peripheral blood flow. Sirtuin 1, a class III histone deacetylase, has been described to regulate the endothelium dependent vasodilation by targeting endothelial nitric oxide synthase. We assessed Sirt1single nucleotide polymorphisms in patients with VWF to further elucidate the role of sirtuin 1 in the pathogenesis of VWF. Methods Peripheral blood samples were obtained from 74 patients with VWF (male 93.2%, female 6.8%, median age 53 years and from 317 healthy volunteers (gender equally distributed, below 30 years of age. Genomic DNA was extracted from peripheral blood mononuclear cells and screened for potential Sirt1single nucleotide polymorphisms. Four putative genetic polymorphisms out of 113 within the Sirt1 genomic region (NCBI Gene Reference: NM_012238.3 were assessed. Allelic discrimination was performed by TaqMan-polymerasechainreaction-based allele-specific genotyping single nucleotide polymorphism assays. Results Sirt1single nucleotide polymorphism A2191G (Assay C_25611590_10, rs35224060 was identified within Sirt1 exon 9 (amino acid position 731, Ile → Val, with differing allelic frequencies in the VWF population (A/A: 70.5%, A/G: 29.5%, G/G: 0% and the control population (A/A: 99.7%, A/G: 0.3%, G/G: 0.5%, with significance levels of P U test (two-tailed P t-test and Chi-square test with Yates correction (all two-tailed: P Conclusion We identified theSirt1A2191Gsingle nucleotide polymorphism as a diagnostic marker for VWF.
Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K
2014-04-01
Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.
International Nuclear Information System (INIS)
Wei, Shuang
1998-01-01
This research thesis reports the study of the metabolism of nucleotides in human tumour cells. The first part addresses the modifications of nucleotide (more specifically purine) metabolism in relationship with human melanoma cell proliferation and differentiation. The second part addresses the modifications of this metabolism in response to an irradiation in human colon tumour cells. For each part, the author proposes a bibliographic synthesis, and a presentation of studied cells and of methods used to grow cells, and respectively to proliferate and differentiate them or to irradiate them, and then discusses the obtained results [fr
Directory of Open Access Journals (Sweden)
Pengchong Jiang
Full Text Available Nerve injury is accompanied by a liberation of diverse nucleotides, some of which act as 'find/eat-me' signals in mediating neuron-glial interplay. Intercellular Ca2+ wave (ICW communication is the main approach by which glial cells interact and coordinate with each other to execute immune defense. However, the detailed mechanisms on how these nucleotides participate in ICW communication remain largely unclear. In the present work, we employed a mechanical stimulus to an individual BV-2 microglia to simulate localized injury. Remarkable ICW propagation was observed no matter whether calcium was in the environment or not. Apyrase (ATP/ADP-hydrolyzing enzyme, suramin (broad-spectrum P2 receptor antagonist, 2-APB (IP3 receptor blocker and thapsigargin (endoplasmic reticulum calcium pump inhibitor potently inhibited these ICWs, respectively, indicating the dependence of nucleotide signals and P2Y receptors. Then, we detected the involvement of five naturally occurring nucleotides (ATP, ADP, UTP, UDP and UDP-glucose by desensitizing receptors. Results showed that desensitization with ATP and ADP could block ICW propagation in a dose-dependent manner, whereas other nucleotides had little effect. Meanwhile, the expression of P2Y receptors in BV-2 microglia was identified and their contributions were analyzed, from which we suggested P2Y12/13 receptors activation mostly contributed to ICWs. Besides, we estimated that extracellular ATP and ADP concentration sensed by BV-2 microglia was about 0.3 μM during ICWs by analyzing calcium dynamic characteristics. Taken together, these results demonstrated that the nucleotides ATP and ADP were predominant signal transmitters in mechanical stimulation-induced ICW communication through acting on P2Y12/13 receptors in BV-2 microglia.
Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...
Indian Academy of Sciences (India)
2017-03-02
Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...
R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.
Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L
2013-07-01
The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/.
Intramolecular transfer of radiation damage in γ-irradiated nucleotides: 8,5'-cyclonucleotides
International Nuclear Information System (INIS)
Fuciarelli, A.F.; Raleigh, J.A.
1984-01-01
The transfer of radiation damage initiated in the sugar phosphate moiety to a nucleotide base as exemplified by 8,5'-cyclonucleotide formation may be important in double-stranded nucleic acids where the bases are shielded to direct hydroxyl attack. With this in mind the authors have renewed a study of the radiation chemistry of cyclonucleotides including further development of an in situ immunochemical assay for their formation in nucleic acids. 8,5'-cycloadenosine 5'-monophosphate has been prepared by radiation chemical synthesis for this purpose. The authors have discovered that the Erlanger and Bieser technique in which the cyclonucleotide hapten is attached to bovine serum albumin (BSA) through the sugar moiety may not be the best approach for preparing cyclonucleotide-containing immunogens as conformational changes may occur in the cyclonucleotide structure during this procedure. The authors are presently using an alternate approach in which the cyclonucleotide hapten is linked to BSA through the phosphate group of the nucleotide. The authors report on these experiments as well as on the basic radiation chemistry of 8,5'-cyclonucleotides
Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)
International Nuclear Information System (INIS)
Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.
1994-01-01
The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs
Okamura, Kohji; Sakaguchi, Hironari; Sakamoto-Abutani, Rie; Nakanishi, Mahito; Nishimura, Ken; Yamazaki-Inoue, Mayu; Ohtaka, Manami; Periasamy, Vaiyapuri Subbarayan; Alshatwi, Ali Abdullah; Higuchi, Akon; Hanaoka, Kazunori; Nakabayashi, Kazuhiko; Takada, Shuji; Hata, Kenichiro; Toyoda, Masashi; Umezawa, Akihiro
2016-01-01
Disease-specific induced pluripotent stem cells (iPSCs) have been used as a model to analyze pathogenesis of disease. In this study, we generated iPSCs derived from a fibroblastic cell line of xeroderma pigmentosum (XP) group A (XPA-iPSCs), a rare autosomal recessive hereditary disease in which patients develop skin cancer in the areas of skin exposed to sunlight. XPA-iPSCs exhibited hypersensitivity to ultraviolet exposure and accumulation of single-nucleotide substitutions when compared with ataxia telangiectasia-derived iPSCs that were established in a previous study. However, XPA-iPSCs did not show any chromosomal instability in vitro, i.e. intact chromosomes were maintained. The results were mutually compensating for examining two major sources of mutations, nucleotide excision repair deficiency and double-strand break repair deficiency. Like XP patients, XPA-iPSCs accumulated single-nucleotide substitutions that are associated with malignant melanoma, a manifestation of XP. These results indicate that XPA-iPSCs may serve a monitoring tool (analogous to the Ames test but using mammalian cells) to measure single-nucleotide alterations, and may be a good model to clarify pathogenesis of XP. In addition, XPA-iPSCs may allow us to facilitate development of drugs that delay genetic alteration and decrease hypersensitivity to ultraviolet for therapeutic applications. PMID:27197874
Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor
DEFF Research Database (Denmark)
Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin
2013-01-01
We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....
International Nuclear Information System (INIS)
Vornam, Barbara; Arkhipov, Andrey; Finkeldey, Reiner
2012-01-01
In the Chernobyl exclusion zone forest trees have to tolerate and to adapt to ionizing radiation, therefore the molecular basis of their adaptive responses is of the utmost interest. Based on SNP analysis and real time PCR nucleotide diversity and expression profiles of gene fragments of catalase (Cat) and glutathione peroxidase (GPx), which are known as radical scavenging genes, were analysed in the needles of irradiated pine trees of the Chernobyl exclusion zone. In acutely and chronically irradiated trees (50 years old) planted before the accident a higher nucleotide diversity of Cat and more somatic mutations were found compared to their control. Chronically irradiated trees (20 years old) planted after the accident showed a similar nucleotide diversity of Cat compared to their control and in both collectives one somatic mutation was found. The nucleotide diversity of GPx was higher in all analysed trees compared to Cat. No somatic mutation events were found in GPx. For both gene fragments, no association between the received dose in a tree and the nucleotide diversity and mutation events was detected. The expression profiles of Cat and GPx in acutely and chronically and in chronically irradiated trees were similar. Compared to their corresponding control collectives, Cat was up-regulated and GPx slightly down-regulated.
Energy Technology Data Exchange (ETDEWEB)
Zeymer, Cathleen, E-mail: cathleen.zeymer@mpimf-heidelberg.mpg.de; Barends, Thomas R. M.; Werbeck, Nicolas D.; Schlichting, Ilme; Reinstein, Jochen, E-mail: cathleen.zeymer@mpimf-heidelberg.mpg.de [Max Planck Institute for Medical Research, Jahnstrasse 29, 69120 Heidelberg (Germany)
2014-02-01
High-resolution crystal structures together with mutational analysis and transient kinetics experiments were utilized to understand nucleotide sensing and the regulation of the ATPase cycle in an AAA+ molecular motor. ATPases of the AAA+ superfamily are large oligomeric molecular machines that remodel their substrates by converting the energy from ATP hydrolysis into mechanical force. This study focuses on the molecular chaperone ClpB, the bacterial homologue of Hsp104, which reactivates aggregated proteins under cellular stress conditions. Based on high-resolution crystal structures in different nucleotide states, mutational analysis and nucleotide-binding kinetics experiments, the ATPase cycle of the C-terminal nucleotide-binding domain (NBD2), one of the motor subunits of this AAA+ disaggregation machine, is dissected mechanistically. The results provide insights into nucleotide sensing, explaining how the conserved sensor 2 motif contributes to the discrimination between ADP and ATP binding. Furthermore, the role of a conserved active-site arginine (Arg621), which controls binding of the essential Mg{sup 2+} ion, is described. Finally, a hypothesis is presented as to how the ATPase activity is regulated by a conformational switch that involves the essential Walker A lysine. In the proposed model, an unusual side-chain conformation of this highly conserved residue stabilizes a catalytically inactive state, thereby avoiding unnecessary ATP hydrolysis.
International Nuclear Information System (INIS)
Zeymer, Cathleen; Barends, Thomas R. M.; Werbeck, Nicolas D.; Schlichting, Ilme; Reinstein, Jochen
2014-01-01
High-resolution crystal structures together with mutational analysis and transient kinetics experiments were utilized to understand nucleotide sensing and the regulation of the ATPase cycle in an AAA+ molecular motor. ATPases of the AAA+ superfamily are large oligomeric molecular machines that remodel their substrates by converting the energy from ATP hydrolysis into mechanical force. This study focuses on the molecular chaperone ClpB, the bacterial homologue of Hsp104, which reactivates aggregated proteins under cellular stress conditions. Based on high-resolution crystal structures in different nucleotide states, mutational analysis and nucleotide-binding kinetics experiments, the ATPase cycle of the C-terminal nucleotide-binding domain (NBD2), one of the motor subunits of this AAA+ disaggregation machine, is dissected mechanistically. The results provide insights into nucleotide sensing, explaining how the conserved sensor 2 motif contributes to the discrimination between ADP and ATP binding. Furthermore, the role of a conserved active-site arginine (Arg621), which controls binding of the essential Mg 2+ ion, is described. Finally, a hypothesis is presented as to how the ATPase activity is regulated by a conformational switch that involves the essential Walker A lysine. In the proposed model, an unusual side-chain conformation of this highly conserved residue stabilizes a catalytically inactive state, thereby avoiding unnecessary ATP hydrolysis
Energy Technology Data Exchange (ETDEWEB)
Shimada, Hiroyuki; Fukao, Taishi; Minami, Hirotake; Ukai, Masatoshi [Department of Applied Physics, Tokyo University of Agriculture and Technology, Koganei-shi, Tokyo 184-8588 (Japan); Fujii, Kentaro; Yokoya, Akinari [Advanced Science Research Center, Japan Atomic Energy Agency, Tokai-mura, Naka-gun, Ibaraki 319-1195 (Japan); Fukuda, Yoshihiro; Saitoh, Yuji [Synchrotron Radiation Research Center, Japan Atomic Energy Agency, Sayo-gun, Hyougo 679-5148 (Japan)
2014-08-07
The N K-edge X-ray absorption near edge structure (XANES) spectra of the purine-containing nucleotide, guanosine 5{sup ′}-monophosphate (GMP), in aqueous solution are measured under various pH conditions. The spectra show characteristic peaks, which originate from resonant excitations of N 1s electrons to π* orbitals inside the guanine moiety of GMP. The relative intensities of these peaks depend on the pH values of the solution. The pH dependence is explained by the core-level shift of N atoms at specific sites caused by protonation and deprotonation. The experimental spectra are compared with theoretical spectra calculated by using density functional theory for GMP and the other purine-containing nucleotides, adenosine 5{sup ′}-monophosphate, and adenosine 5{sup ′}-triphosphate. The N K-edge XANES spectra for all of these nucleotides are classified by the numbers of N atoms with particular chemical bonding characteristics in the purine moiety.
Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1
Energy Technology Data Exchange (ETDEWEB)
Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G
1988-03-25
Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.
Wu, Lei; He, Yao; Zhang, Di
2015-11-01
To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.
Energy Technology Data Exchange (ETDEWEB)
Weiler, Monica [Department of Medicine III and Transfusion Medicine, University Hospital Grosshadern, Ludwig-Maximilians-University, Munich (Germany); Schmetzer, Helga [Helmholtz Center Munich (Germany); German Research Center for Environmental Health, Munich (Germany); Braeu, Marion; Buhmann, Raymund [Helmholtz Center Munich (Germany); German Research Center for Environmental Health, Munich (Germany); Department of Medicine III and Transfusion Medicine, University Hospital Grosshadern, Ludwig-Maximilians-University, Munich (Germany)
2016-11-15
The release of nucleic acids and derivatives after tissue-injury may affect cellular immune-response. We studied the impact of extracellular ribo-, desoxyribonucleotides and nucleosides on T-cell immunity. Peripheral-blood-mononuclear-cells (PBMCs) or isolated CD3{sup +}T-cells obtained from 6 healthy donors were stimulated via CD3/CD28 Dynabeads or dendritic cells (DCs) in the presence or absence of pyrimidine-, purine-nucleotides and -nucleosides (range 2–200 µM). Addition of deoxy-, guanosine-triphosphate (dGTP, GTP) and guanosine resulted concentration dependent in a complete, adenosine-triphosphate (ATP) in a partial inhibition of the induced T-cell-proliferation. Deoxyadenosine-triphosphate (dATP), adenosine and the pyrimidine-ribo- and -deoxyribonucleotides displayed no inhibitory capacity. Inhibitory effects of dGTP and GTP, but not of guanosine and ATP were culture-media-dependent and could be almost abrogated by use of the serum-free lymphocyte-culture-media X-Vivo15 instead of RPMI1640 with standard-supplementation. In contrast to RPMI1640, X-Vivo15 resulted in a significant down-regulation of the cell-surface-located ectonucleotidases CD39 (Ecto-Apyrase) and CD73 (Ecto-5′-Nucleotidase), critical for the extracellular nucleotides-hydrolysis to nucleosides, explaining the loss of inhibition mediated by dGTP and GTP, but not Guanosine. In line with previous findings ATP was found to exert immunosuppressive effects on T-cell-proliferation. Purine-nucleotides, dGTP and GTP displayed a higher inhibitory capacity, but seem to be strictly dependent on the microenvironmental conditions modulating the responsiveness of the respective T-lymphocytes. Further evaluation of experimental and respective clinical settings should anticipate these findings.
International Nuclear Information System (INIS)
Weiler, Monica; Schmetzer, Helga; Braeu, Marion; Buhmann, Raymund
2016-01-01
The release of nucleic acids and derivatives after tissue-injury may affect cellular immune-response. We studied the impact of extracellular ribo-, desoxyribonucleotides and nucleosides on T-cell immunity. Peripheral-blood-mononuclear-cells (PBMCs) or isolated CD3 + T-cells obtained from 6 healthy donors were stimulated via CD3/CD28 Dynabeads or dendritic cells (DCs) in the presence or absence of pyrimidine-, purine-nucleotides and -nucleosides (range 2–200 µM). Addition of deoxy-, guanosine-triphosphate (dGTP, GTP) and guanosine resulted concentration dependent in a complete, adenosine-triphosphate (ATP) in a partial inhibition of the induced T-cell-proliferation. Deoxyadenosine-triphosphate (dATP), adenosine and the pyrimidine-ribo- and -deoxyribonucleotides displayed no inhibitory capacity. Inhibitory effects of dGTP and GTP, but not of guanosine and ATP were culture-media-dependent and could be almost abrogated by use of the serum-free lymphocyte-culture-media X-Vivo15 instead of RPMI1640 with standard-supplementation. In contrast to RPMI1640, X-Vivo15 resulted in a significant down-regulation of the cell-surface-located ectonucleotidases CD39 (Ecto-Apyrase) and CD73 (Ecto-5′-Nucleotidase), critical for the extracellular nucleotides-hydrolysis to nucleosides, explaining the loss of inhibition mediated by dGTP and GTP, but not Guanosine. In line with previous findings ATP was found to exert immunosuppressive effects on T-cell-proliferation. Purine-nucleotides, dGTP and GTP displayed a higher inhibitory capacity, but seem to be strictly dependent on the microenvironmental conditions modulating the responsiveness of the respective T-lymphocytes. Further evaluation of experimental and respective clinical settings should anticipate these findings.
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-11-11
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).
Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator.
Fenati, Renzo A; Connolly, Ashley R; Ellis, Amanda V
2017-02-15
Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded-DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP-Cytosine > TPP-Thymine > TPP-Adenine ≥ TPP-Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80-90% quenching), compared to 25-30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. Copyright © 2016 Elsevier B.V. All rights reserved.
Ewing's sarcoma: analysis of single nucleotide polymorphism in the EWS gene.
Silva, Deborah S B S; Sawitzki, Fernanda R; De Toni, Elisa C; Graebin, Pietra; Picanco, Juliane B; Abujamra, Ana Lucia; de Farias, Caroline B; Roesler, Rafael; Brunetto, Algemir L; Alho, Clarice S
2012-11-10
We aimed to investigate single nucleotide polymorphisms (SNPs) in the EWS gene breaking region in order to analyze Ewing's sarcoma susceptibility. The SNPs were investigated in a healthy subject population and in Ewing's sarcoma patients from Southern Brazil. Genotyping was performed by TaqMan® assay for allelic discrimination using Real-Time PCR. The analysis of incidence of SNPs or different SNP-arrangements revealed a higher presence of homozygote TT-rs4820804 in Ewing's sarcoma patients (p=0.02; Chi Square Test). About 300 bp from the rs4820804 SNP lies a palindromic hexamer (5'-GCTAGC-3') and three nucleotides (GTC), which were previously identified to be in close vicinity of the breakpoint junction in both EWS and FLI1 genes. This DNA segment surrounding the rs4820804 SNP is likely to indicate a breakpoint region. If the T-rs4820804 allele predisposes a DNA fragment to breakage, homozygotes (TT-rs4820804) would have double the chance of having a chromosome break, increasing the chances for a translocation to occur. In conclusion, the TT-rs4820804 EWS genotype can be associated with Ewing's sarcoma and the SNP rs4820804 can be a candidate marker to understand Ewing's sarcoma susceptibility. Copyright © 2012 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Attree EA
2006-06-01
Full Text Available Abstract Background Dietary nucleotide supplementation has been shown to have important effects on the growth and development of cells which have a rapid turnover such as those in the immune system and the gastrointestinal tract. Work with infants has shown that the incidence and duration of diarrhoea is lower when nucleotide supplementation is given, and animal work shows that villi height and crypt depth in the intestine is increased as a result of dietary nucleotides. Dietary nucleotides may be semi-essential under conditions of ill-health, poor diet or stress. Since people with Irritable Bowel Syndrome tend to fulfil these conditions, we tested the hypothesis that symptoms would be improved with dietary nucleotide supplementation. Methods Thirty-seven people with a diagnosis of Irritable Bowel gave daily symptom severity ratings for abdominal pain, diarrhoea, urgency to have a bowel movement, incomplete feeling of evacuation after a bowel movement, bloating, flatulence and constipation for 28 days (baseline. They were then assigned to either placebo (56 days followed by experimental (56 days or the reverse. There was a four week washout period before crossover. During the placebo and experimental conditions participants took one 500 mg capsule three times a day; in the experimental condition the capsule contained the nutroceutical substances. Symptom severity ratings and psychological measures (anxiety, depression, illness intrusiveness and general health were obtained and analysed by repeated measures ANOVAs. Results Symptom severity for all symptoms (except constipation were in the expected direction of baseline>placebo>experimental condition. Symptom improvement was in the range 4 – 6%. A feeling of incomplete evacuation and abdominal pain showed the most improvement. The differences between conditions for diarrhoea, bloating and flatulence were not significant at the p Conclusion Dietary nucleotide supplementation improves some of the
Lack of nucleotide variability in a beetle pest with extreme inbreeding
Andreev, D.; Breilid, H.; Kirkendall, L.; Brun, Luc-Olivier; French-Constant, R.H.
1998-01-01
The coffee berry borer beetle #Hypothenemus hampei$ (Ferrari) (#Curculionidae$ : #Scolytinae$) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an usual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occuring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation i...
NU-IN: Nucleotide evolution and input module for the EvolSimulator genome simulation platform
Directory of Open Access Journals (Sweden)
Barker Michael S
2010-08-01
Full Text Available Abstract Background There is increasing demand to test hypotheses that contrast the evolution of genes and gene families among genomes, using simulations that work across these levels of organization. The EvolSimulator program was developed recently to provide a highly flexible platform for forward simulations of amino acid evolution in multiple related lineages of haploid genomes, permitting copy number variation and lateral gene transfer. Synonymous nucleotide evolution is not currently supported, however, and would be highly advantageous for comparisons to full genome, transcriptome, and single nucleotide polymorphism (SNP datasets. In addition, EvolSimulator creates new genomes for each simulation, and does not allow the input of user-specified sequences and gene family information, limiting the incorporation of further biological realism and/or user manipulations of the data. Findings We present modified C++ source code for the EvolSimulator platform, which we provide as the extension module NU-IN. With NU-IN, synonymous and non-synonymous nucleotide evolution is fully implemented, and the user has the ability to use real or previously-simulated sequence data to initiate a simulation of one or more lineages. Gene family membership can be optionally specified, as well as gene retention probabilities that model biased gene retention. We provide PERL scripts to assist the user in deriving this information from previous simulations. We demonstrate the features of NU-IN by simulating genome duplication (polyploidy in the presence of ongoing copy number variation in an evolving lineage. This example is initiated with real genomic data, and produces output that we analyse directly with existing bioinformatic pipelines. Conclusions The NU-IN extension module is a publicly available open source software (GNU GPLv3 license extension to EvolSimulator. With the NU-IN module, users are now able to simulate both drift and selection at the nucleotide
Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates
International Nuclear Information System (INIS)
Kincaid, R.L.; Manganiello, V.C.
1988-01-01
There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter
Effect of ionizing radiation on calcium and cyclic nucleotides metabolism in rats of different age
International Nuclear Information System (INIS)
Efimova, N.I.; Libenson, S.V.
1982-01-01
Some features of mechanism of calcium homeostasis and cyclic nucleotide exchange breakage in case of acute radiation injury of rats of various age were studied. It is established that calcium level in blood in nonpuberal animals, calcium and cAMP excretion with urine are minimal and reach maximum at puberal age. cGMP excretion with urine and concentrational levels of cAMP and cGMP in blood do not change with age. It is shown that calcium excretion with urine decreases adaptively in conditions of acute radiation injury in rats of all age groups. Maximal shifts in cAMP/cGMP ratio were noted in nonpuberal animals, whereas maximal adaptive-compensatory abilities in the regulation system of calcium homeostasis and cyclic nucleotides are typical to adolescent puberal animals
NMR studies of the fate of adenine nucleotides in glucose-starved erythrocytes
International Nuclear Information System (INIS)
Bubb, W.A.; Mulquiney, P.J.; Kuchel, P.W.; Rohwer, J.; De Atauri, P.
2002-01-01
Full text: As a consequence of many refinements during the past 30 years, we now have a detailed understanding of the glycolytic pathway in human erythrocytes. By comparison, and notwithstanding their central importance to four key steps in erythrocyte glycolysis, our knowledge of the catabolism of adenine nucleotides remains relatively limited. In particular, the mechanism for the degradation of AMP, whose concentration rises under conditions of oxidative stress or glucose deprivation, remains poorly understood, AMP degradation may proceed via two possible pathways which converge in the production of inosine. Analysis of the key intermediates for the respective pathways, adenosine and AMP, as well as determination of end products is not straightforward. High-resolution NMR spectroscopy affords a potentially simple analytical solution to this problem but is complicated by spectral overlap and the sensitivity of key resonances to variations in pH and the concentrations of cations such as Mg 2+ . We describe a multinuclear NMR approach towards characterising the intermediates and end-products of adenine nucleotide metabolism in glucose-starved human erythrocytes. Assignments based on homo- and heteronuclear correlation experiments for both 13 C and 31 P are presented
In silico screening for inhibitors of p-glycoprotein that target the nucleotide binding domains.
Brewer, Frances K; Follit, Courtney A; Vogel, Pia D; Wise, John G
2014-12-01
Multidrug resistances and the failure of chemotherapies are often caused by the expression or overexpression of ATP-binding cassette transporter proteins such as the multidrug resistance protein, P-glycoprotein (P-gp). P-gp is expressed in the plasma membrane of many cell types and protects cells from accumulation of toxins. P-gp uses ATP hydrolysis to catalyze the transport of a broad range of mostly hydrophobic compounds across the plasma membrane and out of the cell. During cancer chemotherapy, the administration of therapeutics often selects for cells which overexpress P-gp, thereby creating populations of cancer cells resistant to a variety of chemically unrelated chemotherapeutics. The present study describes extremely high-throughput, massively parallel in silico ligand docking studies aimed at identifying reversible inhibitors of ATP hydrolysis that target the nucleotide-binding domains of P-gp. We used a structural model of human P-gp that we obtained from molecular dynamics experiments as the protein target for ligand docking. We employed a novel approach of subtractive docking experiments that identified ligands that bound predominantly to the nucleotide-binding domains but not the drug-binding domains of P-gp. Four compounds were found that inhibit ATP hydrolysis by P-gp. Using electron spin resonance spectroscopy, we showed that at least three of these compounds affected nucleotide binding to the transporter. These studies represent a successful proof of principle demonstrating the potential of targeted approaches for identifying specific inhibitors of P-gp. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.
Directory of Open Access Journals (Sweden)
Boulund Fredrik
2012-12-01
Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.
International Nuclear Information System (INIS)
Valle, C.; Marquer, C.; Pasquier, C.
Changes of brain energetic state and of different levels after irradiation are studied. The results will be compared with the variations of brain electric activity due to irradiation. Using an ion exchange chromatographic method for separation and quantitative analysis of nucleotides, evaluation of adenylic nucleotides in brain rat have been chosen [fr
Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta
Energy Technology Data Exchange (ETDEWEB)
Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))
1988-09-26
The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.
The nucleotide sequence of human transition protein 1 cDNA
Energy Technology Data Exchange (ETDEWEB)
Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)
1988-08-11
The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.
Directory of Open Access Journals (Sweden)
Henky Manoppo
2011-01-01
Full Text Available This research evaluated the nonspecific immune responsse, resistance, and growth of Litopenaeus vannamei fed nucleotide diet. Shrimp juveniles (mean weight 5.39±0.56 g were reared in two groups of glass aquaria, each with three replications. Shrimps in group one and group two were fed nucleotide diet and basal diet each for four weeks. Total haemocyte count (THC and PO activity were evaluated at the end of feeding while growth was measured at two weeks interval. At the end of feeding trial, the shrimps were intramuscularly injected with Vibrio harveyi 0.1x106 cfu.shrimp-1. THC of shrimp fed nucleotide diet significantly increased (P-1 diet showed positive effect on the enhancement of nonspecific immune responsse, resistance, and growth of L. vannamei. Key words: Litopenaeus vannamei, nucleotide, THC, PO activity, resistance ABSTRAK Penelitian bertujuan untuk mengevaluasi respons imun non-spesifik dan resistensi udang vaname (Litopenaeus vannamei yang diberi pakan nukleotida. Juvenil (5,39±0,56 g dipelihara dalam dua kelompok akuarium kaca masing-masing dengan 3 ulangan. Udang dalam dalam kelompok pertama diberi pakan nukleotida sedangkan udang dalam kelompok kedua diberi pakan standar selama 4 minggu. Total haemocyte count (THC dan aktivitas phenoloxidase (PO diukur pada akhir pemberian pakan sedangkan pertumbuhan udang diukur setiap dua minggu. Pada akhir periode pemberian pakan perlakuan, udang diuji tantang secara injeksi intramuskular dengan bakteri Vibrio harveyi 0,1x106 cfu.udang-1. THC udang yang diberi pakan nukleotida meningkat secara signifikan (P-1 pakan selama 4 minggu memberi pengaruh positif terhadap peningkatan respons imun non-spesifik, resistensi dan pertumbuhan udang vaname. Kata kunci: Litopenaeus vannamei, nukleotida, THC, aktivitas PO, resistensi
Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian
Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.
Matthes, G; Strunk, S; Siems, W; Grune, T
1993-06-01
Posttransfusional changes of preserved red blood cells can influence the oxygen equilibrium curve which is mainly affected by the concentration of erythrocyte 2,3-diphosphoglycerate (DPG). The regeneration kinetics of DPG and nucleotides (ATP, ADP, AMP, GTP, GDP) was determined over a period of 0-48 h in surgically treated patients following transfusion of DPG-depleted packed red cells stored for 14 days in CPD-SAGM. 3 h after transfusion the DPG levels raised up to 40% of the patients' prior DPG concentrations. Complete regeneration of the DPG concentrations occurred 36-48 h after transfusion. Changes in the nucleotide pattern indicate, after a temporary decrease of ATP and GTP levels (after 10-30 min) and an activation phase (after 3-12 h), the full regeneration of these parameters 24-48 h after transfusion. The regeneration kinetics of DPG should be taken into consideration for transfusions with blood units stored for more than 14 days, especially in patients with reduced compensatory mechanisms (coronary and cerebral scleroses, pacemaker, etc.) and large transfusion volumes.
Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai
2011-01-01
Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702
The nucleotide-binding domain of NLRC5 is critical for nuclear import and transactivation activity
International Nuclear Information System (INIS)
Meissner, Torsten B.; Li, Amy; Liu, Yuen-Joyce; Gagnon, Etienne; Kobayashi, Koichi S.
2012-01-01
Highlights: ► NLRC5 requires an intact NLS for its function as MHC class I transactivator. ► Nuclear presence of NLRC5 is required for MHC class I induction. ► Nucleotide-binding controls nuclear import and transactivation activity of NLRC5. -- Abstract: Major histocompatibility complex (MHC) class I and class II are crucial for the function of the human adaptive immune system. A member of the NLR (nucleotide-binding domain, leucine-rich repeat) protein family, NLRC5, has recently been identified as a transcriptional regulator of MHC class I and related genes. While a ‘master regulator’ of MHC class II genes, CIITA, has long been known, NLRC5 specifically associates with and transactivates the proximal promoters of MHC class I genes. In this study, we analyzed the molecular requirements of NLRC5 nuclear import and transactivation activity. We show that NLRC5-mediated MHC class I gene induction requires an intact nuclear localization signal and nuclear distribution of NLRC5. In addition, we find that the nucleotide-binding domain (NBD) of NLRC5 is critical not only for nuclear translocation but also for the transactivation of MHC class I genes. Changing the cellular localization of NLRC5 is likely to immediately impact MHC class I expression as well as MHC class I-mediated antigen presentation. NLRC5 may thus provide a promising target for the modulation of MHC class I antigen presentation, especially in the setting of transplant medicine.
Directory of Open Access Journals (Sweden)
Carlos Y Valenzuela
2010-01-01
Full Text Available Analysis for the homogeneity of the distribution of the second base of dinucleotides in relation to the first, whose bases are separated by 0, 1, 2,... 21 nucleotide sites, was performed with the VIH-1 genome (cDNA, the Drosophila mtDNA, the Drosophila Torso gene and the human p-globin gene. These four DNA segments showed highly significant heterogeneities of base distributions that cannot be accounted for by neutral or nearly neutral evolution or by the "neighbor influence" of nucleotides on mutation rates. High correlations are found in the bases of dinucleotides separated by 0, 1 and more number of sites. A periodicity of three consecutive significance values (measured by the x²9 was found only in Drosophila mtDNA. This periodicity may be due to an unknown structure or organization of mtDNA. This non-random distribution of the two bases of dinucleotides widespread throughout these DNA segments is rather compatible with panselective evolution and generalized internucleotide co-adaptation.
Effects of preservation methods on amino acids and 5'-nucleotides of Agaricus bisporus mushrooms.
Liu, Ying; Huang, Fan; Yang, Hong; Ibrahim, S A; Wang, Yan-Feng; Huang, Wen
2014-04-15
In this study, the proximate composition, free amino acids content and 5'-nucleotides in frozen, canned and salted Agaricus bisporus (A. bisporus) were investigated. We found that the three kinds of A. bisporus products were good sources of protein, with amount varying in the ranges of 16.54-24.35g/100g (dry weight). Freezing, canning and salting process, followed by 6months of storage led to a significant reduction in free amino acids, especially tyrosine, alanine, glutamine and cysteine. There were medium levels of MSG-like amino acids in frozen A. bisporus and canned A. bisporus, and low levels of MSG-like amino acids in salted A. bisporus. The mount of flavor 5'-nucleotides in frozen A. bisporus was higher than that of canned and salted A. bisporus. The present study thus suggests that freezing is beneficial for the preservation of A. bisporus. Copyright © 2013 Elsevier Ltd. All rights reserved.
A generalized allosteric mechanism for cis-regulated cyclic nucleotide binding domains.
Directory of Open Access Journals (Sweden)
Alexandr P Kornev
2008-04-01
Full Text Available Cyclic nucleotides (cAMP and cGMP regulate multiple intracellular processes and are thus of a great general interest for molecular and structural biologists. To study the allosteric mechanism of different cyclic nucleotide binding (CNB domains, we compared cAMP-bound and cAMP-free structures (PKA, Epac, and two ionic channels using a new bioinformatics method: local spatial pattern alignment. Our analysis highlights four major conserved structural motifs: 1 the phosphate binding cassette (PBC, which binds the cAMP ribose-phosphate, 2 the "hinge," a flexible helix, which contacts the PBC, 3 the beta(2,3 loop, which provides precise positioning of an invariant arginine from the PBC, and 4 a conserved structural element consisting of an N-terminal helix, an eight residue loop and the A-helix (N3A-motif. The PBC and the hinge were included in the previously reported allosteric model, whereas the definition of the beta(2,3 loop and the N3A-motif as conserved elements is novel. The N3A-motif is found in all cis-regulated CNB domains, and we present a model for an allosteric mechanism in these domains. Catabolite gene activator protein (CAP represents a trans-regulated CNB domain family: it does not contain the N3A-motif, and its long range allosteric interactions are substantially different from the cis-regulated CNB domains.
Computational learning on specificity-determining residue-nucleotide interactions
Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Moses, Alan M.; Zhang, Zhaolei
2015-01-01
The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.
Computational learning on specificity-determining residue-nucleotide interactions
Wong, Ka-Chun
2015-11-02
The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.
Czech Academy of Sciences Publication Activity Database
Kubelka, Tomáš; Slavětínská, Lenka; Hocek, Michal
-, č. 26 (2012), s. 4969-4981 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344; GA AV ČR IAA400550902 Institutional support: RVO:61388963 Keywords : C-nucleosides * homonucleosides * cross - coupling * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.344, year: 2012
High pressure {sup 31}P NMR spectroscopy on guanine nucleotides
Energy Technology Data Exchange (ETDEWEB)
Spoerner, Michael; Karl, Matthias; Lopes, Pedro; Hoering, Marcus; Loeffel, Karoline; Nuehs, Andrea; Adelsberger, Joseph; Kremer, Werner; Kalbitzer, Hans Robert, E-mail: hans-robert.kalbitzer@ur.de [University of Regensburg, Centre of Magnetic Resonance in Chemistry and Biomedicine, Institute of Biophysics and Physical Biochemistry (Germany)
2017-01-15
The {sup 31}P NMR pressure response of guanine nucleotides bound to proteins has been studied in the past for characterizing the pressure perturbation of conformational equilibria. The pressure response of the {sup 31}P NMR chemical shifts of the phosphate groups of GMP, GDP, and GTP as well as the commonly used GTP analogs GppNHp, GppCH{sub 2}p and GTPγS was measured in the absence and presence of Mg{sup 2+}-ions within a pressure range up to 200 MPa. The pressure dependence of chemical shifts is clearly non-linear. For all nucleotides a negative first order pressure coefficient B{sub 1} was determined indicating an upfield shift of the resonances with pressure. With exception of the α-phosphate group of Mg{sup 2+}·GMP and Mg{sup 2+}·GppNHp the second order pressure coefficients are positive. To describe the data of Mg{sup 2+}·GppCH{sub 2}p and GTPγS a Taylor expansion of 3rd order is required. For distinguishing pH effects from pressure effects a complete pH titration set is presented for GMP, as well as GDP and GTP in absence and presence of Mg{sup 2+} ions using indirect referencing to DSS under identical experimental conditions. By a comparison between high pressure {sup 31}P NMR data on free Mg{sup 2+}-GDP and Mg{sup 2+}-GDP in complex with the proto-oncogene Ras we demonstrate that pressure induced changes in chemical shift are clearly different between both forms.
Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O
2004-01-01
Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
International Nuclear Information System (INIS)
Chatterjee, Anindita; Priyam, Amiya; Bhattacharya, Subhash C.; Saha, Abhijit
2007-01-01
The interaction of DNA bases and corresponding nucleotides with CdS nanoparticles (NPs), biofunctionalized by cysteine, has been investigated by absorption and fluorescence spectroscopy. Unique enhancement effect of adenine, in contrast to other nucleobases, on the luminescence of cysteine capped CdS (cys-CdS) NPs at both pH 7.5 and 10.5 was found, the extent of enhancement being much higher at pH 10.5. At the latter pH, the difference optical absorption spectra show development of new peak at 278 nm with corresponding decrease in the absorption of adenine at 260 nm, which is attributed to binding of adenine anion to the CdS surface through N7 of the purine ring. Appearance of a new band at 478 cm -1 and concomitant shift in the C 8 -N 7 vibrations to 1610 cm -1 in the FTIR spectra of cys-CdS NPs with adenine also suggest Cd-N7 binding on the particle surface. Amongst various nucleotides, ATP exhibited maximum luminescence enhancement on CdS NPs for a given change in concentration in the micro-molar range at physiological pH. A quantitative correlation between ATP concentration and PL enhancement of CdS NPs has been established, a step which in future might assist in developing new protocols for fluorescence sensing of adenine nucleotides under certain pathological conditions
Woyda-Ploszczyca, Andrzej M; Jarmuszkiewicz, Wieslawa
2014-01-01
In this study, we compared the influence of GDP and GTP on isolated mitochondria respiring under conditions favoring oxidative phosphorylation (OXPHOS) and under conditions excluding this process, i.e., in the presence of carboxyatractyloside, an adenine nucleotide translocase inhibitor, and/or oligomycin, an FOF1-ATP synthase inhibitor. Using mitochondria isolated from rat kidney and human endothelial cells, we found that the action of GDP and GTP can differ diametrically depending on the conditions. Namely, under conditions favoring OXPHOS, both in the absence and presence of linoleic acid, an activator of uncoupling proteins (UCPs), the addition of 1 mM GDP resulted in the state 4 (non-phosphorylating respiration)-state 3 (phosphorylating respiration) transition, which is characteristic of ADP oxidative phosphorylation. In contrast, the addition of 1 mM GTP resulted in a decrease in the respiratory rate and an increase in the membrane potential, which is characteristic of UCP inhibition. The stimulatory effect of GDP, but not GTP, was also observed in inside-out submitochondrial particles prepared from rat kidney mitochondria. However, the effects of GDP and GTP were more similar in the presence of OXPHOS inhibitors. The importance of these observations in connection with the action of UCPs, adenine nucleotide translocase (or other carboxyatractyloside-sensitive carriers), carboxyatractyloside- and purine nucleotide-insensitive carriers, as well as nucleoside-diphosphate kinase (NDPK) are considered. Because the measurements favoring oxidative phosphorylation better reflect in vivo conditions, our study strongly supports the idea that GDP cannot be considered a significant physiological inhibitor of UCP. Moreover, it appears that, under native conditions, GTP functions as a more efficient UCP inhibitor than GDP and ATP.
Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G
2011-04-01
A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.
DEFF Research Database (Denmark)
Gromadski, Kirill B; Schümmer, Tobias; Strømgaard, Anne
2007-01-01
of guanine nucleotides. At the concentrations of nucleotides and factors prevailing in the cell, the overall exchange rate is expected to be in the range of 6 s(-1), which is compatible with the rate of protein synthesis in the cell. eEF1A.GTP binds Phe-tRNA(Phe) with a K(d) of 3 nm, whereas eEF1A.GDP shows...... no significant binding, indicating that eEF1A has similar tRNA binding properties as its prokaryotic homolog, EF-Tu. Udgivelsesdato: 2007-Dec-7...
Predicting protein-binding RNA nucleotides with consideration of binding partners.
Tuvshinjargal, Narankhuu; Lee, Wook; Park, Byungkyu; Han, Kyungsook
2015-06-01
In recent years several computational methods have been developed to predict RNA-binding sites in protein. Most of these methods do not consider interacting partners of a protein, so they predict the same RNA-binding sites for a given protein sequence even if the protein binds to different RNAs. Unlike the problem of predicting RNA-binding sites in protein, the problem of predicting protein-binding sites in RNA has received little attention mainly because it is much more difficult and shows a lower accuracy on average. In our previous study, we developed a method that predicts protein-binding nucleotides from an RNA sequence. In an effort to improve the prediction accuracy and usefulness of the previous method, we developed a new method that uses both RNA and protein sequence data. In this study, we identified effective features of RNA and protein molecules and developed a new support vector machine (SVM) model to predict protein-binding nucleotides from RNA and protein sequence data. The new model that used both protein and RNA sequence data achieved a sensitivity of 86.5%, a specificity of 86.2%, a positive predictive value (PPV) of 72.6%, a negative predictive value (NPV) of 93.8% and Matthews correlation coefficient (MCC) of 0.69 in a 10-fold cross validation; it achieved a sensitivity of 58.8%, a specificity of 87.4%, a PPV of 65.1%, a NPV of 84.2% and MCC of 0.48 in independent testing. For comparative purpose, we built another prediction model that used RNA sequence data alone and ran it on the same dataset. In a 10 fold-cross validation it achieved a sensitivity of 85.7%, a specificity of 80.5%, a PPV of 67.7%, a NPV of 92.2% and MCC of 0.63; in independent testing it achieved a sensitivity of 67.7%, a specificity of 78.8%, a PPV of 57.6%, a NPV of 85.2% and MCC of 0.45. In both cross-validations and independent testing, the new model that used both RNA and protein sequences showed a better performance than the model that used RNA sequence data alone in
Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1
Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef
The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for
International Nuclear Information System (INIS)
Siebert, P.D.; Fukuda, M.
1987-01-01
The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes
Dynamic interaction of TTDA with TFIIH is stabilized by nucleotide excision repair in living cells.
G. Giglia-Mari (Giuseppina); C. Miquel (Catherine); A.F. Theil (Arjan); P.O. Mari (Pierre-Olivier); D. Hoogstraten (Deborah); J.M.Y. Ng (Jessica); C. Dinant (Christoffel); J.H.J. Hoeijmakers (Jan); W. Vermeulen (Wim)
2006-01-01
textabstractTranscription/repair factor IIH (TFIIH) is essential for RNA polymerase II transcription and nucleotide excision repair (NER). This multi-subunit complex consists of ten polypeptides, including the recently identified small 8-kDa trichothiodystrophy group A (TTDA)/ hTFB5 protein.
Directory of Open Access Journals (Sweden)
Yu-Hoon Kim
2014-01-01
Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.
Directory of Open Access Journals (Sweden)
Samantha J Hyde
Full Text Available All nucleotide polymerases and transferases catalyze nucleotide addition in a 5' to 3' direction. In contrast, tRNA(His guanylyltransferase (Thg1 enzymes catalyze the unusual reverse addition (3' to 5' of nucleotides to polynucleotide substrates. In eukaryotes, Thg1 enzymes use the 3'-5' addition activity to add G-1 to the 5'-end of tRNA(His, a modification required for efficient aminoacylation of the tRNA by the histidyl-tRNA synthetase. Thg1-like proteins (TLPs are found in Archaea, Bacteria, and mitochondria and are biochemically distinct from their eukaryotic Thg1 counterparts TLPs catalyze 5'-end repair of truncated tRNAs and act on a broad range of tRNA substrates instead of exhibiting strict specificity for tRNA(His. Taken together, these data suggest that TLPs function in distinct biological pathways from the tRNA(His maturation pathway, perhaps in tRNA quality control. Here we present the first crystal structure of a TLP, from the gram-positive soil bacterium Bacillus thuringiensis (BtTLP. The enzyme is a tetramer like human THG1, with which it shares substantial structural similarity. Catalysis of the 3'-5' reaction with 5'-monophosphorylated tRNA necessitates first an activation step, generating a 5'-adenylylated intermediate prior to a second nucleotidyl transfer step, in which a nucleotide is transferred to the tRNA 5'-end. Consistent with earlier characterization of human THG1, we observed distinct binding sites for the nucleotides involved in these two steps of activation and nucleotidyl transfer. A BtTLP complex with GTP reveals new interactions with the GTP nucleotide in the activation site that were not evident from the previously solved structure. Moreover, the BtTLP-ATP structure allows direct observation of ATP in the activation site for the first time. The BtTLP structural data, combined with kinetic analysis of selected variants, provide new insight into the role of key residues in the activation step.
DEFF Research Database (Denmark)
Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L
2012-01-01
We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....
Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth
2011-01-01
We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP
Czech Academy of Sciences Publication Activity Database
Dračínský, Martin; Pohl, Radek
2015-01-01
Roč. 28, č. 2 (2015), s. 155-165 ISSN 0893-228X R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acids * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.025, year: 2015
The effect of ultraviolet light on the cyclic nucleotide system of human fibroblasts
International Nuclear Information System (INIS)
Fertel, R.H.; Tejwani, G.A.; Albrightson, C.R.; Hart, R.W.
1981-01-01
The concentrations of cyclic AMP and cyclic GMP in in human skin fibroblasts in culture were determined after exposing the cells to varying fluences of UV (254 nm) light. The cyclic nucleotide concentrations of cells irradiated in the log phase of growth were unchanged relative to controls. In contrast, there was a rise in the concentration of cyclic AMP in cells irradiated after they reached confluency. The increase in concentration was observed as early as 30 min after irradiation, reached a maximum of about 200% of control at 4 to 6 h after exposure, and returned to control values by 24 h after irradiation. The effect was proportional to a UV fluence from 5 to 20 J/m 2 , and was blocked by the addition of the UV absorbing agent para-aminobenzoic acid. In contrast, the results indicated that UV light had no effect on the concentration of cyclic GMP in human fibroblast cell cultures. Because of the importance of cyclic nucleotides in the regulation of cellular function, it is reasonable to hypothesize that changes in cyclic AMP induced by UV light may effect the extranuclear functions of irradiated cells. (author)
Kinetic Basis of Nucleotide Selection Employed by a Protein Template-Dependent DNA Polymerase†
Brown, Jessica A.; Fowler, Jason D.; Suo, Zucai
2010-01-01
Rev1, a Y-family DNA polymerase, contributes to spontaneous and DNA damage-induced mutagenic events. In this paper, we have employed pre-steady state kinetic methodology to establish a kinetic basis for nucleotide selection by human Rev1, a unique nucleotidyl transferase that uses a protein template-directed mechanism to preferentially instruct dCTP incorporation. This work demonstrated that the high incorporation efficiency of dCTP is dependent on both substrates: an incoming dCTP and a templating base dG. The extremely low base substitution fidelity of human Rev1 (100 to 10-5) was due to the preferred misincorporation of dCTP with templating bases dA, dT, and dC over correct dNTPs. Using non-natural nucleotide analogs, we showed that hydrogen bonding interactions between residue R357 of human Rev1 and an incoming dNTP are not essential for DNA synthesis. Lastly, human Rev1 discriminates between ribonucleotides and deoxyribonucleotides mainly by reducing the rate of incorporation, and the sugar selectivity of human Rev1 is sensitive to both the size and orientation of the 2′-substituent of a ribonucleotide. PMID:20518555
Directory of Open Access Journals (Sweden)
Dina A Moustafa
Full Text Available Brucella neotomae is not known to be associated with clinical disease in any host species. Previous research suggested that B. neotomae might not express detectable levels of Cu/Zn superoxide dismutase (SOD, a periplasmic enzyme known to be involved in protecting Brucella from oxidative bactericidal effects of host phagocytes. This study was undertaken to investigate the genetic basis for the disparity in SOD expression in B. neotomae. Our Western blot and SOD enzyme assay analyses indicated that B. neotomae does express SOD, but at a substantially reduced level. Nucleotide sequence analysis of region upstream to the sodC gene identified a single-nucleotide insertion in the potential promoter region. The same single-nucleotide insertion was also detected in the sodC promoter of B. suis strain Thomsen, belonging to biovar 2 in which SOD expression was undetectable previously. Examination of the sodC promoter activities using translational fusion constructs with E. coli β-galactosidase demonstrated that the B. neotomae and B. suis biovar 2 promoters were very weak in driving gene expression. Site-directed mutation studies indicated that the insertion of A in the B. neotomae sodC promoter reduced the promoter activity. Increasing the level of SOD expression in B. neotomae through complementation with B. abortus sodC gene did not alter the bacterial survival in J774A.1 macrophage-like cells and in tissues of BALB/c and C57BL/6 mice. These results for the first time demonstrate the occurrence of a single-nucleotide polymorphism affecting promoter function and gene expression in Brucella.
Dass, J Febin Prabhu; Sudandiradoss, C
2012-07-15
5-HT (5-Hydroxy-tryptamine) or serotonin receptors are found both in central and peripheral nervous system as well as in non-neuronal tissues. In the animal and human nervous system, serotonin produces various functional effects through a variety of membrane bound receptors. In this study, we focus on 5-HT receptor family from different mammals and examined the factors that account for codon and nucleotide usage variation. A total of 110 homologous coding sequences from 11 different mammalian species were analyzed using relative synonymous codon usage (RSCU), correspondence analysis (COA) and hierarchical cluster analysis together with nucleotide base usage frequency of chemically similar amino acid codons. The mean effective number of codon (ENc) value of 37.06 for 5-HT(6) shows very high codon bias within the family and may be due to high selective translational efficiency. The COA and Spearman's rank correlation reveals that the nucleotide compositional mutation bias as the major factors influencing the codon usage in serotonin receptor genes. The hierarchical cluster analysis suggests that gene function is another dominant factor that affects the codon usage bias, while species is a minor factor. Nucleotide base usage was reported using Goldman, Engelman, Stietz (GES) scale reveals the presence of high uracil (>45%) content at functionally important hydrophobic regions. Our in silico approach will certainly help for further investigations on critical inference on evolution, structure, function and gene expression aspects of 5-HT receptors family which are potential antipsychotic drug targets. Copyright © 2012 Elsevier B.V. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Raindlová, Veronika; Pohl, Radek; Klepetářová, Blanka; Havran, Luděk; Šimková, Eva; Horáková Brázdilová, Petra; Pivoňková, Hana; Fojta, Miroslav; Hocek, Michal
2012-01-01
Roč. 77, č. 8 (2012), s. 652-662 ISSN 2192-6506 R&D Projects: GA AV ČR(CZ) IAA400040901; GA ČR GBP206/12/G151 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040702 Keywords : DNA * oligonucleotides * polymerase * hydrazones * nucleotides Subject RIV: CC - Organic Chemistry
An intermediate state of T7 RNA polymerase provides another pathway of nucleotide selection
International Nuclear Information System (INIS)
Wang Zhan-Feng; Liu Yu-Ru; Wang Peng-Ye; Xie Ping
2017-01-01
Phage T7 RNA polymerase is a single-subunit transcription enzyme, transcribing template DNA to RNA. Nucleoside triphosphate (NTP) selection and translocation are two critical steps of the transcription elongation. Here, using all-atom molecular dynamics simulations, we found that between pre- and post-translocation states of T7 RNA polymerase an intermediate state exists, where the O helix C-terminal residue tyrosine 639, which plays important roles in translocation, locates between its pre- and post-translocation positions and the side chain of the next template DNA nucleotide has moved into the active site. NTP selection in this intermediate state was studied, revealing that the selection in the intermediate state can be achieved relying on the effect of Watson–Crick interaction between NTP and template DNA nucleotide, effect of stability of the components near the active site such as the nascent DNA–RNA hybrid and role of tyrosine 639. This indicates that another NTP-selection pathway can also exist besides the main pathway where NTP selection begins at the post-translocation state upon the entry of NTP. (paper)
LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E
DEFF Research Database (Denmark)
Jacobsen, Nana; Bentzen, Joan; Meldgaard, Michael
2002-01-01
Genotyping of single nucleotide polymorphisms (SNPs) in large populations presents a great challenge, especially if the SNPs are embedded in GC-rich regions, such as the codon 112 SNP in the human apolipoprotein E (apoE). In the present study, we have used immobilized locked nucleic acid (LNA...... was applied to a panel of patient samples with simultaneous genotyping of the patients by DNA sequencing. The apoE genotyping assays for the codons 112 and 158 SNPs resulted in unambiguous results for all patient samples, concurring with those obtained by DNA sequencing....
Flechsig, Holger
2016-02-01
ATP-binding cassette (ABC) transporters are integral membrane proteins which mediate the exchange of diverse substrates across membranes powered by ATP molecules. Our understanding of their activity is still hampered since the conformational dynamics underlying the operation of such proteins cannot yet be resolved in detailed molecular dynamics studies. Here a coarse grained model which allows to mimic binding of nucleotides and follow subsequent conformational motions of full-length transporter structures in computer simulations is proposed and implemented. To justify its explanatory quality, the model is first applied to the maltose transporter system for which multiple conformations are known and we find that the model predictions agree remarkably well with the experimental data. For the MalK subunit the switching from open to the closed dimer configuration upon ATP binding is reproduced and, moreover, for the full-length maltose transporter, progression from inward-facing to the outward-facing state is correctly obtained. For the heme transporter HmuUV, for which only the free structure could yet be determined, the model was then applied to predict nucleotide-induced conformational motions. Upon binding of ATP-mimicking ligands the structure changed from a conformation in which the nucleotide-binding domains formed an open shape, to a conformation in which they were found in tight contact, while, at the same time, a pronounced rotation of the transmembrane domains was observed. This finding is supported by normal mode analysis, and, comparison with structural data of the homologous vitamin B12 transporter BtuCD suggests that the observed rotation mechanism may contribute a common functional aspect for this class of ABC transporters. Although in HmuuV noticeable rearrangement of essential transmembrane helices was detected, there are no indications from our simulations that ATP binding alone may facilitate propagation of substrate molecules in this transporter
Trosiuk, Tetiana V; Shalak, Vyacheslav F; Szczepanowski, Roman H; Negrutskii, Boris S; El'skaya, Anna V
2016-02-01
Eukaryotic translation elongation factor 1Bα (eEF1Bα) is a functional homolog of the bacterial factor EF-Ts, and is a component of the macromolecular eEF1B complex. eEF1Bα functions as a catalyst of guanine nucleotide exchange on translation elongation factor 1A (eEF1A). The C-terminal domain of eEF1Bα is necessary and sufficient for its catalytic activity, whereas the N-terminal domain interacts with eukaryotic translation elongation factor 1Bγ (eEF1Bγ) to form a tight complex. However, eEF1Bγ has been shown to enhance the catalytic activity of eEF1Bα attributed to the C-terminal domain of eEF1Bα. This suggests that the N-terminal domain of eEF1Bα may in some way influence the guanine nucleotide exchange process. We have shown that full-length recombinant eEF1Bα and its truncated forms are non-globular proteins with elongated shapes. Truncation of the N-terminal domain of eEF1Bα, which is dispensable for catalytic activity, resulted in acceleration of the rate of guanine nucleotide exchange on eEF1A compared to full-length eEF1Bα. A similar effect on the catalytic activity of eEF1Bα was observed after its interaction with eEF1Bγ. We suggest that the non-catalytic N-terminal domain of eEF1Bα may interfere with eEF1A binding to the C-terminal catalytic domain, resulting in a decrease in the overall rate of the guanine nucleotide exchange reaction. Formation of a tight complex between the eEF1Bγ and eEF1Bα N-terminal domains abolishes this inhibitory effect. © 2015 FEBS.
Xu, Jian-Zhong; Yang, Han-Kun; Liu, Li-Ming; Wang, Ying-Yu; Zhang, Wei-Guo
2018-03-25
l-lysine is an important amino acid in animals and humans and NADPH is a vital cofactor for maximizing the efficiency of l-lysine fermentation. Dihydrodipicolinate reductase (DHDPR), an NAD(P)H-dependent enzyme, shows a variance in nucleotide-cofactor affinity in bacteria. In this study, we rationally engineered Corynebacterium glutamicum DHDPR (CgDHDPR) to switch its nucleotide-cofactor specificity resulting in an increase in final titer (from 82.6 to 117.3 g L -1 ), carbon yield (from 0.35 to 0.44 g [g glucose] -1 ) and productivity (from 2.07 to 2.93 g L -1 hr -1 ) of l-lysine in JL-6 ΔdapB::Ec-dapB C115G,G116C in fed-batch fermentation. To do this, we comparatively analyzed the characteristics of CgDHDPR and Escherichia coli DHDPR (EcDHDPR), indicating that hetero-expression of NADH-dependent EcDHDPR increased l-lysine production. Subsequently, we rationally modified the conserved structure of cofactor-binding motif, and results indicated that introducing the mutation K11A or R13A in CgDHDPR and introducing the mutation R16A or R39A in EcDHDPR modifies the nucleotide-cofactor affinity of DHDPR. Lastly, the effects of these mutated DHDPRs on l-lysine production were investigated. The highest increase (26.2%) in l-lysine production was observed for JL-6 ΔdapB::Ec-dapB C115G,G116C , followed by JL-6 Cg-dapB C37G,G38C (21.4%) and JL-6 ΔdapB::Ec-dapB C46G,G47C (15.2%). This is the first report of a rational modification of DHDPR that enhances the l-lysine production and yield through the modulation of nucleotide-cofactor specificity. © 2018 Wiley Periodicals, Inc.
Jung, B; Batal, A B
2012-01-01
1. Two experiments were conducted to determine the effects of dietary nucleotide supplementation on broiler performance, and physical and morphological development of the gastrointestinal tract. 2. Experiment 1: A total of 180 one-d-old male chicks were placed in battery brooders in 3 × 6 replicate pens containing 10 chicks each. Chicks were randomly assigned to one of the three dietary treatments; a maize-soyabean meal based diet supplemented with 0, 0·25, and 0·50% Torula yeast RNA (as a source of nucleotides) from 0 to 16 d of age. 3. Experiment 2: A total of 1344 one-d-old male chicks were placed in floor pens and reared on recycled wood shavings (two flocks) under a high stocking density (0·068 m(2)/bird). Chicks were randomly assigned to one of the 4 dietary treatments (0, 0·25% Torula yeast RNA, 2% and 6% Nupro®) for the starter period (0 to 14 d of age) with 6 replicate pens containing 56 chicks each. All the birds were fed on the same common grower diet with no supplementation of nucleotides from 15 to 32 d of age. 4. Experiment 1: Supplementing the diets with up to 0·50% Torula yeast RNA did not affect broiler performance, or relative intestinal tract weight and length of broilers at any periods measured. 5. Experiment 2: From 0 to 14 d of age, broilers fed on the diets supplemented with 0·25% Torula yeast RNA and 2 and 6% Nupro® were significantly heavier and had improved feed conversion (feed:gain) ratios as compared with the birds fed on the control diet. Supplementing the starter diet only with 2% Nupro® supplementation significantly improved body weight (BW) gain as compared with the control diet over the entire experiment (0 to 32 d of age). Broilers fed on the diets supplemented with 2 and 6% Nupro® from 0 to 14 d of age had better feed conversion (feed:gain) ratios over the entire experiment (0 to 32 d of age) as compared with the birds fed on the control diet, even though the birds were only fed on the diets
Servant, Géraldine; Pinson, Benoit; Tchalikian-Cosson, Aurélie; Coulpier, Fanny; Lemoine, Sophie; Pennetier, Carole; Bridier-Nahmias, Antoine; Todeschini, Anne Laure; Fayol, Hélène; Daignan-Fornier, Bertrand; Lesage, Pascale
2012-07-01
Transposable elements play a fundamental role in genome evolution. It is proposed that their mobility, activated under stress, induces mutations that could confer advantages to the host organism. Transcription of the Ty1 LTR-retrotransposon of Saccharomyces cerevisiae is activated in response to a severe deficiency in adenylic nucleotides. Here, we show that Ty2 and Ty3 are also stimulated under these stress conditions, revealing the simultaneous activation of three active Ty retrotransposon families. We demonstrate that Ty1 activation in response to adenylic nucleotide depletion requires the DNA-binding transcription factor Tye7. Ty1 is transcribed in both sense and antisense directions. We identify three Tye7 potential binding sites in the region of Ty1 DNA sequence where antisense transcription starts. We show that Tye7 binds to Ty1 DNA and regulates Ty1 antisense transcription. Altogether, our data suggest that, in response to adenylic nucleotide reduction, TYE7 is induced and activates Ty1 mRNA transcription, possibly by controlling Ty1 antisense transcription. We also provide the first evidence that Ty1 antisense transcription can be regulated by environmental stress conditions, pointing to a new level of control of Ty1 activity by stress, as Ty1 antisense RNAs play an important role in regulating Ty1 mobility at both the transcriptional and post-transcriptional stages.
International Nuclear Information System (INIS)
Evans, R.K.; Haley, B.E.
1987-01-01
A photoactive nucleotide analogue of dUTP, 5-azido-2'-deoxyuridine 5'-triphosphate (5-N 3 dUTP), was synthesized from dUMP in five steps. The key reaction in the synthesis of 5-N 3 dUTP is the nitration of dUMP in 98% yield in 5 min at 25 0 C using an excess of nitrosonium tetrafluoroborate in anhydrous dimethylformamide. Reduction of the resulting 5-nitro compound with zinc and 20 mM HCl gave 5-aminodeoxyuridine monophosphate (5-NH 2 dUMP). Diazotization of 5-NH 2 dUMP with HNO 2 followed by the addition NaN 3 to the acidic diazonium salt solution gave a photoactive nucleotide derivative in 80-90% yield. The monophosphate product was identified as 5-N 3 dUMP by proton NMR, UV, IR, and chromatographic analysis as well as by the mode of synthesis and its photosensitivity. After formation of 5-N 3 dUTP through a chemical coupling of pyrophosphate to 5-N 3 dUMP, the triphosphate form of the nucleotide was found to support DNA synthesis by Escherichia coli DNA polymerase I at a rate indistinguishable from that supported by dTTP. When UMP was used as the starting compound, 5-N 3 UTP was formed in an analogous fashion with similar yields and produced a photoactive nucleotide which is a substrate for E. coli RNA polymerase. To prepare [γ- 32 P]-5-N 3 dUTP for use as an active-site-directed photoaffinity labeling reagent, a simple method of preparing γ- 32 P-labeled pyrimidine nucleotides was developed. [γ- 32 P]-5-N 3 dUTP is an effective photoaffinity labeling reagent for DNA polymerase I and was found to bind to the active site with a 2-fold higher affinity than dTTP. The photoactivity of 5-N 3 dUMP is stable to extremes of pH, and [γ- 32 P]-5-N 3 dUTP was an effective photolabeling reagent even in the presence of 10 mM dithiothreitol
Shirakawa, I; Chaen, S; Bagshaw, C R; Sugi, H
2000-02-01
The kinetics of displacement of a fluorescent nucleotide, 2'(3')-O-[N[2-[[Cy3]amido]ethyl]carbamoyl]-adenosine 5'-triphosphate (Cy3-EDA-ATP), bound to rabbit soleus muscle myofibrils were studied using flash photolysis of caged ATP. Use of myofibrils from this slow twitch muscle allowed better resolution of the kinetics of nucleotide exchange than previous studies with psoas muscle myofibrils (, Biophys. J. 73:2033-2042). Soleus myofibrils in the presence of Cy3-EDA-nucleotides (Cy3-EDA-ATP or Cy3-EDA-ADP) showed selective fluorescence staining of the A-band. The K(m) for Cy3-EDA-ATP and the K(d) for Cy3-EDA-ADP binding to the myofibril A-band were 1.9 microM and 3.8 microM, respectively, indicating stronger binding of nucleotide to soleus cross-bridges compared to psoas cross-bridges (2.6 microM and 50 microM, respectively). After flash photolysis of caged ATP, the A-band fluorescence of the myofibril in the Cy3-EDA-ATP solution under isometric conditions decayed exponentially with a rate constant of 0.045 +/- 0.007 s(-1) (n = 32) at 10 degrees C, which was about seven times slower than that for psoas myofibrils. When a myofibril was allowed to shorten with a constant velocity, the nucleotide displacement rate constant increased from 0.066 s(-1) (isometric) to 0.14 s(-1) at 20 degrees C with increasing shortening velocity up to 0.1 myofibril length/s (V(max), the shortening velocity under no load was approximately 0. 2 myofibril lengths/s). The rate constant was not significantly affected by an isovelocity stretch of up to 0.1 myofibril lengths/s. These results suggest that the cross-bridge kinetics are not significantly affected at higher strain during lengthening but depend on the lower strain during shortening. These data also indicate that the interaction distance between a cross-bridge and the actin filament is at least 16 nm for a single cycle of the ATPase.
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
Richmond, Amy L.; Kabi, Amrita; Homer, Craig R.; García, Noemí Marina; Nickerson, Kourtney P.; NesvizhskiI, Alexey I.; Sreekumar, Arun; Chinnaiyan, Arul M.; Nuñez, Gabriel; McDonald, Christine
2013-01-01
BACKGROUND & AIMS Polymorphisms that reduce the function of nucleotide-binding oligomerization domain (NOD)2, a bacterial sensor, have been associated with Crohn’s disease (CD). No proteins that regulate NOD2 activity have been identified as selective pharmacologic targets. We sought to discover regulators of NOD2 that might be pharmacologic targets for CD therapies. METHODS Carbamoyl phosphate synthetase/ aspartate transcarbamylase/dihydroorotase (CAD) is an enzyme required for de novo pyrimidine nucleotide synthesis; it was identified as a NOD2-interacting protein by immunoprecipitation-coupled mass spectrometry. CAD expression was assessed in colon tissues from individuals with and without inflammatory bowel disease by immunohistochemistry. The interaction between CAD and NOD2 was assessed in human HCT116 intestinal epithelial cells by immunoprecipitation, immunoblot, reporter gene, and gentamicin protection assays. We also analyzed human cell lines that express variants of NOD2 and the effects of RNA interference, overexpression and CAD inhibitors. RESULTS CAD was identified as a NOD2-interacting protein expressed at increased levels in the intestinal epithelium of patients with CD compared with controls. Overexpression of CAD inhibited NOD2-dependent activation of nuclear factor κB and p38 mitogen-activated protein kinase, as well as intracellular killing of Salmonella. Reduction of CAD expression or administration of CAD inhibitors increased NOD2-dependent signaling and antibacterial functions of NOD2 variants that are and are not associated with CD. CONCLUSIONS The nucleotide synthesis enzyme CAD is a negative regulator of NOD2. The antibacterial function of NOD2 variants that have been associated with CD increased in response to pharmacologic inhibition of CAD. CAD is a potential therapeutic target for CD. PMID:22387394
Directory of Open Access Journals (Sweden)
Valerio Costa
2016-06-01
Full Text Available Type 2 diabetes (T2D is one of the most frequent mortality causes in western countries, with rapidly increasing prevalence. Anti-diabetic drugs are the first therapeutic approach, although many patients develop drug resistance. Most drug responsiveness variability can be explained by genetic causes. Inter-individual variability is principally due to single nucleotide polymorphisms, and differential drug responsiveness has been correlated to alteration in genes involved in drug metabolism (CYP2C9 or insulin signaling (IRS1, ABCC8, KCNJ11 and PPARG. However, most genome-wide association studies did not provide clues about the contribution of DNA variations to impaired drug responsiveness. Thus, characterizing T2D drug responsiveness variants is needed to guide clinicians toward tailored therapeutic approaches. Here, we extensively investigated polymorphisms associated with altered drug response in T2D, predicting their effects in silico. Combining different computational approaches, we focused on the expression pattern of genes correlated to drug resistance and inferred evolutionary conservation of polymorphic residues, computationally predicting the biochemical properties of polymorphic proteins. Using RNA-Sequencing followed by targeted validation, we identified and experimentally confirmed that two nucleotide variations in the CAPN10 gene—currently annotated as intronic—fall within two new transcripts in this locus. Additionally, we found that a Single Nucleotide Polymorphism (SNP, currently reported as intergenic, maps to the intron of a new transcript, harboring CAPN10 and GPR35 genes, which undergoes non-sense mediated decay. Finally, we analyzed variants that fall into non-coding regulatory regions of yet underestimated functional significance, predicting that some of them can potentially affect gene expression and/or post-transcriptional regulation of mRNAs affecting the splicing.
Florea, Mara; Nau, Werner M
2010-03-07
A supramolecular tandem assay for direct continuous monitoring of nucleotide triphosphate-dependent enzymes such as potato apyrase is described. The underlying principle of the assay relies on the use of anion-receptor macrocycles in combination with fluorescent dyes as reporter pairs. A combinatorial approach was used to identify two complementary reporter pairs, i.e. an amino-gamma-cyclodextrin with 2-anilinonaphtalene-6-sulfonate (ANS) as dye (fluorescence enhancement factor of 17 upon complexation) and a polycationic cyclophane with 8-hydroxy-1,3,6-pyrene trisulfonate (HPTS) as dye (fluorescence decrease by a factor of more than 2000), which allow the kinetic monitoring of potato apyrase activity at different ATP concentration ranges (microM and mM) with different types of photophysical responses (switch-ON and switch-OFF). Competitive fluorescence titrations revealed a differential binding of ATP (strongest competitor) versus ADP and AMP, which constitutes the prerequisite for monitoring enzymatic conversions (dephosphorylation or phosphorylation) involving nucleotides. The assay was tested for different enzyme and substrate concentrations and exploited for the screening of activating additives, namely divalent transition metal ions (Ni(2+), Mg(2+), Mn(2+), and Ca(2+)). The transferability of the assay could be demonstrated by monitoring the dephosphorylation of other nucleotide triphosphates (GTP, TTP, and CTP).
Directory of Open Access Journals (Sweden)
RODRIGO GONZÁLEZ
2009-01-01
Full Text Available We present the analysis of an intronic polymorphism of the nephrin gene and its relationship to the development of diabetic nephropathy in a study of diabetes type 1 and type 2 patients. The frequency of the single nucleotide polymorphism rs#466452 in the nephrin gene was determined in 231 patients and control subjects. The C/T status of the polymorphism was assessed using restriction enzyme digestions and the nephrin transcript from a kidney biopsy was examined. Association between the polymorphism and clinical parameters was evaluated using multivaríate correspondence analysis. A bioinformatics analysis of the single nucleotide polymorphism rs#466452 suggested the appearance of a splicing enhancer sequence in intron 24 of the nephrin gene and a modification of proteins that bind to this sequence. However, no change in the splicing of a nephrin transcript from a renal biopsy was found. No association was found between the polymorphism and diabetes or degree of renal damage in diabetes type 1 or 2 patients. The single nucleotide polymorphism rs#466452 of the nephrin gene seems to be neutral in relation to diabetes and the development of diabetic nephropathy, and does not affect the splicing of a nephrin transcript, in spite of a splicing enhancer site.
DEFF Research Database (Denmark)
Eriksen, Mette B; Brusgaard, Klaus; Andersen, Marianne
2012-01-01
Polycystic ovary syndrome (PCOS) is the most common endocrine disease among premenopausal women. A recent study found association between three single nucleotide polymorphisms (SNPs) and PCOS in a cohort of Han Chinese women.......Polycystic ovary syndrome (PCOS) is the most common endocrine disease among premenopausal women. A recent study found association between three single nucleotide polymorphisms (SNPs) and PCOS in a cohort of Han Chinese women....
Kishine, Masahiro; Tsutsumi, Katsuji; Kitta, Kazumi
2017-12-01
Simple sequence repeat (SSR) is a popular tool for individual fingerprinting. The long-core motif (e.g. tetra-, penta-, and hexa-nucleotide) simple sequence repeats (SSRs) are preferred because they make it easier to separate and distinguish neighbor alleles. In the present study, a new set of 8 tetra-nucleotide SSRs in potato ( Solanum tuberosum ) is reported. By using these 8 markers, 72 out of 76 cultivars obtained from Japan and the United States were clearly discriminated, while two pairs, both of which arose from natural variation, showed identical profiles. The combined probability of identity between two random cultivars for the set of 8 SSR markers was estimated to be 1.10 × 10 -8 , confirming the usefulness of the proposed SSR markers for fingerprinting analyses of potato.
International Nuclear Information System (INIS)
Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.
1987-01-01
Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative
NICHOLSON, CD; BRUIN, J; BARRON, E; SPIERS, [No Value; DEBOER, J; VANAMSTERDAM, RGM; ZAAGSMA, J; KELLY, JJ; DENT, G; GIEMBYCZ, MA; BARNES, PJ
The pharmacological profile of a novel cyclic nucleotide phosphodiesterase (PDE) inhibitor, Org 20241, has been characterized. The compound selectively inhibits PDE IV (plC(50), 5.2-6.1) and PDE III (plC(50), 4.4-4.6) from animal and human tissues. Org 20241 relaxed preparations of bovine trachea
International Nuclear Information System (INIS)
Jakobsson, B.; el Hag, I.A.; Andersson, M.; Christensson, P.I.; Stenram, U.
1990-01-01
Rats were fed a 0% casein diet for 1 week, with or without enteral or parenteral administration of essential amino acids, or a 25% casein diet, in one group supplemented with 5-fluorouracil treatment. Ninety minutes before sacrifice the rats were given a tracer of [3H]orotic acid. Incorporation into the acid soluble fraction, RNA, and DNA was determined in liver, small intestine, bone marrow, and kidney. Nucleotide profile was examined in liver and intestine. Protein deficiency caused inter alia a decrease in body weight; a decrease in RNA/DNA ratio and an increase in the specific RNA labeling in liver and kidney; an altered nucleotide profile in the liver; an increase in the nucleotide/DNA and RNA/DNA ratios and a decrease in the specific labeling of the acid soluble fraction, RNA, and DNA in the bone marrow. These changes were prevented to the same extent by giving essential amino acids, either orally or intravenously. The minor changes in intestinal nucleotide profile in protein deprivation were prevented to a slightly larger extent by amino acids orally than parenterally. 5-Fluorouracil treatment gave a decrease in the RNA/DNA ratio in the liver and kidney but an increase in the nucleotide/DNA and RNA/DNA ratios in the bone marrow. Nucleotide profiles were unaltered. The amount of DNA per gram of tissue decreased in bone marrow and increased in kidney. Parenteral administration per se resulted in almost no changes
Evolutionary and Structural Perspectives of Plant Cyclic Nucleotide Gated Cation Channels
Directory of Open Access Journals (Sweden)
Alice Kira Zelman
2012-05-01
Full Text Available Ligand-gated cation channels are a frequent component of signaling cascades in eukaryotes. Eukaryotes contain numerous diverse gene families encoding ion channels, some of which are shared and some of which are unique to particular kingdoms. Among the many different types are cyclic nucleotide-gated channels (CNGCs. CNGCs are cation channels with varying degrees of ion conduction selectivity. They are implicated in numerous signaling pathways and permit diffusion of divalent and monovalent cations, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide binding domain (CNBD and a calmodulin binding domain (CaMBD as well as a 6 transmembrane/1 pore tertiary structure. This review summarizes existing knowledge about the functional domains present in these cation-conducting channels, and considers the evidence indicating that plant and animal CNGCs evolved separately. Additionally, an amino acid motif that is only found in the phosphate binding cassette and hinge regions of plant CNGCs, and is present in all experimentally confirmed CNGCs but no other channels was identified. This CNGC-specific amino acid motif provides an additional diagnostic tool to identify plant CNGCs, and can increase confidence in the annotation of open reading frames in newly sequenced genomes as putative CNGCs. Conversely, the absence of the motif in some plant sequences currently identified as probable CNGCs may suggest that they are misannotated or protein fragments.
Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator
International Nuclear Information System (INIS)
Fenati, Renzo A.; Connolly, Ashley R.; Ellis, Amanda V.
2017-01-01
Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.
Precise detection of de novo single nucleotide variants in human genomes.
Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael
2018-05-07
The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.
Single nucleotide polymorphism discrimination with and without an ethidium bromide intercalator
Energy Technology Data Exchange (ETDEWEB)
Fenati, Renzo A.; Connolly, Ashley R. [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Ellis, Amanda V., E-mail: amanda.ellis@flinders.edu.au [Flinders Centre for Nanoscale Science and Technology, Flinders University, Sturt Road, Bedford Park, Adelaide, South Australia 5042 (Australia); Chemical and Biomolecular Engineering, The University of Melbourne, Parkville, VIC 3010 (Australia)
2017-02-15
Single nucleotide polymorphism (SNP) genotyping is an important aspect in understanding genetic variations. Here, we discriminate SNPs using toe-hold mediated displacement reactions. The biological target is an 80 nucleotide long double-stranded–DNA from the mtDNA HV1 region, associated with maternal ancestry. This target has been specially designed with a pendant toehold and a cationic fluorophore, ATTO 647N, as a reporter, produced in a polymerase chain reaction. Rates of reaction for the toehold-polymerase chain reaction products (TPPs) with their corresponding complementary displacing sequences, labelled with a Black Hole Quencher 1, followed the order TPP–Cytosine > TPP–Thymine > TPP–Adenine ≥ TPP–Guanine. Non-complementary rates were the slowest with mismatches involving cytosine. These reactions, operating in a static/or contact mode, gave averaged readouts between SNPs within 15 min (with 80–90% quenching), compared to 25–30 min in previous studies involving fluorescence resonance energy transfer. Addition of an intercalating agent, ethidium bromide, retarded the rate of reaction in which cytosine was involved, presumably through stabilization of the base pairing, which resulted in markedly improved discrimination of cytosine containing SNPs. - Highlights: • Fluorophores and DNA intercalators effect the rate of toehold-mediated strand displacement. • Ethidium bromide had a destabilizing effect on mismatches that contained cytosine. • A cationic fluorophore and Black Hole Quencher 1 strand displacement system was 2–3 times faster than a FRET system. • This enabled SNP detection using toehold-mediated strand displacement in 15 min.
Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels
Zelman, Alice K.
2012-05-29
Ligand-gated cation channels are a frequent component of signaling cascades in eukaryotes. Eukaryotes contain numerous diverse gene families encoding ion channels, some of which are shared and some of which are unique to particular kingdoms. Among the many different types are cyclic nucleotide-gated channels (CNGCs). CNGCs are cation channels with varying degrees of ion conduction selectivity. They are implicated in numerous signaling pathways and permit diffusion of divalent and monovalent cations, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a calmodulin binding domain as well as a six transmembrane/one pore tertiary structure. This review summarizes existing knowledge about the functional domains present in these cation-conducting channels, and considers the evidence indicating that plant and animal CNGCs evolved separately. Additionally, an amino acid motif that is only found in the phosphate binding cassette and hinge regions of plant CNGCs, and is present in all experimentally confirmed CNGCs but no other channels was identified. This CNGC-specific amino acid motif provides an additional diagnostic tool to identify plant CNGCs, and can increase confidence in the annotation of open reading frames in newly sequenced genomes as putative CNGCs. Conversely, the absence of the motif in some plant sequences currently identified as probable CNGCs may suggest that they are misannotated or protein fragments. 2012 Zelman, Dawe, Gehring and Berkowitz.
International Nuclear Information System (INIS)
Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.
1990-08-01
The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)
Directory of Open Access Journals (Sweden)
Ardina Grüber
2010-02-01
Full Text Available Invasion of the red blood cells (RBC by the merozoite of malaria parasites involves a large number of receptor ligand interactions. The reticulocyte binding protein homologue family (RH plays an important role in erythrocyte recognition as well as virulence. Recently, it has been shown that members of RH in addition to receptor binding may also have a role as ATP/ADP sensor. A 94 kDa region named Nucleotide-Binding Domain 94 (NBD94 of Plasmodium yoelii YM, representative of the putative nucleotide binding region of RH, has been demonstrated to bind ATP and ADP selectively. Binding of ATP or ADP induced nucleotide-dependent structural changes in the C-terminal hinge-region of NBD94, and directly impacted on the RBC binding ability of RH.In order to find the smallest structural unit, able to bind nucleotides, and its coupling module, the hinge region, three truncated domains of NBD94 have been generated, termed NBD94(444-547, NBD94(566-663 and NBD94(674-793, respectively. Using fluorescence correlation spectroscopy NBD94(444-547 has been identified to form the smallest nucleotide binding segment, sensitive for ATP and ADP, which became inhibited by 4-Chloro-7-nitrobenzofurazan. The shape of NBD94(444-547 in solution was calculated from small-angle X-ray scattering data, revealing an elongated molecule, comprised of two globular domains, connected by a spiral segment of about 73.1 A in length. The high quality of the constructs, forming the hinge-region, NBD94(566-663 and NBD94(674-793 enabled to determine the first crystallographic and solution structure, respectively. The crystal structure of NBD94(566-663 consists of two helices with 97.8 A and 48.6 A in length, linked by a loop. By comparison, the low resolution structure of NBD94(674-793 in solution represents a chair-like shape with three architectural segments.These structures give the first insight into how nucleotide binding impacts on the overall structure of RH and demonstrates the
Single nucleotide polymorphism in Egyptian cattle insulin-like growth factor binding protein-3 gene
Directory of Open Access Journals (Sweden)
Othman E. Othman
2014-12-01
It is concluded that the IGFBP-3/HaeIII polymorphism may be utilized as a good marker for genetic differentiation between cattle animals for different body functions such as growth, metabolism, reproduction, immunity and energy balance. The nucleotide sequences of Egyptian cattle IGFBP-3 A and C alleles were submitted to GenBank with the accession numbers KF899893 and KF899894, respectively.
International Nuclear Information System (INIS)
Nissinen, E.A.O.
1987-01-01
This paper on the importance of cellular purines and pyrimidines is evidenced by the multitude of diseases, such as hyperuricemia, orotic aciduria, gout, Lesch-Nyhan syndrome, immunodeficiencies with B- and T-cell dysfunctions, etc. which result from aberrant metabolism. In addition, the use of purine and pyrimidine analogs in chemotherapy is of growing interest. Purine metabolism consists of a complex network of biochemical pathway. These pathways are under complicated feedback regulation and there also exists a close relationship between purine and pyrimidine metabolism. In addition, these pathways interact with those of the carbohydrate, amino acid, and energy metabolism. Since metabolic pathways are closely interrelated, a change in the concentration of a particular metabolite may lead to many changes in the overall metabolic profiles. For instance, in the area of nucleotide metabolism, the inhibition of IMP dehydrogenase by mycophenolic acid leads to various changes in both purine and pyrimidine nucleotide pools. Inhibition of de nova purine biosynthesis by methotrexate leads to many changes in purine and pyrimidine ribonucleotides and deoxyribonucleotides. Thus, the simultaneous measurement of all cellular purine and pyrimidine metabolites from individuals whose metabolism is altered, either by a metabolic disease or by the action of drugs, may further our understanding of cellular metabolism
Energy Technology Data Exchange (ETDEWEB)
Lefkofsky, Hailey B. [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Veloso, Artur [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Bioinformatics Program, Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, MI (United States); Ljungman, Mats, E-mail: ljungman@umich.edu [Translational Oncology Program, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Department of Environmental Health Sciences, School of Public Health, University of Michigan, Ann Arbor, MI (United States)
2015-06-15
Nucleotide excision repair (NER) removes DNA helix-distorting lesions induced by UV light and various chemotherapeutic agents such as cisplatin. These lesions efficiently block the elongation of transcription and need to be rapidly removed by transcription-coupled NER (TC-NER) to avoid the induction of apoptosis. Twenty-nine genes have been classified to code for proteins participating in nucleotide excision repair (NER) in human cells. Here we explored the transcriptional and post-transcriptional regulation of these NER genes across 13 human cell lines using Bru-seq and BruChase-seq, respectively. Many NER genes are relatively large in size and therefore will be easily inactivated by UV-induced transcription-blocking lesions. Furthermore, many of these genes produce transcripts that are rather unstable. Thus, these genes are expected to rapidly lose expression leading to a diminished function of NER. One such gene is ERCC6 that codes for the CSB protein critical for TC-NER. Due to its large gene size and high RNA turnover rate, the ERCC6 gene may act as dosimeter of DNA damage so that at high levels of damage, ERCC6 RNA levels would be diminished leading to the loss of CSB expression, inhibition of TC-NER and the promotion of cell death.
Bennett, G C; Boarder, M R
2000-10-01
Evidence has previously been presented that P1 receptors for adenosine, and P2 receptors for nucleotides such as ATP, regulate stimulus-evoked release of biogenic amines from nerve terminals in the brain. Here we investigated whether adenosine and nucleotides exert presynaptic control over depolarisation-elicited glutamate release. Slices of rat brain cortex were perfused and stimulated with pulses of 46 mM K(+) in the presence of the glutamate uptake inhibitor L-trans-pyrrolidine-2,4-dicarboxylic acid (0.2 mM). High K(+) substantially increased efflux of glutamate from the slices. Basal glutamate release was unchanged by the presence of nucleotides or adenosine at concentrations of 300 microM. Adenosine, ATP, ADP and adenosine 5'-O-(3-thiotriphoshate) at 300 microM attenuated depolarisation-evoked release of glutamate. However UTP, 2-methylthio ATP, 2-methylthio ADP, and alpha,beta-methylene ATP at 300 microM had no effect on stimulated glutamate efflux. Adenosine deaminase blocked the effect of adenosine, but left the response to ATP unchanged. The A(1) antagonist 8-cyclopentyl-1, 3-dipropylxanthine antagonised the inhibitory effect of both adenosine and ATP. Cibacron blue 3GA inhibited stimulus-evoked glutamate release when applied alone. When cibacron blue 3GA was present with ATP, stimulus-evoked glutamate release was almost eliminated. However, this P2 antagonist had no effect on the inhibition by adenosine. These results show that the release of glutamate from depolarised nerve terminals of the rat cerebral cortex is inhibited by adenosine and ATP. ATP appears to act directly and not through conversion to adenosine.
Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.
2009-08-01
The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.
Mustafa, Saima; Fatima, Hira; Fatima, Sadia; Khosa, Tafheem; Akbar, Atif; Shaikh, Rehan Sadiq; Iqbal, Furhan
2018-01-01
To find out a correlation between the single nucleotide polymorphisms in cluster of differentiation 28 and cluster of differentiation 40 genes with Graves' disease, if any. This case-control study was conducted at the Multan Institute of Nuclear Medicine and Radiotherapy, Multan, Pakistan, and comprised blood samples of Graves' disease patients and controls. Various risk factors were also correlated either with the genotype at each single-nucleotide polymorphism or with various combinations of genotypes studied during present investigation. Of the 160 samples, there were 80(50%) each from patients and controls. Risk factor analysis revealed that gender (p=0.008), marital status (pGraves' disease. Both single-nucleotide polymorphisms in both genes were not associated with Graves' disease, either individually or in any combined form.
Efficient Oligo nucleotide mediated CRISPR-Cas9 Gene Editing in Aspergilli
DEFF Research Database (Denmark)
Nødvig, Christina Spuur; Hoof, Jakob Blæsbjerg; Kogle, Martin Engelhard
2018-01-01
CRISPR-Cas9 technologies are revolutionizing fungal gene editing. Here we show that survival of specific Cas9/sgRNA mediated DNA double strand breaks (DSBs) depends on the non-homologous end-joining, NHEJ, DNA repair pathway and we use this observation to develop a tool to assess protospacer....... niger, and in A. oryzae indicating that this type of repair may be wide spread in filamentous fungi. Importantly, we demonstrate that by using single-stranded oligo nucleotides for CRISPR-Cas9 mediated gene editing it is possible to introduce specific point mutations as well gene deletions...
Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen
2012-09-04
A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.
Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.
2015-01-01
Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...
Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA
Jukes, T. H.; Kimura, M.
1984-01-01
The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...
Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif
2015-05-15
Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.
FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.
Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A
2016-06-13
Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.
Chang, Lei; Lee, Sang-Yong; Leonczak, Piotr; Rozenski, Jef; De Jonghe, Steven; Hanck, Theodor; Müller, Christa E; Herdewijn, Piet
2014-12-11
Nucleotide pyrophosphatase/phosphodiesterase 1 (NPP1) belongs to the family of ecto-nucleotidases, which control extracellular nucleotide, nucleoside, and (di)phosphate levels. To study the (patho)physiological roles of NPP1 potent and selective inhibitors with drug-like properties are required. Therefore, a compound library was screened for NPP1 inhibitors using a colorimetric assay with p-nitrophenyl 5'-thymidine monophosphate (p-Nph-5'-TMP) as an artificial substrate. This led to the discovery of 2-(3H-imidazo[4,5-b]pyridin-2-ylthio)-N-(3,4-dimethoxyphenyl)acetamide (5a) as a hit compound with a Ki value of 217 nM. Subsequent structure-activity relationship studies led to the development of purine and imidazo[4,5-b]pyridine analogues with high inhibitory potency (Ki values of 5.00 nM and 29.6 nM, respectively) when assayed with p-Nph-5'-TMP as a substrate. Surprisingly, the compounds were significantly less potent when tested versus ATP as a substrate, with Ki values in the low micromolar range. A prototypic inhibitor was investigated for its mechanism of inhibition and found to be competitive versus both substrates.
Directory of Open Access Journals (Sweden)
Keum-Ju Lee
2011-01-01
Full Text Available We demonstrate that Au-cluster-decorated single-walled carbon nanotubes (SWNTs may be used to discriminate single nucleotide polymorphism (SNP. Nanoscale Au clusters were formed on the side walls of carbon nanotubes in a transistor geometry using electrochemical deposition. The effect of Au cluster decoration appeared as hole doping when electrical transport characteristics were examined. Thiolated single-stranded probe peptide nucleic acid (PNA was successfully immobilized on Au clusters decorating single-walled carbon nanotube field-effect transistors (SWNT-FETs, resulting in a conductance decrease that could be explained by a decrease in Au work function upon adsorption of thiolated PNA. Although a target single-stranded DNA (ssDNA with a single mismatch did not cause any change in electrical conductance, a clear decrease in conductance was observed with matched ssDNA, thereby showing the possibility of SNP (single nucleotide polymorphism detection using Au-cluster-decorated SWNT-FETs. However, a power to discriminate SNP target is lost in high ionic environment. We can conclude that observed SNP discrimination in low ionic environment is due to the hampered binding of SNP target on nanoscale surfaces in low ionic conditions.
Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation
International Nuclear Information System (INIS)
Maat, J.
1978-01-01
A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)
Soares, Emilie; Schwartz, Annie; Nollmann, Marcello; Margeat, Emmanuel; Boudvillain, Marc
2014-08-01
Rho is a ring-shaped, ATP-dependent RNA helicase/translocase that dissociates transcriptional complexes in bacteria. How RNA recognition is coupled to ATP hydrolysis and translocation in Rho is unclear. Here, we develop and use a new combinatorial approach, called time-resolved Nucleotide Analog Interference Probing (trNAIP), to unmask RNA molecular determinants of catalytic Rho function. We identify a regulatory step in the translocation cycle involving recruitment of the 2'-hydroxyl group of the incoming 3'-RNA nucleotide by a Rho subunit. We propose that this step arises from the intrinsic weakness of one of the subunit interfaces caused by asymmetric, split-ring arrangement of primary RNA tethers around the Rho hexamer. Translocation is at highest stake every seventh nucleotide when the weak interface engages the incoming 3'-RNA nucleotide or breaks, depending on RNA threading constraints in the Rho pore. This substrate-governed, 'test to run' iterative mechanism offers a new perspective on how a ring-translocase may function or be regulated. It also illustrates the interest and versatility of the new trNAIP methodology to unveil the molecular mechanisms of complex RNA-based systems. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Colavin, Alexandre; Hsin, Jen; Huang, Kerwyn Casey
2014-03-04
The assembly of protein filaments drives many cellular processes, from nucleoid segregation, growth, and division in single cells to muscle contraction in animals. In eukaryotes, shape and motility are regulated through cycles of polymerization and depolymerization of actin cytoskeletal networks. In bacteria, the actin homolog MreB forms filaments that coordinate the cell-wall synthesis machinery to regulate rod-shaped growth and contribute to cellular stiffness through unknown mechanisms. Like actin, MreB is an ATPase and requires ATP to polymerize, and polymerization promotes nucleotide hydrolysis. However, it is unclear whether other similarities exist between MreB and actin because the two proteins share low sequence identity and have distinct cellular roles. Here, we use all-atom molecular dynamics simulations to reveal surprising parallels between MreB and actin structural dynamics. We observe that MreB exhibits actin-like polymerization-dependent structural changes, wherein polymerization induces flattening of MreB subunits, which restructures the nucleotide-binding pocket to favor hydrolysis. MreB filaments exhibited nucleotide-dependent intersubunit bending, with hydrolyzed polymers favoring a straighter conformation. We use steered simulations to demonstrate a coupling between intersubunit bending and the degree of flattening of each subunit, suggesting cooperative bending along a filament. Taken together, our results provide molecular-scale insight into the diversity of structural states of MreB and the relationships among polymerization, hydrolysis, and filament properties, which may be applicable to other members of the broad actin family.
Directory of Open Access Journals (Sweden)
Norton R.
2001-01-01
Full Text Available Until recently, dietary sources of nucleotides were thought not to be essential for good nutrition. Certain states with higher metabolic demands may require larger amounts that cannot be provided by endogenous production. The objective of the present study was to determine the action of nucleotides on the recovery from lactose-induced diarrhea in weaned rats. Thirty-six weanling Fisher rats were divided into two groups. Group 1 received a standard diet and group 2 received a diet containing lactose in place of starch. On the 10th day, six animals per group were sacrificed for histopathological evaluation. The remaining animals were divided into two other subgroups, each with 6 animals, receiving a control diet, a control diet with nucleotides (0.05% adenosine monophosphate, 0.05% guanosine monophosphate, 0.05% cytidine monophosphate, 0.05% uridine monophosphate and 0.05% inosine monophosphate, a diet with lactose, and a diet with lactose and nucleotides. On the 32nd day of the experiment all animals were sacrificed. Animals with diarrhea weighed less than animals without diarrhea. The introduction of nucleotides did not lead to weight gain. Mean diet consumption was lower in the group that continued to ingest lactose, with the group receiving lactose plus nucleotides showing a lower mean consumption. Animals receiving lactose had inflammatory reaction and deposits of periodic acid-Schiff-positive material in intestinal, hepatic and splenic tissues. The introduction of nucleotides led to an improvement of the intestinal inflammatory reaction. In lactose-induced diarrhea, when the stimulus is maintained - lactose overload - the nucleotides have a limited action on the weight gain and on recovery of intestinal morphology, although they have a protective effect on hepatic injury and improve the inflammatory response.
Dai, Weiran; Ye, Ziliang; Lu, Haili; Su, Qiang; Li, Hui; Li, Lang
2018-02-23
The results showed that there was a certain correlation between the single nucleotide polymorphism of IL-10-1082G/A and rheumatic heart disease, but there was no systematic study to verify this conclusion. Systematic review of the association between single nucleotide polymorphism of IL-10-1082G/A locus and rheumatic heart disease. Computer retrieval PubMed, EMbase, Cochrane Library, CBM, CNKI, VIP and Data WanFang, the retrieval time limit from inception to June 2017. A case control study of single nucleotide polymorphisms and rheumatic heart disease in patients with rheumatic heart disease in the IL-10-1082G/A was collected. Two researchers independently screened the literature, extracted data and evaluated the risk of bias in the study, and using RevMan5.3 software for data analysis. A total of 3 case control studies were included, including 318 patients with rheumatic heart disease and 502 controls. Meta-analysis showed that there was no correlation between IL-10-1082G/A gene polymorphism and rheumatic heart disease [AA+AG VS GG: OR = 0.62, 95% CI (0.28, 1.39), P = 0.25; AA VS AG+GG: OR = 0.73, 95% CI (0.54, 1.00), P = 0.05; AA VS GG: OR = 0.70, 95% CI(0.47, 1.05), P = 0.08; AG VS GG: OR = 0.65, 95% CI (0.22, 1.92), P = 0.43; A VS G: OR = 0.87, 95% CI (0.71, 1.06), P = 0.17]. When AA is a recessive gene, the single nucleotide polymorphism of IL-10-1082G/A is associated with the presence of rheumatic heart disease. Due to the limitations of the quantity and quality of the included literatures, the further research results were still needed.
Directory of Open Access Journals (Sweden)
Susann Schröder
2016-05-01
Full Text Available Cyclic nucleotide phosphodiesterases (PDEs are a class of intracellular enzymes that inactivate the secondary messenger molecules, cyclic adenosine monophosphate (cAMP and cyclic guanosine monophosphate (cGMP. Thus, PDEs regulate the signaling cascades mediated by these cyclic nucleotides and affect fundamental intracellular processes. Pharmacological inhibition of PDE activity is a promising strategy for treatment of several diseases. However, the role of the different PDEs in related pathologies is not completely clarified yet. PDE-specific radioligands enable non-invasive visualization and quantification of these enzymes by positron emission tomography (PET in vivo and provide an important translational tool for elucidation of the relationship between altered expression of PDEs and pathophysiological effects as well as (pre-clinical evaluation of novel PDE inhibitors developed as therapeutics. Herein we present an overview of novel PDE radioligands for PET published since 2012.
Directory of Open Access Journals (Sweden)
Adrien Nicolaï
Full Text Available ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD of Hsp70 propagates a signal to its substrate-binding domain (SBD. Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in
Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P
2005-05-01
The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.
Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T
2010-05-01
This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.
Base-By-Base: single nucleotide-level analysis of whole viral genome alignments.
Brodie, Ryan; Smith, Alex J; Roper, Rachel L; Tcherepanov, Vasily; Upton, Chris
2004-07-14
With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes) is not feasible without new bioinformatics tools. A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1) rapidly identify and correct alignment errors in large, multiple genome alignments; and 2) generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs) to retrieve detailed annotation information about the aligned genomes or use information from text files. Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.
Guanine nucleotide regulatory protein co-purifies with the D2-dopamine receptor
International Nuclear Information System (INIS)
Senogles, S.E.; Caron, M.G.
1986-01-01
The D 2 -dopamine receptor from bovine anterior pituitary was purified ∼1000 fold by affinity chromatography on CMOS-Sepharose. Reconstitution of the affinity-purified receptor into phospholipid vesicles revealed the presence of high and low affinity agonist sites as detected by N-n-propylnorapomorphine (NPA) competition experiments with 3 H-spiperone. High affinity agonist binding could be converted to the low affinity form by guanine nucleotides, indicating the presence of an endogenous guanine nucleotide binding protein (N protein) in the affinity-purified D 2 receptor preparations. Furthermore, this preparation contained an agonist-sensitive GTPase activity which was stimulated 2-3 fold over basal by 10 μM NPA. 35 S-GTPγS binding to these preparations revealed a stoichiometry of 0.4-0.7 mole N protein/mole receptor, suggesting the N protein may be specifically coupled with the purified D 2 -dopamine receptor and not present as a contaminant. Pertussis toxin treatment of the affinity purified receptor preparations prevented high affinity agonist binding, as well as agonist stimulation of the GTPase activity, presumably by inactivating the associated N protein. Pertussis toxin lead to the ADP-ribosylation of a protein of 39-40K on SDS-PAGE. These findings indicate that an endogenous N protein, N/sub i/ or N/sub o/, co-purifies with the D 2 -dopamine receptor which may reflect a precoupling of this receptor with an N protein within the membranes
Nucleotide excision repair- and p53-deficient mouse models in cancer research
Energy Technology Data Exchange (ETDEWEB)
Hoogervorst, Esther M. [Laboratory of Toxicology, Pathology and Genetics, National Institute of Public Health and the Environment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Utrecht University, Department of Pathobiology, Utrecht (Netherlands); Steeg, Harry van [Laboratory of Toxicology, Pathology and Genetics, National Institute of Public Health and the Environment, P.O. Box 1, 3720 BA Bilthoven (Netherlands); Vries, Annemieke de [Laboratory of Toxicology, Pathology and Genetics, National Institute of Public Health and the Environment, P.O. Box 1, 3720 BA Bilthoven (Netherlands)]. E-mail: Annemieke.de.Vries@rivm.nl
2005-07-01
Cancer is caused by the loss of controlled cell growth due to mutational (in)activation of critical genes known to be involved in cell cycle regulation. Three main mechanisms are known to be involved in the prevention of cells from becoming cancerous; DNA repair and cell cycle control, important to remove DNA damage before it will be fixed into mutations and apoptosis, resulting in the elimination of cells containing severe DNA damage. Several human syndromes are known to have (partially) deficiencies in these pathways, and are therefore highly cancer prone. Examples are xeroderma pigmentosum (XP) caused by an inborn defect in the nucleotide excision repair (NER) pathway and the Li-Fraumeni syndrome, which is the result of a germ line mutation in the p53 gene. XP patients develop skin cancer on sun exposed areas at a relatively early age, whereas Li-Fraumeni patients spontaneously develop a wide variety of early onset tumors, including sarcomas, leukemia's and mammary gland carcinomas. Several mouse models have been generated to mimic these human syndromes, providing us information about the role of these particular gene defects in the tumorigenesis process. In this review, spontaneous phenotypes of mice deficient for nucleotide excision repair and/or the p53 gene will be described, together with their responses upon exposure to either chemical carcinogens or radiation. Furthermore, possible applications of these and newly generated mouse models for cancer will be given.
Wei, Zehong; Yi, Lina; Xu, Wei; Zhou, Huihui; Zhang, Yanjiao; Zhang, Wenbing; Mai, Kangsen
2015-11-01
A 9-week feeding trial was conducted to investigate the effects of dietary nucleotides (NT) on growth, immune response and disease resistance of sea cucumber Apostichopus japonicas (initial weight: 5.87 ± 0.03 g). Four graded levels of dietary NT were designed as 0, 150, 375 and 700 mg/kg, respectively. After the feeding trial, sea cucumbers were challenged with Vibrio splendidus for the determination of disease resistance. The results showed that the specific growth rates were significantly higher in sea cucumber fed the diet with 375 mg/kg NT than those fed the basal diet without NT supplementation (P sea cucumber fed diets with nucleotides (≥ 375 mg/kg) had significantly higher phagocytic activities in coelomic fluid (P 0.05). After being challenged with V. splendidus, the cumulative mortalities of sea cucumber fed diets with 150 and 375 mg/kg NT were significantly lower than that in the treatment without dietary nucleotide supplementation (P sea cucumber in vivo. In conclusion, it was showed that dietary NT does increase the growth performance, non-specific immunity and disease resistance of sea cucumber. The optimum dietary NT supplementation level for sea cucumber was found to be 375 mg/kg. The application of dietary NT may present a novel strategy for health management in sea cucumber's aquaculture. Copyright © 2015 Elsevier Ltd. All rights reserved.
Reddy, Umesh K; Nimmakayala, Padma; Levi, Amnon; Abburi, Venkata Lakshmi; Saminathan, Thangasamy; Tomason, Yan R; Vajja, Gopinath; Reddy, Rishi; Abburi, Lavanya; Wehner, Todd C; Ronin, Yefim; Karol, Abraham
2014-09-15
We used genotyping by sequencing to identify a set of 10,480 single nucleotide polymorphism (SNP) markers for constructing a high-resolution genetic map of 1096 cM for watermelon. We assessed the genome-wide variation in recombination rate (GWRR) across the map and found an association between GWRR and genome-wide nucleotide diversity. Collinearity between the map and the genome-wide reference sequence for watermelon was studied to identify inconsistency and chromosome rearrangements. We assessed genome-wide nucleotide diversity, linkage disequilibrium (LD), and selective sweep for wild, semi-wild, and domesticated accessions of Citrullus lanatus var. lanatus to track signals of domestication. Principal component analysis combined with chromosome-wide phylogenetic study based on 1563 SNPs obtained after LD pruning with minor allele frequency of 0.05 resolved the differences between semi-wild and wild accessions as well as relationships among worldwide sweet watermelon. Population structure analysis revealed predominant ancestries for wild, semi-wild, and domesticated watermelons as well as admixture of various ancestries that were important for domestication. Sliding window analysis of Tajima's D across various chromosomes was used to resolve selective sweep. LD decay was estimated for various chromosomes. We identified a strong selective sweep on chromosome 3 consisting of important genes that might have had a role in sweet watermelon domestication. Copyright © 2014 Reddy et al.
Meiler, Arno; Klinger, Claudia; Kaufmann, Michael
2012-09-08
The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
DEFF Research Database (Denmark)
Hansen, Mette H H; Young, Sewall; Jørgensen, Hanne Birgitte Hede
2011-01-01
We establish a TaqMan-based assay panel for genotyping single-nucleotide polymorphisms in rainbow trout and steelhead (Oncorhynchus mykiss). We develop 22 novel single-nucleotide polymorphism markers based on new steelhead sequence data and on assays from sister taxa. Additionally, we adapt 154 p...
Directory of Open Access Journals (Sweden)
Henky Manoppo
2013-12-01
Full Text Available This research evaluated the nonspecific immune responseand growth of Litopenaeus vannamei fednucleotide diet. In Laboratory, juveniles were reared in two groups of glass aquaria, each with threereplications. Shrimps in group one were fed nucleotide diet and in group two were fedpellet four consecutiveweeks. Total Haemocyte Count and Phenoleoxydase activity were evaluated at the end of feeding whilegrowth was measured at two weeks interval. At the end of feeding, shrimps were intramuscularlyinjectedwith Vibrio harveyi 0.1x106 cfu.shrimp-1. In tambak, juveniles were raised in two groups of net cages(hapa, each with three replications. One group was fed nucleotide diet while the other wasfed pellet forfour weeks. Total Haemocyte Count of shrimp fed nucleotide diet significantly increased up to 87% higherthan shrimps fed pellet. Phenoleoxydase activity of shrimp fed nucleotides diet also increased isignificantlyas compared to shrimp fed pellet (p=0.02. Higher resistance and growth were observed in shrimp fednucleotide diet. In tambak, weight gain of shrimp fed nucleotide was 35.75% greater than shrimp fedpellet. Survival rate (83.24% was higher than shrimp fed pellet (81.71%. As conclusion, oral administrationof nucleotide at 400 mg.kg-1 diet could enhancethe nonspecific immune response, resistance, and growth ofL. vannamei.
Exploiting nucleotide composition to engineer promoters.
Directory of Open Access Journals (Sweden)
Manfred G Grabherr
Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.
Fenyk, Stepan; Townsend, Philip D.; Dixon, Christopher H.; Spies, Gerhard B.; de San Eustaquio Campillo, Alba; Slootweg, Erik J.; Westerhof, Lotte B.; Gawehns, Fleur K. K.; Knight, Marc R.; Sharples, Gary J.; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.
2015-01-01
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. PMID:26306038
Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles
Berti, Lorenzo; Burley, Glenn A.
2008-02-01
Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.
Genome-wide patterns of nucleotide polymorphism in domesticated rice
DEFF Research Database (Denmark)
Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D
2007-01-01
Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-04-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.
Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.
Richaud, F; Richaud, C; Ratet, P; Patte, J C
1986-01-01
In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578
Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.
2007-01-01
Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the
Srikant, C B; Dahan, A; Craig, C
1990-02-04
The tissue-selective binding of the two principal bioactive forms of somatostatin, somatostatin-14 (SS-14) and somatostatin-28 (SS-28), their ability to modulate cAMP-dependent and -independent regulation of post-receptor events to different degrees and the documentation of specific labelling of SS receptor subtypes with SS-28 but not SS-14 in discrete regions of rat brain suggest the existence of distinct SS-14 and SS-28 binding sites. Receptor binding of SS-14 ligands has been shown to be modulated by nucleotides and ions, but the effect of these agents on SS-28 binding has not been studied. In the present study we investigated the effects of adenine and guanine nucleotides as well as monovalent and divalent cations on rat brain SS receptors quantitated with radioiodinated analogs of SS-14 ([125I-Tyr11]SS14, referred to in this paper as SS-14) and SS-28 ([Leu8, D-Trp22, 125I-Tyr25] SS-28, referred to as LTT* SS-28) in order to determine if distinct receptor sites for SS-14 and SS-28 could be distinguished on the basis of their modulation by nucleotides and ions. GTP as well as ATP exerted a dose-dependent inhibition (over a concentration range of 10(-7)-10(-3) M) of the binding of the two radioligands. The nucleotide inhibition of binding resulted in a decrease the Bmax of the SS receptors, the binding affinity remaining unaltered. GTP (10(-4) M) decreased the Bmax of LTT* SS-28 binding sites to a greater extent than ATP (145 +/- 10 and 228 +/- 16 respectively, compared to control value of 320 +/- 20 pmol mg-1). Under identical conditions GTP was less effective than ATP in reducing the number of T* SS-14 binding sites (Bmax = 227 +/- 8 and 182 +/- 15, respectively, compared to 340 +/- 15 pmol mg-1 in the absence of nucleotides). Monovalent cations inhibited the binding of both radioligands, Li+ and Na+ inhibited the binding of T* SS-14 to a greater extent than K+. The effect of divalent cations on the other hand was varied. At low concentration (2 mM) Mg2+, Ba2
One-Pot, One-Step Production of Dietary Nucleotides by Magnetic Biocatalysts
Directory of Open Access Journals (Sweden)
Jon del Arco
2018-04-01
Full Text Available The enzymatic synthesis of nucleotides offers several advantages over traditional multistep chemical methods, such as stereoselectivity, regioselectivity, enantioselectivity, simple downstream processing, and the use of mild reaction conditions. However, in order to scale up these bioprocesses, several drawbacks, such as the low enzyme stability and recycling, must be considered. Enzyme immobilization may overcome these cost-related problems by enhancing protein stability and facilitating the separation of products. In this regard, tetrameric hypoxanthine–guanine–xanthine phosphoribosyltransferase (HGXPRT from Thermus thermophilus HB8 was covalently immobilized onto glutaraldehyde-activated MagReSyn®Amine magnetic iron oxide porous microparticles (MTtHGXPRT. In this context, two different strategies were followed: (a an enzyme immobilization through its N-terminus residues at pH 8.5 (derivatives MTtHGXPRT1-3; and (b a multipoint covalent immobilization through the surface lysine residues at pH 10 (derivatives MTtHGXPRT4-5. The immobilized derivatives of MTtHGXPRT3 (activity 1581 international units per gram of support, IU/g; retained activity 29% and MTtHGXPRT5 (activity 1108 IU/g; retained activity 23% displayed the best wet biocatalyst activity, and retained activity values in the enzymatic synthesis of inosine-5′-monophosphate (IMP. In addition, the dependence of the activities and stabilities of both derivatives on pH and temperature was tested, as well as their reusability potential. Taking these results into account, MTtHGXPRT3 was chosen as the best biocatalyst (negligible loss of activity at 60 °C during 24 h; reusable up to seven cycles. Finally, as proof of concept, the enzymatic production of dietary nucleotides from high concentrations of low soluble bases was achieved.
Directory of Open Access Journals (Sweden)
Geldner Niko
2005-02-01
Full Text Available Abstract Background Small G proteins, which are essential regulators of multiple cellular functions, are activated by guanine nucleotide exchange factors (GEFs that stimulate the exchange of the tightly bound GDP nucleotide by GTP. The catalytic domain responsible for nucleotide exchange is in general associated with non-catalytic domains that define the spatio-temporal conditions of activation. In the case of small G proteins of the Arf subfamily, which are major regulators of membrane trafficking, GEFs form a heterogeneous family whose only common characteristic is the well-characterized Sec7 catalytic domain. In contrast, the function of non-catalytic domains and how they regulate/cooperate with the catalytic domain is essentially unknown. Results Based on Sec7-containing sequences from fully-annotated eukaryotic genomes, including our annotation of these sequences from Paramecium, we have investigated the domain architecture of large ArfGEFs of the BIG and GBF subfamilies, which are involved in Golgi traffic. Multiple sequence alignments combined with the analysis of predicted secondary structures, non-structured regions and splicing patterns, identifies five novel non-catalytic structural domains which are common to both subfamilies, revealing that they share a conserved modular organization. We also report a novel ArfGEF subfamily with a domain organization so far unique to alveolates, which we name TBS (TBC-Sec7. Conclusion Our analysis unifies the BIG and GBF subfamilies into a higher order subfamily, which, together with their being the only subfamilies common to all eukaryotes, suggests that they descend from a common ancestor from which species-specific ArfGEFs have subsequently evolved. Our identification of a conserved modular architecture provides a background for future functional investigation of non-catalytic domains.
The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.
Hammond, R W; Crosslin, J M
1995-04-01
The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.
Dysfunctional Hyperpolarization-Activated Cyclic Nucleotide-gated Ion Channels in Cardiac Diseases
Directory of Open Access Journals (Sweden)
Xiaoqi Zhao
Full Text Available Abstract Hyperpolarization-activated cyclic nucleotide-gated (HCN channels are reverse voltage-dependent, and their activation depends on the hyperpolarization of the membrane and may be directly or indirectly regulated by the cyclic adenosine monophosphate (cAMP or other signal-transduction cascades. The distribution, quantity and activation states of HCN channels differ in tissues throughout the body. Evidence exhibits that HCN channels play critical roles in the generation and conduction of the electrical impulse and the physiopathological process of some cardiac diseases. They may constitute promising drug targets in the treatment of these cardiac diseases. Pharmacological treatment targeting HCN channels is of benefit to these cardiac conditions.
Processing closely spaced lesions during Nucleotide Excision Repair triggers mutagenesis in E. coli
Isogawa, Asako; Fujii, Shingo
2017-01-01
It is generally assumed that most point mutations are fixed when damage containing template DNA undergoes replication, either right at the fork or behind the fork during gap filling. Here we provide genetic evidence for a pathway, dependent on Nucleotide Excision Repair, that induces mutations when processing closely spaced lesions. This pathway, referred to as Nucleotide Excision Repair-induced Mutagenesis (NERiM), exhibits several characteristics distinct from mutations that occur within the course of replication: i) following UV irradiation, NER-induced mutations are fixed much more rapidly (t ½ ≈ 30 min) than replication dependent mutations (t ½ ≈ 80–100 min) ii) NERiM specifically requires DNA Pol IV in addition to Pol V iii) NERiM exhibits a two-hit dose-response curve that suggests processing of closely spaced lesions. A mathematical model let us define the geometry (infer the structure) of the toxic intermediate as being formed when NER incises a lesion that resides in close proximity of another lesion in the complementary strand. This critical NER intermediate requires Pol IV / Pol II for repair, it is either lethal if left unrepaired or mutation-prone when repaired. Finally, NERiM is found to operate in stationary phase cells providing an intriguing possibility for ongoing evolution in the absence of replication. PMID:28686598
Directory of Open Access Journals (Sweden)
Jacqueline Morris
2017-12-01
Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation
Molecular cloning and characterization of genes required for nucleotide excision repair in yeast
International Nuclear Information System (INIS)
Friedberg, E.C.
1987-01-01
Nucleotide excision repair in the yeast S. cerevisiae is a complex process which involves a large number of genes. At least five of these genes (RAD1, RAD2, RAD3, RAD4 and RAD10) are absolutely required for this process and mutations in any of these genes result in no detectable excision repair in vivo. In order to understand the function of these genes in DNA repair, the authors isolated a number of them by screening a yeast genomic library for recombinant plasmids which complement the phentoype of sensitivity to ultraviolet (UV) radiation imparted to mutant strains. A plasmid containing the RAD4 gene was isolated by an alternative strategy which will be discussed. The cloned genes have been extensively characterized. It has been determined that the RAD3 gene is essential for the viability of haploid yeast cells in the absence of DNA damage. The RAD2 gene is inducible by treatment of cells with a variety of DNA-damaging agents, including UV radiation and ionizing radiation. The RAD10 gene shares considerable amino acid sequence homology with a cloned gene involved in nucleotide excision repair in human cells. Yeast is a particularly versatile organism for studying gene function by molecular and genetic approaches and emphasis is placed on many of the techniques used in the present studies
Ferrell, Georgia; Lu, Minyan; Stoddard, Paul; Sammel, Mary D; Romero, Roberto; Strauss, Jerome F; Matthews, Catherine A
2009-05-01
Pelvic organ prolapse and preterm premature rupture of membranes, the 2 conditions which have in common weakening of the tensile strength of tissues, are thought to be caused, in part, by abnormal extracellular matrix synthesis and/or catabolism. We identified a new single nucleotide polymorphism (NT_010194(LOXL1):g.45008784A>C) in the promoter of the LOXL1 gene, which is essential for elastin synthesis. Promoter studies showed that the minor "C'' allele had significantly greater activity than the major "A'' allele. Case-control studies examined the association of the alleles of this single nucleotide polymorphism with pelvic organ prolapse and preterm premature rupture of membranes. When comparing allele frequencies and genotypes in pelvic organ prolapse cases versus controls, no significant associations were found. A case-control study conducted in African American neonates also found no significant associations between the promoter alleles and preterm premature rupture of membranes. We conclude that a functional single nucleotide polymorphism exists in the promoter region of the LOXL1 gene. Association studies suggest that the promoter single nucleotide polymorphism does not contribute significantly to risk of pelvic organ prolapse or preterm premature rupture of membranes.
I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)
1993-01-01
textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the
Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.
2017-01-01
PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the
DEFF Research Database (Denmark)
de Los Milagros Bassani Molinas, Maria; Beer, Christiane; Hesse, F
2014-01-01
Large scale, transient gene expression (TGE) is highly dependent of the physiological status of a cell line. Therefore, intracellular nucleotide pools and ratios were used for identifying and monitoring the optimal status of a suspension cell line used for TGE. The transfection efficiency upon po...
Few single nucleotide variations in exomes of human cord blood induced pluripotent stem cells.
Directory of Open Access Journals (Sweden)
Rui-Jun Su
Full Text Available The effect of the cellular reprogramming process per se on mutation load remains unclear. To address this issue, we performed whole exome sequencing analysis of induced pluripotent stem cells (iPSCs reprogrammed from human cord blood (CB CD34(+ cells. Cells from a single donor and improved lentiviral vectors for high-efficiency (2-14% reprogramming were used to examine the effects of three different combinations of reprogramming factors: OCT4 and SOX2 (OS, OS and ZSCAN4 (OSZ, OS and MYC and KLF4 (OSMK. Five clones from each group were subject to whole exome sequencing analysis. We identified 14, 11, and 9 single nucleotide variations (SNVs, in exomes, including untranslated regions (UTR, in the five clones of OSMK, OS, and OSZ iPSC lines. Only 8, 7, and 4 of these, respectively, were protein-coding mutations. An average of 1.3 coding mutations per CB iPSC line is remarkably lower than previous studies using fibroblasts and low-efficiency reprogramming approaches. These data demonstrate that point nucleotide mutations during cord blood reprogramming are negligible and that the inclusion of genome stabilizers like ZSCAN4 during reprogramming may further decrease reprogramming-associated mutations. Our findings provide evidence that CB is a superior source of cells for iPSC banking.
Directory of Open Access Journals (Sweden)
Xu Lizhe
2008-06-01
Full Text Available Abstract Background Serotypes of the Foot-and-Mouth disease viruses (FMDVs were generally determined by biological experiments. The computational genotyping is not well studied even with the availability of whole viral genomes, due to uneven evolution among genes as well as frequent genetic recombination. Naively using sequence comparison for genotyping is only able to achieve a limited extent of success. Results We used 129 FMDV strains with known serotype as training strains to select as many as 140 most serotype-specific nucleotide strings. We then constructed a linear-kernel Support Vector Machine classifier using these 140 strings. Under the leave-one-out cross validation scheme, this classifier was able to assign correct serotype to 127 of these 129 strains, achieving 98.45% accuracy. It also assigned serotype correctly to an independent test set of 83 other FMDV strains downloaded separately from NCBI GenBank. Conclusion Computational genotyping is much faster and much cheaper than the wet-lab based biological experiments, upon the availability of the detailed molecular sequences. The high accuracy of our proposed method suggests the potential of utilizing a few signature nucleotide strings instead of whole genomes to determine the serotypes of novel FMDV strains.
Moriyama, Yoshinori; Hiasa, Miki; Sakamoto, Shohei; Omote, Hiroshi; Nomura, Masatoshi
2017-09-01
Vesicular storage of ATP is one of the processes initiating purinergic chemical transmission. Although an active transport mechanism was postulated to be involved in the processes, a transporter(s) responsible for the vesicular storage of ATP remained unidentified for some time. In 2008, SLC17A9, the last identified member of the solute carrier 17 type I inorganic phosphate transporter family, was found to encode the vesicular nucleotide transporter (VNUT) that is responsible for the vesicular storage of ATP. VNUT transports various nucleotides in a membrane potential-dependent fashion and is expressed in the various ATP-secreting cells. Mice with knockout of the VNUT gene lose vesicular storage and release of ATP from neurons and neuroendocrine cells, resulting in blockage of the initiation of purinergic chemical transmission. Thus, VNUT plays an essential role in the vesicular storage and release of ATP. The VNUT knockout mice exhibit resistance for neuropathic pain and a therapeutic effect against diabetes by way of increased insulin sensitivity. Thus, VNUT inhibitors and suppression of VNUT gene expression may be used for therapeutic purposes through suppression of purinergic chemical transmission. This review summarizes the studies to date on VNUT and discusses what we have learned about the relevance of vesicular ATP release as a potential drug target.
Computational identification of candidate nucleotide cyclases in higher plants
Wong, Aloysius Tze
2013-09-03
In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.
Base-By-Base: Single nucleotide-level analysis of whole viral genome alignments
Directory of Open Access Journals (Sweden)
Tcherepanov Vasily
2004-07-01
Full Text Available Abstract Background With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes is not feasible without new bioinformatics tools. Results A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1 rapidly identify and correct alignment errors in large, multiple genome alignments; and 2 generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs to retrieve detailed annotation information about the aligned genomes or use information from text files. Conclusion Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.
Nucleotide sequence of the human N-myc gene
International Nuclear Information System (INIS)
Stanton, L.W.; Schwab, M.; Bishop, J.M.
1986-01-01
Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions
Adenine nucleotide translocator transports haem precursors into mitochondria.
Directory of Open Access Journals (Sweden)
Motoki Azuma
2008-08-01
Full Text Available Haem is a prosthetic group for haem proteins, which play an essential role in oxygen transport, respiration, signal transduction, and detoxification. In haem biosynthesis, the haem precursor protoporphyrin IX (PP IX must be accumulated into the mitochondrial matrix across the inner membrane, but its mechanism is largely unclear. Here we show that adenine nucleotide translocator (ANT, the inner membrane transporter, contributes to haem biosynthesis by facilitating mitochondrial accumulation of its precursors. We identified that haem and PP IX specifically bind to ANT. Mitochondrial uptake of PP IX was inhibited by ADP, a known substrate of ANT. Conversely, ADP uptake into mitochondria was competitively inhibited by haem and its precursors, suggesting that haem-related porphyrins are accumulated into mitochondria via ANT. Furthermore, disruption of the ANT genes in yeast resulted in a reduction of haem biosynthesis by blocking the translocation of haem precursors into the matrix. Our results represent a new model that ANT plays a crucial role in haem biosynthesis by facilitating accumulation of its precursors into the mitochondrial matrix.
Fenyk, Stepan; Townsend, Philip D; Dixon, Christopher H; Spies, Gerhard B; de San Eustaquio Campillo, Alba; Slootweg, Erik J; Westerhof, Lotte B; Gawehns, Fleur K K; Knight, Marc R; Sharples, Gary J; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J
2015-10-09
Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Ikushima, Shigehito; Tateishi, Yoshiyuki; Kanai, Keiko; Shimada, Emiko; Tanaka, Misa; Ishiguro, Tatsuji; Mizutani, Satoru; Kobayashi, Osamu
2012-04-01
Yeast plays a capital role in brewing fermentation and has a direct impact on flavor and aroma. For the evaluation of competent brewing strains during quality control or development of novel strains it is standard practice to perform fermentation tests, which are costly and time-consuming. Here, we have categorized DNA markers which enable to distinguish and to screen brewing strains more efficiently than ever before. Sequence analysis at 289 loci in the genomes of six bottom fermenting Saccharomyces pastorianus strains revealed that 30 loci contained single nucleotide polymorphisms (SNPs). By determining the nucleotide sequences at the SNP-loci in 26 other S. pastorianus strains and 20 strains of the top fermenting yeast Saccharomyces cerevisiae, almost all these strains could be discriminated solely on the basis of the SNPs. By comparing the fermentative phenotypes of these strains we found that some DNA markers showed a strong association with brewing characteristics, such as the production of ethyl acetate and hydrogen sulphide (H2S). Therefore, the DNA markers we identified will facilitate quality control and the efficient development of brewing yeast strains. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Cornett, L.E.; Norris, J.S.
1987-01-01
In this study the mechanisms involved in α 1 -adrenergic receptor-mediated Ca 2+ mobilization at the level of the plasma membrane were investigated. Stimulation of 45 Ca 2+ efflux from saponin-permeabilized DDT 1 MF-2 cells was observed with the addition of either the α 1 -adrenergic agonist phenylephrine and guanosine-5'-triphosphate or the nonhydrolyzable guanine nucleotide guanylyl-imidodiphosphate. In the presence of [ 32 P] NAD, pertussis toxin was found to catalyze ADP-ribosylation of a M/sub r/ = 40,500 (n = 8) peptide in membranes prepared from DDT 1 , MF-2 cells, possibly the α-subunit of N/sub i/. However, stimulation of unidirectional 45 Ca 2+ efflux by phenylephrine was not affected by previous treatment of cells with 100 ng/ml pertussis toxin. These data suggest that the putative guanine nucleotide-binding protein which couples the α 1 -adrenergic receptor to Ca 2+ mobilization in DDT 1 MF-2 cells is not a pertussis toxin substrate and may possibly be an additional member of guanine nucleotide binding protein family
The objective of this study is to investigate single nucleotide polymorphism (SNP) genotypes imputation of Hereford cattle. Purebred Herefords were from two sources, Line 1 Hereford (N=240) and representatives of Industry Herefords (N=311). Using different reference panels of 62 and 494 males with 1...
Energy Technology Data Exchange (ETDEWEB)
Franzolin, Elisa; Miazzi, Cristina; Frangini, Miriam; Palumbo, Elisa; Rampazzo, Chiara [Department of Biology, University of Padova, Via Ugo Bassi 58B, I-35131 Padova (Italy); Bianchi, Vera, E-mail: vbianchi@bio.unipd.it [Department of Biology, University of Padova, Via Ugo Bassi 58B, I-35131 Padova (Italy)
2012-10-15
In cycling cells cytosolic de novo synthesis of deoxynucleotides is the main source of precursors for mitochondrial (mt) DNA synthesis. The transfer of deoxynucleotides across the inner mt membrane requires protein carriers. PNC1, a SLC25 family member, exchanges pyrimidine nucleoside triphosphates in liposomes and its downregulation decreases mtUTP concentration in cultured cells. By an isotope-flow protocol we confirmed transport of uridine nucleotides by PNC1 in intact cultured cells and investigated PNC1 involvement in the mt trafficking of thymidine phosphates. Key features of our approach were the manipulation of PNC1 expression by RNA interference or inducible overexpression, the employment of cells proficient or deficient for cytosolic thymidine kinase (TK1) to distinguish the direction of flow of thymidine nucleotides across the mt membrane during short pulses with [{sup 3}H]-thymidine, the determination of mtdTTP specific radioactivity to quantitate the rate of mtdTTP export to the cytoplasm. Downregulation of PNC1 in TK1{sup -} cells increased labeled dTTP in mitochondria due to a reduced rate of export. Overexpression of PNC1 in TK1{sup +} cells increased mtdTTP pool size and radioactivity, suggesting an involvement in the import of thymidine phosphates. Thus PNC1 is a component of the network regulating the mtdTTP pool in human cells. -- Highlights: Black-Right-Pointing-Pointer Thymidine phosphates exchange between mitochondria and cytosol in mammalian cells. Black-Right-Pointing-Pointer siRNA-downregulation of PNC1 delays mitochondrial dTTP export in TK1{sup -} cells. Black-Right-Pointing-Pointer PNC1 overexpression accumulates dTTP in mitochondria of TK1{sup +} cells. Black-Right-Pointing-Pointer PNC1 exchanges thymidine nucleotides across the mitochondrial inner membrane. Black-Right-Pointing-Pointer PNC1 participates in the regulation of the mtdTTP pool supporting mtDNA synthesis.
International Nuclear Information System (INIS)
Franzolin, Elisa; Miazzi, Cristina; Frangini, Miriam; Palumbo, Elisa; Rampazzo, Chiara; Bianchi, Vera
2012-01-01
In cycling cells cytosolic de novo synthesis of deoxynucleotides is the main source of precursors for mitochondrial (mt) DNA synthesis. The transfer of deoxynucleotides across the inner mt membrane requires protein carriers. PNC1, a SLC25 family member, exchanges pyrimidine nucleoside triphosphates in liposomes and its downregulation decreases mtUTP concentration in cultured cells. By an isotope-flow protocol we confirmed transport of uridine nucleotides by PNC1 in intact cultured cells and investigated PNC1 involvement in the mt trafficking of thymidine phosphates. Key features of our approach were the manipulation of PNC1 expression by RNA interference or inducible overexpression, the employment of cells proficient or deficient for cytosolic thymidine kinase (TK1) to distinguish the direction of flow of thymidine nucleotides across the mt membrane during short pulses with [ 3 H]-thymidine, the determination of mtdTTP specific radioactivity to quantitate the rate of mtdTTP export to the cytoplasm. Downregulation of PNC1 in TK1 − cells increased labeled dTTP in mitochondria due to a reduced rate of export. Overexpression of PNC1 in TK1 + cells increased mtdTTP pool size and radioactivity, suggesting an involvement in the import of thymidine phosphates. Thus PNC1 is a component of the network regulating the mtdTTP pool in human cells. -- Highlights: ► Thymidine phosphates exchange between mitochondria and cytosol in mammalian cells. ► siRNA-downregulation of PNC1 delays mitochondrial dTTP export in TK1 − cells. ► PNC1 overexpression accumulates dTTP in mitochondria of TK1 + cells. ► PNC1 exchanges thymidine nucleotides across the mitochondrial inner membrane. ► PNC1 participates in the regulation of the mtdTTP pool supporting mtDNA synthesis.
Directory of Open Access Journals (Sweden)
Kiterie M E Faller
Full Text Available Reduced levels of creatine and total adenine nucleotides (sum of ATP, ADP and AMP are hallmarks of chronic heart failure and restoring these pools is predicted to be beneficial by maintaining the diseased heart in a more favourable energy state. Ribose supplementation is thought to support both salvage and re-synthesis of adenine nucleotides by bypassing the rate-limiting step. We therefore tested whether ribose would be beneficial in chronic heart failure in control mice and in mice with elevated myocardial creatine due to overexpression of the creatine transporter (CrT-OE.FOUR GROUPS WERE STUDIED: sham; myocardial infarction (MI; MI+ribose; MI+CrT-OE+ribose. In a pilot study, ribose given in drinking water was bioavailable, resulting in a two-fold increase in myocardial ribose-5-phosphate levels. However, 8 weeks post-surgery, total adenine nucleotide (TAN pool was decreased to a similar amount (8-14% in all infarcted groups irrespective of the treatment received. All infarcted groups also presented with a similar and substantial degree of left ventricular (LV dysfunction (3-fold reduction in ejection fraction and LV hypertrophy (32-47% increased mass. Ejection fraction closely correlated with infarct size independently of treatment (r(2 = 0.63, p<0.0001, but did not correlate with myocardial creatine or TAN levels.Elevating myocardial ribose and creatine levels failed to maintain TAN pool or improve post-infarction LV remodeling and function. This suggests that ribose is not rate-limiting for purine nucleotide biosynthesis in the chronically failing mouse heart and that alternative strategies to preserve TAN pool should be investigated.
Hwang, Hanshin; Taylor, John-Stephen
2005-03-29
We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the
Co-operation between Polymerases and Nucleotide Synthetases in the RNA World.
Directory of Open Access Journals (Sweden)
Ye Eun Kim
2016-11-01
Full Text Available It is believed that life passed through an RNA World stage in which replication was sustained by catalytic RNAs (ribozymes. The two most obvious types of ribozymes are a polymerase, which uses a neighbouring strand as a template to make a complementary sequence to the template, and a nucleotide synthetase, which synthesizes monomers for use by the polymerase. When a chemical source of monomers is available, the polymerase can survive on its own. When the chemical supply of monomers is too low, nucleotide production by the synthetase is essential and the two ribozymes can only survive when they are together. Here we consider a computational model to investigate conditions under which coexistence and cooperation of these two types of ribozymes is possible. The model considers six types of strands: the two functional sequences, the complementary strands to these sequences (which are required as templates, and non-functional mutants of the two sequences (which act as parasites. Strands are distributed on a two-dimensional lattice. Polymerases replicate strands on neighbouring sites and synthetases produce monomers that diffuse in the local neighbourhood. We show that coexistence of unlinked polymerases and synthetases is possible in this spatial model under conditions in which neither sequence could survive alone; hence, there is a selective force for increasing complexity. Coexistence is dependent on the relative lengths of the two functional strands, the strand diffusion rate, the monomer diffusion rate, and the rate of deleterious mutations. The sensitivity of this two-ribozyme system suggests that evolution of a system of many types of ribozymes would be difficult in a purely spatial model with unlinked genes. We therefore speculate that linkage of genes onto mini-chromosomes and encapsulation of strands in protocells would have been important fairly early in the history of life as a means of enabling more complex systems to evolve.
Molecular modeling study for interaction between Bacillus subtilis Obg and Nucleotides.
Directory of Open Access Journals (Sweden)
Yuno Lee
Full Text Available The bacterial Obg proteins (Spo0B-associated GTP-binding protein belong to the subfamily of P-loop GTPase proteins that contain two equally and highly conserved domains, a C-terminal GTP binding domain and an N-terminal glycine-rich domain which is referred as the "Obg fold" and now it is considered as one of the new targets for antibacterial drug. When the Obg protein is associated with GTP, it becomes activated, because conformation of Obg fold changes due to the structural changes of GTPase switch elements in GTP binding site. In order to investigate the effects and structural changes in GTP bound to Obg and GTPase switch elements for activation, four different molecular dynamics (MD simulations were performed with/without the three different nucleotides (GTP, GDP, and GDP + Pi using the Bacillus subtilis Obg (BsObg structure. The protein structures generated from the four different systems were compared using their representative structures. The pattern of C(alpha-C(alpha distance plot and angle between the two Obg fold domains of simulated apo form and each system (GTP, GDP, and GDP+Pi were significantly different in the GTP-bound system from the others. The switch 2 element was significantly changed in GTP-bound system. Also root-mean-square fluctuation (RMSF analysis revealed that the flexibility of the switch 2 element region was much higher than the others. This was caused by the characteristic binding mode of the nucleotides. When GTP was bound to Obg, its gamma-phosphate oxygen was found to interact with the key residue (D212 of the switch 2 element, on the contrary there was no such interaction found in other systems. Based on the results, we were able to predict the possible binding conformation of the activated form of Obg with L13, which is essential for the assembly with ribosome.
Directory of Open Access Journals (Sweden)
Sourabh Chand
Full Text Available Immunosuppression is cornerstone treatment of antineutrophil cytoplasmic antibody associated vasculitis (AAV but is later complicated by infection, cancer, cardiovascular and chronic kidney disease. Caveolin-1 is an essential structural protein for small cell membrane invaginations known as caveolae. Its functional role has been associated with these complications. For the first time, caveolin-1 (CAV1 gene variation is studied in AAV.CAV1 single nucleotide polymorphism rs4730751 was analysed in genomic DNA from 187 white patients with AAV from Birmingham, United Kingdom. The primary outcome measure was the composite endpoint of time to all-cause mortality or renal replacement therapy. Secondary endpoints included time to all-cause mortality, death from sepsis or vascular disease, cancer and renal replacement therapy. Validation of results was sought from 589 white AAV patients, from two European cohorts.The primary outcome occurred in 41.7% of Birmingham patients. In a multivariate model, non-CC genotype variation at the studied single nucleotide polymorphism was associated with increased risk from: the primary outcome measure [HR 1.86; 95% CI: 1.14-3.04; p=0.013], all-cause mortality [HR:1.83; 95% CI: 1.02-3.27; p=0.042], death from infection [HR:3.71; 95% CI: 1.28-10.77; p=0.016], death from vascular disease [HR:3.13; 95% CI: 1.07-9.10; p=0.037], and cancer [HR:5.55; 95% CI: 1.59-19.31; p=0.007]. In the validation cohort, the primary outcome rate was far lower (10.4%; no association between genotype and the studied endpoints was evident.The presence of a CC genotype in Birmingham is associated with protection from adverse outcomes of immunosuppression treated AAV. Lack of replication in the European cohort may have resulted from low clinical event rates. These findings are worthy of further study in larger cohorts.
Directory of Open Access Journals (Sweden)
Manjula Pandey
2014-03-01
Full Text Available By simultaneously measuring DNA synthesis and dNTP hydrolysis, we show that T7 DNA polymerase and T7 gp4 helicase move in sync during leading-strand synthesis, taking one-nucleotide steps and hydrolyzing one dNTP per base-pair unwound/copied. The cooperative catalysis enables the helicase and polymerase to move at a uniformly fast rate without guanine:cytosine (GC dependency or idling with futile NTP hydrolysis. We show that the helicase and polymerase are located close to the replication fork junction. This architecture enables the polymerase to use its strand-displacement synthesis to increase the unwinding rate, whereas the helicase aids this process by translocating along single-stranded DNA and trapping the unwound bases. Thus, in contrast to the helicase-only unwinding model, our results suggest a model in which the helicase and polymerase are moving in one-nucleotide steps, DNA synthesis drives fork unwinding, and a role of the helicase is to trap the unwound bases and prevent DNA reannealing.
Ryu, J; Lee, C
2016-04-01
Selection signals of Korean cattle might be attributed largely to artificial selection for meat quality. Rapidly increased intragenic markers of newly annotated genes in the bovine genome would help overcome limited findings of genetic markers associated with meat quality at the selection signals in a previous study. The present study examined genetic associations of marbling score (MS) with intragenic nucleotide variants at selection signals of Korean cattle. A total of 39 092 nucleotide variants of 407 Korean cattle were utilized in the association analysis. A total of 129 variants were selected within newly annotated genes in the bovine genome. Their genetic associations were analyzed using the mixed model with random polygenic effects based on identical-by-state genetic relationships among animals in order to control for spurious associations produced by population structure. Genetic associations of MS were found (Pdirectional selection for greater MS and remain selection signals in the bovine genome. Further studies of fine mapping would be useful to incorporate favorable alleles in marker-assisted selection for MS of Korean cattle.
Nucleotide sequence alignment of hdcA from Gram-positive bacteria.
Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A
2016-03-01
The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].
Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah
Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.
Directory of Open Access Journals (Sweden)
Heinz Ruth A
2008-01-01
Full Text Available Abstract Background Association analysis is a powerful tool to identify gene loci that may contribute to phenotypic variation. This includes the estimation of nucleotide diversity, the assessment of linkage disequilibrium structure (LD and the evaluation of selection processes. Trait mapping by allele association requires a high-density map, which could be obtained by the addition of Single Nucleotide Polymorphisms (SNPs and short insertion and/or deletions (indels to SSR and AFLP genetic maps. Nucleotide diversity analysis of randomly selected candidate regions is a promising approach for the success of association analysis and fine mapping in the sunflower genome. Moreover, knowledge of the distance over which LD persists, in agronomically meaningful sunflower accessions, is important to establish the density of markers and the experimental design for association analysis. Results A set of 28 candidate genes related to biotic and abiotic stresses were studied in 19 sunflower inbred lines. A total of 14,348 bp of sequence alignment was analyzed per individual. In average, 1 SNP was found per 69 nucleotides and 38 indels were identified in the complete data set. The mean nucleotide polymorphism was moderate (θ = 0.0056, as expected for inbred materials. The number of haplotypes per region ranged from 1 to 9 (mean = 3.54 ± 1.88. Model-based population structure analysis allowed detection of admixed individuals within the set of accessions examined. Two putative gene pools were identified (G1 and G2, with a large proportion of the inbred lines being assigned to one of them (G1. Consistent with the absence of population sub-structuring, LD for G1 decayed more rapidly (r2 = 0.48 at 643 bp; trend line, pooled data than the LD trend line for the entire set of 19 individuals (r2 = 0.64 for the same distance. Conclusion Knowledge about the patterns of diversity and the genetic relationships between breeding materials could be an invaluable aid in crop
Guo, Sheng; Duan, Jin-ao; Qian, Dawei; Wang, Hanqing; Tang, Yuping; Qian, Yefei; Wu, Dawei; Su, Shulan; Shang, Erxin
2013-08-02
In this study, a rapid and sensitive analytical method was developed for the determination of 20 nucleobases, nucleosides and nucleotides in Ziziphus plants at trace levels by using hydrophilic interaction ultra-high performance liquid chromatography coupled with triple-quadrupole tandem mass spectrometry (HILIC-UHPLC-TQ-MS/MS) in multiple-reaction monitoring (MRM) mode. Under the optimized chromatographic conditions, good separation for 20 target compounds were obtained on a UHPLC Amide column with sub-2μm particles within 10min. The overall LODs and LOQs were between 0.11-3.12ngmL(-1) and 0.29-12.48ngmL(-1) for the 20 analytes, respectively. It is the first report about simultaneous analysis of nucleobases, nucleosides and nucleotides in medicinal plants using HILIC-UHPLC-TQ-MS/MS method, which affords good linearity, precision, repeatability and accuracy. The developed method was successfully applied to Ziziphus plant (Z. jujuba, Z. jujuba var. spinosa and Z. mauritiana) samples. The analysis showed that the fruits and leaves of Ziziphus plants are rich in nucleosides and nucleobases as well as nucleotides, and could be selected as the healthy food resources. Our results in present study suggest that HILIC-UHPLC-TQ-MS/MS method could be employed as a useful tool for quality assessment of the samples from the Ziziphus plants as well as other medicinal plants or food samples using nucleotides, nucleosides and nucleobases as markers. Copyright © 2013 Elsevier B.V. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Raindlová, Veronika; Pohl, Radek; Hocek, Michal
2012-01-01
Roč. 18, č. 13 (2012), s. 4080-4087 ISSN 0947-6539 R&D Projects: GA ČR GA203/09/0317 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleotides * aldehydes * DNA * reductive amination * bioconjugations Subject RIV: CC - Organic Chemistry Impact factor: 5.831, year: 2012
DEFF Research Database (Denmark)
Moss, Jennifer; Tinline-Purvis, Helen; Walker, Carol A
2010-01-01
Nucleotide synthesis is a universal response to DNA damage, but how this response facilitates DNA repair and cell survival is unclear. Here we establish a role for DNA damage-induced nucleotide synthesis in homologous recombination (HR) repair in fission yeast. Using a genetic screen, we found...... the Ddb1-Cul4(Cdt)² ubiquitin ligase complex and ribonucleotide reductase (RNR) to be required for HR repair of a DNA double-strand break (DSB). The Ddb1-Cul4(Cdt)² ubiquitin ligase complex is required for degradation of Spd1, an inhibitor of RNR in fission yeast. Accordingly, deleting spd1(+) suppressed...
Han, Weinong; Ming, Mei; Zhao, Rui; Pi, Jingbo; Wu, Chunli; He, Yu-Ying
2012-05-25
Skin cancer is the most common cancer in the United States. Its major environmental risk factor is UVB radiation in sunlight. In response to UVB damage, epidermal keratinocytes activate a specific repair pathway, i.e. nucleotide excision repair, to remove UVB-induced DNA lesions. However, the regulation of UVB response is not fully understood. Here we show that the long isoform of the nuclear factor erythroid 2-related factor 1 (Nrf1, also called NFE2L1), a cytoprotective transcription factor critical for the expression of multiple antioxidant response element-dependent genes, plays an important role in the response of keratinocytes to UVB. Nrf1 loss sensitized keratinocytes to UVB-induced apoptosis by up-regulating the expression of the proapoptotic Bcl-2 family member Bik through reducing glutathione levels. Knocking down Bik reduced UVB-induced apoptosis in Nrf1-inhibited cells. In UVB-irradiated surviving cells, however, disruption of Nrf1 impaired nucleotide excision repair through suppressing the transcription of xeroderma pigmentosum C (XPC), a factor essential for initiating the global genome nucleotide excision repair by recognizing the DNA lesion and recruiting downstream factors. Nrf1 enhanced XPC expression by increasing glutathione availability but was independent of the transcription repressor of XPC. Adding XPC or glutathione restored the DNA repair capacity in Nrf1-inhibited cells. Finally, we demonstrate that Nrf1 levels are significantly reduced by UVB radiation in mouse skin and are lower in human skin tumors than in normal skin. These results indicate a novel role of Nrf1 in UVB-induced DNA damage repair and suggest Nrf1 as a tumor suppressor in the skin.
Robart, Aaron R; O'Connor, Catherine M; Collins, Kathleen
2010-03-01
Telomerase adds simple-sequence repeats to chromosome 3' ends to compensate for the loss of repeats with each round of genome replication. To accomplish this de novo DNA synthesis, telomerase uses a template within its integral RNA component. In addition to providing the template, the telomerase RNA subunit (TER) also harbors nontemplate motifs that contribute to the specialized telomerase catalytic cycle of reiterative repeat synthesis. Most nontemplate TER motifs function through linkage with the template, but in ciliate and vertebrate telomerases, a stem-loop motif binds telomerase reverse transcriptase (TERT) and reconstitutes full activity of the minimal recombinant TERT+TER RNP, even when physically separated from the template. Here, we resolve the functional requirements for this motif of ciliate TER in physiological RNP context using the Tetrahymena thermophila p65-TER-TERT core RNP reconstituted in vitro and the holoenzyme reconstituted in vivo. Contrary to expectation based on assays of the minimal recombinant RNP, we find that none of a panel of individual loop IV nucleotide substitutions impacts the profile of telomerase product synthesis when reconstituted as physiological core RNP or holoenzyme RNP. However, loop IV nucleotide substitutions do variably reduce assembly of TERT with the p65-TER complex in vitro and reduce the accumulation and stability of telomerase RNP in endogenous holoenzyme context. Our results point to a unifying model of a conformational activation role for this TER motif in the telomerase RNP enzyme.
Anthony, R. M.; Schuitema, A. R. J.; Chan, A. B.; Boender, P. J.; Klatser, P. R.; Oskam, L.
2003-01-01
Oligonucleotide arrays capable of detecting single nucleotide polymorphisms (SNPs) from amplified nucleic acid have many applications. The expected SNP is usually placed approximately in the center of the probe to ensure the maximum shift in Tm between complementary and SNP sequences. Unfortunately,
DEFF Research Database (Denmark)
Guilfoyle, Amy P.; Deshpande, Chandrika N.; Font Sadurni, Josep
2014-01-01
, biophysical studies on both the eukaryotic Gα proteins and the GTPase domain (NFeoB) of prokaryotic FeoB proteins have revealed conformational changes in the G5 loop that accompany nucleotide binding and release. However, it is unclear whether this conformational change in the G5 loop is a prerequisite...
Romero, Francisco; Santana-Calvo, Carmen; Sánchez-Guevara, Yoloxochitl; Nishigaki, Takuya
2017-09-01
The cyclic nucleotide-binding domain (CNBD) functions as a regulatory domain of many proteins involved in cyclic nucleotide signalling. We developed a straightforward and reliable binding assay based on intermolecular fluorescence resonance energy transfer (FRET) between an adenosine-3', 5'-cyclic monophosphate analogue labelled with fluorescein and a recombinant CNBD of human EPAC1 tagged with a cyan fluorescence protein (CFP). The high FRET efficiency of this method (~ 80%) allowed us to perform several types of binding experiments with nanomolar range of sample using conventional equipment. In addition, the CFP tag on the CNBD enabled us to perform a specific binding experiment using an unpurified protein. Considering these advantages, this technique is useful to study poorly characterized CNBDs. © 2017 Federation of European Biochemical Societies.
Takaya, Akiko; Sato, Yoshiharu; Shoji, Tatsuma; Yamamoto, Tomoko
2013-08-01
Several posttranscriptional modifications of bacterial rRNAs are important in determining antibiotic resistance or sensitivity. In all Gram-positive bacteria, dimethylation of nucleotide A2058, located in domain V of 23S rRNA, by the dimethyltransferase Erm(B) results in low susceptibility and resistance to telithromycin (TEL). However, this is insufficient to produce high-level resistance to TEL in Streptococcus pneumoniae. Inactivation of the methyltransferase RlmA(II), which methylates the N-1 position of nucleotide G748, located in hairpin 35 of domain II of 23S rRNA, results in increased resistance to TEL in erm(B)-carrying S. pneumoniae. Sixteen TEL-resistant mutants (MICs, 16 to 32 μg/ml) were obtained from a clinically isolated S. pneumoniae strain showing low TEL susceptibility (MIC, 2 μg/ml), with mutation resulting in constitutive dimethylation of A2058 because of nucleotide differences in the regulatory region of erm(B) mRNA. Primer extension analysis showed that the degree of methylation at G748 in all TEL-resistant mutants was significantly reduced by a mutation in the gene encoding RlmA(II) to create a stop codon or change an amino acid residue. Furthermore, RNA footprinting with dimethyl sulfate and a molecular modeling study suggested that methylation of G748 may contribute to the stable interaction of TEL with domain II of 23S rRNA, even after dimethylation of A2058 by Erm(B). This novel finding shows that methylation of G748 by RlmA(II) renders S. pneumoniae TEL susceptible.
International Nuclear Information System (INIS)
Steenbergh, P.H.
1979-01-01
The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)
An affinity pull-down approach to identify the plant cyclic nucleotide interactome
Donaldson, Lara Elizabeth; Meier, Stuart Kurt
2013-01-01
Cyclic nucleotides (CNs) are intracellular second messengers that play an important role in mediating physiological responses to environmental and developmental signals, in species ranging from bacteria to humans. In response to these signals, CNs are synthesized by nucleotidyl cyclases and then act by binding to and altering the activity of downstream target proteins known as cyclic nucleotide-binding proteins (CNBPs). A number of CNBPs have been identified across kingdoms including transcription factors, protein kinases, phosphodiesterases, and channels, all of which harbor conserved CN-binding domains. In plants however, few CNBPs have been identified as homology searches fail to return plant sequences with significant matches to known CNBPs. Recently, affinity pull-down techniques have been successfully used to identify CNBPs in animals and have provided new insights into CN signaling. The application of these techniques to plants has not yet been extensively explored and offers an alternative approach toward the unbiased discovery of novel CNBP candidates in plants. Here, an affinity pull-down technique for the identification of the plant CN interactome is presented. In summary, the method involves an extraction of plant proteins which is incubated with a CN-bait, followed by a series of increasingly stringent elutions that eliminates proteins in a sequential manner according to their affinity to the bait. The eluted and bait-bound proteins are separated by one-dimensional gel electrophoresis, excised, and digested with trypsin after which the resultant peptides are identified by mass spectrometry - techniques that are commonplace in proteomics experiments. The discovery of plant CNBPs promises to provide valuable insight into the mechanism of CN signal transduction in plants. © Springer Science+Business Media New York 2013.
An affinity pull-down approach to identify the plant cyclic nucleotide interactome
Donaldson, Lara Elizabeth
2013-09-03
Cyclic nucleotides (CNs) are intracellular second messengers that play an important role in mediating physiological responses to environmental and developmental signals, in species ranging from bacteria to humans. In response to these signals, CNs are synthesized by nucleotidyl cyclases and then act by binding to and altering the activity of downstream target proteins known as cyclic nucleotide-binding proteins (CNBPs). A number of CNBPs have been identified across kingdoms including transcription factors, protein kinases, phosphodiesterases, and channels, all of which harbor conserved CN-binding domains. In plants however, few CNBPs have been identified as homology searches fail to return plant sequences with significant matches to known CNBPs. Recently, affinity pull-down techniques have been successfully used to identify CNBPs in animals and have provided new insights into CN signaling. The application of these techniques to plants has not yet been extensively explored and offers an alternative approach toward the unbiased discovery of novel CNBP candidates in plants. Here, an affinity pull-down technique for the identification of the plant CN interactome is presented. In summary, the method involves an extraction of plant proteins which is incubated with a CN-bait, followed by a series of increasingly stringent elutions that eliminates proteins in a sequential manner according to their affinity to the bait. The eluted and bait-bound proteins are separated by one-dimensional gel electrophoresis, excised, and digested with trypsin after which the resultant peptides are identified by mass spectrometry - techniques that are commonplace in proteomics experiments. The discovery of plant CNBPs promises to provide valuable insight into the mechanism of CN signal transduction in plants. © Springer Science+Business Media New York 2013.
Cortijo, J; Naline, E; Ortiz, J L; Berto, L; Girard, V; Malbezin, M; Advenier, C; Morcillo, E J
1998-01-02
We have investigated the role of human bronchial cyclic nucleotide phosphodiesterases in the effects of fenspiride, a drug endowed with bronchodilator and anti-inflammatory properties. Functional studies on human isolated bronchi showed that fenspiride (10(-6)-3 x 10(-3) M, 30 min) induced a shift to the left of the concentration-response curves for isoprenaline and sodium nitroprusside with -logEC50 values of 4.1+/-0.1 (n = 7) and 3.5+/-0.2 (n = 8), respectively. Biochemical studies were carried out on three human bronchi in which separation of cyclic nucleotide phosphodiesterase isoenzymes was performed by ion exchange chromatography followed by determination of phosphodiesterase activity with a radioisotopic method. Phosphodiesterase 4 (cyclic AMP-specific) and phosphodiesterase 5 (cyclic GMP-specific) were the major phosphodiesterase isoforms present in the human bronchial tissue. The presence of phosphodiesterase 1 (Ca2+/calmodulin-stimulated), phosphodiesterase 2 (cyclic GMP-stimulated) and, in two cases, phosphodiesterase 3 (cyclic GMP-inhibited) was also identified. Fenspiride inhibited phosphodiesterase 4 and phosphodiesterase 3 activities with -logIC50 values of 4.16+/-0.09 and 3.44+/-0.12, respectively. Phosphodiesterase 5 activity was also inhibited with a -logIC50 value of approximately 3.8. Fenspiride (fenspiride is an effective inhibitor of both cyclic AMP and cyclic GMP hydrolytic activity in human bronchial tissues and this action may contribute to its airway effects.
NDR1 modulates the UV-induced DNA-damage checkpoint and nucleotide excision repair
Energy Technology Data Exchange (ETDEWEB)
Park, Jeong-Min; Choi, Ji Ye [Department of Biological Science, Dong-A University, Busan (Korea, Republic of); Yi, Joo Mi [Research Center, Dongnam Institute of Radiological & Medical Sciences, Busan (Korea, Republic of); Chung, Jin Woong; Leem, Sun-Hee; Koh, Sang Seok [Department of Biological Science, Dong-A University, Busan (Korea, Republic of); Kang, Tae-Hong, E-mail: thkang@dau.ac.kr [Department of Biological Science, Dong-A University, Busan (Korea, Republic of)
2015-06-05
Nucleotide excision repair (NER) is the sole mechanism of UV-induced DNA lesion repair in mammals. A single round of NER requires multiple components including seven core NER factors, xeroderma pigmentosum A–G (XPA–XPG), and many auxiliary effector proteins including ATR serine/threonine kinase. The XPA protein helps to verify DNA damage and thus plays a rate-limiting role in NER. Hence, the regulation of XPA is important for the entire NER kinetic. We found that NDR1, a novel XPA-interacting protein, modulates NER by modulating the UV-induced DNA-damage checkpoint. In quiescent cells, NDR1 localized mainly in the cytoplasm. After UV irradiation, NDR1 accumulated in the nucleus. The siRNA knockdown of NDR1 delayed the repair of UV-induced cyclobutane pyrimidine dimers in both normal cells and cancer cells. It did not, however, alter the expression levels or the chromatin association levels of the core NER factors following UV irradiation. Instead, the NDR1-depleted cells displayed reduced activity of ATR for some set of its substrates including CHK1 and p53, suggesting that NDR1 modulates NER indirectly via the ATR pathway. - Highlights: • NDR1 is a novel XPA-interacting protein. • NDR1 accumulates in the nucleus in response to UV irradiation. • NDR1 modulates NER (nucleotide excision repair) by modulating the UV-induced DNA-damage checkpoint response.
DEFF Research Database (Denmark)
Milne, Roger L; Benítez, Javier; Nevanlinna, Heli
2009-01-01
BACKGROUND: A recent genome-wide association study identified single-nucleotide polymorphism (SNP) 2q35-rs13387042 as a marker of susceptibility to estrogen receptor (ER)-positive breast cancer. We attempted to confirm this association using the Breast Cancer Association Consortium. METHODS: 2q35...
Directory of Open Access Journals (Sweden)
Meiler Arno
2012-09-01
Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.
2012-01-01
Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836
Radicals of DNA and DNA nucleotides generated by ionising radiation
International Nuclear Information System (INIS)
Przybytniak, G.
2004-01-01
A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited
Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise
DEFF Research Database (Denmark)
Mohr, Magni; Rasmussen, Peter; Drust, Barry
2006-01-01
) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following......Abstract This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling...... exercise with heat stress, the core and muscle temperatures peaked at 39.5±0.2 and 40.2±0.2°C to be ~ 1°C higher (Pheat stress trial (P
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
2010-07-01
... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...
Energy Technology Data Exchange (ETDEWEB)
Yamauchi, Takahiro; Kawai, Yasukazu; Ueda, Takanori [Fukui Medical Univ., Matsuoka (Japan)
2002-05-01
Alkylating agents or platinum analogues initiate several excision repair mechanisms, which involve incision of the DNA strand, excision of the damaged nucleotide, gap filling by DNA resynthesis, and rejoining by ligation. The previous study described that nucleotide excision repair permitted incorporation of fludarabine nucleoside (F-area-A) into the repair patch, thereby inhibiting the DNA resynthesis. In the present study, to clarify the repair kinetics in view of the inhibition by F-ara-A, normal lymphocytes were stimulated to undergo nucleotide excision repair by ultraviolet C (UV) irradiation in the presence or absence of F-ara-A. The repair kinetics were determined as DNA single strand breaks resulting from the incision and the rejoining using the alkaline single cell gel electrophoresis (comet) assay. DNA resynthesis was evaluated in terms of the uptake of tritiated thymidine into DNA. The lymphocytes initiated the incision step maximally at 1 h, and completed the rejoining process within 4 h after UV exposure. UV also initiated thymidine uptake, which increased time-dependently and reached a plateau at 4 h. A 2-h pre-incubation with F-ara-A inhibited the repair in a concentration-dependent manner, with the maximal inhibition by 5 {mu}M. This inhibitory effect was demonstrated by the reduction of the thymidine uptake and by the inhibition of the rejoining. A DNA polymerase inhibitor, aphidicolin, and a ribonucleotide reductase inhibitor, hydroxyurea, were not so inhibitory to the repair process as F-ara-A at equimolar concentrations. The present findings suggest that inhibition of nucleotide excision repair may represent a novel therapeutic strategy against cancer, especially in the context of resistant cells with an increased repair capacity. (author)
Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando
2014-01-01
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. PMID:25320081
Choudhury, Baharul Islam; Khan, Mohammed Latif; Dayanandan, Selvadurai
2014-06-16
During the domestication of crops, individual plants with traits desirable for human needs have been selected from their wild progenitors. Consequently, genetic and nucleotide diversity of genes associated with these selected traits in crop plants are expected to be lower than their wild progenitors. In the present study, we surveyed the pattern of nucleotide diversity of two selected trait specific genes, Wx and OsC1, which regulate amylose content and apiculus coloration respectively in cultivated rice varieties. The analyzed samples were collected from a wide geographic area in Northeast (NE) India, and included contrasting phenotypes considered to be associated with selected genes, namely glutinous and nonglutinous grains and colored and colorless apiculus. No statistically significant selection signatures were detected in both Wx and OsC1gene sequences. However, low level of selection that varied across the length of each gene was evident. The glutinous type varieties showed higher levels of nucleotide diversity at the Wx locus (πtot = 0.0053) than nonglutinous type varieties (πtot = 0.0043). The OsC1 gene revealed low levels of selection among the colorless apiculus varieties with lower nucleotide diversity (πtot = 0.0010) than in the colored apiculus varieties (πtot = 0.0023). The results revealed that functional mutations at Wx and OsC1genes considered to be associated with specific phenotypes do not necessarily correspond to the phenotypes in indigenous rice varieties in NE India. This suggests that other than previously reported genomic regions may also be involved in determination of these phenotypes.
Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan
2017-02-01
Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.
Chong, J L; Wickneswari, R; Ismail, B S; Salmijah, S
2008-02-01
This study reports the results of the partial DNA sequence analysis of the 5-enolpyruvyl-shikimate-3-phosphate synthase (EPSPS) gene in glyphosate-resistant (R) and glyphosate-susceptible (S) biotypes of Eleusine indica (L.) Gaertn from Peninsular Malaysia. Sequencing results revealed point mutation at nucleotide position 875 in the R biotypes of Bidor, Chaah and Temerloh. In the Chaah R population, substitution of cytosine (C) to adenine (A) resulted in the change of threonine (Thr106) to proline (Pro106) and from C to thymidine (T) in the Bidor R population, leading to serine (Ser106) from Pro106. As for the Temerloh R, C was substituted by T resulting in the change of Pro106 to Ser106. A new mutation previously undetected in the Temerloh R was revealed with C being substituted with A, resulting in the change of Pro106 to Thr106 indicating multiple founding events rather than to the spread of a single resistant allele. There was no point mutation recorded at nucleotide position 875 previously demonstrated to play a pivotal role in conferring glyphosate resistance to E. indica for the Lenggeng, Kuala Selangor, Melaka R populations. Thus, there may be another resistance mechanism yet undiscovered in the resistant Lenggeng, Kuala Selangor and Melaka populations.
Czech Academy of Sciences Publication Activity Database
Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal
2016-01-01
Roč. 24, č. 6 (2016), s. 1268-1276 ISSN 0968-0896 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * pyrimidines * DNA methyltransferases * DNA polymerases Subject RIV: CC - Organic Chemistry Impact factor: 2.930, year: 2016
Kuznedelov, K D; Timoshkin, O A
1995-01-01
Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.
Ketkar, Amit; Zafar, Maroof K; Banerjee, Surajit; Marquez, Victor E; Egli, Martin; Eoff, Robert L
2012-06-27
Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2'-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2'-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle, which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base-stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase.
Ketkar, Amit; Zafar, Maroof K.; Banerjee, Surajit; Marquez, Victor E.; Egli, Martin; Eoff, Robert L
2012-01-01
Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2′-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2′-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle (χ), which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase. PMID:22632140
DEFF Research Database (Denmark)
Nielsen, Stine Nygaard; Grell, Kathrine; Nersting, Jacob
2017-01-01
BACKGROUND: Adjustment of mercaptopurine and methotrexate maintenance therapy of acute lymphoblastic leukaemia by leucocyte count is confounded by natural variations. Cytotoxicity is primarily mediated by DNA-incorporated thioguanine nucleotides (DNA-TGN). The aim of this study was to establish w...
DEFF Research Database (Denmark)
Krintel, Sophine B; Palermo, Giuseppe; Johansen, Julia S
2012-01-01
Recently, two genome-wide association studies identified single nucleotide polymorphisms (SNPs) significantly associated with the treatment response to tumor necrosis factor α (TNFα) inhibitors in patients with rheumatoid arthritis (RA). We aimed to replicate these results and identify SNPs and t...
Energy Technology Data Exchange (ETDEWEB)
Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.
1987-02-01
To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.
Directory of Open Access Journals (Sweden)
Mohammad Ali Atlasi
2011-01-01
Full Text Available Objective (s Porin is a mitochondrial outer membrane channel, which usually functions as the pathway for the movement of various substances in and out of the mitochondria and is considered to be a component of the permeability transition (PT pore complex that plays a role in the PT. We addressed the hypothesis that porin interacts with other mitochondrial proteins after ischemic injury.Materials and MethodsFor this purpose, we used in vivo 4-vessel occlusion model of rat brain and porin purification method by hydroxyapatite column. After SDS gel electrophoresis and silver nitrate staining, Western blotting was done for porin, adenine nucleotide translocase and cyclophilin-D proteins.Results Porin was purified from mitochondrial mixture in ischemic brain and control groups. Investigation of interaction of adenine nucleotide transposes (ANT and cyclophilin-D with porin by Western blotting showed no proteins co-purified with porin from injured tissues.Conclusion The present study implies that there may not be interaction between porin, and ANT or cyclophilin-D, and if there is any, it is not maintained during the purification procedure.
Awayn, N H; Rosenberg, M F; Kamis, A B; Aleksandrov, L A; Riordan, J R; Ford, R C
2005-11-01
Cystic fibrosis, one of the major human inherited diseases, is caused by defects in the CFTR (cystic fibrosis transmembrane conductance regulator), a cell-membrane protein. CFTR acts as a chloride channel which can be opened by ATP. Low-resolution structural studies of purified recombinant human CFTR are described in the present paper. Localization of the C-terminal decahistidine tag in CFTR was achieved by Ni2+-nitriloacetate nanogold labelling, followed by electron microscopy and single-particle analysis. The presence of the gold label appears to improve the single-particle-alignment procedure. Projection structures of CFTR from two-dimensional crystals analysed by electron crystallography displayed two alternative conformational states in the presence of nucleotide and nanogold, but only one form of the protein was observed in the quiescent (nucleotide-free) state.
International Nuclear Information System (INIS)
Smith, J.B.; Smith, L.; Higgins, B.L.
1985-01-01
Inositol 1,4,5-trisphosphate (IP3) rapidly increased 45 Ca 2+ efflux from a nonmitochondrial organelle in cultured vascular smooth muscle cells that were permeabilized with saponin. A nucleotide, preferably ATP, was essential for IP3-evoked 45 Ca 2+ release. Two nonhydrolyzable ATP analogues satisfied the nucleotide requirement for IP3-evoked 45 Ca 2+ release. IP3 strongly stimulated 45 Ca 2+ efflux at low temperatures (1 to 15 degrees C). Decreasing the temperature from 37 to 4 degrees C inhibited the rate of IP3-stimulated efflux by only about 33%. The failure of such low temperatures to strongly inhibit IP3-induced 45 Ca 2+ efflux suggests that IP3 activated a Ca 2+ channel, rather than a carrier, by a ligand-binding, rather than a metabolic, reaction
Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng
2015-01-01
Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.
The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...
Energy Technology Data Exchange (ETDEWEB)
Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))
1988-07-25
The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.
Incorporation of causative quantitative trait nucleotides in single-step GBLUP.
Fragomeni, Breno O; Lourenco, Daniela A L; Masuda, Yutaka; Legarra, Andres; Misztal, Ignacy
2017-07-26
Much effort is put into identifying causative quantitative trait nucleotides (QTN) in animal breeding, empowered by the availability of dense single nucleotide polymorphism (SNP) information. Genomic selection using traditional SNP information is easily implemented for any number of genotyped individuals using single-step genomic best linear unbiased predictor (ssGBLUP) with the algorithm for proven and young (APY). Our aim was to investigate whether ssGBLUP is useful for genomic prediction when some or all QTN are known. Simulations included 180,000 animals across 11 generations. Phenotypes were available for all animals in generations 6 to 10. Genotypes for 60,000 SNPs across 10 chromosomes were available for 29,000 individuals. The genetic variance was fully accounted for by 100 or 1000 biallelic QTN. Raw genomic relationship matrices (GRM) were computed from (a) unweighted SNPs, (b) unweighted SNPs and causative QTN, (c) SNPs and causative QTN weighted with results obtained with genome-wide association studies, (d) unweighted SNPs and causative QTN with simulated weights, (e) only unweighted causative QTN, (f-h) as in (b-d) but using only the top 10% causative QTN, and (i) using only causative QTN with simulated weight. Predictions were computed by pedigree-based BLUP (PBLUP) and ssGBLUP. Raw GRM were blended with 1 or 5% of the numerator relationship matrix, or 1% of the identity matrix. Inverses of GRM were obtained directly or with APY. Accuracy of breeding values for 5000 genotyped animals in the last generation with PBLUP was 0.32, and for ssGBLUP it increased to 0.49 with an unweighted GRM, 0.53 after adding unweighted QTN, 0.63 when QTN weights were estimated, and 0.89 when QTN weights were based on true effects known from the simulation. When the GRM was constructed from causative QTN only, accuracy was 0.95 and 0.99 with blending at 5 and 1%, respectively. Accuracies simulating 1000 QTN were generally lower, with a similar trend. Accuracies using the
Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa
2013-06-01
Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and
DEFF Research Database (Denmark)
Børsting, Claus; Morling, Niels
2012-01-01
and published as case work examples in forensic journals. Here, the cases were reinvestigated by typing the samples for 49 autosomal single-nucleotide polymorphisms (SNPs) using the SNPforID multiplex assay. RESULTS: Three cases were solved by the SNP investigation without the need for any additional testing....... In two cases, the SNP results supported the conclusions based on STRs. In the last case, the SNP results spoke in favor of paternity, and the combined paternity index based on autosomal STRs and SNPs was 12.3 billion. Nevertheless, the alleged father was excluded by X-chromosome typing. CONCLUSION...
Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.
Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C
2018-01-10
Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing
Curran, S.; Bolton, P.; Rozsnyai, K.; Chiocchetti, A.; Klauck, S.M.; Duketis, E.; Poustka, F.; Schlitt, S.; Freitag, C.M.; Lee, I. van der; Muglia, P.; Poot, M.; Staal, W.G.; Jonge, M.V. de; Ophoff, R.A.; Lewis, C.; Skuse, D.; Mandy, W.; Vassos, E.; Fossdal, R.; Magnusson, P.; Hreidarsson, S.; Saemundsen, E.; Stefansson, H.; Stefansson, K.; Collier, D.
2011-01-01
The Autism Genome Project (AGP) Consortium recently reported genome-wide significant association between autism and an intronic single nucleotide polymorphism marker, rs4141463, within the MACROD2 gene. In the present study we attempted to replicate this finding using an independent case-control
International Nuclear Information System (INIS)
Cordis, G.A.; Das, D.K.
1987-01-01
In order to follow the energy metabolism and the levels of high-energy phosphate compounds in porcine myocardium subjected to ischemic insult, it was necessary to develop a high-performance liquid chromatography (HPLC) method where creatine phosphate (CP) and the adenine nucleotides could be measured simultaneously in a single run. Currently available ion-pair reverse-phase HPLC methods require a separate injection with a change in wavelength and mobile phase in order to measure the creatine phosphate, while baseline separation of AMP is lacking. The ion-exchange HPLC method includes a simultaneous determination, but the baseline drifts due to the gradient and baseline separation of AMP is not achieved. In the following ion-pair reverse-phase HPLC method, simultaneous measurements of porcine myocardial adenine nucleotides and creatine phosphate were achieved along with a stable baseline and homogeneous baseline separation of each measured compound, allowing accurate quantification
Ashley, Neil; Adams, Susan; Slama, Abdelhamid; Zeviani, Massimo; Suomalainen, Anu; Andreu, Antonio L; Naviaux, Robert K; Poulton, Joanna
2007-06-15
Defects in mtDNA maintenance range from fatal multisystem childhood diseases, such as Alpers syndrome, to milder diseases in adults, including mtDNA depletion syndromes (MDS) and familial progressive external ophthalmoplegia (AdPEO). Most are associated with defects in genes involved in mitochondrial deoxynucleotide metabolism or utilization, such as mutations in thymidine kinase 2 (TK2) as well as the mtDNA replicative helicase, Twinkle and gamma polymerase (POLG). We have developed an in vitro system to measure incorporation of radiolabelled dNTPs into mitochondria of saponin permeabilized cells. We used this to compare the rates of mtDNA synthesis in cells from 12 patients with diseases of mtDNA maintenance. We observed reduced incorporation of exogenous alpha (32)P-dTTP in fibroblasts from a patient with Alpers syndrome associated with the A467T substitution in POLG, a patient with dGK mutations, and a patient with mtDNA depletion of unknown origin compared to controls. However, incorporation of alpha (32)P-dTTP relative to either cell doubling time or alpha (32)P-dCTP incorporation was increased in patients with thymidine kinase deficiency or PEO as the result of TWINKLE mutations compared with controls. The specific activity of newly synthesized mtDNA depends on the size of the endogenous pool diluting the exogenous labelled nucleotide. Our result is consistent with a deficiency in the intramitochondrial pool of dTTP relative to dCTP in cells from patients with TK2 deficiency and TWINKLE mutations. Such DNA precursor asymmetry could cause pausing of the replication complex and hence exacerbate the propensity for age-related mtDNA mutations. Because deviations from the normal concentrations of dNTPs are known to be mutagenic, we suggest that intramitochondrial nucleotide imbalance could underlie the multiple mtDNA mutations observed in these patients.
Energy Technology Data Exchange (ETDEWEB)
Barta, Michael L.; McWhorter, William J.; Miziorko, Henry M.; Geisbrecht, Brian V. (UMKC)
2012-09-17
Mevalonate diphosphate decarboxylase (MDD) catalyzes the final step of the mevalonate pathway, the Mg{sup 2+}-ATP dependent decarboxylation of mevalonate 5-diphosphate (MVAPP), producing isopentenyl diphosphate (IPP). Synthesis of IPP, an isoprenoid precursor molecule that is a critical intermediate in peptidoglycan and polyisoprenoid biosynthesis, is essential in Gram-positive bacteria (e.g., Staphylococcus, Streptococcus, and Enterococcus spp.), and thus the enzymes of the mevalonate pathway are ideal antimicrobial targets. MDD belongs to the GHMP superfamily of metabolite kinases that have been extensively studied for the past 50 years, yet the crystallization of GHMP kinase ternary complexes has proven to be difficult. To further our understanding of the catalytic mechanism of GHMP kinases with the purpose of developing broad spectrum antimicrobial agents that target the substrate and nucleotide binding sites, we report the crystal structures of wild-type and mutant (S192A and D283A) ternary complexes of Staphylococcus epidermidis MDD. Comparison of apo, MVAPP-bound, and ternary complex wild-type MDD provides structural information about the mode of substrate binding and the catalytic mechanism. Structural characterization of ternary complexes of catalytically deficient MDD S192A and D283A (k{sub cat} decreased 10{sup 3}- and 10{sup 5}-fold, respectively) provides insight into MDD function. The carboxylate side chain of invariant Asp{sup 283} functions as a catalytic base and is essential for the proper orientation of the MVAPP C3-hydroxyl group within the active site funnel. Several MDD amino acids within the conserved phosphate binding loop ('P-loop') provide key interactions, stabilizing the nucleotide triphosphoryl moiety. The crystal structures presented here provide a useful foundation for structure-based drug design.
Directory of Open Access Journals (Sweden)
Massimo Giangaspero
2008-06-01
Full Text Available Forty-three strains of classical swine fever (hog cholera virus (CSFV from outbreaks in pigs in Europe, Asia and America, two strains from commercial CSFV modified live vaccines and a strain isolated from a diseased lamb from Spain were subjected to analyses of nucleotide sequence variations in the 5’ terminal region of the genome. These isolates were divided into three clusters, namely: CSFV-1, CSFV-2, and CSFV-3, based on palindromic nucleotide substitutions in the 5’ untranslated region (UTR. The homology degree, according to nucleotide base pairing variation in the secondary palindromic structure of the three variable loci V1, V2 and V3, was 60% in the CSFV species, with a mean divergence value of 6.19 base pairs (bp. relatedness within genotypes ranged from 71.11% to 100%, with mean divergence values from 5.5 to 0.73 base pairs. Subgenotypes showed a divergence ranging from 1 to 9 base pairs within the genotype. Genotype CSFV-1 revealed 15 base pair combinations with 13 divergent base pairs, resulting in 4 subgenotypes with 6 variants in subgenotype CSFV-1.1, including the reference strain Brescia and 6 variants in subgenotype CSFV-1.2, including the Alfort reference strain. Subgenotypes CSFV-1.3 and CSFV-1.4 comprised one and two variants, respectively. Genotype CSFV-2 was represented by the Spanish ovine isolate 5440/99 and the genotype CSFV-3 included the Japanese strains Okinawa/86 and Kanagawa/74. CSFV genotypes revealed a strong relationship with Border disease virus strains, showing relatively low divergence values when compared to other pestivirus species. Evaluation of nucleotide base pair divergence among genotypes and expression of evolutionary changes in the CSFV species led to the construction of a phylogenetic tree based on secondary structure.
Flitney, F W; Singh, J
1980-07-01
1. A study has been made of a well documented but poorly understood response of the isolated frog ventricle to treatment with exogenous adenosine 5' triphosphate (ATP). Measurements of membrane potential, isometric twitch tension and levels of endogenous 3',5'-cyclic nucleotides have been made at various times during the ATP-induced response. 2. ATP elicits a characteristic triphasic response, which comprises an initial, abrupt increase in contractility, rising to a maximum within a few beats (first phase); followed by a period when the twitch amplitude falls, sometimes to below the control level (second phase); and superceded by a more slowly developing and longer-lasting increase in contractile force (third phase). The response is unaffected by atropine, propranolol or phentolamine. However, the prostaglandin synthetase inhibitor indomethacin depresses the first phase and entirely suppresses the third phase. 3. The inotropic effects of ATP are accompanied by changes in the shape of the action potential. These effects are dose-related. The duration of the action potential (D-30mV) and its positive overshoot (O) are increased during all phases of the response, for [ATP]o's up to 10(-5) M. However, at higher [ATP]o's, D-30mV and O ar both reduced during the second phase (but not the first or third phase), when isometric twitch tension is also depressed. The relationship between action potential duration and twitch tension (P) for different [ATP]o's is linear for all three phases of the response, but the slopes of the curves (delta P/delta D) are markedly different, indicating that the sensitivity of the contractile system to membrane depolarization is not constant, but varies continuously throughout the response. 4. ATP has a potent stimulatory effect on the metabolism of endogenous 3',5'-cyclic nucleotides. The time courses of the changes in adenosine 3','5-cyclic monophosphate (3',5'-cyclic AMP) and guanosine 3',5'-cyclic monophosphate (3',5'-cyclic GMP) are
Gangarapu, S.; Marcelis, A.T.M.; Zuilhof, H.
2013-01-01
The pKa of the conjugate acids of alkanolamines, neurotransmitters, alkaloid drugs and nucleotide bases are calculated with density functional methods (B3LYP, M08-HX and M11-L) and ab initio methods (SCS-MP2, G3). Implicit solvent effects are included with a conductor-like polarizable continuum
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Di Noia, Maria Antonietta; Todisco, Simona; Cirigliano, Angela; Rinaldi, Teresa; Agrimi, Gennaro; Iacobazzi, Vito; Palmieri, Ferdinando
2014-11-28
The human genome encodes 53 members of the solute carrier family 25 (SLC25), also called the mitochondrial carrier family, many of which have been shown to transport inorganic anions, amino acids, carboxylates, nucleotides, and coenzymes across the inner mitochondrial membrane, thereby connecting cytosolic and matrix functions. Here two members of this family, SLC25A33 and SLC25A36, have been thoroughly characterized biochemically. These proteins were overexpressed in bacteria and reconstituted in phospholipid vesicles. Their transport properties and kinetic parameters demonstrate that SLC25A33 transports uracil, thymine, and cytosine (deoxy)nucleoside di- and triphosphates by an antiport mechanism and SLC25A36 cytosine and uracil (deoxy)nucleoside mono-, di-, and triphosphates by uniport and antiport. Both carriers also transported guanine but not adenine (deoxy)nucleotides. Transport catalyzed by both carriers was saturable and inhibited by mercurial compounds and other inhibitors of mitochondrial carriers to various degrees. In confirmation of their identity (i) SLC25A33 and SLC25A36 were found to be targeted to mitochondria and (ii) the phenotypes of Saccharomyces cerevisiae cells lacking RIM2, the gene encoding the well characterized yeast mitochondrial pyrimidine nucleotide carrier, were overcome by expressing SLC25A33 or SLC25A36 in these cells. The main physiological role of SLC25A33 and SLC25A36 is to import/export pyrimidine nucleotides into and from mitochondria, i.e. to accomplish transport steps essential for mitochondrial DNA and RNA synthesis and breakdown. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Xu, Jing; Zhang, Lin; Yang, Dong-Lei; Li, Qun; He, Zuhua
2015-12-01
Thymidine kinases (TKs) are important components in the nucleotide salvage pathway. However, knowledge about plant TKs is quite limited. In this study, the molecular function of TKs in Arabidopsis thaliana was investigated. Two TKs were identified and named AtTK1 and AtTK2. Expression of both genes was ubiquitous, but AtTK1 was strongly expressed in high-proliferation tissues. AtTK1 was localized to the cytosol, whereas AtTK2 was localized to the mitochondria. Mutant analysis indicated that the two genes function coordinately to sustain normal plant development. Enzymatic assays showed that the two TK proteins shared similar catalytic specificity for pyrimidine nucleosides. They were able to complement an Escherichia coli strain lacking TK activity. 5'-Fluorodeoxyuridine (FdU) resistance and 5-ethynyl 2'-deoxyuridine (EdU) incorporation assays confirmed their activity in vivo. Furthermore, the tk mutant phenotype could be alleviated by nucleotide feeding, establishing that the biosynthesis of pyrimidine nucleotides was disrupted by the TK deficiency. Finally, both human and rice (Oryza sativa) TKs were able to rescue the tk mutants, demonstrating the functional conservation of TKs across organisms. Taken together, our findings clarify the specialized function of two TKs in A. thaliana and establish that the salvage pathway mediated by the kinases is essential for plant growth and development. © 2015 Institute of Plant Physiology and Ecology, SIBS, CAS New Phytologist © 2015 New Phytologist Trust.
Zahurancik, Walter J.; Klein, Seth J.; Suo, Zucai
2014-01-01
Most eukaryotic DNA replication is performed by A- and B-family DNA polymerases which possess a faithful polymerase activity that preferentially incorporates correct over incorrect nucleotides. Additionally, many replicative polymerases have an efficient 3′→5′ exonuclease activity that excises misincorporated nucleotides. Together, these activities contribute to overall low polymerase error frequency (one error per 106–108 incorporations) and support faithful eukaryotic genome replication. Eukaryotic DNA polymerase ϵ (Polϵ) is one of three main replicative DNA polymerases for nuclear genomic replication and is responsible for leading strand synthesis. Here, we employed pre-steady-state kinetic methods and determined the overall fidelity of human Polϵ (hPolϵ) by measuring the individual contributions of its polymerase and 3′→5′ exonuclease activities. The polymerase activity of hPolϵ has a high base substitution fidelity (10−4–10−7) resulting from large decreases in both nucleotide incorporation rate constants and ground-state binding affinities for incorrect relative to correct nucleotides. The 3′→5′ exonuclease activity of hPolϵ further enhances polymerization fidelity by an unprecedented 3.5 × 102 to 1.2 × 104-fold. The resulting overall fidelity of hPolϵ (10−6–10−11) justifies hPolϵ to be a primary enzyme to replicate human nuclear genome (0.1–1.0 error per round). Consistently, somatic mutations in hPolϵ, which decrease its exonuclease activity, are connected with mutator phenotypes and cancer formation. PMID:25414327
Ordoñ ez, Natalia Maria; Shabala, Lana; Gehring, Christoph A; Shabala, Sergey Nikolayevich
2013-01-01
Changes in ion permeability and subsequently intracellular ion concentrations play a crucial role in intracellular and intercellular communication and, as such, confer a broad array of developmental and adaptive responses in plants. These changes are mediated by the activity of plasma-membrane based transport proteins many of which are controlled by cyclic nucleotides and/or other signaling molecules. The MIFE technique for noninvasive microelectrode ion flux measuring allows concurrent quantification of net fluxes of several ions with high spatial (μm range) and temporal (ca. 5 s) resolution, making it a powerful tool to study various aspects of downstream signaling events in plant cells. This chapter details basic protocols enabling the application of the MIFE technique to study regulation of root membrane transport in general and cyclic nucleotide mediated transport in particular. © Springer Science+Business Media New York 2013.
Ordoñez, Natalia Maria
2013-09-03
Changes in ion permeability and subsequently intracellular ion concentrations play a crucial role in intracellular and intercellular communication and, as such, confer a broad array of developmental and adaptive responses in plants. These changes are mediated by the activity of plasma-membrane based transport proteins many of which are controlled by cyclic nucleotides and/or other signaling molecules. The MIFE technique for noninvasive microelectrode ion flux measuring allows concurrent quantification of net fluxes of several ions with high spatial (μm range) and temporal (ca. 5 s) resolution, making it a powerful tool to study various aspects of downstream signaling events in plant cells. This chapter details basic protocols enabling the application of the MIFE technique to study regulation of root membrane transport in general and cyclic nucleotide mediated transport in particular. © Springer Science+Business Media New York 2013.
37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.
2010-07-01
... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...
International Nuclear Information System (INIS)
Fonseca, A.S.; Campos, V.M.A.; Magalhaes, L.A.G.; Paoli, F.
2015-01-01
Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T 4 endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T 4 endonuclease V. Low-intensity lasers: i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells, ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, and iv) did not alter the electrophoretic profile of plasmids incubated with T 4 endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers. (author)
Energy Technology Data Exchange (ETDEWEB)
Fonseca, A.S.; Campos, V.M.A.; Magalhaes, L.A.G., E-mail: adnfonseca@ig.com.br [Instituto de Biologia Roberto Alcantara Gomes, Rio de Janeiro, RJ (Brazil). Departamento de Biofisica e Biometria. Lab. de Ciencias Radiologicas; Paoli, F. [Universidade Federal de Juiz de Fora (UFJF), Juiz de Fora, MG (Brazil). Instituto de Ciencias Biologicas. Departamento de Morfologia
2015-10-15
Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T{sub 4} endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T{sub 4} endonuclease V. Low-intensity lasers: i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells, ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, and iv) did not alter the electrophoretic profile of plasmids incubated with T{sub 4} endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers. (author)
Ruijs, Mariëlle W. G.; Schmidt, Marjanka K.; Nevanlinna, Heli; Tommiska, Johanna; Aittomäki, Kristiina; Pruntel, Roelof; Verhoef, Senno; van 't Veer, L. J.
2007-01-01
Li-Fraumeni syndrome (LFS) is an autosomal-dominant cancer predisposition syndrome of which the majority is caused by TP53 germline mutations and is characterised by different tumour types occurring at relatively young age. Recently, it was shown that a single-nucleotide polymorphism (SNP) in the
Czech Academy of Sciences Publication Activity Database
Campa, D.; Pastore, M.; Gentiluomo, M.; Talar-Wojnarowska, R.; Kupcinskas, J.; Malecka-Panas, E.; Neoptolemos, J. P.; Niesen, W.; Vodička, Pavel; Delle Fave, G.; Bueno-de-Mesquita, H. B.; Gazouli, M.; Pacetti, P.; Di Leo, M.; Ito, H.; Klüter, H.; Souček, P.; Corbo, V.; Yamao, K.; Hosono, S.; Kaaks, R.; Vashist, Y.; Gioffreda, D.; Strobel, O.; Shimizu, Y.; Dijk, F.; Andriulli, A.; Ivanauskas, A.; Bugert, P.; Tavano, F.; Vodičková, L.; Zambon, C.F.; Lovecek, M.; Landi, S.; Key, T. J.; Boggi, U.; Pezzilli, R.; Jamroziak, K.; Mohelníková-Duchoňová, B.; Mambrini, A.; Bambi, F.; Busch, O.; Pazienza, V.; Valente, R.; Theodoropoulos, G.E.; Hackert, T.; Capurso, G.; Cavestro, G.M.; Pasquali, C.; Basso, D.; Sperti, C.; Matsuo, K.; Büchler, M.; Khaw, K. T.; Izbicki, J.; Costello, E.; Katzke, V.; Michalski, Ch.; Stepien, A.; Rizzato, C.; Canzian, F.
2016-01-01
Roč. 7, č. 35 (2016), s. 57011-57020 ISSN 1949-2553 R&D Projects: GA ČR GAP301/12/1734 Institutional support: RVO:68378041 Keywords : pancreatic cancer * CDKN2A * single nucleotide polymorphisms Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.168, year: 2016
Merouze, P; Gaudemer, Y
1975-01-01
1. The influence of catecholamines (adrenaline and noradrenaline) on energy metabolism of the rat myocardium has been studied by incubating slices of this tissue with these hormones and by following the levels of the different phosphorylated fractions and adenylic nucleotides. 2. Similar effects are obtained with both hormones, adrenaline being more effective. 3. Catecholamines decrease significantly the total amount of phosphate while Pi content increases during the first 10 minutes of incubation; labile and residual phosphate contents increase at the beginning of incubation and decrease to the initial values afterwards. 4. ATP and ADP levels decrease significantly with both hormones; however, the effect of noradrenalin on the ATP level needs a longer time of incubation. The ATP/ADP ratios decrease after 5 minutes incubation and the total adenylic nucleotide content is severely decreased (35 per cent with adrenalin, after 20 minutes incubation). 5. Similar results have been obtained with other tissues; these results can explain the decrease of aerobic metabolism we observed under the same conditions.
Interaction between nucleotide binding sites on chloroplast coupling factor 1 during ATP hydrolysis
Energy Technology Data Exchange (ETDEWEB)
Leckband, D.; Hammes, G.G.
1987-04-21
The initial hydrolysis of radioactively-labelled CaATP by chloroplast coupling factor 1 was studied with the quenched-flow method. The time course of hydrolysis can be described as a first-order conversion of the enzyme to an active form followed by steady-state formation of product. The rate constant for the first-order process is independent of substrate concentration but increased hyperbolically to a limiting value of 0.43 s/sup -1/ with increasing concentrations of free Ca/sup 2 +/. A mechanism involving a Ca/sup 2 +/-triggered conversion to an active form of the enzyme is consistent with the data. The steady-state rate varied sigmoidally with the CaATP concentration. Initial exchange of tightly bound ADP is complex: approx. 50% of the bound nucleotide is lost within 30 s, with complete exchange requiring several minutes. The first-order rate constant characterizing the rapid phase of the reaction increases hyperbolically to a limiting value of 0.26 s/sup -1/ as the concentration of CaATP is increased, indicating that the binding of CaATP to the enzyme promotes the exchange process. Modification of the quenched-flow apparatus permitted measurement of the rate of nucleotide exchange during steady-state catalysis. The value of the first-order rate constant characterizing this process is similar to the catalytic rate constant determined under identical conditions. When MgATP is tightly bound to the enzyme, none of the kinetic properties of the enzyme described above were significantly changes. The results obtained suggest a mechanism in which two sites on the enzyme participate in catalysis. Several possible mechanisms consistent with the data are discussed.
Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor
International Nuclear Information System (INIS)
Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.
1987-01-01
Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2
Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts
International Nuclear Information System (INIS)
Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo
2016-01-01
Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X 3 , an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp
Implication of SUMO E3 ligases in nucleotide excision repair.
Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji
2015-08-01
Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.
Single nucleotide editing without DNA cleavage using CRISPR/Cas9-deaminase in the sea urchin embryo.
Shevidi, Saba; Uchida, Alicia; Schudrowitz, Natalie; Wessel, Gary M; Yajima, Mamiko
2017-12-01
A single base pair mutation in the genome can result in many congenital disorders in humans. The recent gene editing approach using CRISPR/Cas9 has rapidly become a powerful tool to replicate or repair such mutations in the genome. These approaches rely on cleaving DNA, while presenting unexpected risks. In this study, we demonstrate a modified CRISPR/Cas9 system fused to cytosine deaminase (Cas9-DA), which induces a single nucleotide conversion in the genome. Cas9-DA was introduced into sea urchin eggs with sgRNAs targeted for SpAlx1, SpDsh, or SpPks, each of which is critical for skeletogenesis, embryonic axis formation, or pigment formation, respectively. We found that both Cas9 and Cas9-DA edit the genome, and cause predicted phenotypic changes at a similar efficiency. Cas9, however, resulted in significant deletions in the genome centered on the gRNA target sequence, whereas Cas9-DA resulted in single or double nucleotide editing of C to T conversions within the gRNA target sequence. These results suggest that the Cas9-DA approach may be useful for manipulating gene activity with decreased risks of genomic aberrations. Developmental Dynamics 246:1036-1046, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
ARHGEF7 (Beta-PIX acts as guanine nucleotide exchange factor for leucine-rich repeat kinase 2.
Directory of Open Access Journals (Sweden)
Karina Haebig
Full Text Available BACKGROUND: Mutations within the leucine-rich repeat kinase 2 (LRRK2 gene are a common cause of familial and sporadic Parkinson's disease. The multidomain protein LRRK2 exhibits overall low GTPase and kinase activity in vitro. METHODOLOGY/PRINCIPAL FINDINGS: Here, we show that the rho guanine nucleotide exchange factor ARHGEF7 and the small GTPase CDC42 are interacting with LRRK2 in vitro and in vivo. GTPase activity of full-length LRRK2 increases in the presence of recombinant ARHGEF7. Interestingly, LRRK2 phosphorylates ARHGEF7 in vitro at previously unknown phosphorylation sites. We provide evidence that ARHGEF7 might act as a guanine nucleotide exchange factor for LRRK2 and that R1441C mutant LRRK2 with reduced GTP hydrolysis activity also shows reduced binding to ARHGEF7. CONCLUSIONS/SIGNIFICANCE: Downstream effects of phosphorylation of ARHGEF7 through LRRK2 could be (i a feedback control mechanism for LRRK2 activity as well as (ii an impact of LRRK2 on actin cytoskeleton regulation. A newly identified familial mutation N1437S, localized within the GTPase domain of LRRK2, further underlines the importance of the GTPase domain of LRRK2 in Parkinson's disease pathogenesis.